US 20150.045318A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2015/0045318 A1 Ralf et al. (43) Pub. Date: Feb. 12, 2015

(54) COMPONENT AND METHOD FOR Publication Classification TREATINGVIRAL DISEASE (51) Int. Cl. A 6LX3 L/7076 (2006.01) (71) Applicant: Institut Pasteur of Shanghai, Chinese A63L/85 (2006.01) Academy of Sciences, Shanghai (CN) A63/675 (2006.01) (52) U.S. Cl. (72) Inventors: Altmeyer Ralf, Shanghai (CN); Peijun CPC ...... A6 IK3I/7076 (2013.01); A61 K3I/675 Ren. Shanghai (CN (2013.01); A61 K3I/I85 (2013.01) en, Shanghai (CN) USPC ...... 514/47, 514/89; 514/577 (21) Appl. No.: 14/384,075 (57) ABSTRACT A method for treating viral infection includes administering (22) PCT Filed: Mar. 11, 2013 to a subject in need thereof a composition containing P2X receptor antagonists. The methods may achieve preventive or (86). PCT No.: PCT/CN2013/072402 therapeutic effect on hand foot and mouth disease by inhib iting viruses. The P2X receptor antagonists can inhibit infec S371 (c)(1), tion by a positive-sense single-stranded RNA picornavirus. (2) Date: Sep. 9, 2014 The virus may be an enterovirus or a Coxsackie virus, such as human enterovirus 71. The P2X receptor antagonist may be (30) Foreign Application Priority Data PPADS, iso-PPADS, PPNDS, Suramin, NFO23, TNP-ATP, NF279, NF157, Evans Blue, an analog thereof, a derivative Mar. 9, 2012 (CN) ...... 20121 OO6262O.9 thereof, or a pharmaceutically acceptable salt thereof. Patent Application Publication Feb. 12, 2015 Sheet 1 of 25 US 2015/0045318A1

10-fold reduction: 3.44 puM 100-fold reduction: 5.19 M 1000-fold reduction: 6.45 M 10,000-fold reduction: 7.19 M ECso = 6.93 uM (2511-fold reduction)

6 Patent Application Publication Feb. 12, 2015 Sheet 2 of 25 US 2015/0045318A1

EC50=4.7uM

500 OOO

400 OOO

3DO OOO

200 OOO EC50=2.6M

100 OOO Patent Application Publication Feb. 12, 2015 Sheet 3 of 25 US 2015/0045318A1

6 E

O as se O EC50=8.07M 1.

Ole 1 2 4. 8 16 32 uM FIG. 4

12,000,000 EC50=2.0LM 10,000,000

8,000,000 E O 6,000,000

4,000,000

2,000,000 Patent Application Publication Feb. 12, 2015 Sheet 4 of 25 US 2015/0045318A1

g

O 2.5 5 10 20 40

23.OO

10 Patent Application Publication Feb. 12, 2015 Sheet 5 of 25 US 2015/0045318A1

§ (wNHHOdwºVN89LVAD)

##uleug £4Kauppi ?ëjaar-1 LigaH fiun-1

FIG. 8

infection group & Drug group Placebo group

Lae©

|

FIG. 9 Patent Application Publication Feb. 12, 2015 Sheet 6 of 25 US 2015/0045318A1

1. 5

1 2.

9

6

the control 8, 20mg/kkg 50mg/kg

O 1 2 3 4 5 6 7 8 9 10 11 Post-injection time FIG 11 Patent Application Publication Feb. 12, 2015 Sheet 7 of 25 US 2015/0045318A1

C S O Cells not pre-treated Cells pre-treated - 7. With drug with drug s E. > 5 valN. S.e 5

ita & 4 1.

{ Cu { & {&

Prior to infection r re s a- a During infection -- r -- -- w Post-infection an ar re r

FIG. 12

* Relative EV71 viral load Ce viability Patent Application Publication Feb. 12, 2015 Sheet 8 of 25 US 2015/0045318A1

FIG. 14

10-fold 100-fold reduction reduction 7.14 4.41

-.5 . 1. 1. .

FIG. 15 Patent Application Publication Feb. 12, 2015 Sheet 9 of 25 US 2015/0045318A1

8.0 x 10

6.0 x 10

4.0 x 10

2.0 x 10

log1 nmol uM SH-TS SH-RS ECso 2.24 3.47

FIG. 16

C 6. f e S 5. Ea 9 c. 5 gC - 4. NO i We 4. 10-fold reduction: 5.89 uM 100-fold reduction: 15.49 puM 2O 3.

9

logo nmol F.G. 17 Patent Application Publication Feb. 12, 2015 Sheet 10 of 25 US 2015/0045318A1

E 40 * Control group CD 30 Drug group E 3 200 o O D - 10 N D

Day post-infection

FIG. 18

40. 10 Control drug

39

in s N' ' ' w8 o' A sesakorn 3 Day Post Infection FIG. 19 Patent Application Publication Feb. 12, 2015 Sheet 11 of 25 US 2015/0045318A1

NF 279 ". o - as 5 E SR d R S 9 S. L e c) R ... O R S. RNA Va i: Cell viability O 1.O 12 14 1S 1.8 2.O Logou FIG. 20A Evans blue

". s O - 5 s d S 9 S. se R 2 C. R RNA u & Cell viability 0.5 1. 15 2.0 Log10 FIM FIG. 20B Patent Application Publication Feb. 12, 2015 Sheet 12 of 25 US 2015/0045318A1

NF 157

6)

-- RNA a Cell viability -0.5 . O).5 O 15 2.0 2.5 L Ogo puM FIG. 20 C

iso-PPADS

120

-- iOO

8 O g - RNA 20 a Cell viability

0.5 O.O. 0.5 1. 1.5 2. log10 ul FIG. 20D Patent Application Publication Feb. 12, 2015 Sheet 13 of 25 US 2015/0045318A1

NF O23

to RNA a Cell viability 0.5 O.O. O.5 1.0 1.5 2.) g Logio ul FIG. 20E

PPADS

12O

OO

8 O

8- RNA 2O Cell viability -0.5 O) O5 1. S g Log 10 uM FIG. 20F Patent Application Publication Feb. 12, 2015 Sheet 14 of 25 US 2015/0045318A1

is logo EW.71 relative titter is viability dr viability 0505 1 1 O uM FIG. 21A BBG

e logo EV71 relative titter I viability 1 1 O uM FIG 21B Patent Application Publication Feb. 12, 2015 Sheet 15 of 25 US 2015/0045318A1

MRS 2159

2 1oo

8. O

s

O. 1 1 1 O 1OO uM FIG. 21C MRS 2179

2O

1 OO SO s 4. O O. 3. 2 40 & is logo EW/1 relative titter 2O A viability

W O1 1 10 1 OO uM FIG 21 D Patent Application Publication Feb. 12, 2015 Sheet 16 of 25 US 2015/0045318A1

RO O437626 7. 2O

S 4. 3O s S. 60 9. 3 CD 2 40 C. g 1. to logo EW.71 relative titter 2O is viability O O O. 1 1 1 O 1 OO uM FIG 21E TNP-ATP

wa9 were S

it 3 2. Va g 1. st logo EW 71 relative titter : a viability W O.1 1. 1 O 1 OO uM FIG. 21F Patent Application Publication Feb. 12, 2015 Sheet 17 of 25 US 2015/0045318A1

2',5'-ADP

m

s v N D g S A) t 9. CD R k O Qa d to logo EW Z1 relative titter O is viability- O O.1 1 10 1 OO uM FIG. 21G A 438O79 7. 12O

6 a 1 OO w

S 8O S old 4 A) 2 SO. O. 3 E 2 4o 2 Sp to logo EV71 relative titter 3. a viability 2O 5. 1 1 O 16 uM FIG. 21H Patent Application Publication Feb. 12, 2015 Sheet 18 of 25 US 2015/0045318 A1

5-BOBD

ims wo t r N. ce

y 2

se rib Fog o EW Z1 relative titter O viability

O. 1 1 1 O LM FIG. 21

A 74OOO3

8. 12O c) E O 1 OO o go O wa 5 4 O a 3 e So 2 3? to log 1 O EV71 eduvalent genome - S. 1 is viablity 32 S4

FIG. 21. Patent Application Publication Feb. 12, 2015 Sheet 19 of 25 US 2015/0045318A1

A 839977

S S. 9. t 9 VC 5 to logo EVA 1 relative fitter O is viability

O1 1. 1 O 1OO LM FIG. 21 K

A-3 17491

e log10 EW71 equvalent genome in viablity

LM FIG. 21. Patent Application Publication Feb. 12, 2015 Sheet 20 of 25 US 2015/0045318A1

AF-353

S s S. C. 9) VC se o O to logo EV71 relative titter wianity (505 O O. 1 1 1 O 1 OO LM FIG. 21M AZ 1 O6O612O

S S c) A) 2 O SD Va 5 e logo EV71 relative titter O : viability

O-1 1 1 O 1 OO uM FIG. 21N Patent Application Publication Feb. 12, 2015 Sheet 21 of 25 US 2015/0045318A1

AZ 1 1645373

to log1 O EV71 eduvalent genome viablity

uM FIG. 21 O 4CN-62 2O

O S 8. S CD A) 2 6O O. E Sb 40 g se 8 d no logo. EVf 1 relative titter & 2O O viability- a m r - O.1 1 1 O 1 OO LM FIG. 21P Patent Application Publication Feb. 12, 2015 Sheet 22 of 25 US 2015/0045318A1

OATP 7 12O

1 OO sa S 8O 4 S. 60 9. it 3 9 Va 2 d to Fogo EW71 relative titter O is viability O O.1 1 1 O 1 OO LM FIG. 21CR RO-3

S S t 2 O wa. 9. VC

c g se logo FV 71 relative titter is viability O O1 1 1 O 1 OO LM FIG 21R Patent Application Publication Feb. 12, 2015 Sheet 23 of 25 US 2015/0045318A1

Spinorphin

N C

2 Eleu-Val-Wai-yr-Pro-ir-ir

o s re logo. EV? 1 retative titter O is viabilityr r O. 1 1 1 O LM FIG 21S bz ATP

: E O

s

te m

2 is log10 EW 71 equivalent genome viability

FIG. 21T Patent Application Publication Feb. 12, 2015 Sheet 24 of 25 US 2015/0045318A1

UTP

2. 1oo

SO t 40 is logo EW 71 relative titter 20 site viabibility 0505 O. 1 1 1 O 1 OO uM FIG. 21U

VERMECTINE

•e log10 EV71 equvalant genome a viability

uM FIG. 21W Patent Application Publication Feb. 12, 2015 Sheet 25 of 25 US 2015/0045318A1

GW 79 1343

S s S. 9. 9. Va o ge logo EWF 1 relative titter O is viabilityr . O O O.1 1 1 O 1 OO uM FIG. 21W MRS 2219

7 2O

1 OO SO s a 4. A9 2 60 to 3 E ase 2 40 Ve e logo EW71 relative titter 2O Osexes is viability- - - - O O.1 1 1 O 1 OO LM FIG 21X US 2015/0045318 A1 Feb. 12, 2015

COMPONENT AND METHOD FOR SUMMARY OF INVENTION TREATINGVIRAL DISEASE 0010. The object of the present invention is to provide compositions and methods for the treatment of viral diseases. BACKGROUND OF INVENTION 0011. In a first aspect of the present invention, it provides 0001 1. Field of the Invention use of a P2X receptor antagonist for the preparation of com 0002 The present invention belongs to the field of bio positions for inhibiting positive-sense single-stranded RNA medicine. More specifically, the present invention relates to picornavirus. compositions and methods for treating viral diseases. 0012. In a preferred embodiment, the P2X receptor antagonist is used for the preparation of compositions for 0003 2. Background Art preventing, alleviating, or treating HFMD. 0004 Hand foot and mouth disease (HFMD) is a common viral infection in Western Pacific regions and is a major cause 0013. In another preferred embodiment, the compositions of death and childhood disease in China and Asia. In 2011, are also used for: Systemic administration or parenteral there were two million children suffering from HFMD in administration; preferably, the compositions are used for oral Western Pacific regions (more than 1.6 million in China, more administration, intravenous injection, intramuscular injec than 340,000 in Japan, and more than 11 million in Vietnam). tion, or inhalation. In the past 20 years, epidemic outbreak occurred once every 0014. In another aspect of the present invention, it pro two to three years in Summer and early autumn in countries vides a method for inhibiting positive-sense single-stranded having temperate climate (Solomon, Lewthwaite et al. 2010). RNA picornavirus, including: administering to a Subject in Chinese mainland has had outbreaks every spring and Sum need thereofan effective amount of P2X receptor antagonists. mer since 2008. 0015. In a preferred embodiment, the objects are mam 0005 HFMD mainly affects children under five. Major mals infected by viruses, including human, monkeys, or mice, symptoms include mouth ulcers, hand, foot and mouth Sores, etc. infected by enterovirus 71 or Coxsackie virus, preferably, mouth pain and burning (herpesangina). Most cases show the subject having HFMD. only mild symptoms and are self-limiting. However, there are 0016. In another preferred embodiment, the P2X receptor still a large number of cases (over twenty-seven thousand antagonist is selected from the group consisting of PPADS. cases in China in 2010, about 1.6%), which showed severe iso-PPADS, PPNDS, Suramin, NF023, TNP-ATP, NF279, neurological symptoms, such as aseptic meningitis, encepha NF157, Evans Blue, and/or analogs thereof or derivatives litis and polio-like paralysis and central nervous system dis thereof, and/or pharmaceutically acceptable salts thereof. orders and neurogenic pulmonary edema and cardiac dys 0017. In another preferred embodiment, the virus is function (Huang, Liu et al. 1999: Yang, Wang et al. 2009: enterovirus. Weng, Chen et al. 2010; Rhoades, Tabor-Godwin et al. 2011). 0018. In another preferred embodiment, the virus is 905 and 506 cases of deaths occurred in China in 2010 and enterovirus A. 2011, respectively. 0019. In another preferred embodiment, the virus is 0006 HFMD is caused by non-polio enteroviruses. Main human enterovirus 71 and Coxsackie virus. pathogenic viruses responsible for HFMD outbreak in Anhui 0020 More preferably, the virus is human enterovirus 71, province in 2008 were EV71 and CVA16 (Yan, Gao et al.: C4 subtype and Coxsackie virus A16 subtype. Zhang, Wang et al. 2010; Zhu, Zhu et al. 2010). Majority of 0021. Due to the disclosure herein, other aspects of the severe cases and deaths were caused by EV71 infection. present invention will be apparent to those skilled in the art. EV71 C4 subtype is a major epidemic strain in China, whereas EV71 C1, C2, C4, B3, and B4 subtypes are prevalent BRIEF DESCRIPTION OF DRAWINGS in other regions of Asia (Yang, Ren et al. 2009). 0022 FIG. 1 shows, at different E02 concentrations, EV71 0007 HFMD spreads from patients to people by direct clinical isolates were used to infect RD cells, atan MOI of 0.1. contact with mouth and nose discharges, blister fluids, and After incubation for 46 h, viral RNA in culture supernatant feces from infected persons (Solomon, Lewthwaite et al. was extracted. Relative EV71 viral load was determined by 2010). Infected people are most contagious one week after quantitative RT-PCR. Numbers in columns 2, 3, 4 of the table disease onset, but contagiousness persists even after symp represent results obtained from three repeated tests. Right toms were improved (Han, Ma et al. 2010). Many infected panel shows the mean values of three results. people (including most infected adults) do not have symp 0023 FIG.2 shows, at different E02 concentrations, EV71 toms. Children with oral rashes are easier to be diagnosed in 10-fold serial dilutions were used to infect RD cells. After through clinical and follow-up Virology diagnosis. incubation for 3-4 days, CPE (cytopathic effect) was 0008. At present, no HFMD vaccines and drugs are avail observed under optical microscope and stained with crystal able. The only way to treat patients and to prevent spreading violet to calculate 50% tissue culture infective dose has been hygiene, Supportive care, pain relief, mouthwash, (TCIDs). and intravenous immunoglobulin (Chinese Ministry of 0024 FIG.3 shows, at different E02 concentrations, EV71 Health 2010). Although vaccines have been in development, was used to infect RD cells cultured in 12-well plates. After protection efficiency, however, still remains unknown, and incubation for 5-7 days, stained and plaque-forming units still requires long period of time for large-scale vaccination to (PFU) were calculated. be implemented. 0025 FIG. 4 shows, at different E02 concentrations, EV71 0009. Therefore, there is an urgent need to develop drugs M.A.V. in 10-fold serial dilutions was used to infect RD cells. that can prevent and treat HFMD in the field, especially, After incubation for 3-4 days, CPE was observed under opti developing drugs that inhibit EV71 and CVA16 viral infec cal microscope and stained with crystal violet to calculate tion to achieve prevention and treatment from the source. 50% tissue culture infective dose (TCIDs). US 2015/0045318 A1 Feb. 12, 2015

0026 FIG.5 shows, at different E02 concentrations, EV71 lar domain, two transmembrane domains, and two intracel M.A.V. was used to infect RD cells cultured in 12-well plates. lular domains. P2X family includes seven subtypes. Trig After incubation for 5-7 days, stained and plaque-forming gered by extracellular ATP P2X ion channels open, causing units (PFU) were calculated. calcium ion influx and intracellular calcium accumulation. A 0027 FIG. 6 shows, at different E02 concentrations, Cox series of downstream signal transduction is activated through sackie virus A16 in 10-fold serial dilutions were used to infect MAPK, PKC, and calmodulin (Erb, Liao et al. 2006). RD cells. After incubation for 2 days, CPE was observed 0046. After in-depth study, the present inventors found under optical microscope and stained with crystal violet to that some P2X receptor antagonists are useful for inhibiting calculate 50% tissue culture infective dose (TCIDs). viruses. The viruses are those of positive-sense single 0028 FIG.7 shows three-day-old newborn ICR mice were stranded RNA picornavirus family, including Aphthovirus, infected with EV71 clinical isolates. Five days after infection, Avihepatovirus, Cardiovirus. Theilovirus, Enterovirus, Erbo blood was collected and serum separated. Viral RNA in serum virus, Hepatovirus, Kobuvirus, Parechovirus, etc.; preferably, was extracted. Viral load was determined by one-step real the virus is Enterovirus, including Enteroviruses A-H class, time quantitative RT-PCR. Rhinovirus A-C: preferably, the virus is Enterovirus A, 0029 FIG. 8 shows distribution of CVA16 in various including Baboon enterovirus, human Coxsackie Virus type organs or tissues of ICR newborn mice. In which, No. 1 and A2-8, A10, A12, A14, A16, human enterovirus type 71, 76, No. 2 indicate blood samples obtained from two mice, respec 89,90-92, etc.; preferably, including Enterovirus 71 (EV71) tively. (including A, B, and C Subtypes), Coxsackie viruses (includ 0030 FIG.9 shows three-day-old newborn ICR mice were ing classes A and B, preferably, including A16 Subtype; infected with CVA16. Six days after infection, tissues were CVA16). obtained, blood collected, and serum separated. RNA from 0047. It is known that enterovirus 71 or Coxsackie virus tissues and serum were extracted. CVA16 RNA was mea A16 infection is a major cause of HFMD. Studies published sured to calculate viral load. by Chinese Ministry of Health “Hand Foot and Mouth Dis 0031 FIG. 10 shows cytotoxicity of RD cells at different ease Treatment Guidelines (2010 version) and a number of E02 concentrations determined by using Celltiter Glo published studies all indicate that EV71 and CVA16 are major reagents. pathogens. Therefore, P2X receptor antagonists can be used 0032 FIG. 11 shows three-day-old ICR mice were for preventing and treating HFMD. injected intraperitoneally and daily with a dose of 50 ul of 50 0048. As an alternative embodiment of the present inven mg/kg E02, 20 mg/kg E02, or 50 ul of DMEM for 4 consecu tion, the P2X receptor is P2X 1-7 receptor subtypes. tive days. Toxicity results were observed. 0049. As another preferred embodiment of the present 0033 FIG. 12 shows testing of time of E02 addition assay. invention, the P2X receptor antagonist is selected from: Potency of E02 to inhibit EV71 infection was tested by add PPADS, Iso-PPADS, PPNDS, Suramin, NF023 (Suramin ing E02 prior to infection (B, C), during infection (D, E), and derivative), TNP-ATP, NF279, NF 157, and Evans Blue. after infection (F), respectively. 0050. In another more preferred embodiment of the 0034 FIG. 13 shows, at different PPADS concentrations, present invention, the P2X receptor antagonist may be: EV71 clinical isolates were used to infect RD cells. Inhibitory Suramin, PPADS, iso-PPADS, PPNDS, NFO23, NF279, potency of PPADS on EV71 replication was determined. TNP-ATP, NF157, and Evans Blue. 0035 FIG. 14 shows mRNA expression level of six P2X 0051. The present invention also includes isomers of vari subtypes in RD cells was determined by RT-PCR method. ous compounds exemplified above, racemates, pharmaceuti 0036 FIG. 15 shows E02 inhibits the replication of EV71 cally acceptable salts, hydrates, precursors, derivatives or isolates SH-TS and SH-RS in RD cells. analogs thereof. So long as the isomers, racemates, pharma 0037 FIG. 16 shows E02 reduces PFU of EV71 isolates ceutically acceptable salts, hydrates, derivatives or analogs SH-TS, SH-RS in RD cells. also possess the function of inhibiting viruses (e.g. enterovi 0038 FIG. 17 shows E02 inhibits the replication of EV71 rus 71 or Coxsackie virus A16 subtype). isolate SEP-4 in Vero cells. 0052. The term "isomer' includes: conformational iso 0039 FIG. 18 shows E02 inhibits the replication of EV71 mers, optical isomers (e.g., enantiomers and non-enanti in rhesus monkeys in vivo. omers), geometric isomers (e.g., cis and trans isomers). 0040 FIG. 19 shows E02 inhibits body temperature rise 0053. The term “derivative or analog refers to P2X recep caused by EV71 in rhesus monkey. tor antagonists having similar structural formula as exempli 0041 FIG. 20 shows P2X receptor antagonists inhibit fied above, in particular, those having same core structure, but EV71 replication in RD cells. compounds having some of radicals Substituted with similar 0042 FIG. 21 shows effects of other antagonists and ago radicals. The compounds still maintain the function of inhib nists on EV71. iting viruses (such as enterovirus 71 or Coxsackie virus A16 subtype). For example, His substituted with C1-C4 alkyl: C1 DETAILED DESCRIPTION alkyl is substituted with C2 alkyl; substitutions occur between 0043. After intensive studies, the present inventors halogen group members (including F, Cl, Br, and I); and revealed, for the first time, a new use of P2X receptor antago substitutions occur between OH, OCH, OCHCH nists for the preparation of viral compositions. The P2X OCHCH, etc. receptor antagonists achieve preventive or therapeutic effect 0054 The term “pharmaceutically acceptable salts' refers on HFMD by inhibiting viruses. to salts formed by reacting the above-mentioned compounds 0044 P2X receptor antagonists and use thereof with inorganic acid, organic acid, alkali metals or alkaline 0045 P2X is a class of ATP-gated ion channel family of earth metals. These salts include (but are not limited to): (1) proteins expressed on cell membrane, and is usually a salts formed with the following inorganic acids: Such as homologous or heterologous trimer formed by an extracellu hydrochloric acid, hydrobromic acid, hydroiodic acid, sulfu US 2015/0045318 A1 Feb. 12, 2015

ric acid, nitric acid, phosphoric acid; (2) salts formed with the may be set up. The control group may be systems containing following organic acids, such as acetic acid, lactic acid, citric P2X receptors without adding candidate substances. acid, Succinic acid, fumaric acid, gluconic acid, benzoic acid, 0061 The candidate substances may include (but are not methane Sulfonic acid, ethane Sulfonic acid, benzene Sulfonic limited to): Small molecule compounds, polypeptides, and acid, p-toluene Sulfonic acid, oxalic acid, Succinic acid, tar ligands. Preferably, the candidate Substances are Small mol taric acid, maleic acid, or arginine Other salts include Salts ecule compounds. For example, the candidate substances formed with alkali metals or alkaline earth metals (e.g., may be various P2X receptor antagonists. Sodium, potassium, calcium, or magnesium), ammonium 0062. As a preferred embodiment of the present invention, salts or water-soluble amine salts (e.g. N-methylglucamine the methods further include: performing further cell experi salt), lower alkanol ammonium salts and other pharmaceuti ments and/or animal testing on the obtained potential Sub cally acceptable amine salts (e.g., methylamine salts, ethy stances to further select and determine truly useful substances lamine salts, propylamine salts, dimethylamine salts, trim for inhibiting viruses. ethylamine salts, diethylamine salts, triethylamine salts, tert 0063. In another aspect, the present invention also butylamine salts, ethylenediamine salts, hydroxyethylamine includes substances for inhibiting viruses obtained by the salts, di-hydroxyethylamine salts, tris-hydroxyethyl amine screening methods. salts, and ammonium salts formed, respectively, with mor 0064 Compositions pholine, piperazine, lysine) or other conventional form of 0065 Compounds of the present invention may be used to “prodrug. Compounds have one or more asymmetric cen prepare pharmaceutical compositions. Pharmaceutically ters. Thus, these compounds may exist as racemic mixtures, acceptable carriers can be solid or liquid. Solid formulations individual enantiomers, individual non-enantiomers isomers, include powders, tablets, pills, capsules, wafers, Supposito non-enantiomer mixtures, cis or trans isomers. ries, and dispersible granules. Solid carriers can be one or 0055. The term “precursor compound” refers to precursor several Substances, which may serve as diluents, flavoring compounds, after being administered by appropriate meth agents, binders, preservatives, tablet disintegrating agents, or ods, metabolized or reacted chemically in patients, are con encapsulating materials. In powders, carriers are micro-seg Verted to P2X receptor antagonist compounds or salts formed mented Solids. Compounds of the present invention and with or solutions of P2X receptor antagonist compounds, as micro-segmented active ingredients are present in mixture. In exemplified previously in the present invention. Precursor tablets, such compounds are mixed with required adhesive compounds include, but are not limited to, forms of carboxy carriers at Suitable ratios and compacted in desired shapes and lic acid esters, carbonic esters, phosphate esters, nitric acid sizes. Suitable carriers are magnesium carbonate, magnesium esters, Sulfuric acid esters, Sulfone esters, Sulfoxide esters, Stearate, talcum, Sugar, lactose, pectin, dextrin, starch, gela amides, carbamates, azo compounds, phosphorus amide, glu tin, carboxymethyl cellulose, sodium carboxymethyl cellu coside, ether, acetals, etc. lose, low melting wax, and cocoa butter, etc. Similarly, wafers 0056 Drug Screening Methods or lozenge, tablets, powders, capsules, and pills. Wafers and lozenges may be solid formulations suitable for oral admin 0057 The present inventors found a class of P2X receptor istration. antagonists can inhibit viral replication. Such an inhibitory 0066 Liquid preparations include solutions, Suspensions, effect is achieved possibly by targeting P2X receptors. and emulsions, for example, water or aqueous propylene gly 0058. After knowing that P2X receptor antagonists can col Solutions. For non-parenteral injection liquid preparations selectively bind to P2X receptors to induce virus inhibitory can be prepared in aqueous polyethylene glycol Solutions. effect, substances binding to P2X receptors can be screened Aqueous solutions suitable for oral administration can be based on these characteristics. After that, truly useful drugs prepared by dissolving active components in water and, as for inhibiting viruses can be found from the afore-mentioned required, adding Suitable colorants, flavoring agents, emulsi Substances. fiers, and thickeners. 0059. Accordingly, the present invention provides meth 0067. The compositions can be used for systemic admin ods of Screening potential drugs for the prevention and the istration, local administration, or parenteral administration. treatment of HFMD, the methods include: (1) providing a 0068 Aqueous suspensions suitable for oral administra system containing (e.g., expressing) P2X receptors; (2) pro tion can be prepared by dispersing micro-segmented active viding candidate Substances to the system of step (1), observ ingredients in aqueous viscous materials, such as natural or ing the binding status of candidate substances to P2X recep synthetic gums, resins, methylcellulose, sodium carboxym tors. If candidate substances can bind to P2X receptors, the ethylcellulose, and other well-known Suspensions. candidate Substances are potential drugs for preventing and 0069. In therapeutic use, daily initial dose of compounds treating HFMD. The system containing (e.g., expressing) used in the present invention is at 0.01-200 mg/kg body P2X receptors may be, for example, a cell system. The cells weight, more preferably 0.25-100 mg/kg body weight, more may be those expressing endogenous P2X receptors or those preferably 0.5-50 mg/kg body weight. However, these doses engineered to express P2X receptors. The systems containing may be changed based on patients’ need and severity of P2X receptors may also be subcellular systems, Solution sys diseases being treated and compounds being used. Generally tems, tissue systems, organ systems or animal systems (such speaking, treatments begin with Smaller doses than the opti as animal models, preferably non-human mammalian animal mum doses of the compounds, after which this dose is models, such as mice, rabbits, sheep, monkeys, etc.), etc. increased in small amount until reaches the best results. For Techniques for detecting whether or not a compound binds to the sake of convenience, if desired, total daily dose may be receptors or receptor subunits are known in the art. divided into several doses for administration in a day. 0060. In a preferred embodiment of the present invention, 0070 Pharmaceutical compositions of the present inven during screening, to more easily observe the differences of tion may also be simultaneously used in combination with P2X receptors binding to candidate Substances, control group other therapeutic agents or adjuvant. US 2015/0045318 A1 Feb. 12, 2015

(0071 Kits 3. Compounds 0072 The P2X receptor antagonists of the present inven tion or compositions containing P2X receptor antagonists 0078 E02 was purchased from Sigma-Aldrich, adminis may be placed in kits convenient for sale or for use. tered as Suramin Sodium. 0073. The P2X receptor antagonists or compositions con Suramin used in monkey experiments was provided by Bayer, taining P2X receptor antagonists may be prepared in the form administered as Suramin free acid. of unit doses to be placed in kits. “Unit dose form' refers to, for the convenience of administration, the dose form required iso-PPADS (0683-10 mg), NF 279 (1199-10 mg), and for single administration prepared by using P2X receptor PPNDS (1309) were purchased from Tocris. antagonists of the present invention or compositions contain Unless otherwise indicated, other compounds were pur ing P2X receptor antagonists, includes, but is not limited to, chased from Sigma-Aldrich and Tocis. various solid dose forms (e.g. tablets), liquids, capsules, and controlled release formulations. Once unit dose forms are prepared, 1-3 doses of the unit dose forms of compositions 4. Rt-PCR Primers and Probes (5' to 3'): may be administered daily. 0074 The kits also include: dosing instructions for the 0079 administration of P2X receptor antagonists to Subjects in need of viral inhibition (such as patients suffering from viral EV71 forward primer: diseases or places containing viruses) so that people would (SEQ ID NO: 1) know how to take medication correctly. CCCTGAATGCGGCTAATC; 0075. The present invention is further illustrated in com EV71 reverse primer: bination with the following specific embodiments. It should (SEQ ID NO: 2) be understood that these embodiments are merely used to ATTGTCACCATAAGCAGCCA; illustrate the present invention and are not intended to limit EV71 probe: the scope of the present invention. Specific conditions in (SEQ ID NO : 3) experimental methods not indicated in the following embodi FAM (6-carboxy fluorescein) - AACCGACTACTTTGGGTGTCC ments are usually those described according to conventional conditions, such as that described in Sambrook, J. et al., GTGTTTC-TAMRA (6-carboxy-tetramethyl-rhodamine); Molecular Cloning, A Laboratory Manual, Science Press, GAPDH forward primer: 2002, or according to the conditions recommended by manu (SEQ ID NO : 4) facturers. Unless otherwise indicated, percentages and parts GAAGGTGAAGGTCGGAGTC; are calculated based on Volume. GAPDH reverse primer: (SEO ID NO; 5) I. EXPERIMENTAL MATERIALS GAAGATGGTGATGGGATTTC;

P2X.1-164F: 1. Cell Lines (SEQ ID NO : 6) 0076 Rhabdomyosarcoma cells (RD cells) were pur CCTCTTCGAGTATGACACC, chased from ATCC, Cat No. VR-805. Cell culture medium P2X.1-164R: was DMEM containing 10% (v/v) FBS, and 1% (w/v) ampi (SEO ID NO: 7) cillin/streptomycin solution was added. CAGAGACACTGCTGATGAG; P2X2-2O2F: 2. Virus Strains (SEQ ID NO: 8) CTGGACATGCTGGGAAACG;

0.077 EV71 clinical isolates: EV71 FY 573, isolated from P2X2-2O2R: HFMD samples in Anhui Province, China, 2008; genotype (SEO ID NO: 9) EV71 C4; Genbank accession number HM 064456; provided TGCCCTTGGAGAAGTGGAAT; by Shanghai Institutes for Biological Sciences, Chinese P2X3 - 153F: Academy of Sciences. (SEQ ID NO: 10) EV71 clinical isolates SH-TS and SH-RS, provided by GGCTCGACAGCGTTTCT; Shanghai Institutes for Biological Sciences, Chinese Acad P2X3 - 153R: emy of Sciences, genotype C4. (SEQ ID NO: 11) EV71 clinical isolates SEP-4, provided by and isolated from TGCCAGCATTCCCGTAT, Cambodia clinical HFMD samples by Institut Pasteur of P2X4-201F: Cambodia, genotype C4. (SEQ ID NO: 12) EV71-FY23 strain: provided by Virology and Immunology TGGGATGTGGCGGATTAT, Unit, Institute of Medical Biology, Chinese Academy of P2X4-2O1R: Medical Sciences, batch number: 2012 1001, Genebank (SEQ ID NO: 13) accession number EU812515.1. TACGCACCTGCCTGTTGAGA; EV71 M.A.V.: EV71 mouse-adapted strain, obtained by P2X5-22 OF: repeated passage of EV71 FY 573 in newborn mice. (SEQ ID NO: 14) CVA16: Coxsackie A16 virus subtype, shzh05-1 (GenBank it TCTTTGCCTGGTGCCCGTTG.; EU262658). US 2015/0045318 A1 Feb. 12, 2015

- Continued Seaplaque Agarose: lonza/amaxa 450101; P2X5 - 22 OR: CellTiter Glo: Promega G7572: (SEQ ID NO: 15) ATCACGGAGCCCAGTCGGAAG; PENICILLIN STREPTOMYCIN: Invitrogen Cat it 1514O122. P2X6-2OSF: (SEQ ID NO: 16) 6. Abbreviations GGAGGACAAAGTATGAGGAGG; I0081 CPE: cytopathic effect, P2X6-2O5R: CT: cycle threshold, (SEO ID NO: 17) GAATGGGTTGGCAAGTGG; ECso: 50% effective concentration,

P2X7-175F: EV71: Enterovirus 71, (SEQ ID NO: 18) I0082 Evans Blue: 6,6-(3,3'-Dimethyl 1, 1'-biphenyl-4, CGTGGAGAAGTGAAGAAG; 4'-diyl)bis(azo)bis 4-amino-5-hydroxy-1,3-naphthalenedis ulphonic acid tetrasodium salt; (SEQ ID NO: 19) TCGGTCAGAGGAACAGAG.C. HFMD: Hand Foot and Mouth Disease, I0083) iso-PPADS: pyridoxal-phosphate-6-aZophenyl-2', 5'-disulphonic acid; 5. Reagents and Kits M.A.V.: Mouse Adapted Virus, 0080 DMEM: Invitrogen cathi 119651 18; I0084. MAPK: Mitogen-activated protein kinases, FBS: Invitrogen cath10099141: MOI: Multiplicity of infection, TRYPSIN 0.25% EDTA: Invitrogen cati525200072: NF 023: 8,8-carbonylbis(imino-3,1-phenylenecarbon Viral RNA extraction kit: QIAamp Viral RNA Mini Kit, ylimino)bis-1,3,5-naphthalene-trisulphonic acid, hexaso QIAGEN cati52906; dium salt; Cell total RNA extraction kit: RNeasy Mini Kit (250), NF 157: 8.8'-Carbonylbisimino-3,1-phenylenecarbon QIAGEN cathi 74106; ylimino(4-fluoro-3,1-phenylene) carbonylimino; Tissue preservation solution: RNAstore sample preservation NF 279: 8,8'-(carbonylbis(imino-4,1-phenylenecarbon solution, Tiangen Technology (Beijing) Co. DP408-02; ylimino-4,1-phenylenecarbonylimino))bis(1.3.5-naphthale netrisulfonic acid) Tissue RNA extraction kit: RNAprep pure animal tissue total PFU: plaque forming unit RNA extraction kit, Tiangen Technology (Beijing) Co., PKC: Protease kinase C, DP43; PPADS: pyridoxal-phosphate-6-aZophenyl-2', 4'-disul Taqman real time RT-PCR reagent: ABI taqMan(R) One-Step phonic acid; RT-PCR, ABI cat #43091.69; PPNDS: Pyridoxal-5'-phosphate-6-(2-naphthylazo-6'-nitro SYBR real time RT-PCR reagent: QIAGEN QuantiTect 4,8-disulfonate) tetrasodium salt, SYBR Green RT-PCR Kit (200), Cat #204243: RD cell: Rhabdomyosarcoma cell, One-step RT-PCR reagents: QIAGEN OneStep RT-PCR Kit TOA: Time of Addition assay, (100); Cat #201212: TCIDs: 50% Tissue Culture Infective dose, DNA electrophoresis agarose: Biowest Argarose, Cat if BW TNP-ATP:trinitrophenol-ATP, RO100: UTP: uridine triphosphate, DNA marker: DL2,000 DNA Marker, Cati D501; 7. Compound Structure and Cas Numbers Crystal violet: Santa Cruz cat it sc-207460; 0085

CAS Registration Number or Compound Structure Chemical Formula

EO2 O O CAS: 129-46-4 NH-C C-NH SO

H H SO OC CO O C 6Na"

N-N:O US 2015/0045318 A1 Feb. 12, 2015

-continued

CAS Registration Number or Compound Structure Chemical Formula iso-PPADS CHO chemical formula: CHONNaO2PS2 HO N o1 PONa) 2n 2N SONa Me N N21

NaOS

NFO23 O O CAS: 104869-31-0 H H O (hydrated) NaON / HN N N NH \, ONa o? so O O O NaO- i i - ONa O O i FO O FO O ONa exH2O ONa

NF279 SONa CAS: 2O2983-32-2 NaOS

SONa NaOS HN O NaOS () ( ) SONa NH

O

PPADS H O CAS: 192575-19-2 O (Tetrasodium salt hydrate)

HO O Hanl ON8. N ONa exH2O 2 N H3C N N2 O O NaOH i| i HONa O O US 2015/0045318 A1 Feb. 12, 2015

-continued

CAS Registration Number or Compound Structure Chemical Formula

TNP-ATP NH2 CAS: 61368-63-6 allN21 N N o--o--0--0 N O O O O

Li Na Na Na" ON O O NO exH2O

NO

PPNDS chemical formula: ONa C18H11NNaOPS2 O H o1 11V ONa HO N 's -ONa so 2 2N H3C N N21

NO O No.1Sis So

NF 157 O 104869-26-3 F HN ( ) SONa HN o nos-( ) SONa O={NH NH

SONa

HN o nos-( ) K) SONa US 2015/0045318 A1 Feb. 12, 2015 8

-continued CAS Registration Number or Compound Structure Chemical Formula Evans Blue NH2 OH OH NH2 314-13-6 NaO-S N N S-ONa OI CO SN ( ) ( ) N2 CO O H3C CH3 O= O OE =O ONa ONa

II. EMBODIMENTS TaqMan(R) One-Step RT-PCR, cat #4309169) of ABI 7900HT I0086 EV71 and CVA16 are major pathogens of HFMD. 384-well plates PCR system. Reaction systems and PCR In the following examples, the present inventors determined program are shown in Table 1 and Table 2. EV71 5'UTR the ability of E02 (Suramin Sodium) or the analogs thereof to quantitative RT-PCR thermal cycling program (Taqman); inhibit EV71 and CVA16 infection in vitro and in vivo. O097 (5) PCR CT values were converted to viral load using PCR standard curves (standard curves were obtained by Example 1 CT values determined by performing RT-PCR on RNA extracted from viruses serially diluted with defined titers at E02 Inhibits EV71 Clinical Isolate (EV71 FY 573) 10-fold). Infection of RD Cells (In Vitro Tests) I0087. 1. E02 can Inhibit EV71 Replication in RD Cells TABLE 1 0088 RD cells were infected with EV71 clinical isolate EV71 5' UTR real-time quantitative RT-PCR reaction system (Taqman) (EV71 FY 573) in different E02 concentrations, at the MOI Total reaction volume: 10 ul (multiplicity of infection) of 0.1. At 46h post infection, viral PCR reagent CathABI4309169 RNA in culture supernatant was extracted, and the relative TaqMan (R) One-Step RT-PCR EV71 viral load was determined by quantitative RT-PCR. 2x reaction buffer 5 ul Procedures are detailed as follows: 40 x RNase inhibitor 0.25 ul 0089 O Cell seeding: 24 h prior to infection, RD cells Forward primer 3 M 1 Jul were seeded in 96-well cell culture plates, 5x10" cells per Reverse primer 9 M 1 Jul well. Probe 1.5 M 1 Jul (0090) (2) Infection: Viral RNA sample 1.75 ul 0091 a. Virus pre-incubated with drug: virus stock solu tion was diluted to 5x10' TCIDs/ml with DMEM and dispensed to 96-well plates at 100 ul per well, and 11 ul of TABLE 2 E02 dissolved in DMEM at corresponding concentration EV71 5'UTR quantitative RT-PCR thermal cycling program (Taqman) or DMEM was added, and incubated at 37° C. for 1 h; PCR thermal cycling program 0092 b. Cells pre-incubated with drug: cell culture ABI 790OHT 384 medium was removed from 96-well plates, each well was 1. 48° C. 30 min added 100 ul of DMEM, then added 11 ul of E02 solution 2.95 C. 10 min at corresponding concentration or DMEM, and incubated 3.95 C. 15 sec 4. 60° C. 1 min at 37° C. for 1 h; In which, repeat perform steps 3-4 0093 c. After 1 h incubation, drug was discarded from cell for 40 cycles culture plates, 111 ul of virus pre-incubated with drug was transferred to cell culture plates, and incubated at 37°C. for 1 h; (0098. The results show E02 can inhibit EV71 replication 0094 d. After incubation, the supernatant was discarded, in RD cells. ECs (50% effective concentration) is 6.93 uM. cells were washed twice with 50 ul of DMEM, each well At 3.44 uM, EV71 replication can be reduced for 10-fold. At was added 180 ul of DMEM containing 2% FBS, 20 ul of 5.19 uM, EV71 replication was reduced for 100-fold; at 6.45 E02 solution at corresponding concentration or DMEM. uM, 1,000-fold reduction, and at 7.63 uM, 10,000-fold reduc Cell culture plates were placed in 37°C., 5% (v/v) carbon tion, see FIG. 1. dioxide incubator for incubation. 0095 (3) Harvesting virus and RNA extraction: after (0099 2. E02 Significantly Reduces EV71 TCIDs in RD infection, cells were cultured for 46 h, 140 ul of supernatant Cells was transferred to 96-deep well plates, viral RNA extraction 01.00 EV71 (clinical isolate EV71 FY 573) in 10-fold was performed using viral RNA extraction kit (QIAGEN serial dilutions was used to infect RD cells at different E02 QIAamp Viral RNA Mini Kit, cat #52906) according to stan concentrations. After 3-4 days of incubation, CPE (cytopathic dard operating procedures of the kit. effect) was observed under optical microscope and stained 0.096 (4) Viral load measurements: EV71 5'UTR gene with crystal violet to calculate 50% tissue culture infective was detected using ABI Taqman one-step RT-PCR kit (ABI dose. Procedures are detailed as follows: US 2015/0045318 A1 Feb. 12, 2015

0101 O Cell seeding: 24 h prior to infection, RD cells 1% low-melting seaplaque, 2% FBS. Cell culture plates were seeded in 96-well cell culture plates, 5x10" cells per were placed in 37°C., 5% (v/v) carbon dioxide incubator well. for incubation. 10102) (2) Infection: 0117 (3) After cultured for 5-7 days, gels were removed, 0103 a. Virus pre-incubated with drug: virus stock solu stained with crystal violet, washed once with PBS, plaque tion was in 10-fold serial dilution with DMEM and dis numbers recorded and plaque forming units calculated. pensed to 96-well plates at 100 ul per well, and 11 ul of E02 0118. The results show E02 can reduce the number of dissolved in DMEM at corresponding concentration was plaques formed by EV71 in RD cells. ECso of E02 to reduce added, and incubated at 37° C. for 1 h; EV71 PFU in RD cells is 2.6 uM, see FIG.3. Therefore, E02 can reduce EV71 plaque forming units in RD cells. 0104 b. Cells pre-incubated with drug: cell culture 0119. In summary, through three test methods: real-time medium was removed from 96-well plates, each well was quantitative RT-PCR, TCIDs and PFU, the results show E02 added 100 ul DMEM, then added 11 ul of E02 solution at can inhibit EV71 clinical isolate infection of RD cells: ECso corresponding concentration, and incubated at 37°C. for 1 for inhibiting EV71 replication in RD cells is 6.93 uM; ECso h; for reducing TCIDs in RD cells is 4.7 uM; ECs for reducing 0105 c. After 1 h incubation, drug was discarded from cell culture plates, 111 ul of virus pre-incubated with drug was PFU is 2.6 uM. transferred to cell culture plates, and incubated at 37°C. for Example 2 1 h; 0106 d. After incubation, virus and drug mixture was E02 inhibits EV71 mouse adapted strain infection in removed, cells were washed twice with 50 ul of DMEM, RD cells (in vitro tests) each well was added 180 ul of DMEM containing 2% FBS, I0120) 1. E02 Reduces EV71 M.a.V.TCIDs in RD Cells 20 ul of E02 Solution at corresponding concentration, cell 0121 EV71 M.A.V. in 10-fold serial dilutions was used to culture plates were placed in 37° C., 5% (v/v) carbon infect RD cells at different E02 concentrations. After cultured dioxide incubator for incubation. for 3-4 days, CPE was observed under optical microscope, 01.07 (3) After cultured for 3-4 days, CPE was observed and stained with crystal violet, to calculate 50% tissue culture under optical microscope, and stained with crystal violet, infective dose. Specific steps are similar to that for testing TCIDso was calculated using Reed-Muench method. corresponding TCIDso of Example 1. 0108. The results show E02 can inhibit CPE caused by O122. The results show the EC50 of E02 to reduce EV71 EV71 infection in RD cells. The ECs of E02 to reduce EV71 M.A.V.TCIDs in RD cells is 8.07 uM, see FIG. 4. Therefore, TCIDs in RD cells is 4.7 uM, see FIG. 2. Therefore, E02 E02 reduces EV71 M.A.V. TCIDs in RD cells. significantly reduces EV71 TCIDs in RD cells. (0123 2. E02 Reduces EV71 M.a.V. PFU in RD Cells 0109) 3. E02 Reduces EV71 Plaque Forming Units in RD 0.124 EV71 M.A.V. was used to infect RD cells cultured Cells in 12-well plates at different E02 concentrations. After cul 0110 EV71 (clinical isolate of EV71 FY 573) was used to tured for 5 to 7 days, stained and plaque-forming units were infect RD cells cultured in 12-well plates at different E02 calculated. Detailed procedures were the same as the corre concentrations. After cultured for 5 to 7 days, stained and sponding PFU testing method of Example 1. plaque forming units were calculated. Procedures are detailed (0.125. The ECofE02 to reduce EV71 M.A.V. PFU in RD as follows: cells is 2.0 uM, see FIG. 5. Therefore, E02 reduces EV71 0111 O Cell seeding: 24 h prior to infection, RD cells M.A.V. PFU in RD cells. were seeded in 12-well cell culture plates, 2x10 cells per I0126. In summary, TCIDs and PFU tests show E02 can well. inhibit the infection in RD cells caused by EV71 mouse 0112 (2) Infection of cells: adapted strain with ECs of 8.07 uMand 2.0 uM, respectively. 0113 a. Virus pre-incubated with drug: virus stock solu Example 3 tion was in 10-fold serially diluted with DMEM to 50,000 PFU/ml, 5,000 PFU/ml, and 500 PFU/ml; and dispensed to E02 Inhibit Coxsackie Virus A16 (CVA16) Infection 12-well plates at 500 ul per well, and 56 ul of E02 dissolved in RD Cells (In Vitro Tests) in DMEM at corresponding concentration was added, and 0127 Coxsackie virus A16 in 10-fold serial dilutions were incubated at 37° C. for 1 h; used to infect RD cells at different E02 concentrations. After 0114 b. Cells pre-incubated with drug: cell culture cultured for 2 days, CPE was observed under optical micro medium was removed from 12-well plates, each well was scope, and stained with crystal violet, to calculate 50% tissue added 500 ul DMEM, then added 56 ul of E02 solution at culture infective dose. Specific procedures were the same as corresponding concentration, and incubated at 37°C. for 1 the TCIDso testing method of Example 1. h; I0128. The results show 25uM of E02 caused CVA16 titer 0115 c. After 1 h incubation, drug was discarded from cell reduction in RD cells from 1x10' TCIDs/ml to 1x10' culture plates, 556 ul of virus pre-incubated with drug was TCIDs/ml, see FIG. 6. Therefore, E02 reduces CVA16 transferred to cell culture plates, and incubated at 37°C. for TCIDs in RD cells. 1 h; I0129 Test results of the above Examples 1-3 show E02 0116 d. After incubation, virus and drug mixture were can inhibit EV71 and CVA16 infection of RD cells in vitro. removed, cells were washed twice with 300 ul of DMEM, E02's ECso that inhibits EV71 clinical isolate is less than 6.93 each well was added 150 ul of DMEM containing corre uM. 10 uM of E02 can completely inhibit EV71 clinical sponding concentration of E02, and was added 1350 ul of isolate and mouse adapted strain infection of RD cells and pre-heat melted (cooled to 37-40°C.) DMEM containing cause CVA16 TCIDso reduction in RD cells. US 2015/0045318 A1 Feb. 12, 2015

Example 4 after infection, serum and tissues (brain, bone marrow, heart, intestine, kidney, liver, lung, muscle, spleen, and thymus) E02 Inhibits EV71 Infection in ICR Newborn Mice were collected. Viral RNA in serum was extracted (viral RNA extraction kit, QIAGEN QIAamp Viral RNA Mini Kit, cat 0130 EV71 clinical isolate (EV71 FY 573) was used to #52906). Tissue samples were placed in RNAstore preserva infect three-day-old newborn ICR mice to test E02's efficacy tion solution (Tiangen, DP408-02) and stored in -80° C. to inhibit EV71 in vivo. Test mice were divided into three refrigerator. Total tissue RNA was extracted using tissue groups: drug group, infection group, and placebo group. RNA extraction kit (RNAprep pure total animal tissue RNA When mice were two-day-old, drug group were intraperito extraction kit). Copies of CVA16 viral genome and GAPDH neally injected with 50 ul of E02 at a dose of 50 mg/kg. gene were detected using one-step real-time quantitative RT Infection group and placebo group were intraperitoneally PCR kit (QIAGEN QuantiTect SYBR Green RT-PCR Kit) in injected with 50 ul of DMEM. When three-day-old, drug ABI 7900HT 384-well plate PCR system. Primers are the group was intraperitoneally injected with a mixture (50 ul) of same as that of EV71 5'UTR primers. See Table 3 and Table E02 at a dose of 50 mg/kg and EV71 clinical isolate at a dose 4 for reaction system and PCR program. See FIG. 8 for of 5x107TCIDso. Infection group was injected with a mixture relative viral load in each tissue and serum. Clearly, CVA16 of 5x107 TCIDs, viruses (25ul) and 25ul of DMEM. Placebo virus was detected mainly in brain, spinal cord, muscle, and group was injected with 50 ul of DMEM. S. 0131 5 days after infection, blood was collected and 0.135 2. E02 Inhibits CVA16 Infection in ICR Newborn serum was separated. Viral RNA in serum was extracted (viral Mice RNA extraction kit, QIAGEN QIAamp Viral RNA Mini Kit, 0.136 Three-day-old ICR newborn mice were infected cat #52906). Copies of EV71 5'UTR gene and GAPDH gene with CVA16 to test E02’s efficacy to inhibit EV71 in vivo. were detected using one-step real-time quantitative RT-PCR Test mice were divided into three groups: drug group, infec kit (QIAGEN QuantiTect SYBR Green RT-PCR Kit) in ABI tion group, and placebo group. When mice were two-day-old, 7900HT 384-well plates PCR system. Reaction system and drug group were injected intraperitoneally with 50 ul of E02 PCR program are shown in Table 3 and Table 4. at dose of 50 mg/kg. Infection group and placebo group were TABLE 3 injected intraperitoneally with 50 ul of DMEM. When three EV71 5'UTR and GAPDH gene real-time day-old, drug group were injected intraperitoneally with E02 quantitative RT-PCR reaction system (SYBR) at a dose of 50 mg/kg and CVA16 at a dose of 1x10'TCIDso One-step RT-PCR kit (SYBR Green) (50 ul). Infection group was injected with a mixture of CVA16 QuantiTect SYBR Green RT-PCR Kit 204243 at a dose of 1x10' TCIDs (25 ul) and 25 ul of DMEM. Reaction system 15 ul Placebo group was injected intraperitoneally with 50 ul of 2x Reaction buffer 7.5 ul Enzyme solution 0.15 ul DMEM. 6 days after infection, tissues were obtained, blood Forward primer (5 M) 1.5 ul collected, and serum separated. RNA from tissues and serum Reverse primer (5 M) 1.5 ul were extracted and CVA16 viral RNA determined Treatment RNA sample 1.5 ul procedures were the same as previously described in “1.” RNase-free water 2.85 ul 0137) See FIG. 9 for the results. The results show 50 mg/kg of E02 significantly decreased CVA16 RNA in brain, TABLE 4 bone marrow, muscle, and serum of ICR newborn mice. EV71 5'UTR and GAPDH gene real-time quantitative 0.138. To summarize Example 4-5, tests in ICR newborn RT-PCR thermal cycling program (SYBR) mice show 50 mg/kg of E02 can inhibit EV71 and Coxsackie PCR program virus A16 in vivo. 1 50° C. 30 min 2 95° C. 15 min Example 6 3 949 C. 15 sec 4 55o C. 30 sec E02 Safety, Tolerability, and Toxicity Tests 5 72° C. 30 sec In which, repeat cycle steps 3-5 for I0139 1. E02 has No Cytotoxicity In Vitro 40 times 0140. Cytotoxicity to RD cells at different E02 concentra Melting curve tions was measured using Celtitr Glo reagents as follows: (1) Cells seeding: 24h prior to testing, RD cells were seeded (0132 RNA loading ratios between EV71 and GAPDH in 96-well cell culture plates at 5x10" per well; were calculated. Average value for the infection group is 15.0 (2) Cells incubated with E02: medium was removed from cell and average value for the drug group 1.8, see FIG. 7. The culture plates, 180 ul of DMEM containing 2% FBS was results show E02 reduces EV71 viral load in mouse serum. 50 added, and then added 20 ul of DMEM solution with corre mg/kg of E02 can reduce viral load in serum of ICR newborn sponding concentration of E02, placed in 37° C., 5% CO mice infected with EV71. incubator for incubation; (3) After cultured for 46 h, cellular ATP levels were measured Example 5 using the PROMEGA Celtitr Glo reagents according to reagent instructions. E02 Inhibits Coxsackie Virus A16 Infection in ICR Testing results show 1x10 to 1x10" uM of E02 had no Newborn Mice cytotoxicity to RD cells, see FIG. 10. 0.133 1. CVA16 Tissue Distribution in Mice 0141 2. E02 is Non-Toxic to ICR Newborn Mice 0134) 5x10'TCIDso CVA16 viruses (50 ul) were injected 0142. Three-day-old ICR mice were injected intraperito to infect two three-day-old ICR newborn mice. Five days neally and daily with 50 ul of E02 at a dose of 50 mg/kg, 20 US 2015/0045318 A1 Feb. 12, 2015 mg/kg, or 50 ul of DMEM for 4 consecutive days. No toxicity divided into two groups, namely: five in control group (aged was observed, as shown in FIG. 11. about 4 years old, weighing about 5.3 kg, injected with physi ological Saline), 5 in treatment group (aged about 4.6 years Example 7 old, weighs about 5.44 kg, injected with 50 mg/kg Suramin). Multiple intravenous injections of Suramin (50 mg/kg) were E02 inhibits EV71 clinical isolates SH-TS and used. One day after the initial injection of Suramin, infected SH-RS infection of RD cells with 4.5 lgCCIDEV71 FY-23 (EV71-FY23 strain (pro vided by Chinese Academy of Medical Sciences, Institute of 0143 1. E02 Inhibits the Replication of EV71 SH-TS and Medical Biology, Virus Immunolgy laboratory), batch num SH-RS in RD Cells ber: 2012 1001, content: 7.5 lgCCIDs/ml, storage condi 0144 RD cells were infected with EV71 SH-TS or SH-RS tions: -80° C.), viral load was determined daily in infected at different E02 concentrations, at the MOI of 0.1. After adult rhesus monkeys (>3 years old), clinical symptoms and cultured for 46 h, viral RNA in culture supernatant was body temperature were observed to analyze the effect of the extracted. Relative EV71 viral load was determined by quan drug on treating and preventing EV71 infection. Specific titative RT-PCR. See Example 1 for specific procedures of experimental procedure is as follows: quantitative RT-PCR. 0153. 1) One day prior to infection: background whole 0145 The results show E02 can inhibit the replication of blood and serum were collected, body temperature measured, EV71 clinical isolates SH-TSSH-RS in RD cells. For SH-TS, animals appearance, behavior, mental state, and local drug administration were observed for abnormality, etc. Then, 7.14 uM can reduce EV71 replication by 10-fold and 25.35 drug was administered intravenously at a dose (50 mg/kg uM can reduce EV71 replication by 100-fold. For SH-RS, Suramin or physiological saline). 4.41 uM can reduce EV71 replication by 10-fold and 16.29 0154 2) On the day of infection (Day 0): body tempera uM can reduce EV71 replication by 1000-fold, as shown in ture measured, animals appearance, behavior, mental state, FIG. 15. and local drug administration were observed for abnormality, Therefore, E02 inhibits the replication of EV71 SH-TS and etc. Intravenous viral challenge was performed with 4.5 lgC SH-RS in RD cells. CID, EV71 FY-23. 0146 2. E02 inhibits EV71 SH-TS and SH-RS infection of 0155 3) During infection period (1-14 days): body tem RD cells (plaque forming units, PFU) perature was measured daily, animals appearance, behavior, 0147 RD cells cultured in 12-well plates were infected mental state, and local drug administration were observed for with EV71 SH-TS or SH-RS at different EO2 concentrations. abnormality, etc., and viral load determined Intravenous After cultured for 5-7 days, cells were stained and plaque administration at a dose (50 mg/kg Suramin or physiological forming units were calculated. Same procedure is as detailed saline) on day 1, 3, 5 after infection. in “3. E02 reduces EV71 plaque forming units in RD cells” of 0156 4) Late stage of infection (21 and 28 days), body Example 1. temperature was measured, animals appearance, behavior, 0148. The results, ECs of E02 to reduce EV71 SH-TS mental state, and local drug administration were observed for PFU in RD cells is 2.24 uM, for SH-RS, 3.47 uM, as shown in abnormality, etc., and viral load determined. FIG. 16. (O157 Blood Viral Load Testing 0158 Whole blood RNA extraction: obtained 0.2 ml 0149 Viral replication and PFU tests show E02 can inhibit blood, added 0.8 ml TRNZol-A", after mixing, placed the well EV71 clinical isolates SH-TS and SH-RS infection of RD at room temperature for 10 min; added 0.2 ml chloroform, cells. tightened cover lid, vigorously shaking for 15 sec, placed at Example 8 room temperature for 5 min, centrifuged at 12500 rpm, 4°C., 20 min, 0.4 ml of aqueous phase was transferred to another E02 Inhibits Cambodia EV71 Isolate SEP-4 fresh tube, equal Volume of isopropanol was added, mixed, Infection of Vero Cells placed at room temperature for 30 min: centrifuged at 12500 rpm, 4°C., 20 min, supernatant was discarded, 1 ml of 75% 0150. Vero cells were infected with EV71 SEP-4 virus ethanol was added to wash precipitates, centrifuged at 12500 strain (provided by Institut Pasteur of Cambodia, Cambodia rpm, 4°C., 30 min. Supernatant discarded, placed at room strain) at different E02 concentrations, at the MOI of 0.1. temperature for 30 min, RNAdried, 20l RNase-freeddHO After cultured for 46 h, viral RNA in culture supernatant was added, and RNA fully dissolved. Viral load was determined extracted. Relative EV71 viral load was determined by quan by measurement method as follows: titative RT-PCR. For specific procedures, refer to Example 1. 0159. 1) Standard dilutions: obtaining standards (per 0151. The results show E02 can inhibit EV71 SEP-4 rep formed according to TakaRa MiniBEST Viral RNA/DNA lication in Vero cells. 5.89 uM of E02 can reduce EV71 extraction Kit Ver 3.0 instructions), 10 ul standards were replication by 10-fold and 15.49 uM reduced EV71 replica obtained, 10-fold serial dilutions 10, 10, 10, 10, 10, 10", tion by 100-fold, as shown in FIG. 17. 100. 0160 2) Primer sequences (Taqman probe method): Example 9 E02 Inhibits EV71 Replication in Rhesus Monkey Upstream primer (10 uM) : 5'-agcc.caaaagaact tcacta-3"; 0152 10 adult rhesus monkeys, which were detected negative for EV71 antibody (rhesus monkey (Macaca), Downstream primer (10 uM) : Source: Institute of Medical Biology, Chinese Academy of 5'-atccagt catggctgct ca-3"; Medical Sciences, Experimental animal use license number: Probe 5-FAM-agtgatat cotgcagacgggcaccatcc - TAMRA-3. SYXK (Yunnan) 2010-0009, Certification unit: Yunnan Pro Vincial Science and Technology Agency), were randomly US 2015/0045318 A1 Feb. 12, 2015

0161 3) Preparing RT-PCR reaction solution (reaction added 100 ul of DMEM, and then added 11 ul of 320 uME02 Solutions were prepared on ice): solution (cell group treated with drug) or 11 ul of DMEM (cell group without drug treatment), incubated at 37° C. for 1 h. 2x One Step RT-PCR Buffer III: 10 ul 0.174 (3) Virus pre-incubated with drug: virus stock solu tion was diluted to 5x10° TCIDs/ml with DMEM, dispensed TaKaRa Ex TaqtMHS (5 U/ul): 0.4 ul to 96-well plates at 100 ul per well, and 11 ul of 320 uM E02 solution (Band C groups) or 11 ul of DMEM (A and F groups) PrimescriptTM RT Enzyme Mix II: 0.4 ul were added, and incubated at 37° C. for 1 h. 0162 Upstream primer (10 uM): 0.4 ul 0.175 (4) Infection: After cells and virus were incubated Downstream primer (10 uM): 0.4 ul for one hour, drug was discarded from cell culture plates. 111 ul of pre-incubated virus with drug (B and C groups) or Probe: 0.8 ul DMEM (A and F groups) was transferred to cell culture plates. After 100 ul of virus solution was transferred to D and ROX Reference Dye II: 0.4 ul E groups, 11 ul of 320 uM E02 was added, and incubated at 37° C. for 1 h. Total RNA: 2 ul 0176 (5) One hour after viral infection of cells, virus and (0163 RNase Free dHO: 5.2 ul drug mixture was discarded from cell culture plates. Cells were washed twice with 50 ul of DMEM. 180 ul per well of Total: 20 ul DMEM containing 2% FBS, 20 ul of 320 uME02 solution (B, E. and F groups) or 20ll of DMEM (A, C, and D groups) were (0164. 4) Performing RealTime One Step RT-PCR. added. Cell culture plates were placed in 37°C., 5% carbon (0165 1. Viral Load Testing dioxide incubator for incubation. 0166 10 test animals were challenged with 4.5 lgCCIDso (0177 (6) Virus harvesting and RNA extraction: at 18 h ofEV71 FY23. Animals in control group exhibited a transient post infection, 140 ul of Supernatant was transferred to increase of viral load (reaching 1-1.5x10 copies/ml) in the 96-deep well plates, viral RNA extraction was performed 6" and 7" days after viral challenge and began to decline after using viral RNA extraction kit (QIAGENQIAamp Viral RNA the 8' day. In the 9 day after viral challenge, they exhibited Mini Kit, cat #52906) according to the kit standard operating a transient increase of viral load (reaching 5.25x10 copies/ procedures. ml) and began to decline after the 10" day. Animals in drug (0178 (7) Viral load determination: EV71 5'UTR gene was treatment group exhibited, respectively, slightly elevated detected using ABI Taqman one-step RT-PCR kit (ABI taq viral load (average 1.5x10" copies/ml) in the 4",7", and 13' Man R. One-Step RT-PCR, Cat #4309169) in ABI 7900HT days after viral challenge. Viral loads were significantly lower 384-well plates PCR system. See Table 1 and Table 2 for than that in control group, as shown in FIG. 18. reaction system and PCR program. 0167 2. Body Temperature Measurement (0179 (8) PCR standard curves were used to convert CT 0168 Animals in control group show certain rise in body values of PCR to viral load (standard curves were obtained by temperatures 1 day after infection and Subsequently (about 3 CT values determined by performing RT-PCR on RNA days after infection) reduced to within normal range. Animals extracted from viruses with defined titers at 10-fold serial in drug treatment group essentially maintained body tempera dilutions). tures within normal range, as shown in FIG. 19. 0180 Infecting cells with high MOI caused most cells to 0169 Conclusions: Under the present experimental con be infected synchronously. 18 hours of incubation ensured ditions, after intravenous infection of 4.5 lgCCID50 EV71, virus only amplified once. The infection conditions may adult rhesus monkeys of control group exhibited certain determine which stage of virus life cycle plays a role in increase in viral loads within specific time periods and also a drug-induced viral inhibition (Bonavia, Franti et al., 2011; slight rise in body temperatures. In contrast, adult rhesus Daelemans, Pauwels et al., 2011). As shown in FIG. 12, test monkeys of drug treatment group exhibited, within that spe results of time of E02 addition assay showed addition of E02 cific time period, slightly elevated viral load, which was sig prior to infection (B, C) and during infection (D, E) can nificantly lower than that of the control group, and body inhibit EV71 infection, whereas E02 added after infection temperature measurements did not show significant changes. (F), could not inhibit EV71 infection. If drug has been added during infection, whether or not drug added after infection (D Example 10 and E) had no significant effect on viral replication. The results show E02 inhibits EV71 infection by inhibiting EV71 Identification of E02 Targets entry into cells. (0170 1. E02 Inhibits EV71 Entry into Cells 0181 2. P2X Receptor Antagonists can Inhibit EV71 (0171 RD cells in 96-well plates were infected with MOI Infection 10 EV71 clinical isolate EV71 FY573. In three periods at 0182 E02 is antagonist to the sensing receptor P2X and prior to, during, and post infection, 32 uM of E02 (dissolved can inhibit P2X1, 2, 3, and 5 subtype receptors (Khakh, in DMEM) or DMEM were added, EV71 replication was Burnstock et al., 2001; Burnstock, 2004; Coddou, Yan et al., measured to determine the stage, in which E02 inhibits EV71 2011), i.e., an antagonist of P2X1, 2, 3, and 5 subtype recep infection. Steps are detailed as follows: tors. P2X is a member of ATP-gated ion channel family of 0172 (1) Cell seeding: 24 h prior to infection, RD cells proteins, expressed on cell membrane, usually homologous were seeded in 96-well cell culture plates, 5x10" cells per or heterologous trimer, formed by an extracellular domain, well; two transmembrane domains and two intracellular domains. 0173 (2) Cells pre-incubated with drug: cell culture P2X family includes seven subtypes. Triggered by extracel medium was removed from 96-well plates, each well was lular ATP, P2X ion channels open, causing calcium influx, US 2015/0045318 A1 Feb. 12, 2015

intracellular calcium accumulation. A series of downstream TABLE 5 signal transduction is activated through MAPK, PKC and calmodulin (Erb, Liao et al., 2006). P2X receptors are widely P2X mRNA RT-PCR reaction system distributed in higher animal tissues (Valera, Hussy et al., One-step RT-PCR kit 1994), expressed in various parts of CNS, and play a role in qiangen 201202 transduction of neuronal synapses triggered sensing signals Reaction system 25 ul 5x reaction buffer 5 ul (such as pain, taste, hearing, etc.), Smooth muscle contrac Enzyme solution 1 Ll tion, blood pressure control in cardiovascular system, and Forward primer (10M) 1.5 ul inflammatory response (Surprenant and North, 2009). Reverse primer (10M) 1.5 ul dNTP 1 Ll 0183 EV71 infection of central nervous system can cause RNA sample 2 Jul acute flaccid paralysis, acute spread myelitis, and acute trans RNase-free water 14 Il verse myelitis, and also can cause aseptic meningitis and encephalitis. Enterovirus infection may also cause potential behavior and memory impairment (Yang, Wang et al., 2009: Rhoades, Tabor-Godwin, et al. 2011). EV71 leads to mainly TABLE 6 neurological disorders through inducing CNS inflammation P2X mRNA RT-PCR thermal in patents with viral infection. EV71 infection can cause cycling program PCR program inflammation at all levels of cerebral cortex, brainstem, and 1 50° C. 30 min spinal cord. EV71-infected patients often die of pulmonary 2 95° C. 15 min edema or hemorrhage. Studies showed that EV71 pulmonary 3 949 C. 15 SeC edema is neurological (Solomon, Lewthwaite et al., 2010). 4 50° C. 60 SeC 5 720 C 60 SeC Among EV71-infected patients, who died of pulmonary syn Cycling steps 3-5 for 40 times drome, inflammation was detected only in spinal cord and 72°C. for 10 min brain, whereas viral particles and inflammation were unde tectable in lungs and heart. (Weng, Chen et al., 2010). Linking disease characteristics caused by EV71 infection with the (0193 Electrophoresis results show, except for P2X7, the distribution and physiological role of P2X, the present inven other six P2X subtype receptors are expressed in RD cells. tors believe that P2X plays an important role in EV71 pathol Results are shown in FIG. 14. Ogy. (0194 3. P2X Receptor Antagonists Inhibit EV71 Infec 0184. Accordingly, in this embodiment, the present inven tion of RD Cells tors used chemical probes (known P2X antagonists or ago 0.195. Inhibitory effect of each P2X receptor antagonists nists) to determine the role of P2X receptors in EV71 infec and agonists on EV71 replication was measured at 0.1. 1, 10. tion. and 100 uM. Specific procedures refer to “1” of Example 1. after infection, however, cells need to be incubated for 3~4 0185. 1. PPADS Inhibits EV71 Infection of RD Cells days, stained with crystal violet, and observed under optical 0186 PPADS is an E02 analog (Khakh, Burnstock et al., microscope to determine whether or not CPE (cytopathic 2001; Burnstock 2004; Coddou, Yan et al. 2011) and has a effect) was present. In addition, the effect of compounds at similar inhibitory effect on P2X subtypes to that of E02. RD each concentration on cytotoxicity to RD cells was deter cells were infected with EV71 clinical isolate FY 573 at mined. After culturing RD cells in various concentrations of different PPADS concentrations to determine the inhibitory compounds for 3~4 days, stained with crystal violet, and effect of PPADS on EV71 replication. Detailed procedure is observed under optical microscope to observe whether or not the same as that in “1” of Example 1. In addition, cytotoxicity cell layer was damaged. Compounds capable of protecting to RD cells at each concentration of PPADS was determined. cells from infection without damage of healthy cell layer can Detailed procedure is the same as that in “1” of Example 6. inhibit EV71 replication in RD cells. (0196. The results are shown in Table 7 and FIG. 20. Except 0187. The results are shown in FIG. 13, PPADS concen E02 and PPADS, P2X receptor antagonists iso-PPADS, trations lower than 64 uMare not cytotoxic to RD cells. ECso NF023, NF279, NF157, TNP-ATP, PPNDS, and Evans Blue for inhibiting EV71 replication is 18.9 uM. can also inhibit EV71 replication. 0188 2. P2X Receptor Expression in RD Cells (0189 Total RNA was extracted from RD cells. Each P2X TABLE 7 subtype mRNA was amplified by one-step RT-PCR. PCR product length was determined by gel electrophoresis. Spe P2X receptor antagonists inhibit EV71 replication in RD cells cific procedures are as follows: Inhibition of EV71 replication 0190. O Total cellular RNA extraction: 2x10 RD cells Compounds 100 M 10 M 1 M 0.1 M were obtained and total RNA extracted using QIAGEN RNe Antagonists EO2 asy kit. Experiments were performed according to kit instruc PPADS tions. Products were dissolved in 50 ul of nuclease-free water. iso-PPADS NFO23 (0191) (2) PCR: each P2X subtype and GAPDH mRNA NF279 was amplified by one-step RT-PCR. Reaction system and NF157 cycling program are as shown in Table 5 and Table 6. TNP-ATP PPNDS (0192 (3) Electrophoresis: PCR product size was detected Evans Blue by 2% gel electrophoresis. US 2015/0045318 A1 Feb. 12, 2015 14

TABLE 7-continued P2X receptor antagonists inhibit EV71 replication in RD cells Inhibition of EV71 replication Compounds 100 M 10 M 1 M 0.1 M Agonists Ivermectine bzATP UTP

(0197) Comparison between the inhibitory effect of these compounds on P2X and EV71 infection, as shown in Table 8. indicates P2X receptors play an important role in EV71 infec tion of RD cells. TABLE 8 P2X receptors and EV71 replication Inhibition of P2X receptors 1 2 3 4 5 6 7 2,3 replication

Agonists Bz-ATP (Burnstock 2004) ------UTP (Burnstock 2004) -- Ivermectin (Khakh, Proctor ---- et al. 1999) Antagonists PPADS (Burnstock 2004) ------Iso-PPADS (Burnstock ------: 2004) NFO23 (Burnstock 2004) ------NF279 (Burnstock 2004) ------TNP-ATP (Burnstock ------: : 2004) PPNDS (Burnstock 2004) ------E02 (Burnstock 2004) ------

Notes: Agonists: -: no activity, +: activating concentration >10 IM, ++: activating concentration 1-10M, +++: activating concentra tion <1 uM; Antagonists: -; no activity, +: inhibitory concentration >300 nM, ++: inhibitory concentration = 10-300 nM, +++: inhibitory concentration <10 nM.

0198 Effects of other antagonists and agonists on EV71 are shown in Table 9 and FIG. 21. TABLE 9 Effects of other antagonists and agonists on EV71 P2X receptors Heteromul Logio 1 2 3 4 5 6 7 P2Y timer reduction ICoo Antagonists

BBG M M My Y NO NO MRS 2159 My NO NO MRS 21.79 M M yy P2Y1 NO NO NF 110 My M My NO NO Rio O437626 M NO NO TNP-ATP My Y My Y My Y NO NO P2X23 A-317491 My My NO NO P2X23 AF353 My My NO NO P2X23 RO-3 My y P2X23 NO NO Spinorphin My Y NO NO S-BDBD M NO NO A438079 My NO NO A 74OOO3 My NO NO A 839977 My NO NO US 2015/0045318 A1 Feb. 12, 2015

TABLE 9-continued Effects of other antagonists and agonists on EV71 P2X receptors EV71 Heteromul Logo 1 2 3 4 5 6 7 P2Y timer reduction ICoo AZ 10606120 My Y NO NO AZ, 11645373 My NO NO KN-62 My NO NO OATP My NO NO 2',5'-ADP P2Y1 NO NO Agonists BZATP My Y YM M My Y YM My Y P2Y11 NO NO UTP M NO NO Modulator

vermectin My Y NO NO GW 791343 My NO Response Potentiator

MRS 2219 M NO NO in the Table, the “blank” indicates no data reported, “NO” indicates there is negative. For Antagonists: VVV activating concentration <10 nM, Wyactivating concentration 10 nM-300 nM, yactivating concentration >300 nM, —no activity, For Agonists: VV V activating concentration <1 uM, V V activating concentration 1-10 uM, w activating concentration >10 uM.

(0199 Therefore, P2X1-6 subtype mRNAs are expressed tory syncytial virus (RSV). Proceedings of the National in RD cells. In addition, a group of P2X receptor antagonists Academy of Sciences 108(17): 6739-6744. can inhibit EV71 replication in the infected RD cells. Com 0203 Burnstock, G. (2004). “Introduction: P2 Recep bined with the association between P2X signal transduction tors. Current Topics in Medicinal Chemistry 4(8): 793 and P2Xabnormalities with diseases, its suggested that P2X 8O3. plays an important role in EV71 infection. There is a close 0204 Chong, J.-H. G.-G. Zheng, et al. (2010). Abnormal relationship between the role of P2X and EV71 and the expression of P2X family receptors in Chinese pediatric pathology of HFMD caused by EV71 infection; 0200. In summary of the above examples, the following acute leukemias.” Biochemical and Biophysical Research conclusions can be drawn: Communications 391 (1): 498-504. (1) P2X receptor antagonist compound E02 can inhibit EV71 (0205 Coddou, C., Z. Yan, et al. (2011). “Activation and infection of RD cells; Regulation of Purinergic P2X Receptor Channels.” Phar (2) Compound E02 can reduce the ability of Coxsackie virus macological Reviews 63(3): 641-683. A16 to infect in RD cells; 0206 Daelemans, D., R. Pauwels, et al. (2011). A time (3) Compound E02 can reduce EV71 viral load in serum of of-drug addition approach to target identification of anti ICR newborn mice; viral compounds.” Nat. Protocols 6(6): 925-933. (4) Compound E02 can reduce CVA16 viral load in brain, 0207 Erb, L., Z. Liao, et al. (2006). “P2 receptors: intra bone marrow, muscle, and serum of ICR newborn mice; cellular signaling. Pfligers Archiv European Journal of (5) E02 inhibits EV71 replication in rhesus monkeys in vivo Physiology 452(5): 552-562. and inhibits body temperature rise caused by EV71 in rhesus (0208 Geyer, J. R. R. Soto, et al. (2010). “AF-353, a novel, monkeys; potent and orally bioavailable P2X3/P2X2/3 receptor (6) P2X1-6 receptor subtype mRNAs can be detected in RD antagonist.” British Journal of Pharmacology 160(6): cells; (7) Many P2X receptor antagonists can inhibit EV71 infec 1387-1398. tion of RD cells. 0209 Han, J.X.-J. Ma, et al. (2010). “Long persistence of 0201 All documents mentioned in the present invention EV71 specific nucleotides in respiratory and feces samples are incorporated by reference in the present application, as if of the patients with Hand-Foot-Mouth Disease after recov each reference was individually incorporated by reference. It ery.” BMC Infectious Diseases 10(1): 178. should also be understood that, after reading the foregoing 0210 Huang, C.-C., C.-C. Liu, et al. (1999). “Neurologic teachings of the present invention, those skilled in the art may Complications in Children with Enterovirus 71 Infection.” make various modifications or changes to the present inven New England Journal of Medicine 341 (13): 936-942. tion. These equivalents would similarly fall within the scope 0211 Khakh, B. S., G. Burnstock, et al. (2001). “Interna of the appended claims in the present application. tional Union of Pharmacology. XXIV. Current Status of the Nomenclature and Properties of P2X Receptors and Their REFERENCES Subunits.” Pharmacological Reviews 53(1): 107-118. 0202 Bonavia, A., M. Franti, et al. (2011). “Identification 0212 Khakh, B.S., W. R. Proctor, et al. (1999). “Allosteric of broad-spectrum antiviral compounds and assessment of Control of Gating and Kinetics at P2X4 Receptor Chan the druggability of their target for efficacy against respira nels.” The Journal of Neuroscience 19(17): 7289-7299. US 2015/0045318 A1 Feb. 12, 2015 16

0213 Piqueur, M., W. Verstrepen, et al. (2009). “Improve ative agent and a high incidence of mixed infections with ment of a real-time RT-PCR assay for the detection of coxsackievirus A16. 'Scandinavian Journal of Infectious enterovirus RNA. Virology Journal 6(1): 95. Diseases 0(0): 1-9. 0220 Yang, F. L. Ren, et al. (2009). “Enterovirus 71 Out 0214 Rhoades, R. E. J. M. Tabor-Godwin, et al. (2011). break in the People's Republic of China in 2008.' Journal “Enterovirus infections of the central nervous system.” of Clinical Microbiology 47(7): 2351-2352. Virology 411(2): 288-305. 0221) Yang, Y., H. Wang, et al. (2009). “Neuropathology 0215 Solomon, T., P. Lewthwaite, et al. (2010). “Virol in 2 cases of fatal enterovirus type 71 infection from a ogy, epidemiology, pathogenesis, and control of enterovi recent epidemic in the People's Republic of China: a his rus 71.' The Lancet Infectious Diseases 10(11): 778-790. topathologic, immunohistochemical, and reverse tran Scription polymerase chain reaction study. Human Pathol 0216) Surprenant, A. and R.A.North (2009). "Signaling at ogy 40(9): 1288-1295. Purinergic P2X Receptors.” Annual Review of Physiology 0222 Zhang, Y., D. Wang, et al. (2010). “Molecular Evi 71(1): 333-359. dence of Persistent Epidemic and Evolution of Subgeno 0217 Valera, S., N. Hussy, et al. (1994). “A new class of type B1 Coxsackievirus A16-Associated Hand, Foot, and ligand-gated ion channel defined by P2X receptor for Mouth Disease in China.” Journal of Clinical Microbiol extracellular ATP Nature 371 (6497): 516-519. ogy 48(2): 619-622. 0223 Zhu, Z., S. Zhu, et al. (2010). “Retrospective 0218. Weng, K.-F., L.-L. Chen, et al. (2010). “Neural seroepidemiology indicated that human enterovirus 71 and pathogenesis of enterovirus 71 infection.” Microbes and coxsackievirus A16 circulated wildly in central and south Infection 12(7): 505-510. ern China before large-scale outbreaks from 2008.' Virol 0219 Yan, X.-F. S. Gao, et al. “Epidemic characteristics ogy Journal 7(1): 300. of hand, foot, and mouth disease in Shanghai from 2009 to Chinese Ministry of Health (2010) Hand foot and mouth 2010: Enterovirus 71 subgenotype C4 as the primary caus disease treatment guidelines (2010 edition.)

SEQUENCE LISTING

<16 Os NUMBER OF SEO ID NOS : 19

<210 SEQ ID NO 1 <211 LENGTH: 18 <212> TYPE: DNA <213> ORGANISM: Artificial Sequence <22 Os FEATURE; OTHER INFORMATION: Synthetic

<4 OOs SEQUENCE: 1

ccctgaatgc ggctaatc 18

SEO ID NO 2 LENGTH: 2O TYPE: DNA ORGANISM: Artificial Sequence FEATURE; OTHER INFORMATION: Synthetic

<4 OOs SEQUENCE: 2 attgtcacca taagcagc.ca

SEO ID NO 3 LENGTH: 28 TYPE: DNA ORGANISM: Artificial Sequence FEATURE; OTHER INFORMATION: Synthetic

<4 OOs SEQUENCE: 3

aac cqactac tittgggtgtc. cqtgttt c 28

SEO ID NO 4 LENGTH 19 TYPE: DNA ORGANISM: Artificial Sequence FEATURE; OTHER INFORMATION: Synthetic US 2015/0045318 A1 Feb. 12, 2015 17

- Continued

<4 OOs, SEQUENCE: 4 galaggtgaag gttcggagtic 19

<210s, SEQ ID NO 5 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic

<4 OOs, SEQUENCE: 5 gaagatggtg atgggatttic

<210s, SEQ ID NO 6 &211s LENGTH: 19 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic

<4 OOs, SEQUENCE: 6 cct citt coag tatgacacc 19

<210s, SEQ ID NO 7 &211s LENGTH: 19 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence & 22 O FEATURE; <223> OTHER INFORMATION: Synthetic

<4 OO > SEQUENCE: 7 cagaga cact gctgatgag 19

<210s, SEQ ID NO 8 &211s LENGTH: 19 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic

<4 OOs, SEQUENCE: 8

Ctggacatgc tigggaaacg 19

<210s, SEQ ID NO 9 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic <4 OOs, SEQUENCE: 9 tgcc Cttgga gaagtggaat

<210s, SEQ ID NO 10 &211s LENGTH: 17 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic

<4 OOs, SEQUENCE: 10 ggct cacag cqtttct 17 US 2015/0045318 A1 Feb. 12, 2015 18

- Continued

<210s, SEQ ID NO 11 &211s LENGTH: 17 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic

<4 OOs, SEQUENCE: 11 tgc.ca.gcatt cocqtat 17

<210s, SEQ ID NO 12 &211s LENGTH: 18 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic

<4 OOs, SEQUENCE: 12 tgggatgtgg C9gatt at 18

<210s, SEQ ID NO 13 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic

<4 OOs, SEQUENCE: 13 tacgcacctg. cctgttgaga

<210s, SEQ ID NO 14 &211s LENGTH: 2O &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic

<4 OOs, SEQUENCE: 14 t ctittgcctg gtgc.ccgttg

<210s, SEQ ID NO 15 &211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic <4 OOs, SEQUENCE: 15 atcacggagc C cagtcggaa g 21

<210s, SEQ ID NO 16 &211s LENGTH: 21 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic

<4 OOs, SEQUENCE: 16 ggagga caaa gtatgaggag g 21

<210s, SEQ ID NO 17 &211s LENGTH: 18 &212s. TYPE: DNA US 2015/0045318 A1 Feb. 12, 2015 19

- Continued <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Synthetic

<4 OOs, SEQUENCE: 17 gaatgggttg gCaagttgg 18

SEQ ID NO 18 LENGTH: 18 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Synthetic

< 4 OOs SEQUENCE: 18 cgtggagalag talagaag 18

SEQ ID NO 19 LENGTH 19 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Synthetic

<4 OOs, SEQUENCE: 19 tcggtcagag galacagagc 19

1. (canceled) NF157, Evans Blue, an analog thereof, a derivative thereof, 2. A method for preventing, alleviating, or treating hand and a pharmaceutically acceptable salt thereof. foot and mouth disease comprises administering to a subject 7. The method of claim 4, wherein the virus is an enterovi in need thereof a composition comprising a P2X receptor rus or a Coxsackie virus. antagonist. 8. The method of claim 4, wherein the virus is an enterovi 3. The method of claim 2, wherein the administering is by rus A. oral administration, intravenous injection, intramuscular 9. The method of claim 4, wherein the virus is a human injection, or inhalation. enterovirus 71. 4. A method for inhibiting infection by a positive-sense single-stranded RNA picornavirus, comprising: administer 10. The method of claim 4, wherein the virus is a Coxsackie ing to a subject in need thereof an effective amount of a P2X virus. receptor antagonist. 11. The method of claim 2, wherein the P2X receptor 5. The method of claim 4, wherein the subject is a human, antagonist is selected from the group consisting of PPADS. a monkey, or a mouse. iso-PPADS, PPNDS, Suramin, NF023, TNP-ATP, NF279, 6. The method of claim 4, wherein the P2X receptor NF157, Evans Blue, an analog thereof, a derivative thereof, antagonist is selected from the group consisting of PPADS. and a pharmaceutically acceptable salt thereof. iso-PPADS, PPNDS, Suramin, NF023, TNP-ATP, NF279, k k k k k