Supplementary Figure 1. Generation of an XIST-mediated, 21-silencing system. a (Step 1) Schematic representation depicting the targeted insertion of rtTA construct into the AAVS1 locus of chromosome 19 in Tri21 iPSC line using a ZFN. Top: AAVS1 locus including exons (grey boxes), ZFN-target sites (black arrow), and homology arms (orange and yellow bars). Middle: donor vector including homology arms, a EF1 promoter (light-green arrow), the rtTA (pink box), poly(A) sequences (purple boxes), a human PGK promoter (green arrow), and the neomycin-resistance gene (Neo, blue box). Bottom: schematic of the rtTA-inserted AAVS1 locus. b (Step 2) Targeted insertion of the exchange cassette into the DYRK1A locus on . Top: DYRK1A gene locus including exons (grey boxes), CRISPR–Cas9-target sites (black arrow), and homology arms (light-blue and pink bars). Middle: donor vector including homology arms, the loxP sequence (yellow triangle), drug- resistance (PuroΔTK, dark blue box), poly(A) sequences, and the lox5171 site (dark yellow triangle). Bottom: schematic of the exchange cassette-inserted DYRK1A locus. c (Step 3) Cre recombinase-mediated cassette exchange used to insert human XIST cDNA. Top: Exchange cassette-inserted DYRK1A locus in chromosome 21. Middle: donor vector including the loxP sequence, the tetracycline-response element (green arrow, pTRE3G), human XIST cDNA (red box), poly(A) sequences, and the lox5171 sequence. Bottom: schematic of the XIST-inserted DYRK1A locus.

Supplementary Figure 2. Analysis of an XIST-inserted trisomy 21 iPSC line. a Immunocytochemical staining of the XIST-Tri21 iPSC line using specific antibodies against OCT3, OCT4, SSEA, and Sendai virus NP (SeVNP). Nuclei were stained with Hoechst 33342. Scale bars: 500 μm. b Karyotype analysis of the XIST-Tri21 iPSC line. c STR analysis of the XIST-Tri21 iPSC line. The STR sequence of the RUNX1 locus in chromosome 21 was compared between a patient with DS and his parents’ genomes.

Supplementary Figure 3. Dox treatment-induced chromosome silencing in the XIST-Tri21 iPSC line. a FISH analysis of XIST RNA in untreated (D−) XIST-Tri21 iPSCs and XIST-Tri21 iPSCs treated with Dox (D+) for 3 weeks. XIST RNA was labelled with a Dylight594-conjugated probe (red). Nuclei were stained with DAPI. Scale bars: 5 μm. b Relative expression levels of XIST in untreated (D−) and Dox-treated (D+) XIST-

Tri21 iPSC lines (n = 4 experiments per cell line). Gene-expression levels were normalised to those of the D− cell lines. Error bars represent the SEM. c Immunocytochemical staining of the XIST-Tri21 iPSC line using an anti-H3K27me3 antibody. Nuclei were stained with Hoechst 33342. Scale bars: 50 μm. d Relative expression levels of genes on chromosome 21 in untreated (D−) and Dox-treated (D+) XIST-Tri21 iPSC lines (n =

4 experiments per line). Gene-expression levels were normalised to those of cDi21 lines (n = 4 experiments per cell line). Error bars represent the SEM. e Percentage of H3K27me3-positive cells in Tri21 iPSCs, untreated (D−) XIST-Tri21 iPSCs, and XIST-Tri21 iPSCs, treated with Dox for 1 week (D 1w+) or 3 weeks (D 3w+). (n = 6 experiments per cell line) Error bars represent the SEM. f Percentage of H3K27me3-positive Tri21 iPSCs, untreated (D−) XIST-Tri21 iPSCs, and (D 3w+) XIST-Tri21 iPSCs after single-cell cloning. The data shown were analysed using Student’s t-test or Welch’s two-sample t-test. *P < 0.05, **P < 0.01

Supplementary Figure 4. Additional transfection of an rtTA into XIST-Tri21 NPCs. a Immunocytochemical staining of XIST-Tri21 NPCs using PAX6- and SOX1-specific antibodies. Nuclei were stained with Hoechst 33342. Scale bars: 100 μm. b Schematic depicting the additional transfection of an rtTA using a PB transposon vector and a hyperactive PB transposase into XIST-Tri21 NPCs. c Relative rtTA-expression levels in XIST-Tri21 NPCs, with or without rtTA transfection (n = 3 experiments per cell line). Expression was normalised to that of untransfected cell lines. Error bars represent the SEM. d Relative expression levels of XIST RNA in rtTA-transfected XIST-Tri21 NPCs. D+ cells were treated with

Dox for 5 days. Expression levels were normalised to those of Dox-untreated lines (n = 5 experiments per cell line). e Immunocytochemistry of rtTA-transfected XIST-Tri21 NPCs using an H3K27me3-specific antibody. D+ cells were treated with Dox for 5 days. Nuclei were stained with Hoechst 33342. Scale bars: 50 μm. f Percentage of H3K27me3-positive cells in rtTA-transfected XIST-Tri21 NPCs. D+ cells were treated with Dox for 5 days (n = 4 experiments per cell line). Error bars represent the SEM. The data shown were analysed using Student’s t-test or Welch’s two-sample t-test. *P < 0.05, **P < 0.01

Supplementary Figure 5. Dox administration did not effects the basal proliferative ability of Tri21 APCs. a Relative rtTA-expression levels in XIST-Tri21 APCs. The expression levels were normalised to those of untransfected APCs (n = 3 experiments per cell line). b Percentage of EdU-positive Tri21 APCs (i.e., not containing the XIST transgene; n = 3 experiments per cell line). Dox was administered to the D+ line for 6 weeks. c Relative numbers of Tri21 APCs 1 day after seeding. The cell numbers were normalised to those of the D− APC line (n = 3 experiments per cell line). Error bars represent the SEM. The data shown were analysed by Student’s t-test, Welch’s two-sample t-test, or one-way ANOVA with Bonferroni’s correction. *P < 0.05, **P < 0.01

Supplementary Figure 6. Transcriptional profiling of each chromosome in Dox-treated XIST-Tri21 APCs. Violin plots of relative log- transformed expression ratios for genes in each chromosome in XIST-Tri21 APC lines. D− cell (red); D+ cell (green); Dremov cell lines (yellow). Gene-expression levels with positive read counts (as determined by RNA-seq analysis) were normalised to those of cDi21 lines. The upper orange dashed lines indicate a ratio of 1.5, whereas the lower black dashed lines indicate a ratio of 1.0. The plots show mean expression levels with error bars indicating the SD. The data shown were analysed by the Kruskal–Wallis test with Bonferroni’s correction. **P < 0.01

Supplementary Figure 7. Transcriptional profiling showed sustained gene suppression in XIST-Tri21 APC lines after Dox removal. Log2- fold changes in the mean gene-expression ratios (Dox-treated lines: Dox-untreated lines, X-axis; Dremov: Dox-untreated lines, Y-axis). The grey data points represent the full set of 18,440 genes with positive read, as determined by RNA-seq, with the point densities for all sets represented by blue line contours. The orange dashed lines indicate a two-thirds decrease in the gene-expression levels for each cell line.

Supplementary Figure 8. Integrative analysis of the RNA-seq and ChIP-seq data revealed a negative correlation between H3K27me3 enrichment and transcriptional silencing in D+ and Dremov XIST-Tri21 APC lines. H3K27me3 accumulation within each gene body and 2 kb upstream of the start site were compared between (a) D+ and D− cell lines, (b) Dremov and D+ cell lines, (c) Dremov and D− XIST-Tri21 APC lines. Genes with a significant difference in H3K27me3 accumulation between two lines are represented with red data points, with the density for all pair points shown by blue line contours. The orange dashed lines indicate a two-thirds decrease in the gene-expression level of each cell line. With the ChIP-seq data, the FDRs were calculated using the Benjamini–Hochberg method, and FDR < 0.05 was considered to reflect a statistically significant difference.

Supplementary Figure 9. Map showing the distribution of H3K27me3 modifications in PIGP and DSCR3 in XIST-Tri21 APCs. (Upper) Integrative Genomics Viewer screenshot of H3K27me3 ChIP-seq track peaks for (a) PIGP and (b) DSCR3 (hg19) in Dox-untreated cell lines, Dox-treated cell lines, and Dremov cell lines. The Y-axis shows the number of fragments per per million reads. (Lower, red bars) The distribution of the regions with significantly higher H3K27me3 accumulation in each comparison. The FDRs were calculated using the Benjamini– Hochberg method. FDR < 0.05 was considered to reflect a statistically significant difference.

Supplementary Figure 10. SNP analysis of mRNA extracted from XIST-Tri21 APCs, with or without Dox treatment, revealed the parental origin of the XIST-inserted chromosome 21. (Upper) SNP analysis of the ETS2 gene in chromosome 21 using the parents’ genomic DNA showed T/T polymorphisms in the maternal genome and G/G polymorphisms in the paternal genome. (Lower) SNP analysis of the ETS2 gene using total cDNA (i.e., not genomic DNA) prepared from XIST-Tri21 APCs, with and without XIST expression. cDNA derived from XIST-Tri21 APCs without Dox treatment (D−) showed T/T/G polymorphisms, whereas cDNA derived from Dox-treated (chromosome-inactivated) XIST-Tri21 APCs lost a T allele, indicating that XIST cDNA was inserted into one of two maternal copies of chromosome 21 (hereafter the XIST-inserted maternal chromosome is referred to as M2).

Supplementary Figure 11. Full immunoblots related to the data shown in Fig. 5g. Full immunoblot images for p-STAT3 (left) and STAT3 (right). β-Actin was detected as a loading control. (Left) The blotted membrane was probed with an anti-p-STAT3 antibody. (Right) The blotted membrane was stripped and re-probed with anti-STAT3 and anti-β-actin antibodies.

Supplementary Figure 12. DYRK1A expression levels in DY+/+/m- and DY+/m/m- XIST-Tri21 APCs depended on the copy numbers of active DYRK1A genes. a, b (Upper) Relative DYRK1A-expression levels in (a) DY+/+/m- and (b) DY+/m/m- XIST-Tri21 APCs, with or without Dox treatment. Expression levels were normalised to that of Dox-untreated lines (n = 4 experiments per cell line). Error bars represent the SEM. The data shown were analysed by Student’s t-test. *P < 0.05. (Lower) Schematic depiction of the combination of targeted DYRK1A alleles and inactivated chromosome 21. The parental origin of chromosome 21 is indicated (M1, M2, or P). Red rectangle, XIST transgene; black stars, DYRK1A-target sites; black , inactivated chromosome 21. Expected copy numbers of the active DYRK1A gene decreased from two to one in M1- and P-DY+/+/m APC lines, and from one to zero in M1P-DY+/m/m APC lines after Dox treatment. In contrast, the expected copy numbers of the active DYRK1A gene remained unchanged as two in the M2-DY+/+/m APC line, or as one in the M1M2- and M2P-DY+/m/m APC lines.

Supplementary Figure 13. Neither overexpression nor knockdown of DSCR3 affected DS APC proliferation. A Dox-inducible DSCR3 transgene was transduced into Partial-Tri21 NPCs using a PB transposon vector and a hyperactive PB transposase. Transfected NPCs were differentiated into APCs, and DSCR3 overexpression was induced by a 6-week treatment with Dox. a Relative DSCR3-expression levels in overexpression vector-transfected Partial-Tri21 APCs. The expression levels were normalised to those of untreated APCs (n = 3 experiments per cell line). b, c Percentage of EdU-positive cells (b) and relative cell numbers 1 day after seeding (c) in DSCR3-overexpressing Partial-Tri21 APCs (n = 3 experiments per line). The cell numbers were normalised to those of untreated APC lines. d Relative DSCR3-expression levels in siRNA- treated Tri21 APCs. The expression levels were normalised to those in control siRNA (siCtrl)-treated Tri21-APCs (n = 3 experiments per cell line). e, f Percentage of EdU-positive cells (e) and relative cell numbers 1 day after seeding (f) in siRNA-treated Tri21 APCs (n = 3 experiments per cell line). The percentage of EdU-positive cells and cell numbers were normalised to that of the Tri21 cell line without siRNA treatment. siDSCR3, DSCR3 siRNA. Error bars represent the SEM. The data shown were analysed by Student’s t-test or Welch’s two-sample t-test. *P < 0.05, **P < 0.01

Supplementary Table 1. Expression of the genes on chromosome 21.

D− D+ Dremov P value Gene Line 1 Line 2 Line 3 Line 1 Line 2 Line 3 Line 1 Line 2 Line 3 (D− and D+) TPTE 0.43 1.32 0.39 0.64 1.69 0.95 1.90 1.11 0.53 0.349 BAGE2 0.47 0.73 0.55 1.04 0.69 0.84 1.31 1.02 0.76 0.091 ANKRD30BP2 1.00 1.00 1.00 25.59 15.01 14.76 1.00 1.00 1.00 0.004 RBM11 0.50 0.57 0.50 0.50 0.62 0.98 0.50 0.50 0.50 0.325 HSPA13 1.12 1.10 1.11 0.92 1.07 1.00 1.11 1.13 1.01 0.136 NRIP1 0.73 0.74 0.97 0.33 0.40 0.34 0.51 0.67 0.57 0.004 USP25 1.39 1.41 1.29 1.16 1.17 1.10 1.08 1.11 1.07 0.010 CXADR 1.56 2.05 1.52 0.66 1.79 1.09 0.86 1.96 0.68 0.261 BTG3 1.96 1.81 1.36 1.12 1.21 1.09 1.19 1.34 1.13 0.063 C21orf91 2.11 1.73 1.13 1.01 1.45 0.91 1.17 1.74 0.99 0.186 CHODL 11.81 8.43 1.63 1.83 2.06 2.43 3.25 3.93 2.25 0.255 TMPRSS15 1.00 1.14 1.00 1.00 1.00 1.00 1.00 1.00 1.00 0.423 LOC101927797 1.67 1.11 1.68 1.91 1.90 2.68 1.38 1.85 2.03 0.102 NCAM2 1.02 0.83 0.32 0.61 0.39 0.39 1.05 0.81 0.37 0.440 LINC00158 1.00 1.14 1.00 1.00 2.50 1.00 2.96 1.00 1.00 0.482 MIR155HG 0.08 0.02 0.65 0.01 0.17 0.13 0.03 0.17 0.18 0.810 LINC00515 3.43 1.48 0.49 0.49 3.00 0.49 0.49 3.77 0.67 0.645 MRPL39 1.45 1.29 1.23 0.83 0.87 1.11 1.05 1.10 1.14 0.041 JAM2 1.73 1.47 0.28 0.20 0.19 0.12 0.83 0.44 0.12 0.089 ATP5J 1.49 1.36 1.28 1.07 1.16 1.24 1.34 1.28 1.25 0.050 GABPA 1.35 1.48 1.39 1.22 1.15 1.30 1.50 1.44 1.45 0.042 APP 1.45 1.63 1.36 0.94 0.95 0.92 0.96 0.98 0.96 0.012 CYYR1 3.33 1.64 1.07 1.32 1.26 1.91 0.78 1.65 1.67 0.612 ADAMTS1 1.96 2.61 7.34 4.21 4.05 3.50 1.35 1.90 2.46 0.738 ADAMTS5 21.13 8.73 5.51 4.59 2.90 2.15 6.02 7.35 1.99 0.075 N6AMT1 1.68 1.48 1.65 0.98 1.21 0.96 1.40 1.37 1.34 0.014 LTN1 1.17 1.30 1.40 1.10 1.18 1.21 1.25 1.28 1.30 0.178 RWDD2B 1.13 1.24 1.62 0.85 0.88 1.49 1.08 1.22 1.77 0.332 USP16 1.38 1.27 1.21 1.00 1.06 1.20 1.36 1.39 1.21 0.073 CCT8 1.30 1.24 1.26 1.08 1.09 1.17 1.12 1.12 1.24 0.018 MAP3K7CL 2.73 1.94 0.96 1.49 0.81 0.90 1.98 0.98 0.68 0.238 LINC00189 3.34 3.88 2.63 2.29 2.37 1.33 3.95 2.60 1.04 0.090 BACH1 1.15 1.28 1.20 0.96 0.96 1.02 1.13 1.12 1.01 0.007 GRIK1 2.05 0.47 1.85 3.61 0.58 1.37 13.31 9.48 1.91 0.830 GRIK1-AS2 2.65 2.30 0.40 1.34 2.02 1.59 1.59 0.87 0.55 0.789 GRIK1-AS1 0.91 0.82 0.82 1.83 1.03 0.82 0.82 0.82 0.82 0.324 KRTAP20-2 1.00 1.00 1.00 1.00 1.25 1.00 1.00 1.00 1.00 0.423 TIAM1 1.56 1.68 2.20 0.49 0.50 0.70 0.86 0.94 1.38 0.002 SOD1 1.73 1.74 1.55 0.96 1.08 1.08 1.32 1.20 1.31 0.001 SCAF4 1.48 1.59 1.32 1.16 1.02 1.10 1.31 1.26 1.42 0.016 HUNK 3.55 2.08 0.97 1.08 0.46 0.49 0.92 0.46 0.62 0.079 MIS18A 1.32 1.06 1.21 0.71 0.71 0.65 0.82 0.92 0.67 0.005 URB1 1.63 1.68 1.50 1.10 0.87 1.13 0.92 1.01 1.26 0.019 EVA1C 6.01 5.49 5.63 2.42 4.38 8.76 3.54 4.72 5.31 0.597 TCP10L 6.15 1.95 3.69 0.64 2.90 1.83 2.29 2.66 1.27 0.205 C21orf59 1.50 1.40 1.39 1.03 1.08 1.14 1.11 1.08 1.12 0.002 SYNJ1 1.35 1.39 1.35 1.23 1.15 1.29 1.41 1.26 1.41 0.083 PAXBP1-AS1 1.10 1.27 1.59 0.88 0.71 0.54 1.31 1.19 0.79 0.027 PAXBP1 1.29 1.20 1.03 0.68 0.79 0.79 1.03 1.08 1.07 0.007 C21orf62 1.03 1.05 0.83 0.75 0.86 0.92 1.95 1.48 0.89 0.226 IFNAR2 1.50 1.27 1.11 0.53 0.69 0.84 0.88 1.00 1.06 0.023 IL10RB-AS1 1.10 1.14 1.00 1.00 1.00 1.00 1.00 1.00 1.00 0.191 IL10RB 1.76 1.77 1.49 1.29 1.67 1.46 1.16 1.25 1.22 0.243 IFNAR1 1.27 1.42 1.35 0.98 0.94 1.18 1.18 1.12 1.39 0.045 IFNGR2 1.34 1.54 1.45 0.72 0.78 0.94 1.15 1.04 1.17 0.008 TMEM50B 1.64 1.76 1.72 1.14 1.18 1.14 1.48 1.66 1.86 0.000 DNAJC28 1.53 2.01 1.76 0.94 1.17 1.53 1.63 1.53 1.79 0.092 GART 1.42 1.34 1.34 1.30 1.21 1.46 1.23 1.27 1.40 0.598 SON 1.18 1.21 1.29 1.25 1.10 1.18 1.18 1.21 1.29 0.398 DONSON 1.90 1.73 1.67 0.85 1.16 1.11 1.35 1.43 1.21 0.021

D− D+ Dremov P value Gene Line 1 Line 2 Line 3 Line 1 Line 2 Line 3 Line 1 Line 2 Line 3 (D− and D+) CRYZL1 1.38 1.52 1.38 1.12 1.34 1.10 1.43 1.57 1.24 0.077 ITSN1 1.88 1.76 1.61 1.15 0.96 1.14 1.23 1.24 1.44 0.004 ATP5O 1.41 1.38 1.35 1.08 1.14 1.25 1.17 1.12 1.18 0.047 LINC00649 0.74 0.32 0.75 0.31 0.38 0.92 0.40 0.50 1.17 0.725 MRPS6 1.65 1.46 2.45 0.71 0.85 1.33 0.77 0.92 1.77 0.054 SLC5A3 1.65 1.19 3.16 0.40 0.59 1.13 0.52 0.77 2.87 0.075 LINC00310 1.65 1.14 1.00 2.22 1.00 1.00 1.97 1.00 2.73 0.559 KCNE2 1.65 0.81 1.58 0.81 0.81 1.60 0.81 0.81 0.81 0.992 KCNE1 1.65 0.54 1.06 1.19 0.54 0.54 0.54 0.54 0.54 0.566 RCAN1 1.65 0.77 1.63 0.55 1.00 1.12 0.46 0.90 1.10 0.490 CLIC6 1.65 1.87 0.82 5.48 19.55 4.86 0.82 7.87 0.82 0.071 LINC00160 1.65 1.00 1.00 1.11 1.00 1.00 1.00 1.00 1.00 0.423 RUNX1 1.65 1.20 1.76 0.46 0.60 0.94 0.69 0.97 1.43 0.043 RUNX1-IT1 1.65 1.00 1.00 1.11 1.00 1.00 1.00 1.91 1.00 0.423 LOC100506403 1.65 1.14 1.00 1.00 1.00 1.00 1.00 1.00 1.00 0.423 SETD4 1.65 1.25 1.34 0.92 1.06 1.02 1.08 0.93 1.10 0.008 LOC100133286 1.65 1.09 0.96 1.07 1.20 0.96 0.96 0.96 1.45 0.451 CBR1 1.65 0.45 0.76 0.44 0.41 0.58 0.48 0.34 0.47 0.471 CBR3-AS1 1.65 1.93 1.72 0.41 1.42 0.87 1.75 1.44 0.69 0.175 CBR3 1.65 2.58 2.01 1.26 1.55 1.82 1.57 1.87 1.16 0.049 DOPEY2 1.65 1.21 1.21 0.74 0.57 0.52 0.78 0.84 0.78 0.012 MORC3 1.65 1.44 1.08 0.89 0.93 0.81 1.04 1.13 1.00 0.034 CHAF1B 1.65 1.66 1.81 0.95 1.19 0.96 0.95 1.40 0.82 0.009 SIM2 1.65 0.64 2.24 0.63 11.53 0.56 0.56 13.47 1.54 0.679 HLCS 1.65 1.63 1.64 0.78 0.92 0.96 1.01 1.27 1.05 0.010 RIPPLY3 1.65 0.69 2.06 0.69 0.87 1.36 0.69 1.98 0.95 0.824 PIGP 1.65 1.74 1.37 0.96 1.20 1.13 1.46 1.28 1.02 0.022 TTC3 1.65 1.45 1.35 0.63 0.57 0.74 0.93 0.91 1.05 0.002 DSCR9 1.65 0.46 1.38 1.03 1.16 0.46 0.46 0.89 0.64 0.711 DSCR3 1.65 1.93 1.45 1.14 1.09 1.11 1.35 1.36 1.13 0.035 DYRK1A 1.65 1.87 1.42 1.01 1.11 0.98 1.26 1.53 1.14 0.018 KCNJ6 1.65 0.61 0.27 0.27 0.27 0.27 1.35 0.77 0.27 0.279 KCNJ15 1.65 0.79 0.94 1.00 0.64 0.81 0.65 0.74 0.94 0.770 ERG 1.65 1.00 1.00 1.00 1.00 1.97 1.00 1.00 2.73 0.484 LINC00114 1.65 1.14 1.00 1.00 1.00 1.00 1.00 1.00 1.00 0.423 ETS2 1.65 0.89 0.85 0.66 0.65 0.76 0.48 0.71 0.74 0.014 PSMG1 1.65 1.22 1.16 0.58 0.72 0.73 0.68 0.77 0.84 0.012 BRWD1 1.65 1.52 1.03 0.85 0.84 0.82 1.14 1.25 1.11 0.063 HMGN1 1.65 1.30 1.12 0.61 0.76 0.76 0.78 0.92 0.86 0.005 WRB 1.65 1.48 0.98 0.74 0.79 0.78 0.95 0.85 0.84 0.059 LCA5L 1.65 1.13 2.58 0.41 1.36 0.72 0.54 0.52 1.08 0.294 SH3BGR 1.65 1.66 1.35 0.29 0.72 0.90 1.36 1.04 1.07 0.113 B3GALT5 1.65 0.68 2.65 0.33 0.15 0.15 0.15 0.15 1.01 0.071 IGSF5 1.65 0.38 0.34 0.34 0.42 0.34 0.34 0.34 0.34 0.447 PCP4 1.65 1.00 1.00 1.00 1.25 1.00 1.00 1.00 1.00 0.423 DSCAM 1.65 1.14 1.00 1.00 1.00 1.00 1.00 1.00 1.00 0.364 BACE2 1.65 2.69 2.76 0.06 0.26 0.34 0.24 0.68 0.31 0.039 MX2 1.65 3.65 38.37 0.18 0.20 0.79 0.16 0.77 0.69 0.021 MX1 1.65 1.00 3.04 0.04 0.10 0.10 0.07 0.11 0.25 0.027 TMPRSS2 1.65 0.46 0.46 0.46 0.46 0.46 0.46 0.46 0.46 0.423 LINC00479 1.65 1.00 1.00 1.00 2.50 1.00 1.00 1.00 1.00 0.423 RIPK4 1.65 0.63 1.02 0.24 0.05 0.08 0.04 0.12 0.06 0.033 PRDM15 1.65 1.00 1.01 0.79 0.73 0.75 0.79 0.89 1.05 0.003 C2CD2 1.65 1.02 1.02 0.35 0.46 0.57 0.59 0.61 0.77 0.023 ZBTB21 1.65 1.15 0.82 0.67 0.66 0.57 0.75 0.82 0.95 0.034 ZNF295-AS1 1.65 1.14 1.00 1.00 1.00 1.00 1.00 1.00 1.00 0.423 ABCG1 1.65 11.92 0.83 4.10 6.68 5.66 4.72 3.14 7.02 0.972 TFF3 1.65 1.00 1.00 1.00 1.00 1.97 1.00 1.00 1.00 0.423 TFF2 1.65 1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00 0.423 TMPRSS3 1.65 1.00 1.00 1.11 1.00 1.00 1.00 1.00 1.00 0.423

D− D+ Dremov P value Gene Line 1 Line 2 Line 3 Line 1 Line 2 Line 3 Line 1 Line 2 Line 3 (D− and D+) RSPH1 3.96 5.07 4.40 0.57 1.28 4.04 0.51 0.51 2.81 0.182 SLC37A1 17.92 27.99 19.54 5.31 21.57 32.54 5.86 12.32 24.16 0.620 PDE9A 0.60 1.23 3.77 0.60 2.03 4.80 0.80 0.54 0.54 0.773 WDR4 1.50 1.14 1.21 1.05 0.99 1.12 0.95 1.04 1.27 0.135 NDUFV3 1.42 1.23 1.23 1.02 0.98 1.16 1.04 0.98 1.26 0.040 PKNOX1 1.09 1.30 1.12 0.95 0.94 0.94 1.14 1.15 1.18 0.058 CBS 0.79 0.49 0.37 0.43 0.26 0.22 0.37 0.37 0.16 0.130 U2AF1 1.62 1.56 1.52 1.04 1.05 1.07 1.22 1.28 1.18 0.001 LINC00322 1.00 1.00 1.12 1.00 1.00 1.00 1.00 1.00 1.00 0.423 SIK1 1.75 0.81 0.25 0.63 0.40 0.46 0.76 0.69 0.38 0.585 LINC00313 1.00 1.14 1.00 1.00 1.00 1.00 1.00 1.00 1.00 0.423 HSF2BP 1.41 1.53 1.27 0.78 0.84 0.82 1.32 0.73 1.14 0.004 RRP1B 1.23 1.22 1.18 0.83 0.73 0.83 0.91 0.88 1.04 0.005 PDXK 1.40 1.53 1.38 0.96 0.88 1.18 1.04 0.92 1.15 0.037 CSTB 1.92 2.08 1.64 1.35 1.39 1.61 1.44 1.25 1.43 0.048 RRP1 1.56 1.43 1.48 1.03 1.00 1.28 1.16 1.15 1.20 0.047 AGPAT3 1.40 1.63 1.22 0.99 1.08 1.02 0.99 1.08 1.04 0.052 TRAPPC10 1.27 1.23 1.17 1.13 0.99 1.03 1.18 1.04 1.19 0.044 PWP2 1.71 1.46 1.62 1.26 1.06 1.22 1.12 1.18 1.41 0.012 C21orf33 1.99 1.92 1.63 1.16 1.31 1.32 1.56 1.56 1.48 0.009 ICOSLG 10.44 7.20 0.98 3.31 8.09 3.17 4.70 7.69 1.62 0.956 AIRE 1.10 1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00 0.423 PFKL 1.96 2.01 1.49 1.06 1.19 1.11 1.47 1.43 1.26 0.028 C21orf2 2.20 2.04 1.64 1.35 1.35 1.19 1.94 1.75 1.57 0.027 TRPM2 0.49 0.56 0.49 0.49 0.62 0.49 0.49 0.49 0.49 0.739 LRRC3-AS1 0.94 1.07 0.94 0.94 0.94 0.94 0.94 0.94 1.10 0.423 LRRC3 0.73 0.38 1.46 0.26 0.32 0.85 0.51 0.79 0.90 0.331 UBE2G2 1.43 1.30 1.37 1.32 1.27 1.30 1.29 1.26 1.42 0.207 SUMO3 1.06 1.03 0.99 0.97 0.96 0.90 1.03 0.99 0.96 0.048 PTTG1IP 1.33 1.34 1.44 1.20 1.23 1.24 1.17 1.19 1.23 0.034 ITGB2 2.59 0.89 3.89 19.11 8.32 8.86 3.48 1.12 1.07 0.041 ITGB2-AS1 1.10 1.00 1.00 3.33 2.50 1.97 1.00 1.00 4.10 0.023 FAM207A 1.60 1.21 1.17 1.18 1.19 1.35 1.04 0.96 1.08 0.619 LINC00162 1.00 2.28 1.00 1.11 2.50 1.00 4.91 1.00 1.00 0.877 SSR4P1 1.62 1.80 1.08 1.19 1.75 2.00 1.17 2.00 1.31 0.690 ADARB1 2.94 1.00 1.74 2.04 3.12 4.13 1.68 1.66 2.86 0.229 POFUT2 1.21 1.20 1.35 1.24 1.12 1.30 0.97 0.91 1.04 0.631 LOC642852 1.59 1.45 1.31 0.89 0.82 0.96 1.20 1.19 1.34 0.003 LINC00316 1.00 1.00 1.00 1.00 1.00 1.00 1.00 1.00 2.73 NA COL18A1 1.23 1.24 1.77 0.67 0.55 0.82 1.00 0.83 0.88 0.012 SLC19A1 1.15 0.92 1.04 0.61 0.61 0.73 0.55 0.57 0.82 0.007 LOC100129027 1.10 0.94 0.17 0.46 0.21 0.81 0.26 0.17 1.36 0.736 PCBP3 0.48 0.16 0.48 0.04 0.25 0.61 0.05 0.27 0.66 0.546 LOC101928796 1.32 1.77 1.19 0.93 0.90 1.18 1.30 1.26 1.64 0.084 COL6A1 0.54 0.41 0.80 0.27 0.31 0.63 0.37 0.35 0.54 0.293 COL6A2 0.61 0.49 0.75 0.27 0.29 0.48 0.39 0.36 0.47 0.056 FTCD 1.48 2.37 1.78 1.51 0.80 2.33 2.70 2.28 1.10 0.493 SPATC1L 1.22 1.18 1.26 0.94 0.89 0.97 1.24 1.06 1.20 0.002 LSS 1.49 1.55 1.59 1.57 1.21 1.23 1.36 1.21 1.18 0.217 MCM3AP-AS1 0.97 0.96 1.02 0.77 0.38 0.52 1.14 0.79 1.23 0.099 MCM3AP 1.46 1.46 1.56 1.40 1.33 1.50 1.37 1.34 1.55 0.242 YBEY 1.56 1.61 1.42 1.37 1.42 1.37 1.57 1.45 1.48 0.118 C21orf58 1.95 1.88 2.20 1.55 2.02 1.24 1.70 2.63 1.75 0.221 PCNT 1.72 1.54 1.57 1.64 1.44 1.46 1.48 1.58 1.47 0.304 DIP2A 1.46 1.46 1.52 1.28 1.24 1.20 1.54 1.54 1.55 0.003 DIP2A-IT1 1.00 3.77 1.00 1.00 1.00 1.00 1.00 1.00 1.00 0.423 S100B 2.21 1.14 1.99 1.00 1.00 1.00 1.00 1.00 1.00 0.121 PRMT2 1.81 1.73 1.66 1.60 1.60 1.58 1.79 1.72 1.61 0.066

Relative expression levels of the genes on chromosome 21. Genes are listed according to chromosomal position. Expression was normalized to that of cDi21 lines (n = 3 experiments per cell line). Data were analysed by Welch's two-sample t-test.

Supplementary Table 2. PCA scores for genes on chromosome 21, based on the RNA-seq data.

Gene Component 1 Component 2 Gene Component 1 Component 2 Gene Component 1 Component 2 SOD1 0.1272 0.0017 CHAF1B 0.0859 -0.0244 JAM2 0.0370 -0.1087 ITSN1 0.1253 -0.0012 WDR4 0.0857 -0.0238 SLC19A1 0.0365 -0.1455 C21orf59 0.1231 -0.0006 PTTG1IP 0.0856 0.0513 MX1 0.0354 -0.1458 DONSON 0.1230 -0.0049 PRMT2 0.0846 0.1267 MCM3AP-AS1 0.0334 -0.0893 RRP1 0.1226 0.0032 GART 0.0846 0.1090 LINC00515 0.0319 0.0095 C21orf33 0.1201 0.0587 YBEY 0.0843 0.1172 KCNJ6 0.0298 -0.0796 DYRK1A 0.1195 0.0035 C21orf91 0.0837 0.0108 LCA5L 0.0294 -0.0577 DSCR3 0.1193 0.0265 TRAPPC10 0.0829 -0.0029 C21orf62 0.0211 0.0077 HLCS 0.1188 -0.0544 HSF2BP 0.0825 -0.0604 NRIP1 0.0209 -0.1630 PFKL 0.1163 0.0318 RSPH1 0.0817 -0.0247 B3GALT5 0.0193 -0.1345 N6AMT1 0.1160 0.0150 UBE2G2 0.0813 0.1031 LINC00162 0.0185 0.0702 U2AF1 0.1147 -0.0135 COL18A1 0.0804 -0.1101 GRIK1-AS2 0.0176 0.0609 BACH1 0.1144 -0.0168 SH3BGR 0.0801 -0.0691 ADARB1 0.0176 0.1059 MRPL39 0.1139 -0.0499 WRB 0.0799 -0.0712 RCAN1 0.0130 -0.0710 ATP5O 0.1132 0.0480 LSS 0.0795 0.0741 LOC101927797 0.0124 0.0922 AGPAT3 0.1131 -0.0146 C21orf58 0.0794 0.0772 LRRC3-AS1 0.0116 -0.0428 CCT8 0.1126 0.0374 PCNT 0.0793 0.1108 RIPK4 0.0100 -0.1398 URB1 0.1122 -0.0309 SON 0.0789 0.0949 LINC00316 0.0093 0.0128 SCAF4 0.1120 0.0220 MX2 0.0771 -0.0950 LRRC3 0.0060 -0.1166 TMEM50B 0.1119 0.0427 IFNGR2 0.0771 -0.0267 ERG 0.0049 0.0380 APP 0.1114 -0.0522 DSCAM 0.0771 -0.0198 SIK1 0.0045 -0.0776 ATP5J 0.1110 0.0701 BACE2 0.0770 -0.1219 ETS2 0.0045 -0.0760 DNAJC28 0.1104 0.0351 PSMG1 0.0747 -0.1290 GRIK1 0.0045 0.0612 CHODL 0.1080 0.0576 CBR3-AS1 0.0729 -0.0232 RIPPLY3 0.0025 -0.0231 MORC3 0.1067 -0.0534 FAM207A 0.0711 0.0480 RUNX1-IT1 0.0012 0.0418 LOC642852 0.1059 -0.0321 SLC37A1 0.0701 0.0695 PDE9A -0.0003 0.0115 PDXK 0.1058 -0.0450 EVA1C 0.0697 0.0982 NCAM2 -0.0036 -0.0768 C21orf2 0.1058 0.0577 TFF2 0.0693 -0.0185 LOC100129027 -0.0047 -0.0799 BTG3 0.1051 0.0127 AIRE 0.0693 -0.0185 LOC100133286 -0.0053 0.0455 PWP2 0.1046 0.0069 LINC00189 0.0688 0.0761 KCNE2 -0.0059 -0.0483 PIGP 0.1044 0.0314 TMPRSS15 0.0687 -0.0112 DSCR9 -0.0074 -0.0455 SPATC1L 0.1041 -0.0367 LOC100506403 0.0687 -0.0112 LINC00158 -0.0089 0.0809 USP16 0.1033 0.0508 LINC00114 0.0687 -0.0112 KCNE1 -0.0094 -0.0813 BRWD1 0.1014 -0.0468 ZNF295-AS1 0.0687 -0.0112 COL6A2 -0.0105 -0.1586 IL10RB-AS1 0.1012 -0.0211 LINC00313 0.0687 -0.0112 CLIC6 -0.0105 0.1184 CBR3 0.1004 0.0667 DIP2A-IT1 0.0687 -0.0112 TFF3 -0.0156 0.0483 LOC101928796 0.0997 0.0104 HUNK 0.0675 -0.0777 PCBP3 -0.0160 -0.1100 PKNOX1 0.0984 -0.0302 FTCD 0.0668 0.0637 LINC00649 -0.0187 -0.0942 SYNJ1 0.0982 0.0925 PAXBP1-AS1 0.0664 -0.0679 CBS -0.0189 -0.1329 USP25 0.0978 0.0398 RUNX1 0.0662 -0.1012 ITGB2 -0.0218 0.1087 DIP2A 0.0965 0.0806 MIS18A 0.0654 -0.1170 COL6A1 -0.0235 -0.1391 NDUFV3 0.0959 -0.0084 SLC5A3 0.0654 -0.0751 LINC00479 -0.0285 0.0725 TCP10L 0.0958 0.0215 MAP3K7CL 0.0631 -0.0130 KRTAP20-2 -0.0285 0.0725 SETD4 0.0951 -0.0412 LINC00310 0.0607 0.0232 PCP4 -0.0285 0.0725 CSTB 0.0947 0.0759 CYYR1 0.0602 0.0106 IGSF5 -0.0314 -0.1211 GABPA 0.0946 0.0924 ABCG1 0.0570 0.0676 ITGB2-AS1 -0.0342 0.1065 S100B 0.0940 -0.0379 RWDD2B 0.0567 -0.0123 TMPRSS2 -0.0356 -0.0998 CRYZL1 0.0930 0.0818 C2CD2 0.0548 -0.1445 TRPM2 -0.0375 -0.0926 LTN1 0.0925 0.0736 HSPA13 0.0540 -0.0249 TPTE -0.0379 0.0499 TIAM1 0.0921 -0.0849 PRDM15 0.0511 -0.1283 LINC00160 -0.0393 0.0696 IL10RB 0.0916 0.0827 SUMO3 0.0501 -0.0424 TMPRSS3 -0.0393 0.0696 TTC3 0.0910 -0.1090 SSR4P1 0.0489 0.1077 MIR155HG -0.0505 -0.1181 IFNAR2 0.0908 -0.0953 DOPEY2 0.0432 -0.1145 CBR1 -0.0521 -0.1401 RRP1B 0.0900 -0.1140 ICOSLG 0.0428 0.1008 ANKRD30BP2 -0.0544 0.1216 ADAMTS5 0.0897 0.0387 LINC00322 0.0427 -0.0312 GRIK1-AS1 -0.0586 0.0409 PAXBP1 0.0896 -0.0933 ZBTB21 0.0417 -0.1359 KCNJ15 -0.0629 -0.0775 IFNAR1 0.0895 0.0105 ADAMTS1 0.0414 0.0940 RBM11 -0.0640 -0.0501 HMGN1 0.0868 -0.1171 SIM2 0.0389 0.0121 BAGE2 -0.0867 0.0088 MCM3AP 0.0863 0.1074 POFUT2 0.0389 0.0096 MRPS6 0.0862 -0.0504 CXADR 0.0373 -0.0287

The score results from the PCA of 178 genes in chromosome 21 showing positive read counts, in at least one of the APC lines, based on RNA-seq data.

Supplementary Table 3. Expression levels of genes located in the 4-Mb region of chromosome 21.

Gene D− D+ Dremov

RUNX1 1.41 0.63 0.98 RUNX1-IT1 1.00 1.04 1.24 LOC100506403 1.04 1.00 1.00 SETD4 1.32 1.00 1.03 LOC100133286 1.00 1.07 1.10 CBR1 0.55 0.47 0.43 CBR3-AS1 1.65 0.80 1.21 CBR3 2.24 1.52 1.51 DOPEY2 1.13 0.60 0.80 MORC3 1.29 0.88 1.05 CHAF1B 1.76 1.03 1.03 SIM2 2.96 1.60 2.27 HLCS 1.62 0.88 1.11 RIPPLY3 1.03 0.93 1.09 PIGP 1.55 1.09 1.24 TTC3 1.33 0.64 0.96 DSCR9 1.00 0.82 0.64 DSCR3 1.70 1.12 1.27 DYRK1A 1.69 1.03 1.30 KCNJ6 0.87 0.27 0.65 KCNJ15 0.76 0.80 0.77 ERG 1.03 1.25 1.40 LINC00114 1.04 1.00 1.00 ETS2 0.90 0.69 0.63

The relative expression levels of genes located in the 4-Mb region of chromosome 21. Expression levels were normalised to that of the cDi21 lines (n = 3 experiments per cell line).

Supplementary Table 4. sgRNA sequences for CRISPR–Cas9.

Purpose Target site Sequence

XIST insertion DYRK1A intron 1 AGTTTACACGGGTGATGAGC

DYRK1A targeting DYRK1A intron 8 GATGGAAAACGGGTAAAATA

Supplementary Table 5. Primers for DYRK1A targeting.

Purpose Forward primer (5' to 3') Reverse primer (5' to 3')

RT-PCR (exon 8–10) F1; TGACCAAGCACCAAAAGCAAG R2; CGGGTTCCTGGTGGTTTGTA

5' Junctional PCR F2; CACGCCACTGCCCTCTAGCTTGGGAGACAG R3; GGCCGATGCAAAGTGCCGATAAACATAACG

3' Junctional PCR F3; TTGACGGCAATTTCGATGATGCAGCTTGGG R2; CTGGTGGCAGCGTCCGCTAAAATACAAGGC

Outside PCR F2; CACGCCACTGCCCTCTAGCTTGGGAGACAG R2; CTGGTGGCAGCGTCCGCTAAAATACAAGGC

STR GCACCCAACCCAGTTTTCAGAG (Fluor) GCTGTCTTCCCACTATAACATAAAC

Supplementary Table 6. Primers for Quantitative RT-PCR.

Gene Forward primer (5' to 3') Reverse primer (5' to 3')

ACTB TCAAGATCATTGCTCCTCCTGAG ACATCTGCTGGAAGGTGGACA

XIST AGCTCCTCGGACAGCTGTAA GGACACATGCAGCGTGGTA

CCT8 TTTTTCCTGATTCCGGCCATT AACCATGCCATGCAATACTGA

RCAN1 GCTCCGCCAAATCCAGACAA GCTGCGTGCAATTCATACTTTTC

DYRK1A ACCACCTCCAGTACATCGTCAAG CCGGGCTCTCCCACTGTT

C21orf33 GATGCGGAGTCTACGATGGG CCAGGTCTGTGATTTTGCCAC

rtTA CTGGGAGTTGAGCAGCCTAC TCCAGCATCTCGATTGGCAG

DSCR3 CCTACACTGGAGACCACCAACTT GATGAGGTGGTCAGGGTGAAG

PIGP TGTTTGGGATTAACATGATGAGTACCT TCTGCTGTTGATTTTTTGCATAGTT

HLCS AGGACAAAGGGCCCAACAG CGCTGCCCAGATGGACTT

Supplementary Table 7. Primers for allele-specific SNP analysis.

Purpose Forward primer (5' to 3') Reverse primer (5' to 3')

PCR for allele-specific SNP analysis GCATGAATGGCCAGATGCTG CAATCCTGCCTTTCCTGGGT

Sanger sequencing TTGTGGGTGACATTCTCTGG -