T-Cell Activation Signals (Acquired Inmunodeficiency Syndrome/Trans-Activator) SANDRA E

Proc. Natl. Acad. Sci. USA Vol. 84, pp. 6845-6849, October 1987 Immunology

Human immunodeficiency virus long terminal repeat responds to T-cell activation signals (acquired inmunodeficiency syndrome/trans-activator) SANDRA E. TONG-STARKSEN*, PAUL A. Luciwt, AND B. MATIJA PETERLIN* *Howard Hughes Medical Institute, Departments of Medicine and of Microbiology and Immunology, University of California, San Francisco, CA 94143; and tDepartment of Medical Pathology, University of California, Davis, CA 95616 Communicated by Frank Lilly, June 1, 1987 (received for review April 17, 1987)

ABSTRACT Human immunodeficiency virus (HIV), the (IFN-y) (20). Finally, they can be efficiently transfected with causative agent of AIDS, infects and kills lymphoid cells plasmid DNA. Recently, Jurkat cells have been used to bearing the CD4 antigen. In an infected cell, a number of analyze sequences in the IL-2 promoter that respond to T-cell cellular as well as HIV-encoded gene products determine the activation signals (21, 22). In our study, Jurkat cells were levels of viral gene expression and HIV replication. Efficient used to analyze the effects ofT-cell activation signals on gene HIV-replication occurs in activated T cells. Utilizing transient expression directed by the HIV long terminal repeat (LTR). expression assays, we show that gene expression directed by the HIV long terminal repeat (LTR) increases in response to T-cell MATERIALS AND METHODS activation signals. The effects of T-cell activation and of the Plasmid Constructions. Plasmid constructions containing HIV-encoded trans-activator (TAT) are multiplicative. Anal- the HIV LTR positioned upstream from the bacterial chlor- ysis of mutations and deletions in the HIV LTR reveals that the amphenicol acetyltransferase (CAT) reporter gene, designat- region responding to T-cell activation signals is located at ed TAR-1, and those containing the HIV TAT, designated positions -105 to -80. These sequences are composed of two TAT-1, have been described (23). To determine the speci- direct repeats, which are homologous to the core transcrip- ficity of T-cell activation, the following promoters and tional enhancer elements in the simian virus 40 genome. Our enhancers positioned upstream from the CAT gene were studies reveal that these elements function as the HIV enhanc- tested: Rous sarcoma virus LTR (pRSVCAT) (24), herpes er. By acting directly on the HIV LTR, T-cell activation may simplex virus (HSV) thymidine kinase (TK) promoter play an important role in HIV gene expression and in the (ptkCAT) (25), and human T-lymphotropic virus I LTR- activation of latent HIV. (pHTLV-I-LTR-CAT) (26-28). p(-156/+185)CAT is a plasmid derived from TAR-1 and A lymphocytopathic retrovirus, designated human immunode- contains only the sequences between positions -156 and ficiency virus (HIV), has been shown to be the cause of +185 ofthe HIV LTR upstream from the CAT gene. Plasmids acquired immunodeficiency syndrome (AIDS) in humans (1-4). of the p(M) series are derived from TAR-1. Double-stranded The CD4 antigen found on the surface of T-helper/inducer oligonucleotides with altered sequences as shown in Fig. 1C lymphoid and monocyte/macrophage cells is, at least in part, were synthesized on a Pharmacia gene assembler. Construc- the receptor for HIV (5-8). In human T cells derived from tion of p(M+4/+9)CAT and p(M+14/+18)CAT involved peripheral blood lymphocytes, efficient binding ofHIV and the digestion of TAR-1 with Pvu II (which cleaves at position early phase ofviral infection do not require activation ofT cells -17) and Bgl II (position +19) and replacement of the (9, 10). However, the extent of viral replication is directly wild-type sequence with the appropriate synthetic oligonu- related to the state of T-cell activation (9, 10). Stimulation of cleotides. To produce p(M+39/+43)CAT and p(M+45/+49)- infected Jurkat cells, a human T-cell line, with phytohemag- CAT, the region between the Sac I site (+38) and the HindIII glutinin (PHA) increases HIV production (11). Similarly, HIV site (+80) was replaced with the appropriate synthetic oli- replication increases 4-fold in a chronically infected human gonucleotides. p(-451/-156)tkCAT is a plasmid containing T-cell line (Molt4) after stimulation with phorbol ester (12). the portion of the HIV LTR between positions -454 and Thus, intracellular events in activated T cells regulate the -156 inserted upstream from the HSV TK promoter and the production ofHIV. In addition to cellularfactors, HIV-encoded CAT gene. pABtkCAT consists of a double-stranded oligo- factors such as the trans-activator (TAT) and anti-repression nucleotide covering the region of the HIV LTR between trans-activator or trans-acting regulator of splicing (ART/TRS) positions -105 and -80 (Fig. 1C, shown as regions A and B) also affect viral gene expression (13-17). An understanding of inserted in the same transcriptional orientation relative to the the molecular mechanisms relating T-cell activation to viral HSV TK promoter; in pBAtkCAT, the oligonucleotide is in gene expression may provide insight into the elements that the opposite orientation. convert a latent HIV infection into active viral replication, Transient Transfection Assays. For assays, 1.5 x 107 Jurkat which results in the loss of T-helper/inducer cells and in the cells were transfected in a total volume of 2 ml by a appearance of clinical AIDS. DEAE-dextran method (23, 29). In single transfections, 5 ,ug To analyze the effects of T-cell activation on specific of the indicated plasmid and S ,ug of pUC18 were used. In events in HIV gene expression, we chose the Jurkat cell line (18). These human T cells are permissive for HIV infection Abbreviations: HIV, human immunodeficiency virus; LTR, long (11, 19). They can be activated by a variety of signals to terminal repeat; AIDS, acquired immunodeficiency syndrome; TAT, produce interleukin-2 (IL-2), IL-2 receptor, and interferon y trans-activator; PHA, phytohemagglutinin; IL-2, interleukin-2; IFN- y, interferon-y; TAR, trans-acting responsive element; CAT, chloramphenicol acetyltransferase; TK, thymidine kinase; HSV, herpes The publication costs of this article were defrayed in part by page charge simplex virus; PMA, phorbol 12-myristate 13-acetate; NRE, nega- payment. This article must therefore be hereby marked "advertisement" tive regulatory element; SV40, simian virus 40; Cm, chloramphen- in accordance with 18 U.S.C. §1734 solely to indicate this fact. icol; AcCm, monoacetylated chloramphenicol.

6845 Downloaded by guest on September 27, 2021 6846 Immunology: Tong-Starksen et al. Proc. Natl. Acad Sci. USA 84 (1987) cotransfections, 5 ug of each test plasmid was used. Trans- appropriate amount of cell lysate (24). Reaction mixtures fected cells were incubated for 48 hr at 370C and then divided were incubated at 370C for 16 hr or for the times indicated. into two equal portions. One portion served as resting Jurkat Results are given in percent conversion of chloramphenicol cells. The other portion was treated with PHA (final concen- (Cm) to its monoacetylated forms (AcCm). CAT enzymatic tration, 1 ,ug/ml) and phorbol 12-myristate 13-acetate (PMA; activity was linear within each assay. Values were normal. final concentration, 50 ng/ml) (20). Eight hours after addition ized to 10 ,ug of protein in cell lysates and were the mean of of PHA and PMA, cells were harvested and lysed. three independent transfections. To determine the time course of viral gene induction, an Determination of Jurkat (T-Ceil) Activation. Culture super- aliquot ofcells was removed from both the resting and activated natants from the cells used for determining the time course of Jurkat cell cultures at 1, 2, 3, 4, 8, 12, and 16 hr after addition viral gene induction were used for IL-2 assays. IL-2 activity of PHA and PMA. Cells were harvested for CAT assays. was detected by using triplicate cultures of CTLL cells (30). CAT assays were performed in a final volume of 200 tl Eight hours after addition of PHA and PMA, Jurkat cells containing 0.1 ILCi (3.7 kBq) of [14C]chloramphenicol, 4 mM were stained with anti-Tac monoclonal antibodies followed acetyl-coenzyme A, and 0.25 M Tris HCl (pH 7.4), with the by fluorescein isothiocyanate (FITC)-conjugated goat anti- A B 1 2 3 4 5 6

- + + + 1 2 3 4 5 6

+ + +

q~. AcCm

" Is.I! 10 ,ft tt Cm

16 16 16 16 1 1 16 16 16 16 16 16 Time (hr) TAR-1 TAR-1 TAR-1 pRSVCAT ptkCAT pHTLV-l TAT-1 TAT-1 LTR-CAT C CTGG -451 -450 AAGGGCTAATTTGGTCCCAAAGAAGACAAGAGATCCTTGATCTGTGGATCTACCACACAC -391 -390 AAGGCTACTTCCCTGATTGGCAGAATTACACACCAGGGCCAGGGATCAGATATCCACTGA -331 x -330 CCTTTGGATGGTGCTTCAAGCTAGTACCAGTTGAGCCAGAGAAGGTAGAAGAGGCCAATG -271

-270 AAGGAGAGAACAACAGCTTGTTACACCCTATGAGCCTGCATGGGATGGAGGACGCGGAGA -211 Ava I (-156) -210 AAGAAGTGTTAGTGTGGAGGTTTGACAGCAAACTAGCATTTCATCACATGGCCCGAGAGC -151 Y A -150 TGCATCCGGAGTACTACAAAGACTGCTGACATCGAGCTTTCTACAAGGGACTTTCCGCTG -91 B III II I -90 GGGACTTTCCAGGGAGGCGTGGCCTGGGCGGGACTGGGGAGTGGCGTCCCTCAGATGCTG -31 -1 +1 M+4/+9 M+14/+18 -30 CATATAAGCAGCTGCTTTTTGCCTGTACTG GGTWCTCTCT GTT[GACCAGATCTGAGCCT +30 M+39/+43 M+45/49 TCGCG +31 GGGAGCTCTCTGGCITAACTIAGGGAACCCACTGCTTAAGCCTCAATAAAGCTTGCCTTGAG +90 - I~~GAGTTI IGCTGI +91 TGCTTCAAGTAG,TGTGTGCCCGTCTGTTGTGTGACTCTGGTAACTAGAGATCCCTCAGAC +150 +151 CCTTTTAGTCAGTGTGGAAAAATCTCTAGCAG +182 FIG. 1. (A and B) CAT gene expression in resting and activated Jurkat cells. Nonacetylated [14C]chloramphenicol (Cm) and monoacetylated forms (AcCm) are shown after TLC. The - and + signs over the autoradiographs denote transfections into resting and activated Jurkat cells, respectively. (A) Effects of TAT on CAT gene expression directed by the HIV LTR in resting and activated Jurkat cells. TAR-1 consists of the HIV LTR (-454 to +185) upstream from the CAT gene (lanes 1 through 6) (32). TAT-1 is a plasmid containing the synthetic HIV-SF2 TAT gene (300 base pairs) positioned between the simian virus 40 (SV40) early promoter and polyadenylylation sites (lanes 3-6) (23). (B) CAT gene expression directed by various promoters in resting and activated Jurkat cells. Rous sarcoma virus LTR (pRSVCAT) is shown in lanes 1 and 2 (24). HSV TK promoter (ptkCAT) is shown in lanes 2 and 3 (25). Human T-lymphotropic virus I LTR (pHTLV-I-LTR-CAT) is shown in lanes 5 and 6 (26-28). (C) HIV LTR sequence, showing regulatory regions and mutations (32). p(M+4/+9)CAT, p(M+14/+18)CAT, p(M+39/+43)CAT, and p(M+45/+49)CAT denote sites of base substitution mutations in TAR-1; the mutant sequences are shown below the wild-type sequences in each box. Regulatory regions and regions ofhomology are shown as follows: I-III, three binding sites for the transcription factor Spl (33); A and B, core transcriptional enhancer elements (34); X, region homologous to IL-2 distal and proximal control elements (21); Y, region homologous to 5' flanking sequences of IFN--y (21). Downloaded by guest on September 27, 2021 Immunology: Tong-Starksen et al. Proc. Natl. Acad. Sci. USA 84 (1987) 6847

Table 1. Effects of T-cell activation on HIV LTR-directed Table 3. Time course of induction of HIV LTR-directed gene gene expression expression after T-cell activation

CAT Cm conversion, % Cm conversion,* % Time, Fold reaction Fold hr Control PHA/PMA activation Plasmid Control PHA/PMA time, hr activation 1 0.17 0.20 1.2 ptkCAT 0.11 0.13 16 1.2 2 0.20 0.37 1.8 pRSVCAT 5.7 4.3 16 0.75 3 0.14 0.45 3.2 pHTLV-I-LTR-CAT 0.19 0.27 16 1.4 4 0.32 1.31 4.1 TAR-1 0.79 3.9 16 4.9 8 0.30 2.1 7.0 TAR-1 + TAT-1 14.0 79 1 5.6 12 0.31 1.76 5.7 CAT enzymatic activities were measured in resting and PHA/ 16 0.21 1.00 4.8 PMA-activated Jurkat cells. Results of transfections with various promoters directing CAT gene expression are shown. CAT reaction CAT reaction mixtures were incubated for 16 hr. mixtures were incubated for the time indicated for each plasmid construction. that CAT activity directed by the IL-2 promoter also peaks *Standard errors in this and all subsequent tables are less than 35% of the mean with the exception of values less than 1% Cm with similar kinetics (21, 22). conversion. The latter probably overestimate the actual CAT Core Transcriptional Enhancer Elements in the HIV LTR activity because they are near the background counts of the silica Are Sufficient for Response to T-Cell Activation Signals. To plates. localize the HIV LTR sequences that respond to T-cell activation signals, several additional plasmids containing portions ofthe HIV LTR were constructed. A DNA fragment serum to mouse IgG (31). The indirect immunofluorescent encompassing positions -454 to -156 in the HIV LTR was staining of the IL-2 receptor was measured by fluorescence- positioned immediately upstream of the HSV TK promoter activated cell sorter analysis. and the CAT gene to produce p(-454/-156)tkCAT. The sequences from -340 to -185 have been described as a RESULTS negative regulatory element (NRE) (35) in the basal expres- T-Cell Activation Increases HIV LTR-Directed Gene sion ofTAR-1; a short stretch within the U3 region ofthe HIV Expression and Is Multiplicative with the Effect of TAT. LTR also has homology to the upstream promoter elements Transfections with TAR-1 result in low but detectable CAT of the IL-2 gene (Fig. 1C) (34). The results in Table 5 show activities (Fig. 1A, Table 1). Transfecting TAR-i into Jurkat that T-cell activation signals do not involve sequences be- cells that were subsequently activated with PHA and PMA tween -454 and -156. These results suggest that the se- results in CAT activities increased 5-fold above those seen in quences responding to T-cell activation signals lie down- unactivated Jurkat cells transfected in parallel (Fig. iA, Table stream from position -156. 1). Similar increases in CAT activity in comparisons between In p(-156/+185)CAT, the portion of the HIV LTR from activated and resting cells are not seen with ptkCAT, -156 to + 185 is located immediately upstream from the CAT pRSVCAT, or pHTLV-I-LTR-CAT (Fig. 1B, Table 1). The gene. Expression of CAT is stimulated in activated T cells CAT activity is increased 155-fold in experiments in which transfected with p(-156/+185)CAT (Table 5). Several cis- TAR-1 and TAT-1 were cotransfected into unstimulated acting regulatory elements involved in HIV gene expression Jurkat cells (Fig. iA, Table 2). TAR-1 and TAT-1 cotrans- are present in the region of the HIV LTR downstream from fections into activated as with positions -156. The enhancer for HIV has been reported to compared resting Jurkat cells reside between positions -135 to -17 (35). There are two result in 5-fold increased CAT activities (Fig. 1, Table 1). direct repeats 10 base pairs in length at positions -105 to -80 When the effects ofTAT and T-cell activation are combined, that have homology to the SV40 core transcriptional enhanc- gene expression directed by the HIV LTR increases 880-fold er element (29). To further localize the enhancer element in over the basal level seen in resting Jurkat cells, which do not the HIV LTR and to determine whether or not it is required express TAT (Table 2). Thus, the effects of TAT and T-cell for T-cell activation, we cloned both orientations of a activation on the HIV LTR are multiplicative. synthetic oligonucleotide representing positions -105 to -80 The Kinetics of Viral Gene Induction Parallels That of IL-2 immediately upstream from the HSV TK promoter, which Production. To determine the time course of viral gene lacks an endogenous enhancer. The resulting plasmids, induction, we measured CAT activity directed by the HIV pABtkCAT and pBAtkCAT, contain the sense and antisense LTR from 1 to 16 hr after the treatment of Jurkat cells with orientations of the candidate HIV enhancer, respectively. PHA and PMA (Table 3). At 8 hr after addition of PHA and Both of these plasmids direct CAT expression 3- to 5-fold PMA, we note the maximal appearance of IL-2 (Table 4), over that measured for ptkCAT (Table 5). These results IL-2 receptor (Fig. 2), and HIV LTR-directed CAT activity establish that the region in the HIV LTR from positions - 105 (Table 3). In transient expression assays, others have found to -80 has properties consistent with a transcriptional enhancer element. Activation of T cells increases CAT Table 2. Effects of T-cell activation and viral TAT on HIV expression 7- to 14-fold when cells transfected with pAB- LTR-directed gene expression are multiplicative T-cell Cm conversion, Fold Table 4. IL-2 activity in supernatants of activated Jurkat cells Plasmid stimulus % activation IL-2 activity, Rate, units/ml per TAR-1 None 0.09 1.0 Time, hr units/ml hr in preceding 4 hr TAR-1 PHA/PMA 0.45 5.0 4 5 1.2 TAR-1 + TAT-1 None 14.0 155 8 20 3.8 TAR-1 + TAT-1 PHA/PMA 79 880 12 26 1.5 16 30 1.0 CAT enzymatic activities for TAR-1 transfections were derived from data obtained from 4-hr reactions. CAT activities for TAR-1 + Supernatants from unstimulated cells yielded no detectable IL-2 TAT-1 cotransfections were obtained from 1-hr reactions. Values activity (data not shown). The values shown represent the averages shown are normalized for 1 hr. of three independent experiments. Downloaded by guest on September 27, 2021 6848 Immunology: Tong-Starksen et al. Proc. Natl. Acad. Sci. USA 84 (1987)

1500 HIV LTR are multiplicative; sequences in the HIV LTR that are essential for trans-activation by TAT are not required for the T-cell activation response. In Jurkat cells, the TAT gene product trans-activates the HIV LTR over 100-fold, which extends our previous observations on TAT trans-activation E in human T-lymphoid tumor (HUT-78) and carcinoma (HeLa) cells, as well as in Syrian hamster cells (HIT) (23). cD Our data show that the two tandemly repeated core C- transcriptional enhancer elements that make up the HIV enhancer are sufficient for the response to T-cell activation signals. The upstream promoter elements-i.e., the three Spl sites and a "TATA box," as well as the 5' NRE and the IL-2 and IFN-y homology regions, do not respond to T-cell Mean fluorescence intensity activation signals. The significance of the homologous regions remains to be determined; however, this 5' region did FIG. 2. Indirect immunofluorescent staining and fluorescence- not behave as a NRE (35). activated cell sorter analysis of IL-2 receptors on Jurkat cells. The Since the effects of T-cell activation and trans-activation solid line represents staining of resting Jurkat cells; the dotted line are multiplicative, they are expected to be mediated by represents staining of activated Jurkat cells. For activation, Jurkat different mechanisms. T-cell activation may result in a direct cells were incubated at 37°C with PHA (1,g/ml) and PMA (50 ng/ml) transcriptional effect. This is supported by the observation for 8 hr. that treatment with phorbol esters results in increased rates of transcriptional initiation from promoters containing the tkCAT and pBAtkCAT are compared to resting T cells SV40 core transcriptional enhancer elements (37). Trans- transfected in parallel (Table 5). These results show that the activation by TAT, which results in increased steady-state region -105 to -80 in the HIV LTR is sufficient for levels of mRNA, may be mediated by post-transcriptional responding to T-cell activation signals. mechanisms (unpublished results). A model proposing two TAR Sequences Essential for TAT Trans-Activation Are Not different pathways of HIV gene regulation is more consistent Required forResponse toT-Cell Activation Signals. To determine with multiplicative rather than additive effects observed for if sequences in TAR (positions -17 to +80) play a role in T-cell T-cell activation and trans-activation by TAT. activation, we tested four substitution mutants in TAR T-cell activation results from presentation of antigen in the [p(M+4/+9)CAT, p(M+14/+18)CAT, p(M+39/+43)CAT, context of self major histocompatibility determinants (MHC) and p(M+45/+49)CAT; see Fig. 1C]. Some ofthese cannot be or from administration of lectins (PHA, concanavalin A), trans-activated by TAT. We observed that in all four TAR calcium ionophores (ionomycin), or anti-CD3 and anti- substitution mutants, T-cell activation leads to increased CAT clonotypic antibodies concomitantly with PMA (20). These activity (Table 5). Thus, these data show that T-cell activation stimuli lead to expression of previously silent cellular genes signals act on the HIV enhancer and not on other regulatory as well as to cell growth and proliferation (20). T-cell elements such as Spl sites, TAR, or the NRE. activation can be blocked by administration of cyclosporin A and the protein synthesis inhibitor cycloheximide (38, 39). At DISCUSSION present, we do not know whether protein synthesis is Activation of HIV-infected peripheral blood lymphocytes is required for HIV LTR gene activation and whether the required for high-level viral replication (36). The target DNA administration of cyclosporin A can block this activation. sequences of T-cell activation signals are located in the HIV However, we have preliminary evidence that T-cell growth LTR. We demonstrated that T-cell activation increases HIV and proliferation influence viral gene expression. The effects LTR-directed gene expression. We have also shown that the of T-cell activation on the HIV LTR were dramatically trans-activating effects ofTAT and ofT-cell activation on the increased in Jurkat cells grown in medium containing 0.5% Table 5. Localization of the CIS-acting elements in the HIV LTR that respond to T-cell activation signals Cm conversion, % CAT reaction Fold Plasmid Control PHA/PMA time, hr activation p(-451/-156)tkCAT 0.52 0.45 16 0.87 p(-156/+185)CAT 0.33 1.6 16 4.8 p(-156/+185)CAT + TAT-1 6.0 55 4 9.2 pABtkCAT 0.49 6.6 16 14 pBAtkCAT 0.43 2.8 16 6.6 p(M+4/+9)CAT 0.15 0.45 16 3.0 p(M+4/+9)CAT + TAT-1 4.5 47 4 10 p(M+14/+18)CAT 0.12 0.40 16 3.3 p(M+14/+18)CAT + TAT-1 0.48 3.2 16 6.7 p(M+39/+43)CAT 0.075 0.29 16 3.9 p(M+39/+43)CAT + TAT-1 0.28 1.05 16 3.8 p(M+45/+49)CAT 0.27 1.1 16 4.1 p(M+45/+49)CAT + TAT-1 3.4 43 4 13 Results are shown of transfections of plasmid constructions containing deletion or substitution mutations in the HIV LTR and of plasmid constructions containing portions of the HIV LTR upstream from a heterologous promoter. p(M+4/+9)CAT and p(M+45/+49)CAT are trans-activated by TAT to a similar extent as TAR-1, whereas p(M+14/+18)CAT and p(M+39/+43)CAT show very little trans-activation by TAT. CAT reaction mixtures were incubated for the time indicated for each plasmid construction. Downloaded by guest on September 27, 2021 Immunology: Tong-Starksen et al. Proc. Natl. Acad. Sci. USA 84 (1987) 6849

instead of 10% fetal calf serum. Such serum-starved Jurkat (1985) J. Immunol. 135, 3151-3162. cells stop dividing and may mimic nondividing resting pe- 10. Folks, T., Kelly, J., Benn, S., Kinter, A., Justement, J., Gold, ripheral blood T cells. When transfected Jurkat cells were J., Redfield, R., Sell, K. W. & Fauci, A. S. (1986) J. Immunol. serum starved for 24 and then treated with 136, 4049-4053. hr, serum, PHA, 11. Zagury, D., Bernard, J., Leonard, R., Cheynier, R., Feldman, and PMA for 8 hr, up to 50-fold induction of CAT activity M., Sarin, P. S. & Gallo, R. C. (1986) Science 231, 850-853. directed by the HIV LTR was seen (data not shown). The 12. Harada, S., Koyanagi, Y., Nakashima, H., Kobayashi, N. & individual contributions to regulation of HIV LTR-directed Yamamoto, N. (1986) Virology 154, 249-258. gene expression by serum, PHA, and PMA, as well as other 13. Arya, S. K., Guo, C., Josephs, S. F. & Wong-Staal, F. (1985) T-cell agonists and mitogens, require further investigation. Science 229, 69-73. T-cell activation may be significant with respect to the 14. Sodroski, J., Patarca, R., Rosen, C., Wong-Staal, F. & onset of clinical AIDS. In an individual infected with HIV, Haseltine, W. (1985) Science 229, 74-77. AIDS pathogenesis appears to be a stepwise process (36, 40). 15. Chen, I. S. Y. (1986) Cell 47, 1-2. After to the of AIDS-related 16. Rosen, C. A., Sodroski, J. G., Goh, W. C., Dayton, A. I., exposure HIV, symptoms Lippe, J. & Haseltine, W. A. (1986) Nature (London) 319, complex (ARC) may ensue. This illness can subside and an 555-559. asymptomatic phase lasting months to years may follow. On 17. Feinberg, M. B., Jarrett, R. F., Aldovini, A., Gallo, R. C. & the cellular level, it appears that HIV establishes a latent Wong-Staal, F. (1986) Cell 46, 807-817. infection in T cells, monocytes, macrophages, and perhaps 18. Schneider, U., Schwenk, H. U. & Bornkamm, G. (1977) Int. J. other cell types (36, 40). It has been proposed that agents that Cancer 19, 621-626. stimulate the immune system such as infection with another 19. Lifson, J. D., Reyes, G. R., McGrath, M. S., Stein, B. S. & virus (e.g., cytomegalovirus) can function to stimulate HIV Engleman, E. G. (1986) Science 232, 1123-1127. replication and, consequently, lead to the development of 20. Weiss, A., Imboden, J., Hardy, K., Manger, B., Terhorst, C. AIDS Here we data to the notion that & Stobo, J. (1986) Annu. Rev. Immunol. 4, 593-619. (41). present support 21. Fujita, T., Shibuya, H., Ohashi, T., Yamanishi, K. & T-cell activation by itself increases gene expression directed Taniguchi, T. (1986) Cell 46, 401-407. by the HIV LTR. Others have shown that T-cell activation 22. Durandt, D. B., Bush, M. R., Morgan, J. G., Weiss, A. & increases viral replication (9, 10). Viral replication is further Crabtree, G. R. (1987) J. Exp. Med. 165, 395-407. escalated by viral TATs and, consequently, CD4' lymphoid 23. Peterlin, B. M., Luciw, P. A., Barr, P. J. & Walker, M. D. cells are killed. The affected individual, now immuno- (1986) Proc. Natl. Acad. Sci. USA 83, 9734-9738. compromised by loss of T-helper/inducer cells, is prone to 24. Gorman, C. M., Merlino, G. T., Willingham, M. C., Pastan, I. fatal opportunistic infections and, in some cases, neoplasia. & Howard, B. H. (1982) Proc. Natl. Acad. Sci. USA 79, Therapies directed at blocking T-cell activation at appropri- 6777-6781. ate times viral and thus 25. Walker, M. D., Edlund, T., Boulet, A. M. & Rutter, W. J. may prevent gene expression prolong (1983) Nature (London) 306, 557-561. the state of viral latency. Such therapeutic approaches are 26. Cann, A. J., Rosenblatt, J. D., Wachsman, W., Shah, N. P. & expected to modulate the clinical expression of AIDS. Chen, I. S. Y. (1985) Nature (London) 318, 571-574. 27. Sodroski, J. G., Rosen, C. A. & Haseltine, W. A. (1984) Note. After submission of this manuscript, a report by Nabel and Science 225, 381-385. Baltimore (42) appeared that reached similar general conclusions. 28. Fujisawa, J., Seiki, M., Koyokawa, T. & Yoshida, M. (1985) Proc. Natl. Acad. We thank Irvin S. Y. Chen for the pHTLV-I-LTR-CAT plasmid, Sci. USA 82, 2277-2281. Art Weiss and Michael D. Walker for helpful discussions, and 29. Gluzman, Y. & Shenk, T. (1983) Enhancers and Eukaryotic Michael Armanini for expert secretarial assistance as well as prep- Gene Expression (Cold Spring Harbor Laboratory, Cold aration ofthis manuscript. We gratefully appreciate the contributions Spring Harbor, NY). of Karen Shaw in cloning and oligonucleotide synthesis. This work 30. Mosmann, T. (1983) J. Immunol. Methods 65, 55-63. was supported in part by grants from the California Universitywide 31. Loken, M. R. & Stall, A. M. (1982) J. Immunol. Methods 50, Taskforce on AIDS to P.A.L. and B.M.P. R85-R112. 32. Sanchez-Pescador, R., Power, M. D., Barr, P. J., Steimer, 1. Barre-Sinoussi, F., Chermann, J. C., Rey, F., Nugeyre, K. S., Stempien, M. M., Brown-Shimer, S. L., Gee, W. W., M. T., Chamaret, S., Gruest, J., Dauguet, C., Axler-Blin, C., Renard, A. R., Randolph, A., Levy, J. A., Dina, D. & Luciw, Vezinet-Brun, F., Rouzioux, C., Rozenbaum, W. & P. A. (1985) Science 227, 484-492. Montagnier, L. (1983) Science 220, 868-871. 33. Jones, K. A., Kadonaga, J. T., Luciw, P. A. & Tjian, R. 2. Gallo, R. C., Salahuddin, S. Z., Popovic, M., Shearer, G. M., (1986) Science 232, 755-759. Kaplan, M., Haynes, B. F., Palker, T. J., Redfield, R., 34. Starcich, B., Ratner, L., Josephs, S. F., Okamoto, T., Gallo, Oleske, J., Safai, B., White, G., Foster, R. & Markham, P. D. R. C. & Wong-Staal, F. (1984) Science 227, 538-540. (1984) Science 224, 500-503. 35. Rosen, C. A., Sodroski, J. G. & Haseltine, W. A. (1985) Cell 3. Levy, J. A., Hoffman, A. D., Kramer, S. M., Landis, J. A., 41, 813-823. Shimabukuro, J. M. & Oshiro, L. S. (1984) Science 225, 36. Klatzmann, D. & Gluckman, J. C. (1986) Immunol. Today 7, 840-842. 291-2%. 4. Wong-Staal, F. & Gallo, R. C. (1985) Nature (London) 317, 37. Imbra, R. J. & Karin, M. (1986) Nature (London) 323, 555- 395-403. 557. 5. Dalgleish, A. G., Beverly, P. C. L., Clapham, P. R., Craw- 38. J. R. G. ford, D. H., Greaves, M. F. & Weiss, R. A. (1984) Nature Reed, C., Alpers, J. D., Nowell, P. C. & Hoover, (London) 312, 763-767. (1986) Proc. Natl. Acad. Sci. USA 83, 3982-3986. 6. Klatzman, D., Champagne, E., Chamaret, S., Gruest, J., 39. f(ronke, M., Leonard, W. J., Depper, J. M., Arya, S. K., Guetard, D., Hercend, T., Gluckman, J.-C. & Montagnier, L. Wong-Staal, F., Gallo, R. C., Waldmann, T. A. & Greene, (1984) Nature (London) 312, 767-768. W. C. (1984) Proc. Natl. Acad. Sci. USA 81, 5214-5218. 7. McDougal, J. S., Kennedy, M. S., Sligh, J. M., Cort, S. P., 40. Ho, D. D., Rota, T., Schooley, R., Kaplan, J., Allan, J., Mawle, A. & Nicholson, J. K. A. (1986) Science 231, 382-385. Groopman, J., Resnick, L., Felsenstein, D., Andrews, C. & 8. Maddon, P. J., Dalgleish, A. G., McDougal, J. S., Clapham, Hirsch, M. (1985) N. Engl. J. Med. 313, 1493-1497. P. R., Weiss, R. A. & Axel, R. (1986) Cell 47, 333-348. 41. Rando, B. F., Pellet, P., Luciw, P. A. & Srinivasan, A. (1987) 9. McDougal, J. S., Mawle, A., Cort, S. P., Nicholson, J. K. A., Oncogene 1, 13-18. Cross, G. D., Scheppler-Campbell, J. A., Hicks, D. & Sligh, J. 42. Nabel, G. & Baltimore, D. (1987) Nature (London) 326, 711-713. Downloaded by guest on September 27, 2021