D 1085 OULU 2010 D 1085
UNIVERSITY OF OULU P.O.B. 7500 FI-90014 UNIVERSITY OF OULU FINLAND ACTA UNIVERSITATIS OULUENSIS ACTA UNIVERSITATIS OULUENSIS ACTA
SERIES EDITORS DMEDICA Kari Antero Mäkelä
ASCIENTIAE RERUM NATURALIUM Kari Antero Mäkelä Professor Mikko Siponen THE ROLES OF OREXINS ON BHUMANIORA SLEEP/WAKEFULNESS, University Lecturer Elise Kärkkäinen CTECHNICA ENERGY HOMEOSTASIS AND Professor Hannu Heusala INTESTINAL SECRETION DMEDICA Professor Olli Vuolteenaho ESCIENTIAE RERUM SOCIALIUM Senior Researcher Eila Estola FSCRIPTA ACADEMICA Information officer Tiina Pistokoski GOECONOMICA University Lecturer Seppo Eriksson
EDITOR IN CHIEF Professor Olli Vuolteenaho PUBLICATIONS EDITOR
Publications Editor Kirsti Nurkkala UNIVERSITY OF OULU, FACULTY OF MEDICINE, INSTITUTE OF BIOMEDICINE, ISBN 978-951-42-6377-4 (Paperback) DEPARTMENT OF PHYSIOLOGY; ISBN 978-951-42-6378-1 (PDF) UNIVERSITY OF OULU, ISSN 0355-3221 (Print) BIOCENTER OULU; ISSN 1796-2234 (Online) UNIVERSITY OF EASTERN FINLAND, DEPARTMENT OF BIOTECHNOLOGY AND MOLECULAR MEDICINE, A. I. VIRTANEN INSTITUTE FOR MOLECULAR SCIENCES
ACTA UNIVERSITATIS OULUENSIS D Medica 1085
KARI ANTERO MÄKELÄ
THE ROLES OF OREXINS ON SLEEP/ WAKEFULNESS, ENERGY HOMEOSTASIS AND INTESTINAL SECRETION
Academic dissertation to be presented with the assent of the Faculty of Medicine of the University of Oulu for public defence in Auditorium F101 of the Department of Physiology (Aapistie 7), on 10 December 2010, at 12 noon
UNIVERSITY OF OULU, OULU 2010 Copyright © 2010 Acta Univ. Oul. D 1085, 2010
Supervised by Professor Karl-Heinz Herzig Professor Juhani Leppäluoto
Reviewed by Professor Barbara Cannon Professor Pertti Panula
ISBN 978-951-42-6377-4 (Paperback) ISBN 978-951-42-6378-1 (PDF) http://herkules.oulu.fi/isbn9789514263781/ ISSN 0355-3221 (Printed) ISSN 1796-2234 (Online) http://herkules.oulu.fi/issn03553221/
Cover Design Raimo Ahonen
JUVENES PRINT TAMPERE 2010 Mäkelä, Kari Antero, The roles of orexins on sleep/wakefulness, energy homeostasis and intestinal secretion University of Oulu, Faculty of Medicine, Institute of Biomedicine, Department of Physiology, P.O.Box 5000, FI-90014 University of Oulu, Finland; University of Oulu, Biocenter Oulu, P.O. Box 5000, FI-90014 University of Oulu, Finland; University of Eastern Finland, Department of Biotechnology and Molecular Medicine, A. I. Virtanen Institute for Molecular Sciences, P.O.Box 1627, FI-70211 Kuopio, Finland Acta Univ. Oul. D 1085, 2010 Oulu, Finland
Abstract Orexins, or hypocretins, are peptides originally found in the hypothalamus, and have been shown to be involved in the stabilization and maintenance of sleep and wakefulness. In addition, these peptides are known for their actions on energy homeostasis by increased heat production or physical activity. Previous results suggest them to be also involved in peripheral actions on the regulation of intestinal secretion, depending on the subject’s nutritional status (fasted-fed). Orexin-A and Orexin-B peptides, are derived from the prepro-orexin precursor protein. These ligands bind to two G-protein-coupled receptors, orexin-1 and -2 -receptors. Despite intensive research, the role of orexins has not yet been clarified. The aim of the present study was to investigate the role of orexins and their receptors on sleep and wake patterns, energy homeostasis and intestinal secretion. The effects of orexins on sleep and wakefulness, and energy homeostasis were studied in a novel transgenic mouse line, overexpressing the human prepro-orexin gene. The overexpression of prepro-orexin and orexin-A was confirmed in the hypothalami of transgenic mice. The transgenic mice showed a significant reduction in their REM sleep during day and night time, and differences in their vigilance states in the light/dark transition periods. In addition, the mice demonstrated a significantly elevated day time food intake at room temperature, and an increased metabolic heat production independent of uncoupling protein 1 mediated thermogenesis in brown adipose tissue. Instead, transgenic mice showed increased levels of uncoupling protein 2 in white adipose tissue. Furthermore, transgenic mice significantly decreased their total locomotor activity during the first two nights in response to cold exposure (+4°C). The effect of orexins and their receptors on duodenal HCO3¯ secretion were studied after an overnight (16 h) food deprivation in an in situ perfused organ. Fasting decreased the expression of orexin receptors in rat duodenal mucosa and in acutely isolated duodenal enterocytes. Furthermore, food deprivation abolished OXA induced duodenal mucosal HCO3¯ secretion in rats, and intracellular calcium signalling in isolated rat and human duodenal enterocytes. In conclusion, the present thesis demonstrates that orexins inhibit REM sleep. In addition, peptides affect increasingly on metabolic heat production, independent of uncoupling protein 1 mediated thermogenesis. Furthermore, the orexin system has a significant role in duodenal bicarbonate secretion, which is regulated by the presence of food in the intestine.
Keywords: bicarbonate secretion, energy homeostasis, fasting, food deprivation, hypocretins, orexins, orexins receptors, sleep, wakefulness
Acknowledgements
This thesis work was carried out at the Department of Physiology, Institute of Biomedicine, and Biocenter Oulu, University of Oulu, and at the Department of Biotechnology and Moleculare Medicine, A.I. Virtanen Insitute, University of Kuopio. I wish to express my sincere gratitude to my supervisor Prof. Karl-Heinz Herzig, M.D., Ph.D. for giving me the opportunity to work in his research group and opening my eyes to various possibilities in the molecular physiology research field. My second supervisor emeritus Prof. Juhani Leppäluoto, M.D., Ph.D. is deeply acknowledged for his guidance and support. I wish to thank the referees, Prof. Pertti Panula, M.D., Ph.D. and Prof. Barbara Cannon, B.Sc., Ph.D., D.Sc. for their valuable comments to my thesis. Many thanks to Bryan Dopp, M.Ed., TESL for the English revision of this work. I would like to thank all of my co-authors for their invaluable contribution to my thesis. I owe my thanks to Prof. Takeshi Sakurai, M.D., Ph.D. for providing the hPPO gene construct, and Prof. Leena Alhonen, Ph.D. for the creation of the transgenic animal line. I wish to thank Prof. Tarja Porkka-Heiskanen for successive collaboration in the mouse sleep study. My sincere thanks belong to Henna-Kaisa Wigren, Ph. D., Janneke Zant and Andrey Kostin, Ph. D., for the sleep recordings and data analysis, as well as for their professional comments. I´m deeply grateful to Prof. Gunnar Flemström, M.D., Ph.D. for a unique change of long-lasting and productive collaboration. Magnus Bengtsson, Ph.D., Markus Sjöblom, Ph.D. and Gunilla Jedstedt are acknowledged for their invaluable groundwork for the rat experiments and for calcium measurements. In addition, I would like to thank Prof. Hans Rudolf Berthoud, Ph.D., Prof. Seppo Saarela, Ph.D., Prof. Karl Åkerman, M.D., Ph.D, and Vootele Võikar, M.D., Ph.D. I am very thankful to my co-author Tiia Kettunen for her valuable work at the beginning of this project. Many thanks for Anniina Markkula for her contribution to the cold experiments. Special thanks to Anne Huotari and Miia Kovalainen for their support in animal work and hilarious moments shared with you. I thank Sanna Oikari, Ph.D. for her contribution as a co-author and for methodological discussions. Anna-Kaisa Purhonen, Ph.D. is acknowledged for her help and interesting scientific discussions. I wish to thank Taina Lajunen, Ph.D. for helping me out with my thesis-related questions. Special thanks to Riitta Kauppinen, Meeri Kröger, Tuula Taskinen, Anna-Maija Koisti, Eija Kumpulainen and Alpo Vanhala for their excellent technical assistance. I´m thankful to all present and
5 past members of our research group including Lauri Marin, Miika Heinonen, Ph.D., Heli Ruotsalainen, Ph.D., Toni Karhu, David Vicente, Alicia Acosta, Mohan Babu, Shivaprakash Mutt, Katja Klausz, Ph.D., Maria Vlasova, Ph.D., Mari Lappalainen and Jenna Pekkinen for their friendship and support through all of these years. Many thanks for Marika Hämeenaho, Kaija Pekkarinen, Riitta Laitinen and Helena Pernu for their secretarial work. I thank Eero Kouvalainen and Pekka- Alakuijala for solving several computer-related problems. I want to thank my parents Helena and Antero Mäkelä for their care and support. Many thanks to my sisters Heidi Koskela and Merja Törnqvist for encouraging me to achieve my goal. Finally, I would like to thank my wife Teija Seppä-Mäkelä and my son Kari Tobias Mäkelä for their love and support through all of these workloaded years. This study was supported in part by the Jalmari and Rauha Ahokas Foundation, the Finnish Cultural Foundation (Central Fund, North Savo Regional Fund, and North Ostrobothnia Regional Fund (to K.M.), the Finnish Academy (Grants 108478 and 110525 to K.-H.H.), the Novo Nordisk Foundation (to K.- H.H.) and the Swedish Research Council (Grant 3515).
6 Abbreviations
5-HT Serotonin α-MSH α-Melanocyte Stimulating Hormone Aa Amino acid ACTH Adrenocorticotropic hormone, corticotropin ARC Arcuate nucleus BF Basal forebrain BL Base line Bp Base pair BP Blood pressure CAG/Orexin Mice overexpressing rat PPO under β-actin/cytomegalovirus hybrid promoter cAMP 3'-5'-cyclic adenosine monophosphate CHO Chinese hamster ovary cell line CHO-K1 Chinese hamster ovary K1 cell line CNS Central nervous system CRF Corticotropin-releasing factor (or hormone) CSF Cerebrospinal fluid DMH Dorsomedial hypothalamic nucleus DTT Dithiothreitol EC Enteroromaffin cells EDTA Ethylene Diamine Tetra-acetic Acid EEG Electroencephalography EMG Electromyography ERK Extracellular signal-regulated FAA Food anticipatory activity GABA γ-Aminobutyric acid GIT Gastrointestinal tract GPCR G protein-coupled receptor HCO3 Bicarbonate ion HLA-DQB1*0602 Allel associated with human cases of narcolepsy HPA Hypothalamus-pituitary-adrenal (axis) hPPO Human prepro-orexin HR Heart rate I.c.v. Intracerebroventricular I.v. Intravenous
7 KO Knockout LC Locus coeruleus LDT Laterodorsal tegmental nucleus LH Lateral hypothalamus LHA Lateral hypothalamic area MAP Mean arterial pressure MCH Melanin-concentrating hormone MMSLT Murine multiple sleep latency test MRN Median raphe nucleus NREM Non-rapid eye movement Orexin/ataxin-3 Mice with ablated orexin neurons OXA Orexin-A OXB Orexin-B OX-KO Orexin knockout OX1R Orexin 1 receptor OX2R Orexin 2 receptor PF-LHA Perifornical-lateral hypothalamic area PLC Phospholipase C PLD Phospholipase D PPO Prepro-orexin PPT Peduncolopontine nucleus p38 Cell signaling pathway REM Rapid eye movement RIA Radioimmunoassay ROC Receptor-operated Ca2+ RSNA Renal sympathetic nerve activity RT-PCR Reverse transcription-polymerase chain reaction SB-334867 Selective OX1R antagonist SD Sleep deprivation S.c. Subcutaneous SCN Suprachiasmatic nucleus SOC Secondary store operated Ca2+ STC-1 Enteroendocrine cell line derived originally from mouse SWS Slow wave sleep Tg Transgenic TRH Thyrotropin-releasing hormone TMN Tuberomamillary nucleus
8 UCP Uncoupling protein VIP Vasoactive intestinal peptide VLPO Ventrolateral preoptic nucleus VTA Ventral tegmental area Wt Wildtype
9
10 List of original articles
This thesis is based on the following articles, which are referred to in the text by their corresponding Roman numerals:
I Mäkelä KA*, Wigren HK*, Zant JC, Sakurai T, Alhonen L, Kostin A, Porkka- Heiskanen T & Herzig KH (2010) Characterization of sleep-wake patterns in a novel transgenic mouse line overexpressing human prepro-orexin/hypocretin. Acta Physiol 198(3): 237–249. II Mäkelä KA, Kettunen TS, Kovalainen M, Markkula A, Åkerman KEO, Järvelin MR, Saarela S, Alhonen L & Herzig KH Mice overexpressing human prepro-orexin have increased heat production and a PPAR gamma dependent upregulation of UCP2 in WAT. Manuscript. III Bengtsson MW*, Mäkelä K*, Sjöblom M, Uotila S, Åkerman KEO, Herzig KH & Flemström G (2007) Food-induced expression of orexin receptors in rat duodenal mucosa regulates the bicarbonate secretory response to orexin-A. Am J Physiol Gastrointest Liver Physiol 293(2): G501-G509. IV Bengtsson MW, Mäkelä K, Herzig KH & Flemström G (2009) Short food deprivation inhibits orexin receptor 1 expression and orexin-A induced intracellular calcium signaling in acutely isolated duodenal enterocytes. Am J Physiol Gastrointest Liver Physiol 296(3): G651-G658. *Equal contribution as first author
11
12 Contents
Abstract Acknowledgements 5 Abbreviations 7 List of original articles 11 Contents 13 1 Introduction 17 2 Review of the literature 19 2.1 Orexins ...... 19 2.1.1 PPO gene and orexin peptides ...... 19 2.1.2 Orexin receptors ...... 21 2.1.3 Orexin receptor signal transduction pathway ...... 21 2.2 Physiological functions of orexins ...... 23 2.2.1 Orexins and their receptors in the central nervous system ...... 23 2.2.2 The actions of orexins and their receptors on sleep/wakefulness and its pathophysiological conditions ...... 25 2.2.3 Feeding behaviour and energy homeostasis ...... 30 2.2.4 Reward seeking systems and drug addiction ...... 34 2.2.5 Orexins and their receptors in periphery ...... 35 2.2.6 Orexins and their receptors in the gastrointestinal tract ...... 36 2.2.7 Orexins and their receptors in the pancreas ...... 38 2.2.8 Orexins and their receptors in the adrenal gland ...... 39 2.2.9 Cardiovascular effects of orexins ...... 41 2.2.10 Orexins and their receptors in adipose tissue ...... 42 2.2.11 Orexins and their receptors in gonads ...... 43 2.2.12 Distribution and function of orexins and their receptors in other tissues ...... 44 2.2.13 Orexins in the circulation ...... 44 2.3 Sleep and arousal ...... 45 2.4 Thermoregulation in mammals ...... 49 2.4.1 Uncoupling proteins ...... 51 2.5 Duodenal bicarbonate secretion ...... 54 2.5.1 Gastroduodenal defense ...... 54 2.5.2 Duodenal bicarbonate secretion...... 55 3 Aims of the study 59 4 Materials and methods 61
13 4.1 Generation and characterization of hPPO overexpressing mice ...... 61 4.1.1 Generation and basic characterization of the mice ...... 61 4.1.2 Surgery for polysomnography ...... 66 4.1.3 EEG/EMG and video recording...... 66 4.1.4 Physiological and behavioral analysis of the hPPO mice ...... 70 4.2 Effects of food deprivation on duodenal mucosal bicarbonate secretion and orexin receptors’ expression in rat duodenal mucosa and in acutely isolated duodenal enterocytes ...... 71 4.2.1 Chemicals and drugs ...... 71 4.2.2 Animal preparation ...... 72 4.2.3 Intra-arterial infusions to the duodenum ...... 73 4.2.4 I.c.v. infusions ...... 74 4.2.5 Isolation of duodenal enterocytes ...... 74 4.2.6 Human biopsies and preparation of enterocytes ...... 75 4.2.7 Calcium imaging ...... 76 4.2.8 Quantitative real-time PCR ...... 76 4.2.9 Western blotting ...... 77 4.2.10 Data analyses ...... 78 5 Results 81 5.1 Generation and characterization of hPPO overexpressing mouse line ...... 81 5.1.1 Basic characterization of the mice ...... 82 5.1.2 The characterization of the sleep-wake patterns in hPPO overexpressing mice ...... 86 5.1.3 Physiological and behavioral analysis of the hPPO overexpressing mice ...... 89 5.2 Effects of food deprivation on duodenal mucosal bicarbonate secretion and orexin receptors expression in rat duodenal mucosa and in acutely isolated duodenal enterocytes ...... 91 5.2.1 In situ experiments ...... 91 5.2.2 In vitro experiments ...... 96 5.2.3 Quantitative real-time PCR and Western blotting analysis of orexin receptors ...... 100 6 Discussion 103 6.1 The generation and characterization of hPPO overexpressing mice ...... 103 6.1.1 The characterization of the sleep-wake patterns ...... 103
14 6.1.2 Effects of orexin overexpression on energy homeostasis ...... 105 6.2 Effects of overnight fasting on OXA induced duodenal bicarbonate secretion ...... 110 6.3 Methodological considerations ...... 114 6.3.1 hPPO overexpressing mice ...... 114 6.3.2 In situ and in vitro experiments studying the effects of orexins on duodenal HCO3 secretion ...... 116 6.4 Future aspects ...... 119 7 Conclusions 123 References 125 Original publications 155
15
16 1 Introduction
Orexins, or hypocretins, are peptides which were originally found from the hypothalamus simultaneously by two research groups (de Lecea et al. 1998, Sakurai et al. 1998). Since the discovery of the peptides, both terms have have been used in the scientific literature, yet orexin a bit more frequently. During the 16th Acta Physiologica International Symposium on “10 Years of Hypocretins/Orexins – Physiology and Pathophysiology” held at the University and Biocenter of Oulu, Finland, from the 13th to 14th of August 2008, with both primary discoverers present, no agreement could be found (Herzig & Purhonen 2010). Thus, in my thesis, I will use the word orexin to refer to the peptides and their receptors. Orexins have been shown to be involved in the regulation of sleep and wakefulness, energy homeostasis and autonomic functions (de Lecea et al. 1998, Sakurai et al. 1998, de Lecea & Sutcliffe 2005, Conti et al. 2006, Heinonen et al. 2008, Tsujino & Sakurai 2009). Orexin-A (OXA) and Orexin-B (OXB) are the active peptides, derived from the prepro-orexin (PPO) precursor protein by proteolytic processing and posttranslational modification (Sakurai et al. 1998). These peptides are ligands for two orphan G-protein-coupled receptors, the orexin-1 receptor (OX1R) and orexin-2 receptor (OX2R). In 1999, Lin et al. discovered that the reason for canine narcolepsy was a mutation in the OX2R gene (Lin et al. 1999). Subsequent studies in animals and humans have confirmed the involvement of the orexins and their receptors in narcolepsy, and initiated research for other roles of the orexin system in the regulation of sleep/wakefulness (Chemelli et al. 1999, Lin et al. 1999, Nishino et al. 2000, Peyron et al. 2000, Hara et al. 2001, Tsujino & Sakurai 2009, Bonnavion & de Lecea 2010). In particular, orexins might function in the maintenance and stabilization of sleep and wakefulness and the inhibition of REM sleep. Since the discovery of orexins, several studies have supported their role also in energy homeostasis (Sakurai et al. 1998, Tsujino & Sakurai 2009). Orexins are known to acutely promote appetite (Sakurai et al. 1998). Recent studies, however, have proposed a more important role for them in the homeostasis of energy metabolism (Tsujino & Sakurai 2009). Orexins and/or their receptors are widely distributed in several tissues, including the intestine, pancreas, adrenals, gonads and adipose tissue (Heinonen et al. 2008). In the intestine, orexins are involved in the regulation of motility and secretional mechanims. Flemström et al. demonstrated that a close-intra arterial infusion of OXA induced duodenal bicarbonate ( HCO3 ) secretion in fed rats,
17 while a short overnight fast (16 h) abolished this response (Flemstrom et al. 2003). Thus, the nutritional status (fasted or fed) might reflect on the expression of orexin receptors in the duodenum. The aim of the present thesis was to investigate the role of orexins and their receptors in 1) sleep/wake patterns, 2) energy homeostasis and 3) intestinal secretion. The effects of the orexin system on sleep/wakefulness and energy homeostasis were studied using a newly created mouse line overexpressing human PPO (hPPO) under its endogenous promoter. The role of orexins and their receptors in duodenal HCO3 secretion was evaluated by the molecular analysis of orexin receptors expression, in situ with duodenal perfusion in rats and in vitro using calcium signaling methods.
18 2 Review of the literature
2.1 Orexins
Orexins, or hypocretins are peptides which were originally isolated from the lateral hypothalamic area (LHA) simultaneously by two research groups (de Lecea et al. 1998, Sakurai et al. 1998). De Lecea et al. discovered these two secretin-like peptides from neuronal cell bodies of the dorsal and lateral hypothalamic areas using subtractive cDNA cloning (de Lecea et al. 1998). Later it was demonstrated that orexins are more similar to the bombesin family than to secretins (Willie et al. 2001). The name hypocretin indicates that peptides are synthesized in the hypothalamus, and their structure is similar to those of incretins. Using a reverse pharmacology approach, Sakurai et al. published results from the identification of OXA and OXB, and their receptors OX1R and OX2R (Sakurai et al. 1998). When administered centrally, orexins increase food consumption in rats. Therefore, the name “orexins” was derived from the Greek word orexis, which means appetite. Amino acid sequences of OXA and hypocretin-1 are identical to each other, with the exception of five additional amino acids in the N-terminus of hypocretin-1 (de Lecea et al. 1998, Sakurai et al. 1998). There are no differences between OXB or hypocretin-2 sequences. OXA and OXB are proteolytically cleaved from a peptide precursor PPO prior to secretion (Sakurai et al. 1998). Their actions are mediated via the two above mentioned G protein-coupled receptors (GPCR), OX1R and OX2R. The OX1R mainly binds OXA, whereas OX2R binds both OXA and OXB with similar affinities acting on both central and peripheral sites.
2.1.1 PPO gene and orexin peptides
The hPPO gene is located on human chromosome 17q21 (Sakurai et al. 1998). Its nucleotide sequence is 1432 base pairs (bp) in length and consists of two exons and one intron (Figure 1) (Sakurai et al. 1999). Exon 1 consists of 143 bp that covers 5´-untranslated region and first seven residues of secretory signal sequence. Intron 1, which is located between two exons, is 816 bp long. The exon 2 contains the rest of the open reading frame and 3´-untranslated region.
19 5´ 3´ Exon Intron1 Exon2 hPPO gene 1
Transcription Splicing
hPPO mRNA Cap poly(A)
Translation
1 34 66 70 97 131 Signal OXA OXB hPPO precursor peptide sequence
Cleavage
Posttranslational modification(s) OXA OXB OX1R OX2R Gi/ Gq Gs Gq G0 PLC PLD PLC Fig. 1. The processing of active orexin peptides from hPPO gene and orexin receptor signaling. Modified from Sakurai et al. 1998, Sakurai et al. 1999, Tsujino & Sakurai 2009. In addition to the hPPO gene, Sakurai with his colleagues described also a larger hPPO gene fragment, which contains a 3149 bp 5´-flanking region and a 122 bp 5´-noncoding region (Sakurai et al. 1999). The hPPO gene with its endogenous promoter directed the expression of the fused Escherichia coli β-galactosidase (lacZ) gene, with SV40 antigen nuclear localization signal, in the transgenic mice LHA. This genomic fragment makes possible to study the effects of exogenous molecules produced in orexin neurons. Mature PPO mRNA is encoded by exons 1 and 2 and translated into a precursor polypeptide PPO (Figure 1) (Sakurai et al. 1998). OXA and OXB peptides are cleaved from 130-residue (rodents) and 131-residue (human) PPO by proteolytic processing. Mouse PPO is 95% identical to that of the rat sequence, while human PPO has 83% similarity to both mouse and rat sequences. OXA is a 33-amino-acid long peptide with a molecular mass of 3562 Dalton. It has an N- terminal pyroglutamyl residue, C-terminal amide, and two intrachain disulfide bonds (Cys6 – Cys12, Cys – Cys14) (Figure 1) resulting an rigid turn between the Arg8 and Thr11 residues (Sakurai et al. 1998, Kim et al. 2004). Human, mouse, 20 rat and bovine OXA are identical to each other (Sakurai et al. 1998). Rat OXB is a 28-amino-acid long linear peptide of 2937 Dalton, with a C-terminal amide (Figure 1). It shares a 46% identity in amino-acid sequence compared with OXA, so that the C-terminal half of the OXB is highly similar to that of OXA. The mouse OXB sequence is identical to a rat´s, while human OXB differs from those by two amino acids (Pro2 and Asn18 are converted to Ser2 and Ser18, respectively). Both orexins consist of two α-helices. In human OXA, helix 1 is comprised of the residues Cys14 – His21 and helix 2 Asn 25 – Leu31 (Kim et al. 2004). For human OXB, the α-helices range from the residues Leu7 to Ser18 and from Ala22 to Met28 (Lee et al. 1999, Miskolzie et al. 2003, Lang et al. 2006). Both orexin receptors are capable of mediating the action of OXA after a segment conformation of the peptide between residues 6–14 (Lang et al. 2006). For OXB, the conformation at position 20 is crucial for selectivity of OX2R over OX1R. 2.1.2 Orexin receptors Orexins bind and mediate their action through OX1R and OX2R (Figure 1) (Sakurai et al. 1998, Kukkonen et al. 2002). Human amino acid sequences of the two orexin receptors show 64% homology. Orexin receptors are also highly conserved between different species. Human OX1R shares a 94% identity when compared with rat amino acid sequence, and OX2Rs have a 95% similarity between these two species. The results from a competitive radioligand binding assay using Chinese hamster ovary (CHO) cells showed that OX1R mainly binds OXA, whereas OX2R binds both OXA and OXB, with similar affinities. In a mouse, OX1R is 416 amino acids (aa) in length, while there are actually two different splice variants from OX2R; mOX2αR (443 aa) and mOX2ßR (460 aa) (Chen & Randeva 2004). Since these two variants are differently distributed in mouse tissues and 24 h food deprivation elevated more hypothalamic mOX2ßR gene expression when compared with both mOX1R and mOX2αR levels, these variants have been suggested to possess a different physiological role. However, no difference was observed between OXA and OXB binding properties for different splice variants. 2.1.3 Orexin receptor signal transduction pathway The activation of OXRs, especially OX1Rs, leads to a Ca2+ influx in native neurons and in the neuroendocrine cell line STC-1 (van den Pol et al. 1998, van 21 den Pol 1999, van den Pol et al. 2001, Uramura et al. 2001, Larsson et al. 2003). Similar Ca2+ influx was observed in neuron/neuroendocrine cells, as well as CHO cells which express heterologously OX1Rs (Lund et al. 2000, Holmqvist et al. 2002, Larsson et al. 2005). Zhu et al. demonstrated that OX1R is coupled to the Gq class of G-proteins as shown in Figure 1 (Zhu et al. 2003). Furthermore, at low orexin concentrations, OX1Rs activate the receptor-operated Ca2+ (ROC) influx pathway (Lund et al. 2000, Kukkonen & Akerman 2001). At high orexin concentrations, OX1R activation induces phospholipase C (PLC) dependent Ca2+ release and secondary store operated Ca2+ (SOC) influx (Mazzocchi et al. 2001a, Karteris et al. 2004, Karteris et al. 2005). The activation of PLC is observed in the endocrine cells of adrenal glands and testis. The ROC influx pathway includes also extracellular signal-regulated kinase (ERK) and the PLC responses, whereas the SOC influx supports the PLC response (Ammoun et al. 2006a, Johansson et al. 2007). The ERK pathway has also been reported to be protective for the cells, while the p38 pathway seems to be essential for the induction of cell death (Ammoun et al. 2006b). Further studies have demonstrated the participation of phospholipase D (PLD) in orexin receptor activation (Johansson et al. 2008). The production of 3'-5'-cyclic adenosine monophosphate (cAMP) has been demonstrated in adrenal cortical cells, CHO cells, and in hypothalamic neurons (Malendowicz et al. 1999, Mazzocchi et al. 2001a, Holmqvist et al. 2005, Karteris et al. 2005). Recently, it was also shown that OX1R activation leads to arachidonic acid release, indicating the importance of an ubiquitous phospholipase A2 (PLA2) in signal transduction (Turunen et al. 2009). In human adrenal glands, expressing OX2R as a predominant receptor, the dependence of G-proteins machinery (Gs, Gq and Gi; Figure 1) in OXA induced receptor activation has been suggested (Randeva et al. 2001, Karteris et al. 2005). Binding of the orexins to the OX2R also results in an activation of the PLC signaling pathway (Zhu et al. 2003). A dose and time dependent increase in ERK1/2 and p38 pathways, by both OXA and OXB, was observed in HEK-293 cells overexpressing human OX2R (Tang et al. 2008). ERK1/2 seems to be activated by Gs, Gq/11 and Gi, while the activation of p38 is mediated by Gi signaling. In addition, in human H295 adrenocortical cells, both orexins mediate their actions mainly through OX1R, but also through OX2R via ERK1/2 and p38 pathways (Ramanjaneya et al. 2009). 22 2.2 Physiological functions of orexins The wide distribution of orexins and their receptors suggests that they might play a role in several physiological systems, including arousal and sleep-wakefulness, feeding, energy homeostasis, gastrointestinal motility and secretion, glucose homeostasis, cardiovascular, reward-seeking and addiction (Figure 2) (Heinonen et al. 2008, Tsujino & Sakurai 2009, Boutrel et al. 2010). CNS Wakefulness Sleep Heart Food intake Adrenals Heart rate Metabolic rate Addiction Sympathetic tone Blood pressure Epinephrine release Glucocorticoid release Stomach WAT HCl secretion PPAR-γ-2 Motility Orexins Lipolysis Intestines Testis Bicarbonate secretion Spermatogenesis Motility Ovaries Pancreas Reproduction Insulin secretion Fig. 2. The functions of orexins in central nervous system and periphery. Modified from Heinonen et al. 2008, Tsujino & Sakurai 2009, Boutrel et al. 2010. 2.2.1 Orexins and their receptors in the central nervous system In 1998, Sakurai et al. showed that PPO mRNA, as well as OXA protein, are localized in the neurons of the lateral and posterior hypothalamic areas and in the perifornical nucleus of the rat brain (Sakurai et al. 1998). Hypothalamic PPO mRNA levels are increased after 48 h fasting in rats (Sakurai et al. 1998, Cai et al. 1999). Interestingly, OXA peptide levels, when measured by enzyme immunoassay from lateral hypothalamus homogenate of 48 h fasted rats, were reduced, instead of the predicted increase (Gallmann et al. 2006). The rate of 23 OXA release and degradation might have increased at the synapses in target regions. On the other hand, the vesicular storage capacity might have decreased in the presynaptic terminals. The presence of PPO and orexin-immunoreactivity was demonstrated also in the dorsomedial hypothalamic nucleus (DMH) (Peyron et al. 1998, Nambu et al. 1999). In addition, both in situ hybridization and immunohistochemical analyses verified the presence of PPO and OXA also in the subthalamus, the zona incerta, subincertal, and subthalamic nuclei (Sakurai et al. 1998). Orexin-immunoreactive axons and terminals were detected in the hypothalamic arcuate nucleus (ARC) and paraventricular nucleus (PVN) (Peyron et al. 1998). OXA immunoreactive fibres were detected around the suprachiasmatic nucleus (SCN) in Syrian and Siberian hamsters, while in rats OXA immunoreactivity was present in SCN (McGranaghan & Piggins 2001). Orexin-immunoreactive axons and terminals were detected throughout the rat brain, including cerebral cortex, circumventricular organs, thalamus (paraventricular nucleus), limbic system (hippocampus), and locus coeruleus (LC) and raphe nuclei located in a brain stem (Nambu et al. 1999). The use of OXA and OXB specific antibodies revealed differential distribution of the peptides in the rat brain and spinal cord (Cutler et al. 1999). The OXA immunoreactive fibres were found in the spinal cord, and near ventricles. In addition, orexin- immunoreactive descending axon projections are found in mouse, rat and human cervical cord (van den Pol 1999). In human brains, OXA has been detected abundantly in the hypothalamus, thalamus, medulla oblongata, and pons (Arihara et al. 2000). OXB immunoreactive cell bodies were found in the LHA and perifornical nucleus (Cutler et al. 1999, Date et al. 1999). OXB fibres, however, were sparse in areas receiving projections from OXA. Another study showed more wide- ranging projections also for OXB fibres in rat brain (Date et al. 1999). OXB had projections into the hypothalamus, thalamus, cerebral cortex, olfactory bulb, and brainstem. The differences between the two studies can probably be explained by differences in the antibodies (Cutler et al. 1999, Date et al. 1999). Both peptides are expressed also in the human pituitary (Blanco et al. 2003). Both OX1R and OX2R are present in the rat brain at mRNA level (Sakurai et al. 1998). Subsequent studies revealed a specific distribution of orexin receptors (Trivedi et al. 1998, Lu et al. 2000b). OX1R mRNA is mostly expressed in the ventromedial hypothalamic nucleus while the OX2R mRNA can mostly be found in the PVN. Both receptors are also present, however, to a lesser extent in DMH. 24 In addition, Lu et al. demonstrated the moderate expression of OX2R mRNA in the ARC while Trivedi et al. could not detect it (Trivedi et al. 1998, Lu et al. 2000b). OX1R mRNA is highly expressed in tenia tecta, parts of the hippocampal area, dorsal raphe nucleus, and LC (Trivedi et al. 1998). OX1R as well as OX2R can also be found in basal forebrain (BF) areas (Trivedi et al. 1998, Lu et al. 2000b). OX2R mRNA can be found in the cerebral cortex, nucleus accumbens, subthalamic and paraventricular thalamic nucleus as well as in the anterior pretectal nucleus (Trivedi et al. 1998). The presence of OX2R was verified in the ventral tegmental area (VTA) (Trivedi et al. 1998, Lu et al. 2000b). Both receptors have also other projections within the central nervous system (CNS). Immunohistochemical studies confirmed the expression of OX1R in the rat brain and spinal cord also at protein level (Trivedi et al. 1998, Lu et al. 2000b, Hervieu et al. 2001). The highest OX1R levels are detected in hypothalamic and thalamic nucleus, as well as in the LC. OX1R immunoreactivity can also be found in rat SCN (Backberg et al. 2002). The distribution of OX1Rs in other brain areas was generally in line with the existent mRNA data. Both receptors are present in rat pontine neurons, OX2R however to a lesser extend. In contrast to OX1R, the expression of OX2R cannot be clearly seen in LC. Results from Blanco et al. demonstrated the presence of OX1R in somatotrope cells of the pituitary, while OX2R was expressed in corticotrope cells (Blanco et al. 2001). Both orexins and their receptors are present in the CNS and they have wide projections suggesting their involvement in many different physiological processes (Peyron et al. 1998, Trivedi et al. 1998, Cutler et al. 1999, Date et al. 1999, Nambu et al. 1999, Lu et al. 2000b). 2.2.2 The actions of orexins and their receptors on sleep/wakefulness and its pathophysiological conditions The involvement of orexins and their receptors in sleep/wakefulness, especially in narcolepsy, were found soon after the identification of orexins (Peyron et al. 1998, Chemelli et al. 1999, Horvath et al. 1999, Lin et al. 1999, Nishino et al. 2000). In 1999, Lin et al. discovered that an autosomal recessive mutation in the OX2R gene causes narcolepsy in Doberman pinschers (Lin et al. 1999). The mutation is caused by an insertion of a short interspersed nucleotide element (SINE) into the third intron of the OX2R gene. As a result, the exon 4 is skipped in the splicing event and the exon 3 is spliced directly into exon 5. The mutated OX2R gene is coding for a truncated version of the OXR2 peptide. Labrador retrievers suffering 25 narcolepsy were found to carry a mutation caused by a G to A transition in the 5´ splice junction consensus sequence, leading to a skipping of exon 6, and finally, to a C-terminally truncated OX2R peptide. Due to the latter mutations, the receptor does not localize onto the membrane. In the Dachshund, narcolepsy is caused by a single point mutation in the OX2R gene, which leads to an amino acid change (E54K) in the N-terminal part of the peptide (Hungs et al. 2001). The resultant receptor protein product cannot bind orexins. Narcoleptic Dobermans have significantly elevated levels of OXA at birth, while the levels are decreased at four weeks of age when the first symptoms are observed and then increased again (John et al. 2004). In 1999, Chemelli et al. introduced a PPO knockout (OX-KO) mouse model (Chemelli et al. 1999). Due to the targeted disruption of the PPO gene, these mice exhibit a phenotype similar to human and canine narcolepsy. OX-KO mice show brief periods of ataxia, increased rapid eye movement (REM) sleep, and direct transitions from wakefulness to REM sleep. During the day time OX-KO mice show shortened REM sleep latency. However, the greatest differences between OX-KO and their wild type (wt) littermates were observed during the night time, when the mice are normally the most active. As with REM sleep time, the REM episode duration is significantly increased in OX-KO mice. These results are further supported by the fact, that OX-KO mice exhibit decreased intervals between successive REM sleep episodes. In addition, these mice showed an increase in non-rapid eye movement (NREM) sleep time, as well as a decrease in awake time, and awake episode duration, which indicate a fragmented sleep-wake cycle. Orexin/ataxin-3 mice express a toxic truncated Machado-Joseph disease gene product, ataxin-3 in their orexin producing neurons, leading to the ablation of these neurons within two weeks after birth (Hara et al. 2001). These mice exhibit a phenotype highly similar to that of human narcolepsy. The results relating to sleep state patterns are similar to those observed in OX-KO mice. During the light period, however, orexin/ataxin-3 mice show significant decreases in time spent in REM sleep, as well as episode duration of wake state when compared with wt mice. Authors also reported about direct transitions from wake state to REM sleep in the mice in the light period. Interestingly, orexin/ataxin-3 mice are obese, indicating a decreased metabolic rate. Since the expression of ataxin-3 eliminates also other co-expressed neurotransmitters, such as dynorphin, pentraxin (Narp), and precursor-protein convertase (PC1) in the orexin neurons, the observed results might not reflect only the functions of orexins (Chou et al. 2001, Hara et al. 2001, Reti et al. 2002, Nilaweera et al. 2003, Hara et al. 2005, 26 Zhang et al. 2007). A rat model with an expression of ataxin-3 in its orexin producing neurons exhibits also a narcoleptic phenotype similar to that of OX-KO and orexin/ataxin-3 mice (Beuckmann et al. 2004). Similarly, rats with small interfering RNA (siRNA) mediated knockdown of PPO show an altered diurnal distribution of REM sleep, cataplexy and sleep-onset REM (Chen et al. 2006). Interestingly, OX1R knockout mice do not exhibit behavioral arrest at all, and overall, the narcolepsy phenotype is less severe (Kisanuki et al. 2000, Kisanuki et al. 2001). In contrast, OX2R knockout mice differ from OX-KO mice by milder cataplexy-like attacks, and infrequent direct transitions from wakefulness to REM sleep (Willie et al. 2003). In addition, sleep attacks were not related to REM sleep transitions or atonia. OX1R/OX2R double receptor knockout mice exhibit a phenotype similar to that of OX-KO mice (Kisanuki et al. 2000, Kisanuki et al. 2001). Preliminary results from mice overexpressing rat PPO under a β- actin/cytomegalovirus hybrid promoter (CAG/orexin) showed a suppression of REM sleep during the day time and fragmented NREM sleep (Mieda et al. 2004b, Mieda et al. 2006b). In humans, narcolepsy results from both genetic and environmental factors (Mignot et al. 1997, Mignot et al. 2001). Most of the human cases of narcolepsy are sporadic and they associate with HLA-DQB1*0602. Peyron et al. showed that only one narcoleptic patient out of 74 was carrying an orexin gene mutation (Peyron et al. 2000). This further implicates that narcolepsy in humans is not a simple genetic disease. It should be noted that HLA-DQB1*0602 positivity decreases among those patients with less severe, or no cataplexy (Mignot et al. 1997). In addition, some of the controls are also HLA-DQB1*0602 positive (Pelin et al. 1998, Mignot et al. 2001). PPO mRNA is absent in hypothalami of narcoleptic patients (Peyron et al. 2000). Immunohistochemical studies from human narcolepsy subjects showed about a 90% reduction in the number of orexin containing neurons (Thannickal et al. 2000). Both Peyron and Thannickal demostrated that only orexin neurons are lost in human narcolepsy, while orexin co-existent melanin-concentrating hormone (MCH) neurons can still be found (Peyron et al. 2000, Thannickal et al. 2000). Radioimmunoassay (RIA) results from human narcolepsy-cataplexy patients revealed a total absence of orexin in cerebrospinal fluid (CSF) in most of the cases (Nishino et al. 2000, Ripley et al. 2001). Human patients with narcolepsy and animal models with a failure or a loss on function of the orexin system have problems maintaining wakefulness (Chemelli et al. 1999, Lin et al. 1999, Nishino et al. 2000, Hara et al. 2001, Beuckmann et 27 al. 2004). Alam et al. studied the activation of all neurons in the perifornical- lateral hypothalamic area (PF-LHA) and demonstrated that 53% of neurons were activated during wakefulness and REM sleep, while in NREM sleep, the firing of these neurons decreased (Alam et al. 2002). In addition, 38% of the neurons were activated only in wake state. This indicates the importance of the PF-LHA area in the regulation of sleep-waking states. Lee et al. recorded the activity of orexin neurons in rats and demonstrated that these cells discharge during active waking, which is associated with high postural muscle tone (Lee et al. 2005). In contrast, neurons stop firing during sleep when the postural muscle tone has decreased or totally disapeared. Orexin system neurons have wide projections to various areas both in the brain and brainstem (Hagan et al. 1999, Brown et al. 2002, Liu et al. 2002, Yamanaka et al. 2002, de Lecea & Sutcliffe 2005, Tsujino & Sakurai 2009). These areas include noradrenergic LC neurons, serotonergic dorsal raphe neurons and histaminergic tuberomammillary nucleus (TMN) neurons. All of these monoaminergic neurons are activated by orexins. These neurons fire fast during wakefulness, slow down, and finally even stop in NREM sleep and REM sleep, respectively (Saper et al. 2001). A microinjection of OXA into the LC increases wakefulness and suppresses REM sleep in rats (Bourgin et al. 2000). Interestingly, only OX1Rs can be found in the LC. A local infusion of OXA into the dorsal raphe nucleus creates an increase of extracellular serotonin, or 5- hydroxytryptamine (5-HT) in rats (Tao et al. 2006). OXB, however, causes increased 5-HT levels, both in the dorsal raphe nucleus as well as the medial raphe nucleus. Delivery of OXA into the TMN increases also wakefulness, and decreased the amounts of NREM and REM sleep in rats (Huang et al. 2001). Furthermore, infusion of OXA into the lateral ventricle of histamine H1 receptor KO mice did not increase wakefulness, indicating the importance of the histaminergic system in orexin mediated arousal. A recent study showed that maintenance of sleep/wake states does not require histamine H1 receptors or OX1Rs (Hondo et al. 2009). It was speculated that the OXR2 mediated pathway does not require the histaminergic system in sleep/wake regulation. All of the latter structures send projections throughout the BF, which is suggested to have an important role in arousal (Saper et al. 2001, de Lecea & Sutcliffe 2005, Arrigoni et al. 2009). Orexins show an exitatory action on BF cholinergic neurons (Eggermann et al. 2001). Intrabasalis delivery of OXA increases acetylcholine release within the prefrontal cortex in rats (Fadel et al. 2005). Orexin infusion into the BF increases wakefulness (Espana et al. 2001, Thakkar et al. 2001). 28 Orexin neurons also project to the laterodorsal tegmental nucleus (LDT) and peduncolopontine nucleus (PPT) (Peyron et al. 1998, Nambu et al. 1999). In these areas, cholinergic neurons promote either wakefulness or REM sleep (Saper et al. 2001). Orexins excite cholinergic neurons in LTD (Burlet et al. 2002, Takahashi et al. 2002). Furthermore, Xi et al. showed that administration of OXA into cat LDT increases wakefulness and decreases REM sleep (Xi et al. 2001). Recently, whole cell recordings demonstrated that orexins have an excitatory effect on PPT neurons (Kim et al. 2009). In addition, it has been proposed that orexins may have an interplay with other signaling molecules, such as dynorphin, to promote arousal (Arrigoni et al. 2009, Kantor et al. 2009). Orexin neurons receive an input from GABAergic neurons of the ventrolateral preoptic area (VLPO) (Sakurai et al. 2005, Yoshida et al. 2006, Tsujino & Sakurai 2009). Neurons in the VLPO fire rapidly during sleep, and they have been proposed to have a role in the initiation of NREM sleep. In addition, these neurons function in the maintenance of NREM and REM sleep (Sherin et al. 1996, Szymusiak et al. 1998, Lu et al. 2000a). Reverse transcription-polymerase chain reaction (RT-PCR) analysis demonstrated the presence of gamma- aminobutyric acid (GABA) in the latter neurons (Gallopin et al. 2000, Tsujino & Sakurai 2009). In addition, their action was inhibited by noradrenaline and acetylcholine. Furthermore, during sleep, when the neurons are active, they inhibit monoaminergic and cholinergic nuclei. Thus, GABAergic neurons might send inhibitory projections to orexin neurons during sleep (Tsujino & Sakurai 2009). Several studies have proposed a role for growth hormone-releasing hormone (GHRH) as a sleep-promoting substance (Steiger 2007). I.c.v. injection of OXA decreased GHRH mRNA levels in the paraventricular nucleus in rats (Lopez et al. 2004). Therefore, the authors speculated that the latter could partly be in response to an inhibitory action of OXA on REM sleep. In addition, i.c.v administration of OXA significantly decreased the mean growth hormone levels in continuously fed rats (Seoane et al. 2004). In vivo photostimulation of orexin neurons increased the probability of transition to wakefulness from the sleep (Adamantidis et al. 2007). In the zebrafish model, inconsistent results about insomnia after genetic manipulation of the orexin system have been reported (Panula 2010). Prober et al. described increased locomotor activity and an insomnia-like phenotype with orexin overexpression, whereas Yokogawa reported an insomnia-like phenotype with orexin receptor mutants (Prober et al. 2006, Yokogawa et al. 2007). Since sleep 29 can be promoted by a pharmacological blockade of both orexin receptors, orexin receptor antagonists have been tested for the treatment of insomnia (Brisbare- Roch et al. 2007, Roecker & Coleman 2008, Hoever et al. 2010). Both promising and unpromising results have been obtained and orexin receptors antagonists are still under intensive research (Brisbare-Roch et al. 2007, Cox et al. 2010). 2.2.3 Feeding behaviour and energy homeostasis Overweight and obesity, physical conditions of people with a body mass index (BMI) equal or more than 25 kg/m2 and 30 kg/m2, respectively, are defined as abnormal or excessive fat accumulation that causes a risk to health (WHO 2010). Increased food intake and reduced physical activity are major factors for the development of overweight and obesity. According to World Health Organization estimations for 2010, in Finland, the prevalence for 15–100 year old males and females having a BMI ≥ 25 kg/m2 are 67.1% and 54.5%, respectively, while the same numbers for people with BMI ≥ 30 kg/m2 are 20.9% and 19.4%. In the USA, the numbers are even higher, 80.9% and 76.7% for males and females with BMI ≥ 25 kg/m2 and 44.2% and 48.3% for people with BMI ≥ 30 kg/m2, respectively. In addition to assisting the continuous struggle for healthier diets and increased physical activity, obesity research has focused on the investigation of obesity related genes. In general, two sets of neuronal populations in hypothalamic ARC have a key role in the regulation of feeding behaviour (Simpson et al. 2009). The first pathway involves the orexigenic neuropeptide Y/agouti related peptide (NPY/AgRP) expressing neurons, while the other set consists of the anorexigenic pro-opiomelanocortin/cocaine- and amphetamine- regulated transcript (POMC/CART) neurons. These neurons project and/or have projections to/from other hypothalamic regions or central locations important in the modulation of feeding. In addition, the CNS receives peripheral satiety and hunger signals directly or indirectly from hormones and peptides, such as from leptin, cholecystokinin (CCK) and ghrelin. Orexins have been shown to be involved in feeding behaviour and energy homeostasis (Sakurai et al. 1998). In addition, orexins and their receptors have been shown to localize especially in the LHA, which is commonly known for its actions on feeding behaviour and energy homeostasis (Sakurai et al. 1998, Elmquist et al. 1999). At first, it was shown by Sakurai et al. that a single injection of OXA or OXB into the left lateral ventricle promotes acute daytime 30 feeding in rats (Sakurai et al. 1998). An injection of OXA, but not OXB, into the third ventricle given during light period induces feeding also in mice (Lubkin & Stricker-Krongrad 1998). Intracerebroventricular (i.c.v.) administration of OXA (12 nmol/day) for seven days increased daytime food intake, however with only a slight decrease in the night time food intake, and with no or only a small increase in body weight in rats (Yamanaka et al. 1999). In another study, chronic i.c.v. infusion of OXA (18 nmol/day) increased daytime feeding but also decreased nocturnal feeding in rats (Haynes et al. 1999). In addition, OXA had no effect on total body weight. A 6 day intraparaventricular administration of OXA (0.5 nmol) induced weight loss in rats, with no difference in food intake, but an increase in physical activity (Novak & Levine 2009). OXA, but not OXB, enhanced the food intake in rats when injected directly into the LH, PVN, DMN and the perifornical hypothalamus (Dube et al. 1999). However, direct injections of orexins had no effect in the ARC, VMN, preoptic area, or in the central nucleus of the amygdala (CeA). Intraperitoneally (i.p.) administered selective OX1R antagonist, SB- 334867, with a 50-fold higher selectivity over OX2R, reduced food intake in rats, even after 18 h fasting (Haynes et al. 2000, Smart et al. 2001). Furthermore, intracisternally added OXA antibody decreased remarkably food intake in 24 h fasted rats (Yamada et al. 2000). Surprisingly, in rhesus monkeys, i.c.v. injection of OXA resulted in decreased food intake, and OXB had no effect at all, indicating that orexins may not play a role in short-term food intake in primates (Ramsey et al. 2005). In addition, i.c.v injected OXA has no effect on food intake in old rats (Takano et al. 2004). Thus, the orexin system might change during aging. This is in line with the findings that the expressions of PPO mRNA as well as both orexins on protein level are decreased in 12 month old rat brains (Porkka- Heiskanen et al. 2004). Aging does not have an effect on PPO mRNA levels in mice (Terao et al. 2002). However, OX1R mRNA levels reduced in the hippocampus, and OX2R mRNA levels in several different brain areas in aging mice. In contrast, a recent study showed that also the amount of orexin immunospecific neurons in mice starts to decline at the age of 400 days (Brownell & Conti 2010). LHA contains glucose sensitive neurons, which are activated by hyperglycemia or hypoglycemia (Tsujino & Sakurai 2009). These cells are considered to act in the short term-regulation of feeding and energy homeostasis. They respond to changes in extracellular glucose contents by firing either exciting (glucose excited) or inhibiting (glucose inhibited) neurons. As mentioned before, during fasting, mRNA levels of orexins in the LHA are upregulated (Sakurai et al. 31 1998, Cai et al. 1999). It has been proposed that orexin neurons might have a role as sensors of the whole body’s nutritional status. To support this idea, using whole-cell patch-clamp recordings, it was shown that isolated orexin neurons are glucose sensitive, or in other words, glucose inhibited neurons (Yamanaka et al. 2003). The neurons responded to increased glucose concentrations by hyperpolarization and cessation of action potentials, while the decreased glucose caused a depolarization and increased the frequency of action potentials. In addition, leptin was also found to inhibit orexin neurons, while ghrelin activates them. Later, Burdakov et al. demonstrated the effect of a glucose induced inhibition of the firing of orexin neurons (Burdakov et al. 2005). Furthermore, + glucose inhibition seems to be mediated by an opening of “leak” K (K2P) channels, sensing changes in fluctuations of glucose (Burdakov et al. 2006). OX-KO mice are hypophagic, but they gain slightly more weight than their wt littermates (Chemelli et al. 1999, Hara et al. 2001, Willie et al. 2003). In addition, these mice show reduced locomotor activity during the night time. However, the increase in weight is more likely due to a reduced metabolic rate than reduced activity. In contrast, mice overexpressing rat PPO, under β- actin/cytomegalovirus hybrid promoter (CAG/orexin), show a reduced total and body weight adjusted intake of high fat diet, accompanied with increased energy expenditure and lowered body weight (Funato et al. 2009). In addition, Lubkin & Stricker-Krongrad showed that an injection of OXA into the third ventricle of wt mice increases the metabolic rate (Lubkin & Stricker-Krongrad 1998). Several studies have shown that orexin deficiency in narcoleptics is by some means related to obesity (Lammers et al. 1996, Hara et al. 2001, Kok et al. 2003). Narcoleptics are obese in spite of reduced feeding, suggesting a decreased metabolic rate. In contrast, rats treated with daily OXA into the paraventricular nucleus show a lowered body weight with no difference in food intake (Novak & Levine 2009). Microinjections resulted also in increased physical activity. In addition to LHA, areas like VMH, DMH and ARC have a role in feeding, as well as in energy homeostasis (Elmquist et al. 1999, Tsujino & Sakurai 2009). Orexin neurons send projections to ARC, and they also receive innervation from NPY and AgRP neurons, which are important for feeding, as well as from α- melanocyte stimulating hormone (α-MSH) fibres, whose product α-MSHs are cleaved from POMC, and are essential for satiety (Elias et al. 1998, Peyron et al. 1998, Date et al. 1999, Schwartz et al. 2000). I.c.v. administration of OXA causes an increase in c-Fos expression in rat NPY neurons, suggesting the involvement of NPY in OXA induced feeding (Yamanaka et al. 2000). Furthermore, treatment 32 of isolated rat ARC NPY neurons with OXA resulted in increased cytosolic Ca2+ concentration (Kohno et al. 2008). Again, OXA does not stimulate food intake in the rats with impaired NPY system (Moreno et al. 2005). Whole-cell patch-clamp recordings from rat brain slices showed that orexin, as well as ghrelin, activate NPY/AgRP neurons, while leptin inhibits orexins (van den Top et al. 2004). Another study confirmed the latter with recordings from NPY cells showing a direct excitatory effect of arcuate nucleus NPY neurons in response to OXA (Li & van den Pol 2006). POMC KO mice have elevated PPO mRNA levels in the LHA, suggesting a close interaction between α-MSH and the orexin system (Lopez et al. 2+ 2007). In addition, OXA and OXB decreased [Ca ]i levels in POMC-containing neurons in rats. In addition, glucose-responsive neurons of the VMH responded to 2+ the administration of orexins by decreased [Ca ]i levels (Muroya et al. 2004). Furthermore, whole-cell patch-clamp recordings showed that OXA decreases the action potential firing of mouse POMC neurons (Ma et al. 2007). Nucleus accumbens also has a role in food intake (Zheng et al. 2003, Tsujino & Sakurai 2009). In 2003 Zheng et al. demonstrated that injection of the GABAA agonist muscimol into the nucleus accumbens shell of rats resulted in an increase in Fos expression in orexin neurons and food intake (Zheng et al. 2003). Similar results were observed later by Baldo et al. (Baldo et al. 2004). Later, it was shown that orexin signaling may affect the nucleus accumbens stimulated need for high- fat food (Zheng et al. 2007). On the other hand, infusion of OXA into the medial portion of the accumbens shell increased food intake and locomotor activity in rats (Thorpe & Kotz 2005). The authors speculated that OXA may act through the accumbens shell to affect feeding behavior and locomotor activity. Circadian clocks are important biological timekeeping mechanisms which enable organisms to predict their customary cycling events (Challet 2010). The main circadian clock in mammals is located in the suprachiasmatic nuclei (SCN) of the hypothalamus, from where it coordinates the timing of other local oscillators located in the brain and periphery. However, another circadian system is responsible for preparing animals for their ongoing or next meal. When food is given to rodents at restricted times, i.e. scheduled times, they start to show food anticipatory activity (FAA) (Mistlberger 2009). The increase in the locomotor activity begins 1–3 h before the animals have the possibility to access their food. Since the FAA is not abolished by the lesions of the SCN, it is believed that a food-entrainable oscillator (FEO) is situated elsewhere than in the SCN (Stephan 2002). Recently, it was shown that Fos expression in orexin neurons, as a marker of neuronal activation, increased during the food anticipatory period (Mieda et al. 33 2004a). In addition, due to restricted feeding, the Fos expression in OXA immunoreactive cells from mouse brain shifted from night to day (Akiyama et al. 2004). Furthermore, orexin/ataxin-3 mice display impaired FAA. OX-KO mice exhibit a similar behaviour, indicating the importance of the orexin system in the locomotor activity in FAA (Kaur et al. 2008). The mRNA expressions of genes that are suggested to participate in the regulation of food entrainment of circadian rhythms, like mNpas2, mPer1 and mBal1, are also reduced in the forebrain of orexin/ataxin-3 mice (Wakamatsu et al. 2001, Dudley et al. 2003, Akiyama et al. 2004, Fuller et al. 2008). Mieda et al. demonstrated later, that during restricted feeding, Per genes were oscillated actively in the DMH (Mieda et al. 2006a, Tsujino & Sakurai 2009). Since DMH neurons project to orexin neurons, interactions between DMH neurons and orexin neurons might have an important function in FEO (Sakurai et al. 2005, Mieda et al. 2006a, Tsujino & Sakurai 2009). 2.2.4 Reward seeking systems and drug addiction Previous publications have implicated a role for orexins also as a target for substance abuse and eating disorders (Lawrence et al. 2006). LHA is a well known area for its importance in reward and drug addiction (DiLeone et al. 2003). In 2003, Georgescu et al. demonstrated that µ-opioid receptors are present in LHA orexin neurons. These neurons are affected by a chronic morphine administration and a morphine withdrawal by opioid antagonist naloxone (Georgescu et al. 2003). In addition, OX-KO mice do not possess normal behavioral signs of withdrawal from morphine. Two-chamber, nonbiased, conditioned place-preference studies showed that orexin neurons are Fos- activated also after morphine, cocaine and food rewards in rats (Harris et al. 2005). Thus, it further indicates the role of orexin neurons in reward-seeking and addiction. In addition, orexin neurons have been shown to innervate the VTA and nucleus accumbens, which are known for their actions on rewards (Fadel & Deutch 2002). OXA microinjected into the VTA in rats resulted in a reinstatement response for morphine (Harris et al. 2005). In addition, microinjection of SB- 334867 into VTA prevents the morphine-induced place preference in rats (Narita et al. 2006). Furthermore, injection of OXA or OXB into VTA increased the levels of dopamine in the nucleus accumbens. These data indicate the role of orexin neurons in the VTA in the morphine-induced rewarding effect, which is associated with an activation of the mesolimbic dopamine system. Accordingly, 34 also other studies have shown the importance of the orexin signaling in the VTA in neural plasticity relevant to addiction, but also the possibility for the involvement of OXB and OX2R (Borgland et al. 2006, Borgland et al. 2008). I.c.v. or local VTA infusions of OXA reinstate a previously extinguished cocaine seeking behaviour in rats (Boutrel et al. 2005, Wang et al. 2009). In addition, this behavior is completely blockaded by OX1R antagonists. However, corticotropin-releasing factor (CRF, also known as corticotrophin-releasing hormone) -dependent footshock-induced reinstatement of cocaine seeking, or the VTA dopamine or glutamine levels were not were not affected by OX1R antagonist SB-408124 infusion into the VTA (Wang et al. 2009). Thus, it is believed that in the VTA, orexins and CRF work independently on the mesolimbic dopamine mechanism in cocaine seeking (Boutrel et al. 2005, Wang et al. 2009). Microinjection of OXA into LHA and PVN stimulates voluntary ethanol intake in rats trained to drink 10% ethanol, with no difference on water or food consumption (Schneider et al. 2007). Thus, the feeding stimulatory effect of OXA was masked by the ethanol consumption. This proposes a function of the orexin system in ethanol intake. In addition, i.p. administration of SB-334867 resulted in a decrease in operant self-administration of ethanol in rats (Richards et al. 2008). Furthermore, i.p. administration of SB-334867 abolished the cue-induced reinstatement alcohol-seeking behavior (Lawrence et al. 2006). Interestingly, i.c.v. administration of SB-334867 also decreases nicotine uptake in rats (Hollander et al. 2008). Furthermore, OXA innervates OX1Rs which are located in the insula of the cortical brain region, which is proposed to be an important area in the addiction to smoking (Naqvi et al. 2007, Hollander et al. 2008). Thus, it is believed that the orexin system may also have a role in maintaining nicotine addiction (Hollander et al. 2008). 2.2.5 Orexins and their receptors in periphery In addition to the presence of orexins and their receptors in the CNS, these are also widely expressed in the various peripheral tissues (Heinonen et al. 2008). Orexins and/or their receptors are detected in tissues such as the intestine, pancreas, adrenals, kidney, white and brown adipose tissue (WAT, BAT) and reproductive tract. In addition, OXA and OXB can be detected also in plasma/serum. 35 2.2.6 Orexins and their receptors in the gastrointestinal tract Kirchgessner and Liu showed that PPO, as well as OX1R and OX2R mRNA are expressed in the rat myenteric plexus (Kirchgessner & Liu 1999). In addition, PPO, OXA and OXB were found in the myenteric and submucosal plexi and in cultures of isolated myenteric ganglia of mice, rats, guinea-pigs and humans. In fetal mouse, OXA was present in neuroendocrine cells of the pyloric region of both stomach and small intestine (de Miguel & Burrell 2002). In rats, an OXA like immunoreactivity was detected in varicose nerve fibres in the myenteric and submucosal ganglia and neurones, and in the interconnecting nerve strands, as well as in the longitudinal and circular muscle and in the mucosa including enteroromaffin (EC) cells (Naslund et al. 2002). In the guinea-pig stomach, OXA like immunoreactivity was present in the endocrine cells, which also show gastrin immunoreactivity (Kirchgessner & Liu 1999). In humans, PPO mRNA is expressed in the stomach and ileum, and to a lesser extent in colon and colorectal epithelial cells (Nakabayashi et al. 2003). No expression of PPO mRNA was detected in the duodenum. On the protein level, OXA was observed in ganglion cells of the thoracic sympathetic trunk, and in the ganglion cells of myenteric plexuses within the gastrointestinal tract (GIT). In the duodenum, OXA was co- expressed with chromogranin-A, thus indicating originate of endocrine cells. OX1R is found in submucosal neurons and in nerve fibers which surround the mucosal crypts with extensions to the endings in the subepithelial plexus (Naslund et al. 2002). OX1R immunoreactivity is displayed also in the myenteric neurons and its nearby varicosities. Nerve fibers in the circular muscle also express OX1R. While OX1R seems to be expressed widely, OX2R can only be found in enteroendocrine cells located in duodenal crypts. Orexins regulate the gastric and intestinal motility via both central and peripheral pathways (Heinonen et al. 2008). OXA excites submucosal secretomotor neurons in a guinea-pig ileum and increases motility in isolated guinea-pig colon segments. 3 day fasting increases the amount of OXA- immunoreactive guinea-pig submucosal neurons (Kirchgessner & Liu 1999). Microinjections of orexins into DMN resulted in increased intragastric pressure and antral motility in anaesthetized rats (Krowicki et al. 2002). However, intracisternal injection of OXA resulted in relaxation of the rat proximal stomach, in addition to the increased motility of the distal stomach (Kobashi et al. 2002). Intravenous (i.v.) infusion of SB-334867 decreased the emptying of a liquid nutrient from the stomach in rats (Smart et al. 2001, Ehrstrom et al. 2005b). In 36 addition, an i.v. infusion of OXA decreased the rate of gastric emptying of a 99mTc-labeled omelet in humans fasted overnight (Ehrstrom et al. 2005a). OXA seems to have a dual role in the regulation of intestinal motility (Heinonen et al. 2008). Administration of OXA into mouse small intestine segments induced a contraction of the longitudinal muscle, possible via activation of cholinergic neurons and muscarinic receptors (Satoh et al. 2001). In the presence of atropine and guanethidine, however, exogenously added OXA induced a relaxation of the small intestine. In mouse jejunal segments, this relaxation was mediated via a nitric oxide pathway (Satoh et al. 2006b). In contrast, an i.v. infusion of both orexins inhibited fasting motility in the rat duodenum (Naslund et al. 2002). In addition, the inhibitory effect of OXA is most probably mediated by OX1R, and is dependent on the L-arginine/nitric oxide pathway (Ehrstrom et al. 2003). Furthermore, bilateral subdiaphragmatic vagotomy did not abolish the response to OXA. Intracisternal administration of OXA, but not OXB, resulted in a stimulation of gastric acid secretion in 24 h fasted, conscious rats, while i.p. injection of OXA had no effect (Takahashi et al. 1999). Since the stimulation was blocked by atropine or surgical vagotomy, it was proposed that the OXA stimulated gastric acid secretion is mediated by a vagus-dependent cholinergic mechanism. In addition, this effect is likely to be mediated via the OX1Rs (Okumura et al. 2001). An i.v. infusion of OXA had no effect on basal or pentagastrin-stimulated gastric acid secretion in rats that were food deprived for 18 h (Ehrstrom et al. 2005b). However, i.v. administration of SB-334867 inhibited the previously mentioned secretions, thus suggesting the role of endogenous OXA on gastric acid secretion independently of gastrin. A close intra-arterial infusion of OXA stimulated HCO3 secretion in fed, but not in overnight fasted (16 h) rats (Flemstrom et al. 2003). Orexins have been suggested to have an affect on cholecystokinin (CCK) release from intestinal neuroendocrine cells (Larsson et al. 2003). This peptide is secreted from I-cells of the duodenum and jejunum and it stimulates the release of digestive enzymes from the pancreas and bile acid from the gallbladder (Heinonen et al. 2008). Both orexin receptors are expressed in the intestinal neuroendocrine cell line, STC-1, and OXA causes a dose dependent stimulation of CCK release via an activation of L-type voltage-gated Ca2+-channels (Larsson et al. 2003). CCK mediates its satiety signal via CCK1 receptors which are located in afferent vagal fibers. In addition, OX1R mRNA was present in both rat and human nodose ganglia, and OX2R mRNA was detected in human nodose ganglia (Burdyga et al. 2003). I.v. injection of OXA just before CCK-8 37 administration leads to inhibition of jejunal afferent discharge in anesthetized rats. Thus, orexin might affect the CCK signaling from gut to brain. Administration of CCK-8 into mice brain slices activated orexin neurons (Tsujino et al. 2005). The activation was mediated through the CCK1 receptor. In addition, an i.c.v. injection of OXA reversed the i.p. administered CCK-8 induced reduction in feeding in mice (Asakawa et al. 2002). I.p. injection of CCK-8 resulted in increased OXA levels in the posterior brainstem in 48 h fasted rats, but not in the LHA (Gallmann et al. 2006). Thus, it was speculated that CCK-8 induced inhibition of food intake after long fasting might be due to inhibition of orexin neurons in the brainstem. 2.2.7 Orexins and their receptors in the pancreas Both orexin receptors are expressed on the mRNA level in the rat pancreas (Kirchgessner & Liu 1999). In addition, OXA- and orexin receptor-like immunoreactivity was found in insulin secreting β-cells, nerve fibers in pancreatic ganglia and in paravascular nerve bundles. In rats, the presence of OXA and OX1R was shown also in glucagon secreting α-cells (Ouedraogo et al. 2003). The presence of both orexin receptors in mRNA level has been demonstrated in rat pancreatic islets (Nowak et al. 2005). In humans, PPO mRNA was observed in the pancreas, and OXA peptide was detected in pancreatic islets, as well as in somatostatin and glucagon positive cells (Nakabayashi et al. 2003). However, Ehrström et al. demonstrated the presence of OXA only in insulin positive islet cells and not in somatostatin or glucagon positive cells (Ehrstrom et al. 2005a). Low glucose levels stimulated the release of OXA from isolated rat pancreatic islets (Ouedraogo et al. 2003). In the presence of low glucose, administration of OXA on islets increased glucagon secretion. In the presence of high glucose, OXA decreased glucose-stimulated insulin secretion. Plasma concentration of OXA increased during 18 h fasting. In contrast, in another study, both OXA and OXB stimulated insulin secretion at low and high glucose concentrations in rat pancreatic islets (Nowak et al. 2005). Orexins stimulated insulin secretion also in the perfused rat pancreas. Afterwards, the same group reported that OXA stimulated insulin secretion in the perfused rat pancreas only in the presence of high glucose (Goncz et al. 2008). Similarly, a subcutaneous (s.c.) injection of OXA or OXB stimulated insulin secretion in female rats for up to 120 minutes and 60 minutes, respectively (Nowak et al. 2000). However, only the administration of OXA resulted in an increase of blood glucose, while OXB 38 had no effect. A daily s.c. administration of OXA or OXB for 7 days increased both insulin and leptin plasma levels in female rats (Switonska et al. 2002). However, Ehrstrom et al. demonstrated that an i.v. infusion of OXA did not affect the levels of plasma insulin in the rats (Ehrstrom et al. 2004). An i.v. infusion of OXA or SB-33486 during a liquid nutrient meal decreased plasma insulin levels in rats fasted for 18 h (Ehrstrom et al. 2005b). Furthermore, SB-334867, but not OXA, with the meal increased plasma glucose levels. In humans fasted overnight, an i.v. infusion of OXA increased postprandial plasma insulin levels, while there was no change in plasma glucacon or glucose (Ehrstrom et al. 2005a). The administration of OXA resulted in reduced glucagon secretion in perfused rat pancreas, isolated rat pancreatic islets, and clonal pancreatic A-cells (InR1-G9) (Goncz et al. 2008). Similarly, an i.v. infusion of OXA decreased plasma glucacon levels in rats (Ehrstrom et al. 2004). Infusion of OXA through the jugular vein increased plasma glucagon levels in rats food deprived for 18 h (Ouedraogo et al. 2003). However, in humans fasted overnight, an i.v. infusion of OXA did not affect plasma glucacon or glucose levels (Ehrstrom et al. 2005a). Recently, Funato et al. studied the effects of orexin overexpression and/or orexin receptor deficiency on glucose metabolism and insulin sensitivity, using transgenic/KO mice approaches (Funato et al. 2009). The overexpression of orexins attenuated diet-induced obesity and improved insulin insensitivity due to increased energy metabolism and decreased diet comsumption. The authors speculated that improvements in insulin sensitivity resulted from an OX2R- mediated reduction of adiposity. 2.2.8 Orexins and their receptors in the adrenal gland PPO mRNA was weakly expressed in the human adrenal gland (Nakabayashi et al. 2003). Western blot analysis confirmed also the presence of PPO and OXA peptides in fetal and adult human adrenal gland (Karteris et al. 2001, Randeva et al. 2001). However, other studies have failed to demonstrate the presence of PPO or OXA in the human or rat adrenal gland, pheochromocytomas, cortisol- producing adenomas or aldosterone-producing adenomas (Lopez et al. 1999, Arihara et al. 2000, Johren et al. 2001, Nakabayashi et al. 2003). Spinazzi et al. found that cortisol-secreting adenomas expressed PPO mRNA and OXA peptide, whereas nothing could be detected in the human adrenal cortex (Spinazzi et al. 2005). 39 Using in situ hybridization, Johren et al. demonstrated the presence of OX2R mRNA in a rat zona glomerulosa and zona reticularis (Johren et al. 2001). RT- PCR and Western blott analysis demonstrated the presence of OX2R in fetal and adult human adrenal gland and membrane, respectively (Karteris et al. 2001, Randeva et al. 2001). Mazzocchi et al. demonstrated the presence of both orexin receptors on mRNA level in zona fasciculate, zona reticularis and medulla, and OX1R in zona glomerulosa in humans (Mazzocchi et al. 2001b). OX1R mRNA is highly expressed in the porcine adrenal cortex, while expression is low in the medulla (Nanmoku et al. 2002). The expression of both receptors on mRNA level has been demonstrated also in cultured rat and human adrenocortical cells (Ziolkowska et al. 2005). The presence of both orexin receptors on mRNA level in adrenal medulla was demonstrated in rats (Lopez et al. 1999). In human pheochromocytomas, only OX2R mRNA was detected by RT-PCR (Mazzocchi et al. 2001a). However, immunohistochemical studies demonstrated the presence of both OX1R and OX2R in the human adrenal cortex and medulla, respectively (Blanco et al. 2002). The effects of orexins on the hypothalamus-pituitary-adrenal (HPA) axis have been widely evidenced (Heinonen et al. 2008). An i.c.v. injection of OXA increased the mRNA expression of CRF and AVP in parvocellular neurones of the PVN in rats (Al-Barazanji et al. 2001). In addition, i.c.v. administration of OXA and/or OXB increased plasma adrenocorticotropic hormone (ACTH) and/or dose dependently corticosterone levels in rats (Hagan et al. 1999, Jaszberenyi et al. 2000, Kuru et al. 2000). The i.c.v administed corticotrophin-releasing hormone (CRH) antagonist, α-helical CRH9−41, inhibited OXA and OXB induced corticosterone secretion (Jaszberenyi et al. 2000). Furthermore, administration of the selective OX2R antagonist abolished OXA induced plasma ACTH release in rats, indicating that OX2R may have a role in a stress-induced ACTH release (Chang et al. 2007). Orexins might exert their effect on glucocorticoid secretion also without the intervention of the HPA-axis (Heinonen et al. 2008). Administration of OXA and OXB increased a basal corticosterone secretion in rat zona fasciculate and fona reticularis cells (Malendowicz et al. 1999). In another study, OXA increased cortisol, but also aldosterone secretion in cultured porcine adrenal cortex cells (Nanmoku et al. 2002). In rat or human dispersed or cultured adrenocortical, as well as adenomatous cells, OXA, but not OXB, dose dependently increased corticosterone or cortisol secretion (Mazzocchi et al. 2001b, Spinazzi et al. 2005, Ziolkowska et al. 2005). Administration of OXA in a human adrenocortical cell 40 line H295R increased production of enzymes associated in cortisol production (Wenzel et al. 2009). S.c. injections of both orexins, with OXA as a more potent stimulator, elevated corticosterone, but not aldosterone plasma levels in rats (Malendowicz et al. 1999). A one week systemic administration of orexins increased both corticosterone and aldosterone levels in female rat plasma (Malendowicz et al. 2001). An i.c.v. injection of OXA elevated plasma epinephrine and norepinephrine levels, while OXB affected only norepinephrine secretion in conscious rats (Shirasaka et al. 1999). In human pheochromocytoma slices, the administration of OXA or OXB resulted in an increase of epinephrine and norepinephrine secretion (Mazzocchi et al. 2001a). Similarly, OXA increased the release of epinephrine and norepinephrine from cultured porcine adrenal medullary cells (Nanmoku et al. 2002). In contrast, OXA and OXB inhibited dopamine release in cultured rat pheochromocytoma PC12 cells via the cAMP/protein kinase A pathway (Nanmoku et al. 2000). Recently, using carbon-fiber amperometry, OXA was shown to stimulate catecholamine release from cultured rat chromaffin cells and mouse adrenal medullary slices mainly through OX1R (Chen et al. 2008). However, orexins did not have any effect on catecholamine release in human adrenal slices (Mazzocchi et al. 2001b). 2.2.9 Cardiovascular effects of orexins Johren et al. detected PPO mRNA in rat heart (Johren et al. 2001). No expression of orexin receptors, however, was detected. Samson et al. provided the first evidence that orexins affect cardiovascular functions (Samson et al. 1999). An i.c.v. injection of OXA and OXB increased dose dependently mean arterial pressure (MAP) in conscious rats. Another study showed that an i.c.v. injection of both orexins dose dependently elevated MAP, as well as heart rate (HR) in conscious rats, OXA being more efficant than OXB (Shirasaka et al. 1999). In addition, plasma levels of norepinephrine rose after the administration of a high 3.0 nmol concentration of OXA or OXB, while only OXA affected plasma epinephrine levels in conscious rats. Similarly, intracisternal injections of both orexins at various doses and microinjection of OXA into rostral ventrolateral medulla resulted in increased MAP and HR in urethan-anesthetized rats (Shirasaka et al. 1999). Furthermore, a local administration of OXA into a nucleus tractus solitarius (NTS) increased blood pressure (BP) and HR (Smith et al. 2002). The rats were anesthetized with urethane. Using the same injection site, 41 de Oliveira et al. demonstrated a decrease in MAP and HR after an injection of a smaller dose of OXA in α-chloralose or urethane-anesthetized rats (de Oliveira et al. 2003). And again, Ciriello et al. demonstrated that a microinjection of OXA into the rostal ventromedial medulla led to an increase only in HR, but not in MAP in sodium pentobarbital anaesthetized rats (Ciriello et al. 2003). Interestingly, an i.c.v. injection of OXA (0.003 pmol) decreased renal sympathetic nerve activity (RSNA) and BP, while a higher dose of OXA (0.003 nmol) increased both RSNA and BP in urethane-anesthetized rats (Tanida et al. 2006). Similarly, a 0.5–500 fmol administration of OXA in a rat subfornical organ decreased the HR and BP in urethane-anaesthetised rats (Smith et al. 2007). Taken together, the differences observed in the effects of orexins on the cardiovascular tone might be related to the different injection sites and dosages used (Ciriello et al. 2003, de Oliveira et al. 2003, Tanida et al. 2006, Smith et al. 2007). OX-KO mice show lowered basal arterial pressure (Kayaba et al. 2003). Thus orexins might contribute to a maintaining of basal blood pressure. The effects of peripherally injected orexins on the cardiovascular system are less prominent. A low dose of i.v. administered OXA (0.003 nmol) decreased, and a high dose (0.3 nmol) significantly increased RSNA and BP in urethane- anesthetized rats (Tanida et al. 2006). In contrast, an i.v. injection of OXA or OXB (11 nmol/kg) did not affect MAP or HR in urethane-anesthetized rats (Chen et al. 2000). Similarly, an i.v. injection of OXA (100 pmol) did not alter the arterial pressure, HR or RSNA in conscious rabbits (Matsumura et al. 2001). 2.2.10 Orexins and their receptors in adipose tissue In the past few years, some reports have indicated a role for orexins also in adipose tissue. Digby et al. demonstrated the presence of OX1R and OX2R at the mRNA level in human adipose tissue and in isolated human s.c. and omental adipocytes, as well as at the protein level in s.c. and omental adipose tissue lysates and tissue sections (Digby et al. 2006). The authors demonstrated also that after an administration of OXA or OXB (100 nM, 24 h) into s.c. adipocyte explants, the mRNA levels of peroxisome proliferator-activated receptors (PPAR) -2 in samples were significantly increased. The orphan nuclear hormone receptor PPAR affects adipogenesis expressions of adipocytes-specific genes (Kintscher & Law 2005). Thus, it was speculated that orexins might have an important function in adipocyte metabolism (Digby et al. 2006). The tracing of the retrograde neuronal tracer pseudorabies virus (PRV) in OX–GFP mice revealed a 42 PRV infection of OX–GFP neurons in the LHA after the injection of virus into the right epididymal fat pat, indicating that these neurons form a circuit to integrate epididymal adipose sympathetic outflow (Stanley et al. 2010). This data suggests that orexin and MCH neurons in the LHA project into the adipose tissue polysynaptically. OX1R mRNA has been detected also in the BAT of ob/ob mice (Haynes et al. 2002). However, no other publications have shown the expression of orexins or orexin receptors in BAT. 2.2.11 Orexins and their receptors in gonads PPO and/or OX1R mRNA were detected in rat testis (Sakurai et al. 1998, Johren et al. 2001). RIAs for OXA and OXB have identified the presence of both peptides in rat testis (Mitsuma et al. 2000a, Mitsuma et al. 2000b). Barreiro et al. showed that OX1R, but not OX2R, mRNA is expressed especially in seminiferous tubules throughout postnatal development (Barreiro et al. 2004). Expression levels of PPO mRNA in the rat testis and OXA peptide in Leydig cells and spermatocytes were found to increase along with aging (Barreiro et al. 2005). In humans, the presence of OX1R and OX2R mRNA was demonstrated in the testis, epididymis, penis, and seminal vesicle (Karteris et al. 2004). In addition, using an immunofluorescence approach, both receptors were detected in Leydig cells, myoid cells of the seminiferous tubules and Sertoli cells. In testis, orexins have been speculated to play a role in several physiological functions, such as steroidogenesis, Sertoli cell gene expression and spermatogonial DNA synthesis (Karteris et al. 2004, Barreiro et al. 2005). However, further studies are required to fully understand the exact roles of orexins in the male reproductive tract. In the first study looking for orexins and their receptors in ovaries, only OX1R mRNA was detected in rats (Johren et al. 2001). Recently, both orexin receptors, however, have been detected in mRNA and the protein level in rat ovaries during the estrous cycle (Silveyra et al. 2007). The expression levels were increased during the proestrus afternoon. In addition, i.p. injection of SB-334867 and/or JNJ-10397049, a selective OX2R antagonist, decreased serum gonadotropin levels and ovulation. The expression of OX1R is affected by sex hormones in both male and female rats (Silveyra et al. 2009). 43 2.2.12 Distribution and function of orexins and their receptors in other tissues PPO mRNA, but not OXA was expressed in the human kidney, and the expression of OX1R mRNA was observed in the rat kidney (Johren et al. 2001, Nakabayashi et al. 2003). However, later it was shown that OXA protein, as well as both orexin receptors at both the mRNA and protein level, can be found in the human kidney (Takahashi et al. 2006). In addition, OXA-like immunoreactivity was detected in human urine. It was proposed that OXA may have a role as a mediator ensuring the proper function of the kidney. Plasma OXA levels are elevated in hemodialysis patients, suggesting that the kidney functions in the clearance of orexins (Sugimoto et al. 2002). PPO, as well as both orexin receptors, were detected in the Merkel cells in the skin of the porcine snout (Beiras- Fernandez et al. 2004). The authors raised a possibility for a role of the orexin system in sensation modulation (van den Pol 1999, Beiras-Fernandez et al. 2004). However, more studies need to be conducted in the future in this context (Beiras- Fernandez et al. 2004). OX2R mRNA has been detected also in the rat lung (Johren et al. 2001). 2.2.13 Orexins in the circulation OXA can be detected in mouse, rat and human plasma after solid phase extraction by immunoassays (Arihara et al. 2001, Ouedraogo et al. 2003, Surendran et al. 2003). In addition, serum and plasma levels of OXA are increased during fasting in rats and in humans (Komaki et al. 2001, Ouedraogo et al. 2003). In 0–18 year old humans, plasma OXA and OXB levels are at their highest in neonates and in children during puberty (Tomasik et al. 2004). In obese children, plasma OXA levels correlated negatively with BMI and increased during body weight loss (Bronsky et al. 2007). In adults, plasma OXA concentrations were significantly lower in obese and morbidly obese subjects when compared to healthy normal weight individuals (Adam et al. 2002). In addition, a negative correlation was observed between OXA plasma levels and BMI. Similarly, plasma OXA was significantly decreased in obese women with no difference in plasma OXB levels (Baranowska et al. 2005). In contrast, a weak positive correlation between BMI and plasma OXA levels was observed in morbidly obese patients before gastric banding surgery when compared with normal weighted subjects (Heinonen et al. 2005). No difference was observed in plasma OXA levels before and after the 44 operation. Differences in assay conditions, antibody and handling of the samples might account for these differences. For example, in the measurements from Adams et al., normal weighted individuals and overweighted individuals had almost the same levels of OXA in their plasma (Adam et al. 2002, Heinonen et al. 2005). Obese and morbidly obese subjects showed significantly lowered OXA levels compared with healthy normal weighted individuals. In spite of the observed negative correlatation with BMI, the overall changes in the OXA values were fairly modest (52–56 pg/ml). The first study investigating the plasma OXA levels in narcoleptic patients reported insignificant differences between patients and normal subjects (Dalal et al. 2001). However, Higuchi et al. demonstrated later reduced plasma OXA levels in narcoleptic patients (Higuchi et al. 2002). OXA, but not OXB, can cross the blood brain barrier by diffusion in mice (Kastin & Akerstrom 1999). In addition, orexins have been widely detected also in the periphery, for example in the intestine and testis (Arihara et al. 2001, Heinonen et al. 2008). However, despite the intensive research done in orexin field, the source of orexins present in the circulation is still unknown. 2.3 Sleep and arousal Sleep is a natural state of behaviour for all mammals and birds, which is characterized by a reduction in voluntary motor activity, a decreased reaction to external stimulation and stereotypic posture (Fuller et al. 2006). Conventionally, wakefulness is characterized by beta waves, which in the cortical EEG appear as desynchronized high-frequency and low-amplitude waves in the 14- to 30-Hz range. These waves are believed to represent the differences in the timing of processing regulatory functions of the brain, including cognitive, motor and perceptual functions. When eyes are closed, beta waves are replaced by 8- to 12- Hz alpha waves. Sleep itself may be divided into two phases, namely a slow wave sleep (SWS), or NREM sleep, and REM sleep. SWS is usually associated with reduced neuronal activity. In humans, SWS is divided in 4 different stages. During the first state, the EEG frequency slows and EEG oscillations center in the 4- to 7-Hz theta range. In this state, conscious awareness starts to decrease, while in stage 2 the awareness is completely gone. The EEG stage 2 is characterized by patterns of waveforms called “sleep spindles” and “K-complexes”. In deep sleep, which covers both the stages 3 and 4, EEG oscillations predominate in the 1–3 Hz. This is also known as slow-wave activity (SWA) in the EEG. The delta waves are 45 proposed to reflect synchronized oscillations of thalamocortical circuit activity. Delta waves or slow oscillations (0.5–1.0 Hz) originate from the neocortex. In sleep, the periods of SWS and REM are cyclical (McCarley 2007). All mammals and birds have REM sleep, although the birds show briefer bouts. In REM sleep, brains are working more actively, and in humans, this state is usually associated with dreams. Neuronal activity changes before the EEG signs of REM sleep can be observed. During REM sleep, the cortical EEG displays a high- frequency and low amplitude activity, which is similar to those seen in stage 1 sleep and wakefulness (Fuller et al. 2006, McCarley 2007). In addition, REM sleep is characterized with the presence of rapid eye movements and suppression of muscle tone. In humans, the first REM period is short and it usually begins about 70 minutes after falling asleep (McCarley 2007). From then on, the REM sleep cycles at about every 90 minutes, so that the duration of each REM spout is approximately 30 minutes. Depending on the size of the animal, REM sleep cycles show differences in duration. In mice, this cycle is about 7 minutes (Steiger 2002). Rodents show a typical hippocampal theta activity (4–8 Hz) in EEG for REM sleep (Fuller et al. 2006, McCarley 2007). Since the human hippocampus is located far from the scalp surface, EEG recordings do not usually detect hippocampal theta. Recently, Lu et al. proposed a model flip-flop switch controlling REM sleep (Fuller et al. 2006, Lu et al. 2006). The sublaterodorsal nucleus and precoeruleus area consist of REM-on cells, while ventrolateral periaqueductal grey matter and lateral pontine tegmentum form REM-off areas. These areas inhibit themselves with innervations of GABAergic neurons, and help in the producing of sharp transitions between REM and SWS sleep. Orexin neurons have been proposed to excite REM-off neurons, when they are active. In addition, the extended part of the VLPO, as well as the MCH, is believed to inhibit the REM-off area. REM-on cells project into the BF area and regulate EEG oscillatios, while sublaterodorsal nucleus projects to the medulla and spinal cord and controls atonia during REM sleep. The REM-on neurons are modulated by cholinergic neurons to make possible the initiation and coordination of REM sleep (McCarley 2007). Acetylcholine excites brainstem reticular formation neurons to produce the signs of REM. The REM-off neurons are modulated by noradrenergic and serotoninergic neurons by 5-HT and norepinephrine. Arousal is mediated through discrete neuronal populations which project to the thalamus and BF (Saper et al. 2001, Fuller et al. 2006). It is produced by a complicated system, including projecting cholinergic neurons, monoaminergic 46 neurons and LHA orexin neurons. The first branch of this “ascending reticular activating system” consists of cholinergic neurons in the pedunculopontine nuclei (PPT) and laterodorsal tegmental nuclei (LTD) located in the mesopontine tegmentum. These neurons fire rapidly during wakefulness and REM sleep, while they are almost silent during SWS, when cortical activity is slow. They send excitatory cholinergic projections to thalamocortical nucleus, and reticular nucleus, which act as a gatekeeper between the thalamus and cerebral cortex. BF contains cholinergic and noncholinergic neurons that project to the cortex and the thalamus, and play a role in waking and EEG desynchronization. A group of monoaminergic neurons project to the BF, cerebral cortex, thalamus, as well as to LHA, which contains orexin neurons (de Lecea et al. 1998, Sakurai et al. 1998, Saper et al. 2001). This system consists of the noradrenergic LC, histaminergic tuberomammillary neurons and the dopaminergic ventral periaqueductal grey matter, as well as the serotoninergic dorsal and median raphe nuclei (Fuller et al. 2006). Neurons in these areas fire actively during wakefulness and less during SWS, while they cease firing during REM. LHA have projections to the BF, the cerebral cortex and the brain stem, which also projects back. Orexin neurons are active during wakefulness and increase the firing rate of the TMN, the LC and the dorsal raphe (de Lecea et al. 1998, Sakurai et al. 1998, Saper et al. 2001). In contrast, neurons containing MCH probably inhibit the ascending monoaminergic system, and are active during REM sleep (Fuller et al. 2006). VLPO inhibits the monoaminergic and cholinergic nuclei in order to produce sleep (Sherin et al. 1996, Szymusiak et al. 1998, Lu et al. 2000a). This area consists of 2 sets of neurons (Fuller et al. 2006). The core neurons have projections to the TMN and the extended neurons to the LC and the dorsal, as well as raphe nucleus. Neurons in VLPO are active during sleep, and they have a proposed role in the initiation of SWS, as well as in SWS and REM sleep (Sherin et al. 1996, Szymusiak et al. 1998, Lu et al. 2000a). These neurons contain gamma-aminobutyric acid (GABA) and they are inhibited by noradrenaline and acetylcholine. VLPO and the arousal system interact via a mutually inhibitory flip-flop system (Saper et al. 2001). Since orexin neurons also receive input also from the GABAergic neurons of VLPO, and they are inhibited by GABA receptor agonists, it is possible that inhibitory GABAergic projections turn off orexin neurons (Yamanaka et al. 2003, Sakurai et al. 2005, Xie et al. 2006, Tsujino & Sakurai 2009). Orexins may also have a stabilizing role in maintaining the behavioural state by a “flip-flop” switch (Saper et al. 2001). It has been proposed 47 that orexin neurons might “press” the switch into the “wakeful” position, and prevent switching into the “sleep” position during wakefulness. Sleep and wakefulness are under homeostatic and circadian control (Fuller et al. 2006, McCarley 2007). Nowadays, it is a commonly accepted fact that the “sleep drive” results from a homeostatic pressure that increases due to prolonged wakefulness and is dissipated by sleep. Recent data indicates that the purine nucleoside adenosine has a role as a mediator of this homeostatic control of sleep. I.p. administration of adenosine analogs promote sleep and increase slow wave sleep in rats (Radulovacki et al. 1984). Caffeine, an adenosine antagonist, suppresses sleep in humans (Landolt et al. 1995). Porkka-Heiskanen et al. showed that extracellular adenosine concentration in the BF of cat increases both during spontaneous and prolonged wakefulness, while it decreases during sleep, especially in SWS (Porkka-Heiskanen et al. 1997). Adenosine mediates its sleep- inducing effects via the action of A1 and A2 adenosine receptors (McCarley 2007). Thakkar et al. showed that orexin neurons express adenosine A1 receptors (Thakkar et al. 2002). Adenosine might promote sleep by inhibiting LHA orexin neurons activity (Liu & Gao 2007). Furthermore, a blockade of A1Rs in the LHA by the local microinjection of the selective A1R antagonist DPX induces a significant increase in wakefulness, and a reduction in the following sleep, indicating that adenosine reduces the activity of orexin neurons (Thakkar et al. 2008). A perfusion of CGS21680, an adenosine A2A receptor agonist, into the ventral striatum of rats promotes sleep and diminishes orexin neuron activity (Satoh et al. 2006a). Interestingly, it was recently reported that rats with lesions of the LHA do not increase their adenosine levels in the BF with prolonged waking (Murillo-Rodriguez et al. 2008). It was speculated that adenosine in the BF is stimulated especially by the activity of orexin neurons in the LHA. In mammals, most of their physiological and behavioral events, including the sleep-wake cycle, follow daily oscillations, which are controlled by different environmental cues, a circadian timing system, and complex interactions between these two factors (Dibner et al. 2010). The circadian timing system consists of a central pacemaker in the SCN and circadian clocks in other areas of the brain, as well as in peripheral tissues and organs. The SCN circadian clock needs environmental cues or zeitgebers for synchronization. These include the important photic stimuli, light, or non-photic cues, such as manipulation of arousal or locomotor activity (Mrosovsky 1996, Mistlberger & Skene 2005). Photic information activates the retinohypothalamic tract, while nonphotic stimuli use the geniculohypothalamic tract, as well as the dorsal raphe nucleus and median 48 raphe nucleus (MRN) (Dibner et al. 2010). Circadian rhythms normally follow a 24 h cycle, but in the absence of these stimuli, they will differ slightly from this cycle. A SCN ablation in rats leads to the elimination of sleep-wake rhythm with no change in the total amount of sleep (Mistlberger et al. 1987). However, studies from Edgar et al. revealed that SCN-lesioned squirrel monkeys exhibit eliminated sleep-wake and sleep stage rhythms, but also increased total sleep time (Edgar et al. 1993). Similarly, SCN-lesioned C57Bl/6j mice showed an increased amount of NREM sleep (Easton et al. 2004). However, using SCN-ablated balb/c mice, no differences were found in the total amount of SWS or REM sleep, when compared with control mice (Ibuka et al. 1980). The observed differences between these two studies might relate to different strains (Mistlberger 2005). PPO peptide or OXA immunoreactivite fibres were detected around the SCN in rats or the Syrian and the Siberian hamster (Peyron et al. 1998, McGranaghan & Piggins 2001). OX1R is present in the rat SCN (Backberg et al. 2002). OXA and/or OXB caused either an excitatory or inhibitory response in the rodents’ SCN cells and/or brain slices in vitro (Farkas et al. 2002, Brown et al. 2008, Klisch et al. 2009). In addition, OXA is able to elicit phase advances and/or delays in cultured SCN primary cells as well as organotypic in brain slices (Klisch et al. 2009). Orexin fluctuations measured from the rat CSF lose their rhythm in consequence of SCN ablation, suggesting the control of SCN in orexins release (Zhang et al. 2004). Mice exposed to a 6 h dark pulse stimulus during subjective day show orexin neuronal activation in the medial and the lateral hypothalamus, as well as the activation of neurons in the MRN (Marston et al. 2008). In contrast, the pulse suppressed SCN activity. These results suggest that activation of OXA neurons might reset the SCN circadian clock via a MRN route. Recent results suggest that orexin neurons have a role in the circadian suppression of REM sleep (Kantor et al. 2009). 2.4 Thermoregulation in mammals Thermogenesis is a process in which an organism produces heat (Morrison et al. 2008). Commonly, the inefficiency of mitochondrial ATP production and utilization results in thermogenesis, and it occurs in almost all living tissues. Basal metabolic rate (BMR) describes the minimal cost of living and it can be measured in adult animals when they are in a postabsorptive state, and rest in a thermoneutral environment (Hulbert & Else 2004). Usually, it is measured as the rate of oxygen consumption. However, normally animals need to regulate their 49 body temperature due to the challenge of low ambient temperature (Nedergaard et al. 2007, Morrison et al. 2008). This regulatory thermogenesis includes the CNS network’s stimulated increase in heart rate, shivering thermogenesis occurring in skeletal muscle, and non-shivering thermogenesis by mitochondrial oxidation occurring in BAT. In rodents, but not in adult humans, cold exposure stimulates the secretion of thyroid-stimulating hormone, leading to increased heat production (Leppaluoto et al. 2005). In addition, exercise and feeding can also increase heat production, and thus compensate the shivering and non-shivering thermogenesis in cold (Fogelholm & Kukkonen-Harjula 2000, Nedergaard et al. 2007, Morrison et al. 2008). Contractive activity of the skeletal muscles produces heat as a byproduct (Morrison et al. 2008). Voluntary muscle contractions originate from the CNS, from which the nerve impulses through α-motoneurons innervate muscle fibers. Of note, regular physical activity associates with successful weight management. In the muscle, the heat produced comes from the additional energy of ATP (Morrison et al. 2008). In the lack of voluntary physical activity, however, other mechanisms may also take part in heat production. A thermoneutral zone is a range of environmental temperature where warm- blooded mammals do not need to produce any extra heat to cover their heat loss (Cannon & Nedergaard 2004). In naked humans, and in most experimental animals such as mice, this temperature is near +30 °C. Rodents show a nearly two- to fourfold increase in their oxygen consumption after an acute or chronic cold exposure to +4 °C (Lowell & Spiegelman 2000, Cannon & Nedergaard 2004). In acute cold, the heat produced is mainly due to shivering (Cannon & Nedergaard 2004). In cold, the core body temperature falls down resulting in repeated fast skeletal muscles contractions, shivering (Morrison et al. 2008). As in voluntary muscle contractions, the increase in α-motoneuron activity initiates the shivering. In experimental rodents moved from their thermoneutral zone to approximately +20 °C, shivering-derived thermogenesis interchanges almost completely with brown fat-derived thermogenesis in about 4 weeks (Cannon & Nedergaard 2004). Of note, during the interchange, characteristics of muscle training can also be seen. It is commonly accepted that the non-shivering thermogenesis occurs in BAT via uncoupling protein 1 (UCP1) mediated heat production. BAT is innervated by sympathetic nerves. A norepinephrine signaling through ß3-receptors follows activation of lipases, which stimulate lipolysis of 50 triglyceride droplets. The increased levels of free fatty acids activate UCP1 and initiate the heat production. Feeding increases the metabolic rate, while fasting decreases it (Lowell & Spiegelman 2000). In addition, the content of food influences greatly in diet- induced thermogenesis (Westerterp-Plantenga 2008). A protein rich diet seems to induce a greater thermic response than for that of a high-fat diet. 2.4.1 Uncoupling proteins Uncoupling proteins (UCPs) are located in the inner mitochondrial membrane (Cannon & Nedergaard 2004). UCP1 is able to bypass or uncouple the oxidative phosphorylation pathway by dissipating the proton gradient as a form of heat. It is exclusively expressed in BAT, mediating the cold-induced non-shivering thermogenesis in rodents. UCP1 knockout mice are cold-sensitive, indicating the importance of UCP1 in cold-induced thermogenesis (Enerback et al. 1997). In addition, UCP1 KO mice of C57BL/6J genetic background show a resistance to diet-induced obesity (Liu et al. 2003). This resistance was temperature dependent. However, recently it was shown that the defect of UCP induces obesity in C57BL/6 mice kept at thermoneutrality (Feldmann et al. 2009). Thus, it is evidenced that only UCP1 can mediate diet-induced adrenergic thermogenesis. In humans, the presence of BAT was originally postulated to exist only in infants and young children (Hany et al. 2002, Cohade et al. 2003a, Cohade et al. 2003b, Yeung et al. 2003, Nedergaard et al. 2007). However, results from combined positron-emission tomography and computed tomography (PET-CT) demonstrated a high rate of uptake of 18F-fluorodeoxyglucose (18F-FDG) in BAT, thus identifying the existence of BAT in adult humans. The amount of BAT is inversely correlated with BMI and age, thus indicating the importance of human BAT in energy metabolism (Cypess et al. 2009, Zingaretti et al. 2009). The presence of UCP1 in human adipose tissue samples from a region extending from the anterior neck to the thorax identified by PET-CT, and perithyroid adipose tissue confirmed the existence of metabolically active BAT in humans. Thus, BAT UCP1 acts as the main effector of non-shivering thermogenesis in rodents and possible also in humans (Cannon & Nedergaard 2004, Cypess et al. 2009, Zingaretti et al. 2009). UCP1 is involved in diet-induced adaptive thermogenesis (Cannon & Nedergaard 2004). Administration of leptin stimulates the production BAT UCP1 mRNA (Scarpace et al. 1997, Cusin et al. 1998, Satoh et al. 1998). On the 51 contrary, fasting for 2 days decreases the UCP1 mRNA levels in rat BAT and refeeding increases the levels rapidly (Champigny & Ricquier 1990). Of note, mRNA levels of the other UCPs, namely UCP2 and UCP3, in muscle are increased during starvation (Gong et al. 1997, Cadenas et al. 1999). Also four other UCPs have been identified (Borecky et al. 2001). Human UCP2 and UCP3 have about a 70% homology to each other, and show 59% and 57% amino-acid identity to UCP1, respectively (Boss et al. 1997b, Fleury et al. 1997, Gimeno et al. 1997, Gong et al. 1997, Vidal-Puig et al. 1997). The two remaining UCPs, UCP4 and UCP5, or brain mitochondrial carrier protein 1 (BMCP1), can also be found from mammals (Sanchis et al. 1998, Mao et al. 1999, Yu et al. 2000, Borecky et al. 2001). However, UCP4 and UCP5 show only a low degree of homology to the other UCPs. Therefore it could be speculated whether these two proteins even belong to the same phylogenetic tree together with the first three UCPs (Borecky et al. 2001). The roles of other UCPs, except UCP1, in heat production are unclear (Nedergaard & Cannon 2003, Cannon et al. 2006, Jia et al. 2009). UCP2 mRNA is widely expressed in different organs, and the protein can be detected in tissues such as pancreatic islets, stomach, spleen and WAT (Fleury et al. 1997, Pecqueur et al. 2001). The amount of UCP2 mRNA in different tissues might not reflect the total amount of UCP2 protein (Pecqueur et al. 2001). Even though the spleen and stomach mitochondrias contain approximately the same amount of UCP2 mRNA, they show a difference of 10 times in their protein levels. In addition, the UCP1 protein level in BAT mitochondria is about 160 times higher compared with the amount of UCP2 protein in spleen mitochondria. It should also be noted that UCP2 protein is absent in BAT of UCP1 KO mice, despite the increase in UCP2 mRNA levels (Enerback et al. 1997, Pecqueur et al. 2001). Cold exposure at +4Cº for 10 days did not affect UCP2 mRNA levels in BAT, WAT, thigh muscle or liver in Swiss mice (Fleury et al. 1997). However, UCP2 mRNA levels in WAT were elevated in C57Ksj mice exposured to +4Cº for 24 h (Masaki et al. 2000). Furthermore, another study shows an increased expression of UCP2 mRNA in BAT, heart and soleus muscle in rats cold exposured at +6Cº for 48 h (Boss et al. 1997a). UCP2 or UCP3 knockout mice are not obese or cold-sensitive, suggesting that these proteins do not possess a function in cold or diet-induced thermogenesis (Arsenijevic et al. 2000, Vidal-Puig et al. 2000). In contrast, mice overexpressing UCP2 are leaner when compared with their wt littermates (Horvath et al. 2003). In addition, transgenic mice overexpressing UCP2 in orexin neurons (Hcrt-UCP2), have an elevated hypothalamic temperature that results in a reduction in core 52 body temperature (Conti et al. 2006). Furthermore, atherosclerotic plaques and mammalian macrophages overexpressing UCP2 showed increased heat production (van De Parre et al. 2008). Both UCP2 and UCP3 have been proposed to act as mitochondrial uncouplers (Jaburek et al. 1999). However, measurements of proton conductance in a yeast heterologous expression system showed that high UCP2 protein expression might cause non-specific uncoupling (Stuart et al. 2001). The observed overexpression artifact is due to mitochondrial membrane damage and is not related to UCP2 protein activity itself. Several studies have proposed a role for UCP2, as well as for UCP3, in resting metabolic rate, fat metabolism and obesity in humans (Bouchard et al. 1997, Walder et al. 1998, Jia et al. 2009, Salopuro et al. 2009, Srivastava et al. 2010). UCP1 acts as a mediator of adaptive nonadrenergic nonshivering thermogenesis (Golozoubova et al. 2006). Recently it was shown that cold- acclimated UCP1 KO mice increase their oxygen consumption in general, and also in inguinal fat pads, indicating UCP1 independent thermogenesis in WAT (Ukropec et al. 2006). White adipocytes have the ability to transdifferentiate into brown adipocytes under cold stress. Due to the defective function of UCP1 in UCP1 KO mice, the sympathetic outflow might be overdriven, causing nonadaptive thermogenesis (Golozoubova et al. 2006, Ukropec et al. 2006). Even though the amount of mitochondria in WAT is lower than in BAT, some recent studies demonstrate that some obesity-related genes have an important function in WAT mitochondria (Semple et al. 2004, Dahlman et al. 2006). The possible role of UCP3 in thermogenesis is also under debate. UCP3 mRNA is expressed in BAT and muscle (Boss et al. 1997b, Gong et al. 1997, Vidal-Puig et al. 1997). Even though mice overexpressing UCP3 show reduced weight gain, this effect has been proven to be an artifact (Cadenas et al. 2002, Horvath et al. 2003). Interestingly, wt mice treated with MDMA (3,4- methylenedioxymethamphetamine), or better known as ecstasy, show significantly increased rectal and muscle temperatures, when compared with UCP3 KO mice (Mills et al. 2003). However, the authors did not study the uncoupling effects of ecstacy. Hamsters lacking UCP3 in brown adipose tissue show a reduced cold tolerance limit, indicating the importance of the protein in brown adipose tissue metabolism (Nau et al. 2008). Both UCP2 and UCP3 possess other potential actions, in addition to their possible role in energy metabolism (Echtay 2007, Bouillaud 2009). These include functions such as cell protection against reactive oxygen species, mediation of 53 insulin secretion, and regulation of fatty acid metabolism. However, more studies will be required for a proper evaluation of the functions of these proteins. Previous studies have demonstrated that the effects of OXA on core body temperature are independent of UCP1 (Yoshimichi et al. 2001, Russell et al. 2002). A third cerebroventricle infusion of OXA increased body temperature in a dose-responsive manner in rats (Yoshimichi et al. 2001). UCP3 mRNA levels in muscle were significantly increased, while no difference was observed in BAT UCP1 or WAT UCP2 mRNA levels. Similarly, no difference was observed in BAT UCP1 levels after a chronic intraparaventricular infusion of OXA in rats (Russell et al. 2002). Interestingly, an i.c.v. infusion of SB-334867 elevated significantly BAT temperature in rats in addition to raised UCP1 levels (Verty et al. 2010). The authors suggested that orexins are involved in the maintenance of body weight through elevated food intake and affect thermogenesis. 2.5 Duodenal bicarbonate secretion 2.5.1 Gastroduodenal defense GIT is continuously exposed to several intrinsic and/or extrinsic factors that arise from different chemical, physical or biological sources (Flemstrom & Isenberg 2001). These factors include acid produced by gastric parietal cells, pepsin, bile acid and noxious agents, such as ethanol and nonsteroidal anti-inflammatory drugs, as well as Helicobacter pylori (Flemstrom & Isenberg 2001, Binder 2005, Ganong 2005). However, the GI-tract is endowed with multiple distinct protective mechanisms against possible factors of injury (Flemstrom & Isenberg 2001, Binder 2005). Gastroduodenal mucosal defense is divided into three elements, namely the pre-epithelial, epithelial, and subepithelial. The pre-epithelial element consists of a mucus HCO3 layer. In addition, the epithelial cells are connected to each other with intercellular tight junctions. Moreover, the subepithelial element covers different factors such as blood flow, cytokines and acid/base transporters. Together these components form an effective defense system against possible mucosal injuries. The gastric and duodenal mucosa is covered by an adherent mucus-gel layer (Flemstrom & Isenberg 2001). In the stomach, this layer is firm and continuous, while in the duodenum, it is thinner and patchy (Allen & Flemstrom 2005). Mucus is secreted by neck cells of the gastric glands and surface mucosal cells 54 (Ganong 2005). In addition, the mucus-gel layer is made up of mucin (glycoproteins), phospholipids, electrolytes and water (Binder 2005). The two main mechanisms to stimulate mucus secretion are acetylcholine induced vagal stimulation and the physical as well as chemical effects of ingested food. In addition, mucus secretion is stimulated by prostaglandins (Ganong 2005). The presence of acid in the lumen results in the stimulation of both gastric and duodenal HCO3 secretion (Allen & Flemstrom 2005). Together, the mucus-gel layer and the HCO3 secreted by mucosal cells form the mucosal barrier. The stable mucus-gel layer is important in the surface neutralization of the gastric acid and forms a physical barrier against pepsin. The mucosal HCO3 secretion has a remarkable role in neutralizing the acid diffusing into the mucus-gel layer. Furthermore, the role of HCO3 secretion becomes important in maintaining a near-neutral pH gradient between the surfaces of mucus and the mucosa. 2.5.2 Duodenal bicarbonate secretion The duodenum spontaneously secretes HCO3 at steady basal rates, and this secretory action likely involves the release of endogenous prostaglandins and ENS activity (Smedfors & Johansson 1986, Flemstrom et al. 2010). The entry of gastric acid into the duodenum induces HCO3 secretion from the mucosal surface enterocytes (Flemstrom & Isenberg 2001, Allen & Flemstrom 2005). The secretion has a role as a primary defense mechanism against the acid discharged from the stomach. Importantly, the duodenal mucosal HCO3 secretion occurs at very high rates (per unit surface area) when compared to that observed in the stomach. In addition, HCO3 is secreted to the small intestine also from the pancreas and the liver (Flemstrom & Isenberg 2001, Binder 2005). The hormone secretin is released from S cells in the duodenum in response to gastric acid load (Flemstrom & Isenberg 2001, Binder 2005, Ganong 2005). This triggers both pancreatic and the bile duct HCO3 secretion. Secretin has no effect on duodenal HCO3 secretion (Flemstrom & Isenberg 2001). The mucus pH gradient forms an effective barrier against H+ (Flemstrom & Isenberg 2001). Acid sensitive neural receptors or cell filaments pierce thought the mucus-gel layer to sense the luminal pH. Holm et al. suggested that CO2 may have a role as a messenger mediating the effect between the introcuded luminal acid and the following secretory response (Holm et al. 1998). Several different pathways that mediate the response to acid have been identified (Allen & Flemstrom 2005). Numerous studies have proved prostaglandins to be important 55 stimulators in the local control of duodenal HCO3 secretion (Flemstrom 1980, Flemstrom & Nylander 1981, Isenberg et al. 1986, Takeuchi et al. 1997, Takeuchi et al. 1999). Both duodenal prostaglandin E receptor subtypes, EP3 and EP4, seem to be involved in the duodenal HCO3 response (Takeuchi et al. 1997, Takeuchi et al. 1999, Aoi et al. 2004). In addition, neurotransmitters such as vasoactive intestinal peptide (VIP) and acetylcholine, among many others, have also been identified to act as mediators of the neural response (Allen & Flemstrom 2005). The influence of the CNS on duodenal HCO3 secretion has been widely studied (Allen & Flemstrom 2005). Sham feeding stimulated duodenal HCO3 secretion in humans (Ballesteros et al. 1991). In addition, duodenal HCO3 secretion is stimulated via vagal nerves or with a close-intra-arterial administration, a procedure that minimizes the central nervous actions of the cholinergic agonist bethanechol (Jonson et al. 1986, Ballesteros et al. 1991, Flemstrom et al. 2003). The effects of different neuropeptides from the CNS on duodenal secretion are also well demonstrated (Flemstrom & Jedstedt 1989, Lenz 1989, Allen & Flemstrom 2005). Hypothalamic CRF released during stress stimulates duodenal bicarbonate secretion (Lenz 1989). In addition, an i.c.v. infusion of thyrotropin-releasing hormone (TRH), bombesin, gastrin-releasing peptide, or CRF increased bicarbonate secretion in anesthetized or freely moving rats (Flemstrom & Jedstedt 1989, Lenz et al. 1989). An i.c.v. administration of benzodiazepines or alpha 1-selective adrenoceptor agonist, phenylephrine, leads also to the stimulation of HCO3 secretion in anesthetized rats, while the alpha 2- adrenoceptor agonist, clonidine, decreased the secretion (Safsten et al. 1991, Larson et al. 1996). Duodenal HCO3 secretion is also affected by a variety of peripherally acting agents (Allen & Flemstrom 2005). Duodenal luminal acid stimulates 5-HT release from mouse duodenal mucosa (Smith et al. 2006). Administration of 5-HT on the serosal side of stripped mouse mucosal tissue lead to stimulation of HCO3 secretion (Tuo & Isenberg 2003). Similarly, in situ close intra-arterial infusion of 5-HT stimulated duodenal HCO3 secretion in anaesthetized fed or overnight fasted rats (Safsten et al. 2006). In addition, acid or 5-HT stimulated response in duodenal HCO3 secretion was abolished by the 5-HT4 receptor antagonist SB 204070 (Safsten et al. 2006, Smith et al. 2006). Tetrodotoxin or the muscarinic receptor antagonist, atropine, reduced 5-HT induced secretion in animals, indicating that the stimulation by 5-HT is mainly mediated via a cholinergic neural pathway (Tuo & Isenberg 2003, Tuo et al. 2004, Smith et al. 2006). 5-HT 56 is suggested to act also directly upon the 5-HT4 receptors of duodenocytes (Smith et al. 2006). Melatonin is released, in addition from the pineal gland, also from the enterochromaffin cells of the intestinal epithelium (Vakkuri et al. 1985, Allen & Flemstrom 2005). In addition, as compared with CNS production, it is produced in huge amounts in the intestine (Allen & Flemstrom 2005). Melatonin increased duodenal HCO3 secretion when administered by a close intra-arterial infusion in anaesthetized rats (Sjoblom et al. 2001). The secretion response was inhibited by the i.v. injection of MT2-receptor antagonist luzindole. An i.c.v. infused adrenoceptor agonist, phenylephrine, induced secretion which was also diminished by the luzindole. Since melatonin induced clear calcium signaling in rat and human duodenal enterocytes, free from enteric neurons, melatonin may have an effect directly on enterocyte membrane receptors (Sjoblom et al. 2003). The nicotinic receptor antagonist, hexamethonium affected luminal melatonin stimulated secretion decreasingly (Sjoblom & Flemstrom 2003). Both intra-artelial and luminal administration of guanylin or uroguanylin dose-dependently stimulated duodenal HCO3 secretion in anaesthetized rats (Bengtsson et al. 2007). It was speculated that the response to luminal guanylins was mediated via a direct action on apical membrane-bound guanylyl cyclase C, and the intra-arterial stimulus was affected by the cholinergic system with the interaction of mucosal melatonin from enteroendocrine cells. In addition, luminally added Escherichia coli heat-stable enterotoxin, which binds the same receptor as guanylins, induced the stimulation of HCO3 in female rat duodenal preparation (Guba et al. 1996). Other peripherally acting agents are also potent stimuli of duodenal secretion, such as glucagon, CCK-8 and many more (Flemstrom et al. 1999, Sjoblom et al. 2003, Allen & Flemstrom 2005). A close intra-arterial infusion of OXA resulted in a significant and dose-dependent increase of duodenal HCO3 secretion in fed anesthetized rats (Flemstrom et al. 2003). However, OXA was without an effect in overnight food deprived (16 h) rats, suggesting that the presence of different nutrients in the intestinal lumen causes the stimulation of orexin receptors’ expression. Duodenal mucosal HCO3 secretion is inhibited with several agents or mechanisms (Lenz 1989). An i.c.v. administration of CRF and a physical strain, a stress stimulus, stimulated duodenal HCO3 secretion in rats. In addition, patients with duodenal ulcer disease show increased plasma levels of noradrenalin (Allen & Flemstrom 2005). In patients with duodenal ulcer disease, the eradication of 57 Helicobacter pylori leads to normalization of proximal duodenal HCO3 secretion (Hogan et al. 1996). Furthermore, the administration of α-adrenoceptor ligands affects HCO3 secretion (Flemstrom & Isenberg 2001, Allen & Flemstrom 2005). Moreover, α2-Adrenoceptors, and neuropeptide Y1 receptors, inhibit mucosal HCO3 secretion via the action of sympathetic nervous system. 58 3 Aims of the study The aim of the study was to elucidate the roles of the orexin system in regard to its actions on sleep/wake patterns, energy homeostasis and intestinal HCO3 secretion. The specific aims were: 1. To create a novel mouse line overexpressing hPPO under its endogenous promoter in order to study the effects of orexins on sleep-wake patterns. This was important since no detailed analysis of sleep/wake patterns in endogenously orexin-overexpressing animal models had been done. 2. To study the effects of orexins on energy metabolism in hPPO tg mice. Since the orexins have been shown to affect heat production, and UCP1 is generally believed to mediate cold and diet induced thermogenesis, we further investigated the action of orexins and UCPs on heat production. 3. To study the effects of short overnight fasting on rat duodenal orexin receptors’ expression and OXA induced duodenal HCO3 secretion. 4. To complete the results of sub-investigation 3, we aimed to study the effects of short overnight fasting on orexin receptors’ expression in acutely isolated rat duodenal enterocytes, and OXA induced intracellular calcium signaling in rat and human acutely isolated duodenal enterocytes. 59 60 4 Materials and methods 4.1 Generation and characterization of hPPO overexpressing mice 4.1.1 Generation and basic characterization of the mice The isolated hPPO gene with its endogenous promoter was microinjected into the pronuclei of zygotes derived from Balb/c × DBA/2 (CD2) mice using standard techniques (Sakurai et al. 1999). Male adult (2–4 month-old) heterozygous CD2 transgenic (tg) mice and their wt littermates were used in this study, unless otherwise stated. If the number of mice in one litter was not large enough to fill study groups, age-matched mice from different litters were mixed together. Transgene analysis was made from tail or ear biopsies by PCR (5'-ATG TAA TGC CCT CTA TCC C-3', antisense primer 5'-CTA CTG TGC CTG ACC AAA C-3') and confirmed by Southern blotting. All mice were housed in cages under a controlled environment (temperature 20 ± 1 °C, humidity 40–60%, lights on between 07:00 a.m. - 07:00 p.m.). Mice were given free access to tap water and fed ad libitum with Lactamin R36 standard chow diet (4% fat, 18.5% protein, 55.7% carbohydrates, and 3.5% fibers; calories from protein 24.4%, calories from fat 14.8%, calories from carbohydrate 60.6%; Lactamin AB, Södertälje, Sweden) or with 2018 Teklad Global 18% Protein Rodent Diet (18.6% of crude protein, 6.2% of fat [ether extract] 3.5% of crude fiber; calories from protein 24%, calories from fat 18%, calories from carbohydrate 58%; Harlan Laboratories, Indianapolis, Indiana, USA) unless otherwise stated. The diets did not contain any animal protein or fish meal. The main fat source in the diets was soybean oil. The experiments were approved by the Institutional Animal Care and Use Committee of the University of Kuopio and by the Provincial Government. The procedures were conducted in accordance with the guidelines set by the European Community Council Directives 86/609/EEC. Southern blotting To confirm the PCR results and to identify the tg mice bearing the hPPO transgene, genomic DNA from tail biopsies was isolated, digested with EcoRI, separated on a 0.8% agarose gel and transferred to a nylon membrane (Nylon Membranes, positively charged; Roche Diagnostics GmbH, Mannheim, 61 Germany). Blots were air-dried and DNA was crosslinked using UV light. Hybridization was performed with a randomly primed 32P-labelled hPPO gene probe (Ready-To-Go DNA Labelling beads; GE Healthcare, Little Chalfont, UK) using ULTRAhyb® Ultrasensitive Hybridization Buffer (Ambion®; Applied Biosystems INC, Foster City, CA, USA) according to the manufacturer's specifications and scanned with a Typhoon 9410 imaging system (GE Healthcare). Western blotting Tissues from overnight fasted (16 h) mice were homogenized and lysed for 30 min with a solubilizing solution [25 mM tris (pH 7.4), 0.1 mM EDTA, 1 mM dithiothreitol (DTT), 15µl/ml protease inhibitor cocktail (Sigma, St Louis, MO, USA)] on ice. For the analysis of UCPs and PPARs expression in the peripheral tissues or orexin receptors’ expression in the brains, the mice were allowed to eat freely. The extracts were cleared by centrifugation (15000 × g, 15 min, +4 °C). Protein concentrations were determined using the Bradford method (Bio-Rad protein assay; Bio-Rad Laboratories GmbH, Munich, Germany). A total of 40 μg protein per lane from the hypothalamus, pancreas, duodenum, and spleen was electrophoresed on a 10% Tricine-SDS-PAGE gel (for OXA) or on a 12.5% SDS- polyacrylamide gel (for OX1R and OX2R), and then electrophoretically transferred to a nitrocellulose membrane [Bio-Rad, Trans-Blot® Transfer Medium, Pure Nitrocellulose Membrane (0.2 μm); Bio-Rad Laboratories, Hercules, CA, USA] (Schagger 2006). OXA Western blot was performed using a commercial kit [orexin-A (Human, Mouse, Rat) Western Blot Kit, WBK-003-30; Phoenix Pharmaceuticals, Burlingame, CA, USA]. Synthetic orexin A peptide (0.2 μg, human, bovine, rat, mouse, SC1337; NeoMPS, Strasbourg, France) was used in this study as a positive control. After blocking overnight at +4 °C in 1 × TBS Tween 20 (pH 7.6) with 5% BSA, membranes were incubated with orexin- A/hypocretin-1 (human, rat, mouse, bovine; WBK-003-30; Phoenix Pharmaceuticals) primary antibody (1:1000, at +4 °C overnight), and finally incubated with the horseradish peroxidase-conjugated secondary antibody (1:10000, 1 h at room temperature). In the orexin receptors’ western blots, the blotting was done overnight at +4 °C in 1 × TBS Tween 20 (pH 7.6) with 5% low- fat milk-powder. The incubation with OX1R and OX2R antibody (1:1000 anti- rat/human orexin 1, cat no. OX1R11-A, anti-rat orexin 2, cat no. OX2R21-A, Alpha Diagnostic International, San Antonio, TX) was performed overnight at +4 °C. Since the antigens used to produce OX1R and OX2R antibodies were 100% 62 and 94% homologous, respectively, to mouse orexin receptors, a high crossreactivity was expected. Membranes were then washed and incubated with a secondary antibody [1:10000, Zymax goat anti-rabbit IgG(H+L) horseradish peroxidase conjugate, Zymed, San Francisco, CA] for 1 h. Afterwards, both OXA and orexin receptors’ blots were washed and chemiluminescence detected either with the ECL developing reagent included in the kit for OXA (Orexin A (Human, Mouse, Rat) Western Blot Kit, WBK-003-30, Phoenix Pharmaceuticals, Inc., CA, USA), or with ECL Plus for orexin receptors (GE Healthcare, Amersham, UK) according to the manufacturer's instructions. Blots were visualized with a Typhoon 9400 Imager (GE Healthcare, UK). Immunohistochemistry Overnight fasted mice were anaesthetized and perfused with 4% paraformaldehyde in 0.1 mM PBS (pH 7.4). The brains were removed and post- fixed for 12 h. Tissues were sectioned at 20 μm with a vibratome, and processed for immunohistochemistry. Sections were washed in PBS, incubated with 0.5% NaBH4 in PBS and washed three times with PBS for 45 min. The sections were incubated for 1 h with blocking solution containing 5% normal donkey serum in PBST (0.5% Triton X-100 in PBS) and treated with goat polyclonal orexin-A antibody, which detects total OXA from humans, mice and rats [orexin-A (C-19): sc-8070, goat polyclonal IgG; Santa Cruz Biotechnology®, Santa Cruz, CA, USA] at a dilution of 1:500. Before adding the secondary antibody, the sections were washed for 45 min in PBS. Primary antibody binding was detected by 1 h incubation with Cy3-labelled donkey anti-goat antibody (1:600, Cy-3-conjugated donkey anti goat; Jackson ImmunoResearch, West Grove, PA, USA). After 45 min of additional washing in PBS, sections were covered with cover slips. The slides were observed under a confocal microscope for red fluorescence. RIA for orexin, leptin and ghrelin Blood was collected from the tail vein of anesthetized overnight fasted mice (~200 µl) into the heparinized capillary tubes or from vena cava inferior (~500 µl) into the syringe with a needle containing 20 µl of 0.5 M EDTA. Heparinized blood was centrifuged (12.500 rpm, 2 min, +4ºC); the plasma was decanted and stored at −70 °C. Plasma OXA levels were measured after solid phase extraction with a mouse orexin RIA kit (Orexin A (Human, Rat, Mouse), RIA Kit, 100% 63 cross-reactivity with mouse orexin-A, Phoenix Pharmaceuticals, Inc., CA, USA). For OXA assay, plasmas from 5 tg or 5 wt mice were pooled together. Plasma leptin and ghrelin levels were determined with RIAs (Ghrelin (Rat, Mouse) – RIA Kit, RK-031-31, Phoenix Pharmaceuticals, Inc., CA, USA and Linco Mouse Leptin RIA, ML-82K, Millipore, MA, USA). Plasma cholesterol and triglyceride levels Blood samples were taken from the tail vein of overnight fasted mice, and total plasma cholesterol and triglyseride levels were determined using the Ecoline S+: Cholesterol 12 × 25 ml and Ecoline S+: Triglycerides 12 × 25 ml according to the manufacturer’s (VWR International, PA, USA) instructions. Glucose tolerance test 1.5 month and 5 month old mice (5 tg + 5 wt) fasted overnight (16 h) were given an intraperitoneal injection of glucose (2 mg/g body weight). Blood samples for both glucose and insulin analysis were collected from the tail vein at different time points (0, 10, 20, 60 and 120 min for glucose and 0, 20, 60 and 120 min for insulin) and plasma glucose was measured with an automated clinical analyzer (EPOS 5060, Eppendorf, Hamburg, Germany). Plasma insulin was measured using the ELISA kit (Crystal Chem Inc., IL, USA) according to the manufacturer’s instructions. Quantitative real-time PCR Overnight fasted or fed mice were killed by cervical dislocation between 7:00– 10:00 a.m. Mice were fasted for the analysis of mouse endogenous PPO (mmPPO) and hPPO. For other analyses, the mice were given free access to their food. Tissues were collected from the following organs: hypothalamus, cortex, hippocampus, BF, pancreas, duodenum, muscle, BAT, WAT and spleen. Tissues were treated immediately with RNAlater (Qiagen, Hilden, Germany) or snap frozen into liquid nitrogen, and stored for further analysis. Total RNA was extracted with the RNAeasy kit (Qiagen). Genomic DNA was digested by treatment with Dnase I (Qiagen). cDNA was synthesized from 1 μg of RNA using either the ThermoScript RT-PCR System for First-Strand cDNA Synthesis (Invitrogen, Carlsbad, CA, USA) with random hexamers as primers or iScript 64 cDNA Synthesis Kit (Bio-Rad Laboratories) with both oligo(dt) and random hexamers as primers. hPPO, as well as mmPPO, OX1R and OX2R, mRNA levels were measured using commercial assays (Taqman® Gene Expression Assays, Applied Biosystems INC) following the manufacturer´s instructions. Reactions, in total volume of 30 μL, contained 1 × TaqMan® Universal PCR Master Mix (Applied Biosystems INC), 20 ng (for OX1R and OX2R) and 100 ng (for hPPO), and 50 ng (for mmPPO) of sample and 1 × of primers mix. All samples were normalized to eukaryotic 18s rRNA (Taqman Pre-Developed Assay Reagents Eukaryotic 18 s rRNA). Specific primers were designed with the eprimer3 program or taken from the literature (Schmittgen & Zakrajsek 2000, Huang et al. 2006). Reactions contained 2 µl of sample (6–40 ng of cDNA), 1 × SYBR Green master mix (Applied Biosystems INC) and forward and reverse primers (15 pmol of forward primer and 30 pmol of reverse primer for UCP1, 15 pmol of both UCP2 primers, 7.5 pmol of both UCP3 primers and 6 pmol of both 18s primers). All samples were done as duplicates in the following conditions: 2 min at 50 °C and 10 min at 95 °C followed by 40–42 cycles of 15 s at 95 °C and 1 min at 62 °C. Each assay included a relative standard curve of three serial dilutions of cDNA from wt mouse and no template controls. The cycle threshold (Ct) values below 35 were considered as positive and the others negative. The results were calculated according to the manufacturer's descriptions (ABI PRISM 7700 or ABI PRISM 7300 Sequence Detection System; Applied Biosystems INC). The samples from the hPPO run were loaded afterwards into 1.0% agarose gel (in 1 × TBE [Tris-borate buffer]) and visualized with ethidiumbromide staining. Table 1. Primers used in quantitative real-time PCR for characterization of hPPO tg mice. Gene Forward Reverse Eukaryotic 18s rRNA GTAACCCGTTGAACCCCATT CCATCCAATCGGTAGTAGCG Mouse PPAR AGTGACCTGGCGCTCTTCAT CGCAGAATGGTGTCCTGGAT Mouse PPAR CGCTGATGCACTGCCTATGA AGAGGTCCACAGAGCTGATTCC Mouse UCP1 GGCCAGGCTTCCAGTACCATTAG GTTTCCGAGAGAGGCAGGTGTTTC Mouse UCP2 TGGTGGTGGTCGGAGATA GAGGTTGGCTTTCAGGAGAG Mouse UCP3 CCAGGGAGGAAGGAGTCA GGAAGTTGTCAGTAAACAGGTG 65 4.1.2 Surgery for polysomnography All procedures were approved by the University of Helsinki Ethical Committee for Animal Experiments and by the Regional Committee of the State Provincial Office and performed according to applicable national and EU legislation (the European Community Council Directives 86/609/EEC). Two to three-month-old male mice were group housed on a 12 h light/dark cycle (lights on at 08:30 a.m., intensity 100–150 lx at the level of the cages) at constant temperature +22 ± 1 °C. The cage floor was covered with wood chips, and paper shreds were given to the mice for nesting material. Mice were given standard rodent pellets and water ad libitum. 3- to 4-weeks before operation, mice were allowed to adapt to their new conditions. During the period the mice were familiarized with the experimenter to avoid stress. The protocol for mouse sleep recording was adapted from Stenberg et al. (Stenberg et al. 2003). Mice were anaesthetized using ~1 mg kg−1 medetomidine ,®Domitor®, Orion Oyj, Espoo, Finland) and 75 mg kg−1 ketamine (Ketalar) Pfizer AB, Sollentuna, Sweden) administered as an i.p.. Lidocain (Orion Oyj) was used as a local anaesthetic. The mice were implanted with two gold-plated miniature skull screw electrodes for unilateral bipolar electroencephalographic (EEG) recording. The frontoparietal electrodes were placed 1 mm rostral and 1 mm lateral to the bregma, and 2 mm rostral and 2 mm lateral to the lambda. A third screw for fixation to the skull was placed on the contralateral side. For electromyographic recording, two Teflon-coated silver wires ( = 0.0055 inches; A-M Systems, Carlsberg, WA, USA) were implanted into the neck musculature. All electrodes were connected to a miniature connector, which was fixed to the bared skull with cyanoacrylate glue and then embedded with dental cement. This construct allowed the recording of mice for months. After the surgery mice (wt, n = 11, tg, n = 8) were single housed in clear plastic Macrolon boxes (length 26 cm, width 20 cm, height 39 cm) with an opening on top allowing the connection and movement of EEG/EMG leads as well as video recording. Mice were allowed to recover from the operation at least for one week. 4.1.3 EEG/EMG and video recording Flexible lightweight recording leads were counterbalanced with a weight on a string, supported by roller-bearing pulleys, and attached to the connector. The system allowed using the simultaneous and continuous recording of eight mice 66 for 3–4 weeks. The EEG/EMG signals were amplified (gain 5 K for EEG and 1 K for EMG) in a 16-channel AC amplifier (A-M Systems), analogically filtered (high pass: 1 Hz for EEG and 10 Hz for EMG, low pass: 30 Hz for both, notch filters to avoid mains power 50 Hz artefacts), digitized (241.5 Hz for EEG and 72.6 for EMG) with a 1401 unit (Cambridge Electronic Devices, Cambridge, UK), monitored online during the experiments and saved on a computer using the Spike2 software (version 6.07; Cambridge Electronic Devices) for further off-line analysis. The age of the mice during the recordings was 5–7 months. In addition to polysomnography, the behavior of the mice was continuously followed with standard infrared surveillance miniature video cameras using Digital Video Surveillance System version 8.0.0 (GeoVision Inc., Buckinghamshire, UK) throughout the third and fourth recording weeks. To exclude the possibility that orexin-overexpressing mice had symptoms of narcolepsy such as cataplexy, as has been reported for OX-KO mice with a disrupted orexin system (Mochizuki et al. 2004), the video recordings were inspected together with the EMG/EEG recordings of the sleep deprivation (SD) periods, the handling periods of the Murine Multiple Sleep Latency Test (MMSLT) and a part of the natural activity period of the mice after lights off (20:30–00:00 h). The mice exhibited no signs of sudden attacks of inactivity or loss of muscle tone together with prominent EEG theta activity. Experimental design To allow the mice enough time for habituation to their new conditions, the final experiments were performed only during the last two weeks of recording. A schematic presentation of the experimental schedule is shown in Figure 3A. 67 Fig. 3. Experimental schedule and Murine Multiple Sleep Latency Test (MMSLT). A) Experimental schedule. Mice were housed in a 12 h light–dark cycle with lights on at 08:30 hours. After a 24 h baseline recording of EEG/EMG, mice were sleep deprived with a gentle handling method for 6 h, after which they were allowed 18 h of undisturbed recovery sleep. The MMSLT protocol was performed for a minimum 2 days after SD (sleep deprivation). Sleep latencies were first measured in baseline conditions, and 1 day later at the same circadian time points after 6 h of SD. B) MMSLT. Sleep latencies (seconds to first sleep episode) were repeatedly measured during four consecutive 20 min nap opportunities separated by 10 min handling periods. During the handling periods, the mice were kept awake as in SD by introducing novel objects into their cages. I, published by permission of Acta Physiol (Oxf.) SD was performed in order to study sleep homeostasis, a process in which prolonged waking results in a consequent recovery sleep characterized by increased duration, and intensity of slow wave sleep (SWS) (Borbely 1982). SD increases sleep propensity and it leads to an increase in the amount, consolidation (as measured by brief awakenings) and intensity [as defined by increased SWS EEG delta (1–4 Hz power)] of the subsequent SWS. Also, the amount of REM sleep is increased due to SD. After a 24 h baseline (BL) recording, the mice were sleep deprived for 6 h starting at light onset (08:30 a.m.). SD was performed by using a gentle handling method consisting of an introduction of new bedding material and wooden blocks into the mice cages (Huber et al. 2000). If the mice appeared sleepy or slow waves were visible in the EEG, the objects were replaced and/or the cage was gently tapped. To avoid stress, touching of the mice was avoided. At the end of SD, foreign objects were removed from the cage and the mice were allowed to have an undisturbed recovery sleep for the next 18 h. Data 68 from the SD day were normalized to corresponding time points of the baseline day within each individual animal before calculating group means, in order to minimize circadian factors and to reduce the inter-individual variation in the homeostatic sleep response. The MMSLT was used to measure sleep propensity/sleepiness during BL and after 6 h SD. The MMSLT was performed no less than 2 days after the initial SD. The protocol was adjusted from a publication by Veasey et al. and described in detail in Figure 3b (Veasey et al. 2004). Sleep latencies were measured during four consecutive 20 min nap opportunities, which were each separated by 10 min handling periods (as in SD) during BL conditions and following 6 h of SD. Vigilance state scoring and EEG power spectra EEG/EMG recordings of the 24 h baseline period, the SD day (24 h) and the MMSLT treatment periods (2 h 10 min) were visually scored into three vigilance states: wake, SWS and REM sleep in 30 s sliding windows divided into 2 s epochs using the Spike2 script Sleepscore v1.01 (Cambridge Electronic Devices). Sleep consolidation was quantified from data divided into 2 s epochs in order to automatically count brief awakenings from SWS (waking episodes between 2 and 12 s). Brief awakenings were approved as a count only when both muscle activation in the EMG and a clear arousal (desynchronization/amplitude decrease) in the EEG was observed. Vigilance states were scored according to standard criteria: waking as low amplitude, high frequency EEG with high voltage EMG; SWS as high amplitude EEG associated with low voltage EMG and the presence of slow delta (1–4 Hz) oscillations in the EEG; REM sleep as low amplitude, high frequency EEG with the absence of EMG and presence of prominent EEG theta (5–9 Hz) oscillations. Epochs with mixed states or artefacts were marked and excluded from further analysis. The scores and the EEG/EMG recordings were further processed in MatLab (The MathWorks, Natic, MA, USA). Brief awakenings were counted as wake bouts of 2–12 s in between SWS bouts (MatLab). EEG power spectra in 1 Hz frequency bins were generated for each scored epoch using a Fast Fourier transformation routine. EEG power spectra are shown for each vigilance state separately. From the scored data, the percentage of time spent in each vigilance state and their mean bout duration (in seconds) was calculated. To investigate sleep continuity or fragmentation, the number of wake transitions either from SWS or REM was calculated. Data are shown as group mean (±SEM), analysed 69 in 1 h time bins and organized into time periods of different lengths (1, 6, 12 or 24 h) for the BL day and the SD day (08:30 a.m. – 08:30 p.m., the 12 h light period, 08:30 p.m. – 08:30 a.m., the 12 h dark period). 4.1.4 Physiological and behavioral analysis of the hPPO mice Growth Tg and wt mice were weighed the same day every week, starting from weaning (4 weeks old) until they were 21 weeks old. The groups (n = 6) were combined from two separate litters. Physiological and behavioural analysis of the mice in room temperature or under acute cold exposure Mice were housed in singular cages with bedding inside. Metabolic performance, home cage activity, and drinking and feeding behavior of the 8 tg + 8 wt mice over 24 h was measured with an automated metabolic analyzing system for small animals (TSE Systems GmbH, Bad Homburg, Germany). With this system, 8 mice could be measured simultaneously. The data was measured continuously for 3–4 days in a room with a 12–12 h light/dark cycle (lights on between 7:00 a.m. – 7:00 p.m.). The general conditions for the experiments done at room temperature were as follows: temperature +20 ± 1 °C, humidity 40–60%, lights on between 07:00 a.m. – 07:00 p.m. For the acute cold (+4ºC) exposure studies, the cages were placed in a climate chamber, where 3 mice could be measured simultaneously. All mice were given free access to tap water and fed ad libitum. Mice were killed immediately after 4 days of cold exposure (between 8:00 – 10:00 am) and the tissues were collected and either treated with RNA later (Qiagen) or snap frozen in liquid nitrogen. Temperature telemetry Mice (n = 4) were implanted with temperature transmitters (PhysioTel® TA-F20 Mouse Transmitter, Data Sciences International (DSI), St. Paul, MN, U.S.A.) in the abdominal cavity. Two weeks after the operation, the mice were transferred to individual cages and allowed to adjust to their new environment for a week. A 70 telemetry system for recording body temperature was used for continuous recordings for 3 days. Body temperature was collected for 20 seconds at 5 minutes intervals. The data were collected, stored, and analyzed by using Dataquest A.R.T. software (Data Sciences International, DSI, St. Paul, MN, USA). Data analysis and statistics All values are shown as a group (wt or tg) mean ± SEM. Statistical analyses for EEG/EMG and video recordings were performed with SigmaStat 3.1 (SPSS Science Software, Chicago, IL, USA). Otherwise the GraphPad Prism 4 (GraphPad Software, San Diego, CA, USA) was used. When two groups were compared, we used two-tailed, unpaired Student's t-test. For analysis of circadian distribution of vigilance states or frequencies in power spectra, we used two-way repeated-measures anova (independent Factor A: genotype; dependent Factor B: time or frequency) with Holm-Sidak as a post hoc test. In case the data were not normally distributed, equivalent nonparametric statistical tests were used (two- way repeated-measures anova on Ranks, with Dunn's test as a post hoc). p < 0.05 was considered significant; n represents the number of animals used per group. For analysis of metabolic performance, home cage activity, drinking and feeding behavior and core body temperature, we used Two Way Repeated Measures of ANOVA with Bonferroni as a post hoc test. p < 0.05 was considered significant; n represents the number of animals used per group. 4.2 Effects of food deprivation on duodenal mucosal bicarbonate secretion and orexin receptors’ expression in rat duodenal mucosa and in acutely isolated duodenal enterocytes 4.2.1 Chemicals and drugs Atropine sulfate, bethanechol (carbamyl-methylcholine chloride), OXA (human, bovine, rat), prostaglandin E2, thyrotropin-releasing hormone (TRH), the anesthetic 5-ethyl-5-(1'-methyl-propyl)-2-thiobarbiturate (Inactin), carbachol (carbamylcholine chloride), collagenase type H, Dulbecco's modified Eagle's medium with Ham’s nutrient mixture F-12 (DME-F12), and gentamicin were purchased from Sigma-Aldrich (St. Louis, MO). The OX1R antagonist SB- 334867 [1-(2-methylbenzoxanzol-6-yl)-3-[1,5]naphthyridin-4-yl-urea hydrochloride] 71 and the OX2R agonist (Ala11,D-Leu15)-orexin-B were obtained from Tocris Bioscience (Ellisville, MO). Membrane filters (polycarbonate, diameter 25 mm, thickness 25 µm, 3 × 106 pores/cm2, pore diameter 3 µm) were obtained from Osmonics, Livermore, CA. Dispase II was purchased from Boehringer-Mannheim (Mannheim, Germany) and Pluronic F-127 and the fura 2 calibration imaging kit (F-6774) were from Molecular Probes. Fura 2-AM was obtained from Calbiochem (La Jolla, CA), and fetal calf serum (Svanocolone, FBS Super) was from The National Veterinary Institute (Håtunaholm, Sweden). Atropine sulfate was dissolved in isotonic saline and stored in stock solution protected from light at +4 °C for a maximum of 4 days. OXA was stored at −20 °C in stock solution containing 0.5 mg/ml bovine serum albumin. SB-334867 was dissolved in isotonic saline and stored at –20 °C for a maximum of 6 days. Prostaglandin E2 was added as a small amount from an ethanol stock solution stored at –20 °C. 4.2.2 Animal preparation Male F1-hybrids of Lewis × Dark Agouti rats (230–280 g, 7–9 wk old; Animal Department, Biomedical Center, Uppsala, Sweden) were group-housed in standard Macrolon cages (59 × 38 × 20 cm) containing wood-chip bedding material. The animals were kept under standardized temperature and humidity conditions (+20 °C ± 1 and 50 ± 10%, respectively) on a 12-h light-dark cycle. All rats had free access to water and, unless deprived of food overnight (16 h), free access to food pellets (Labfor, Kimstad, Sweden). All experiments were approved by the Uppsala Ethics Committee for Experiments with Animals. The rats were anesthetized at 9 a.m. with an i.p. injection of Inactin (120 mg/kg body weight). The anesthetic was given by the person who had previously handled the animals, thus minimizing any post-operative stress. Rats were tracheotomized and they were placed on a heating pad to maintain their body temperature between +37–38 °C. The temperature was controlled by a rectal thermistor probe. The surgical and experimental protocols were adapted from protocols fully described previously (Flemstrom et al. 1982, Flemstrom et al. 1999, Sjoblom et al. 2001). The protocol with some modifications is described briefly here. A femoral artery and vein were catheterized by installation of PE-50 polyethylene catheters (Becton-Dickinson, Franklin Lakes, NJ). The arterial catheter, containing 20 IU/ml heparin isotonic saline, was connected to a transducer operating a PowerLab system (AD Instruments, Hastings, UK) to measure continuously the mean arterial blood pressure. Ringer-bicarbonate 72 + − + 2+ solution (Na 145, Cl 124, K 2.5, Ca 0.75, and HCO3 25 mM) was infused through the vein at a rate of 1.0 ml/h to compensate for fluid loss and to minimize changes in body acid-base balance during experiments. 40 µl arterial blood samples were taken at the start and the end of all experiments for measurements of acid-base status by a blood gas-analyzer (AVL Compact 3, Graz, Austria). The vein was also used for i.v. administration of atropine. The abdomen was carefully opened by a midline incision. The common bile duct was catheterized with PE-10 polyethylene tubing (Becton-Dickinson) in order to avoid bile and pancreatic secretions into the intestine. For measurement of duodenal mucosal HCO3 secretion, a 12-mm segment of duodenum, together with its complete blood supply, starting at 10 mm distal to the pylorus, thus without the effect of Brunner's glands, was cannulated in situ between two glass tubes connected to a reservoir (Study III, Fig. 1). The glass tubes were entered through two precise and small antemesenterial incisions, made with an electrical high-temperature cautery loop tip (Bovie/Aaron Medical, St. Petersburg, FL), thus avoiding any major damage of the duodenal wall. 10 ml of isotonic saline fluid was maintained at +37 °C by a water jacket and rapidly circulated by a gas lift of 100% nitrogen. HCO3 secretion into the luminal perfusate was continuously titrated with 50 mM HCl at pH 7.4 using an automated pH stat system (Radiometer, Copenhagen, Denmark). After the operation and cannulation of the hepatic artery, the abdomen was closed with sutures. The rat was allowed to rest for 1 h in order to stabilize cardiovascular, respiratory, and gastrointestinal functions. 4.2.3 Intra-arterial infusions to the duodenum In this study, OXA was administered to the duodenum by a close intra-arterial infusion, a technique allowing the use of very small amounts of the substance, thus minimizing any effect of the CNS (Sjoblom et al. 2001). A cannula was placed in the hepatic artery, 3–4 mm proximal to its entrance into the liver. The perfusion was done in the retrograde direction at a rate of 17 µl/min. Thus, the perfusate was mainly distributed to the duodenum (via the cranial pancreaticoduodenal artery) and the pancreas. The distribution of the perfusate to the duodenal segment was verified visually at the start of each experiment by intra-arterial injection of Ringer solution (<0.1 ml). The solution changed briefly the brightness of the segment, thus verifying the proper installation of the cannula. 73 4.2.4 I.c.v. infusions A metal cannula was implanted into the right cerebral ventricle of a rat brain using a stereotaxic instrument (model 900, Kopf Instruments, Tujunga, CA). A right parietal bone was exposed by a skin incision and a 1-mm hole was drilled through the bone, 0.8 mm posterior to the bregma and 1.5 mm lateral to the midsagittal suture. The cannula was fixed to the skull by dental cement (Fuji type II, GC, Tokyo, Japan). All drugs infused were dissolved in the artificial cerebrospinal fluid (in mM: 151.5 Na+, 3.0 K+, 1.2 Ca2+, 0.8 Mg2+, 132.8 Cl−, 25 HCO3 , and 0.5 phosphate; pH 7.4). The fluid was infused through the cannula at a rate of 30 µl/h. The cannula placement within the cerebral ventricle space was verified after the end of each experiment by adding Evans blue solution to the infusate and then dissecting the brain. 4.2.5 Isolation of duodenal enterocytes The protocol for isolation of clusters of duodenal enterocytes has been described earlier by Sjöblom et al. and used elsewhere (Sjoblom et al. 2003, Safsten et al. 2006). Rats were euthanized at about 09:30 a.m.. A ~3-cm-long segment of the duodenum, starting 2–3 mm distal to the pylorus, was preparated via an abdominal midline incision. The segment was separated from mesenteric tissue and opened along the antemesenterial axis. The luminal content was rinsed off from the surface with a normal respiratory medium (NRM) solution (in mM: + + 2+ 2+ − 2 114.4 Na , 5.4 K , 1.0 Ca , 1.2 Mg , 121.8 Cl , 1.2 SO4 , 6.0 phosphate, 15.0 HEPES, 1.0 pyruvate, and 10.0 glucose, plus 10 mg/l phenol red, 0.1 mg/ml gentamicin, and 2.0% fetal calf serum). The pH was adjusted to 7.4 immediately before use and the temperature was maintained at +37 °C. The segment was mounted on a precleaned glass slide (luminal side facing up) and the mucosa was gently scraped off. The scraping procedure was adapted from Sjoblom et al. (Sjoblom et al. 2003). The duodenal remnant was evaluated by morphological examination, and cells originating from submucosal Brunner's glands were excluded from the preparations. The scraped-off mucosa was cut into small pieces of 0.3–0.8 mm in diameter. The pieces were then scattered and briefly shaken in NRM solution with 0.5 mM DTT. After 2–3 min sedimentation, the supernatant was removed and the tissue fragments remaining in the sediment were washed three times in DTT-free NRM solution. The tissue fragments were gassed with 100% O2 and portions (15–20 µl) were digested for 2–3 min by inoculation in 10 74 ml NRM solution containing 0.1 mg/ml collagenase type H and 0.1 mg/ml dispase II. After digestion at +37 °C in a horizontal shaking water bath, the reaction was quenched by adding DTT to a final concentration of 0.3 mM. The solution was centrifuged for 3 min at 1000 × g. The resulting pellet was washed three times by suspension in 10 ml DMEM/F-12 with 15 mM HEPES and 2.5 mM glutamine (3 min at 1000 × g). In addition, DMEM/F-12 always included HCO3 (1 mM), gentamicin (0.01 mg/ml), and fetal calf serum (2.0%). In addition, the pH of the solutions were adjusted to 7.40. Finally, the resulting pellet was suspended in ~1 ml of DMEM/F-12 and put on ice. Cooling of the sample increases the viability of the enterocyte clusters (Sjoblom et al. 2003). The viability of the enterocytes was tested by Trypan blue. The final sample included clusters of interconnected duodenal enterocytes as well as a few single cells. The majority of the cluster cells showed morphological characteristics typical of crypt cells (Chew et al. 1998). In the present experiments, submucosal tissue was not included. In addition, no enteric neurons were detected under a visual inspection with light microscopy, and fluorescence microscopy with fura 2-AM, a substance staining the enteric neurons, loaded preparations. Clusters of 10–50 interconnected cells were chosen for further imaging analysis and up to 50 enterocytes were selected (caged) prior to administration of orexin receptor ligands or atropine. Calcium signaling of each caged enterocyte was saved to a computer and analyzed at the end of experiments. 4.2.6 Human biopsies and preparation of enterocytes Human duodenal biopsy samples were obtained from patients undergoing upper endoscopy at the Gastroenterology Unit, Uppsala University Hospital and they showed endoscopically normal duodenal and gastric mucosa. The patients did not eat any food in the morning before the endoscopy. Biopsy samples were taken between 09:00–10:00 a.m. with a single-use biopsy forceps (Boston Scientific, Natick, MA) and were immediately placed into 20 ml of sterile DMEM/F-12 medium (15 mM HEPES, L-glutamine, and 1 mM HCO3 , 2.0% fetal calf serum and 0.01 mg/ml gentamicin) and transported to the laboratory. The samples were cut into fine pieces at room temperature within 20–40 min after removal. Clusters of duodenal enterocytes were prepared and the Trypan blue exclusion test of cell viability was used as described above. The project was approved by the Ethics Committee of the Medical Faculty at Uppsala University, and all subjects provided written, informed consent. 75 4.2.7 Calcium imaging 70 µl of the cell cluster suspension was loaded with fura 2-AM (2 µM) for 20–30 min in an electrolyte solution (in mM: 141.2 Na+; 5.4 K+; 1.0 Ca2+; 1.2 Mg2+; 146.4 Cl−; 0.4 phosphate; 20.0 TES and 10.0 glucose; pH 7.40). The loading took place at +37 °C. This solution had been previously used for studies of cell aggregates (Shariatmadari et al. 2001, Sjoblom et al. 2003). Probenecid (1 mM), pluronic F-127 (0.02%), and fetal calf serum (2.0%) were also included in the loading procedure. The suspension was gently centrifuged and the resultant concentrated pool of clusters was placed on an uncoated and precleaned circular glass coverslip (diameter 25 mm; Knittel, Braunschweig, Germany) at the bottom of a temperature-controlled (+37 °C) perfusion chamber. The coverslip was covered by a uniformly sized pore polycarbonate membrane filter. The covering filter and the cell preparation were superfused (1 ml/min) with the electrolyte solution and receptor ligands to be tested by inclusion in the perfusate. Calibration of the fluorescence data was performed in vitro according to the method introduced by Grynkiewicz et al. (Grynkiewicz et al. 1985). The fluorescence ratio calibration curve was made using the fura 2 calcium imaging 2+ calibration kit (F-6774; Molecular Probes, Eugene, OR). Changes in [Ca ]i in the fura 2-AM-loaded cells were measured by the dual-wavelength excitation ratio technique by exposure to alternating 340- and 380-nm light with the use of a filter changer under the control of an InCytIM-2 system (Intracellular Imaging, Cincinnati, OH) and a diachronic mirror (DM430; Nikon, Tokyo, Japan). Emission was measured through a 510-nm barrier filter with an integrating charge-coupled device camera (Cohu, San Diego, CA), and measurements were 2+ performed 30 times per minute. The relative increase in [Ca ]i was expressed as the ratio of the fluorescence intensity at 340 nm to that at 380 nm (340 nm/380 2+ nm) and converted to [Ca ]i. 4.2.8 Quantitative real-time PCR Continuously fed and overnight-fasted rats were killed by decapitation between 9:00 and 10:00 a.m.. A 10–15 mm segment of duodenum, starting 5 mm distal to the pylorus was promptly excised via an abdominal midline incision and freed from mesentery. The segment was then opened along the antemesenterial axis, mounted as a sheet and cut into 2-mm-thick slices. Slices were treated with RNAlater for pending analysis (Qiagen, Hilden, Germany). In contrast, clusters of 76 enterocytes devoid of duodenal submucosa were promptly frozen in liquid nitrogen and then kept at −78 °C before further experiments. The extraction of total RNA and the digestion of genomic DNA was done like previously described. cDNA was synthesized from 1 µg RNA by using the TaqMan reverse transcription reagents (Applied Biosystems INC) with random hexamers as primers. Specific primers (Table 2) for orexin receptors, rat β-actin mRNA (for duodenal slices) and 18s rRNA endogenous control (for clusters of enterocytes) were designed with the eprimer3 program or taken from the literature (Schmittgen & Zakrajsek 2000, Beck et al. 2001). Primers were synthesized either at the A. I. Virtanen Institute, Kuopio, Finland, or at the TAG Copenhagen A/S, Denmark. PCR reactions were performed with the ABI-PRISM 7700 or ABI PRISM 7300 sequence detection system (Applied Biosystems) in total volume of 30 µl. Reactions contained a 2-µl sample (400 ng), 1× SYBRgreen master mix (Applied Biosystems) and forward and reverse primers (15 pmol forward and 30 pmol reverse for OX1 primers, 15 pmol of both OX2 primers and 6 pmol of both rat β- actin primers or 5pmol of both 18s primers). All samples were done as duplicates in the following conditions: 2 min at 50 °C and 10 min at 95 °C, followed by 42 cycles of 15 s at 95 °C and 1 min at 62 °C. Each assay included a relative standard curve of three serial dilutions of cDNA from fasted rats and no template controls. The cycle threshold (Ct) values below 35 were considered as positive and the others negative. Results were calculated according to the manufacturer's descriptions (ABI PRISM 7700 or ABI PRISM 7300 Sequence Detection System, Applied Biosystems). Table 2. Primers used in quantitative real-time PCR for analysis of orexin receptors. Gene Forward Reverse Eukaryotic 18s rRNA GTAACCCGTTGAACCCCATT CCATCCAATCGGTAGTAGCG Rat β-actin CAACCGTGAAAAGATGACCCAGA ACGACCAGAGGCATACAGGGAC Rat OX1R GCGCGATTATCTCTATCCGAA AAGGCTATGAGAAACACGGCC Rat OX2R GGAGTGCCATCTTCACTCCTG GATTCCATAAGGATGCTCGGG 4.2.9 Western blotting Samples of duodenal mucosa from four fed and four overnight-fasted rats were homogenized in 60 µl of solubilizing solution [25 mM Tris pH 7.4, 0.1 mM EDTA, 1 mM DTT, 15µl/ml protease inhibitor cocktail (Sigma-Aldrich, St. Louis, MO)] by sonication at +4 °C for 15 min. After centrifugation (12,500 rpm, 15 min, 77 +4 °C), total protein concentrations were measured by the Bradford method (Bio- Rad protein assay, Bio-Rad Laboratories, Munich, Germany). Equal amounts of protein (100 µg protein/lane) were electrophoresed on a 12.5% SDS- polyacrylamide gel and then transferred to a nitrocellulose membrane [Bio-Rad, Trans-Blot transfer medium, Pure Nitrocellulose Membrane (0.2 µm), Bio-Rad Laboratories, CA]. Blocking was done with 5% nonfat milk powder in TBS containing 0.01% Tween 20 at room temperature for 1 h. Incubation with OX1 antibody (1:1000, anti-rat/human orexin 1, cat no. OX1R11-A, Alpha Diagnostic International, San Antonio, TX, USA) was performed overnight at +4 °C. β-Actin antibody (1:2000, no. 4967, Cell Signaling Technology, Danvers, MA) was used as a loading control. Membranes were then washed and incubated with a secondary antibody [1:10000, Zymax goat anti-rabbit IgG(H+L) horseradish peroxidase conjugate, Zymed, San Francisco, CA] for 1 h. Afterward, blots were washed and chemiluminescence detected with an ECL Plus (GE Healthcare, Amersham, UK) according to the manufacturer's instructions. Detection was made with the Typhoon 9400 Imager (GE Healthcare) and band densities were analyzed with the ImageQuant TL program (GE Healthcare). 4.2.10 Data analyses The descriptive statistics are expressed as ratio of proportions and a 95% confidence interval for categorical data and otherwise as means ± SE, except for quantitative real-time PCR, where results are expressed as ± SEM. Rates of alkaline secretion by the duodenum are expressed as microequivalents of base ( HCO3 ) per centimeter of intestine per hour. The secretion and the mean arterial blood pressure were recorded continuously and registered at 10-min intervals. The statistical significance of data was tested by repeated-measures ANOVA. To test the difference within a group, a one-factor repeated-measure ANOVA was used, followed by Tukey's multiple comparison post hoc test. Between groups, comparison was made by two-factor repeated-measures ANOVA, followed by a one-way ANOVA at each time point. If the ANOVA was significant at a given time point, a Tukey's multiple comparison post hoc analysis was used. When appropriate, the statistical significance of data was calculated and tested by Fisher's exact test. Linear trend between doses was tested by the 2 test for trend. 2+ Some cells spontaneously increase [Ca ]i during the experimental period, probably reflecting the presence of cell-to-cell signaling within the cluster preparations. The figures display the ratio of proportions between orexin- 78 responding cells and spontaneously responding controls. A ratio larger than 1, indicated by a dashed line in figures, thus indicates the OXA-induced stimulation of calcium signaling. Orexin receptor expression data between groups were compared by the Student's nonpaired t-test. p values of <0.05 were considered significant. All statistical analyses were performed on an IBM-compatible computer using GraphPad Prism 4.0 (GraphPad Software, San Diego, CA). 79 80 5 Results 5.1 Generation and characterization of hPPO overexpressing mouse line Analysis of the offspring by genomic PCR and Southern blot analysis of tail DNAs digested with EcoRI and hybridized with a cDNA corresponding to the hPPO gene identified two potential founders. The mouse line UKU351F was chosen for further studies for its higher hPPO transgene expression levels. The tg mice were viable and fertile. Southern blot analysis confirmed the integration of the hPPO transgene in the mouse genome (Figure 4A). The transgene was transmitted to all founders in a Mendelian fashion. Those offspring that did not inherit the transgene were considered as wt littermates and used in our studies as control animals. Transgene expression was analysed by quantitative real-time PCR. Transgene expression was observed in the hypothalamus (Figure 4B), duodenum and pancreas (data not shown) with the highest expression in the hypothalamus (Figure 4C). The cycle threshold (Ct) values for hPPO in tg mice hypothalamus samples were between 26.84–27.63. The transgene was not detected in any of the tissues of the wt mice. In addition, hPPO transgene expression did not affect endogenous mouse PPO levels in tg mice (data not shown). 81 Fig. 4. A) The genomic Southern blot analysis of the hPPO gene in tg and wt mice. Analysis showed that tg mice have one integration site for hPPO genes in the genome while nothing was detected in wt mice. B) Quantitative real-time analysis of hPPO in the hypothalamus. The samples were run on 1.0% agarose gel. hPPO is expressed in the hypothalamus (third lane) of tg mice. No expression was detected in the no template control (Ntc, second lane) or wt mice hypothalamus (fourth lane). C) Human/mouse OXA Western blot analysis in the hypothalami of tg and wt mice. Tg mice showed a remarkably increased amount of OXA in the hypothalamus while nothing was detected in wt mice. I, published by permission of Acta Physiol (Oxf.) 5.1.1 Basic characterization of the mice Quantitative real-time PCR Mouse endogenous mRNA expression levels for OX1R and OX2R were studied as possible physiological adaptation in response to hPPO overexpression. The mRNA levels of mouse OX1R were slightly, although not significantly, decreased in the hypothalami of tg mice (data not shown) compared with their wt littermates, while the expression of hypothalamic mouse OX2R mRNA was significantly (wt = 1.790 ± 0.2208, tg = 1.036 ± 0.1234, p = 0.0177, mean ± SEM, n = 5) down-regulated in tg mice compared with wt mice. We found no statistically significant differences in the expression levels of OX1R or OX2R in the BF, cortex or hippocampus (data not shown) between wt and tg mice. Only minor trends towards lower OX1R expression levels in tg mice hippocampus and OX2R expression levels in the cortex were observed, 82 suggesting that hPPO transgene expression has no significant effect on mouse endogenous OX1R or OX2R receptor expression in the brain except lowered OX2R expression in the hypothalamus. The expression of OX1R mRNA was detected in the hypothalamus of wt mouse as a positive control, but also in WAT (Study II, Fig. 1A). The cycle threshold (Ct) values for OX1R in wt mice hypothalamus and WAT samples were between 26.34–26.87 and 30.08–32.3, respectively. No OX2R mRNA expression was detected in WAT of wt mouse (data not shown). Western blot analysis Western blot analysis of human and mouse endogenous OXA was performed to detect the differences between wt and tg mice. Expression of OXA protein (~ 3.5 kDa) in the hypothalamus is shown in Figure 4C. OXA was overexpressed in the hypothalamus of tg mice, compared with wt littermates (Figure 4C). Mouse endogenous OXA was below the detection limit in the hypothalamus of wt mice (Figure 4C). In addition to the hypothalamus, OXA was expressed also in the pancreas and duodenum (data not shown), which have also been demonstrated by others previously (Kirchgessner & Liu 1999). OXA was not detectable in the spleen of transgenic mice, indicating that there is no ectopic expression (Figure 4C). Protein levels of OX1R in the wt mice hypothalamus (positive control) and WAT samples were determined by Western blotting. OX1R was detected in the hypothalamus and the WAT of wt mice with an apparent molecular mass of about 48 kDa, while nothing was detected in the muscle tissue (negative control) (Study II, Fig. 1B). No OX2R was detected in WAT or muscle of wt mice (data not shown). Immunohistochemical analysis Immunohistochemical analysis of human and mouse endogenous OXA was carried out for the brain sections of wt and tg mice to compare protein expression levels in perifornical LHA where orexins are mainly expressed. OXA-producing cells were detected in the perifornical LHA in wt and tg mice (Figure 5, left and right, respectively). However, in tg mice, OXA immunofluorescence intensity, but not the number of immunopositive neurons, was increased in comparison with their wt littermates. 83 Fig. 5. Immunohistochemical analysis of OXA in brains from wt (left figure) and tg (right figure) mice. Brain sections were treated with human/mouse OXA antibody, and OXA-producing cells were detected in the perifornical LHA in both wt and tg mice. The neuronal expression of hPPO (visualized as intensity of immunofluorescence) was increased in tg mice compared with their wild type littermates. I, published by permission of Acta Physiol (Oxf.) RIA for orexin, leptin and ghrelin Tg mice had slightly, but not significantly, increased (16%) amount of OXA immunoreactivity in their pooled (n = 5) plasma sample, compared with their wt littermates (28.8 pg/ml vs. 24.2 pg/ml), respectively. No significant differences were observed in the plasma ghrelin (n = 4) or leptin (n = 4 for wt mice and 3 for tg mice) levels between wt and tg animals. The ghrelin levels were as follows: wt mice 572.8 ± 82.2 pmol/ml and tg mice 701.1 ± 144.1 pmol/ml. Plasma leptin levels were 5.5 ng/ml ± 1.1 for wt mice and 4.4 ng/ml ± 1.5 for tg mice. The mRNA levels of leptin in WAT were significantly decreased in tg male mice compared with their wild type littermates (p = 0.0191). Plasma cholesterol and triglyceride levels hPPO transgene expression did not affect plasma cholesterol and triglyceride levels. The plasma cholesterol levels were 2.25 ± 0.04 mmol/l in wt mice and 2.43 ± 0.1 mmol/l in tg mice, whereas triglyceride levels were 0.8 ± 0.14 mmol/l and 0.86 ± 0.12 mmol/l in wild type and tg mice, respectively (n = 5 in both groups). 84 Glucose tolerance test No significant difference was observed in plasma glucose or insulin levels between wt or tg mice at any given time point, neither in anaesthetized (n = 5, data not shown) or non-anaesthetized (n = 5, data not shown) animals, during the glucose tolerance test. Growth A trend towards smaller body weight was observed in tg male mice compared to wt mice. Tg mice were smaller since the start of the measurement until the 20th week (Study II, Fig 2). However, the differences were not statistically significant. mRNA expression of UCPs and PPARs (delta and gamma) Total RNA was extracted from the hypothalamus, WAT, BAT and skeletal muscle from both wt and tg mice and reverse transcribed to cDNA. Gene expression analysis of UCPs 1, 2 and 3 were performed by quantitative real-time PCR. Expression level of UCP2 in WAT was significantly increased in RT housed tg mice compared with their wt littermates (two-tailed, unpaired Student’s t test, p = 0.0181; Table 3; Study II, Fig. 7), while the expression of UCP1 and UCP3 did not significantly differ in any of the given tissues (Table 3). The mRNA levels of UCP2 in WAT of tg mice were increased by 53% compared with wt littermates. After 4 days of cold exposure at +4ºC, no significant differences were observed in BAT, WAT or muscle UCPs mRNA levels between genotypes (data not shown). mRNA expression of PPARdelta and PPARgamma in WAT were significantly elevated in RT housed tg mice when compared with their wt littermates (p = 0.0141, p = 0.0220, respectively) (Study II, Figs 8A,B). The mRNA levels of PPARdelta (Study II, Fig. 8A) and PPARgamma (Study II, Fig. 8B) in tg animals were increased by 67% and 45%, respectively. 85 Table 3. UCP1, 2 and 3 mRNA expression levels in hPPO wt and tg mice tissues. Tissue and analyte mRNA expression level (wt) mRNA expression level (tg) (Analyte mRNA/18s rRNA) (Analyte mRNA/18s rRNA) BAT UCP1 (1) 1.086 ± 0.1159 0.7296 ± 0.2347 WAT UCP1 (1) 0.5350 ± 0.1776 0.4790 ± 0.1687 WAT UCP2 (1) 1.195 ± 0.1847 2.548 ± 0.3772* Muscle UCP3 (1) 1.450 ± 0.3436 1.410 ± 0.3168 BAT UCP1 (2) 1.397 ± 0.2208 1.267 ± 0.1385 WAT UCP1 (2) 0.3291 ± 0.1886 0.4901 ± 0.09019 WAT UCP2 (2) 0.8917 ± 0.1348 0.9771 ± 0.1166 Muscle UCP3 (2) 1.053 ± 0.1847 1.634 ± 0.5222 * p < 0.05 (two-tailed, unpaired Student's t test), wt = wild type, tg = transgenic, (1) Measurements made in RT (+20ºC), (2) Measurements made in cold (+4 °). 5.1.2 The characterization of the sleep-wake patterns in hPPO overexpressing mice Vigilance states and EEG power during baseline recordings Vigilance state scores of the 24 h baseline recording were analysed in 1 h time bins and averaged into 24 or 12 h (light or dark) periods. No statistically significant differences between genotypes were found in the percentage of time spent in each vigilance state, in vigilance state bout durations or in the number of state transitions (brief awakenings, SWS to wake or REM to wake transitions) (Study I, Table 1). An hour by hour analysis of the circadian distribution of vigilance states (Figures 6A,B,C) revealed statistically significant differences (two-way repeated- measures ANOVA with Holm-Sidak, p < 0.05) between genotypes in the light– dark transition periods: tg mice spent less time awake and more time in SWS during the early hours of the dark period while during the late hours of the dark period they spent more time awake and less time in SWS. REM sleep was reduced in tg mice compared with wt mice at a few time points during both the light and dark periods (Figure 6C). The mean EEG power spectra between 1 and 35 Hz in 1 Hz bins were calculated separately for WAKE, SWS and REM sleep by averaging the EEG power of the scored epochs over the 24 h BL period. No major differences between the genotypes were found (Study I, Figs 4B,D,F). 86 Fig. 6. Vigilance states during baseline. Percentage of time spent in each vigilance state (A: Wake; B: SWS; C: REM) during the 24 h baseline recording in consecutive 1 h time bins. The light and dark periods are indicated below the X-axis with horizontal white and black bars respectively. Individual bins in which a statistically significant (two-way repeated-measures ANOVA with Holm-Sidak, p < 0.05) difference between genotypes was present are indicated with asterisks. The arrows point to the direction of change in which the tg mice differ from their wt mice. Genotypes are indicated as follows: tg (•; n = 10), wt (○; n = 5). I, published by permission of Acta Physiol (Oxf.) Vigilance states and EEG during SD and recovery sleep Vigilance state scores of the SD, and the following recovery sleep period were analysed in 1 h time bins and averaged into 6 h SD, 6 h lights on recovery period 87 (immediately following the SD), 12 h lights off recovery period and into the total 18h recovery period. SD was effective in keeping the animals awake as mice were awake on average 93.7 ± 1.7% of the time (wt: 95.6 ± 1.5%, n = 6; tg: 92.9 ± 2.5%, n = 9, Study I, Fig. 5A). Transgenic mice had more EEG power in the low (1 Hz) delta frequency range (1 Hz, p < 0,05) in the WAKE state compared with wt during SD (two-way repeated-measures anova with Holm- Sidak, p < 0.05; Study I, Fig. 5B). EEG data are shown as normalized to corresponding spectra of the BL day (% of BL power). No significant differences between genotypes were found during recovery sleep in the amount of SWS, number of brief awakenings or latency to SWS (as investigated by the MMSLT) (Study I, Table 2, Fig. 5C). The amount of REM sleep, however, was reduced in tg mice compared with wt mice at several time points during both the light and dark periods (Study I, Table 2; Figure 7). Fig. 7. Percentage of time spent in REM state during the 24 h recording period in consecutive 1 h time bins. Sleep deprivation was performed during the first 6 h of light period and in the following 18 h, undisturbed recovery sleep was allowed. The light and dark periods are indicated below the X-axis with horizontal white and black bars, respectively. Individual time bins in which a statistically significant (two-way repeated- measures ANOVA with Holm-Sidak, p < 0.05) difference between genotypes was present are indicated with asterisks. The arrows point to the direction of change in which the tg mice differ from their wt mice. Genotypes are indicated as follows: tg (•; n = 10), wt (○; n = 5). I, published by permission of Acta Physiol (Oxf.) 88 To investigate the actual recovery sleep response, sleep amounts and the EEG power spectra were compared to corresponding circadian time points of the baseline day within each individual animal. The amounts of SWS and REM sleep compared to baseline increased in both groups (Study I, Table 2), thus both groups showed a recovery sleep response. After baseline normalization, no statistically significant differences between genotypes were found (Study I, Table 2). Sleep intensity as defined by increased SWS EEG delta (1–4 Hz) power increased in both groups (Study I, Fig. 5D). A statistically significant (two-way repeated-measures ANOVA with Holm-Sidak, p < 0.05) attenuation in SWS EEG power increase in the low delta range (1–2 Hz) was found in tg mice, compared with wt mice during the first 2 h of recovery sleep (Study I, Fig. 5B). 5.1.3 Physiological and behavioral analysis of the hPPO overexpressing mice Physiological and behavioural analysis with the automated animal monitoring system documented a similar total food and water intake in tg mice and their wt littermates, housed in RT (data not shown). However, body weight adjusted food intake and food intake per mouse were significantly increased in tg mice compared with wt mice when only the daytime food intake (12 h) from 3 days was analyzed (Study II, Figs 3A,B, (two-tailed, unpaired Student's t test, p = 0.0282 and 0.0293, respectively). The body weight adjusted food intake levels were 0.1967 ± 0.03785 g/g body weight in wt mice and 0.3548 ± 0.03987 g/g body weight tg mice, whereas food intake levels per mouse were 5.030 ± 0.8101 g and 8.153 ± 0.7397 g in wt and tg mice, respectively (n = 4 in both groups). However, no significant difference was observed in the night time food intake (data not shown). In addition, tg mice showed increased heat production during the whole testing period (Figure 8). No significant differences were observed in the total locomotor activity between wt and tg mice (Study II, Fig. 5A). 89 Fig. 8. Heat production in tg and wt mice housed in RT. First 48 hours of the measurement are shown in this figure. Wt mice are marked with solid line and tg mice with dashed line. Vertical dashed lines separate the day time (the beginning of the measurement) and the night time. Tg mice showed increased heat production compared with wt mice. Values are represented as mean ± SEM. After acute cold exposure, no differences were observed in total water or food intake between wt and tg mice (data not shown). Neither was any difference observed in metabolic heat production between wt or tg mice (Study II, Fig. 4B). However, a difference was observed in total motor activity. Tg mice showed decreased activity due to cold exposure compared with wt mice (Figure 9). When the night time activity was calculated cumulatively (1st and 2nd night periods), the total activity of tg mice was significantly decreased compared with wt mice (Study II, Fig. 6, two-tailed, unpaired Student's t test, p = 0.0494, wt; n = 7, tg; n = 8). The values for wt mice were 6256 ± 623.8 counts, while for tg they were 4305 ± 416.9 counts. In general, both genotypes showed a notable decrease in their total activity due to acute cold exposure when compared with mice placed in RT. 90 Fig. 9. Total locomotor activity of tg and wt mice housed in +4ºC. First 48 hours of the measurement are shown in this figure. Wt mice are marked with solid line and tg mice with dashed line. Vertical dashed lines separate the day time (the beginning of the measurement) and the night time. Tg mice showed reduced activity compared with wt mice. Values are represented as mean ± SEM. Temperature telemetry Temperature telemetry analysis showed no significant difference in the core body temperature of tg mice when compared with wt littermates in RT (data not shown). All mice showed a clear circadian rhythmicity in core body temperature (data not shown). 5.2 Effects of food deprivation on duodenal mucosal bicarbonate secretion and orexin receptors expression in rat duodenal mucosa and in acutely isolated duodenal enterocytes 5.2.1 In situ experiments Experimental related factors In all cases, the in situ isolated perfused rat duodenum spontaneously secreted HCO3 at a steady basal rate, and neither this secretion nor the mean arterial blood pressure was influenced by the intra-arterial or luminal administration of vehicle 91 (isotonic saline) alone. The i.c.v. infusion of vehicle (artificial cerebrospinal fluid) alone did cause a slight and continuous rise in duodenal alkaline secretion, but did not affect the arterial blood pressure. In some experimental groups, there was a slight decline in the mean arterial blood pressure during the (up to) 240 min-time period of the experiments. However, the blood pressure remained ≥ 90 mmHg in all animals studied. Animals were continuously infused intravenously with Ringer-bicarbonate solution, and blood acid-base balance was measured in all experimental groups. Mean blood pH was 7.36 ± 0.01 at the start of the first control period and 7.38 ± 0.01 at the end of experiments (n = 110). Blood HCO3 concentrations were 30.7 ± 0.3 and 28.7 ± 0.3 mM, respectively. The slight decrease in blood HCO3 concentration attained statistical significance (p < 0.05), but no significant differences between experimental groups were observed. Intra-arterial administration of OXA and SB-334867 Close intra-arterial infusion of OXA (60, 240 and 600 pmol·kg−1·h−1) caused a dose-dependent increase (p < 0.05 with 60 and p < 0.01 with 240 and 600 −1 −1 pmol·kg ·h ) in mucosal HCO3 secretion in fed rats (Figure 10). Infusion of the lowest dose (60 pmol·kg−1·h−1) alone for extended period of time (150 min, n = 8) caused an initial (40 min) rise in secretion from 15.0 ± 2.4 to 17.8.5 ± 2.4 −1 −1 µeq·cm ·h . The rate of HCO3 secretion then remained at the latter plateau throughout the experimental period. In contrast to the stimulation in fed rats, no response was observed to the infusion of OXA at any given dose in overnight- fasted rats (n = 6, data not shown), confirming a previous study (Flemstrom & Sjoblom 2005). 92 OXA pmol/kg, h Fig. 10. Close intra-arterial infusion of OXA (60–600 pmol·kg−1·h−1) in continuously fed rats. Pretreatment with the OX1R antagonist SB-334867 (6 nmol/kg, intra-arterial bolus dose) inhibited orexin-induced secretion. Muscarinic antagonist atropine (0.75 µmol/kg iv followed by 0.15 µmol·kg−1·h−1 iv) had no effect on the stimulation induced by OXA. SB-334867 (SB) was injected and administration of atropine (Atr) started as indicated. Means ± SE of HCO3 secretion and mean arterial blood pressure (BP) in OXA-infused animals and in control animals receiving vehicle alone are shown (n ≥ 7 in all groups). III, published by permission of Am J Physiol Gastrointest Liver Physiol. Pretreatment with the OX1R antagonist SB-334867 (6 nmol/kg intra-arterial bolus dose) inhibited the secretory response to OXA (Figure 10). Even the highest 93 rate of OXA infusion (600 pmol·kg−1·h−1) did not cause a rise in secretion in animals pretreated with SB-334867 (p > 0.05). Intra-arterial bolus injection of SB-334867 alone (6 nmol/kg) tended to increase basal HCO3 secretion (Figure 10; Study III, Fig. 4), but the slight rise in secretion did not attain statistical significance (p > 0.05). In contrast, intra-arterial bolus injection of a tenfold higher dose of SB-334867 (60 nmol/kg) caused a significant (p < 0.05) rise in secretion (n = 5, not shown). The lower dose of 6 nmol/kg was thus selected for studies of the antagonist action of SB-334867 (Figure 10; Study III, Fig. 4). A partial agonist action of SB-334867 was confirmed by continuous intra- arterial infusion of the compound at consecutively increasing rates (Study III, Fig. 3). In fed animals, there was a rise in HCO3 secretion that attained significance (p < 0.05) with the highest dose infused (6 nmol·kg−1·h−1). Effects of continuous infusion of SB-334867 were tested also in overnight food-deprived animals (Study III, Fig. 3). No significant increase in secretion was observed in the food- deprived group, indicating a partial agonist action of SB-334867, appearing only in fed animals and at infusion of higher doses of the compound. Blood glucose concentration was 8.3 ± 0.8 mM at the start of the initial control period, preceding infusion of OXA alone, and 6.7 ± 0.7 mM at the end of these experiments. There was a decline in blood glucose of very similar magnitude in control animals infused with vehicle (isotonic NaCl) alone, from 9.5 ± 0.3 to 6.5 ± 0.5 mM (n = 6). A decline in blood glucose concentration of similar magnitude occurred also in animals pretreated with SB-334867. Effects of muscarinic receptor ligands The muscarinic antagonist atropine (0.75 µmol/kg bolus dose followed by 0.15 −1 −1 µmol·kg ·h , both i.v.) did not affect the orexin-induced rise in mucosal HCO3 secretion (Figure 10). Basal secretion as well as secretion stimulated by infusion of 60 and 240 pmol·kg−1·h−1 of OXA appeared higher in the atropine-treated group than in animals infused with OXA alone, but differences between groups did not attain statistical significance (p > 0.05). In contrast, atropine abolished stimulation induced by the muscarinic agonist bethanechol and also prevented the bethanechol-induced decline in mean arterial blood pressure (Study III, Fig. 4). Bethanechol alone significantly (p < 0.05) stimulated secretion at a dose of 5 µmol·kg−1·h−1. Higher doses of bethanechol caused a marked decline in the mean arterial blood pressure and were therefore not used. 94 Bethanechol-induced secretion was studied in some further experiments. The intra-arterial bolus dose of SB-334867 (6 nmol/kg), inhibiting stimulation by OXA (Figure 10), did not prevent the rise (p > 0.05) in secretion induced by bethanechol (Study III, Fig. 4). Nor did this dose of SB-334867 affect the decrease (p < 0.05) in mean arterial blood pressure induced by the two larger doses of bethanechol. The absence of effects of atropine on orexin-induced secretion (Figure 10) and of SB-334867 on bethanechol-induced secretion (Study III, Fig. 4) suggests independence between pathways for OXA and muscarinic- induced stimulation of the duodenal HCO3 secretion. Luminal administration of OXA Glucagon, uroguanylin, heat-stable enterotoxin and the neurohormone melatonin are potent stimuli of the duodenal secretion when added to the luminal perfusate (Joo et al. 1998, Flemstrom et al. 1999, Sjoblom & Flemstrom 2003). In addition, previous results have shown that orexin releases cholecystokinin from the neuroendocrine cell line STC-1 (Larsson et al. 2003, Allen & Flemstrom 2005). In the present study, the presence of OXA (1 to 100 nM) in the luminal perfusate did not affect the HCO3 secretion by the duodenal mucosa (Study III, Fig. 5). There were no significant differences in rates of secretion between OXA perfused and control animals. Nor did luminal OXA affect the mean arterial blood pressure or the decline in blood glucose concentration during the experimental period (data not shown). Prostaglandin E2 (20 µM), added to the luminal perfusate at the end of all experiments as a test of the viability of the preparation, caused a similar rise in HCO3 secretion in OXA-perfused and control animals (p < 0.01 in both groups). Central nervous administration of OXA An i.c.v. infusion of OXA (2 or 20 nmol·kg−1·h−1) caused a small continuous rise (p < 0.05) in duodenal HCO3 secretion, and this rise continued after cessation of OXA infusion (Study III, Fig. 6). However, there was a similar increase (p < 0.05) in secretion in control animals infused with vehicle (artificial cerebrospinal fluid) alone (Study III, Fig. 6), and the rise in HCO3 secretion in the two orexin-infused groups was not significantly different (p > 0.05) from that in the control group. The mean arterial blood pressure in orexin-infused animals remained at a stable 95 level (p > 0.05) and was very similar to that observed in animals infused with artificial cerebrospinal fluid alone (Study III, Fig. 6). The absence of an effect of i.c.v. OXA on the duodenal alkaline secretion could in theory reflect operation-induced damage of the vagal supply to the cannulated duodenal segment. Central nervous administration of TRH is known to elicit stimulation of the duodenal alkaline secretion mediated by the vagal nerves (Flemstrom & Jedstedt 1989, Lenz et al. 1989). I.c.v. TRH caused a rapid rise (p < 0.05) in duodenal secretion in the present study (Study III, Fig. 6), confirming that the cannulated segment had persistent efferent vagal supply, and also slightly increased (p < 0.05) the mean arterial blood pressure. Blood glucose concentration decreased from 8.8 ± 0.5 to 8.2 ± 0.6 mM in animals infused intracerebroventricularly with 2 nmol·kg−1·h−1 of OXA, and from 10.3 ± 0.9 to 8.0 ± 0.9 mM in those infused with the higher dose of 20 nmol·kg−1·h−1. These decreases in glucose concentration were not different from that of the 10.2 ± 0.5 to 8.0 ± 0.5 mM observed in the control animals infused with vehicle alone. 5.2.2 In vitro experiments OXA induced calcium signaling in rat enterocytes Experiments were run on preparations taken from the final pellet up to 6 h after the isolation procedure, and selected (caged) enterocytes were studied for up to 25 min in the temperature-regulated perfusion chamber. Enterocytes were selected primarily from clusters of 10–50 interconnected enterocytes. As tested by Trypan blue exclusion, the enterocyte viability was >95% after preparation and remained 2+ at >80% after a 6-h period. Most caged cells displayed a stable [Ca ]i of ~100 nM during the initial prepeptide period of the experiments. Control experiments were performed by perfusion with ligand-free electrolyte solution. Fed animals had free access to their regular supply of food until the start of the experiments. OXA was added to the perfusate at two concentrations in each experiment. Exposure to the peptide at a concentration of 1 nM was followed by exposure to 10 nM (271 cells in clusters from 8 rats), or exposure to a concentration of 10 nM was followed by 100 nM (220 cells in clusters from 5 rats). The duration of exposure to each concentration was 180 s. OXA increased 2+ [Ca ]i at all concentrations tested (p < 0.01) in enterocytes harvested from continuously fed animals (Figure 11). The proportion of responding cells 96 increased dose dependently from ~16% at the lowest concentration of 1 nM to ~20% at 10 nM and ~29% at 100 nM (trend, p < 0.05). In the majority of 2+ responding cells, [Ca ]i increased without a clear initial peak to reach a sustained plateau that remained stable within the experimental period. Cessation of 2+ exposure to OXA did not result in any immediate decline in [Ca ]i. The 2+ magnitude of the rise in [Ca ]i was concentration dependent in cells that responded already to the lower of the two tested concentrations of OXA (Study IV, Fig. 2). The cholinergic agonist carbachol (100 µM) was added to the perfusate in some experiments as a test of the viability of the enterocytes from fed animals. In contrast to OXA, carbachol induced intracellular calcium signaling (p < 0.001, data not shown) in the majority of the caged enterocytes. OXA (10 and 100 nM) 2+ increased [Ca ]i also in the absence of calcium in the perfusate (153 enterocytes in clusters from 5 rats). As in the presence of extracellular calcium, the peptide 2+ induced a [Ca ]i response in a significant (p < 0.01) proportion of enterocytes. The signaling pattern was, however, distinctly different from that observed in 2+ cells with access to extracellular calcium; the rise in [Ca ]i displayed an initial peak response, followed by a rapid decline (Study IV, Fig. 3). Fasted animals had been deprived of food overnight (16 h) before the isolation of enterocytes. This period of fasting inhibits the duodenal HCO3 secretory response to exogenous OXA in rats in vivo (Ehrstrom et al. 2005a). Initially, we tested the same concentrations of peptide and durations of exposure as were used in experiments with enterocytes from fed animals. The absence of significant effects (not shown) made it of interest to use a protocol with longer durations of exposure to OXA. Only one concentration of OXA was superfused in each experiment, and the time of exposure to the peptide was extended to 600 s. The concentrations used were 1 nM (52 cells in clusters from 3 rats), 10 nM (139 cells in clusters from 4 rats), or 100 nM (132 cells in clusters from 4 rats). No significant responses to OXA were observed (Figure 11). Furthermore, the cholinergic agonist carbachol (100 µM) was added to the perfusate at the end of experiments as a test of the viability of the enterocytes. Carbachol induced intracellular calcium signaling (Study IV, Fig. 4) in a majority of enterocytes from fasted rats also. 97 Fig. 11. At all concentrations tested (1–100 nM), 180 s of exposure to OXA induced an intracellular calcium signaling in duodenal enterocytes acutely isolated from continuously fed animals. Despite a longer time of exposure (600 s), the same concentrations did not elicit a response in cells isolated from fasted animals. The proportion of caged cells that responded with increased intracellular calcium concentration ([Ca2+]i) to OXA stimulation. Responding controls are cells showing spontaneous changes in [Ca2+]i. Ratio of proportions and 95% confidence interval (CI) are shown. Dashed line represents ratio of 1. **p < 0.01; ***p < 0.001. IV, published by permission of Am J Physiol Gastrointest Liver Physiol. Effects of enteric nervous system on OXA induced calcium signaling The present findings strongly suggest that OXA exerts its action directly on the enterocyte membrane receptor. However, it is possible that enterocyte responses to OXA reflect an action primarily at acetylcholine-releasing enteric neurons. In the present study, only preparations microscopically devoid of enteric neurons were used. Enteric neurons are markedly stained by fura 2-AM and would thus have been easily detectable. Furthermore, pretreatment of cell preparations (fed animals) with the muscarinergic antagonist atropine (1 µM) did not affect basal 2+ [Ca ]i nor the proportion of cells responding to 1 or 10 nM OXA (213 cells in 98 clusters from 5 rats, not shown). Neither did atropine affect the shape or 2+ magnitude of the orexin-induced [Ca ]i responses (data not shown). Enterocytes from human biopsies The patients undergoing endoscopy took no food in the morning before the procedure. This is not directly comparable to overnight fasting, but we used the same protocol for enterocytes from human biopsies as for those from fasted rats. OXA was added to clusters of human enterocytes (81 cells, 1 biopsy sample from each of 3 patients) for an extended period of time (600 s) and in separate experiments for each concentration. The results from experiments with a lower concentration of OXA (10 nM) were inconclusive, but at a higher concentration (100 nM) the peptide induced intracellular calcium signaling in ~11% of the 2+ human enterocytes (p < 0.05). The pattern of the increase in [Ca ]i was similar to that observed in rat enterocytes, but in general, the magnitude of the response was smaller (Study IV, Fig. 5). Orexin receptor antagonist and agonist Our in vivo data provided evidence that the SB-334867 at higher doses may act as a partial agonist. Thus, we performed experiments in which SB-334867 alone (1, 10, and 100 nM) was added to the perfusate (503 cells in clusters from 6 rats), using the same protocol as for OXA. None of the tested concentrations of SB- 2+ 334867 induced an increase in [Ca ]i. In further experiments, we used the high concentration of 1,000 nM of SB-334867 (128 cells in clusters from 5 animals). In contrast to the lower doses, this high concentration induced a robust increase in the intracellular calcium level in ~24% of the enterocytes (p < 0.001) (Study IV, Fig. 6), with a calcium signaling pattern similar to that induced by OXA (not shown). These findings suggest that, at higher concentrations, SB-334867 acts in a partial agonistic fashion also in vitro. The lower concentration of 10 nM of SB-334867 was therefore selected to 2+ test whether the antagonist inhibits the [Ca ]i response to OXA. The clusters were preperfused with SB-334867 for 180 s and the antagonist was then present in the perfusate throughout the experimental period. SB-334867 completely 2+ abolished (p < 0.01) the [Ca ]i response to OXA (1 and 10 nM, 180 s exposure, 530 cells in clusters from 6 rats) (Study IV, Fig. 7). In further experiments we examined effects of (Ala11,D-Leu15)-orexin-B, an agonist that displays a 400-fold 99 2+ selectivity for OX2R over OX1R as evaluated from [Ca ]i responses in the CHO- K1 cell line (Asahi et al. 2003). The agonist was added to the perfusate according to the same protocol as was used for OXA (1, 10, and 100 nM, 714 cells from 7 rats). None of the tested concentrations induced intracellular calcium signaling (Study IV, Fig. 8). 5.2.3 Quantitative real-time PCR and Western blotting analysis of orexin receptors mRNA expression of OX1R and OX2R and protein expression of OX1R in rat duodenal samples mRNA expressions of OX1R, as well as OX2R, were significantly downregulated in fasted animals compared with fed animals (Study IV, Fig. 7; p = 0.00234, p = 0.00159 respectively). The mRNA levels of OX1R and OX2R in fasted animals were reduced by 44.5% and 70.1%, respectively. Protein levels of OX1R in the rat duodenal mucosa samples were determined by Western blotting and compared between fed and fasted animals. OX1R was detected with an apparent molecular mass of ~50-kDa, whereas β-actin was detected as a ~45-kDa peptide (Figure 12). Quantification analysis revealed a significantly (p = 0.0233) decreased amount of OX1R in fasted animals compared with fed animals (Figure 12). The protein level of OX1R in fasted animals was reduced by 49.3% compared with that in fed animals (Figure 12). 100 Fig. 12. Western blot analysis of OX1R and β-actin in duodenal mucosa samples of fed and fasted rats. (Left) OX1R was detected with a molecular mass of 50 kDa and β-actin of 45 kDa. (Right) Quantification of OX1R Western blots (represents mean of 2 separate runs, n = 4). The protein expression levels of OX1R in fasted animals were significantly (*p < 0.05) reduced compared with fed animals (means ± SEM). III, published by permission of Am J Physiol Gastrointest Liver Physiol. mRNA expression of orexin receptors in rat duodenal enterocytes Expression of both receptors was significantly downregulated in cells from fasted animals compared with those from fed animals (p = 0.0447, p = 0.0411, respectively). The mRNA levels of OX1R and OX2R in fasted animals were reduced by 54.5% and 60.4%, respectively (Figure 13). Fig. 13. mRNA expression of the orexin receptors (A, OX1R; B, OX2R) normalized to 18s rRNA in duodenal enterocytes from rats and provided in relative amounts. The expression levels of OX1R and OX2R in enterocytes from fasted animals were significantly lower than those in fed animals (n = 5, means ± SEM; *p < 0.05). IV, published by permission of Am J Physiol Gastrointest Liver Physiol. 101 102 6 Discussion 6.1 The generation and characterization of hPPO overexpressing mice Recent studies have evinced the orexin system as an important regulator of sleep and wakefulness as well as energy homeostasis (Tsujino & Sakurai 2009, Bonnavion & de Lecea). In the present study, transgenic mice overexpressing the hPPO transgene under its endogenous promoter were generated, and their sleep– wake patterns, as well as feeding and energy homeostasis related processes, were characterized. The tg mice showed significant differences in the circadian distribution of vigilance states in the light–dark transition periods. In addition, tg mice showed small reductions in REM sleep during both the light and dark periods. Moreover, our tg mice showed an increased metabolic heat production and significantly elevated day time food intake at RT, when compared with their wt littermates. In addition, after an acute cold exposure both genotypes showed a similar amount of heat produced. However, tg mice exhibited decreased locomotor activity compared with their wt littermates. The increased energy expenditure in the tg mice did not result from a change in UCP1 expression in BAT. Instead, we found an increase in UCP2 mRNA levels in WAT. The tg mice were viable and fertile. The hPPO transgene was overexpressed in the mRNA and protein level in the hypothalami of tg mice. The plasma concentration of pooled OXA was also slightly elevated in tg animals compared with wt mice. The transgene expression decreased OX2R mRNA expression in the hypothalamus, but did not have any effect on OX1R or endogenous OX1R/OX2R mRNA levels in the BF, cortex or hippocampus. In addition, OX1Rs, but not OX2Rs, were found to be expressed in wt mice WAT. 6.1.1 The characterization of the sleep-wake patterns In the baseline recordings, tg mice showed significant differences in the circadian distribution of vigilance states in the light-dark transition periods when compared with their wt littermates. After SD, tg mice had a similar amount of SWS recovery as their wt littermates. However, the amount of REM sleep was decreased. When recovery REM sleep was normalized to baseline within each individual animal (spontaneous sleep during corresponding circadian time points), the reduction in 103 REM sleep could no longer be detected, indicating that the tg mice have a normal REM sleep response to SD. In contrast to studies made on OX-KO mice or orexin-overexpressing mice, we did not observe vigilance state fragmentation in our tg mice (Mieda et al. 2004b, Mieda et al. 2006b). Our results are in line with Mieda et al. who demonstrated that CAG/orexin mice overexpressing rat PPO, under the control of a β-actin/cytomegalovirus hybrid promoter, show a significantly suppressed amount of REM sleep during the daytime (Mieda et al. 2004b, Mieda et al. 2006b). In addition, microinjections into the right or left lateral ventricle of the brain or 1 h perfusion of OXA into the histaminergic TMN resulted in decreased REM sleep and SWS during the light period in rodents (Piper et al. 2000, Huang et al. 2001). In contrast, OX-KO mice and orexin/ataxin-3 mice with an ablation of orexin-producing neurons, show increased amounts of REM sleep during the dark period (Chemelli et al. 1999, Hara et al. 2001). It has been demonstrated, that the expression of ataxin-3 also eliminates other coexpressed neurotransmitters in the orexin neurons (Chou et al. 2001, Reti et al. 2002, Nilaweera et al. 2003, Kantor et al. 2009). Thus, the results from orexin/ataxin-3 mice might not reflect completely the functions of only orexins. A study from Mochizuki et al. demonstrated that OX-KO mice have normal amounts of wake, NREM and REM sleep (Mochizuki et al. 2004). The authors speculated that the observation of increased REM sleep in OX-KO mice presented in other studies might have appeared because cataplexy was not separated from REM (Chemelli et al. 1999, Willie et al. 2003, Mochizuki et al. 2004). Recently, it was also shown that orexin/ataxin-3 mice kept in constant darkness had a reduction in REM sleep rhythmicity when compared with wt or OX-KO mice (Kantor et al. 2009). Thus, it was proposed that orexin neurons, but not just orexins themselves, are necessary for the circadian control of REM sleep. Our hPPO tg mice spent less time awake and more time in SWS during the early hours of the dark period, whereas during the late hours of the dark period they spent more time awake and less time in SWS. Sleep and wakefulness are under both homeostatic and circadian control. Orexin levels show day-night fluctuations, with high levels during the dark period (night time) when mice are more active (Taheri et al. 2000, Yoshida et al. 2001, Martinez et al. 2002). In mammals, the primary circadian clock located in SCN, controls the circadian rhythm and is important for circadian rhythmicity in the orexin system (Deboer et al. 2004, Klisch et al. 2009). In the present study, overexpression of orexins affected the circadian distribution of vigilance states. On the other hand, in constant darkness both OX-KO and orexin/ataxin-3 mice show normal circadian 104 rhythms of wake and NREM sleep (Kantor et al. 2009). As mentioned before, orexin/ataxin-3 mice had less circadian variation in REM sleep than their wt littermates or OX-KO mice. In addition, both OX-KO and orexin/ataxin-3 mice show normal circadian rhythms of body temperature, locomotor activity and wakefulness, indicating that their circadian clocks and clock effector mechanisms are functioning normally. However, a recent study has demonstrated that in vitro applied OXA itself is able to alter neuronal activity of the rat SCN (Klisch et al. 2009). Thus, the orexinergic system might have direct influences on the circadian system. SD was performed to investigate sleep homeostasis, a process by which prolonged waking increases the intensity (measured by EEG delta power 1–4 Hz) and/or duration of the consequent SWS. No differences in the amount of SWS or latency to SWS (studied with MMSLT) after SD were found between genotypes. However, during the first 2 h of recovery sleep, tg mice had a statistically significant reduction in their SWS delta (between 1 and 2 Hz) response, when compared with their wt littermates, indicating a reduced SWS intensity/sleep pressure during recovery sleep. The tg mice had more slow wave intrusions in the waking EEG during SD. It has been shown that intrusions of slow delta waves in waking EEG during SD might reflect increased sleep pressure/sleepiness (Cajochen et al. 2002). Thus the tg mice might have been sleepier (e.g. latency to sleep after SD) than their wt littermates. However, the mechanism for how tg mice were able to release some of their sleep pressure already during SD is not known. In conclusion, the hPPO-overexpressing mice show a slight, but statistically significant reduction in REM sleep both during the day and the night, as well as changes between vigilance states in the light/dark transition periods. Thus, our results confirm the role of orexins in the maintenance and stabilization of sleep and wakefulness, as well as inhibition of REM sleep. In addition, orexins might have influences on the circadian system. 6.1.2 Effects of orexin overexpression on energy homeostasis Orexins affect energy homeostasis in several different ways, like increasing food intake and affecting activity, as well as changing the metabolic rate (Lubkin & Stricker-Krongrad 1998, Sakurai et al. 1998, Chemelli et al. 1999, Haynes et al. 1999, Yamanaka et al. 1999). In the present study, the mice overexpressing hPPO showed increased metabolic heat production and significantly elevated day time 105 food intake at RT. An acute cold exposure balanced the effects of non-shivering thermogenesis between genotypes and tg mice had a significantly greater decrease in their locomotor activity in response to cold compared with wt mice. Previous reports investigating the effects of orexins using either short or long term exogenous orexin administration revealed conflicting results. Initially, both OXA and OXB were shown to promote acute feeding after i.c.v. injections (Sakurai et al. 1998). Chronic i.c.v. administration of OXA increased daytime food intake with no or only a little increase in body weight in rats (Yamanaka et al. 1999). In another study, i.c.v. infusions of OXA resulted in increased daytime food intake and decreased nocturnal feeding with no effect on weight in rats (Haynes et al. 1999). Daily intraparaventricular administration of OXA in rats resulted in significant weight loss (Novak & Levine 2009). However, no difference was observed in total food intake. In the present study, we did not find any significant difference in the total amount of 24 h food intake between tg and wt mice. However, after a subanalysis of our data, we found that orexin tg mice ate significantly more during daytime when compared with their wt littermates. It could be speculated whether the shorter times spent awake for tg mice correlated to increased day time feeding. Our results are, at least partly, consistent with the findings by Yamanaka et al., who earlier described the effect of chronic i.c.v. administration of OXA affecting increasingly only daytime feeding (Yamanaka et al. 1999). Therefore, our results show that long term overexpression of orexins affects the circadian food intake pattern without an effect on total food consumption. Despite the lack of difference in total food intake, our tg mice tended to gain less weight than the wt mice during the first 5 and half months since birth. However, the differences were not significant at any time point. In addition, the tg mice showed an increased heat production (i.e. metabolic rate). Furthermore, when acutely exposed to cold, our tg mice showed a significantly decreased locomotor activity compared with wt mice, suggesting that tg mice do not need additional physical activity when exposed to a cold environment. Our results are in accordance with the findings from OX-KO mice, which eat less than their wt littermates and gain slightly more weight, indicating a reduced metabolic rate (Chemelli et al. 1999, Willie et al. 2003). In addition, orexin/ataxin-3 mice, with expression of a toxic protein that ablates the orexin producing neurons, show hypophagia and even obesity (Hara et al. 2001). In contrast, rat PPO overexpressing CAG/orexin mice on a low fat diet show no difference in food intake (Funato et al. 2009). However, the same mice on a high 106 fat diet show significantly reduced food intake and increased energy expenditure. It should be noted that these mice fed on the low fat diet show no difference in heat production when compared with wt mice. Possible differences in the diet compositions might explain the differences in the heat productions observed between Funato´s and our tg mice. Previously it was reported that injection of OXA increased the metabolic rate in mice (Lubkin & Stricker-Krongrad 1998). Narcoleptic patients with low or undetectable levels of orexin might have decreased metabolic rate (Hara et al. 2001, Kok et al. 2003). In addition, the metabolic rate of the OX-KO mice has been shown to fluctuate diurnally with a decreased rate upon awakening. Recent studies made with CAG/orexin and OX1R deficient/orexin overexpressing mice (OX1R-/-;CAG/orexin) on a high fat diet demonstrated an increased energy expenditure, indicating a role of central orexin-OX2R signaling in protection from high fat diet induced obesity (Funato et al. 2009). The respiratory quotient of our tg mice was investigated to find out whether lipids or carbohydrates are metabolized. No differences, however, were observed in usage of different substrates between tg or wt mice (data not shown). It has been shown earlier that chronic i.c.v. administration of OXA has no effect on plasma cholesterol and free fatty acid levels in rats (Yamanaka et al. 1999). In line with those findings, our tg mice also display normal serum cholesterol and triglycerides. Switonska et al. showed that daily subcutaneous injections of orexins for one week significantly elevated leptin plasma levels in rats (Switonska et al. 2002). In contrast, Funato et al. reported decreased serum leptin levels in male CAG/orexin mice, with a significant reduction of fat mass after a low fat diet (Funato et al. 2009). We did not find any significant differences in plasma leptin or ghrelin concentrations between tg and their wt littermates. Previously, it was demonstrated that s.c. injection of OXA caused an increase in both blood insulin and glucose levels in rats (Nowak et al. 2000). Later, it was also shown that daily administration of orexins for one week significantly elevated blood insulin in female rats, while Ehrström and colleaques did not observe any changes in insulin levels after OXA injection into the jugular vein in 18 h fasted male rats (Switonska et al. 2002, Ehrstrom et al. 2004). Instead, intravenously added OXA significantly decreased plasma insulin levels in fasted rats and elevated plasma glucose concentration (Ouedraogo et al. 2003). In our tg mice, no significant difference was observed in glucose or insulin levels during GTT when compared with wt littermates. CAG/orexin mice on a low fat diet 107 showed no differences in GTT, while being on a high fat diet demonstrated lowered blood glucose levels after GTT (Funato et al. 2009). The circadian body temperature cycle is a biological event, which is affected by food intake, locomotor activity and different enzyme and hormones. These phenomena are regulated by the suprachiasmatic nucleus, which receives projections from orexin neurons in LHA (Date et al. 1999). Mochizuki, and co workers demonstrated that OX-KO mice did not decrease their core body temperature during sleep at the same level than wt mice did (Mochizuki et al. 2006). This was probably due to deficient activation of heat loss mechanisms or sustained thermogenic activity. The same mice show a reduced activity during night time (Chemelli et al. 1999). On the other hand, CAG/orexin mice on a high fat diet tended to have a higher core body temperature. However, these mice did not exhibit hyperactivity. In this study, no difference was observed in core body temperature, nor in total activity between tg and wt mice placed in RT. However, during acute cold exposure, tg mice showed a trend towards decreased total activity compared with wt mice. During the night time, that is when the mice are normally active, tg mice showed significantly increased amounts of activity counts compared with wt mice. In general, mice respond to acute cold mostly by shivering and increasing physical activity, while the role of brown fat-derived UCP1 dependent thermogenesis grows gradually during the next three to four weeks (Cannon & Nedergaard 2004). Thus, our results are in line with those observed in CAG/orexin mice, suggesting that the leaner phenotype of orexin tg mice is due to an increased metabolic rate rather than increased core body temperature or total activity (Funato et al. 2009). No difference was observed in plasma T3 levels between genotypes (data not shown). It should be noted that both wt and tg mice significantly decreased their total activity in response to acute cold exposure when compared with mice in RT. During cold exposure, shivering occurs as the predominant muscle function over physical activity in the very beginning (Cannon & Nedergaard 2004). Thus, the mice move only when they need to eat or to generate extra heat by physical activity. To determine whether mitochondrial uncoupling proteins were responsible for increased heat production in tg mice, the mRNA expression of UCPs 1–3 were analyzed in tissues important for energy metabolism (Enerback et al. 1997). CAG/orexin mice showed increased energy expenditure with elevated UCP1 mRNA levels in BAT under a high fat diet, but not under a low fat diet (Funato et al. 2009). Importantly, wt mice fed on a high fat diet increased their BAT UCP1 108 levels in the same manner as the tg mice. Thus, the increase in BAT UCP1 is most probably due to dietary factors. In contrast to the results from CAG/orexin mice fed on a high diet, we did not find a difference in BAT UCP1 mRNA expression levels between our hPPO tg and wt animals fed on normal diet. Yet, we found a difference in the heat production. UCP1 is the main effector of a cold- and diet- induced non-shivering thermogenesis both in rodents and possible also in humans (Cannon & Nedergaard 2004, Cypess et al. 2009, Zingaretti et al. 2009). Previous studies have demonstrated that the effects of OXA on core body temperature might be independent of UCP1 (Yoshimichi et al. 2001, Russell et al. 2002). On the other hand, OX-KO mice show a stress induced increase in BAT UCP1 levels and hyperthermia (Zhang et al. 2010). However, our hPPO tg mice do not exhibit any anxiety like behaviour (unpublished data). The roles of other UCPs on energy metabolism are less clear (Cannon & Nedergaard 2004). Interestingly, in the present study, an overexpression of orexins in the tg mice housed in RT resulted in significantly increased UCP2 mRNA levels in WAT. It should be noticed that UCP2 expression was not analysed at the protein level. Pecqueur et al. have demonstrated earlier that the UCP2 protein level does not necessarily correspond to the UCP2 mRNA expression level (Pecqueur et al. 2001). In line with our results, a 7 day administration of ghrelin, an orexigenic peptide linked to orexins in mice, decreased and increased UCP1 in BAT and UCP2 in WAT, respectively (Toshinai et al. 2003, Tsubone et al. 2005). Even though the authors speculated that ghrelin can regulate body weight, adiposity and UCPs mRNA expression in mice, the participation of WAT UCP2 was not discussed (Tsubone et al. 2005). Tg mice overexpressing UCP2 in orexin neurons (Hcrt-UCP2) had an elevated hypothalamic temperature resulting in a reduced core body temperature (Conti et al. 2006). In addition, mice overexpressing UCP2 are leaner than their wt littermates (Horvath et al. 2003). Furthermore, overexpression of UCP2 in atherosclerotic plaques and mammalian macrophages results in increased heat production (van De Parre et al. 2008). Several studies have implicated a role for UCP2 in resting metabolic rate, fat metabolism and obesity in humans (Bouchard et al. 1997, Walder et al. 1998, Jia et al. 2009, Salopuro et al. 2009, Srivastava et al. 2010). Even though the amount of mitochondria in WAT is relatively low compared with BAT, recent studies have demonstrated that WAT mitochondria might have a role in obesity related genes (Semple et al. 2004, Dahlman et al. 2006). Digby et al. demonstrated the expression of OX1R and OX2R mRNA in s.c. and omental adipose tissue and in isolated adipocytes in humans (Digby et al. 109 2006). OXA increased peroxisome-proliferator-activated receptor (PPAR) gamma expression. Similarly, our experiments show that OX1R is expressed in mRNA and protein level in wt mice WAT. UCP2 gene expression is under the control of PPARs in WAT (Aubert et al. 1997, Kelly et al. 1998, Digby et al. 2000). In our experiments, PPAR delta and PPAR gamma mRNA levels were significantly upregulated in tg mice WAT. We did not see any difference in the WAT UCP2 mRNA levels in mice acutely exposured to cold when compared with wt mice. It could be speculated whether wt mice have increased their WAT UCP2 levels in response to cold. It has been shown earlier that UCP2 mRNA levels in WAT are increased in mice in response to cold (+4ºC for 24 h) (Masaki et al. 2000). Therefore, a short cold exposure might have affected WAT UCP2 mRNA levels also in our mice. In conclusion, the mice overexpressing hPPO demonstrate that orexins affect energy metabolism by increasing metabolic heat production. In addition, due to the increased thermogenesis during the acute cold exposure, tg mice might not need extra physical activity to compensate for the heat loss. The increased energy loss is compensated by increased daytime food consumption. 6.2 Effects of overnight fasting on OXA induced duodenal bicarbonate secretion Our results demonstrate that OX1R and OX2R mRNA, as well as OX1R protein, are expressed in the rat duodenal mucosa. OXA induced duodenal HCO3 secretion was inhibited by the pretreatment of the OX1R antagonist, SB-334867. 2+ In freshly isolated rat duodenal enterocytes, SB-334867 inhibited the [Ca ]i response to OXA, while the OX2R agonist, (Ala11,D-Leu15)-orexin-B, did not induce calcium signaling. Short (overnight) food deprivation for 16 h decreased significantly rat mucosal and enterocyte OX1R, as well as OX2R expression. Moreover, fasting abolished the secretory response to OXA, as well as the induction of calcium signaling. These findings provide strong evidence that OXA-induced duodenal HCO3 secretion is mediated mainly via OX1R. In addition, the expression of duodenal orexin receptors and secretory responses are markedly related to food intake. In the present study, OXA and SB-334867 were administered into the duodenum by a close intra-arterial infusion, which allows the use of very small amounts of compound, minimizing the effect of the CNS. The possible sites of action for intra-arterially infused compounds are enterocyte basolateral receptors, 110 enteroendocrine cell receptors and/or receptors in the enteric nervous system (ENS) (Flemstrom et al. 2010). An i.c.v. injection of OXA (1.0 nmol), via activation of vagal efferents, resulted in increased pancreatic exocrine secretion in conscious rats (Miyasaka et al. 2002). In addition, an intracisternal injection of OXA (0.2–2.7 nmol) causes a dose-dependent increase in gastric acid secretion in conscious rats (Takahashi et al. 1999, Okumura et al. 2001). In contrast, peripherally (i.v. and i.p) administrated OXA had no effect on pancreatic or gastric secretion (Takahashi et al. 1999, Miyasaka et al. 2002). In our study, however, the close intra-arterial infusion of OXA caused a stimulation of duodenal HCO3 secretion, while i.c.v. infusion of the peptide had no significant effect. Moreover, luminal administration of OXA did not affect duodenal HCO3 secretion, indicating that OXA acts at basolateral receptors. Our results provide the evidence that effects of OXA on duodenal HCO3 secretion may reflect the peripheral actions of orexins. In the current study, we show the presence of both orexin receptors on the mRNA level and OX1R on the protein level in the rat duodenal mucosa. In addition, OX1R and OX2R mRNA are expressed in the rat duodenal enterocytes. OX1R mRNA is expressed in epithelial cells, while OX2R mRNA can be found in the nonepithelial fraction of rat jejunal mucosa (Ducroc et al. 2007). PPO, OX1R and/or OX2R mRNA, as well as OXA and/or both receptors on the protein level, are found in submucosal and myenteric plexa and in interconnecting neurons (Kirchgessner & Liu 1999, Naslund et al. 2002, Nakabayashi et al. 2003, Ehrstrom et al. 2005a). Matsuo et al. demonstrated that the cholinergic system is involved in the OXA induced contraction of guinea-pig ileum (Matsuo et al. 2002). Many of the central actions of orexins are mediated by cholinergic mechanisms (Tsujino & Sakurai 2009). Overnight fasting induced an 100-fold decrease in sensitivity to the muscarinic agonist bethanechol (Flemstrom et al. 2003). In many species, duodenal HCO3 secretion is mediated through muscarinic dependent processes (Jonson et al. 1986, Nylander et al. 1987, Ballesteros et al. 1991, Glad et al. 1997). In our study, the muscarinic antagonist atropine abolished the bethanechol induced stimulation of duodenal secretion. Atropine did not affect the secretory response to OXA. Neither did SB-334867 have an effect on secretion induced by the bethanechol. OXA induced intracellular calcium signaling in clusters of enterocytes, and the pretreatment with atropine, did not inhibit this response. Microscopical analysis of enterocytes confirmed that no enteric neurons were detectable during experiments. In conclusion, our findings strongly indicate that OXA acts directly on intestinal 111 enterocytes through OX1R. A lower proportion of enterocytes in clusters responded to OXA, when compared with similar responses seen with melatonin or carbachol (~40%). The reason might be that feeding induces an expression of orexin receptors only in a limited number of the enterocytes. In addition, the location, maturation and development of enterocytes might also influence the expression. Experimental studies of gastrointestinal physiology and pathophysiology in humans and animals have been generally performed after an overnight fast (Flemstrom et al. 2010). This is an old tradition originating from Pavlov´s laboratory. Fasting results either in upregulation or downregulation of orexins and its receptors. Hypothalamic PPO mRNA levels are increased after 48 h fast in rats (Sakurai et al. 1998, Cai et al. 1999) Similarly, OX1R mRNA levels in the VMH and the medial division of amygdala, as well as OX2R mRNA levels in the ARC increased after a 20 h fast in rats (Lu et al. 2000b). Interestingly, a 24 h fasting period leads to downregulation of the OX1R and OX2R mRNA levels in the rat adrenal cortex, while in the hypothalamus the levels are naturally upregulated (Karteris et al. 2005). Our results demonstrated that an overnight fast for 16 h decreases OX1R and OX2R mRNA expression, as well as OX1R protein expression on rat duodenal mucosa. Fasting abolishes duodenal HCO3 secretory response to OXA occurring in fed rats. In addition, OXA induced intracellular calcium signaling in freshly isolated duodenal enterocytes from fed rats, while no significant response was observed in cells obtained from fasted rats. A similar 2+ pattern of [Ca ]i rise was observed also in human enterocytes treated with a high concentration of OXA (100 nM), although with a smaller magnitude of response. However, the patients were advised not to eat in the morning before the endoscopy. Thus, the restriction of food intake was not directly comparable to that of short overnight fasting. In addition, humans show a lower metabolic rate and remarkable differences also in rates of intestinal fluid and water transport (Pappenheimer 1998). Food deprivation for 16 h downregulates the orexin receptors expression on the mRNA level in rat freshly isolated duodenal 2+ enterocytes. Treatment with carbachol, a cholinergic agonist, induced [Ca ]i response also in enterocytes from starved rats that did not respond to OXA, indicating that short fasting does not induce a general decline in receptors expression. Short overnight fasting does not affect duodenal secretory responses to close intra-arterially infused VIP, melatonin, 5-HT, uroguanylin or PGE2 (Flemstrom et al. 2003, Safsten et al. 2006, Bengtsson et al. 2007, Flemstrom et 112 al. 2010). Our results show that studies made on intestinal secretion or effects of drug therapy require particular evaluation with respect to the feeding status. The mechanisms by which feeding modulates the intestinal responses to OXA are still unclear. One explanation could be that nutrients have a stimulatory action on orexin receptors’ expression. The intestinal mucosa is equipped with different types of detectors, such as neurons and endocrine cells, and it is in contact with different intestinal contents (Furness et al. 1999). Again, it can detect and respond to changes in luminal content. Orexins are present both in enterochromaffin cells and in nerve endings of enteric neurons (Kirchgessner & Liu 1999, Naslund et al. 2002). Thus, a paracrine/endocrine orexin-mediated response may lead to upregulation of orexin receptors in response to food. Recently, Bengtsson et al. demonstrated that glucose (liquid nutrient, 8.5 kJ/ml), but not other nutrients, introduced to the GI-tract via a gavage, prepared the duodenum for OXA-induced HCO3 response in overnight fasted rats (Bengtsson 2008). OXA induced intracellular calcium signaling at all tested doses in acutely 2+ isolated duodenal enterocytes isolated from fed rats. The rise in [Ca ]i was slow and no clear initial peak response was observed. In addition, a sustained plateau was observed even after the removal of OXA. This signaling pattern is comparable to that induced by 5-HT in acutely isolated enterocytes and to that produced by OXA in LTD and DR neurons (Kohlmeier et al. 2004, Safsten et al. 2+ 2006). OXA increased [Ca ]i also in rat duodenal enterocytes in the absence of 2+ extracellular calcium. OXA is likely to increase the enterocyte [Ca ]i by release of calcium from the endoplasmic reticulum as well as by an influx of extracellular calcium via store-operated calcium channels (Lund et al. 2000, Kukkonen & Akerman 2001, Larsson et al. 2005). In conclusion, our study demonstrates that OXA stimulates duodenal mucosal HCO3 secretion via basolateral OX1Rs. In addition, OXA induces intracellular calcium signaling in acutely isolated rat and human duodenal enterocytes. Moreover, a short overnight food deprivation decreased orexin receptors expression and abolished the secretory response to OXA, as well as the induction of intracellular calcium signaling. 113 6.3 Methodological considerations 6.3.1 hPPO overexpressing mice The generation of transgenic mice The present study was designed to use different experimental and methodological approaches, in order to answer the aims set out at the start of this thesis. The generation of genetically engineered mice, with either overexpressing or a knocking out of the desired gene/genes, is a common technique for determining gene functions and the interrelationship between proteins in vivo. The major advantages of the overexpression mice models are that high levels of target gene expression can usually be achieved, and the animals often demonstrate a positive phenotype. However, integration of the transgene into the genome can affect viability, fertility, tissue specificity and levels of transgene expression. (Williams & Wagner 2000) Our hPPO overexpressing mice were viable and fertile. In addition, the transgene was harbored only in one place of the genome. The overexpression of the gene was observed only in tissues known for their positivity for orexins expression. The random integration process can lead to inappropriate insertion of the transgene into the genome. Due to the disruption of some endogenous gene, different biochemical routes and physiological systems might be affected. Thus we cannot fully exclude the possibility of the inappropriate insertion of the hPPO transgene in our mice. In the present study, the hPPO transgene expression did not have any effect on mouse endogenous PPO levels in tg mice. Thus, it could be questioned whether the orexin co-expressed peptides or proteins are not affected by the hPPO overexpression. Our unpublished data, however, shows that the effect of hPPO overexpression also affected the orexin co-expressed peptides such as POMC and GHRH (data not shown). It could be speculated that some of the current findings observed in our study are due to the overexpression of orexins, i.e. not from a normal actions of orexins. However, most of our findings were strongly supported by further studies made by other groups. Thus, in general, our findings seem to reflect the normal physiological functions of orexins. 114 Measurement of OXA using RIA Heinonen et al. demonstrated recently that significant differences may occur between the results obtained from different laboratories in regard to immunoreactive OXA levels measured with RIA (Heinonen et al. 2008). However, the obtained results still show the relative differences between experimental groups. In our experiments, this was of importance in showing the differences of OXA plasma concentrations between wt and tg mice, and confirming the overexpression of orexins in our tg mice. Effects of genetic background The genetic background of the wt and tg mice used in this study was CD2 (a hybrid of a Balb/c × DBA/2). It has been shown, that EEG patterns show a high degree of heritability, and distinct differences in SWS delta exist between Balb/c × DBA/2 strains (Franken et al. 1998). In addition, BALB/c mice show a weak diurnal rhythm (Valatx & Bugat 1974). Therefore, we cannot exclude the possibility that the observed differences in circadian distribution of vigilance states and in EEG power found in the present study are partly due to the mixed genetic background the strain (Valatx & Bugat 1974, Franken et al. 2001). Both Balb/c and DBA2 strains show a relative resistance to high fat diet- induced glucose intolerance and obesity (Fearnside et al. 2008). In addition, even when fed with a control diet, these two strains gain significantly less weight than, for example, C57BL/6 mice. C57BL/6 mice overexpressing rat PPO under β- actin/cytomegalovirus hybrid promoter (CAG/orexin) show increased heat production only when fed on a high fat diet (Funato et al. 2009). Thus, it is possible that the CD2 background itself may somehow facilitate the actions of orexin overexpression on heat production in our hPPO tg mice. Vigilance state scoring In the present study, both wt and tg mice showed a high number of brief awakenings per hour. The numbers for wt mice were 22 ± 4 (lights on) and 13 ± 1 (lights off), and for the tg mice, these were 27 ± 2 (lights on) and 16 ± 2 (lights off). Studies using longer epochs, such as 10 s, show a generally lower number of brief awakenings or wake bouts (Diniz Behn et al. 2008). In our study, the vigilance states were scored by 2 s epochs, and brief awakenings were counted as 115 waking episodes from SWS between 2 and 12 s. In addion, the brief awakenings were scored only if both muscle activation and a clear EEG arousal (desynchronization/amplitude decrease) were detected together. When including short lasting arousals also, the number of brief awakenings is higher than in some published reports where only longer arousals have been counted (Diniz Behn et al. 2008). However, literature and strain differences can greatly affect the number of brief awakenings (Huber et al. 2000). Thus, our results are in accordance with other similarly performed studies. LabMaster measurements The analyses of feeding, drinking, locomotor activity and calorimetry were performed using an automated monitoring system, LabMaster, allowing us to measure 8 mice simultaneously when the experiments were done at RT. Only age- matched 3 months ± 1 week old male mice were used in this study. Before each individual experiment the mice were housed in similar cages to that of experimental conditions for one week. When mice cages were put in a climate chamber for the cold exposure studies, we were able to measure 3 mice at once. Thus the measurement of 15 mice occurred within 1.5 months. However, the groups were age-matched in order to have all mice 3.5 months ± 1.5 week old at the time of experiments. The environmental factors, which were temperature, humidity and day/night light cycle, were continuously controlled. Thus, it is unlikely that the relatively long time gap between the experiments affected the results. In addition, the genotypes were randomly chosen by drawn lots in every run. Furthermore, only persons familiar to the mice were allowed to perform the analysis, thus minimizing any stress. 6.3.2 In situ and in vitro experiments studying the effects of orexins on duodenal HCO3 secretion Drugs used The OX1R antagonist SB-334867 shows up to a 50-fold higher sensitivity for OX1R over OX2R in vitro (Smart et al. 2001). The usage of the antagonist is extensive, and it can be considered as a valuable tool for studying the effects of OXA (Bingham et al. 2006, Heinonen et al. 2008). In our studies, a partial agonist 116 action of SB-334867 was observed in both in vivo and in vitro experiments. Thus, only low doses of the antagonist were used in the present study to test whether 2+ SB-334867 inhibits the HCO3 secretion response in rat duodenum or [Ca ]i response in the duodenal enterocyte clusters to OXA. Results from CHO cells show that OX1R has a 10 times higher affinity for OXA than for OXB, whereas OX2R has an equal affinity for both peptides (Sakurai et al. 1998). In the present study, we could not totally exclude the possibility that OX2Rs might also have a role in mediating the action of OXA on small intestinal secretion. During the time of the experiments, no commercial selective OX2R antagonist was present. However, in our in vitro study we used a highly selective OXB agonist, (Ala11,D-Leu15)-orexin-B, which has a 400-fold 2+ selectivity for OX2R over OX1R, as observed from [Ca ]i responses in the CHO- K1 cells (Asahi et al. 2003). The agonist was added to the perfusate using the 2+ same concentrations as was used for OXA, and it did not affect [Ca ]i. This 2+ provides further evidence that the orexin-induced [Ca ]i response is mediated through OX1Rs. Close intra-arterial infusion In the present study, we used a close intra-arterial infusion for the infusion of OXA and SB-334967. This technique allows the use of very small amounts of compound, thereby minimizing the effect of the CNS. In our study, the intra- arterially administered OXA caused a stimulation of duodenal bicarbonate secretion, while the i.c.v. injection of OXA was without a significant effect. We observed a slight increase in HCO3 secretion after an i.c.v. infusion of OXA. However, that was similar to those seen in rats treated with vehicle. Thus, our results show strong evidence that OXA acts peripherally on small intestinal secretion. Animal preparation In the present study, the close intra-arterial infusion of OXA stimulated duodenal HCO3 secretion in the fed rats, while i.c.v. infusion was without a significant effect. The absence of a secretory response to central OXA could reflect an operation induced damage of vagal nerves. When penetrating the diaphragm, the abdominal vagal trunks separate into three branches, namely the paired gastric and celiac branches and the unpaired branch (Berthoud et al. 1991). The 117 duodenum receives fibers from the branches, and axons from the gastric branches go through the pyloric sphincter to the duodenum (Zhang et al. 2000). In our experimental setup (Study III, Fig. 1), the duodenum was never cut. The hepatic branch, entering the duodenum via the perivascular plexuses of the hepatic, gastroduodenal, and superior pancreaticoduodenal arteries, innervates the duodenum. In the present study, the stimulatory action of i.c.v. administered TRH was confirmed. The present type of in situ chamber preparation have been used in studies demonstrating that i.c.v. administration of the TRH or the catecholamine phenylephrine induces vagally mediated stimulation of duodenal alkaline secretion (Flemstrom & Jedstedt 1989, Larson et al. 1996, Zhang et al. 2000, Sjoblom et al. 2001). In addition, electrical stimulation of the cut cervical vagal nerves, in the distal direction, stimulates HCO3 secretion in rat and cat duodenum in situ (Jonson et al. 1986, Nylander et al. 1987). Thus, we have evidenced that the cannulated duodenum has functional vagal innervations. Animal control during experiments During the present experiments, we monitored blood pressure, and analysed the acid-base balance as well as the blood glucose concentration of the rats. No differences were observed in the acid-base balances, and some groups showed only a slight decline in the blood HCO3 concentrations. The mean arterial blood pressures remained ≥90 mmHg in all rats. Thus, it can be concluded that our rats were maintained in good condition for studying epithelial acid-base transport. In most rats treated by intra-arterial OXA or SB-334867, a decrease was observed in blood glucose concentration during the experiment. However, the decreases did not differ significantly from those observed with control rats infused with vehicle alone. Previous studies have shown that administration of OXA to specific brain areas causes dose-dependent increases in the heart rate and mean arterial blood pressure (Chen et al. 2000, de Oliveira et al. 2003, Zhang et al. 2005). Of note, the regulation of cardiovascular functions seems to be age dependent (Hirota et al. 2003). In our study, rats aged only between 7- to 9-week-old were used. Thus, this might have affected the observed absence of blood pressure effects. OXA is a highly lipophilic peptide that easily passes brain tissue (Kastin & Akerstrom 1999). The manner of administration as well as the acid-base balance and general condition of the animals may influence the response. 118 6.4 Future aspects Orexins are multifunctional peptides that are involved in several physiological functions including sleep/wake, energy homeostasis and intestinal secretion. Right after the discovery of orexins and their receptors, the majority of the studies concentrated on the central actions and regulation of the orexin system. However, lately, an increasing number of studies have implicated the role of orexins also in the periphery. In the present study, the associations of orexins on sleep/wake regulation, as well as in energy homeostasis were further investigated using a novel transgenic mouse line overexpressing hPPO under its endogenous promoter (Figure 14). In addition, we studied the effects of short overnight fasting on orexin receptors expression, and in OXA induced HCO3 secretory response both in situ in the rat duodenum and in vitro in acutely isolated duodenal enterocytes (Figure 14). The hPPO tg mice showed a significant reduction in REM sleep, both during the day and the night, and differences in vigilance state amounts in the light/dark transition periods. These findings support the role of the orexin system in the regulation of REM sleep and propose an important functioning role for them in the regulation of the circadian system. Further studies are required to better understand the mechanism for the ability of tg mice to release their sleep pressure when awake during SD. Tg mice, housed in RT, showed an increased metabolic heat production and significantly elevated day time food intake. An acute cold exposure balanced the effects of non-shivering heat production between the genotypes, and tg mice decreased significantly their total locomotor activity due to a response to the cold. Only UCP2 mRNA in WAT, but not UCP1 mRNA in BAT, was elevated in tg mice. The reason for that is not clear, and further studies should be done to understand the possible involvement of WAT UCP2 in regard to increased energy metabolism. Due to the present accepted knowledge, only BAT UCP1 is a mediator of cold induced thermogenesis. Thus, other possible mechanisms behind the observed increase in heat production in the current study need to be considered for study further. 119 Mechanisms to Other factors Role of UCP2 in overcome sleep related to heat heat production pressure during SD production UCP2 mRNA expression Effects on sleep/wakefulnessin Effects on energyhomeostasis in WAT hPPO tg mice: in hPPO tg mice: REM sleep Day time food intake Circadian distribution of vigilance Heat production states Acute cold exposure Total activity Orexin system Effects on duodenalsecretion: Short overnight food deprivation OX1R expression 2+ Abolition of OXA induced [Ca ]I - signaling and HCO3 secretion Role of Effects of nutrients OX2R on receptor(s) expression Fig. 14. Mind map illustrating the major findings of the present thesis and consequent ideas for future studies. Our study demonstrated that stimulation of duodenal mucosal HCO3 secretion by peripheral OXA is mediated via duodenal basolateral OX1Rs. In addition, OXA induced a signaling of intracellular calcium in acutely isolated rat and human duodenal enterocytes. Furthermore, a short overnight food deprivation decreased orexin receptors expression and abolished the secretory response to OXA, as well as induction of intracellular calcium signaling. Even though we provided very strong evidence that the intestinal secretory action of OXA is mediated via OX1Rs, we cannot exclude the possible role of OX2Rs also on this aspect. Thus, studies using a selective OX2R antagonist should be conducted in the near future. In addition, results from overnight food deprivation induced receptor downregulation suggest that studying intestinal secretion and the effects of drug therapy require particular evaluation with respect to feeding status. In summary, the results from the present study further demonstrated that orexins have an important role in both the regulation of sleep/wake functions and energy homeostasis. In addition, we showed that the peripheral orexin system has a significant role in duodenal mucosal HCO3 secretion. Since orexins have wide- 120 ranging influences on a great variety a physiological processes, the possibilities of the therapeutical use of orexins and their agonists or antagonists have been intensively studied (Neubauer 2010, Ritchie et al. 2010, Zhou et al. 2010). Our results here provide new insights in the field of basic research which is important for understanding the regulatory mechanisms of the orexin system. 121 122 7 Conclusions In the current study, the major conclusions were: 1. The hPPO overexpressing mice showed a significant reduction in REM sleep during both day and night, and differences in the amount of vigilance states during the light/dark transition periods. 2. The tg mice showed an increased metabolic heat production and significantly elevated day time food intake at RT. An acute cold exposure balanced the effects of heat production observed at RT between genotypes. In addition, tg mice decreased their locomotor activity in response to cold. 3. A short overnight fasting resulted in a decrease of orexin receptors’ expression, and abolished OXA induced duodenal mucosal HCO3 secretion in rats. 4. A short overnight fasting inhibited OX1R expression and OXA induced intracellular calcium signalling in acutely isolated duodenal enterocytes. 123 124 References Adam JA, Menheere PP, van Dielen FM, Soeters PB, Buurman WA & Greve JW (2002) Decreased plasma orexin-A levels in obese individuals. Int J Obes Relat Metab Disord 26(2): 274–6. Adamantidis AR, Zhang F, Aravanis AM, Deisseroth K & de Lecea L (2007) Neural substrates of awakening probed with optogenetic control of hypocretin neurons. Nature 450(7168): 420–4. Akiyama M, Yuasa T, Hayasaka N, Horikawa K, Sakurai T & Shibata S (2004) Reduced food anticipatory activity in genetically orexin (hypocretin) neuron-ablated mice. Eur J Neurosci 20(11): 3054–62. Al-Barazanji KA, Wilson S, Baker J, Jessop DS & Harbuz MS (2001) Central orexin-A activates hypothalamic-pituitary-adrenal axis and stimulates hypothalamic corticotropin releasing factor and arginine vasopressin neurones in conscious rats. J Neuroendocrinol 13(5): 421–4. Alam MN, Gong H, Alam T, Jaganath R, McGinty D & Szymusiak R (2002) Sleep- waking discharge patterns of neurons recorded in the rat perifornical lateral hypothalamic area. J Physiol 538(Pt 2): 619–31. Allen A & Flemstrom G (2005) Gastroduodenal mucus bicarbonate barrier: protection against acid and pepsin. Am J Physiol Cell Physiol 288(1): C1–19. Ammoun S, Johansson L, Ekholm ME, Holmqvist T, Danis AS, Korhonen L, Sergeeva OA, Haas HL, Akerman KE & Kukkonen JP (2006a) OX1 orexin receptors activate extracellular signal-regulated kinase in Chinese hamster ovary cells via multiple mechanisms: the role of Ca2+ influx in OX1 receptor signaling. Mol Endocrinol 20(1): 80–99. Ammoun S, Lindholm D, Wootz H, Akerman KE & Kukkonen JP (2006b) G-protein- coupled OX1 orexin/hcrtr-1 hypocretin receptors induce caspase-dependent and - independent cell death through p38 mitogen-/stress-activated protein kinase. J Biol Chem 281(2): 834–42. Aoi M, Aihara E, Nakashima M & Takeuchi K (2004) Participation of prostaglandin E receptor EP4 subtype in duodenal bicarbonate secretion in rats. Am J Physiol Gastrointest Liver Physiol 287(1): G96–103. Arihara Z, Takahashi K, Murakami O, Totsune K, Sone M, Satoh F, Ito S, Hayashi Y, Sasano H & Mouri T (2000) Orexin-A in the human brain and tumor tissues of ganglioneuroblastoma and neuroblastoma. Peptides 21(4): 565–70. Arihara Z, Takahashi K, Murakami O, Totsune K, Sone M, Satoh F, Ito S & Mouri T (2001) Immunoreactive orexin-A in human plasma. Peptides 22(1): 139–42. Arrigoni E, Mochizuki T & Scammell TE (2009) Activation of the basal forebrain by the orexin/hypocretin neurones. Acta Physiol (Oxf) 198(3): 223–35. Arsenijevic D, Onuma H, Pecqueur C, Raimbault S, Manning BS, Miroux B, Couplan E, Alves-Guerra MC, Goubern M, Surwit R, Bouillaud F, Richard D, Collins S & Ricquier D (2000) Disruption of the uncoupling protein-2 gene in mice reveals a role in immunity and reactive oxygen species production. Nat Genet 26(4): 435–9. 125 Asahi S, Egashira S, Matsuda M, Iwaasa H, Kanatani A, Ohkubo M, Ihara M & Morishima H (2003) Development of an orexin-2 receptor selective agonist, [Ala(11), D- Leu(15)]orexin-B. Bioorg Med Chem Lett 13(1): 111–3. Asakawa A, Inui A, Inui T, Katsuura G, Fujino MA & Kasuga M (2002) Orexin reverses cholecystokinin-induced reduction in feeding. Diabetes Obes Metab 4(6): 399–401. Aubert J, Champigny O, Saint-Marc P, Negrel R, Collins S, Ricquier D & Ailhaud G (1997) Up-regulation of UCP-2 gene expression by PPAR agonists in preadipose and adipose cells. Biochem Biophys Res Commun 238(2): 606–11. Backberg M, Hervieu G, Wilson S & Meister B (2002) Orexin receptor-1 (OX-R1) immunoreactivity in chemically identified neurons of the hypothalamus: focus on orexin targets involved in control of food and water intake. Eur J Neurosci 15(2): 315–28. Baldo BA, Gual-Bonilla L, Sijapati K, Daniel RA, Landry CF & Kelley AE (2004) Activation of a subpopulation of orexin/hypocretin-containing hypothalamic neurons by GABAA receptor-mediated inhibition of the nucleus accumbens shell, but not by exposure to a novel environment. Eur J Neurosci 19(2): 376–86. Ballesteros MA, Wolosin JD, Hogan DL, Koss MA & Isenberg JI (1991) Cholinergic regulation of human proximal duodenal mucosal bicarbonate secretion. Am J Physiol 261(2 Pt 1): G327–31. Baranowska B, Wolinska-Witort E, Martynska L, Chmielowska M & Baranowska-Bik A (2005) Plasma orexin A, orexin B, leptin, neuropeptide Y (NPY) and insulin in obese women. Neuro Endocrinol Lett 26(4): 293–6. Barreiro ML, Pineda R, Gaytan F, Archanco M, Burrell MA, Castellano JM, Hakovirta H, Nurmio M, Pinilla L, Aguilar E, Toppari J, Dieguez C & Tena-Sempere M (2005) Pattern of orexin expression and direct biological actions of orexin-a in rat testis. Endocrinology 146(12): 5164–75. Barreiro ML, Pineda R, Navarro VM, Lopez M, Suominen JS, Pinilla L, Senaris R, Toppari J, Aguilar E, Dieguez C & Tena-Sempere M (2004) Orexin 1 receptor messenger ribonucleic acid expression and stimulation of testosterone secretion by orexin-A in rat testis. Endocrinology 145(5): 2297–306. Beck B, Richy S, Dimitrov T & Stricker-Krongrad A (2001) Opposite regulation of hypothalamic orexin and neuropeptide Y receptors and peptide expressions in obese Zucker rats. Biochem Biophys Res Commun 286(3): 518–23. Beiras-Fernandez A, Gallego R, Blanco M, Garcia-Caballero T, Dieguez C & Beiras A (2004) Merkel cells, a new localization of prepro-orexin and orexin receptors. J Anat 204(2): 117–22. Bengtsson MW (2008) Effects of Orexins, Guanylins and Feeding on Duodenal Bicarbonate Secretion and Enterocyte Intracellular Signaling. Digital Comprehensive Summary thesis. Uppsala University, Department of Neuroscience, Division of Physiology. Bengtsson MW, Jedstedt G & Flemstrom G (2007) Duodenal bicarbonate secretion in rats: stimulation by intra-arterial and luminal guanylin and uroguanylin. Acta Physiol (Oxf) 191(4): 309–17. 126 Berthoud HR, Carlson NR & Powley TL (1991) Topography of efferent vagal innervation of the rat gastrointestinal tract. Am J Physiol 260(1 Pt 2): R200–7. Beuckmann CT, Sinton CM, Williams SC, Richardson JA, Hammer RE, Sakurai T & Yanagisawa M (2004) Expression of a poly-glutamine-ataxin-3 transgene in orexin neurons induces narcolepsy-cataplexy in the rat. J Neurosci 24(18): 4469–77. Binder HJ (2005) Gastric Function. In: Boron WF & Boulpaep EL (eds) Medical Physiology. Philadelphia, Elsevier Saunders: 903–905. Bingham MJ, Cai J & Deehan MR (2006) Eating, sleeping and rewarding: orexin receptors and their antagonists. Curr Opin Drug Discov Devel 9(5): 551–9. Blanco M, Gallego R, Garcia-Caballero T, Dieguez C & Beiras A (2003) Cellular localization of orexins in human anterior pituitary. Histochem Cell Biol 120(4): 259– 64. Blanco M, Garcia-Caballero T, Fraga M, Gallego R, Cuevas J, Forteza J, Beiras A & Dieguez C (2002) Cellular localization of orexin receptors in human adrenal gland, adrenocortical adenomas and pheochromocytomas. Regul Pept 104(1–3): 161–5. Blanco M, Lopez M, Garcia-Caballero T, Gallego R, Vazquez-Boquete A, Morel G, Senaris R, Casanueva F, Dieguez C & Beiras A (2001) Cellular localization of orexin receptors in human pituitary. J Clin Endocrinol Metab 86(4): 1616–9. Bonnavion P & de Lecea L (2010) Hypocretins in the control of sleep and wakefulness. Curr Neurol Neurosci Rep 10(3): 174–9. Borbely AA (1982) A two process model of sleep regulation. Hum Neurobiol 1(3): 195– 204. Borecky J, Maia IG & Arruda P (2001) Mitochondrial uncoupling proteins in mammals and plants. Biosci Rep 21(2): 201–12. Borgland SL, Storm E & Bonci A (2008) Orexin B/hypocretin 2 increases glutamatergic transmission to ventral tegmental area neurons. Eur J Neurosci 28(8): 1545–56. Borgland SL, Taha SA, Sarti F, Fields HL & Bonci A (2006) Orexin A in the VTA is critical for the induction of synaptic plasticity and behavioral sensitization to cocaine. Neuron 49(4): 589–601. Boss O, Samec S, Dulloo A, Seydoux J, Muzzin P & Giacobino JP (1997a) Tissue- dependent upregulation of rat uncoupling protein-2 expression in response to fasting or cold. FEBS Lett 412(1): 111–4. Boss O, Samec S, Paoloni-Giacobino A, Rossier C, Dulloo A, Seydoux J, Muzzin P & Giacobino JP (1997b) Uncoupling protein-3: a new member of the mitochondrial carrier family with tissue-specific expression. FEBS Lett 408(1): 39–42. Bouchard C, Perusse L, Chagnon YC, Warden C & Ricquier D (1997) Linkage between markers in the vicinity of the uncoupling protein 2 gene and resting metabolic rate in humans. Hum Mol Genet 6(11): 1887–9. Bouillaud F (2009) UCP2, not a physiologically relevant uncoupler but a glucose sparing switch impacting ROS production and glucose sensing. Biochim Biophys Acta 1787(5): 377–83. 127 Bourgin P, Huitron-Resendiz S, Spier AD, Fabre V, Morte B, Criado JR, Sutcliffe JG, Henriksen SJ & de Lecea L (2000) Hypocretin-1 modulates rapid eye movement sleep through activation of locus coeruleus neurons. J Neurosci 20(20): 7760–5. Boutrel B, Cannella N & de Lecea L (2010) The role of hypocretin in driving arousal and goal-oriented behaviors. Brain Res 1314: 103–11. Boutrel B, Kenny PJ, Specio SE, Martin-Fardon R, Markou A, Koob GF & de Lecea L (2005) Role for hypocretin in mediating stress-induced reinstatement of cocaine- seeking behavior. Proc Natl Acad Sci USA 102(52): 19168–73. Brisbare-Roch C, Dingemanse J, Koberstein R, Hoever P, Aissaoui H, Flores S, Mueller C, Nayler O, van Gerven J, de Haas SL, Hess P, Qiu C, Buchmann S, Scherz M, Weller T, Fischli W, Clozel M & Jenck F (2007) Promotion of sleep by targeting the orexin system in rats, dogs and humans. Nat Med 13(2): 150–5. Bronsky J, Nedvidkova J, Zamrazilova H, Pechova M, Chada M, Kotaska K, Nevoral J & Prusa R (2007) Dynamic changes of orexin A and leptin in obese children during body weight reduction. Physiol Res 56(1): 89–96. Brown RE, Sergeeva OA, Eriksson KS & Haas HL (2002) Convergent excitation of dorsal raphe serotonin neurons by multiple arousal systems (orexin/hypocretin, histamine and noradrenaline). J Neurosci 22(20): 8850–9. Brown TM, Coogan AN, Cutler DJ, Hughes AT & Piggins HD (2008) Electrophysiological actions of orexins on rat suprachiasmatic neurons in vitro. Neurosci Lett 448(3): 273–8. Brownell SE & Conti B (2010) Age- and gender-specific changes of hypocretin immunopositive neurons in C57Bl/6 mice. Neurosci Lett 472(1): 29–32. Burdakov D, Gerasimenko O & Verkhratsky A (2005) Physiological changes in glucose differentially modulate the excitability of hypothalamic melanin-concentrating hormone and orexin neurons in situ. J Neurosci 25(9): 2429–33. Burdakov D, Jensen LT, Alexopoulos H, Williams RH, Fearon IM, O'Kelly I, Gerasimenko O, Fugger L & Verkhratsky A (2006) Tandem-pore K+ channels mediate inhibition of orexin neurons by glucose. Neuron 50(5): 711–22. Burdyga G, Lal S, Spiller D, Jiang W, Thompson D, Attwood S, Saeed S, Grundy D, Varro A, Dimaline R & Dockray GJ (2003) Localization of orexin-1 receptors to vagal afferent neurons in the rat and humans. Gastroenterology 124(1): 129–39. Burlet S, Tyler CJ & Leonard CS (2002) Direct and indirect excitation of laterodorsal tegmental neurons by Hypocretin/Orexin peptides: implications for wakefulness and narcolepsy. J Neurosci 22(7): 2862–72. Cadenas S, Buckingham JA, Samec S, Seydoux J, Din N, Dulloo AG & Brand MD (1999) UCP2 and UCP3 rise in starved rat skeletal muscle but mitochondrial proton conductance is unchanged. FEBS Lett 462(3): 257–60. Cadenas S, Echtay KS, Harper JA, Jekabsons MB, Buckingham JA, Grau E, Abuin A, Chapman H, Clapham JC & Brand MD (2002) The basal proton conductance of skeletal muscle mitochondria from transgenic mice overexpressing or lacking uncoupling protein-3. J Biol Chem 277(4): 2773–8. 128 Cai XJ, Widdowson PS, Harrold J, Wilson S, Buckingham RE, Arch JR, Tadayyon M, Clapham JC, Wilding J & Williams G (1999) Hypothalamic orexin expression: modulation by blood glucose and feeding. Diabetes 48(11): 2132–7. Cajochen C, Wyatt JK, Czeisler CA & Dijk DJ (2002) Separation of circadian and wake duration-dependent modulation of EEG activation during wakefulness. Neuroscience 114(4): 1047–60. Cannon B & Nedergaard J (2004) Brown adipose tissue: function and physiological significance. Physiol Rev 84(1): 277–359. Cannon B, Shabalina IG, Kramarova TV, Petrovic N & Nedergaard J (2006) Uncoupling proteins: a role in protection against reactive oxygen species--or not? Biochim Biophys Acta 1757(5–6): 449–58. Challet E (2010) Interactions between light, mealtime and calorie restriction to control daily timing in mammals. J Comp Physiol B 180(5): 631–44. Champigny O & Ricquier D (1990) Effects of fasting and refeeding on the level of uncoupling protein mRNA in rat brown adipose tissue: evidence for diet-induced and cold-induced responses. J Nutr 120(12): 1730–6. Chang H, Saito T, Ohiwa N, Tateoka M, Deocaris CC, Fujikawa T & Soya H (2007) Inhibitory effects of an orexin-2 receptor antagonist on orexin A- and stress-induced ACTH responses in conscious rats. Neurosci Res 57(3): 462–6. Chemelli RM, Willie JT, Sinton CM, Elmquist JK, Scammell T, Lee C, Richardson JA, Williams SC, Xiong Y, Kisanuki Y, Fitch TE, Nakazato M, Hammer RE, Saper CB & Yanagisawa M (1999) Narcolepsy in orexin knockout mice: molecular genetics of sleep regulation. Cell 98(4): 437–51. Chen CT, Hwang LL, Chang JK & Dun NJ (2000) Pressor effects of orexins injected intracisternally and to rostral ventrolateral medulla of anesthetized rats. Am J Physiol Regul Integr Comp Physiol 278(3): R692–7. Chen J & Randeva HS (2004) Genomic organization of mouse orexin receptors: characterization of two novel tissue-specific splice variants. Mol Endocrinol 18(11): 2790–804. Chen L, Thakkar MM, Winston S, Bolortuya Y, Basheer R & McCarley RW (2006) REM sleep changes in rats induced by siRNA-mediated orexin knockdown. Eur J Neurosci 24(7): 2039–48. Chen XW, Huang W, Yan JA, Fan HX, Guo N, Lu J, Xiu Y, Gu JL, Zhang CX, Ruan HZ, Hu ZA, Yu ZP & Zhou Z (2008) Reinvestigation of the effect of orexin A on catecholamine release from adrenal chromaffin cells. Neurosci Lett 436(2): 181–4. Chew CS, Safsten B & Flemstrom G (1998) Calcium signaling in cultured human and rat duodenal enterocytes. Am J Physiol 275(2 Pt 1): G296–304. Chou TC, Lee CE, Lu J, Elmquist JK, Hara J, Willie JT, Beuckmann CT, Chemelli RM, Sakurai T, Yanagisawa M, Saper CB & Scammell TE (2001) Orexin (hypocretin) neurons contain dynorphin. J Neurosci 21(19): RC168. Ciriello J, Li Z & de Oliveira CV (2003) Cardioacceleratory responses to hypocretin-1 injections into rostral ventromedial medulla. Brain Res 991(1–2): 84–95. 129 Cohade C, Mourtzikos KA & Wahl RL (2003a) "USA-Fat": prevalence is related to ambient outdoor temperature-evaluation with 18F-FDG PET/CT. J Nucl Med 44(8): 1267–70. Cohade C, Osman M, Pannu HK & Wahl RL (2003b) Uptake in supraclavicular area fat ("USA-Fat"): description on 18F-FDG PET/CT. J Nucl Med 44(2): 170–6. Conti B, Sanchez-Alavez M, Winsky-Sommerer R, Morale MC, Lucero J, Brownell S, Fabre V, Huitron-Resendiz S, Henriksen S, Zorrilla EP, de Lecea L & Bartfai T (2006) Transgenic mice with a reduced core body temperature have an increased life span. Science 314(5800): 825–8. Cox CD, Breslin MJ, Whitman DB, Schreier JD, McGaughey GB, Bogusky MJ, Roecker AJ, Mercer SP, Bednar RA, Lemaire W, Bruno JG, Reiss DR, Harrell CM, Murphy KL, Garson SL, Doran SM, Prueksaritanont T, Anderson WB, Tang C, Roller S, Cabalu TD, Cui D, Hartman GD, Young SD, Koblan KS, Winrow CJ, Renger JJ & Coleman PJ (2010) Discovery of the Dual Orexin Receptor Antagonist [(7R)-4-(5- Chloro-1,3-benzoxazol-2-yl)-7-methyl-1,4-diazepan-1-yl][5-methy l-2-(2H-1,2,3- triazol-2-yl)phenyl]methanone (MK-4305) for the Treatment of Insomnia. J Med Chem 53(14): 5320–32. Cusin I, Zakrzewska KE, Boss O, Muzzin P, Giacobino JP, Ricquier D, Jeanrenaud B & Rohner-Jeanrenaud F (1998) Chronic central leptin infusion enhances insulin- stimulated glucose metabolism and favors the expression of uncoupling proteins. Diabetes 47(7): 1014–9. Cutler DJ, Morris R, Sheridhar V, Wattam TA, Holmes S, Patel S, Arch JR, Wilson S, Buckingham RE, Evans ML, Leslie RA & Williams G (1999) Differential distribution of orexin-A and orexin-B immunoreactivity in the rat brain and spinal cord. Peptides 20(12): 1455–70. Cypess AM, Lehman S, Williams G, Tal I, Rodman D, Goldfine AB, Kuo FC, Palmer EL, Tseng YH, Doria A, Kolodny GM & Kahn CR (2009) Identification and importance of brown adipose tissue in adult humans. N Engl J Med 360(15): 1509–17. Dahlman I, Forsgren M, Sjogren A, Nordstrom EA, Kaaman M, Naslund E, Attersand A & Arner P (2006) Downregulation of electron transport chain genes in visceral adipose tissue in type 2 diabetes independent of obesity and possibly involving tumor necrosis factor-alpha. Diabetes 55(6): 1792–9. Dalal MA, Schuld A, Haack M, Uhr M, Geisler P, Eisensehr I, Noachtar S & Pollmacher T (2001) Normal plasma levels of orexin A (hypocretin-1) in narcoleptic patients. Neurology 56(12): 1749–51. Date Y, Ueta Y, Yamashita H, Yamaguchi H, Matsukura S, Kangawa K, Sakurai T, Yanagisawa M & Nakazato M (1999) Orexins, orexigenic hypothalamic peptides, interact with autonomic, neuroendocrine and neuroregulatory systems. Proc Natl Acad Sci USA 96(2): 748–53. Deboer T, Overeem S, Visser NA, Duindam H, Frolich M, Lammers GJ & Meijer JH (2004) Convergence of circadian and sleep regulatory mechanisms on hypocretin-1. Neuroscience 129(3): 727–32. 130 Dibner C, Schibler U & Albrecht U (2010) The mammalian circadian timing system: organization and coordination of central and peripheral clocks. Annu Rev Physiol 72: 517–49. Digby JE, Chen J, Tang JY, Lehnert H, Matthews RN & Randeva HS (2006) Orexin receptor expression in human adipose tissue: effects of orexin-A and orexin-B. J Endocrinol 191(1): 129–36. Digby JE, Crowley VE, Sewter CP, Whitehead JP, Prins JB & O'Rahilly S (2000) Depot- related and thiazolidinedione-responsive expression of uncoupling protein 2 (UCP2) in human adipocytes. Int J Obes Relat Metab Disord 24(5): 585–92. DiLeone RJ, Georgescu D & Nestler EJ (2003) Lateral hypothalamic neuropeptides in reward and drug addiction. Life Sci 73(6): 759–68. Diniz Behn CG, Kopell N, Brown EN, Mochizuki T & Scammell TE (2008) Delayed orexin signaling consolidates wakefulness and sleep: physiology and modeling. J Neurophysiol 99(6): 3090–103. Dube MG, Kalra SP & Kalra PS (1999) Food intake elicited by central administration of orexins/hypocretins: identification of hypothalamic sites of action. Brain Res 842(2): 473–7. Ducroc R, Voisin T, El Firar A & Laburthe M (2007) Orexins control intestinal glucose transport by distinct neuronal, endocrine, and direct epithelial pathways. Diabetes 56(10): 2494–500. Dudley CA, Erbel-Sieler C, Estill SJ, Reick M, Franken P, Pitts S & McKnight SL (2003) Altered patterns of sleep and behavioral adaptability in NPAS2-deficient mice. Science 301(5631): 379–83. Easton A, Meerlo P, Bergmann B & Turek FW (2004) The suprachiasmatic nucleus regulates sleep timing and amount in mice. Sleep 27(7): 1307–18. Echtay KS (2007) Mitochondrial uncoupling proteins--what is their physiological role? Free Radic Biol Med 43(10): 1351–71. Edgar DM, Dement WC & Fuller CA (1993) Effect of SCN lesions on sleep in squirrel monkeys: evidence for opponent processes in sleep-wake regulation. J Neurosci 13(3): 1065–79. Eggermann E, Serafin M, Bayer L, Machard D, Saint-Mleux B, Jones BE & Muhlethaler M (2001) Orexins/hypocretins excite basal forebrain cholinergic neurones. Neuroscience 108(2): 177–81. Ehrstrom M, Gustafsson T, Finn A, Kirchgessner A, Gryback P, Jacobsson H, Hellstrom PM & Naslund E (2005a) Inhibitory effect of exogenous orexin a on gastric emptying, plasma leptin, and the distribution of orexin and orexin receptors in the gut and pancreas in man. J Clin Endocrinol Metab 90(4): 2370–7. Ehrstrom M, Levin F, Kirchgessner AL, Schmidt PT, Hilsted LM, Gryback P, Jacobsson H, Hellstrom PM & Naslund E (2005b) Stimulatory effect of endogenous orexin A on gastric emptying and acid secretion independent of gastrin. Regul Pept 132(1–3): 9– 16. 131 Ehrstrom M, Naslund E, Levin F, Kaur R, Kirchgessner AL, Theodorsson E & Hellstrom PM (2004) Pharmacokinetic profile of orexin A and effects on plasma insulin and glucagon in the rat. Regul Pept 119(3): 209–12. Ehrstrom M, Naslund E, Ma J, Kirchgessner AL & Hellstrom PM (2003) Physiological regulation and NO-dependent inhibition of migrating myoelectric complex in the rat small bowel by OXA. Am J Physiol Gastrointest Liver Physiol 285(4): G688–95. Elias CF, Saper CB, Maratos-Flier E, Tritos NA, Lee C, Kelly J, Tatro JB, Hoffman GE, Ollmann MM, Barsh GS, Sakurai T, Yanagisawa M & Elmquist JK (1998) Chemically defined projections linking the mediobasal hypothalamus and the lateral hypothalamic area. J Comp Neurol 402(4): 442–59. Elmquist JK, Elias CF & Saper CB (1999) From lesions to leptin: hypothalamic control of food intake and body weight. Neuron 22(2): 221–32. Enerback S, Jacobsson A, Simpson EM, Guerra C, Yamashita H, Harper ME & Kozak LP (1997) Mice lacking mitochondrial uncoupling protein are cold-sensitive but not obese. Nature 387(6628): 90–4. Espana RA, Baldo BA, Kelley AE & Berridge CW (2001) Wake-promoting and sleep- suppressing actions of hypocretin (orexin): basal forebrain sites of action. Neuroscience 106(4): 699–715. Fadel J & Deutch AY (2002) Anatomical substrates of orexin-dopamine interactions: lateral hypothalamic projections to the ventral tegmental area. Neuroscience 111(2): 379–87. Fadel J, Pasumarthi R & Reznikov LR (2005) Stimulation of cortical acetylcholine release by orexin A. Neuroscience 130(2): 541–7. Farkas B, Vilagi I & Detari L (2002) Effect of orexin-A on discharge rate of rat suprachiasmatic nucleus neurons in vitro. Acta Biol Hung 53(4): 435–43. Fearnside JF, Dumas ME, Rothwell AR, Wilder SP, Cloarec O, Toye A, Blancher C, Holmes E, Tatoud R, Barton RH, Scott J, Nicholson JK & Gauguier D (2008) Phylometabonomic patterns of adaptation to high fat diet feeding in inbred mice. PLoS ONE 3(2): e1668. Feldmann HM, Golozoubova V, Cannon B & Nedergaard J (2009) UCP1 ablation induces obesity and abolishes diet-induced thermogenesis in mice exempt from thermal stress by living at thermoneutrality. Cell Metab 9(2): 203–9. Flemstrom G (1980) Stimulation of HCO3- transport in isolated proximal bullfrog duodenum by prostaglandins. Am J Physiol 239(3): G198–203. Flemstrom G, Bengtsson MW, Makela K & Herzig KH (2010) Effects of short-term food deprivation on orexin-A-induced intestinal bicarbonate secretion in comparison with related secretagogues. Acta Physiol (Oxf) 198(3): 373–80. Flemstrom G, Garner A, Nylander O, Hurst BC & Heylings JR (1982) Surface epithelial HCO3(-) transport by mammalian duodenum in vivo. Am J Physiol 243(5): G348–58. Flemstrom G, Hallgren A, Nylander O, Engstrand L, Wilander E & Allen A (1999) Adherent surface mucus gel restricts diffusion of macromolecules in rat duodenum in vivo. Am J Physiol 277(2 Pt 1): G375–82. 132 Flemstrom G & Isenberg JI (2001) Gastroduodenal mucosal alkaline secretion and mucosal protection. News Physiol Sci 16: 23–8. Flemstrom G & Jedstedt G (1989) Stimulation of duodenal mucosal bicarbonate secretion in the rat by brain peptides. Gastroenterology 97(2): 412–20. Flemstrom G & Nylander O (1981) Stimulation of duodenal epithelial HCO3- transport in the guinea pig and cat by luminal prostaglandin E2. Prostaglandins 21 Suppl: 47–52. Flemstrom G & Sjoblom M (2005) Epithelial cells and their neighbors. II. New perspectives on efferent signaling between brain, neuroendocrine cells, and gut epithelial cells. Am J Physiol Gastrointest Liver Physiol 289(3): G377–80. Flemstrom G, Sjoblom M, Jedstedt G & Akerman KE (2003) Short fasting dramatically decreases rat duodenal secretory responsiveness to orexin A but not to VIP or melatonin. Am J Physiol Gastrointest Liver Physiol 285(6): G1091–6. Fleury C, Neverova M, Collins S, Raimbault S, Champigny O, Levi-Meyrueis C, Bouillaud F, Seldin MF, Surwit RS, Ricquier D & Warden CH (1997) Uncoupling protein-2: a novel gene linked to obesity and hyperinsulinemia. Nat Genet 15(3): 269– 72. Fogelholm M & Kukkonen-Harjula K (2000) Does physical activity prevent weight gain--a systematic review. Obes Rev 1(2): 95–111. Franken P, Chollet D & Tafti M (2001) The homeostatic regulation of sleep need is under genetic control. J Neurosci 21(8): 2610–21. Franken P, Malafosse A & Tafti M (1998) Genetic variation in EEG activity during sleep in inbred mice. Am J Physiol 275(4 Pt 2): R1127–37. Fuller PM, Gooley JJ & Saper CB (2006) Neurobiology of the sleep-wake cycle: sleep architecture, circadian regulation, and regulatory feedback. J Biol Rhythms 21(6): 482–93. Fuller PM, Lu J & Saper CB (2008) Differential rescue of light- and food-entrainable circadian rhythms. Science 320(5879): 1074–7. Funato H, Tsai AL, Willie JT, Kisanuki Y, Williams SC, Sakurai T & Yanagisawa M (2009) Enhanced orexin receptor-2 signaling prevents diet-induced obesity and improves leptin sensitivity. Cell Metab 9(1): 64–76. Furness JB, Kunze WA & Clerc N (1999) Nutrient tasting and signaling mechanisms in the gut. II. The intestine as a sensory organ: neural, endocrine, and immune responses. Am J Physiol 277(5 Pt 1): G922–8. Gallmann E, Arsenijevic D, Williams G, Langhans W & Spengler M (2006) Effect of intraperitoneal CCK-8 on food intake and brain orexin-A after 48 h of fasting in the rat. Regul Pept 133(1–3): 139–46. Gallopin T, Fort P, Eggermann E, Cauli B, Luppi PH, Rossier J, Audinat E, Muhlethaler M & Serafin M (2000) Identification of sleep-promoting neurons in vitro. Nature 404(6781): 992–5. Ganong WF (2005) Regulation of gastrointestinal function. In: Ganong WF (ed) Review of Medical Physiology. New York, McGraw-Hill Medical: 491, 503. 133 Georgescu D, Zachariou V, Barrot M, Mieda M, Willie JT, Eisch AJ, Yanagisawa M, Nestler EJ & DiLeone RJ (2003) Involvement of the lateral hypothalamic peptide orexin in morphine dependence and withdrawal. J Neurosci 23(8): 3106–11. Gimeno RE, Dembski M, Weng X, Deng N, Shyjan AW, Gimeno CJ, Iris F, Ellis SJ, Woolf EA & Tartaglia LA (1997) Cloning and characterization of an uncoupling protein homolog: a potential molecular mediator of human thermogenesis. Diabetes 46(5): 900–6. Glad H, Svendsen P, Olsen O & Schaffalitzky de Muckadell OB (1997) Importance of vagus nerves in duodenal acid neutralization in anesthetized pigs. Am J Physiol 272(1 Pt 1): G154–60. Golozoubova V, Cannon B & Nedergaard J (2006) UCP1 is essential for adaptive adrenergic nonshivering thermogenesis. Am J Physiol Endocrinol Metab 291(2): E350–7. Goncz E, Strowski MZ, Grotzinger C, Nowak KW, Kaczmarek P, Sassek M, Mergler S, El-Zayat BF, Theodoropoulou M, Stalla GK, Wiedenmann B & Plockinger U (2008) Orexin-A inhibits glucagon secretion and gene expression through a Foxo1-dependent pathway. Endocrinology 149(4): 1618–26. Gong DW, He Y, Karas M & Reitman M (1997) Uncoupling protein-3 is a mediator of thermogenesis regulated by thyroid hormone, beta3-adrenergic agonists, and leptin. J Biol Chem 272(39): 24129–32. Grynkiewicz G, Poenie M & Tsien RY (1985) A new generation of Ca2+ indicators with greatly improved fluorescence properties. J Biol Chem 260(6): 3440–50. Guba M, Kuhn M, Forssmann WG, Classen M, Gregor M & Seidler U (1996) Guanylin strongly stimulates rat duodenal HCO3- secretion: proposed mechanism and comparison with other secretagogues. Gastroenterology 111(6): 1558–68. Hagan JJ, Leslie RA, Patel S, Evans ML, Wattam TA, Holmes S, Benham CD, Taylor SG, Routledge C, Hemmati P, Munton RP, Ashmeade TE, Shah AS, Hatcher JP, Hatcher PD, Jones DN, Smith MI, Piper DC, Hunter AJ, Porter RA & Upton N (1999) Orexin A activates locus coeruleus cell firing and increases arousal in the rat. Proc Natl Acad Sci USA 96(19): 10911–6. Hany TF, Gharehpapagh E, Kamel EM, Buck A, Himms-Hagen J & von Schulthess GK (2002) Brown adipose tissue: a factor to consider in symmetrical tracer uptake in the neck and upper chest region. Eur J Nucl Med Mol Imaging 29(10): 1393–8. Hara J, Beuckmann CT, Nambu T, Willie JT, Chemelli RM, Sinton CM, Sugiyama F, Yagami K, Goto K, Yanagisawa M & Sakurai T (2001) Genetic ablation of orexin neurons in mice results in narcolepsy, hypophagia, and obesity. Neuron 30(2): 345–54. Hara J, Yanagisawa M & Sakurai T (2005) Difference in obesity phenotype between orexin-knockout mice and orexin neuron-deficient mice with same genetic background and environmental conditions. Neurosci Lett 380(3): 239–42. Harris GC, Wimmer M & Aston-Jones G (2005) A role for lateral hypothalamic orexin neurons in reward seeking. Nature 437(7058): 556–9. 134 Haynes AC, Chapman H, Taylor C, Moore GB, Cawthorne MA, Tadayyon M, Clapham JC & Arch JR (2002) Anorectic, thermogenic and anti-obesity activity of a selective orexin-1 receptor antagonist in ob/ob mice. Regul Pept 104(1–3): 153–9. Haynes AC, Jackson B, Chapman H, Tadayyon M, Johns A, Porter RA & Arch JR (2000) A selective orexin-1 receptor antagonist reduces food consumption in male and female rats. Regul Pept 96(1–2): 45–51. Haynes AC, Jackson B, Overend P, Buckingham RE, Wilson S, Tadayyon M & Arch JR (1999) Effects of single and chronic intracerebroventricular administration of the orexins on feeding in the rat. Peptides 20(9): 1099–105. Heinonen MV, Purhonen AK, Makela KA & Herzig KH (2008) Functions of orexins in peripheral tissues. Acta Physiol (Oxf) 192(4): 471–85. Heinonen MV, Purhonen AK, Miettinen P, Paakkonen M, Pirinen E, Alhava E, Akerman K & Herzig KH (2005) Apelin, orexin-A and leptin plasma levels in morbid obesity and effect of gastric banding. Regul Pept 130(1–2): 7–13. Hervieu GJ, Cluderay JE, Harrison DC, Roberts JC & Leslie RA (2001) Gene expression and protein distribution of the orexin-1 receptor in the rat brain and spinal cord. Neuroscience 103(3): 777–97. Herzig KH & Purhonen AK (2010) Physiology and pathophysiology of hypocretins/orexins. Acta Physiol (Oxf) 198(3): 199–200. Higuchi S, Usui A, Murasaki M, Matsushita S, Nishioka N, Yoshino A, Matsui T, Muraoka H, Ishizuka Y, Kanba S & Sakurai T (2002) Plasma orexin-A is lower in patients with narcolepsy. Neurosci Lett 318(2): 61–4. Hirota K, Kushikata T, Kudo M, Kudo T, Smart D & Matsuki A (2003) Effects of central hypocretin-1 administration on hemodynamic responses in young-adult and middle- aged rats. Brain Res 981(1–2): 143–50. Hoever P, de Haas S, Winkler J, Schoemaker RC, Chiossi E, van Gerven J & Dingemanse J (2010) Orexin receptor antagonism, a new sleep-promoting paradigm: an ascending single-dose study with almorexant. Clin Pharmacol Ther 87(5): 593–600. Hogan DL, Rapier RC, Dreilinger A, Koss MA, Basuk PM, Weinstein WM, Nyberg LM & Isenberg JI (1996) Duodenal bicarbonate secretion: eradication of Helicobacter pylori and duodenal structure and function in humans. Gastroenterology 110(3): 705–16. Hollander JA, Lu Q, Cameron MD, Kamenecka TM & Kenny PJ (2008) Insular hypocretin transmission regulates nicotine reward. Proc Natl Acad Sci USA 105(49): 19480–5. Holm M, Johansson B, Pettersson A & Fandriks L (1998) Carbon dioxide mediates duodenal mucosal alkaline secretion in response to luminal acidity in the anesthetized rat. Gastroenterology 115(3): 680–5. Holmqvist T, Akerman KE & Kukkonen JP (2002) Orexin signaling in recombinant neuron-like cells. FEBS Lett 526(1–3): 11–4. Holmqvist T, Johansson L, Ostman M, Ammoun S, Akerman KE & Kukkonen JP (2005) OX1 orexin receptors couple to adenylyl cyclase regulation via multiple mechanisms. J Biol Chem 280(8): 6570–9. 135 Hondo M, Nagai K, Ohno K, Kisanuki Y, Willie JT, Watanabe T, Yanagisawa M & Sakurai T (2009) Histamine-1 receptor is not required as a downstream effector of orexin-2 receptor in maintenance of basal sleep/wake states. Acta Physiol (Oxf). Horvath TL, Diano S, Miyamoto S, Barry S, Gatti S, Alberati D, Livak F, Lombardi A, Moreno M, Goglia F, Mor G, Hamilton J, Kachinskas D, Horwitz B & Warden CH (2003) Uncoupling proteins-2 and 3 influence obesity and inflammation in transgenic mice. Int J Obes Relat Metab Disord 27(4): 433–42. Horvath TL, Peyron C, Diano S, Ivanov A, Aston-Jones G, Kilduff TS & van Den Pol AN (1999) Hypocretin (orexin) activation and synaptic innervation of the locus coeruleus noradrenergic system. J Comp Neurol 415(2): 145–59. Huang C, Zhang Y, Gong Z, Sheng X, Li Z, Zhang W & Qin Y (2006) Berberine inhibits 3T3-L1 adipocyte differentiation through the PPARgamma pathway. Biochem Biophys Res Commun 348(2): 571–8. Huang ZL, Qu WM, Li WD, Mochizuki T, Eguchi N, Watanabe T, Urade Y & Hayaishi O (2001) Arousal effect of orexin A depends on activation of the histaminergic system. Proc Natl Acad Sci USA 98(17): 9965–70. Huber R, Deboer T & Tobler I (2000) Effects of sleep deprivation on sleep and sleep EEG in three mouse strains: empirical data and simulations. Brain Res 857(1–2): 8–19. Hulbert AJ & Else PL (2004) Basal metabolic rate: history, composition, regulation, and usefulness. Physiol Biochem Zool 77(6): 869–76. Hungs M, Fan J, Lin L, Lin X, Maki RA & Mignot E (2001) Identification and functional analysis of mutations in the hypocretin (orexin) genes of narcoleptic canines. Genome Res 11(4): 531–9. Ibuka N, Nihonmatsu I & Sekiguchi S (1980) Sleep-wakefulness rhythms in mice after suprachiasmatic nucleus lesions. Waking Sleeping 4(2): 167–73. Isenberg JI, Hogan DL, Koss MA & Selling JA (1986) Human duodenal mucosal bicarbonate secretion. Evidence for basal secretion and stimulation by hydrochloric acid and a synthetic prostaglandin E1 analogue. Gastroenterology 91(2): 370–8. Jaburek M, Varecha M, Gimeno RE, Dembski M, Jezek P, Zhang M, Burn P, Tartaglia LA & Garlid KD (1999) Transport function and regulation of mitochondrial uncoupling proteins 2 and 3. J Biol Chem 274(37): 26003–7. Jaszberenyi M, Bujdoso E, Pataki I & Telegdy G (2000) Effects of orexins on the hypothalamic-pituitary-adrenal system. J Neuroendocrinol 12(12): 1174–8. Jia JJ, Zhang X, Ge CR & Jois M (2009) The polymorphisms of UCP2 and UCP3 genes associated with fat metabolism, obesity and diabetes. Obes Rev 10(5): 519–26. Johansson L, Ekholm ME & Kukkonen JP (2007) Regulation of OX1 orexin/hypocretin receptor-coupling to phospholipase C by Ca2+ influx. Br J Pharmacol 150(1): 97–104. Johansson L, Ekholm ME & Kukkonen JP (2008) Multiple phospholipase activation by OX(1) orexin/hypocretin receptors. Cell Mol Life Sci 65(12): 1948–56. John J, Wu MF, Maidment NT, Lam HA, Boehmer LN, Patton M & Siegel JM (2004) Developmental changes in CSF hypocretin-1 (orexin-A) levels in normal and genetically narcoleptic Doberman pinschers. J Physiol 560(Pt 2): 587–92. 136 Johren O, Neidert SJ, Kummer M, Dendorfer A & Dominiak P (2001) Prepro-orexin and orexin receptor mRNAs are differentially expressed in peripheral tissues of male and female rats. Endocrinology 142(8): 3324–31. Jonson C, Nylander O, Flemstrom G & Fandriks L (1986) Vagal stimulation of duodenal HCO3(-)-secretion in anaesthetized rats. Acta Physiol Scand 128(1): 65–70. Joo NS, London RM, Kim HD, Forte LR & Clarke LL (1998) Regulation of intestinal Cl- and HCO3-secretion by uroguanylin. Am J Physiol 274(4 Pt 1): G633–44. Kantor S, Mochizuki T, Janisiewicz AM, Clark E, Nishino S & Scammell TE (2009) Orexin neurons are necessary for the circadian control of REM sleep. Sleep 32(9): 1127–34. Karteris E, Chen J & Randeva HS (2004) Expression of human prepro-orexin and signaling characteristics of orexin receptors in the male reproductive system. J Clin Endocrinol Metab 89(4): 1957–62. Karteris E, Machado RJ, Chen J, Zervou S, Hillhouse EW & Randeva HS (2005) Food deprivation differentially modulates orexin receptor expression and signaling in rat hypothalamus and adrenal cortex. Am J Physiol Endocrinol Metab 288(6): E1089–100. Karteris E, Randeva HS, Grammatopoulos DK, Jaffe RB & Hillhouse EW (2001) Expression and coupling characteristics of the CRH and orexin type 2 receptors in human fetal adrenals. J Clin Endocrinol Metab 86(9): 4512–9. Kastin AJ & Akerstrom V (1999) Orexin A but not orexin B rapidly enters brain from blood by simple diffusion. J Pharmacol Exp Ther 289(1): 219–23. Kaur S, Thankachan S, Begum S, Blanco-Centurion C, Sakurai T, Yanagisawa M & Shiromani PJ (2008) Entrainment of temperature and activity rhythms to restricted feeding in orexin knock out mice. Brain Res 1205: 47–54. Kayaba Y, Nakamura A, Kasuya Y, Ohuchi T, Yanagisawa M, Komuro I, Fukuda Y & Kuwaki T (2003) Attenuated defense response and low basal blood pressure in orexin knockout mice. Am J Physiol Regul Integr Comp Physiol 285(3): R581–93. Kelly LJ, Vicario PP, Thompson GM, Candelore MR, Doebber TW, Ventre J, Wu MS, Meurer R, Forrest MJ, Conner MW, Cascieri MA & Moller DE (1998) Peroxisome proliferator-activated receptors gamma and alpha mediate in vivo regulation of uncoupling protein (UCP-1, UCP-2, UCP-3) gene expression. Endocrinology 139(12): 4920–7. Kim HY, Hong E, Kim JI & Lee W (2004) Solution structure of human orexin-A: regulator of appetite and wakefulness. J Biochem Mol Biol 37(5): 565–73. Kim J, Nakajima K, Oomura Y, Wayner MJ & Sasaki K (2009) Electrophysiological effects of orexins/hypocretins on pedunculopontine tegmental neurons in rats: an in vitro study. Peptides 30(2): 191–209. Kintscher U & Law RE (2005) PPARgamma-mediated insulin sensitization: the importance of fat versus muscle. Am J Physiol Endocrinol Metab 288(2): E287–91. Kirchgessner AL & Liu M (1999) Orexin synthesis and response in the gut. Neuron 24(4): 941–51. 137 Kisanuki YY, Chemelli RM, Sinton CM, Williams SC, Richardson JA, Hammer RE & Yanagisawa M (2000) The role of Orexin Receptor Type-1 (OX1R) in the Regulation of Sleep. Sleep 23: A91. Kisanuki YY, Chemelli RM, Tokita S, Willie JT, Sinton CM & Yanagisawa M (2001) Behavioral and Polysomnographic Characterization of Orexin-1 Receptor and Orexin- 2 Receptor Double Knockout Mice. Sleep 24: A22. Klisch C, Inyushkin A, Mordel J, Karnas D, Pevet P & Meissl H (2009) Orexin A modulates neuronal activity of the rodent suprachiasmatic nucleus in vitro. Eur J Neurosci 30(1): 65–75. Kobashi M, Furudono Y, Matsuo R & Yamamoto T (2002) Central orexin facilitates gastric relaxation and contractility in rats. Neurosci Lett 332(3): 171–4. Kohlmeier KA, Inoue T & Leonard CS (2004) Hypocretin/orexin peptide signaling in the ascending arousal system: elevation of intracellular calcium in the mouse dorsal raphe and laterodorsal tegmentum. J Neurophysiol 92(1): 221–35. Kohno D, Suyama S & Yada T (2008) Leptin transiently antagonizes ghrelin and long- lastingly orexin in regulation of Ca2+ signaling in neuropeptide Y neurons of the arcuate nucleus. World J Gastroenterol 14(41): 6347–54. Kok SW, Overeem S, Visscher TL, Lammers GJ, Seidell JC, Pijl H & Meinders AE (2003) Hypocretin deficiency in narcoleptic humans is associated with abdominal obesity. Obes Res 11(9): 1147–54. Komaki G, Matsumoto Y, Nishikata H, Kawai K, Nozaki T, Takii M, Sogawa H & Kubo C (2001) Orexin-A and leptin change inversely in fasting non-obese subjects. Eur J Endocrinol 144(6): 645–51. Krowicki ZK, Burmeister MA, Berthoud HR, Scullion RT, Fuchs K & Hornby PJ (2002) Orexins in rat dorsal motor nucleus of the vagus potently stimulate gastric motor function. Am J Physiol Gastrointest Liver Physiol 283(2): G465–72. Kukkonen JP & Akerman KE (2001) Orexin receptors couple to Ca2+ channels different from store-operated Ca2+ channels. Neuroreport 12(9): 2017–20. Kukkonen JP, Holmqvist T, Ammoun S & Akerman KE (2002) Functions of the orexinergic/hypocretinergic system. Am J Physiol Cell Physiol 283(6): C1567–91. Kuru M, Ueta Y, Serino R, Nakazato M, Yamamoto Y, Shibuya I & Yamashita H (2000) Centrally administered orexin/hypocretin activates HPA axis in rats. Neuroreport 11(9): 1977–80. Lammers GJ, Pijl H, Iestra J, Langius JA, Buunk G & Meinders AE (1996) Spontaneous food choice in narcolepsy. Sleep 19(1): 75–6. Landolt HP, Dijk DJ, Gaus SE & Borbely AA (1995) Caffeine reduces low-frequency delta activity in the human sleep EEG. Neuropsychopharmacology 12(3): 229–38. Lang M, Bufe B, De Pol S, Reiser O, Meyerhof W & Beck-Sickinger AG (2006) Structural properties of orexins for activation of their receptors. J Pept Sci 12(4): 258–66. Larson GM, Jedstedt G, Nylander O & Flemstrom G (1996) Intracerebral adrenoceptor agonists influence rat duodenal mucosal bicarbonate secretion. Am J Physiol 271(5 Pt 1): G831–40. 138 Larsson KP, Akerman KE, Magga J, Uotila S, Kukkonen JP, Nasman J & Herzig KH (2003) The STC-1 cells express functional orexin-A receptors coupled to CCK release. Biochem Biophys Res Commun 309(1): 209–16. Larsson KP, Peltonen HM, Bart G, Louhivuori LM, Penttonen A, Antikainen M, Kukkonen JP & Akerman KE (2005) Orexin-A-induced Ca2+ entry: evidence for involvement of trpc channels and protein kinase C regulation. J Biol Chem 280(3): 1771–81. Lawrence AJ, Cowen MS, Yang HJ, Chen F & Oldfield B (2006) The orexin system regulates alcohol-seeking in rats. Br J Pharmacol 148(6): 752–9. de Lecea L, Kilduff TS, Peyron C, Gao X, Foye PE, Danielson PE, Fukuhara C, Battenberg EL, Gautvik VT, Bartlett FS, 2nd, Frankel WN, van den Pol AN, Bloom FE, Gautvik KM & Sutcliffe JG (1998) The hypocretins: hypothalamus-specific peptides with neuroexcitatory activity. Proc Natl Acad Sci USA 95(1): 322–7. de Lecea L & Sutcliffe JG (2005) The hypocretins and sleep. FEBS J 272(22): 5675–88. Lee JH, Bang E, Chae KJ, Kim JY, Lee DW & Lee W (1999) Solution structure of a new hypothalamic neuropeptide, human hypocretin-2/orexin-B. Eur J Biochem 266(3): 831–9. Lee MG, Hassani OK & Jones BE (2005) Discharge of identified orexin/hypocretin neurons across the sleep-waking cycle. J Neurosci 25(28): 6716–20. Lenz HJ (1989) Regulation of duodenal bicarbonate secretion during stress by corticotropin-releasing factor and beta-endorphin. Proc Natl Acad Sci USA 86(4): 1417–20. Lenz HJ, Vale WW & Rivier JE (1989) TRH-induced vagal stimulation of duodenal HCO- 3 mediated by VIP and muscarinic pathways. Am J Physiol 257(5 Pt 1): G677–82. Leppaluoto J, Paakkonen T, Korhonen I & Hassi J (2005) Pituitary and autonomic responses to cold exposures in man. Acta Physiol Scand 184(4): 255–64. Li Y & van den Pol AN (2006) Differential target-dependent actions of coexpressed inhibitory dynorphin and excitatory hypocretin/orexin neuropeptides. J Neurosci 26(50): 13037–47. Lin L, Faraco J, Li R, Kadotani H, Rogers W, Lin X, Qiu X, de Jong PJ, Nishino S & Mignot E (1999) The sleep disorder canine narcolepsy is caused by a mutation in the hypocretin (orexin) receptor 2 gene. Cell 98(3): 365–76. Liu RJ, van den Pol AN & Aghajanian GK (2002) Hypocretins (orexins) regulate serotonin neurons in the dorsal raphe nucleus by excitatory direct and inhibitory indirect actions. J Neurosci 22(21): 9453–64. Liu X, Rossmeisl M, McClaine J, Riachi M, Harper ME & Kozak LP (2003) Paradoxical resistance to diet-induced obesity in UCP1-deficient mice. J Clin Invest 111(3): 399– 407. Liu ZW & Gao XB (2007) Adenosine inhibits activity of hypocretin/orexin neurons by the A1 receptor in the lateral hypothalamus: a possible sleep-promoting effect. J Neurophysiol 97(1): 837–48. 139 Lopez M, Lage R, Tung YC, Challis BG, Varela L, Virtue S, O'Rahilly S, Vidal-Puig A, Dieguez C & Coll AP (2007) Orexin expression is regulated by alpha-melanocyte- stimulating hormone. J Neuroendocrinol 19(9): 703–7. Lopez M, Senaris R, Gallego R, Garcia-Caballero T, Lago F, Seoane L, Casanueva F & Dieguez C (1999) Orexin receptors are expressed in the adrenal medulla of the rat. Endocrinology 140(12): 5991–4. Lopez M, Seoane LM, Tovar S, Nogueiras R, Dieguez C & Senaris R (2004) Orexin-A regulates growth hormone-releasing hormone mRNA content in a nucleus-specific manner and somatostatin mRNA content in a growth hormone-dependent fashion in the rat hypothalamus. Eur J Neurosci 19(8): 2080–8. Lowell BB & Spiegelman BM (2000) Towards a molecular understanding of adaptive thermogenesis. Nature 404(6778): 652–60. Lu J, Greco MA, Shiromani P & Saper CB (2000a) Effect of lesions of the ventrolateral preoptic nucleus on NREM and REM sleep. J Neurosci 20(10): 3830–42. Lu J, Sherman D, Devor M & Saper CB (2006) A putative flip-flop switch for control of REM sleep. Nature 441(7093): 589–94. Lu XY, Bagnol D, Burke S, Akil H & Watson SJ (2000b) Differential distribution and regulation of OX1 and OX2 orexin/hypocretin receptor messenger RNA in the brain upon fasting. Horm Behav 37(4): 335–44. Lubkin M & Stricker-Krongrad A (1998) Independent feeding and metabolic actions of orexins in mice. Biochem Biophys Res Commun 253(2): 241–5. Lund PE, Shariatmadari R, Uustare A, Detheux M, Parmentier M, Kukkonen JP & Akerman KE (2000) The orexin OX1 receptor activates a novel Ca2+ influx pathway necessary for coupling to phospholipase C. J Biol Chem 275(40): 30806–12. Ma X, Zubcevic L, Bruning JC, Ashcroft FM & Burdakov D (2007) Electrical inhibition of identified anorexigenic POMC neurons by orexin/hypocretin. J Neurosci 27(7): 1529– 33. Malendowicz LK, Hochol A, Ziolkowska A, Nowak M, Gottardo L & Nussdorfer GG (2001) Prolonged orexin administration stimulates steroid-hormone secretion, acting directly on the rat adrenal gland. Int J Mol Med 7(4): 401–4. Malendowicz LK, Tortorella C & Nussdorfer GG (1999) Orexins stimulate corticosterone secretion of rat adrenocortical cells, through the activation of the adenylate cyclase- dependent signaling cascade. J Steroid Biochem Mol Biol 70(4–6): 185–8. Mao W, Yu XX, Zhong A, Li W, Brush J, Sherwood SW, Adams SH & Pan G (1999) UCP4, a novel brain-specific mitochondrial protein that reduces membrane potential in mammalian cells. FEBS Lett 443(3): 326–30. Marston OJ, Williams RH, Canal MM, Samuels RE, Upton N & Piggins HD (2008) Circadian and dark-pulse activation of orexin/hypocretin neurons. Mol Brain 1(1): 19. Martinez GS, Smale L & Nunez AA (2002) Diurnal and nocturnal rodents show rhythms in orexinergic neurons. Brain Res 955(1–2): 1–7. Masaki T, Yoshimatsu H, Chiba S & Sakata T (2000) Impaired response of UCP family to cold exposure in diabetic (db/db) mice. Am J Physiol Regul Integr Comp Physiol 279(4): R1305–9. 140 Matsumura K, Tsuchihashi T & Abe I (2001) Central orexin-A augments sympathoadrenal outflow in conscious rabbits. Hypertension 37(6): 1382–7. Matsuo K, Kaibara M, Uezono Y, Hayashi H, Taniyama K & Nakane Y (2002) Involvement of cholinergic neurons in orexin-induced contraction of guinea pig ileum. Eur J Pharmacol 452(1): 105–9. Mazzocchi G, Malendowicz LK, Aragona F, Rebuffat P, Gottardo L & Nussdorfer GG (2001a) Human pheochromocytomas express orexin receptor type 2 gene and display an in vitro secretory response to orexins A and B. J Clin Endocrinol Metab 86(10): 4818–21. Mazzocchi G, Malendowicz LK, Gottardo L, Aragona F & Nussdorfer GG (2001b) Orexin A stimulates cortisol secretion from human adrenocortical cells through activation of the adenylate cyclase-dependent signaling cascade. J Clin Endocrinol Metab 86(2): 778–82. McCarley RW (2007) Neurobiology of REM and NREM sleep. Sleep Med 8(4): 302–30. McGranaghan PA & Piggins HD (2001) Orexin A-like immunoreactivity in the hypothalamus and thalamus of the Syrian hamster (Mesocricetus auratus) and Siberian hamster (Phodopus sungorus), with special reference to circadian structures. Brain Res 904(2): 234–44. Mieda M, Williams SC, Richardson JA, Tanaka K & Yanagisawa M (2006a) The dorsomedial hypothalamic nucleus as a putative food-entrainable circadian pacemaker. Proc Natl Acad Sci USA 103(32): 12150–5. Mieda M, Williams SC, Sinton CM, Richardson JA, Sakurai T & Yanagisawa M (2004a) Orexin neurons function in an efferent pathway of a food-entrainable circadian oscillator in eliciting food-anticipatory activity and wakefulness. J Neurosci 24(46): 10493–501. Mieda M, Willie J & Sakurai T (2006b) Genetic Rescue of Narcoleptic Mice. In: Nishino S & Sakurai T (eds) Orexin/Hypocretin System: Physiology and Pathophysiology. Totowa, New Jersey, Humana Press, p 365. Mieda M, Willie JT, Hara J, Sinton CM, Sakurai T & Yanagisawa M (2004b) Orexin peptides prevent cataplexy and improve wakefulness in an orexin neuron-ablated model of narcolepsy in mice. Proc Natl Acad Sci USA 101(13): 4649–54. Mignot E, Hayduk R, Black J, Grumet FC & Guilleminault C (1997) HLA DQB1*0602 is associated with cataplexy in 509 narcoleptic patients. Sleep 20(11): 1012–20. Mignot E, Lin L, Rogers W, Honda Y, Qiu X, Lin X, Okun M, Hohjoh H, Miki T, Hsu S, Leffell M, Grumet F, Fernandez-Vina M, Honda M & Risch N (2001) Complex HLA- DR and -DQ interactions confer risk of narcolepsy-cataplexy in three ethnic groups. Am J Hum Genet 68(3): 686–99. de Miguel MJ & Burrell MA (2002) Immunocytochemical detection of orexin A in endocrine cells of the developing mouse gut. J Histochem Cytochem 50(1): 63–9. Mills EM, Banks ML, Sprague JE & Finkel T (2003) Pharmacology: uncoupling the agony from ecstasy. Nature 426(6965): 403–4. 141 Miskolzie M, Lucyk S & Kotovych G (2003) NMR conformational studies of micelle- bound orexin-B: a neuropeptide involved in the sleep/awake cycle and feeding regulation. J Biomol Struct Dyn 21(3): 341–51. Mistlberger RE (2005) Circadian regulation of sleep in mammals: role of the suprachiasmatic nucleus. Brain Res Brain Res Rev 49(3): 429–54. Mistlberger RE (2009) Food-anticipatory circadian rhythms: concepts and methods. Eur J Neurosci 30(9): 1718–29. Mistlberger RE, Bergmann BM & Rechtschaffen A (1987) Relationships among wake episode lengths, contiguous sleep episode lengths, and electroencephalographic delta waves in rats with suprachiasmatic nuclei lesions. Sleep 10(1): 12–24. Mistlberger RE & Skene DJ (2005) Nonphotic entrainment in humans? J Biol Rhythms 20(4): 339–52. Mitsuma T, Hirooka Y, Kayama M, Mori Y, Yokoi Y, Rhue N, Ping J, Izumi M, Ikai R, Adachi K & Nogimori T (2000a) Radioimmunoassay for orexin A. Life Sci 66(10): 897–904. Mitsuma T, Hirooka Y, Kayma M, Mori Y, Yokoi Y, Izumi M, Rhue N, Ping J, Adachi K, Ikai R, Kawai N, Nakayashiki A & Nogimori T (2000b) Radioimmunoassay for hypocretin-2. Endocr Regul 34(1): 23–7. Miyasaka K, Masuda M, Kanai S, Sato N, Kurosawa M & Funakoshi A (2002) Central Orexin-A stimulates pancreatic exocrine secretion via the vagus. Pancreas 25(4): 400– 4. Mochizuki T, Crocker A, McCormack S, Yanagisawa M, Sakurai T & Scammell TE (2004) Behavioral state instability in orexin knock-out mice. J Neurosci 24(28): 6291–300. Mochizuki T, Klerman EB, Sakurai T & Scammell TE (2006) Elevated body temperature during sleep in orexin knockout mice. Am J Physiol Regul Integr Comp Physiol 291(3): R533–40. Moreno G, Perello M, Gaillard RC & Spinedi E (2005) Orexin a stimulates hypothalamic- pituitary-adrenal (HPA) axis function, but not food intake, in the absence of full hypothalamic NPY-ergic activity. Endocrine 26(2): 99–106. Morrison SF, Nakamura K & Madden CJ (2008) Central control of thermogenesis in mammals. Exp Physiol 93(7): 773–97. Mrosovsky N (1996) Locomotor activity and non-photic influences on circadian clocks. Biol Rev Camb Philos Soc 71(3): 343–72. Murillo-Rodriguez E, Liu M, Blanco-Centurion C & Shiromani PJ (2008) Effects of hypocretin (orexin) neuronal loss on sleep and extracellular adenosine levels in the rat basal forebrain. Eur J Neurosci 28(6): 1191–8. Muroya S, Funahashi H, Yamanaka A, Kohno D, Uramura K, Nambu T, Shibahara M, Kuramochi M, Takigawa M, Yanagisawa M, Sakurai T, Shioda S & Yada T (2004) Orexins (hypocretins) directly interact with neuropeptide Y, POMC and glucose- responsive neurons to regulate Ca2+ signaling in a reciprocal manner to leptin: orexigenic neuronal pathways in the mediobasal hypothalamus. Eur J Neurosci 19(6): 1524–34. 142 Nakabayashi M, Suzuki T, Takahashi K, Totsune K, Muramatsu Y, Kaneko C, Date F, Takeyama J, Darnel AD, Moriya T & Sasano H (2003) Orexin-A expression in human peripheral tissues. Mol Cell Endocrinol 205(1–2): 43–50. Nambu T, Sakurai T, Mizukami K, Hosoya Y, Yanagisawa M & Goto K (1999) Distribution of orexin neurons in the adult rat brain. Brain Res 827(1–2): 243–60. Nanmoku T, Isobe K, Sakurai T, Yamanaka A, Takekoshi K, Kawakami Y, Goto K & Nakai T (2002) Effects of orexin on cultured porcine adrenal medullary and cortex cells. Regul Pept 104(1–3): 125–30. Nanmoku T, Isobe K, Sakurai T, Yamanaka A, Takekoshi K, Kawakami Y, Ishii K, Goto K & Nakai T (2000) Orexins suppress catecholamine synthesis and secretion in cultured PC12 cells. Biochem Biophys Res Commun 274(2): 310–5. Naqvi NH, Rudrauf D, Damasio H & Bechara A (2007) Damage to the insula disrupts addiction to cigarette smoking. Science 315(5811): 531–4. Narita M, Nagumo Y, Hashimoto S, Narita M, Khotib J, Miyatake M, Sakurai T, Yanagisawa M, Nakamachi T, Shioda S & Suzuki T (2006) Direct involvement of orexinergic systems in the activation of the mesolimbic dopamine pathway and related behaviors induced by morphine. J Neurosci 26(2): 398–405. Naslund E, Ehrstrom M, Ma J, Hellstrom PM & Kirchgessner AL (2002) Localization and effects of orexin on fasting motility in the rat duodenum. Am J Physiol Gastrointest Liver Physiol 282(3): G470–9. Nau K, Fromme T, Meyer CW, von Praun C, Heldmaier G & Klingenspor M (2008) Brown adipose tissue specific lack of uncoupling protein 3 is associated with impaired cold tolerance and reduced transcript levels of metabolic genes. J Comp Physiol B 178(3): 269–77. Nedergaard J, Bengtsson T & Cannon B (2007) Unexpected evidence for active brown adipose tissue in adult humans. Am J Physiol Endocrinol Metab 293(2): E444–52. Nedergaard J & Cannon B (2003) The 'novel' 'uncoupling' proteins UCP2 and UCP3: what do they really do? Pros and cons for suggested functions. Exp Physiol 88(1): 65–84. Neubauer DN (2010) Almorexant, a dual orexin receptor antagonist for the treatment of insomnia. Curr Opin Investig Drugs 11(1): 101–10. Nilaweera KN, Barrett P, Mercer JG & Morgan PJ (2003) Precursor-protein convertase 1 gene expression in the mouse hypothalamus: differential regulation by ob gene mutation, energy deficit and administration of leptin, and coexpression with prepro- orexin. Neuroscience 119(3): 713–20. Nishino S, Ripley B, Overeem S, Lammers GJ & Mignot E (2000) Hypocretin (orexin) deficiency in human narcolepsy. Lancet 355(9197): 39–40. Novak CM & Levine JA (2009) Daily intraparaventricular orexin-A treatment induces weight loss in rats. Obesity (Silver Spring) 17(8): 1493–8. Nowak KW, Mackowiak P, Switonska MM, Fabis M & Malendowicz LK (2000) Acute orexin effects on insulin secretion in the rat: in vivo and in vitro studies. Life Sci 66(5): 449–54. 143 Nowak KW, Strowski MZ, Switonska MM, Kaczmarek P, Singh V, Fabis M, Mackowiak P, Nowak M & Malendowicz LK (2005) Evidence that orexins A and B stimulate insulin secretion from rat pancreatic islets via both receptor subtypes. Int J Mol Med 15(6): 969–72. Nylander O, Flemstrom G, Delbro D & Fandriks L (1987) Vagal influence on gastroduodenal HCO3- secretion in the cat in vivo. Am J Physiol 252(4 Pt 1): G522–8. Okumura T, Takeuchi S, Motomura W, Yamada H, Egashira Si S, Asahi S, Kanatani A, Ihara M & Kohgo Y (2001) Requirement of intact disulfide bonds in orexin-A- induced stimulation of gastric acid secretion that is mediated by OX1 receptor activation. Biochem Biophys Res Commun 280(4): 976–81. de Oliveira CV, Rosas-Arellano MP, Solano-Flores LP & Ciriello J (2003) Cardiovascular effects of hypocretin-1 in nucleus of the solitary tract. Am J Physiol Heart Circ Physiol 284(4): H1369–77. Ouedraogo R, Naslund E & Kirchgessner AL (2003) Glucose regulates the release of orexin-a from the endocrine pancreas. Diabetes 52(1): 111–7. Panula P (2010) Hypocretin/orexin in fish physiology with emphasis on zebrafish. Acta Physiol (Oxf) 198(3): 381–6. Pappenheimer JR (1998) Scaling of dimensions of small intestines in non-ruminant eutherian mammals and its significance for absorptive mechanisms. Comp Biochem Physiol A Mol Integr Physiol 121(1): 45–58. Pecqueur C, Alves-Guerra MC, Gelly C, Levi-Meyrueis C, Couplan E, Collins S, Ricquier D, Bouillaud F & Miroux B (2001) Uncoupling protein 2, in vivo distribution, induction upon oxidative stress, and evidence for translational regulation. J Biol Chem 276(12): 8705–12. Pelin Z, Guilleminault C, Risch N, Grumet FC & Mignot E (1998) HLA-DQB1*0602 homozygosity increases relative risk for narcolepsy but not disease severity in two ethnic groups. US Modafinil in Narcolepsy Multicenter Study Group. Tissue Antigens 51(1): 96–100. Peyron C, Faraco J, Rogers W, Ripley B, Overeem S, Charnay Y, Nevsimalova S, Aldrich M, Reynolds D, Albin R, Li R, Hungs M, Pedrazzoli M, Padigaru M, Kucherlapati M, Fan J, Maki R, Lammers GJ, Bouras C, Kucherlapati R, Nishino S & Mignot E (2000) A mutation in a case of early onset narcolepsy and a generalized absence of hypocretin peptides in human narcoleptic brains. Nat Med 6(9): 991–7. Peyron C, Tighe DK, van den Pol AN, de Lecea L, Heller HC, Sutcliffe JG & Kilduff TS (1998) Neurons containing hypocretin (orexin) project to multiple neuronal systems. J Neurosci 18(23): 9996–10015. Piper DC, Upton N, Smith MI & Hunter AJ (2000) The novel brain neuropeptide, orexin-A, modulates the sleep-wake cycle of rats. Eur J Neurosci 12(2): 726–30. van den Pol AN (1999) Hypothalamic hypocretin (orexin): robust innervation of the spinal cord. J Neurosci 19(8): 3171–82. van den Pol AN, Gao XB, Obrietan K, Kilduff TS & Belousov AB (1998) Presynaptic and postsynaptic actions and modulation of neuroendocrine neurons by a new hypothalamic peptide, hypocretin/orexin. J Neurosci 18(19): 7962–71. 144 van den Pol AN, Patrylo PR, Ghosh PK & Gao XB (2001) Lateral hypothalamus: early developmental expression and response to hypocretin (orexin). J Comp Neurol 433(3): 349–63. Porkka-Heiskanen T, Alanko L, Kalinchuk A, Heiskanen S & Stenberg D (2004) The effect of age on prepro-orexin gene expression and contents of orexin A and B in the rat brain. Neurobiol Aging 25(2): 231–8. Porkka-Heiskanen T, Strecker RE, Thakkar M, Bjorkum AA, Greene RW & McCarley RW (1997) Adenosine: a mediator of the sleep-inducing effects of prolonged wakefulness. Science 276(5316): 1265–8. Prober DA, Rihel J, Onah AA, Sung RJ & Schier AF (2006) Hypocretin/orexin overexpression induces an insomnia-like phenotype in zebrafish. J Neurosci 26(51): 13400–10. Radulovacki M, Virus RM, Djuricic-Nedelson M & Green RD (1984) Adenosine analogs and sleep in rats. J Pharmacol Exp Ther 228(2): 268–74. Ramanjaneya M, Conner AC, Chen J, Kumar P, Brown JE, Johren O, Lehnert H, Stanfield PR & Randeva HS (2009) Orexin-stimulated MAP kinase cascades are activated through multiple G-protein signalling pathways in human H295R adrenocortical cells: diverse roles for orexins A and B. J Endocrinol 202(2): 249–61. Ramsey JJ, Kemnitz JW, Newton W, Hagopian K, Patterson TA & Swick AG (2005) Food intake in rhesus monkeys following central administration of orexins. Regul Pept 124(1–3): 209–14. Randeva HS, Karteris E, Grammatopoulos D & Hillhouse EW (2001) Expression of orexin-A and functional orexin type 2 receptors in the human adult adrenals: implications for adrenal function and energy homeostasis. J Clin Endocrinol Metab 86(10): 4808–13. Reti IM, Reddy R, Worley PF & Baraban JM (2002) Selective expression of Narp, a secreted neuronal pentraxin, in orexin neurons. J Neurochem 82(6): 1561–5. Richards JK, Simms JA, Steensland P, Taha SA, Borgland SL, Bonci A & Bartlett SE (2008) Inhibition of orexin-1/hypocretin-1 receptors inhibits yohimbine-induced reinstatement of ethanol and sucrose seeking in Long-Evans rats. Psychopharmacology (Berl) 199(1): 109–17. Ripley B, Overeem S, Fujiki N, Nevsimalova S, Uchino M, Yesavage J, Di Monte D, Dohi K, Melberg A, Lammers GJ, Nishida Y, Roelandse FW, Hungs M, Mignot E & Nishino S (2001) CSF hypocretin/orexin levels in narcolepsy and other neurological conditions. Neurology 57(12): 2253–8. Ritchie C, Okuro M, Kanbayashi T & Nishino S (2010) Hypocretin ligand deficiency in narcolepsy: recent basic and clinical insights. Curr Neurol Neurosci Rep 10(3): 180–9. Roecker AJ & Coleman PJ (2008) Orexin receptor antagonists: medicinal chemistry and therapeutic potential. Curr Top Med Chem 8(11): 977–87. Russell SH, Small CJ, Sunter D, Morgan I, Dakin CL, Cohen MA & Bloom SR (2002) Chronic intraparaventricular nuclear administration of orexin A in male rats does not alter thyroid axis or uncoupling protein-1 in brown adipose tissue. Regul Pept 104(1– 3): 61–8. 145 Safsten B, Jedstedt G & Flemstrom G (1991) Effects of diazepam and Ro 15–1788 on duodenal bicarbonate secretion in the rat. Gastroenterology 101(4): 1031–8. Safsten B, Sjoblom M & Flemstrom G (2006) Serotonin increases protective duodenal bicarbonate secretion via enteric ganglia and a 5-HT4-dependent pathway. Scand J Gastroenterol 41(11): 1279–89. Sakurai T, Amemiya A, Ishii M, Matsuzaki I, Chemelli RM, Tanaka H, Williams SC, Richardson JA, Kozlowski GP, Wilson S, Arch JR, Buckingham RE, Haynes AC, Carr SA, Annan RS, McNulty DE, Liu WS, Terrett JA, Elshourbagy NA, Bergsma DJ & Yanagisawa M (1998) Orexins and orexin receptors: a family of hypothalamic neuropeptides and G protein-coupled receptors that regulate feeding behavior. Cell 92(4): 573–85. Sakurai T, Moriguchi T, Furuya K, Kajiwara N, Nakamura T, Yanagisawa M & Goto K (1999) Structure and function of human prepro-orexin gene. J Biol Chem 274(25): 17771–6. Sakurai T, Nagata R, Yamanaka A, Kawamura H, Tsujino N, Muraki Y, Kageyama H, Kunita S, Takahashi S, Goto K, Koyama Y, Shioda S & Yanagisawa M (2005) Input of orexin/hypocretin neurons revealed by a genetically encoded tracer in mice. Neuron 46(2): 297–308. Salopuro T, Pulkkinen L, Lindstrom J, Kolehmainen M, Tolppanen AM, Eriksson JG, Valle TT, Aunola S, Ilanne-Parikka P, Keinanen-Kiukaanniemi S, Tuomilehto J, Laakso M & Uusitupa M (2009) Variation in the UCP2 and UCP3 genes associates with abdominal obesity and serum lipids: the Finnish Diabetes Prevention Study. BMC Med Genet 10: 94. Samson WK, Gosnell B, Chang JK, Resch ZT & Murphy TC (1999) Cardiovascular regulatory actions of the hypocretins in brain. Brain Res 831(1–2): 248–53. Sanchis D, Fleury C, Chomiki N, Goubern M, Huang Q, Neverova M, Gregoire F, Easlick J, Raimbault S, Levi-Meyrueis C, Miroux B, Collins S, Seldin M, Richard D, Warden C, Bouillaud F & Ricquier D (1998) BMCP1, a novel mitochondrial carrier with high expression in the central nervous system of humans and rodents, and respiration uncoupling activity in recombinant yeast. J Biol Chem 273(51): 34611–5. Saper CB, Chou TC & Scammell TE (2001) The sleep switch: hypothalamic control of sleep and wakefulness. Trends Neurosci 24(12): 726–31. Satoh N, Ogawa Y, Katsuura G, Numata Y, Masuzaki H, Yoshimasa Y & Nakao K (1998) Satiety effect and sympathetic activation of leptin are mediated by hypothalamic melanocortin system. Neurosci Lett 249(2–3): 107–10. Satoh S, Matsumura H, Kanbayashi T, Yoshida Y, Urakami T, Nakajima T, Kimura N, Nishino S & Yoneda H (2006a) Expression pattern of FOS in orexin neurons during sleep induced by an adenosine A2A receptor agonist. Behav Brain Res 170(2): 277– 86. Satoh Y, Okishio Y, Azuma YT, Nakajima H, Hata F & Takeuchi T (2006b) Orexin A affects ascending contraction depending on downstream cholinergic neurons and descending relaxation through independent pathways in mouse jejunum. Neuropharmacology 51(3): 466–73. 146 Satoh Y, Uchida M, Fujita A, Nishio H, Takeuchi T & Hata F (2001) Possible role of orexin A in nonadrenergic, noncholinergic inhibitory response of muscle of the mouse small intestine. Eur J Pharmacol 428(3): 337–42. Scarpace PJ, Matheny M, Pollock BH & Tumer N (1997) Leptin increases uncoupling protein expression and energy expenditure. Am J Physiol 273(1 Pt 1): E226–30. Schagger H (2006) Tricine-SDS-PAGE. Nat Protoc 1(1): 16–22. Schmittgen TD & Zakrajsek BA (2000) Effect of experimental treatment on housekeeping gene expression: validation by real-time, quantitative RT-PCR. J Biochem Biophys Methods 46(1–2): 69–81. Schneider ER, Rada P, Darby RD, Leibowitz SF & Hoebel BG (2007) Orexigenic peptides and alcohol intake: differential effects of orexin, galanin, and ghrelin. Alcohol Clin Exp Res 31(11): 1858–65. Schwartz MW, Woods SC, Porte D, Jr., Seeley RJ & Baskin DG (2000) Central nervous system control of food intake. Nature 404(6778): 661–71. Semple RK, Crowley VC, Sewter CP, Laudes M, Christodoulides C, Considine RV, Vidal- Puig A & O'Rahilly S (2004) Expression of the thermogenic nuclear hormone receptor coactivator PGC-1alpha is reduced in the adipose tissue of morbidly obese subjects. Int J Obes Relat Metab Disord 28(1): 176–9. Seoane LM, Tovar SA, Perez D, Mallo F, Lopez M, Senaris R, Casanueva FF & Dieguez C (2004) Orexin A suppresses in vivo GH secretion. Eur J Endocrinol 150(5): 731–6. Shariatmadari R, Lund PE, Krijukova E, Sperber GO, Kukkonen JP & Akerman KE (2001) Reconstitution of neurotransmission by determining communication between differentiated PC12 pheochromocytoma and HEL 92.1.7 erythroleukemia cells. Pflugers Arch 442(2): 312–20. Sherin JE, Shiromani PJ, McCarley RW & Saper CB (1996) Activation of ventrolateral preoptic neurons during sleep. Science 271(5246): 216–9. Shirasaka T, Nakazato M, Matsukura S, Takasaki M & Kannan H (1999) Sympathetic and cardiovascular actions of orexins in conscious rats. Am J Physiol 277(6 Pt 2): R1780– 5. Silveyra P, Cataldi NI, Lux-Lantos V & Libertun C (2009) Gonadal steroids modulated hypocretin/orexin type-1 receptor expression in a brain region, sex and daytime specific manner. Regul Pept 158(1–3): 121–6. Silveyra P, Lux-Lantos V & Libertun C (2007) Both orexin receptors are expressed in rat ovaries and fluctuate with the estrous cycle: effects of orexin receptor antagonists on gonadotropins and ovulation. Am J Physiol Endocrinol Metab 293(4): E977–85. Simpson KA, Martin NM & Bloom SR (2009) Hypothalamic regulation of food intake and clinical therapeutic applications. Arq Bras Endocrinol Metabol 53(2): 120–8. Sjoblom M & Flemstrom G (2003) Melatonin in the duodenal lumen is a potent stimulant of mucosal bicarbonate secretion. J Pineal Res 34(4): 288–93. Sjoblom M, Jedstedt G & Flemstrom G (2001) Peripheral melatonin mediates neural stimulation of duodenal mucosal bicarbonate secretion. J Clin Invest 108(4): 625–33. 147 Sjoblom M, Safsten B & Flemstrom G (2003) Melatonin-induced calcium signaling in clusters of human and rat duodenal enterocytes. Am J Physiol Gastrointest Liver Physiol 284(6): G1034–44. Smart D, Sabido-David C, Brough SJ, Jewitt F, Johns A, Porter RA & Jerman JC (2001) SB-334867-A: the first selective orexin-1 receptor antagonist. Br J Pharmacol 132(6): 1179–82. Smedfors B & Johansson C (1986) Cholinergic influence on duodenal bicarbonate response to hydrochloric acid perfusion in the conscious rat. Scand J Gastroenterol 21(7): 809–15. Smith AJ, Chappell AE, Buret AG, Barrett KE & Dong H (2006) 5-Hydroxytryptamine contributes significantly to a reflex pathway by which the duodenal mucosa protects itself from gastric acid injury. FASEB J 20(14): 2486–95. Smith PM, Connolly BC & Ferguson AV (2002) Microinjection of orexin into the rat nucleus tractus solitarius causes increases in blood pressure. Brain Res 950(1–2): 261–7. Smith PM, Samson WK & Ferguson AV (2007) Cardiovascular actions of orexin-A in the rat subfornical organ. J Neuroendocrinol 19(1): 7–13. Spinazzi R, Rucinski M, Neri G, Malendowicz LK & Nussdorfer GG (2005) Preproorexin and orexin receptors are expressed in cortisol-secreting adrenocortical adenomas, and orexins stimulate in vitro cortisol secretion and growth of tumor cells. J Clin Endocrinol Metab 90(6): 3544–9. Srivastava N, Prakash J, Lakhan R, Agarwal CG, Pant DC & Mittal B (2010) A common polymorphism in the promoter of UCP2 is associated with obesity and hyperinsulenemia in northern Indians. Mol Cell Biochem 337(1–2): 293–8. Stanley S, Pinto S, Segal J, Perez CA, Viale A, DeFalco J, Cai X, Heisler LK & Friedman JM (2010) Identification of neuronal subpopulations that project from hypothalamus to both liver and adipose tissue polysynaptically. Proc Natl Acad Sci USA 107(15): 7024–9. Steiger A (2002) Sleep cycle. In: Craighead EW & Nemeroff CB (eds) The Corsini Encyclopedia of Psychology and Behavioral Science, Wiley 4, p 1538. Steiger A (2007) Neurochemical regulation of sleep. J Psychiatr Res 41(7): 537–52. Stenberg D, Litonius E, Halldner L, Johansson B, Fredholm BB & Porkka-Heiskanen T (2003) Sleep and its homeostatic regulation in mice lacking the adenosine A1 receptor. J Sleep Res 12(4): 283–90. Stephan FK (2002) The "other" circadian system: food as a Zeitgeber. J Biol Rhythms 17(4): 284–92. Stuart JA, Harper JA, Brindle KM, Jekabsons MB & Brand MD (2001) Physiological levels of mammalian uncoupling protein 2 do not uncouple yeast mitochondria. J Biol Chem 276(21): 18633–9. Sugimoto T, Nagake Y, Sugimoto S, Akagi S, Ichikawa H, Nakamura Y, Ogawa N & Makino H (2002) Plasma orexin concentrations in patients on hemodialysis. Nephron 90(4): 379–83. 148 Surendran S, Campbell GA, Tyring SK, Matalon K, McDonald JD & Matalon R (2003) High levels of orexin A in the brain of the mouse model for phenylketonuria: possible role of orexin A in hyperactivity seen in children with PKU. Neurochem Res 28(12): 1891–4. Switonska MM, Kaczmarek P, Malendowicz LK & Nowak KW (2002) Orexins and adipoinsular axis function in the rat. Regul Pept 104(1–3): 69–73. Szymusiak R, Alam N, Steininger TL & McGinty D (1998) Sleep-waking discharge patterns of ventrolateral preoptic/anterior hypothalamic neurons in rats. Brain Res 803(1–2): 178–88. Taheri S, Sunter D, Dakin C, Moyes S, Seal L, Gardiner J, Rossi M, Ghatei M & Bloom S (2000) Diurnal variation in orexin A immunoreactivity and prepro-orexin mRNA in the rat central nervous system. Neurosci Lett 279(2): 109–12. Takahashi K, Arihara Z, Suzuki T, Sone M, Kikuchi K, Sasano H, Murakami O & Totsune K (2006) Expression of orexin-A and orexin receptors in the kidney and the presence of orexin-A-like immunoreactivity in human urine. Peptides 27(4): 871–7. Takahashi K, Koyama Y, Kayama Y & Yamamoto M (2002) Effects of orexin on the laterodorsal tegmental neurones. Psychiatry Clin Neurosci 56(3): 335–6. Takahashi N, Okumura T, Yamada H & Kohgo Y (1999) Stimulation of gastric acid secretion by centrally administered orexin-A in conscious rats. Biochem Biophys Res Commun 254(3): 623–7. Takano S, Kanai S, Hosoya H, Ohta M, Uematsu H & Miyasaka K (2004) Orexin-A does not stimulate food intake in old rats. Am J Physiol Gastrointest Liver Physiol 287(6): G1182–7. Takeuchi K, Ukawa H, Kato S, Furukawa O, Araki H, Sugimoto Y, Ichikawa A, Ushikubi F & Narumiya S (1999) Impaired duodenal bicarbonate secretion and mucosal integrity in mice lacking prostaglandin E-receptor subtype EP(3). Gastroenterology 117(5): 1128–35. Takeuchi K, Yagi K, Kato S & Ukawa H (1997) Roles of prostaglandin E-receptor subtypes in gastric and duodenal bicarbonate secretion in rats. Gastroenterology 113(5): 1553–9. Tang J, Chen J, Ramanjaneya M, Punn A, Conner AC & Randeva HS (2008) The signalling profile of recombinant human orexin-2 receptor. Cell Signal 20(9): 1651– 61. Tanida M, Niijima A, Shen J, Yamada S, Sawai H, Fukuda Y & Nagai K (2006) Dose- different effects of orexin-A on the renal sympathetic nerve and blood pressure in urethane-anesthetized rats. Exp Biol Med (Maywood) 231(10): 1616–25. Tao R, Ma Z, McKenna JT, Thakkar MM, Winston S, Strecker RE & McCarley RW (2006) Differential effect of orexins (hypocretins) on serotonin release in the dorsal and median raphe nuclei of freely behaving rats. Neuroscience 141(3): 1101–5. Terao A, Apte-Deshpande A, Morairty S, Freund YR & Kilduff TS (2002) Age-related decline in hypocretin (orexin) receptor 2 messenger RNA levels in the mouse brain. Neurosci Lett 332(3): 190–4. 149 Thakkar MM, Engemann SC, Walsh KM & Sahota PK (2008) Adenosine and the homeostatic control of sleep: effects of A1 receptor blockade in the perifornical lateral hypothalamus on sleep-wakefulness. Neuroscience 153(4): 875–80. Thakkar MM, Ramesh V, Strecker RE & McCarley RW (2001) Microdialysis perfusion of orexin-A in the basal forebrain increases wakefulness in freely behaving rats. Arch Ital Biol 139(3): 313–28. Thakkar MM, Winston S & McCarley RW (2002) Orexin neurons of the hypothalamus express adenosine A1 receptors. Brain Res 944(1–2): 190–4. Thannickal TC, Moore RY, Nienhuis R, Ramanathan L, Gulyani S, Aldrich M, Cornford M & Siegel JM (2000) Reduced number of hypocretin neurons in human narcolepsy. Neuron 27(3): 469–74. Thorpe AJ & Kotz CM (2005) Orexin A in the nucleus accumbens stimulates feeding and locomotor activity. Brain Res 1050(1–2): 156–62. Tomasik PJ, Spodaryk M & Sztefko K (2004) Plasma concentrations of orexins in children. Ann Nutr Metab 48(4): 215–20. van den Top M, Lee K, Whyment AD, Blanks AM & Spanswick D (2004) Orexigen- sensitive NPY/AgRP pacemaker neurons in the hypothalamic arcuate nucleus. Nat Neurosci 7(5): 493–4. Toshinai K, Date Y, Murakami N, Shimada M, Mondal MS, Shimbara T, Guan JL, Wang QP, Funahashi H, Sakurai T, Shioda S, Matsukura S, Kangawa K & Nakazato M (2003) Ghrelin-induced food intake is mediated via the orexin pathway. Endocrinology 144(4): 1506–12. Trivedi P, Yu H, MacNeil DJ, Van der Ploeg LH & Guan XM (1998) Distribution of orexin receptor mRNA in the rat brain. FEBS Lett 438(1–2): 71–5. Tsubone T, Masaki T, Katsuragi I, Tanaka K, Kakuma T & Yoshimatsu H (2005) Ghrelin regulates adiposity in white adipose tissue and UCP1 mRNA expression in brown adipose tissue in mice. Regul Pept 130(1–2): 97–103. Tsujino N & Sakurai T (2009) Orexin/hypocretin: a neuropeptide at the interface of sleep, energy homeostasis, and reward system. Pharmacol Rev 61(2): 162–76. Tsujino N, Yamanaka A, Ichiki K, Muraki Y, Kilduff TS, Yagami K, Takahashi S, Goto K & Sakurai T (2005) Cholecystokinin activates orexin/hypocretin neurons through the cholecystokinin A receptor. J Neurosci 25(32): 7459–69. Tuo BG & Isenberg JI (2003) Effect of 5-hydroxytryptamine on duodenal mucosal bicarbonate secretion in mice. Gastroenterology 125(3): 805–14. Tuo BG, Sellers Z, Paulus P, Barrett KE & Isenberg JI (2004) 5-HT induces duodenal mucosal bicarbonate secretion via cAMP- and Ca2+-dependent signaling pathways and 5-HT4 receptors in mice. Am J Physiol Gastrointest Liver Physiol 286(3): G444–51. Turunen PM, Ekholm ME, Somerharju P & Kukkonen JP (2009) Arachidonic acid release mediated by OX(1) orexin receptors. Br J Pharmacol. Ukropec J, Anunciado RP, Ravussin Y, Hulver MW & Kozak LP (2006) UCP1- independent thermogenesis in white adipose tissue of cold-acclimated Ucp1-/- mice. J Biol Chem 281(42): 31894–908. 150 Uramura K, Funahashi H, Muroya S, Shioda S, Takigawa M & Yada T (2001) Orexin-a activates phospholipase C- and protein kinase C-mediated Ca2+ signaling in dopamine neurons of the ventral tegmental area. Neuroreport 12(9): 1885–9. Wakamatsu H, Yoshinobu Y, Aida R, Moriya T, Akiyama M & Shibata S (2001) Restricted-feeding-induced anticipatory activity rhythm is associated with a phase- shift of the expression of mPer1 and mPer2 mRNA in the cerebral cortex and hippocampus but not in the suprachiasmatic nucleus of mice. Eur J Neurosci 13(6): 1190–6. Vakkuri O, Rintamaki H & Leppaluoto J (1985) Presence of immunoreactive melatonin in different tissues of the pigeon (Columba livia). Gen Comp Endocrinol 58(1): 69–75. Valatx JL & Bugat R (1974) [Genetic factors as determinants of the waking-sleep cycle in the mouse (author's transl)]. Brain Res 69(2): 315–30. Walder K, Norman RA, Hanson RL, Schrauwen P, Neverova M, Jenkinson CP, Easlick J, Warden CH, Pecqueur C, Raimbault S, Ricquier D, Silver MH, Shuldiner AR, Solanes G, Lowell BB, Chung WK, Leibel RL, Pratley R & Ravussin E (1998) Association between uncoupling protein polymorphisms (UCP2-UCP3) and energy metabolism/obesity in Pima indians. Hum Mol Genet 7(9): 1431–5. van De Parre TJ, Martinet W, Verheye S, Kockx MM, Van Langenhove G, Herman AG & De Meyer GR (2008) Mitochondrial uncoupling protein 2 mediates temperature heterogeneity in atherosclerotic plaques. Cardiovasc Res 77(2): 425–31. Wang B, You ZB & Wise RA (2009) Reinstatement of cocaine seeking by hypocretin (orexin) in the ventral tegmental area: independence from the local corticotropin- releasing factor network. Biol Psychiatry 65(10): 857–62. Veasey SC, Yeou-Jey H, Thayer P & Fenik P (2004) Murine Multiple Sleep Latency Test: phenotyping sleep propensity in mice. Sleep 27(3): 388–93. Wenzel J, Grabinski N, Knopp CA, Dendorfer A, Ramanjaneya M, Randeva HS, Ehrhart- Bornstein M, Dominiak P & Johren O (2009) Hypocretin/orexin increases the expression of steroidogenic enzymes in human adrenocortical NCI H295R cells. Am J Physiol Regul Integr Comp Physiol 297(5): R1601–9. Verty AN, Allen AM & Oldfield BJ (2010) The Endogenous Actions of Hypothalamic Peptides on Brown Adipose Tissue Thermogenesis in the Rat. Endocrinology. Westerterp-Plantenga MS (2008) Protein intake and energy balance. Regul Pept 149(1–3): 67–9. WHO (2010) Obesity. URI: http://www.who.int/topics/obesity/en/. Vidal-Puig A, Solanes G, Grujic D, Flier JS & Lowell BB (1997) UCP3: an uncoupling protein homologue expressed preferentially and abundantly in skeletal muscle and brown adipose tissue. Biochem Biophys Res Commun 235(1): 79–82. Vidal-Puig AJ, Grujic D, Zhang CY, Hagen T, Boss O, Ido Y, Szczepanik A, Wade J, Mootha V, Cortright R, Muoio DM & Lowell BB (2000) Energy metabolism in uncoupling protein 3 gene knockout mice. J Biol Chem 275(21): 16258–66. Williams RS & Wagner PD (2000) Transgenic animals in integrative biology: approaches and interpretations of outcome. J Appl Physiol 88(3): 1119–26. 151 Willie JT, Chemelli RM, Sinton CM, Tokita S, Williams SC, Kisanuki YY, Marcus JN, Lee C, Elmquist JK, Kohlmeier KA, Leonard CS, Richardson JA, Hammer RE & Yanagisawa M (2003) Distinct narcolepsy syndromes in Orexin receptor-2 and Orexin null mice: molecular genetic dissection of Non-REM and REM sleep regulatory processes. Neuron 38(5): 715–30. Willie JT, Chemelli RM, Sinton CM & Yanagisawa M (2001) To eat or to sleep? Orexin in the regulation of feeding and wakefulness. Annu Rev Neurosci 24: 429–58. Xi MC, Morales FR & Chase MH (2001) Effects on sleep and wakefulness of the injection of hypocretin-1 (orexin-A) into the laterodorsal tegmental nucleus of the cat. Brain Res 901(1–2): 259–64. Xie X, Crowder TL, Yamanaka A, Morairty SR, Lewinter RD, Sakurai T & Kilduff TS (2006) GABA(B) receptor-mediated modulation of hypocretin/orexin neurones in mouse hypothalamus. J Physiol 574(Pt 2): 399–414. Yamada H, Okumura T, Motomura W, Kobayashi Y & Kohgo Y (2000) Inhibition of food intake by central injection of anti-orexin antibody in fasted rats. Biochem Biophys Res Commun 267(2): 527–31. Yamanaka A, Beuckmann CT, Willie JT, Hara J, Tsujino N, Mieda M, Tominaga M, Yagami K, Sugiyama F, Goto K, Yanagisawa M & Sakurai T (2003) Hypothalamic orexin neurons regulate arousal according to energy balance in mice. Neuron 38(5): 701–13. Yamanaka A, Kunii K, Nambu T, Tsujino N, Sakai A, Matsuzaki I, Miwa Y, Goto K & Sakurai T (2000) Orexin-induced food intake involves neuropeptide Y pathway. Brain Res 859(2): 404–9. Yamanaka A, Sakurai T, Katsumoto T, Yanagisawa M & Goto K (1999) Chronic intracerebroventricular administration of orexin-A to rats increases food intake in daytime, but has no effect on body weight. Brain Res 849(1–2): 248–52. Yamanaka A, Tsujino N, Funahashi H, Honda K, Guan JL, Wang QP, Tominaga M, Goto K, Shioda S & Sakurai T (2002) Orexins activate histaminergic neurons via the orexin 2 receptor. Biochem Biophys Res Commun 290(4): 1237–45. Yeung HW, Grewal RK, Gonen M, Schoder H & Larson SM (2003) Patterns of (18)F- FDG uptake in adipose tissue and muscle: a potential source of false-positives for PET. J Nucl Med 44(11): 1789–96. Yokogawa T, Marin W, Faraco J, Pezeron G, Appelbaum L, Zhang J, Rosa F, Mourrain P & Mignot E (2007) Characterization of sleep in zebrafish and insomnia in hypocretin receptor mutants. PLoS Biol 5(10): e277. Yoshida K, McCormack S, Espana RA, Crocker A & Scammell TE (2006) Afferents to the orexin neurons of the rat brain. J Comp Neurol 494(5): 845–61. Yoshida Y, Fujiki N, Nakajima T, Ripley B, Matsumura H, Yoneda H, Mignot E & Nishino S (2001) Fluctuation of extracellular hypocretin-1 (orexin A) levels in the rat in relation to the light-dark cycle and sleep-wake activities. Eur J Neurosci 14(7): 1075–81. 152 Yoshimichi G, Yoshimatsu H, Masaki T & Sakata T (2001) Orexin-A regulates body temperature in coordination with arousal status. Exp Biol Med (Maywood) 226(5): 468–76. Yu XX, Mao W, Zhong A, Schow P, Brush J, Sherwood SW, Adams SH & Pan G (2000) Characterization of novel UCP5/BMCP1 isoforms and differential regulation of UCP4 and UCP5 expression through dietary or temperature manipulation. FASEB J 14(11): 1611–8. Zhang S, Zeitzer JM, Sakurai T, Nishino S & Mignot E (2007) Sleep/wake fragmentation disrupts metabolism in a mouse model of narcolepsy. J Physiol 581(Pt 2): 649–63. Zhang S, Zeitzer JM, Yoshida Y, Wisor JP, Nishino S, Edgar DM & Mignot E (2004) Lesions of the suprachiasmatic nucleus eliminate the daily rhythm of hypocretin-1 release. Sleep 27(4): 619–27. Zhang W, Fukuda Y & Kuwaki T (2005) Respiratory and cardiovascular actions of orexin- A in mice. Neurosci Lett 385(2): 131–6. Zhang W, Sunanaga J, Takahashi Y, Mori T, Skurai T, Kanmura Y & Kuwaki T (2010) Orexin neurons are indispensable for stress-induced thermogenesis in mice. J Physiol. Zhang X, Renehan WE & Fogel R (2000) Vagal innervation of the rat duodenum. J Auton Nerv Syst 79(1): 8–18. Zheng H, Corkern M, Stoyanova I, Patterson LM, Tian R & Berthoud HR (2003) Peptides that regulate food intake: appetite-inducing accumbens manipulation activates hypothalamic orexin neurons and inhibits POMC neurons. Am J Physiol Regul Integr Comp Physiol 284(6): R1436–44. Zheng H, Patterson LM & Berthoud HR (2007) Orexin signaling in the ventral tegmental area is required for high-fat appetite induced by opioid stimulation of the nucleus accumbens. J Neurosci 27(41): 11075–82. Zhou Y, Proudnikov D, Yuferov V & Kreek MJ (2010) Drug-induced and genetic alterations in stress-responsive systems: Implications for specific addictive diseases. Brain Res 1314: 235–52. Zhu Y, Miwa Y, Yamanaka A, Yada T, Shibahara M, Abe Y, Sakurai T & Goto K (2003) Orexin receptor type-1 couples exclusively to pertussis toxin-insensitive G-proteins, while orexin receptor type-2 couples to both pertussis toxin-sensitive and -insensitive G-proteins. J Pharmacol Sci 92(3): 259–66. Zingaretti MC, Crosta F, Vitali A, Guerrieri M, Frontini A, Cannon B, Nedergaard J & Cinti S (2009) The presence of UCP1 demonstrates that metabolically active adipose tissue in the neck of adult humans truly represents brown adipose tissue. FASEB J 23(9): 3113–20. Ziolkowska A, Spinazzi R, Albertin G, Nowak M, Malendowicz LK, Tortorella C & Nussdorfer GG (2005) Orexins stimulate glucocorticoid secretion from cultured rat and human adrenocortical cells, exclusively acting via the OX1 receptor. J Steroid Biochem Mol Biol 96(5): 423–9. 153 154 Original publications I Mäkelä KA, Wigren HK, Zant JC, Sakurai T, Alhonen L, Kostin A, Porkka- Heiskanen T & Herzig KH (2010) Characterization of sleep-wake patterns in a novel transgenic mouse line overexpressing human prepro-orexin/hypocretin. Acta Physiol 198(3): 237–249. DOI: 10.1111/j.1748-1716.2009.02068.x. II Mäkelä KA, Kettunen TS, Kovalainen M, Markkula A, Åkerman KEO, Järvelin MR, Saarela S, Alhonen L & Herzig KH Mice overexpressing human prepro-orexin have increased heat production and a PPAR gamma dependent upregulation of UCP2 in WAT. Manuscript. III Bengtsson MW, Mäkelä K, Sjöblom M, Uotila S, Åkerman KEO, Herzig KH & Flemström G (2007) Food-induced expression of orexin receptors in rat duodenal mucosa regulates the bicarbonate secretory response to orexin-A. Am J Physiol Gastrointest Liver Physiol 293(2): G501-G509. DOI: 10.1152/ajpgi.00514.2006. IV Bengtsson MW, Mäkelä K, Herzig KH & Flemström G (2009) Short food deprivation inhibits orexin receptor 1 expression and orexin-A induced intracellular calcium signaling in acutely isolated duodenal enterocytes. Am J Physiol Gastrointest Liver Physiol 296(3): G651-G658. DOI: 10.1152/ajpgi.90387.2008. Reprinted with permissions from Acta Physiol (Oxf.) (I) and Am J Physiol Gastrointest Liver Physiol (III, IV). Original publications are not included in the electronic version of the dissertation. 155 156 ACTA UNIVERSITATIS OULUENSIS SERIES D MEDICA 1070. Tanskanen, Päivikki (2010) Brain MRI in subjects with schizophrenia and in adults born prematurely : the Northern Finland 1966 Birth Cohort Study 1071. Abass, Khaled M. (2010) Metabolism and interactions of pesticides in human and animal in vitro hepatic models 1072. Luukkonen, Anu-Helmi (2010) Bullying behaviour in relation to psychiatric disorders, suicidality and criminal offences : a study of under-age adolescent inpatients in Northern Finland 1073. Ahola, Riikka (2010) Measurement of bone exercise : osteogenic features of loading 1074. Krüger, Johanna (2010) Molecular genetics of early-onset Alzheimer's disease and frontotemporal lobar degeneration 1075. Kinnunen, Urpo (2010) Blood culture findings during neutropenia in adult patients with acute myeloid leukaemia : the influence of the phase of the disease, chemotherapy and the blood culture systems 1076. Saarela, Ville (2010) Stereometric parameters of the Heidelberg Retina Tomograph in the follow-up of glaucoma 1077. Reponen, Jarmo (2010) Teleradiology—changing radiological service processes from local to regional, international and mobile environment 1078. Leskinen, Kaja (2010) Fissure sealants in caries prevention : a practice-based study using survival analysis 1079. Hietasalo, Pauliina (2010) Behavioral and economic aspects of caries control 1080. Jääskeläinen, Minna (2010) Apoptosis-regulating factors in developing and adult ovaries 1081. Alahuhta, Maija (2010) Tyypin 2 diabeteksen riskiryhmään kuuluvien työikäisten henkilöiden painonhallinnan ja elintapamuutoksen tunnuspiirteitä 1082. Hurskainen, Merja (2010) The roles of collagens XV and XVIII in vessel formation, the function of recombinant human full-length type XV collagen and the roles of collagen XV and laminin ?α4 in peripheral nerve development and function 1083. Rasi, Karolina (2010) Collagen XV as a matrix organizer : its function in the heart and its role together with laminin α4 in peripheral nerves 1084. Korkiakangas, Eveliina (2010) Aikuisten liikuntamotivaatioon vaikuttavat tekijät Book orders: Granum: Virtual book store http://granum.uta.fi/granum/ D 1085 OULU 2010 D 1085 UNIVERSITY OF OULU P.O.B. 7500 FI-90014 UNIVERSITY OF OULU FINLAND ACTA UNIVERSITATIS OULUENSIS ACTA UNIVERSITATIS OULUENSIS ACTA SERIES EDITORS DMEDICA Kari Antero Mäkelä ASCIENTIAE RERUM NATURALIUM Kari Antero Mäkelä Professor Mikko Siponen THE ROLES OF OREXINS ON BHUMANIORA SLEEP/WAKEFULNESS, University Lecturer Elise Kärkkäinen CTECHNICA ENERGY HOMEOSTASIS AND Professor Hannu Heusala INTESTINAL SECRETION DMEDICA Professor Olli Vuolteenaho ESCIENTIAE RERUM SOCIALIUM Senior Researcher Eila Estola FSCRIPTA ACADEMICA Information officer Tiina Pistokoski GOECONOMICA University Lecturer Seppo Eriksson EDITOR IN CHIEF Professor Olli Vuolteenaho PUBLICATIONS EDITOR Publications Editor Kirsti Nurkkala UNIVERSITY OF OULU, FACULTY OF MEDICINE, INSTITUTE OF BIOMEDICINE, ISBN 978-951-42-6377-4 (Paperback) DEPARTMENT OF PHYSIOLOGY; ISBN 978-951-42-6378-1 (PDF) UNIVERSITY OF OULU, ISSN 0355-3221 (Print) BIOCENTER OULU; ISSN 1796-2234 (Online) UNIVERSITY OF EASTERN FINLAND, DEPARTMENT OF BIOTECHNOLOGY AND MOLECULAR MEDICINE, A. I. VIRTANEN INSTITUTE FOR MOLECULAR SCIENCES