Necroptosis-Blocking Compound NBC1 Targets Heat Shock Protein 70 to Inhibit MLKL Polymerization and Necroptosis

Necroptosis-blocking compound NBC1 targets heat shock protein 70 to inhibit MLKL polymerization and necroptosis

Andrea N. Johnstona,b, Yuyong Mac,d, Hua Liua,e, Shuzhen Liua, Sarah Hanna-Addamsa, She Chenf, Chuo Chenc, and Zhigao Wanga,1

aDepartment of Molecular Biology, The University of Texas Southwestern Medical Center, Dallas, TX 75390; bDepartment of Veterinary Clinical Sciences, School of Veterinary Medicine, Louisiana State University, Baton Rouge, LA 70803; cDepartment of Biochemistry, The University of Texas Southwestern Medical Center, Dallas, TX 75390; dChemistry Service Unit (CSU), WuXi Apptec (Wuhan) Co., 430075 Hubei, China; eSchool of Pharmacy, Jiangxi University of Traditional Chinese Medicine, 330006 Nanchang, China; and fProteomics Center, National Institute of Biological Sciences, 102206 Beijing, China

Edited by Junying Yuan, Harvard Medical School, Boston, MA, and approved February 13, 2020 (received for review September 23, 2019) Necroptosis is a regulated necrotic cell death pathway involved in disulfide bond-dependent amyloid-like fibers, which are essential development and disease. Its signaling cascade results in the for necroptosis execution. An MLKL cysteine mutant that fails to formation of disulfide bond-dependent amyloid-like polymers of form a disulfide bond also fails to activate necroptosis efficiently. mixed lineage kinase domain-like protein (MLKL), which mediate Moreover, compound necrosulfonamide (NSA) covalently conju- proinflammatory cell membrane disruption. We screened compound gates cysteine 86 of human MLKL to block MLKL polymerization libraries provided by the National Cancer Institute and identified a and necroptosis without blocking tetramer formation, suggesting small-molecule inhibitor of necroptosis named necroptosis-blocking that tetramer formation is not sufficient for cell killing, while compound 1 (NBC1). Biotin-labeled NBC1 specifically conjugates polymers are necessary (22–24). However, how MLKL polymer to heat shock protein Hsp70. NBC1 and PES-Cl, a known Hsp70 formation is regulated is not known. substrate-binding inhibitor, block the formation of MLKL polymers, It is not surprising that molecular chaperone proteins have been but not MLKL tetramers in necroptosis-induced cells. In vitro, implicated in the necroptosis pathway, since many different recombinant Hsp70 interacts with the N-terminal domain (NTD) of

complexes form during the process. For example, heat shock BIOCHEMISTRY MLKL and promotes NTD polymerization, which has been shown to protein 90 (Hsp90) and its cochaperone CDC37 have been shown mediate the cell killing activity. Furthermore, the substrate-binding to be involved in necroptosis at different steps (25–29). Hsp90 is domain (SBD) of Hsp70 is sufficient to promote MLKL polymerization. an abundant and highly conserved molecular chaperone with a NBC1 covalently conjugates cysteine 574 and cysteine 603 of the SBD diverse set of client proteins, many of which are members of the to block its function. In addition, an SBD mutant with both cysteines kinome. Interactions are dependent on recognition of the kinase mutatedtoserineslosesitsability to promote MLKL polymerization. or pseudokinase domain by cochaperone CDC37. It has been Interestingly, knockdown of Hsp70 in cells leads to MLKL destabiliza- reported that the Hsp90/CDC37 complex interacts with RIPK3 tion, suggesting that MLKL might also be a client protein of Hsp70. and is required for RIPK3 activation. Chemical inhibition of In summary, using NBC1, an inhibitor of necroptosis, we identi- Hsp90 prevents RIPK1 interaction with RIPK3 and blocks phos- fied Hsp70 as a molecular chaperone performing dual functions in phorylation of RIPK3 and MLKL, abrogating necroptosis (25, 27). necroptosis. It stabilizes MLKL protein under normal condition and promotes MLKL polymerization through its substrate-binding domain during necroptosis. Significance

necroptosis | MLKL | Hsp70 | NBC1 | polymerization Necroptosis is a regulated form of necrotic cell death implicated in many human diseases, including infection, inflammation, neurodegeneration, and cancer. TNF-induced necroptosis results ecroptosis is a regulated immunogenic necrotic cell death in the formation of MLKL tetramers, which further polymerize to process (1). Morphologically, it is characterized by organelle N form disulfide bond-dependent amyloid-like fibers to promote swelling, plasma membrane rupture, and release of damage- cell death. Here we report the identification of a necroptosis- associated molecular patterns (DAMPs). It has been implicated in blocking compound, NBC1, which covalently conjugates two a variety of pathological conditions, including infection, inflamma- cysteines of chaperone Hsp70. Importantly, Hsp70 requires these tion, ischemic injuries, cancer, and neurodegeneration (2–7). two cysteines to promote polymerization of MLKL tetramers A multitude of pathophysiologic stimuli have been shown to in an ATP-independent manner. NBC1 blocks MLKL polymeriza- induce necroptosis, including death ligands, such as tumor ne- α α tion and subsequent cell death. This work reinforces the impor- crosis factor (TNF ), Fas ligand, or TNF-related apoptosis tance of MLKL polymer formation and identifies chaperone inducing ligand (TRAIL), or pathogen recognition receptors, Hsp70 as an obligatory facilitator for MLKL polymerization, such as Toll-like receptors 3 and 4 (TLR3, TLR4) or Z-DNA- – providing further insights for intervention of necroptosis- binding protein 1 (ZBP1/DAI) (2 7). The best studied pathway associated diseases. is TNFα-mediated necroptosis. Following TNF binding to its receptor and concurrent inhibition of caspase 8, receptor inter- Author contributions: A.N.J., C.C., and Z.W. designed research; A.N.J., Y.M., H.L., S.L., acting protein kinases 1 and 3 (RIPK1/3) interact through their S.H.-A., S.C., and Z.W. performed research; Y.M. and C.C. contributed new reagents/ana- RIP homotypic interaction motif (RHIM), activate via phos- lytic tools; A.N.J., Y.M., C.C., and Z.W. analyzed data; and A.N.J. and Z.W. wrote the paper. phorylation, and form an amyloid-like structure (8–13). RIPK3 The authors declare no competing interest. recruits mixed lineage kinase domain-like protein (MLKL) to This article is a PNAS Direct Submission. form the necrosome (14, 15). Phosphorylation of MLKL by Published under the PNAS license. RIPK3 induces a conformational change of MLKL, causing 1To whom correspondence may be addressed. Email: [email protected]. MLKL to form tetramers and translocate to the membrane This article contains supporting information online at https://www.pnas.org/lookup/suppl/ fractions, resulting in cell death (16–21). Recently, we demon- doi:10.1073/pnas.1916503117/-/DCSupplemental. strated that MLKL tetramers further polymerize to form

www.pnas.org/cgi/doi/10.1073/pnas.1916503117 PNAS Latest Articles | 1of10 Downloaded by guest on September 23, 2021 Hsp90/CDC37 also interacts with MLKL to promote MLKL olig- A NBC1 B HT-29 cells (T/S/Z) omerization and membrane translocation (26). Interestingly, Hsp90 120 inhibitors prevent necroptosis induced by TNF, but fail to block EC 100 50 necroptosis induced by the overexpression of the N-terminal do- 80 main (NTD) of MLKL (26). Through an unbiased small-molecule screen, we have identi- 60 fied a chemical inhibitor of necroptosis that targets an additional 40 molecular chaperone, heat shock protein 70 (Hsp70). Hsp70 C Cell Survival (%) 20 stabilizes MLKL and promotes MLKL polymerization. Unlike 0 0 0.1 0.3 1 3 10 30 Hsp90, Hsp70 interacts with the NTD of MLKL, and inhibition NBC1 concentration (M) of Hsp70 blocks necroptosis induced by the dimerization of the NTD. This work highlights the complex and important role of NTD-DmrB cells (D/Z) D L929 cells (T/Z) heat shock proteins in necroptosis. 120 120 EC EC 100 50 100 50 Results 80 80 Identification of Necroptosis-Blocking Compound NBC1. We per- 60 60 formed a forward small-molecule screen using libraries provided ’ 40 40

Cell Survival (%) by the National Cancer Institute s Developmental Therapeutics Cell Survival (%) Program Open Chemical Repository to identify inhibitors of 20 20 TNFα-induced necroptosis. Using a phenotypic cell death assay, 0 00 0 0.1 0.3 1 3 10 30 0 0.1 0.3 1 3 10 30 NBC1 concentration (M) 2,675 small molecules were evaluated. We initiated the screen with NBC1 concentration (M) NBC1 concentration (M) the colon cancer cell line HT-29, which undergoes TNFα-mediated necroptosis using conventional stimuli: TNFα (T) to activate Fig. 1. Identification of a necroptosis-blocking compound, NBC1, from the TNFR1, Smac mimetic (S) to inhibit cIAP-mediated ubiquitination NCI Open Chemical Repository Collection. (A) Chemical structure of NBC1. Potential Michael acceptor sites are labeled with a red asterisk. (B) NBC1 of RIPK1, and ZVAD-FMK (Z), the pan-caspase inhibitor (10). – α RIPK1 inhibitor necrostatin-1 (Nec-1) and MLKL inhibitor NSA dose response curve in HT-29 cells. Necroptosis was induced with TNF (20 ng/mL), Smac mimetic (100 nM), and ZVAD-FMK (20 μM), abbreviated were used as positive controls (9, 14, 30). Successful candidate as T/S/Z. Cells were treated for 16 h, and cell viability was measured by compounds from the primary screen were further tested in NTD- the CellTiter-Glo assay. Viable cells expressed as a percentage of dimethyl DmrB cells, which stably express a tet-inducible truncated MLKL sulfoxide (DMSO)-treated cells. Data are presented as mean ± SD of tech- transgene containing the N-terminal domain (NTD; amino acids 1 to nical triplicates. Identical concentrations of T/S/Z were used in the following 190) fused to a chemically induced dimerization domain (DmrB) experiments unless otherwise indicated. (C, Top) Domain structures of MLKL with C-terminal 3×FLAGtag(22).UsingNTD-DmrBcellsbypasses and NTD-DmrB, which is the N-terminal domain (NTD) of MLKL (amino acids the proximal necroptosis signaling cascade and identifies inhibitors 1 to 190) fused to a chemically induced dimerization domain (DmrB) with × – that act downstream of MLKL dimerization. A third-tier assay used 3 FLAG-tag at the C terminus. (C, Lower) NBC1 dose response curve in NTD- mouse fibroblast L929 cells. Because cysteine 86 targeted by NSA is DmrB cells. Necroptosis was induced with dimerizer and ZVAD-FMK (D/Z). Mus musculus Cells were treated for 6 h, and cell survival was assessed by the CellTiter-Glo not conserved in the MLKL homolog, NSA is in- assay. Viable cells expressed as a percentage of DMSO-treated cells. Data are effective in murine cells (14), ensuring that any novel MLKL in- presented as mean ± SD of technical triplicates. Identical concentrations of hibitors would have a mechanism unique from NSA. From the D/Z were used in following experiments. (D) NBC1 dose–response curve in tiered screen, a single small molecule effectively blocked nec- mouse fibrosarcoma L929 cells. Necroptosis was induced with TNFα (5 ng/mL) roptosis in all cell lines. It was originally named NSC632841 in and ZVAD-FMK (T/Z). Cells were treated for 16 h, and cell viability was PubChem, with an International Union of Pure and Applied measured by the CellTiter-Glo assay. Viable cells expressed as a percentage Chemistry (IUPAC) name of (3E,5E)-3,5-dibenzylidene-1-prop- of DMSO-treated cells. Data are presented as mean ± SD of technical trip- 2-enoylpiperidin-4-one (Fig. 1A). We renamed it NBC1 for licates. Identical concentrations were used in the following experiments unless otherwise indicated. “necroptosis-blocking compound 1.” NBC1 had variable EC50 values in HT-29 (0.72 μM), NTD-DmrB (3.4 μM), and L929 cells μ (8.6 M), which may reflect cell type and species differences more than 10 times higher in a stable line than in the NTD-DmrB B–D (Fig. 1 ). line (Fig. 2D, compare lanes 1 and 6), about 40% of cells could be induced to undergo necroptosis (Fig. 2E). NBC1 was still pro- NBC1 Requires Michael Acceptors to Block Necroptosis, but Does Not high α β tective in the NTD-4CS-DmrB cells, indicating that it did not Target the Cysteines of NTD. NBC1 contains three , -unsaturated E enone moieties, presumably acting as Michael acceptors, which target any cysteine moiety in the NTD-DmrB protein (Fig. 2 ). are highly reactive and known to covalently conjugate active NBC1 Specifically Conjugates Hsp70. To identify the molecular target cysteines in target proteins (31). We have shown previously that of NBC1, biotinylated NBC1 (biotin-NBC1) and negative analog NSA contains two Michael acceptors, both of which are required (biotin-NBC1-D3) were generated (Fig. 3A). Biotin-NBC1 main- to efficiently conjugate cysteine 86 of human MLKL (10, 23). tained its ability to block necroptosis but required a higher con- NBC1 analogs with different amounts of Michael acceptors were B generated to perform structure–activity relationship studies (Fig. centration (Fig. 3 ). Following treatment of NTD-DmrB cells 2A). Compounds with two Michael acceptors (NBC1-D1, NBC1- with increasing concentrations of biotin-NBC1, a unique avidin- ∼ C D2) retained significant activity, while compound NBC1-D3 with positive band was identified at 72 kDa (Fig. 3 ,arrowhead). – only one Michael acceptor lost all activity (Fig. 2B). This result Streptavidin precipitation of biotin-NBC1 treated NTD-DmrB D suggests that at least two Michael acceptors are required for cell lysates isolated this 72-kDa protein (Fig. 3 ,arrowhead). NBC1 to block necroptosis. When the target site of NSA, cys- Mass spectrometry identified the labeled protein as the molecular teine 86 of human MLKL, was mutated to serine in the NTD- chaperone heat shock protein 70 (Hsp70; HSPA1A). This in- C86S-DmrB cells, NSA no longer inhibited necroptosis, while teraction was confirmed in biotin-NBC1–treated NTD-DmrB NBC1 still did (Fig. 2C). We have shown previously that the cells (Fig. 3E). Notably, MLKL was not identified in the mass NTD-4CS-DmrB mutant with all four cysteines (C18, C24, C28, spectroscopy analysis, nor did MLKL interact with biotin- and C86) mutated to serines does not activate necroptosis effi- NBC1 in vivo. The conjugation was covalent, as boiling failed ciently (22). However, when NTD-4CS-DmrB was expressed to disrupt biotin-NBC1 binding to Hsp70 in vivo (Fig. 3E)or

2of10 | www.pnas.org/cgi/doi/10.1073/pnas.1916503117 Johnston et al. Downloaded by guest on September 23, 2021 NBC1 NBC1-D1 NTD-DmrB cells (D/Z) A B 120 * 100

80 * * 60 *

40 * NBC1-D2 NBC1-D3 Cell Survival (%) *

0 conc 0 1 3 10 1 3 10 1 3 10 1 3 10 (M) NBC1 NBC1-D1 NBC1-D2 NBC1-D3

NTD-DmrB NTD-C86S-DmrB E NTD-4CS-DmrBhigh C (D/Z) (D/Z) (D/Z) 120 * 120 * * 100 * 100

high 80 D NTD-4CS-DmrB NTD-DmrB 80 lysate (g): 2.5 5 10 20 20 40 60 60 FLAG 43 40 (NTD-DmrB) 40

Cell Survival (%) 20 LDH 34 Cell Survival (%) 20 1 2 3 4 5 6 NSA NSA NSA NBC1 NBC1 NBC1 DMSO DMSO DMSO

Fig. 2. NBC1 requires Michael acceptors for its function, but does not target the cysteines of MLKL. (A) Chemical structures of NBC1 and its derivatives (NBC1-

D1, NBC1-D2, NBC1-D3). Potential Michael acceptor sites are labeled with red asterisks. (B) Dose–response curve of NBC1 and derivatives in NTD-DmrB cells BIOCHEMISTRY (*P < 0.05). (C) Necroptosis survival assay in NTD-DmrB and NTD-C86S-DmrB cells. The mutation of cysteine 86 to serine in the NTD-C86S-DmrB cells renders NSA ineffective (*P < 0.05). (D) Immunoblot comparison of MLKL expression in NTD-4CS-DmrBhigh and NTD-DmrB cells. NTD-4CS-DmrB has all four cysteines in NTD mutated to serines. Increasing amounts of whole-cell lysate were loaded as indicated for SDS/PAGE and subjected to Western blotting with FLAG and LDH antibodies. Both NTD-DmrB and NTD-4CS-DmrB are tagged with C-terminal 3×FLAG epitope. (E) Necroptosis survival assay in NTD-4CS-DmrBhigh cells (*P < 0.05).

recombinant human Hsp70 in vitro (Fig. 3F). Interestingly, higher of MLKL tetramer formation. NBC1 also did not affect membrane biotin-NBC1 concentrations resulted in lower signals in Hsp70 translocation of MLKL (Fig. 5C). To determine if Hsp70 could immunoblot (Fig. 3F, compare lanes 2, 4, and 6), suggesting that regulate polymerization of MLKL, we conducted semidenaturing biotin-NBC1 might block the antibody (BD 610608) binding to detergent agarose gel electrophoresis (SDD-AGE), which is widely its antigen, which is aa 429 to 640, containing its substrate used to detect SDS-resistant amyloid or amyloid-like polymers (38). binding domain (SBD). Furthermore, biotin-NBC1 did not NBC1 but not NBC1-D3 inhibited MLKL polymerization (Fig. 5D, SI Ap- conjugate another important chaperone Hsp90 in vitro ( lane 3), suggesting that Hsp70 is required for MLKL tetramers to pendix, Fig. S1A). further polymerize to form functional polymers (Fig. 5E). Similarly, Chemical Inhibition of Hsp70 with Known Inhibitor PES-Cl Blocks in NTD-DmrB cells, NBC1 did not inhibit D/Z-induced tetramer F G Necroptosis. Hsp70 has two highly conserved domains, an N- formation (Fig. 5 ) or membrane translocation (Fig. 5 ), but terminal nucleotide-binding domain (NBD), which regulates the blocked polymer formation (Fig. 5H), confirming the essential role affinity of substrate binding, and a C-terminal substrate-binding of Hsp70 in MLKL polymerization (Fig. 5I). Necroptotic cells ex- domain (SBD) (32–34) (Fig. 4A). In order to confirm a role for pose phosphatidylserine (PS) on the outer plasma membrane after Hsp70 in necroptosis, two chemical inhibitors with unique mecha- MLKLactivation(39).InbothHT-29andNTD-DmrBcells,NBC1 nismsofactionwereusedincelldeath assays. VER-155008 (VER), blocked signal-induced PS externalization, visualized by Annexin V- which acts as an ATP competitive inhibitor to block NBD function FITC staining (SI Appendix,Fig.S1B–E), indicating that NBC1 (35, 36), did not protect cells from necroptosis in any cell lines indeed inhibits MLKL activation. tested, including HT-29 cells, L929 cells, NTD-DmrB cells, and high NTD-4CS-DmrB cells. On the contrary, PES-Cl, which binds to Hsp70 Promotes MLKL Polymerization In Vitro. Previously, we have the SBD and disrupts interaction with substrate proteins (37), was developed a recombinant system to detect in vitro polymeriza- protective (Fig. 4 B–E). This suggests that blockade of Hsp70’sSBD tion of MLKL (22, 23). Next we examined how Hsp70 affects but not NBD is critical to its protective effect. Hsp70 inhibitors are MLKL polymerization. Recombinant GST-NTD readily inter- known to disrupt autophagy and induce accumulation of p62 olig- acted with Hsp70, which was blocked by NBC1, but not NBC1- omers. NBC1, but not its negative analog NBC1-D3, also induced D3 (Fig. 6A). At low concentration (0.1 μM), GST-NTD did not p62 aggregation and LC3-II accumulation (Fig. 4F), suggesting that from polymers after incubation (Fig. 6B, lane 1). Coincubation it indeed inhibits Hsp70. with Hsp70, but not bovine serum albumin (BSA), greatly en- B Inhibition of Hsp70 by NBC1 Blocks MLKL Polymerization. Next, we hanced GST-NTD polymerization (Fig. 6 , lane 2 and 3). examined at which step inhibition of Hsp70 blocks necroptosis. In Adding ATP to the reaction had no effect (Fig. 6B, lanes 4, 5, HT-29 cells, T/S/Z-induced MLKL phosphorylation (Fig. 5A)and and 6), suggesting that NBD function is not required. Impor- MLKL tetramer formation (Fig. 5B)werenotaffectedby tantly, NBC1 but not NBC-D3 inhibited the effect of Hsp70 on cotreatment with NBC1, suggesting that Hsp70 functions downstream GST-NTD polymerization (Fig. 6C).

Johnston et al. PNAS Latest Articles | 3of10 Downloaded by guest on September 23, 2021 A B NTD-DmrB cells (D/Z) Biotin-NBC1 ** 80 *

* 40 Biotin-NBC1-D3

* Cell Survival (%) 20

0 conc 0 10 30 10 30 (M) Biotin- Biotin- NBC1 NBC1-D3 monoavidin C D precipitation E Biotin-NBC1 Biotin-NBC1 (M) Biotin-NBC1 - + - + Hsp70 -72 0 5 10 15 20 30 monoavidin 180 precipitation FLAG -43 180- 130 (NTD-DmrB) 130- 95- 95 Hsp70 -72 Hsp70 Input 72- 72 FLAG -43 55- (NTD-DmrB) 55 43- 43 Hsp70 (350 nM) 34 F 34- Biotin-NBC1(nM) 0 1 0 10 0 25 0 26 26- Biotin-NBC1-D3 (nM) 0 0 1 0 10 0 25 17 Avidin-HRP -72 Hsp70 -72 Avidin-HRP silver staining 1 2 3 4 5 6 7

Fig. 3. NBC1 specifically conjugates Hsp70. (A) Chemical structures of biotinylated NBC1 (biotin-NBC1) and its negative analog (biotin-NBC1-D3). Potential Michael acceptor sites are labeled with red asterisks. (B) Necroptosis survival assay in NTD-DmrB cells. Cells were treated as in Fig. 1C (*P < 0.05). (C) Iden- tification of a unique biotin-NBC1–conjugated protein. NTD-DmrB cells were treated with increasing concentrations of biotin-NBC1 for 16 h. Whole-cell lysates were separated by SDS/PAGE, followed by avidin-HRP Western blotting. (D) Identification of Hsp70 as an NBC1 target protein. NTD-DmrB cells were treated with or without biotin-NBC1, and biotin-labeled proteins were precipitated with monoavidin beads as described in Materials and Methods. Eluates were separated by SDS/PAGE followed by silver staining. The band marked by the arrow was excised for mass spectrometry and identified as Hsp70. (E) NTD- DmrB cells were treated with DMSO or biotin-NBC1 (20 μM), and 1 mg of whole-cell lysates were subjected to monoavidin bead precipitation. Eluates and 20 μg whole-cell lysates were subjected to Western blotting with antibodies against FLAG and Hsp70 (Enzo, ADI-SPA-812). (F) In vitro conjugation assay. Recombinant human Hsp70 (350 nM) was incubated with increasing concentrations of biotin-NBC1 or biotin-NBC1-D3 overnight at 4 °C. Samples were boiled in SDS loading buffer and subjected to Western blotting with avidin-HRP and Hsp70 antibody (BD no. 610608).

Cysteines 574 and 603 of Hsp70 Are Targeted by NBC1. When Hsp70 inhibited necroptosis (Fig. 7D), and endogenous MLKL recombinant NBD and SBD were examined in the in vitro poly- level also decreased (Fig. 7E). Furthermore, when Hsp70 was merization assay, SBD, but not NBD, promoted GST-NTD poly- knocked down with a short hairpin RNA (shHsp70) in HT-29 merization, similar to the full-length Hsp70 (Fig. 6 D and E). There cells, necroptosis was inhibited and again MLKL level decreased are two cysteines (C574 and C603) in the SBD, which localize in the (Fig. 7 F and G). These results suggest that MLKL is likely a client α-helical lid subdomain. When the two cysteines were mutated to protein of Hsp70 and loss of Hsp70 protein results in de- serines in the SBD, the binding affinity of biotin-NBC1 with the stabilization of MLKL. Due to the high sequence homology be- mutant proteins drastically decreased, especially with the dou- tween Hsp70 and the constitutively expressed Hsc70, we next ble mutant C574S/C603S (Fig. 6F). Furthermore, the C574S/ assessed the role of Hsc70. Knockdown of Hsc70 did not protect C603S mutant completely lost the ability to activate GST-NTD against necroptosis and did not decrease MLKL expression (Fig. 7 polymer formation (Fig. 6G, lane 6), suggesting that these two H and I), suggesting that this effect is specific to Hsp70. In- cysteines in the SBD are essential for promoting MLKL poly- terestingly, when Hsp70’s cochaperone heat shock protein 40 merization (Fig. 6H). (Hsp40; DNAJB1) was silenced, necroptosis was not affected and MLKL level did not decrease (SI Appendix,Fig.S1F and G), Hsp70 Knockdown Blocks Necroptosis and Destabilizes MLKL. Heat suggesting that an alternate Hsp70 cochaperone might be involved shock protein 70 is an inducible molecular chaperone responsible in maintaining MLKL stability. for protein folding and stability (32, 33). In order to evaluate whether reduction of Hsp70 inhibited necroptosis, Hsp70 was si- Discussion lenced with small interfering RNA (siRNA). Concurrent treat- Previously we have reported that MLKL forms disulfide bond- ment with the pan-caspase inhibitor ZVAD-FMK was required to dependent amyloid-like polymers to activate necroptosis (22). block apoptosis induced with Hsp70 knockdown. In NTD-DmrB However, how MLKL polymer formation is regulated is not well cells, knockdown of Hsp70 with two different siRNA oligos ef- understood. In this study, using a necroptosis-blocking com- fectively blocked necroptosis (Fig. 7A). However, Hsp70 knock- pound, NBC1, we identified chaperone Hsp70 as an obligatory down also resulted in NTD-DmrB protein level decrease (Fig. facilitator for MLKL polymerization. NBC1 contains three Mi- 7B). Quantitative PCR revealed that mRNA level of NTD-DmrB chael acceptors, which could covalently conjugate highly reactive was not reduced by Hsp70 knockdown, indicating that the de- cysteines in target proteins. Structure–activity studies revealed crease of NTD-DmrB protein is posttranscriptional (Fig. 7C). that NBC1 required at least two Michael acceptors to effectively Since NTD-DmrB is a transgene, endogenous MLKL was exam- block necroptosis. With a series of in vitro and cell-based assays, ined next. In HeLa cells stably expressing RIPK3, knockdown of we identified chaperone Hsp70 as its direct target. Mutagenesis

4of10 | www.pnas.org/cgi/doi/10.1073/pnas.1916503117 Johnston et al. Downloaded by guest on September 23, 2021 A BC HT-29 cells (T/S/Z) L929 cells (T/Z) 100 * * 100 * * 80 80 * * 60 60 1 385 390 616 Hsp70: 40 40

Cell Survival (%) 20 Cell Survival (%) 20 VER PES-Cl conc conc 0 10 10 20 10 20 0 10 10 20 10 20 (M) (M) NBC1 PES-Cl VER NBC1 PES-Cl VER

DENTD-DmrB cells (D/Z) NTD-4CS-DmrBhigh cells (D/Z) F DMSO PES-Cl NBC1 NBC1-D3 120 120 * p62 * * * * aggregates 100 100 * 180- 130- IB: p62 80 80 95- 60 60 72- 40 40 monomer 55-

Cell Survival (%) Cell Survival (%) 20 20 IB: LDH 34- conc conc 0 10 10 20 10 20 0 10 10 20 10 20 LC3-I (M) (M) 17- NBC1 PES-Cl VER NBC1 PES-Cl VER LC3-II 1 2 3 4

Fig. 4. Known Hsp70 inhibitor PES-Cl blocks necroptosis. (A) Diagram of Hsp70 domain structure. Hsp70 contains a nucleotide-binding domain (NBD) at amino acids 1 to 385 and a substrate-binding domain (SBD) at amino acids 390 to 616. Compound VER-155008 (VER) inhibits NBD through ATP competition, and compound PES-Cl blocks substrate binding. (B) Necroptosis survival assay in HT-29 cells. X-axis represents the concentration of compounds (*P < 0.05). (C) Necroptosis survival assay in L929 cells (*P < 0.05). (D) Necroptosis survival assay in NTD-DmrB cells (*P < 0.05). (E) Necroptosis survival assay in NTD-4CS- DmrBhigh cells (*P < 0.05). (F) NBC1 effect on p62 aggregation and LC3 accumulation. NTD-DmrB cells were treated with DMSO, PES-Cl (10 μM), NBC1 (10 μM), or NBC1-D3 (10 μM) for 16 h. Cell lysates were subjected to Western blotting with p62, LDH, and LC3 antibodies. BIOCHEMISTRY experiments further demonstrated that cysteines 574 and 603 of G). Furthermore, the NBD inhibitor VER-155008 did not block Hsp70 were covalently conjugated by NBC1. Hsp70 markedly necroptosis, while SBD inhibitors NBC1 and PES-Cl blocked promoted the efficiency of MLKL in vitro polymerization, and MLKL polymerization and necroptosis (Figs. 4 and 5). Finally, this activity was inhibited by NBC1. Importantly, NBC1 blocked knockdown of the Hsp70 cofactor Hsp40, which stimulates Hsp70’s MLKL polymerization and necroptosis in living cells. ATPase activity, had no effect on necroptosis (SI Appendix,Fig. Our results confirm the previous finding that disulfide bond- S1F). These results suggest that Hsp70 uses its SBD to bind MLKL dependent MLKL polymer formation is required for nec- tetramers and promote MLKL polymerization without requiring roptosis. First, NTD-4CS-DmrB requires more than 10 times NBD function. Second, cysteines 574 and 603 of the SBD are im- overexpression to achieve about half of the cell killing activity portant for Hsp70 to promote MLKL polymerization, while these of wild-type NTD-DmrB protein (Fig. 2 C–E), suggesting that cysteines have not been reported to be important for its disulfide bond formation is important for MLKL function. aggregation-prevention and disassembling function. The SBD is Second, compounds that block MLKL polymerization also block divided into two subdomains, a two-layer β-sandwich, containing the necroptosis, although they might employ different mechanisms. peptide binding pocket, and α-helical lid subdomain, composed of For example, NSA conjugates cysteine 86 of MLKL, while NBC1 five helices. Both cysteine residues are located in the α-helical lid conjugates cysteines 574 and 603 of Hsp70 to block MLKL poly- domain (amino acids 508 to 641), which regulates the kinetics of merization. Interestingly, neither NSA nor NBC1 blocks MLKL substrate binding and can induce conformational changes in the tetramer formation, suggesting that formation of MLKL tetramers bound substrate (32, 33). The lid does not need to fold over the is not sufficient for cell killing, while MLKL polymer formation substrate, allowing great flexibility for multiple sizes of substrate to is required. bind (34). Our results show that NBC1 directly conjugated cysteines The best known function of Hsp70 is to facilitate proteins 574 and 603 to block Hsp70’s ability to promote MLKL polymeri- folding into their native state by transiently interacting with short zation (Fig. 6F). Moreover, recombinant SBD with these two cys- hydrophobic peptide segments to prevent aggregation or to refold teines mutated to serines lost its ability to activate MLKL aggregated proteins. This is extensively studied in pathological polymerization (Fig. 6G). It is very interesting that the two cysteines amyloid assembly and disassembly (40–42). For instance, Hsp70 in of Hsp70 play a vital role for promoting MLKL polymerization, combination with Hsp110 and Hsp40 can function as disaggregase given the fact that MLKL polymer formation depends on proper to disassemble Parkinson’s-linked α-synuclein amyloid fibrils to disulfide bond formation among its tetramer subunits. nontoxic monomers or small oligomers (41). However, in the case These results lead us to propose the following working hy- of MLKL, Hsp70 serves to promote polymerization rather than pothesis for how Hsp70 promotes MLKL polymerization (Fig. disassemble the polymers, suggesting a unique mechanism. 6H). Phosphorylation of MLKL induces its conformational There are at least two major differences between the aggregation- changes to form disulfide bond-dependent tetramers. Hsp70 prevention and disassembling function of Hsp70 and its MLKL interacts with exposed short hydrophobic peptides in the newly polymerization-promoting function. First, our results indicate that formed tetramer, and uses cysteines 574 and 603 to protect and Hsp70 promotes MLKL polymerization in an ATP-independent maybe activate other cysteines in the tetramer. Binding of Hsp70 manner, while ATP binding and hydrolysis by the NBD are essential with the tetramer could also shield the tetramer from the re- for Hsp70’s substrate binding and release cycle to perform its ducing power of thioredoxin 1, which we have previously shown aggregation-prevention and disassembling function (32, 33). For directly interacts with MLKL and keeps MLKL in a reduced MLKL, addition of ATP had no effect for Hsp70-assisted in vitro state (23). The Hsp70-associated MLKL tetramer is then de- polymerization (Fig. 6B). Additionally, SBD alone was suffi- livered to the growing MLKL polymer and forms proper disul- cient to promote MLKL in vitro polymerization (Fig. 6 E and fide bonds with the polymer. Once the tetramer incorporates into

Johnston et al. PNAS Latest Articles | 5of10 Downloaded by guest on September 23, 2021 A HT-29 cells B HT-29 cells C HT-29 cells cytosol membrane

DMSO DMSO NBC1 NBC1-D3 DMSO DMSO NBC1 NBC1-D3 T/S/Z - + ++ T/S/Z - + ++ DMSO DMSO NBC1 NBC1-D3 DMSO DMSO NBC1 NBC1-D3 p-MLKL -55 Tetramer T/S/Z - + ++ - + ++ 180- MLKL -55 MLKL 55 LDH IB: MLKL -34 130 LAMP1 1 2 3 4 95 34 HT-29 cells 14-3-3 55- Monomer 1 2 3 4 5 6 7 8 D 1 2 3 4 Non-reducing DMSO DMSO NBC1 NBC1-D3 NTD-DmrB cells T/S/Z - + ++ H SDD-AGE DMSO NBC1 NBC1-D3 IB: MLKL F NTD-DmrB cells DMSO DMSO DMSO D/Z D/Z D/Z SDD-AGE Polymer DMSO DMSO NBC1 NBC1-D3 IB: FLAG D/Z - + ++ (NTD-DmrB) 180- Tetramer 130- Polymer IB: FLAG Monomer 1 2 3 4 (NTD-DmrB) Non-reducing Monomer E 43- Monomer 43- IB: FLAG 1 2 3 4 5 6 (NTD-DmrB) 1 2 3 4 I

G NTD-DmrB cells cytosol membrane

DMSO DMSO NBC1 NBC1-D3 DMSO DMSO NBC1 NBC1-D3 D/Z - + ++ - + ++ 43 NTD-DmrB 34 130 LAMP1 95 34 14-3-3

1 2 3 4 5 6 7 8

Fig. 5. Hsp70 is required for MLKL polymer formation. (A) HT-29 cells were induced with or without T/S/Z for 6 h in the presence of DMSO, NBC1 (10 μM), or NBC1-D3 (10 μM). Whole-cell lysates were separated by SDS/PAGE and subjected to Western blotting with indicated antibodies. Antibody against phosho- ser358 of MLKL is labeled as p-MLKL. (B) HT-29 cells were treated as in A. Whole-cell lysates were separated by nonreducing SDS/PAGE and subjected to Western blotting with MLKL antibody. (C) HT-29 cells were treated as in A, and cytosol and crude membrane fractions were obtained. Western blotting was performed with indicated antibodies. LAMP1 is a lysosomal membrane protein, and 14–3-3 is a cytosolic protein. (D) HT-29 cells were treated as in A. Whole- cell lysates were separated by SDD-AGE and subjected to Western blotting with MLKL antibody. Under this condition, the MLKL monomer was barely de- tected, while the polymers presented a strong characteristic spread-out pattern in necroptotic samples. (E) Working model in HT-29 cells. Necroptosis induction promotes the formation of necrosome and MLKL tetramers. Hsp70 facilitates the polymerization of MLKL tetramers into functional polymers. Compound NBC1 inhibits Hsp70 SBD function to block MLKL polymer formation and necroptosis. (F) NTD-DmrB cells were induced with or without D/Z for 4 h in the presence of DMSO, NBC1 (10 μM), or NBC1-D3 (10 μM). Whole-cell lysates were separated by nonreducing SDS/PAGE (Upper) or reducing SDS/PAGE (Lower), followed by Western blotting with FLAG antibody. (G) NTD-DmrB cells were treated as in F, and cytosol and crude membrane fractions were obtained. Western blotting was performed with indicated antibodies. (H) NTD-DmrB cells were treated as in F. Whole-cell lysates were separated by SDD-AGE and subjected to Western blotting with FLAG antibody. (I) Working model in NTD-DmrB cells. Dimerizer induces the formation of NTD-DmrB tetramers. Hsp70 facilitates the polymerization of NTD-DmrB tetramers into functional polymers. Compound NBC1 inhibits Hsp70 SBD function to block MLKL polymer formation and necroptosis.

the polymer, it dissociates from Hsp70, possibly because of steric Knockdown of Hsp70 destabilized MLKL protein but did not hindrance, and the released Hsp70 will start a new cycle again. disrupt mRNA levels (Fig. 7), consistent with MLKL’s client This also explains why ATP is not needed for Hsp70 substrate protein status. Yet, inhibition of Hsp70 with NBC1 did not dissociation. More experiments are needed to test this hypothesis. significantly modulate MLKL protein levels in HT-29 or NTD- SI Appendix A B Promoting MLKL polymerization by Hsp70 is similar to a pre- DmrB cells up to 48 h ( , Fig. S2 and ). This may vious report that chaperones including Hsp70 could bind to toxic be due to the more profound effects of Hsp70 knockdown on Aβ oligomers and promote their assembly into larger, less toxic protein stability than chemical inhibition alone. In fact, in- 42 hibition of Hsp70 in silenced cells did not further decrease NTD- species. Interestingly, Hsp70 also functions equally effectively with DmrB protein level (SI Appendix, Fig. S2C). It is also possible or without ATP in that regard (43). Taken together, these ob- that NBC1 might not affect Hsp70 interaction with nascent servations suggest that, apart from its aggregation-prevention and MLKL protein during translation. Chemical inhibition of Hsp90 disassembling function, Hsp70 can promote polymerization of also does not consistently reduce levels of its client proteins small oligomers in an ATP-independent manner under specific RIPK1, RIPK3, or MLKL, and this is reportedly dependent on circumstances. Understanding the mechanism of this function specific inhibitors and the cell lines utilized (25–29). The per- might also provide more insights into pathological aggregation- centage of cell survival and effective concentration of NBC1 induced neurodegenerative diseases. varied between cell lines. Mouse L929 cells had a 10-fold higher

6of10 | www.pnas.org/cgi/doi/10.1073/pnas.1916503117 Johnston et al. Downloaded by guest on September 23, 2021 AB C

DE G H BIOCHEMISTRY

Fig. 6. Hsp70 promotes MLKL polymerization in vitro. (A) Immunoprecipitation with recombinant proteins. Recombinant Hsp70 (2 μM) was incubated overnight at 4 °C with DMSO, NBC1 (10 μM), or NBC1-D3 (10 μM) and then dialyzed against PBS buffer. Recombinant GST-NTD (C-terminal 3×FLAG-tagged) was then incubated with the treated Hsp70 samples and subjected to anti-FLAG immunoprecipitation, followed by Western blotting with Hsp70 antibody (Enzo, ADI-SPA-812). (B) In vitro MLKL polymerization assay. Recombinant GST-NTD (0.1 μM) was incubated alone, with Hsp70 (0.7 μM), or with BSA (0.7 μM) at room temperature for 3 h in the absence or presence of ATP (1 mM). The samples were separated by SDD-AGE (Upper) or SDS/PAGE (Middle), followed by Western blotting with FLAG antibody. Hsp70 and BSA were visualized by Coomassie blue staining (Lower). (C) Hsp70 was incubated with NBC1 and NBC1-D3 as described in A. GST-NTD (0.1 μM) was then incubated with BSA (0.7 μM) or treated Hsp70 (0.7 μM) at room temperature for 3 h. The samples were separated by SDD-AGE (Upper) or SDS/PAGE (Middle), followed by Western blotting with FLAG antibody. Hsp70 and BSA were visualized by Coomassie blue staining (Lower). (D) BSA, recombinant Hsp70, NBD, and SBD were visualized by Coomassie blue staining. (E) GST-NTD was incubated with BSA, Hsp70, NBD, and SBD as described in B. The samples were separated by SDD-AGE (Upper) or SDS/PAGE (Lower), followed by Western blotting with FLAG antibody. (F) Biotin-NBC1 or biotin-NBC1-D3 was incubated with the SBD and cysteine-to-serine mutants of the SBD (C574S, C603S, C574/603S), followed by Western blotting with avidin-HRP (Upper). Recombinant proteins were visualized by Coomassie blue stain (Lower). (G) GST-NTD was incubated with indicated recombinant proteins as in B. The samples were separated by SDD-AGE (Upper), and protein loading was visualized by Coomassie blue staining (Lower). (H) Working model. Hsp70 interacts with the NTD of MLKL tetramer and uses cysteine 574 and 603 to protect active cysteines in the tetramer, allowing new disulfide bonds to form properly between tetramers to promote polymerization.

EC50 than HT-29 cells, illustrating potential species and tissue dif- (46). However, the effects are variable in A549 (lung), T-47D ferences that may be relevant to Hsp70 regulation in necroptosis. (breast), and HT-29 (colon) cells, and cotreatment with JG-98, In transformed cells, antagonism of Hsp70 and its constitu- ZVAD-FMK, and NSA is not protective, suggesting cell line- tively active family member Hsc70 often leads to apoptotic cell specific differences (46). Similarly, VER and NBC1 treatment death (44, 45). Previous publications have shown a divergent caused moderate cell number reduction in both HT-29 and function for Hsp70 in necroptosis. Chemical inhibition of Hsp70 NTD-DmrB cells, which was not rescued by ZVAD-FMK and with the allosteric inhibitor JG-98 and analogs destabilizes NSA treatment, suggesting that the cytotoxicity of these Hsp70 RIPK1 regulators c-IAP1/2, XIAP, and cFLIPS/L, causing apo- inhibitors is not through apoptosis or necroptosis in these two ptosis, or necroptosis if caspases are inhibited, in breast cancer cell lines (SI Appendix, Fig. S3 A and B). Furthermore, both cell lines (MDA-MB-231, MCF7, SK-BR-3) and Jurkat cells compounds did not induce detectable degradation of c-IAP1/2 or

Johnston et al. PNAS Latest Articles | 7of10 Downloaded by guest on September 23, 2021 ABNTD-DmrB cells (D/Z) NTD-DmrB cells C NTD-DmrB cells 120 Hsp70 NTD-DmrB 1.6 mRNA mRNA 100 * 1.4 * 1.2 80 siLuc siMLKLsiHsp70-1siHsp70-2 1 * Hsp70 -72 60 0.8 FLAG -43 (NTD-DmrB) level mRNA 0.6 40

Cell Survival (%) -55 0.4 * β-tubulin * 20 1 2 3 4 0.2 0

siLuc siLuc

siLuc siHsp70-1siHsp70-2 siHsp70-1siHsp70-2 siMLKL siHsp70-1siHsp70-2

DFHeLa/TO-RIPK3 cells (T/S/Z) E HeLa/TO-RIPK3 cells 100 * 120 * * siLuc siHsp70-1 80 100 * * 80 60 ZVAD T/S/Z ZVAD T/S/Z 60 Hsp70 -72 40 MLKL -55 40 20 RIPK3 -95 Cell Survival (%) Cell Survival (%) 20 0 LDH -34 0 1 2 3 4 HT-29

siLuc shHsp70.1shHsp70.2 siMLKL siHsp70-1siHsp70-2 H 120 NTD-DmrB cells (D/Z)

100 * I NTD-DmrB cells

80 G 60 HT-29shHsp70.1shHsp70.2 siLuc siHsc70-1siHsc70-2siHsc70-3 40 Hsp70 -72 Cell Survival (%) Hsc70 -72 20 FLAG -43 MLKL -55 (NTD-DmrB) β-tubulin -55 LDH -34 siLuc siMLKL siHsc70-1 siHsc70-2 siHsc70-3

Fig. 7. Hsp70 knockdown destabilizes MLKL. (A) NTD-DmrB cells were transfected with siRNAs against luciferase, MLKL, or Hsp70 for 72 h. Cells were then treated with D/Z to induce necroptosis for 6 h, followed by the CellTiter-Glo assay (*P < 0.05). (B) NTD-DmrB cells were transfected with siRNAs as in A. Cell lysates were subjected to Western blotting with Hsp70, FLAG, and β-tubulin antibodies. (C) NTD-DmrB cells were transfected with siRNAs as in A. The mRNA level of Hsp70 and NTD-DmrB is assessed by qPCR. All mRNA expression is normalized to actin, and siLuc is set to 1. Data are presented as mean ± SD of triplicate wells (*P < 0.05). (D) HeLa/TO-RIPK3 cells were transfected with siRNAs as in A. Cells were treated with T/S/Z to induce necroptosis for 16 h, followed by the CellTiter-Glo assay (*P < 0.05). (E) HeLa/TO-RIPK3 cells were transfected with siRNA and treated as in D. Cell lysates were subjected to Western blotting with Hsp70, MLKL, RIPK3, and LDH antibodies. (F) HT-29 cells were transduced with lentivirus harboring shRNA against Hsp70 and selected for 5 d. Parental cells as well as two different pools of knockdown cells (shHsp70.1 and shHsp70.2) were induced with T/S/Z for 16 h, followed by the CellTiter-Glo assay (*P < 0.05). (G) Hsp70 knockdown was performed as in F, and Western blotting was performed with Hsp70, MLKL, and LDH antibodies. (H) NTD-DmrB cells were transfected with indicated siRNAs for 72 h. Cells were treated with D/Z to induce necroptosis for 6 h, followed by the CellTiter-Glo assay (*P < 0.05). (I) NTD- DmrB cells were transfected with indicated siRNAs for 72 h, followed by Western blotting with Hsc70, FLAG, and β-tubulin antibodies.

XIAP in HT-29 cells (SI Appendix, Fig. S3C). These results inhibitor 17-AAG is unable to block necroptosis induced by NTD- suggest that Hsp70 inhibition-induced cytotoxicity is compound- DmrB expression, while Hsp70 inhibitor NBC1 could (SI Ap- specific and cell line-specific. Interestingly, NBC1 and PES-Cl pendix,Fig.S4). These results suggest that Hsp90/CDC37 and attenuated apoptosis induced by cotreatment of TNF and TAK1 Hsp70 might actually cooperate and function in sequential inhibitor 5Z-7, while VER had no apparent effect (SI Appendix, order to promote necroptosis. Hsp90 interacts with RIPK3 Fig. S3 D–G), suggesting that SBD, but not NBD, might be in- through its cochaperone CDC37 and assists RIPK3 with MLKL volved in activating apoptosis. Since caspase-8 activation re- phosphorylation. Hsp90/CDC37 then binds the pseudokinase do- quires its tandem death-effector domain (tDED) to assemble main of MLKL and facilitates phosphorylated MLKL in tetramer into filament structure (47), it is tempting to speculate that formation. Subsequently, Hsp70 interacts with the NTD of MLKL Hsp70 might also be involved in the polymerization of caspase-8, tetramers and promotes MLKL tetramers to further polymerize, similar to its role in facilitating MLKL polymerization. Future leading to eventual cell death. Many important questions remain experiments will be needed to address this possibility. regarding MLKL polymerization and cell death induction. What In the context of necroptosis, the role of Hsp70 is distinct from role does membrane association play in MLKL polymerization? Hsp90. The Hsp90/CDC37 complex often associates with kinases Does it need recruiting factors on the membrane other than lipids? through recognition of the kinase domain by CDC37. They in- Most interestingly, how do MLKL polymers rupture membranes? deed bind both RIPK3 and MLKL and facilitate MLKL tetramer Materials and Methods – formation (25 29). On the contrary, Hsp70 associates with the General Reagents. Screening compounds were obtained from the National NTD of MLKL tetramers and promotes polymerization. Moreover, Cancer Institute (NCI)/Division of Cancer Treatment and Diagnosis (DCTD)/ inhibition of Hsp90 blocks MLKL tetramer formation (25–27), Developmental Therapeutics Program (DTP; https://dtp.cancer.gov/). The Chuo which is not affected by Hsp70 inhibitors (Fig. 5). Importantly, Hsp90 Chen lab synthesized NBC1 analogs and biotinylated compounds (SI Appendix,

8of10 | www.pnas.org/cgi/doi/10.1073/pnas.1916503117 Johnston et al. Downloaded by guest on September 23, 2021 Supplemental Material and Methods). Recombinant human TNFα,Smac- immediately neutralized with 6 μL of 1 M Tris, pH 7.4. All procedures were mimetic, and anti-RIPK3 antibody were prepared as previously described (10). done at 4 °C. The following reagents and antibodies were used: ZVAD-FMK (ApexBio), For crude membrane fractionation, cell pellets were resuspended in five

dimerizer (Clonetech, no. 635058), necrosulfonamide and PES-Cl (Millipore), VER- volumes of buffer A (20 mM Tris, pH 7.4, 10 mM KCl, and 1 mM MgCl2)and 155008, anti-FLAG M2 antibody and affinity gel (Sigma), anti-human MLKL incubated on ice for 20 min. The cells were passed through a 22-G needle 30 (GeneTex, GTX107538), anti–phospho-S358 of MLKL (Abcam, ab187091), anti- times and centrifuged at 500 × g for 10 min. The supernatant was centri- RIPK1 (BD, no. 551042), anti-lactate dehydrogenase (LDH) (Abcam, ab53292), fuged again at 20,000 × g for 10 min and saved as cytosol fraction. The pellet anti-Hsp70 (BD, no. 610608; Enzo, ADI-SPA-812-F), anti-Hsp40 (Cell Signaling, no. was extracted with lysis buffer and centrifuged at 20,000 × g for 10 min and 4868), anti-Hsc70 (Santa Cruz, K-19), anti-p62 (Santa Cruz, SC-28359), anti-LC3 saved as crude membrane fraction. (Cell Signaling, no. 4108), anti-LAMP1 (Santa Cruz, SC-17768), anti-14–3-3 (Santa Cruz, SC-629), anti–c-IAP1 (BD, no. 556533), anti–c-IAP2 (BD, no. 51–90000062), Cell Survival Assay. Cell survival was measured using CellTiter-Glo Lumines- anti-XIAP (BD, no. 610717), anti–caspase-8 (Cell Signaling, no. 9746), anti-PARP1 cent Cell Viability Assay according to the manufacturer’s protocol (Promega). (BD, no. 556362), avidin-HRP (Cell Signaling, no. 3999S), and monoavidin agarose Cells were seeded at 2,000 cells per well in 96-well plates 24 h prior (Pierce, no. 20228). T/S/Z treatment includes TNF (20 ng/mL), Smac-mimetic (100 to treatment. Luminescence was measured using a BioTek Synergy 2 nM), and ZVAD-FMK (20 μM). L929 cells were treated with TNF (2 ng/mL) and plate reader. ZVAD-FMK (20 μM). NTD-DmrB cells were treated with dimerizer (20 nM) and ZVAD-FMK (20 μM). For compound treatment, unless otherwise stated, NBC1, Recombinant Protein Purification. The cDNAs encoding Hsp70 and its mutants the negative analog, and PES-Cl were used at 10 μM, and necrosulfonamide were cloned into the pET21b vector. Cysteine mutants were generated by (NSA) was used at 5 μM. site-directed mutagenesis. His-fusion proteins were purified from BL21(DE3) Escherichia coli cells with Nickel beads as described before (23). Purified Cell Culture and Stable Cell Lines. HT-29, HeLa, and L929 cells were cultured in recombinant proteins were dialyzed against PBS buffer. DMEM (high glucose) supplemented with 10% FBS. NTD-DmrB, NTD-4CS- DmrB, and HeLa/TO-RIPK3 cell lines were reported before (22, 23, 30). MLKL Polymerization. Recombinant GST-NTD was generated as previously They were generated in the background of HeLa-TetR cells that expressed described (22). Recombinant GST-NTD (0.1 μM) was incubated with or the Tet repressor (TetR), and the transgene expression was induced with without recombinant Hsp70, Hsp70 truncations or cysteine mutants, or BSA 50 ng/mL doxycycline (Dox) for 24 h. (0.7 μM) at room temperature in PBS buffer for 1 or 3 h as indicated.

Small Interfering RNA (siRNA) Transfection. For siRNA transfection, cells were In Vitro Compound Conjugation Assay. Recombinant Hsp70, Hsp90, and Hsp70 plated at 2,000 cells per well in 96-well plates and 100,000 cells per well in 6- truncations or cysteine mutants were mixed with NBC1 and NBC1 analogs and well plates 24 h prior to transfection. Transfection was carried out as per rotated at 4 °C in PBS buffer for 16 h. GenMute (SignaGen) protocol with 5 nM siRNA for 96 wells and 50 nM for 6 BIOCHEMISTRY wells. Cells were incubated in standard culture conditions for 72 h prior to Mass Spectrometry/Liquid Chromatography (MS-LC). MS-LC was performed as treatment. The following siRNAs were used: siLuc, CGUACGCGGAAUACUUCGA; previously described (30). Briefly, the protein band of interest was excised, siMLKL, GCUAAGAAGAGAUAAUGAA; siHsp70-1, UGACCAAGAUGAAGGAGAU; destained, and reduced, followed by in-gel trypsin digestion. The peptides siHsp70-2, AGGACGAGUUUGAGCACAA, siHsp40, ACCCGUCGUAUUCAAAGAUGU; were extracted and analyzed by a QSTAR XL mass spectrometer (AB Sciex). siHsc70-1, CCGAACCACUCCAAGCUAU; siHsc70-2, UGACAAAGAUGAAGGAAAU; and siHsc70-3, ACGGAAAAGUCGAGAUAAU. RNA Isolation, cDNA Generation, and qPCR. Total RNA was isolated with Direct- shRNA-mediated Hsp70 knockdown. Stable knockdown of Hsp70 with lentivirus zol RNA Kits (Zymo Research). cDNA was synthesized using iScript cDNA was performed as described before (30). Briefly, shHsp70 was cloned into the synthesis kit (BioRad, no. 1708891). Gene expression was assessed using pTY-shRNA-EF1a-Hygromycin vector (gift from Zhijian “James” Chen, UT standard qPCR approaches with iTaq universal SYBR Green supermix (no. 172- Southwestern, Dallas, TX) and cotransfected with vectors pMD2.G and 5124). Analysis was performed on a CFX Connect Real-Time PCR Detection ΔΔ psPAX2 into 293T cells to produce lentivirus. HT-29 cells were transduced System (BioRad). The 2 Ct method was used to analyze the relative change with lentivirus and selected with 0.1 mg/mL hygromycin for 5 d. The se- in gene expression normalized to actin. The following primers were used quence for shHsp70 is the same as for siHsp70-1. for qPCR: Hsp70-F, AGGACATCAGCCAGAACAAG-3; Hsp70-R, CTGGTGATG- GACGTGTAGAAG; NTD-MLKL-F, ATGCTCCAGGACCAAGGAAAG; NTD-MLKL- Nonreducing Sodium Dodecyl Sulfate–Polyacrylamide Gel Electrophoresis (SDS/ R, CACTCAGCTTCCTGTTCACG; Actin-F, AACTCCATCATGAAGTGTGACG; and PAGE). Nonreducing SDS/PAGE is as standard SDS/PAGE, but sample buffer Actin-R, GATCCACATCTGCTGGAAGG. excludes 2-mercaptoethanol or DTT. Chemical Compound Synthesis. Chemical compound synthesis is detailed in the Semidenaturing Detergent Agarose Gel Electrophoresis (SDD-AGE). SDD-AGE SI Appendix. was performed as described previously (38). Briefly, 1% agarose gel was cast in 1× TAE with 0.1% SDS. Cell lysates were loaded with sample buffer Statistical Analysis. Statistical analyses were performed with Excel. Student’s (0.5× TAE, 5% glycerol, 2% SDS, and 0.02% bromophenol blue), and the gel t test was used to determine significance in cell death, and P < 0.05 is used to was run at 4 V/cm gel length in 1× TAE with 0.1% SDS. Proteins were determine significant differences. Data are presented as mean ± SD. transferred to a PVDF membrane with TBS buffer (20 mM Tris, pH 7.4, and 150 mM NaCl) using capillary transfer, followed by Western blotting. Data Availability. All data are included in the manuscript and SI Appendix.

Cell Lysates and Immunoprecipitation. Cells were scraped and washed with ACKNOWLEDGMENTS. We thank Chengwei Zhang for assisting with PBS buffer twice, followed by lysing with five volumes of lysis buffer (50 mM compound synthesis, Hong Yu for excellent technical assistance, and Tris, pH 7.4, 137 mM NaCl, 1 mM EDTA, 1% Triton X-100, and 10% glycerol, Dr. Noelle Williams and Bethany Cross of the UT Southwestern Pharmacol- ogy Core for performing the in vitro metabolic stability assay. This work is supplemented with protease inhibitors). After 30 min incubation on ice, the × supported by grants from the Welch Foundation (I1827) and National cells were centrifuged at 20,000 g for 12 min and supernatant was col- Institute of General Medical Sciences (NIGMS) (R01, RGM120502A) to Z.W. μ lected. Lysates (1 mg) were incubated with 20 L anti-FLAG or monoavidin and fellowships to A.N.J. (2T32GM008203-26A1) and S.H.-A. (TL1TR001104). agarose beads at 4 °C overnight. Beads were washed five times with lysis Z.W. is the Virginia Murchison Linthicum Scholar in Medical Research and buffer and eluted with 60 μL elution buffer (0.2 M glycine, pH 2.8) and Cancer Prevention and Research Institute of Texas Scholar (R1222).

1. L. Galluzzi et al., Molecular mechanisms of cell death: Recommendations of the no- 5. M. Pasparakis, P. Vandenabeele, Necroptosis and its role in inflammation. Nature 517, menclature committee on cell death 2018. Cell Death Differ. 25, 486–541 (2018). 311–320 (2015). 2. B. Shan, H. Pan, A. Najafov, J. Yuan, Necroptosis in development and diseases. Genes 6. E. S. Mocarski, H. Guo, W. J. Kaiser, Necroptosis: The Trojan horse in cell autonomous Dev. 32, 327–340 (2018). antiviral host defense. Virology 479-480, 160–166 (2015). 3. R. Weinlich, A. Oberst, H. M. Beere, D. R. Green, Necroptosis in development, in- 7. L. Sun, X. Wang, A new kind of cell suicide: Mechanisms and functions of pro- flammation and disease. Nat. Rev. Mol. Cell Biol. 18,127–136 (2017). grammed necrosis. Trends Biochem. Sci. 39, 587–593 (2014). 4. F. K. Chan, N. F. Luz, K. Moriwaki, Programmed necrosis in the cross talk of cell death 8. N. Holler et al., Fas triggers an alternative, caspase-8-independent cell death pathway and inflammation. Annu. Rev. Immunol. 33,79–106 (2015). using the kinase RIP as effector molecule. Nat. Immunol. 1, 489–495 (2000).

Johnston et al. PNAS Latest Articles | 9of10 Downloaded by guest on September 23, 2021 9. A. Degterev et al., Chemical inhibitor of nonapoptotic cell death with therapeutic 29. C. K. Yang, S. D. He, Heat shock protein 90 regulates necroptosis by modulating potential for ischemic brain injury. Nat. Chem. Biol. 1, 112–119 (2005). multiple signaling effectors. Cell Death Dis. 7, e2126 (2016). 10. S. He et al., Receptor interacting protein kinase-3 determines cellular necrotic re- 30. Z. Wang, H. Jiang, S. Chen, F. Du, X. Wang, The mitochondrial phosphatase PGAM5 sponse to TNF-alpha. Cell 137, 1100–1111 (2009). functions at the convergence point of multiple necrotic death pathways. Cell 148, 11. Y. S. Cho et al., Phosphorylation-driven assembly of the RIP1-RIP3 complex regulates 228–243 (2012). – programmed necrosis and virus-induced inflammation. Cell 137, 1112 1123 (2009). 31. P. A. Jackson, J. C. Widen, D. A. Harki, K. M. Brummond, Covalent modifiers: A 12. D. W. Zhang et al., RIP3, an energy metabolism regulator that switches TNF-induced chemical perspective on the reactivity of α,β-Unsaturated carbonyls with thiols via cell death from apoptosis to necrosis. Science 325, 332–336 (2009). Hetero-Michael addition reactions. J. Med. Chem. 60, 839–885 (2017). 13. J. Li et al., The RIP1/RIP3 necrosome forms a functional amyloid signaling complex 32. M. P. Mayer, B. Bukau, Hsp70 chaperones: Cellular functions and molecular mecha- required for programmed necrosis. Cell 150, 339–350 (2012). nism. Cell. Mol. Life Sci. 62 , 670–684 (2005). 14. L. Sun et al., Mixed lineage kinase domain-like protein mediates necrosis signaling 33. F. U. Hartl, A. Bracher, M. Hayer-Hartl, Molecular chaperones in protein folding and downstream of RIP3 kinase. Cell 148, 213–227 (2012). proteostasis. Nature 475, 324–332 (2011). 15. J. Zhao et al., Mixed lineage kinase domain-like is a key receptor interacting protein 3 34. R. Schlecht, A. H. Erbse, B. Bukau, M. P. Mayer, Mechanics of Hsp70 chaperones en- downstream component of TNF-induced necrosis. Proc. Natl. Acad. Sci. U.S.A. 109, – 5322–5327 (2012). ables differential interaction with client proteins. Nat. Struct. Mol. Biol. 18, 345 351 16. H. Wang et al., Mixed lineage kinase domain-like protein MLKL causes necrotic (2011). membrane disruption upon phosphorylation by RIP3. Mol. Cell 54, 133–146 (2014). 35. A. J. Massey et al., A novel, small molecule inhibitor of Hsc70/Hsp70 potentiates Hsp90 17. L. Su et al., A plug release mechanism for membrane permeation by MLKL. Structure inhibitor induced apoptosis in HCT116 colon carcinoma cells. Cancer Chemother. 22, 1489–1500 (2014). Pharmacol. 66, 535–545 (2010). 18. X. Chen et al., Translocation of mixed lineage kinase domain-like protein to plasma 36. R. Schlecht et al., Functional analysis of Hsp70 inhibitors. PLoS One 8, e78443 (2013). membrane leads to necrotic cell death. Cell Res. 24, 105–121 (2014). 37. G. M. Balaburski et al., A modified HSP70 inhibitor shows broad activity as an anti- 19. Z. Cai et al., Plasma membrane translocation of trimerized MLKL protein is required cancer agent. Mol. Cancer Res. 11, 219–229 (2013). for TNF-induced necroptosis. Nat. Cell Biol. 16,55–65 (2014). 38. S. Hanna-Addams, Z. Wang, Use of two dimensional semi-denaturing detergent 20. J. M. Hildebrand et al., Activation of the pseudokinase MLKL unleashes the four-helix agarose gel Electrophoresis to confirm size heterogeneity of amyloid or amyloid-like bundle domain to induce membrane localization and necroptotic cell death. Proc. fibers. J. Vis. Exp., 10.3791/57498.(2018). – Natl. Acad. Sci. U.S.A. 111, 15072 15077 (2014). 39. S. Zargarian et al., Phosphatidylserine externalization, “necroptotic bodies” release, 21. Y. Dondelinger et al., MLKL compromises plasma membrane integrity by binding to and phagocytosis during necroptosis. PLoS Biol. 15, e2002711 (2017). – phosphatidylinositol phosphates. Cell Rep. 7, 971 981 (2014). 40. E. Chuang, A. M. Hori, C. D. Hesketh, J. Shorter, Amyloid assembly and disassembly. J. 22. S. Liu et al., MLKL forms disulfide bond-dependent amyloid-like polymers to induce Cell Sci. 131, jcs189928 (2018). necroptosis. Proc. Natl. Acad. Sci. U.S.A. 114, E7450–E7459 (2017). 41. X. Gao et al., Human Hsp70 disaggregase reverses Parkinson’s-linked α-synuclein 23. E. Reynoso et al., Thioredoxin-1 actively maintains the pseudokinase MLKL in a re- amyloid fibrils. Mol. Cell 59, 781–793 (2015). duced state to suppress disulfide bond-dependent MLKL polymer formation and 42. N. B. Nillegoda et al., Crucial HSP70 co-chaperone complex unlocks metazoan protein necroptosis. J. Biol. Chem. 292, 17514–17524 (2017). disaggregation. Nature 524, 247–251 (2015). 24. A. Johnston, Z. Wang, Necroptosis: MLKL polymerization. J. Nat. Sci. 4, e513 (2018). 43. B. Mannini et al., Molecular mechanisms used by chaperones to reduce the toxicity of 25. D. Li et al., A cytosolic heat shock protein 90 and cochaperone CDC37 complex is – required for RIP3 activation during necroptosis. Proc. Natl. Acad. Sci. U.S.A. 112, 5017– aberrant protein oligomers. Proc. Natl. Acad. Sci. U.S.A. 109, 12479 12484 (2012). – 5022 (2015). 44. M. E. Murphy, The HSP70 family and cancer. Carcinogenesis 34, 1181 1188 (2013). 26. A. V. Jacobsen et al., HSP90 activity is required for MLKL oligomerisation and mem- 45. C. Boudesco, S. Cause, G. Jego, C. Garrido, Hsp70: A cancer target inside and outside – brane translocation and the induction of necroptotic cell death. Cell Death Dis. 7, the cell. Methods Mol. Biol. 1709, 371 396 (2018). e2051 (2016). 46. S. R. Srinivasan et al., Heat shock protein 70 (Hsp70) suppresses RIP1-dependent ap- 27. D. Li et al., Natural product kongensin A is a non-canonical HSP90 inhibitor that optotic and necroptotic cascades. Mol. Cancer Res. 16,58–68 (2018). blocks RIP3-dependent necroptosis. Cell Chem. Biol. 23, 257–266 (2016). 47. T. M. Fu et al., Cryo-EM structure of caspase-8 tandem DED filament reveals assembly 28. X. M. Zhao et al., Hsp90 modulates the stability of MLKL and is required for TNF- and regulation mechanisms of the death-inducing signaling complex. Mol. Cell 64, induced necroptosis. Cell Death Dis. 7, e2089 (2016). 236–250 (2016).

10 of 10 | www.pnas.org/cgi/doi/10.1073/pnas.1916503117 Johnston et al. Downloaded by guest on September 23, 2021