PNC1) Regulates Mitochondrial Biogenesis and the Invasive Phenotype of Cancer Cells

Oncogene (2010) 29, 3964–3976 & 2010 Macmillan Publishers Limited All rights reserved 0950-9232/10 www.nature.com/onc ORIGINAL ARTICLE Mitochondrial pyrimidine nucleotide carrier (PNC1) regulates mitochondrial biogenesis and the invasive phenotype of cancer cells

C Favre1, A Zhdanov2, M Leahy1, D Papkovsky2 and R O’Connor1

1Cell Biology Laboratory, Department of Biochemistry, BioSciences Institute, University College Cork, Cark, Ireland and 2Laboratory of Biophysics and Bioanalysis, Department of Biochemistry, University College Cork, Cork, Ireland

The insulin-like growth factor (IGF-I) signalling path- occur with mitochondrial DNA (mtDNA) mutations way is essential for metabolism, cell growth and survival. (Penta et al., 2001). However, the Warburg hypothesis It induces expression of the mitochondrial pyrimidine has been revisited notably because observed increases in nucleotide carrier 1 (PNC1) in transformed cells, but the glycolysis in cancer cells can occur along with normal consequences of this for cell phenotype are unknown. Here mitochondrial function or respiration. There is now we show that PNC1 is necessary to maintain mitochondrial considerable evidence to indicate that enhanced glyco- function by controlling mitochondrial DNA replication and lysis in cancer cells cooperates with oxidative metabo- the ratio of transcription of mitochondrial genes relative to lism, and that the anabolic functions of mitochondria in nuclear genes. PNC1 suppression causes reduced oxidative glutamine and fatty acid metabolism are essential for phosphorylation and leakage of reactive oxygen species tumour cell proliferation (reviewed by Deberardinis (ROS), which activates the AMPK-PGC1a signalling path- et al., 2008; Jones and Thompson, 2009). way and promotes mitochondrial biogenesis. Overexpression The insulin-like growth factor (IGF-I) signalling of PNC1 suppresses mitochondrial biogenesis. Suppression pathway through PI3-kinase, Akt and mTOR is of PNC1 causes a profound ROS-dependent epithelial– important in promoting cell growth and proliferation. mesenchymal transition (EMT), whereas overexpression This signalling pathway can directly enhance both of PNC1 suppresses both basal EMT and induction of glycolysis and oxidative phosphorylation (OxPhos). EMT by TGF-b. Overall, our findings indicate that PNC1 It controls the expression and trafficking of glucose is essential for mitochondria maintenance and suggest that transporters (Quon et al., 1995; Hajduch et al., 1998; its induction by IGF-I facilitates cell growth whereas Huang et al., 2005), enhances glycolysis (Elstrom et al., protecting cells from an ROS-promoted differentiation 2004; Pankratz et al., 2009) and may also directly programme that arises from mitochondrial dysfunction. enhance OxPhos (Unterluggauer et al., 2008). IGF-I- Oncogene (2010) 29, 3964–3976; doi:10.1038/onc.2010.146; mediated activation of the mTOR pathway is regulated published online 10 May 2010 by AMP-activated kinase (AMPK), a serine or threo- nine kinase that is considered to be a master regulator Keywords: PNC1; IGF-I; mitochondria; ROS; EMT of cellular and systemic metabolism by acting to restore in cancer; metabolism energy balance (Marshall, 2006). However, although AMPK has an important role in mitochondrial biogenesis, the links between the IGF-I signalling pathway and mitochondrial function and biogenesis are not clear. Introduction The Warburg effect suggests that increased glycolysis in cancer cells harbouring mitochondria with mtDNA The importance of mitochondria in cancer cell proli- mutations confers a growth advantage in hypoxic feration has been studied since Warburg (1956) conditions. However, damaged mitochondria may also proposed that tumour cells are less dependant on directly participate in increasing metastatic potential by mitochondria for ATP production than normal cells. activating a reactive oxygen species (ROS)-mediated Increased glycolysis and rapid production of ATP could retrograde signalling pathway (Ferraro et al., 2006; allow tumour cells to survive in low oxygen conditions Owusu-Ansah et al., 2008). Earlier studies have corre- found inside solid tumours in vivo (Pedersen, 1978; lated elevated levels of ROS in cancer cells with Gatenby and Gillies, 2004). It has long been suggested carcinogenesis (Klaunig et al., 1998; Mori et al., 2004). that this adaptation is due to an energy deficiency Numerous studies have implicated ROS in DNA caused by non-functional mitochondria such as may mutation and apoptosis, low levels of ROS produced in response to growth factor signalling may also Correspondence: Professor R O’Connor, Department of Biochemistry, function as a secondary messenger to activate signalling University College Cork, BioSciences Institute, College Road, pathways (Finkel, 2000). Cork, Ireland. The intense interest in targeting the IGF-I pathway E-mail: [email protected] Received 28 July 2009; revised 23 February 2010; accepted 25 February for cancer therapy (reviewed in Pollak, 2008) highlight 2010; published online 10 May 2010 the need for better insights into the mechanistic links PNC1 regulates mitochondrial function and EMT C Favre et al 3965 between IGF-I or insulin signalling, mitochondrial (which inhibit glycolytic production of ATP resulting in function, ROS signalling and metabolic regulation. reliance on respiration (OxPhos) (Marroquin et al., For these reasons we investigated the role of IGF-I 2007)). No significant difference was observed between signalling in mitochondrial activity in tumour cells by PNC1-deficient cells and control cells cultured in glucose analyzing the function of the mitochondrial pyrimidine (Figure 2a). No difference was also observed in control nucleotide carrier 1 (PNC1), which we previously cells after 2 h culture in galactose. In contrast, PNC1- identified as an IGF-I and insulin-responsive protein deficient clones showed a reduction of 15–20% in in transformed cells (Floyd et al., 2007). Here we show cellular ATP level in the presence of galactose. This that PNC1 is essential for maintenance of mtDNA and reduction in mitochondrial ATP production suggests respiration, and that suppression of PNC1 leads to that cells with PNC1 suppressed are deficient in OxPhos activation of an ROS-mediated signalling pathway that and cannot compensate for inhibition of glycolysis by controls nuclear gene expression. The findings show galactose as efficiently as controls. that IGF-I signalling is integrated with mitochondrial To further assess the effect of PNC1 suppression on function to determine the phenotype of cancer cells. respiration, we investigated the effect of PNC1 suppression on oxygen consumption using the phosphorescent probe MitoXpress (Luxcel Biosciences, Cork, Ireland), whose fluorescence emission is quenched by oxygen. Results When cell cultures are isolated from air, the cells consume dissolved oxygen and the fluorescence emission PNC1 suppression is associated with increased of the probe increases (Will et al., 2006). As can be seen mitochondrial ROS production in Figure 2b, HeLa cells with suppressed PNC1 grown We have previously shown that PNC1 expression levels in glucose show decreased oxygen consumption com- are inversely correlated with cellular ROS levels (Floyd pared with controls. This effect on oxygen consumption et al. , 2007). To investigate the mechanism of this, we is consistent with the decrease in mitochondrial ATP generated HeLa cell lines in which PNC1 expression was production in PNC1-deficient cells grown in galactose stably suppressed using shRNA. Clones showing an (Figure 2a). approximately 40% (ShRNA PNC1 clone 1) and 60% Cells with suppressed PNC1 could compensate for the (ShRNA PNC1 clone 2) reduction, respectively in PNC1 loss of mitochondrial ATP by increasing activation of transcription were isolated (Figure 1a). Increased basal the glycolytic pathway for ATP production. We there- expression of cellular ROS was observed in these clones fore investigated glycolytic activity in PNC1-deficient compared with controls (Figure 1b). The subcellular cells by measuring the rate of extracellular acidification, origin of the observed ROS was investigated using which is linked to lactic acid production during immunofluorescence with the ROS-specific H2DCF-DA glycolysis. We found that cells with suppressed PNC1 dye. As shown in Figure 1c, when compared with have increased extracellular acidification (increased controls, cells with suppressed PNC1 expression show emission of the pH-sensitive probe). This indicates that increased accumulation of the H2DCF-DA dye in glycolysis is increased in these cells compared with regions in which it is colocalized with the mitochondrial controls (Figure 2c). marker MitoTracker. We then used inhibitors that Altogether our study data indicate that in conditions target different complexes of the mitochondrial respira- of normal oxygen supply suppression of PNC1 causes a tory chain to determine which complex may contribute defect in the respiratory chain and increases the rate of to this ROS production. Rotenone (blocks transfer of glycolysis to compensate for overall cellular ATP electron from complex I to complex II) induced ROS production. production in both control and shRNA clones whereas antimycin A (complex III inhibitor) and CCCP (Elec- tron Transport Chain, uncoupler; unpublished data) did PNC1 expression regulates mitochondrial mass not increase ROS production in cells with suppressed and mtDNA replication PNC1 (Figure 1d). The observation that antimycin A We next turned our attention to the mechanisms by does not affect ROS production in PNC1-deficient cells which PNC1 regulates mitochondrial function. Having suggests that complex III in these cells is already leaking observed decreased OxPhos in cells with suppressed ROS. Altogether, these data indicate that the increased PNC1, we first investigated whether mitochondrial cellular ROS observed in cells with suppressed PNC1 is membrane potential (MMP) was altered using the derived from mitochondria and may be derived from a tetramethylrhodamine (TMRE) probe, which accumu- leak in the respiratory chain at complex III. lates inside the mitochondria in a potential-dependent manner. Surprisingly, neither PNC1 suppression nor PNC1 suppression inhibits mitochondrial ATP production PNC1 overexpression had a detectable affect on MMP and activates glycolysis (Figure 3a). This suggests that although the mitochon- We next tested the effects of PNC1 suppression on dria of these cells contain a defective respiratory chain, respiratory chain activity. To do this, we measured the they maintain a normal MMP. levels of intracellular ATP in cells cultured in glucose- PNC1 is a UTP carrier, so it is likely that reduced containing media (which produce ATP by both respira- availability of UTP in PNC1-deficient cells (Floyd et al., tion and glycolysis) and in galactose-containing media 2007) could impair mtDNA transcription. This could

Oncogene PNC1 regulates mitochondrial function and EMT C Favre et al 3966 Control 1 Control 2 150 150 120 100

80 Counts 60 0 0 010101 102 103 4 010101 102 103 4 40 PNC1 ShRNA 1 PNC1 ShRNA 2 20 150 150 (% of parental cells) Level of PNC1 mRNA Level 0 Counts Parental Control 1 Control 2 ShRNA 1 ShRNA 2 0 0 010101 102 103 4 010101 102 103 4 Fluorescence

H2DCF-DA Merge

MitoTracker H2DCF-DA ShRNA control PNC1 ShRNA

160 * * 140 * 120 * * * 100 CM 80 Rot Ant A 60 % of control

H2DCF-DA level H2DCF-DA 40 20 0 Control 1 Control 2 PNC1 A PNC1 B Figure 1 PNC1 suppression increases mitochondrial ROS production. (a) Pnc1 mRNA expression in the different HeLa stable clones was estimated by real-time PCR using pnc1- and gapdh-specific primers. Levels of pnc1 mRNA relative to gapdh are represented. (b) The cellular ROS level was measured in HeLa stable clones by flow cytometry using the H2DCFDA fluorescent. The green open histogram represents the level of cellular ROS in cells expressing control shRNA1. The purple closed histograms represent ROS levels for each clone as indicated. Results shown are representative of three independent experiments that gave similar results. (c) Visualization of cellular ROS in HeLa clones by fluorescence microscopy in digitonin-permeabilized cells using the H2DCFDA (green) or MitoTracker (red)-specific probes. (d) Cellular ROS level in HeLa clones treated with complete media (CM), 10 mM rotenone (Rot) or 10 mM antimycin A (AntA). The cellular ROS level was measured by FACS using the H2DCFDA probe. A Student’s t-test comparing each condition to complete media for each clone was calculated. *Po0.025.

result in reduced expression of mitochondrial-encoded of PNC1 on mitochondrial ATP production, PNC1 components of the respiratory chain leading to de- suppression had no discernable effect on the overall creased ATP output and increased ROS production. To transcription of mtDNA-encoded genes in MCF-7 and test this hypothesis, we analyzed the transcription levels HeLa cells (Figure 3b). of three genes (cyclooxygenase-1, NADH dehydro- To test whether the observed lack of difference in the genase subunit IV (mtND4) and cytochrome B) and level of mtDNA transcription between control cells and one ribosomal RNA (rRNA 16s) encoded by mtDNA, cells with suppressed PNC1 was related to different and compared them with two cellular housekeeping numbers of mitochondria in these cells, we assessed genes (gapdh and actin). Surprisingly, despite the effect mitochondrial mass. To do this we used the MitoTracker

Oncogene PNC1 regulates mitochondrial function and EMT C Favre et al 3967 a then normalized the amount of mtDNA transcription to 100 * mitochondria mass. As can be seen in Figure 3d, relative 80 * mtDNA transcription per mitochondrion was decreased 60 in cells with suppressed PNC1, whereas it was increased 40 in cells with overexpressed PNC1. Glucose

Galactose 2h UTP is a cofactor for the DNA helicase twinkle,

(% of control) 20

Total cellular ATP which is necessary for mtDNA replication (Korhonen 0 Control ShRNA 1 ShRNA 2 et al., 2003). Thus, PNC1 expression would also be expected to alter mtDNA replication. We assessed the b 50 * levels of mtDNA by real-time PCR using primers * * * Control * * 45 * speciﬁc for mtDNA (spanning Cox1 and 2 genes) * * ShRNA 1 * normalized to the level of nuclear genomic DNA 40 * s] * (Figure 3e). Cells with suppressed PNC1 had reduced μ * ShRNA 2 mtDNA, whereas cells with overexpressed PNC1 had 35 * * increased mtDNA compared with controls. * *

Lifetime [ 30 Overall, the data indicate that PNC1 is essential for Control + AA ShRNA 2 + AA the transcription and replication of mtDNA, and 25 ShRNA 1 + AA suggest that control of mitochondrial mass may be a 0 compensatory mechanism to maintain respiratory chain 0 20 40 60 80 100 efﬁciency. Time (min.) c -7 Control PNC1 controls mitochondrial biogenesis by ROS- 1.2x10 Control +FCCP -7 1.1x10 ShRNA1 dependent activation of the AMPK signalling pathway 1.0x10-7 ShRNA2 Increased mitochondrial mass or mitochondrial bio- -8 9.0x10 #### # # genesis requires induction of nuclear genes encoding -8 # ### # 8.0x10 # mitochondrial proteins. To investigate whether mito- -8 # #

rate [H+] M # 7.0x10 # chondrial biogenesis was affected in cells with sup- ## # 6.0x10-8 pressed or overexpressed PNC1, we compared the 0 Extracellular acidification 0 10 20 30 40 50 expression of mitochondria-encoded and nuclear- Time (min.) encoded mRNA in total RNA extracts. Cells with suppressed PNC1 showed increased transcription of the Figure 2 Suppression of PNC1 inhibits mitochondrial ATP production and oxygen consumption, and increases glycolysis. nuclear-encoded mitochondrial genes ADP/ATP trans- (a) Total cellular ATP production was measured in HeLa clones locator and Aralar (Figure 4a), whereas cells over- stably expressing shRNA control or shRNA PNC1. Cells were expressing PNC1 showed decreased transcription of grown in either glucose or galactose-containing media as indicated. these genes (Figure 4b). This suggests that PNC1 (b) Oxygen consumption was measured using the phosphorescent controls mitochondrial mass by regulating transcription oxygen-sensing probe MitoXpress in HeLa cells expressing shRNA control or a PNC1 shRNA as indicated. The mitochondrial of nuclear genes that encode mitochondrial proteins. inhibitor Antimycin A was used as a negative control (AA). Data To determine whether signalling pathways associated are presented as oxygen consumption over time. (c) Glycolysis was with mitochondrial biogenesis were activated in cells measured with a phosphorescent pH-sensitive probe and presented with suppressed or overexpressed PNC1, we first as extracellular cellular acidification rate. FCCP (0.5 mM) was applied to the control cells to increase glycolysis and mimic a investigated AMPK, a known mitochondrial biogenesis deficiency in OxPhos. In (a), (b) and (c), the data are presented as promoter (Lage et al., 2008). MCF-7 cells with the mean and standard deviation of values obtained for each time suppressed PNC1 showed increased basal AMPK point in three independent experiments. Statistical significance phosphorylation on Thr172 and increased phosphoryla- # (Student’s t-test *Po0.01, Po0.025). tion of its substrate Acetyl-CoA carboxylase (ACC; Figure 4c). Interestingly, IGF-I-induced phosphorylation of both Green (MTG) probe that accumulates in the mitochon- AMPK and ACC was not observed in cells over- dria in an MMP-independent manner. As shown in expressing PNC1 (Figure 4d). Figure 3c, cells with suppressed PNC1 have increased AMPK can be activated by cellular AMP and mitochondrial mass whereas cells with overexpressed phosphorylation on Thr172 by LKB1. Interestingly, PNC1 have reduced mitochondrial mass. The increased the basal increase in AMPK activation observed in cells mitochondrial mass observed in PNC1-deficient cells with PNC1 suppressed was also observed in LKB1- would mask a reduction in mtDNA transcription in deficient HeLa cells, suggesting that the pathway for whole cell lysates derived from cells deficient in PNC1, activation of AMPK is LKB1 independent (Figure 5a). and could account for the lack of observable differences AMPK can also be activated through signalling path- (Figure 3b). To gain insight into the relative levels of ways that require intracellular calcium and cellular ROS mitochondrial transcription per mitochondrion, we (Witczak et al., 2008). Since ROS is increased in cells analyzed mtDNA transcription (Cox1 and cytochrome B) with suppressed PNC1, this was a likely candidate. To and mitochondrial mass in the same pool of cells, and test this we used N-acetyl cysteine (NAC) to scavenge

Oncogene PNC1 regulates mitochondrial function and EMT C Favre et al 3968 ROS. As shown in Figure 5a and Supplementary Figure transcription factors including nuclear respiratory fac- S1, NAC treatment totally blocked AMPK activation in tors (NRF-1 and NRF-2) that control transcription of HeLa and MCF-7 cells with PNC1 suppressed. This nuclear-encoded mitochondrial genes. In cells with indicates that increased AMPK activation is mediated PNC1 suppressed, both PGC1a and NRF-2a expression by elevated cellular ROS in PNC1-deﬁcient cells. levels were increased (Figure 5b), whereas in cells with We next measured the activity of a downstream target PNC1 overexpressed, PGC1a and NRF-2a expression of AMPK, the transcription and activation of prolif- levels were reduced (Figure 5c). The effects on PGC1a erator-activated receptor-g coactivator-1 (PGC-1a) and NRF-2a correlate closely with PNC1 expression (Terada et al., 2002; Jager et al., 2007; Irrcher et al., and mitochondrial mass. NAC and the AMPK inhibitor 2008), which acts as a transcriptional co-factor for compound C were both able to abrogate the increase in mitochondrial mass and transcription of nuclear- 120 encoded genes in PNC1-deﬁcient cells (Supplementary 100 Figure S2). 80 Taken together the data indicate that PNC1 regulates 60 mitochondrial biogenesis through an ROS-dependent signalling pathway that controls AMPK activity and 40 2 (% of control) TMRE staining 20 transcription of PGC1a and NRF-2a. 0 Control SiRNA 1 SiRNA 2 Neo Ha-PNC1 Ha-PNC1 clone 1 clone 2 C 12 PNC1 regulates ROS-dependent epithelial–mesenchymal N12 transition in MCF-7 and HeLa cells GAPDH Ha 1 0.98 1.03 MCF-7 and HeLa cells with PNC1 suppressed both PNC1 Actin showed altered morphology (Supplementary Figure S3) 1 0.58 0.34

C12 C 1 2 pnc1 Figure 3 PNC1 suppression does not affect mitochondrial membrane potential but controls mitochondrial mass and mtDNA cox1 transcription per mitochondrion. (a) The mitochondrial membrane mtND4 potential of MCF-7 cells with PNC1 overexpressed or suppressed was measured by FACS using the TMRE probe. Expression levels cyto B of pnc1 in cells transfected with siRNA measured by RT–PCR are mt rRNA16S indicated in left panel below (abbreviations: (c) siRNA control, 1 gapdh PNC1 siRNA1, 2 PNC1 siRNA2)). PNC1 protein expression and Ha-PNC1 overexpression were determined by western blot with actin anti-Ha antibody and are shown in right panel below (abbrevia- MCF-7 HeLa tions: N, pcDNA3-Ha; 1, PNC1 Ha clone 1; 2, PNC1 Ha clone 2). (b) RT–PCR showing levels of three mitochondria-encoded genes 140 # 120 (Cox1, mtND4 and CytoB) and one mitochondria-encoded 120 # 100 ribosomal RNA (rRNA 16S) in MCF-7 or HeLa cells transfected 100 # for 72 h with an siRNA control or two siRNA speciﬁc for PNC1. 80 80 # As control, the level of transcription of PNC1 and two house- 60 60 keeping genes (gapdh and actin) are also indicated. (c) The 40 mitochondrial mass of MCF-7 cells was measured by FACS using

MTG staining (% of control) 40 20 20 the MitoTracker Green probe. The data for cells with PNC1 suppressed are shown in the left panel and are presented as the 0 0 Control SiRNA 1 SiRNA 2 Neo Ha-PNC1 Ha-PNC1 percentage of fluorescence in controls (cells transfected with control clone 1 clone 2 siRNA), The right panel shows the mitochondrial mass of MCF-7 cells overexpressing PNC1 with data presented as percentage of 120 fluorescence in controls (cells expressing empty vector). For both Cox 1 400 Cox 1 100 Cyto B Cyto B * panels the data represent the mean and standard deviation of data * # # # # 80 # 300 from three independent experiments (Student’s t-test Po0.01). (d) Analysis of mitochondrial transcription per mitochondria. The 60 # 200 * levels of transcription of the mitochondrial genes (Cyclooxygenase-1 40 (COX1) and cytochrome B (CytoB) relative to gapdh were (% of control) 100 per mitochondria 20 measured by real-time PCR. In the same cultures mitochondrial Level of transcription Level 0 0 mass was measured using MitoTracker Green staining with FACS. Control SiRNA 1 SiRNA 2 Neo Ha-PNC1 Ha-PNC1 To determine the rate of transcription per mitochondria the data clone 1 clone 2 for gene expression were expressed as a fraction of the data for mitochondrial mass. For each condition the data are presented as a 120 160 # percentage of control (either control siRNA or empty vector), and 100 140 # as the mean and standard deviation from three separate experi- 80 120 ments (Student’s t-test *Po0.05, #Po0.01). (e) Mitochondrial 100 DNA content per cell population was determined by real-time PCR 60 80 # using primers specific for mtDNA or genomic DNA. The data are 40 60 (% of control) mtDNA / DNA 40 presented as the ratio of mtDNA to genomic DNA. For each 20 # 20 condition the data are presented as a percentage of control (either 0 0 control siRNA or empty vector), and as the mean and standard Control SiRNA 1 SiRNA 2 Neo Ha-PNC1 Ha-PNC1 deviation from three separate experiments (Student’s t-test clone 1 clone 2 #Po0.01).

Oncogene PNC1 regulates mitochondrial function and EMT C Favre et al 3969 Cox 1 Cyto B ATP/ADP trans Aralar 140 160 200 160 120 140 180 # 140 # # 120 160 120 * 100 140 100 80 120 100 80 100 80 60 60 80 60 60 40 40 40 (% of control) 40 20 20 Mean fluorescence 20 20 0 0 0 0 control SiRNA 1 SiRNA 2 control SiRNA 1 SiRNA 2 control SiRNA 1 SiRNA 2 control SiRNA 1 SiRNA 2

Cox 1 Cyto B ATP/ADP trans Aralar 140 120 120 120 120 100 100 * 100 # 100 # # 80 80 80 80 60 60 60 60 40 40 40 40 (% of control) 20 20 20 20 Mean fluorescence 0 0 0 0 Neo clone 1 clone 2 Neo clone 1 clone 2 Neo clone 1 clone 2 Neo clone 1 clone 2

Uns IGF-I 5 min IGF-I 10 min Ha PNC1 Ha PNC1 Neo Clone 1 Clone 2

Control SiRNA 1 SiRNA 2 Control SiRNA 1 SiRNA 2 Control SiRNA 1 SiRNA 2 0 5 10 0 5 10 0 5 10 IGF-I min.

p ACC p AMPK

p AMPK

AMPK

p P70S6K1

Actin AMPK

Actin

Figure 4 PNC1 expression controls the transcription of nuclear-encoded mitochondrial genes (a) and (b) total mitochondrial transcription compared with nuclear transcription. The mRNA encoded by mtDNA (COX1 and CytoB) or nuclear DNA (ATP/ADP translocator and Aralar) were measured by real-time PCR in cells with (a) suppressed or (b) overexpressed PNC1 relative to gapdh. Data are presented as a percentage of control (either control siRNA or empty vector), and as the mean and standard deviation from three separate experiments (Student’s t-test *Po0.025, #Po0.01). (c, d) Activity of AMPK in MCF-7 cells with suppressed PNC1 (c)or overexpressing PNC1 (d). Cells were serum-starved for 4 h and then stimulated for the indicated time with IGF-I. Lysates were prepared and analysed by western blot with anti-phospho-ACC, anti-phospho-AMPK, AMPK and actin antibodies. and size. We therefore investigated whether mitochon- (Figure 6e). Vimentin, fibronectin and N-cadherin were dria dysfunction in these cells was associated with also increased (Supplementary Figure S4; unpublished phenotypic changes in migration, adhesion or clono- data). genic growth. In wound-healing assays, cells with PNC1 Mitochondrial ROS signalling has been strongly suppressed showed higher motility than controls implicated in motility, EMT and metastatic process (Figure 6a). This was not due to increased proliferation (Wu, 2006; Ishikawa et al., 2008). To determine whether as both controls and PNC1 shRNA clones showed PNC1 regulates EMT through mitochondrial ROS similar proliferation rates (Figure 6b). Strikingly, production, we used the ROS scavenger NAC. Exposure cells with suppressed PNC1 had greatly decreased of cells to NAC completely blocked EMT in cells with adhesion to fibronectin (Figure 6c) and a twofold PNC1 suppressed as indicated by the expression levels increased capacity to form colonies in soft agarose and location of E-cadherin (Figure 7a). (Figure 6d). The increase in b-catenin expression and cell motility Because the cellular changes observed in MCF-7 and in PNC1-deficient cells were abrogated by NAC HeLa cells with suppressed PNC1 resembled those of (Figure 7b; Supplementary Figure S5). Interestingly, cells undergoing epithelial–mesenchymal transition the AMPK inhibitor compound C had no effect on (EMT), we investigated expression of markers of EMT b-catenin expression suggesting that although ROS by immunofluorescence. As shown in Figure 6e, MCF-7 controls both EMT and mitochondrial biogenesis, cells with suppressed PNC1 exhibited a strong reduction EMT does not require AMPK. in E-cadherin at the cell–cell contacts compared with To test whether overexpression of PNC1 would controls (Figure 6e). By contrast, the expression of the suppress EMT, we used TGF-b to stimulate the onset mesenchymal marker b-catenin was increased of EMT in MCF-7 cells. TGF-b can induce an ROS-

Oncogene PNC1 regulates mitochondrial function and EMT C Favre et al 3970 CM CM + NAC

1 2 1 2 A A l 2 A A N N N N ntro ontrol 1 ontrol 2 hR hR ontrol 1 o hR hR C C S S C C S S

Phospho ACC

Phospho AMPK

AMPK

Actin

PNC1 PGC1 α NRF2 α 140 400 300 120 350 # 250 # 300 100 200 * 80 250 200 150 60 # * # 150 100 40 100 (% of control) 20 50 50 Mean fluorescence 0 0 0 control SiRNA 1 SiRNA 2 control SiRNA 1 SiRNA 2 control SiRNA 1 SiRNA 2

PNC1 PGC1 α NRF2 α 300 # 120 120 100 100 250 # 200 80 80 * 60 60 150 # # 100 40 # 40

(% of control) 50 20 20

Mean fluorescence 0 0 0 Neo Ha-PNC1 Ha-PNC1 Neo Ha-PNC1 Ha-PNC1 Neo Ha-PNC1 Ha-PNC1 clone 1 clone 2 clone 1 clone 2 clone 1 clone 2 Figure 5 PNC1 expression levels control activation of an ROS–AMPK–PGC1a signalling pathway. (a) AMPK activity was measured in HeLa cells with stably suppressed PNC1 and that were cultured in complete medium (CM) incubated for 30 min with or without 5mM NAC by western blotting with anti-phospho-ACC, anti-phospho-AMPK, AMPK or anti-actin antibodies. (b) Pnc1, pgc1a and nrf2a mRNA expression was measured by real-time PCR in MCF-7 cells with (c) suppressed or (d) overexpressed PNC1. Data are presented as a percentage of control (either control siRNA or empty vector), and as the mean and standard deviation from three separate experiments (Student’s t-test *Po0.05, #Po0.01).

dependent EMT in epithelial cells (Rhyu et al., 2005). As duction, bioenergetics/metabolism and the invasive shown in Figure 7c, control MCF-7 cells lost E-cadherin potential of transformed cells. As summarized in expression when stimulated with TGF-b, whereas cells Figure 8, we found that PNC1 is essential for overexpressing PNC1 retained E-cadherin levels. This maintenance of mtDNA synthesis and transcription, indicates that cells expressing PNC1 are protected from the ratio of mitochondria- to nuclear-encoded compo- induction of EMT. Exposure of cells to NAC also nents of the electron transport chain, and mitochondrial reversed the effects of TGF-b in control cells and had no function. Suppression of PNC1 leads to release of ROS, effect on E-cadherin expression in cells with PNC1 which results in increased mitochondrial biogenesis and overexpressed. an altered cellular differentiation programme (EMT). In Altogether, these data show that PNC1 controls contrast, overexpression of PNC1 suppresses ROS and cellular phenotype in transformed cells by regulating EMT. Thus PNC1 maintains mitochondrial function mitochondrial production of cellular ROS. and regulates an ROS-induced cellular differentiation programme. Our study results strongly indicate that the defect in oxygen consumption and mitochondrial ATP produc- Discussion tion is caused by the effects of PNC1 on expression of both nuclear- and mitochondria-encoded components of Regulation of mitochondrial function by growth factors the respiratory chain. This is most likely due to and their effects on growth, proliferation and the decreased mitochondrial UTP (Floyd et al., 2007) and phenotype of cancer cells is an important but still the consequences of this for mtDNA replication and poorly understood area of cancer research. Here we transcription. As components of the respiratory chain have shown that the IGF-I- and insulin-responsive are encoded by both nuclear and mtDNA, an imbalance mitochondrial UTP carrier PNC1 controls mtDNA in expression could lead to defective respiratory chain replication and transcription, mitochondrial ROS pro- function and ROS production. Our study results are

Oncogene PNC1 regulates mitochondrial function and EMT C Favre et al 3971 ShRNA control 1 PNC1 shRNA 2 15x104 control 1 13x104 control 2 4 0 h 11x10 ShRNA 1 9x104 ShRNA 2 7x104 5x104 18 h 4 Average number of cells number Average 3x10 104 0h 24h 48h 72h 96h

0.6 140 # 0.5 120 Control 1 0.4 100 # Control 2 0.3 80 ShRNA1 Mean 0.2 ShRNA2 60

fluorescence 0.1 40 0 Colonies/Well 057.5 20 Fibronectin mg/ml 0 control1 control2 shRNA 1 shRNA 2

Control SiRNA1 SiRNA2

E-Cadherin

β Catenin

Figure 6 PNC1 suppression initiates an epithelial–mesenchymal transition in MCF-7 and HeLa cells. (a) HeLa cells were assayed for cell migration in a wound-healing assay for 18 h at which cells were stained with crystal violet and photographed at Â 20 magnification. (b) Cell proliferation was assessed in cultures that were seeded at 104 cells per well in 24-well plate and complete media. At the indicated time cells were trypsinized and counted. The graph represents the average number of cells per well of three independent experiments. (c) HeLa cells with suppressed PNC1 were assessed for adhesion to fibronectin-coated plates for 30 min. The graph represents crystal violet staining of attached cells measured by spectrophotometry as a mean and standard deviation of three separate experiments. (d) Anchorage-independent growth of HeLa cell clones assayed in soft agar assay. Cells were allowed to grow for 3 weeks before staining with crystal violet and counting. The graph represents the mean and standard deviation of number of colonies per well from three separate experiments. (one way ANOVA #Po0.01,). (e) E-cadherin and b-catenin were detected by immunofluorescence with specific antibodies in formaldehyde-fixed cells and a Cy2-labelled secondary antibody (green). Nuclei were stained with Hoechst (blue). Images were obtained using a Nikon epifluorescence microscope and represent similar fields in more than three experiments.

consistent with previous studies showing that mitochon- regulating the level of PNC1 expression, IGF-I may drial ROS activates a retrograde pathway leading to enhance mitochondrial function (OxPhos) when cells altered expression of nuclear-encoded genes (Butow and require this energy to support the transformed pheno- Avadhani, 2004; Owusu-Ansah et al., 2008). type. This would also increase overall mitochondrial We previously showed that PNC1 expression is bioenergetics including fatty acid synthesis and gluta- strongly induced in response to IGF-I and insulin mine metabolism, which has recently been shown to be stimulation, which indicates direct regulation of mito- essential for Myc oncogene-driven tumour cell growth chondrial function. Although IGF-I has long been (Jones et al., 2005; Deberardinis et al., 2008). Our implicated in cellular metabolism through its activity observation that IGF-I directly activates AMPK also on mTOR, glycolysis and glucose transporters, there is indicates a direct role for IGF-I in enhancing expression also recent evidence for a direct effect of IGF-I on of nuclear-encoded genes necessary for mitochondrial OxPhos in tumour cells (Unterluggauer et al., 2008) and biogenesis. in an experimental cirrhosis model in rat in which a low Our ﬁndings support an essential function for PNC1 dose of IGF-I can increase the mitochondrial activity in maintenance of mtDNA. A linear correlation was (Perez et al., 2008). Our study results suggest that by observed between mtDNA content and the level of

Oncogene PNC1 regulates mitochondrial function and EMT C Favre et al 3972 Control SiRNA1 SiRNA2

E-Cadherin - NAC

E-Cadherin + NAC

# 180 CM # 160 NAC # 140 CC # 120 100 80 60 % control 40 20 Catenin expression

β 0 control1 control2 shRNA 1 shRNA 2 Neo Ha-PNC1 clone 1 Ha-PNC1 clone 2

Uns

TGFβ

TGFβ + NAC

Figure 7 Morphological changes observed on PNC1 suppression are due to an ROS-dependent EMT programme in MCF-7 cells. (a) E-cadherin expression was assessed in MCF-7 cells with suppressed PNC1 that were incubated in complete media (control) or incubated overnight with 5 mM NAC. (b) The expression level of b-catenin was measured by FACS using an intracellular labelling in HeLa clones stably transfected with an shRNA control or an shRNA specific for PNC1 cultured for 8 h in complete media (CM) in presence or absence of 5 mM NAC or 10 mM compound C (CC). Statistical significance (one-way ANOVA #Po0.01). (c) E-cadherin expression was assessed in cells overexpressing PNC1 after overnight treatment with 20 ng/ml of TGF-b either in the presence or in the absence of 5 mM NAC. Images were obtained using a Nikon epifluorescence microscope and represent similar fields in more than three experiments.

PNC1 expression in transformed cells. When PNC1 was also rescue mtDNA deletion observed in yeast lacking reduced by 80% (as routinely obtained with siRNA the DNA helicase PIF1. The mtDNA maintenance in number 2) this resulted in a reduction in mtDNA mammalian cells is controlled by several nuclear- content of approximately 80%, whereas cells with PNC1 encoded gene products. Among these are the DNA suppressed by 40–60% of PNC1 (siRNA1 and shRNA) polymerase-g (DNA polG), the DNA helicase twinkle showed a 40–60% reduction in mtDNA content and mtDNA-interacting proteins including mtSSB (Figure 3e; unpublished data). The necessity for PNC1 and TFAM (Falkenberg et al., 2007). Mutations in in mtDNA maintenance is apparently conserved these proteins result in a loss of mtDNA and have throughout evolution because deletion of the yeast been associated with various mitochondrial diseases homologue Rim2p causes loss of mtDNA (Van Dyck (Copeland, 2008). The minimal replication system et al., 1995). Interestingly, Rim2p overexpression can consists of the DNA polG and twinkle. Interestingly,

Oncogene PNC1 regulates mitochondrial function and EMT C Favre et al 3973 PNC1 Expressed PNC1 Suppressed

IGF-IR IGF-IR

mtDNA mtDNA V V IV IV UTP III III I I ATP II ATP II PI3K PI3K PNC1 PNC1 ROS ROS Induction Akt Mitochondrial DNA Akt of EMT Synthesis and Transcription Cell Growth NAC

mTOR PNC1 mTOR Mitochondrial AMPK AMPK Mass

Nuclear-encoded Nuclear-encoded α α PNC1 PGC-1 components of PNC1 PGC-1 components of Mitochondria Mitochondria

Figure 8 Model illustrating function of PNC1 as an IGF-I-responsive protein in maintaining mitochondrial function. IGF-I induces expression of IGF-1. When PNC1 is expressed mitochondrial DNA synthesis and transcription produce components of the electron transport chain that together with nuclear-encoded components are essential for maintaining Oxphos and prevent production of ROS. When PNC1 is suppressed DNA synthesis and transcription are impaired; there is an imbalance in mitochondrial-encoded components of the electron transport chain compared with nuclear-encoded components, a defect in Oxphos occurs; and ROS are produced. This leads to activation of an AMPK-dependent signalling pathway that activates mitochondrial biogenesis and expression of genes that change cellular phenotype (epithelial to mesenchymal transition). IGF-I also activates AMPK indicated by dotted line. although twinkle can use different 50-triphosphates as regulates ROS production and cell size and that cofactors for its helicase activity, UTP is proposed to be impaired proliferation occurs as a consequence of its most potent cofactor (Korhonen et al., 2003). drastic loss of mtDNA in cells with greatly suppressed Because PNC1 imports UTP into mitochondria, it is PNC1. rational to propose that decreased mitochondrial UTP PNC1 expression is enhanced in transformed cell lines in PNC1-deficient cells (Floyd et al., 2007) would reduce and tumours compared with non-transformed cells, the efficiency of twinkle activity and reduce mtDNA which suggests a role in facilitating transformation or levels. tumour growth. In this report we found that suppression The function of PNC1 in mtDNA maintenance may of PNC1 in transformed cells leads to acquisition of a also explain why suppression of PNC1 leads to impaired more aggressive phenotype because of an ROS-depen- cell proliferation only in certain conditions. We have dent EMT programme. Mitochondria, and specifically, previously reported that PNC1 suppression affects mutations in mtDNA, have previously been implicated cell proliferation and halts the cell cycle in G1 (Floyd in cancer progression (reviewed in Brandon et al., 2006; et al., 2007). However, this reduction was only observed Chatterjee et al., 2006). Transfer of mutated mtDNA when PNC1 was suppressed by more than 70%. HeLa from highly metastatic cell lines is sufficient to initiate a clones stably expressing shRNA targeting PNC1 ex- metastatic phenotype in non-metastatic cell lines by hibited a 40% and 60% reduction in protein did not promoting mitochondrial ROS production (Ishikawa show reduced proliferation (Figure 6b). Previous studies et al., 2008). Moreover, mtDNA depletion in MCF-7 of mtDNA suppression after ethidium bromide treat- cells induces an EMT programme (Naito et al., 2008). ment or suppression of critical components of the Our results show that PNC1, by regulating the mtDNA maintenance machinery have shown impaired mitochondrial ROS production, has the potential to proliferation only when a critical level of mtDNA (less regulate initiation of an ROS-dependent EMT pro- than 25% of initial content) is reached, which suggests gramme in tumour cells. Furthermore, PNC1 over- that a minimal level of mtDNA is sufficient for cell expression in MCF-7 cells was sufficient to prevent proliferation (Jazayeri et al., 2003; Jeng et al., 2008). TGF-b-induced EMT. Thus, increased PNC1 expres- Interestingly, the effects of PNC1 on cell size and ROS sion could enable a tumour to optimally produce ATP production were not as tightly correlated with the and grow whilst it would also protect cells from degree of PNC1 suppression (Floyd et al., 2007 and metabolic stress and prevent progression toward an this study). In addition, cells overexpressing PNC1 invasive aggressive phenotype. Our findings also suggest showed increased cell size and decreased ROS without that PNC1 may have a more general function in altered proliferation (Floyd et al., 2007). Altogether, regulating cellular differentiation programmes that are these observations suggest that PNC1 primarily controlled by mitochondria retrograde signalling.

Oncogene PNC1 regulates mitochondrial function and EMT C Favre et al 3974 In summary, we have shown that PNC1 controls measured using two pairs of primers located on either one mitochondrial integrity and regulates signalling exon and one intron of pnc1 gene or two introns of the actin pathways that control the growth and differentiation gene (pnc1 exon4 and intron4, and a-actin intron3 and intron4 of cancer cells. Our findings also highlight one of the for DNA F, DNA R, actDNA F and actDNA R, respectively). limitations associated with the concept of targeting mitochondria in cancer. Partial inhibition of mitochon- Western blot analysis and antibodies drial function may exacerbate the aggressiveness of Cellular protein extracts and western blot were prepared as cancer due to ROS production and subsequent effects previously described (Floyd et al., 2007). Anti-phospho ACC, anti-phospho-p70SK1, anti-AMPK and anti-phospho-AMPK on EMT signalling. antibodies were all purchased from Cell Signaling Technology (Beverly, MA, USA). The anti-actin monoclonal antibody was purchased from Sigma-Aldrich (Dublin, Ireland). Materials and methods Adhesion, migration, soft agar and proliferation assays Cell lines and plasmids These assays were conducted as previously described (Ayllon and MCF-7 and HeLa cells were maintained in Dulbecco’s O’Connor, 2007) with the following modifications. For adhesion modified Eagle’s medium supplemented with 10% (v/v) fetal assays, 1 Â 104 cells per well were added to previously coated wells bovine serum, 10 mML-glutamine and antibiotic (all from (with fibronectin) in triplicate andallowedtoattachfor30min. Biowhittaker, Verviers, Belgium). The pSuper-PNC1-ShRNA The cells were then stained with crystal violet and the number of and pSuper-Scramble vectors were generated by insertion of attached cells was estimated by spectrophotometer. For soft agar the PNC1 shRNA (sequence: gatccccggctgtatactttgcatgttattga assays, 4 Â 103 HeLa cells per well were resuspended in 0.33% tatcctaacatgcaaagtatacagcctttttc) or scramble (sequence: gat low-melting point agarose in Dulbecco’s modified Eagle’s ccccctggaagtcttcattaaggtgttgatatcccaccttaatgaagacttccagtttttc) medium–10% fetal bovine serum and plated in triplicate onto between the BglII and XhoI sites of pSUPER.neo (OligoEngine, 35-mm dishes containing a 2 ml base agarose layer (0.6%). Seattle, WA, USA). PNC1 siRNAs and transfection procedure were previously Immunofluorescence and flow cytometry described (Floyd et al., 2007). Immunofluorescence assays were conducted as previously described (Floyd et al., 2007). For ROS detection, the RT–PCR and real-time PCR H2DCF-DA probe (Molecular Probes, Eugene, OR, USA) Whole RNA was isolated using the Trizol method (Invitrogen, was added at 50 mM to the media in the absence of fetal Carlsbad, CA, USA). And cDNA synthesis was carried out by calf serum and incubated for 15 min at 37 1C. After one wash reverse transcription with equal amounts of RNA (2 mg) using in PHEM, the cells were fixed in PHEM 3.7% formaldehyde a cDNA synthesis kit (Invitrogen). Equal amounts of cDNA for 15 min and treated or not with 10 mM of digitonin were amplified using HotStar Taq DNA polymerase (Qiagen, (Calbiochem, San Diego, CA, USA) for 30 min in Hank’s Hilden, Germany) for regular reverse transcriptase (RT)–PCR balanced salt solution (Gibco BRL, Paisley, Scotland, UK) at or QuantiTect SYBR Green PCR kit (Qiagen) for real-time room temperature. The discs were then mounted on slides and PCR. The various levels of amplification were normalized to photographed using a Nikon E600 and Â 100 objective. the levels of amplification of gapdh or actin. For fluorescence-activated cell sorting (FACS) analysis the following probes were used: 40 nM MitoTracker Green dye (Molecular Probes) for mitochondria mass, 10 mM H2DCF-DA Measurement of ATP levels, O2 consumption and glycolysis (Molecular Probes) for ROS detection, 20 nM TMRE (Sigma) For ATP analysis, we incubated cells for 6 h in 96-well plates for MMP. For b-catenin detection, 150 000 cells were cultured 5 (Sarstedt, Wexford, Ireland) at 2 Â 10 cells per well in serum- for 8 h in six-well plates in normal media in presence or free Dulbecco’s modified Eagle’s medium containing P/S, 1 mM absence of 5 mM NAC or 10 mM compound C. Cells were then pyruvate and either 10 mM of glucose or 10 mM of galactose. collected using phosphate-buffered saline 0.5 mM EDTA, Cellular total ATP was quantified using CellTiterGlo Assay washed in phosphate-buffered saline 0.5%, bovine serum (Promega, Madison, WI, USA) and Victor2 plate reader albumin 0.1% saponin, incubated for 20 min with b-catenin (PerkinElmer Life Science, Waltham, MA, USA) on white antibody (BD Transduction Laboratories, Erembodegem, 96-well plates (Greiner Bio One, Frickenhausen, Germany) Belgium) in the presence of saponin. Cells were then washed following the manufacturer’s instructions. and incubated for 20 min with anti-mouse Cy3-conjugated For O2 consumption assay, we used the phosphorescent antibody (Jackson ImmunoResearch Laboratories, Newmarket, oxygen-sensing probe MitoXpress (Luxcel Biosciences) as UK). Cells were then washed and analysed by FACS. previously described (Zhdanov et al., 2008). The extracellular acidification assay was performed as previously described (Hynes et al., 2009). Conflict of interest

Determination of mtDNA levels The authors declare no conﬂict of interest. Total DNA was isolated as described before (Miller et al., 1988). Brieﬂy, cells were lysed in lysis buffer (100 mM Tris- HCL (pH 8.5), 5 mM EDTA, 0.2% SDS and 10 mg/ml proteinase K) at 55 1C for 2 h. Total DNA was extracted Acknowledgements using ethanol precipitation. Owing to the absence of introns in the mitochondrial genome, mtDNA was assessed using primer We thank Kurt Tidmore for assistance with illustrations and pairs that are complementary to sequences spanning two genes: to our colleagues in the Cell Biology Laboratory for helpful Cox1 for mtDNA F and Cox2 for mtDNA R (see Table 1 in discussions. This work was funded by Science Foundation Supplementary Figures). The levels of nuclear DNA were Ireland and the Health Research Board.

Oncogene PNC1 regulates mitochondrial function and EMT C Favre et al 3975 References

Ayllon V, O’Connor R. (2007). PBK/TOPK promotes tumour Klaunig JE, Xu Y, Isenberg JS, Bachowski S, Kolaja KL, cell proliferation through p38 MAPK activity and regulation of Jiang J et al. (1998). The role of oxidative stress in the DNA damage response. Oncogene 26: 3451–3461. chemical carcinogenesis. Environ Health Perspect 106(Suppl 1): Brandon M, Baldi P, Wallace DC. (2006). Mitochondrial mutations in 289–295. cancer. Oncogene 25: 4647–4662. Korhonen JA, Gaspari M, Falkenberg M. (2003). TWINKLE Has 50- Butow RA, Avadhani NG. (2004). Mitochondrial signaling: the 430 DNA helicase activity and is speciﬁcally stimulated by retrograde response. Mol Cell 14: 1–15. mitochondrial single-stranded DNA-binding protein. J Biol Chem Chatterjee A, Mambo E, Sidransky D. (2006). Mitochondrial DNA 278: 48627–48632. mutations in human cancer. Oncogene 25: 4663–4674. Lage R, Dieguez C, Vidal-Puig A, Lopez M. (2008). AMPK: a Copeland WC. (2008). Inherited mitochondrial diseases of DNA metabolic gauge regulating whole-body energy homeostasis. Trends replication. Annu Rev Med 59: 131–146. Mol Med 14: 539–549. Deberardinis RJ, Sayed N, Ditsworth D, Thompson CB. (2008). Brick Marroquin LD, Hynes J, Dykens JA, Jamieson JD, Will Y. (2007). by brick: metabolism and tumor cell growth. Curr Opin Genet Dev Circumventing the Crabtree effect: replacing media glucose with 18: 54–61. galactose increases susceptibility of HepG2 cells to mitochondrial Elstrom RL, Bauer DE, Buzzai M, Karnauskas R, Harris MH, Plas toxicants. Toxicol Sci 97: 539–547. DR et al. (2004). Akt stimulates aerobic glycolysis in cancer cells. Marshall S. (2006). Role of insulin, adipocyte hormones, and nutrient- Cancer Res 64: 3892–3899. sensing pathways in regulating fuel metabolism and energy home- Falkenberg M, Larsson NG, Gustafsson CM. (2007). DNA replication ostasis: a nutritional perspective of diabetes, obesity, and cancer. Sci and transcription in mammalian mitochondria. Annu Rev Biochem STKE 2006: re7. 76: 679–699. Miller SA, Dykes DD, Polesky HF. (1988). A simple salting out Ferraro D, Corso S, Fasano E, Panieri E, Santangelo R, Borrello S procedure for extracting DNA from human nucleated cells. Nucleic et al. (2006). Pro-metastatic signaling by c-Met through RAC-1 and Acids Res 16: 1215. reactive oxygen species (ROS). Oncogene 25: 3689–3698. Mori K, Shibanuma M, Nose K. (2004). Invasive potential induced Finkel T. (2000). Redox-dependent signal transduction. FEBS Lett under long-term oxidative stress in mammary epithelial cells. Cancer 476: 52–54. Res 64: 7464–7472. Floyd S, Favre C, Lasorsa FM, Leahy M, Trigiante G, Stroebel P et al. Naito A, Cook CC, Mizumachi T, Wang M, Xie CH, Evans TT et al. (2007). The insulin-like growth factor-I mTOR signaling pathway (2008). Progressive tumor features accompany epithelial–mesench- induces the mitochondrial pyrimidine nucleotide carrier to promote ymal transition induced in mitochondrial DNA-depleted cells. cell growth. Mol Biol Cell 18: 3545–3555. Cancer Sci 99: 1584–1588. Gatenby RA, Gillies RJ. (2004). Why do cancers have high aerobic Owusu-Ansah E, Yavari A, Mandal S, Banerjee U. (2008). Distinct glycolysis? Nat Rev Cancer 4: 891–899. mitochondrial retrograde signals control the G1–S cell cycle Hajduch E, Alessi DR, Hemmings BA, Hundal HS. (1998). checkpoint. Nat Genet 40: 356–361. Constitutive activation of protein kinase B alpha by membrane Pankratz SL, Tan EY, Fine Y, Mercurio AM, Shaw LM. (2009). targeting promotes glucose and system A amino acid transport, Insulin receptor substrate-2 regulates aerobic glycolysis in mouse protein synthesis, and inactivation of glycogen synthase kinase 3 in mammary tumor cells via glucose transporter 1. J Biol Chem 284: L6 muscle cells. Diabetes 47: 1006–1013. 2031–2037. Huang C, Thirone AC, Huang X, Klip A. (2005). Differential Pedersen PL. (1978). Tumor mitochondria and the bioenergetics of contribution of insulin receptor substrates 1 versus 2 to insulin cancer cells. Prog Exp Tumor Res 22: 190–274. signaling and glucose uptake in l6 myotubes. J Biol Chem 280: Penta JS, Johnson FM, Wachsman JT, Copeland WC. (2001). 19426–19435. Mitochondrial DNA in human malignancy. Mutat Res 488: Hynes J, O0Riordan TC, Zhdanov AV, Uray G, Will Y, Papkovsky 119–133. DB. (2009). In vitro analysis of cell metabolism using a long-decay Perez R, Garcia-Fernandez M, Diaz-Sanchez M, Puche JE, Delgado pH-sensitive lanthanide probe and extracellular acidiﬁcation assay. G, Conchillo M et al. (2008). Mitochondrial protection by low doses Anal Biochem 390: 21–28. of insulin-like growth factor-I in experimental cirrhosis. World J Irrcher I, Ljubicic V, Kirwan AF, Hood DA. (2008). AMP-activated Gastroenterol 14: 2731–2739. protein kinase-regulated activation of the PGC-1alpha promoter in Pollak M. (2008). Insulin and insulin-like growth factor signalling in skeletal muscle cells. PLoS ONE 3: e3614. neoplasia. Nat Rev Cancer 8: 915–928. Ishikawa K, Takenaga K, Akimoto M, Koshikawa N, Yamaguchi A, Quon MJ, Chen H, Ing BL, Liu ML, Zarnowski MJ, Yonezawa K Imanishi H et al. (2008). ROS-generating mitochondrial et al. (1995). Roles of 1-phosphatidylinositol 3-kinase and ras in DNA mutations can regulate tumor cell metastasis. Science 320: regulating translocation of GLUT4 in transfected rat adipose cells. 661–664. Mol Cell Biol 15: 5403–5411. Jager S, Handschin C, St-Pierre J, Spiegelman BM. (2007). AMP- Rhyu DY, Yang Y, Ha H, Lee GT, Song JS, Uh ST et al. (2005). activated protein kinase (AMPK) action in skeletal muscle via direct Role of reactive oxygen species in TGF-beta1-induced mitogen- phosphorylation of PGC-1alpha. Proc Natl Acad Sci USA 104: activated protein kinase activation and epithelial–mesenchymal 12017–12022. transition in renal tubular epithelial cells. J Am Soc Nephrol 16: Jazayeri M, Andreyev A, Will Y, Ward M, Anderson CM, Clevenger 667–675. W. (2003). Inducible expression of a dominant negative DNA Terada S, Goto M, Kato M, Kawanaka K, Shimokawa T, Tabata I. polymerase-gamma depletes mitochondrial DNA and produces a (2002). Effects of low-intensity prolonged exercise on PGC-1 rho0 phenotype. J Biol Chem 278: 9823–9830. mRNA expression in rat epitrochlearis muscle. Biochem Biophys Jeng JY, Yeh TS, Lee JW, Lin SH, Fong TH, Hsieh RH. (2008). Res Commun 296: 350–354. Maintenance of mitochondrial DNA copy number and expression Unterluggauer H, Hutter E, Viertler HP, Jansen-Durr P. (2008). are essential for preservation of mitochondrial function and cell Insulin-like growth factor-induced signals activate mitochondrial growth. J Cell Biochem 103: 347–357. respiration. Biotechnol J 3: 813–816. Jones RG, Plas DR, Kubek S, Buzzai M, Mu J, Xu Y et al. (2005). Van Dyck E, Jank B, Ragnini A, Schweyen RJ, Duyckaerts C, AMP-activated protein kinase induces a p53-dependent metabolic Sluse F et al. (1995). Overexpression of a novel member of checkpoint. Mol Cell 18: 283–293. the mitochondrial carrier family rescues defects in both DNA Jones RG, Thompson CB. (2009). Tumor suppressors and cell and RNA metabolism in yeast mitochondria. Mol Gen Genet 246: metabolism: a recipe for cancer growth. Genes Dev 23: 537–548. 426–436.

Oncogene PNC1 regulates mitochondrial function and EMT C Favre et al 3976 Warburg O. (1956). On the origin of cancer cells. Science 123: its role as a master regulator of cellular metabolism. Cell Mol Life 309–314. Sci 65: 3737–3755. Will Y, Hynes J, Ogurtsov VI, Papkovsky DB. (2006). Analysis of Wu WS. (2006). The signaling mechanism of ROS in tumor mitochondrial function using phosphorescent oxygen-sensitive progression. Cancer Metastasis Rev 25: 695–705. probes. Nat Protoc 1: 2563–2572. Zhdanov AV, Ward MW, Prehn JH, Papkovsky DB. (2008). Witczak CA, Sharoff CG, Goodyear LJ. (2008). AMP-activated Dynamics of intracellular oxygen in PC12 cells upon stimulation protein kinase in skeletal muscle: from structure and localization to of neurotransmission. J Biol Chem 283: 5650–5661.

Supplementary Information accompanies the paper on the Oncogene website (http://www.nature.com/onc)

Oncogene