TRANSCRIPTIONAL CONTROL OF Ca2+ SIGNALING IN T CELLS

______

A Dissertation Submitted to the Temple University Graduate Board

In Partial Fulfillment Of the requirements for the Degree of Doctor of Philosophy

By: Elsie Samakai August, 2017

Examining committee members:

Jonathan Soboloff, Advisory Chair, Medical Genetics and Molecular Biochemistry and Fels Institute for Cancer Research and Molecular Biology Brad Rothberg, Medical Genetics and Molecular Biochemistry Xavier Grana, Fels Institute for Cancer Research and Molecular Biology Dan Liebermann, Fels Institute for Cancer Research and Molecular Biology Dietmar Kappes, External Member, Fox Chase Cancer Center

ABSTRACT

Antigen presentation to T cells results in their activation through T Cell Receptor

(TCR) stimulation, resulting in sustained elevation of cytosolic Ca2+ concentration critical for T cell activation. Sustained Ca2+ signlas are importand for the activation of Nuclear Factor of Activated T cells (NFAT), which is a key regulator of T cell activation through its transcriptional control of genes in multiple process including cytokine production, proliferation and differentiation(Rao, Luo, & Hogan,

1997). Recently it was shown that Stromal Interaction Molecule 1 (STIM1) inhibits plasma membrane Ca2+/ATPase 4 (PMCA4) function during T cell activation resulting in sustained elevation of Ca2+ signals(Ritchie, Samakai, &

Soboloff, 2012). This interaction requires upregulation of both STIM1 and

PMCA4. In this thesis, I hypothesize that changes in Ca2+ signals arising from transcriptional changes of STIM1 and PMCA are important for the efficient activation of T cells. In the first part of this thesis, I assess the transcriptional regulation of STIM1 and PMCA4. My in vitro studies show that expression of both proteins is regulated by the EGR family members, EGR1 and EGR4. Additionally, transcriptional regulation of PMCA inhibition by EGR1 and EGR4 is required for efficient activation of T cells. Interestingly, whereas significant roles for EGR1,

EGR2 and EGR3 in T cell development and function have been established, a role for EGR4 has not, hitherto been elucidated. In the second half of this thesis, using qPCR, I reveal that EGR4 expression is stimulated by TCR engagement in primary double positive, CD4 and CD8 positive murine T cells. Further, EGR4- null mice exhibit shifts in early thymic development, although this does not affect

ii the relative number of double or single positive T cells in the thymus.

Interestingly, EGR4-null primary T cells exhibit normal Ca2+ entry, but fail to exhibit activation-induced inhibition of Ca2+ clearance. Although not all subsets of

EGR1 and EGR4 null primary T cells exhibited decreased STIM1 expression, significant defects in proliferation, migration and/or cytokine production were observed upon stimulation in all populations, albeit to different extents. These findings reveal a two-faceted role in which EGRs regulate T cell development and function through both Ca2+-dependent and independent methods. I believe that these findings have important implications towards the general understanding of transcriptional control of Ca2+ signaling, as well as having a possible impact in the quest to advance therapies targeting immunological disorders.

iii

ACKNOWLEDGMENTS

First and foremost, I would like to express my sincerest gratitude to my advisor,

Dr. Jonathan Soboloff. Your constant guidance and critique have been invaluable to completing my research. Thank you for also teaching me how to be succesful in science beyond the bench. Whether it be in grant writing, data presentation or talking science with peers while sipping on wine in the Tuscan hills (aka networking). It’s been a journey I’ll never forget and I am forever grateful.

In addition, I would like to thank the rest of my thesis committee: Dr. Brad

Rothberg, Dr. Dan Liebermann and Dr. Xavier Grana. I am grateful for your constant support, insightful comments and suggestions over the years. I would like to thank Dr. Diane Soprano for her support throughout my studies. Thank you for going above and beyond to ensure I was on track to graduate. Thank you for also being the ultimate role model for a woman in science. I would also like to thank my external reader Dr. Dietmar Kappes. Thank you for the time you have taken to help me through the final stretch. My hope for you all is that you never have to sit through another long, arduous committee meeting again (but who are we kidding?).

I’d like to thank Dr. Shan He and Dr. Yi Zhang for the work they did with the

GVHD mouse model. It was a key part of my thesis and I am grateful for this amazing collaboration. I’d like to thank Dr. Kayla Pratt and Dr. Italo Tempera for teaching me how to do ChIP and performing the initial experiments. Again, my

iv work would not have been complete without your help.

Next I’d like to thank my lab mates: Dr. Rob Hooper, Christina Go, and Long Le.

Rob, thank you for all the Ca2+ imaging you did on this work. Thank you for lending your shoulder through the lows and sharing in the joy through the highs. I can never thank you enough for all you have done for me. Christina, thank you for being such an inspiration. You’re a strong, loving and kind person and this journey was so much easier with you in it. Long, thank you for all the mouse work you did on this project. Thank you for also being the person I could talk to about anything. You have all become my family now and I am thankful for that.

To my fellow graduate students Dr. Umme Ayesa, Dr. Maria Barton, Dr. Danielle

Feather and Dr. Bhanukanthe Manne. This journey has been extra special because of your love and support.

To my parents, Eddie and Susan and my sisters, Sequila and Soneka. You are my dream team. Thank you for always believing in me and encouraging me. You are my rock.

To my very own super hero, my husband and best friend, Timothy Moore. Thank you for your love and patience through this roller coaster ride that we call Phd training. Thank you for your sacrifice especially the times you had to play both parents when my gels ran too long. Thank you for always believing in me and supporting me through all my decisions, even the crazy ones.

To Nahla and Savannah. Mommy loves you.

v

TABLE OF CONTENTS

ABSTRACT ...... ii

ACKNOWLEDGMENTS ...... iv

LIST OF ABBREVIATIONS ...... x

LIST OF TABLES ...... xvi

LIST OF FIGURES ...... xvii

CHAPTER 1: LITERATURE REVIEW ...... - 1 -

PART I: Overview of Ca2+ Signaling ...... - 1 -

Introduction ...... - 1 - Mechanism of Ca2+ Entry in T cells ...... - 3 - PART II: Concerted action of Ca2+ homeostatic proteins at the IS ...... - 18 -

Inhibition of PMCA at the IS ...... - 19 - Mitochondrial Ca2+ uptake at the IS ...... - 30 - PART III: Downstream Effects of Ca2+ signals ...... - 34 -

Role in early TCR Activation ...... - 34 - Immunological Synapse formation ...... - 34 - Nuclear Factor of Activated T Cells (NFAT) ...... - 35 - Nuclear Factor Kappa-Light-Chain-Enhancer of Activated B Cells (NF-κB) .... - 37 - CREB-AP1 pathway ...... - 40 - PART IV: STIM1 and T cell development ...... - 41 -

Early stages of thymic development ...... - 41 -

vi

Positive Selection ...... - 45 - Negative Selection ...... - 46 - Non-Conventional T cell development ...... - 46 - PART V: Role of Early Growth Response Transcription Factors in T cells .

- 48 -

EGR regulation of Ca2+ homeostatic proteins ...... - 49 - EGRs in T cell development, Activation and Function ...... - 50 - PART VI: EGR mediated Ca2+ Signaling in a Disease Model ...... - 55 -

Graft-Versus-Host Disease ...... - 55 - Pathophysiology of GVHD ...... - 56 - Treatment of aGVHD ...... - 58 - CHAPTER 2: STATEMENT OF GOALS ...... - 61 -

CHAPTER 3: MATERIALS AND METHODS ...... - 63 - PART I: Reagents ...... - 63 -

Antibodies ...... - 63 - Ca2+ Imaging ...... - 63 - PART II: Cell Culture ...... - 63 -

PART III: Animal Colonies ...... - 64 -

Maintenance ...... - 64 - DNA isolation ...... - 64 - Genotyping PCR conditions for EGR1 knockout ...... - 64 - Genotyping PCR conditions for EGR4 knockout ...... - 64 - PART IV: Cytosolic Ca2+ Measurements ...... - 65 -

PART V: Chromatin Immunoprecipitation ...... - 66 -

PART VI: Protein Analysis ...... - 67 -

vii

Cell lysis ...... - 67 - SDS PAGE ...... - 67 - PART VII: Quantitative PCR ...... - 68 -

RNA extraction ...... - 68 - cDNA Synthesis ...... - 68 - RT-qPCR ...... - 68 - PART VIII: Transfection Protocols ...... - 70 -

Standard Electroporation protocol ...... - 70 - Amaxa Nucleofection protocol ...... - 70 - PART IX: CRISPR/CAS9 system targeting human STIM1 and stable cell

line generation ...... - 75 -

PART X: Functional Assays ...... - 75 -

Luciferase reporter gene assay ...... - 75 - Cytokine Expression assay ...... - 76 - Graft versus Host (GVH) competitive Assay ...... - 76 - Flow cytometry ...... - 77 - Proliferation Assays ...... - 77 - Migration Assays ...... - 77 - PART XI: Statistical Analysis ...... - 78 -

CHAPTER 4: RESULTS ...... - 79 - PART I: EGR-mediated STIM1 Upregulation during T cell activation

Modulates Ca2+ Signals and NFAT Activation ...... - 79 -

Control of STIM1 and PMCA4 expression by the EGR family of transcription factors ...... - 79 - Redundant EGR1/EGR4-mediated control of STIM1 and PMCA4 expression ...... - 83 - Defining EGR binding sites on the STIM1 and PMCA4 promoters ...... - 87 -

viii

Loss of both EGR1/4 expression affects Ca2+ clearance and not Ca2+ entry .. - 91 - Role of STIM1-mediated PMCA inhibition for control NFAT activation in activated T cells ...... - 102 - PART II: Assessing Functional Consequences of EGR-mediated Ca2+

Modulation in T cells using an in vivo model ...... - 109 -

Expression of EGR4 in Primary T cells ...... - 109 - EGR4 is involved in thymic development ...... - 112 - Control of STIM1 expression by EGR4 in primary T cells ...... - 115 - EGR4 regulates Ca2+ Clearance Inhibition ...... - 120 - EGR4-mediated STIM1 upregulation is required for effective Proliferation and Migration ...... - 123 - CHAPTER 5: SUMMARY AND DISCUSSION ...... - 137 - PART I: Regulation of Ca2+ homeostatic proteins by EGR Family members

...... - 137 -

PART II: EGR-mediated changes in Ca2+ Clearance ...... - 139 -

PART III: EGR4 in T cell Development ...... - 141 -

PART IV: The Importance of STIM1-mediated PMCA Inhibition in T cell

Activation and Function ...... - 143 -

PART V: Therapeutic Potential of EGR-Dependent Ca2+ Clearance ... - 145 -

CHAPTER 6: CONCLUSION ...... - 147 - REFERENCES CITED ...... - 150 -

ix

LIST OF ABBREVIATIONS

µl: microliter

µM: micromolar aGVHD: acute Graft versus Host disease

APC: Antigen Presenting cell

ARC: Arachidonate-regulated Ca2+

BSA: Bovine Serum Albumin

Ca2+: ionic calcium

CaM: calmodulin

CaMKIV: calmodulin-dependent kinase IV cAMP: Cyclic adenosine monophosphate

Cas9: Caspase 9

CC1: coiled-coil 1

CCE: Capacitative Ca2+ entry

CCL9: (C-C motif) ligand 19 cGVHD: chronic Graft versus Host disease

ChIP: Chromatin Immunoprecipitation

CK: casein kinase

CLP: Common Lymphoid progenitors

CRAC: Ca2+ release-activated Ca2+ current

CREB: cAMP response element binding protein

CREM: cAMP-responsive element modulator

x

CRISPR: Clustered regularly interspaced short palindromic repeats

CsA: Cyclosporin A cSMAC: central supramolecular activation cluster

DAG: diacylglycerol

DAMPs: Damage-associated molecular patterns

DN: Double negative

DNA: deoxyribonucleic acid

DP: Double positive

DPC: Distal pole complex dSMAC: distal supramolecular activation cluster

DYRK: dual-specificity tyrosine-phosphorylation regulated kinases

EGR: Early growth response

EMRE: essential MCU regulator

ER: Endoplasmic Reticulum

F-actin: filamentous Actin

FBS: Fetal Bovine Serum

FRET: Förster Resonance Energy Transfer fura-2 A/M: fura-2 acetoxymethylester;

GSK: glycogen synthase kinase 3

GVHD: Graft versus Host disease

GVT: Graft versus Tumor

HEK: Embryonic kidney

HGF: Hepatocyte growth factor

xi hrs: hours

HSCT: hematopoietic stem cell transplantation

IELs: intraepithelial lymphocytes

IKK: IκB kinase complex

IL-1: interleukin 1

IL-2: interleukin 2

IL-2r: interleukin 2 receptor

IL-4: interleukin 4

IMM: inner mitochondrial membrane

IMS: intermembrane space iNKT: invariant natural killer T cells

InsP3: inositol-1,4,5-trisphosphate

InsP3R: inositol-1,4,5-trisphosphate receptor

IS: Immunological synapse

ITAM: immunoreceptor tyrosine-based activation motif

Kd: equilibrium dissociation constant

KD: knockdown

KO: knockout

LAT: Linker for Activation of T cells

Lck: lymphocyte protein tyrosine kinase

M: molar

MCU: Mitochondrial Calcium Uniporter

MHC: major histocompatibility complex

xii

MICU1: mitochondrial calcium uptake 1

MICUR1: mitochondrial calcium uniporter regulator 1 mRNA: messenger RNA

NCX:Sodium Calcium exchanger

NES: nuclear export sequence

NFAT: nuclear factor of activated T cells

NF-Κb: nuclear factor kappa-light-chain-enhancer of activated B cells nM: nanomolar

OMM: outer mitochondrial membrane

PAMPs: Pathogen-associated molecular patterns

PBS: phosphate buffered saline

PCR: Polymerase chain reaction

PIP2: Phosphatidylinositol 4,5-bisphosphate

PKC: Protein kinase C

PLC-γ: Phospholipase C γ

PM: Plasma membrane

PMA: phorbol-12-myristate-13-acetate

PMCA: Plasma membrane Ca2+/ATPase pSMAC: peripheral supramolecular activation cluster

RNA: Ribonucleic acid

RNAi: Ribonucleic acid interference

ROS: reactive oxygen species

RT-qPCR: Reverse transcription quantitative polymerase chain reaction

xiii

SAM: sterile alpha motif

SCID: Severe-Combined Immunodeficiency

SDS: Sodium dodecyl sulfate

SEM: standard error of the mean

SERCA: sarco/endoplasmic Ca2+/ATPase siRNA: small interfering RNA

SOAR: STIM-Orai activating Region

SOCe: Store Operated Ca2+ entry

SOCS1: suppressor of cytokine signaling 1

SOCS3: suppressor of cytokine signaling 3

SP: single positive

STIM1: Stromal Interacting Molecule 1

STIM2: Stromal Interacting Molecule 2

TBP: TATA Binding protein

TCR: T cell receptor

Tg: Tharpsigargin

Th1: T helper 1

Th2: T helper 2

TM: Transmembrane

TNFα: Tumor necrosis factor α

Tregs: regulatory T cells

WT: wildtype

ZAP70: Zeta-chain-associated protein kinase 70

xiv

Δ597: STIM1 mutant with a c-terminal truncation from amino acid 597

ΔΨ: membrane potential

xv

LIST OF TABLES

Table Page

Table 2.1 PCR primers for genotyping ...... 65

Table 2.2 Oligonucleotide sequences for primers used……………………..69

Table 2.3. Summary of DNA constructs ...... 73

Table 2.4. Summary of RNAi sequences and constructs ...... 74

Table 4.1. Calculated non-linear regression constants from Ca2+ clearance assays ...... 95

xvi

LIST OF FIGURES

Figure Page

Figure 1.1. Ca2+ signals during T cell activation ...... 5

Figure 1.2. STIM Domains ...... 12

Figure 1.3. ORAI1 Domains ...... 14

Figure 1.4. Structure of PCMA ...... 24

Figure 1.5. Proposed model for co-ordination of Ca2+ signals in activated T cells ...... 28

Figure 1.6. Progression of T cell differentiation ...... 43

Figure 1.7. Role of EGRs in T cell Development and Activation ...... 53

Figure 2.1. Amaxa Transfection using different solutions ...... 71

Figure 4.1. Modulation of STIM1 expression by EGR4 knockdown ...... 81

Figure 4.2. EGR1/4 are both required for STIM1 expression ...... 85

Figure 4.3. ChIP analysis of EGR1 binding to the STIM1 and PMCA promoter in T cells ...... 89

Figure 4.4. EGR1/4 knockdown reduced activation-dependent inhibition of Ca2+ clearance ...... 95

Figure 4.5. EGR1/4 knock-down does not alter the Tg-releasable Ca2+ pool ...... 98

Figure 4.6. EGR1/4 knock-down or STIM1 over-expression does not significantly alter the peak Ca2+ entry ...... 100

15. Figure 4.7. Altered expression of Ca2+ homeostatic proteins after EGR1/4 knock-down ...... 104

Figure 4.8. Crispr-Cas9 knock-out of STIM1 in Jurkat T cells ...... 105

Figure 4.9. PMCA inhibition is required for NFAT activation ...... 107

Figure 4.10. EGR4 is expressed in Primary T cells ...... 111

xvii

Figure 4.11. EGR4 plays a role in DN development ...... 113

Figure 4.12. STIM1 expression is dysregulated in EGR4-/- T cells ...... 118

Figure 4.13. EGR4-/- T cells display faster clearance ...... 122

Figure 4.14. Defective Proliferation in EGR1-/- and EGR4-/- T cells ...... 127

Figure 4.15. CCR7 and c-Met expression in EGR-/- T cells...... 129

Figure 4.16. Decreased Invasion capacity of EGR4-/- T cells ...... 133

Figure 4.17 EGR4-/- T cells exhibit impairment in cytokine production in vivo ...... 135

xviii

CHAPTER 1: LITERATURE REVIEW

PART I: Overview of Ca2+ Signaling

Introduction

Ca2+ is a versatile, universal second messenger utilized in all cellular types and species. It serves diverse roles in multiple biological processes involved in the birth, development, function and death of cells, tissues and organisms. As

Ca2+ signaling is very versatile, a longstanding question is how such versatility can be achieved from a single cation. Today, with the help of current technologies and accompanying procedures used to identify and measure Ca2+ signals in single cells, whole tissue and animals, great strides have been made in not only identifying key molecular components in the generation of these Ca2+ signals, but also how these signals are modulated to give rise to specific spatial and temporal Ca2+ signatures that determine cell fate and function.

In the adaptive immune system, T cells play a critical role in mounting an appropriate response against infectious agents through a lifetime. Adaptive immunity is able to handle an unlimited number of antigenic structures through the generation of receptors from a process called V(D)J recombination which eventually leads to the formation of a fully functional T cell Receptor

(TCR)(Danilova, 2012). T cell responses are initiated when a specific antigen is presented through the major histocompatibility complex (MHC) on an Antigen

Presenting cell (APC) to the T cell receptor (TCR). Recognition of this foreign antigen by TCR results in the activation of a T cell culminating in proliferation,

- 1 -

and differentiation into effector T cells (Feske, 2007). The importance of Ca2+ signals to T cell activation was recognized as early as the 60s, where Ca2+ uptake upon T cell stimulation was observed and was required for proliferation of

T cells (Asherson, Davey, & Goodford, 1970; Whitfield, Perris, & Youdale, 1968).

Today, we know that the binding of an antigen to the TCR triggers the mobilization of Ca2+ and is needed for effective T cell activation, anergy, gene expression, motility, synapse formation, cytotoxicity, development and differentiation (Feske, 2007). Like other cells, Ca2+ signals in T cells are tightly regulated in both baseline conditions and after activation. In addition to depressed Ca2+ responses being linked to decreased functional responses in T cells (Asherson et al., 1970; Feske, 2007; Whitfield et al., 1968), differences in levels and patterns of Ca2+ responses in T cells have been linked to variations in the cellular response to activation of different T cell subsets (Arrol, Church,

Bacon, & Young, 2008; Melichar, Ross, Herzmark, Hogquist, & Robey, 2013;

Munoz-Ruiz et al., 2016; van Panhuys, Klauschen, & Germain, 2014). Studies have shown that T cells are capable of extracting specific information from both the frequency and amplitude of Ca2+ signals, therefore showing that the complexity of the signals may serve to increase the amount of information that can be encoded via Ca2+-dependent pathways. In this thesis, I explore mechanisms involved in shaping Ca2+ signals in T cells.

Within the last decade, great strides have been made in identifying the channels, pumps and transporters that control that regulate short-term changes in cytosolic Ca2+ content. However, the impact of altered expression of Ca2+

- 2 -

homeostatic proteins over the hours required for T cells to transition from a naïve cell to an effector has not been fully investigated. Indeed, it has been shown that changes in expression of Ca2+ homeostatic proteins upon T cell activation affect the spatial and temporal Ca2+ signatures of the cell (Lioudyno et al., 2008;

Quintana et al., 2011; Ritchie et al., 2012). In this thesis, I explore the regulation and impact of transcriptional control of Ca2+ homeostatic proteins to T cell activation. Because dysregulated or impaired Ca2+ signaling in T lymphocytes

have been associated with the pathophysiological processes in several autoimmune and inflammatory diseases, understanding transcriptional regulation of Ca2+ signaling could lead to new therapeutic advances.

Mechanism of Ca2+ Entry in T cells

After it was recognized that Ca2+ signals were important for the activation of T cells, it was discovered that stimulation of the TCR with antibodies induced the release of Ca2+ from intracellular Ca2+ stores (Weiss, Imboden, Shoback, &

Stobo, 1984). Moreover, stimulation of T cells with either antibodies against the

TCR or the Ca2+ ionophore, ionomycin, led to the appearance of the same new phosphoproteins suggesting a link between TCR stimulation and the Ca2+ pathway (Imboden & Stobo, 1985; Imboden, Weiss, & Stobo, 1985; Weiss et al.,

1984). It is now generally accepted that successful activation of the T cell requires positive engagement of an antigen, presented by an Antigen Presenting

Cell (APC) onto the TCR followed by increases in cytosolic Ca2+ levels.

The TCR is a complex of integral membrane proteins composed of a ligand-sensing subunit, TCRαβ (or to a lesser extent, TCRγδ) and 3 signaling

- 3 -

subunits, CD3εδ, εγ and ζζ. The core of its antigen-sensing function is a heterodimer composed of TCRα and TCRβ chains that detect MHC-bound antigen in a highly specific manner. Antigen binding triggers phosphorylation of immunoreceptor tyrosine-based activation motifs (ITAMs) by lymphocyte protein tyrosine kinase (Lck) on the cytosolic side of the TCR/CD3 complex. This leads to further recruitment and activation of a series of kinases and their substrates, ultimately leading to the ligation and thus activation of phospholipase C-γ (PLC-γ)

(Fig. 1.1). PLC-γ activation is a key physiological mediator of receptor-operated

Ca2+ signaling and an early step in a process that ultimately leads to the initiation of Store Operated Ca2+ entry (SOCe) which is the main mode of Ca2+ entry in T cells.

- 4 -

- 5 -

FIGURE 1.1: Ca2+ signals during T cell Activation (Taken from unpublished manuscript (Samakai, Go, & Soboloff, 2017)). Activation in T cells is achieved by TCR engagement by an antigen on an APC. It can also be achieved experimentally using monoclonal antibodies or lectins. This leads to the

2+ recruitment of PLCγ, production of InsP3 and release of Ca from the ER. The corresponding decrease in ER Ca2+ content leads to engagement of STIM1, resulting in a conformational change from its resting dimeric state to an extended multimeric form, enabling activation of Orai channels and Ca2+ influx. Cytosolic

Ca2+ is cleared via the combined action of sarco/endoplasmic Ca2+/ATPase

(SERCA) and the plasma membrane Ca2+/ATPase (PMCA). Also depicted is

Ca2+-dependent regulation of NFAT. First, increased cytosolic Ca2+ leads to calmodulin activation. This leads to activation of the phosphatase calcineurin which dephosphorylates NFAT, leading to nuclear translocation via importins, where it acts as a transcription factor alongside NF-κB and AP-1, among others.

NFAT requires a persistent Ca2+ signal to remain in the nucleus due to the activity of kinases such as GSK, DYRK, and CK which lead to NFAT phosphorylation and the subsequent transport by exportins to the cytosol.

- 6 -

SOCE

The mechanism and key molecular components of SOCe have only been elucidated in the last couple of decades. It was long observed that activation of

PLC-coupled receptors in virtually all cells leads to a characteristic biphasic Ca2+ signal in which a rapid and transient release of Ca2+ from the Endoplasmic

Reticulum (ER) is followed by large sustained Ca2+ entry via the Plasma

Membrane(Putney, 1978). This led to James Putney proposing the “capacitative model” in which depletion of intracellular Ca2+ stores somehow signaled plasma membrane Ca2+ channels to open, thereby permitting refilling of ER Ca2+ stores(Putney, 1986). Subsequent publications using pharmacological inhibitors of the sarco/endoplasmic reticulum Ca2+/ATPase (SERCA) to deplete intracellular Ca2+ stores independent of receptor activation, induced a sustained increase in cytoplasmic Ca2+ (Takemura, Hughes, Thastrup, & Putney, 1989;

Thastrup, Cullen, Drobak, Hanley, & Dawson, 1990). Moreover, an electrophysiological current activated by Ca2+ store depletion in Mast and T cells

2+ 2+ named Ca release-activated Ca current (ICRAC) provided quantitative evidence of a relationship between store depletion and agonist-mediated Ca2+ influx(Hoth

& Penner, 1992; Zweifach & Lewis, 1993). This capacitative Ca2+ entry (CCE), now commonly referred to as SOCe, describes Ca2+ entry via the plasma membrane (PM) as a direct consequence of ER store-depletion upon receptor activation. This model was further solidified by subsequent discoveries showing that close interactions between the ER and Plasma membranes were required for coupling to occur(Patterson, van Rossum, & Gill, 1999; Yao, Ferrer-Montiel,

- 7 -

Montal, & Tsien, 1999) and, finally, the identification of Stromal Interacting

Molecule (STIM) family members (Fig. 1.2) as ER Ca2+ sensors and SOCE regulators (Liou et al., 2005; Roos et al., 2005) and members of the Orai family

(Fig. 1.3) as Ca2+ channels (Feske et al., 2006; Vig, Peinelt, et al., 2006; Zhang et al., 2006) using RNAi screens. We now know that SOCE is the key Ca2+ entry pathway in T cells and is vital to T cell function as evidenced by severe combined immunodeficiency observed in both STIM/Orai-null mouse mice (Gwack et al.,

2008; Oh-Hora et al., 2008) and human patients (Picard et al., 2009) exhibiting mutations in SOCE components (Picard et al., 2009).

The activation of PLC leads to the hydrolysis of Phosphatidylinositol 4,5- bisphosphate (PIP2) into inositol-1,4,5-trisphosphate (InsP3) and diacylglycerol

(DAG) (Dittmar et al., 1997; van Leeuwen & Samelson, 1999). DAG production leads to activation of the Ras/Raf-1/MEK/ERK and nuclear factor kappa-light- chain-enhancer of activated B cells (NF-κB) pathways which are crucial for T cell activation and function (discussed in further sections). Simultaneously, InsP3

2+ binds to and activates ER-localized InsP3 Receptors (InsP3Rs), Ca channels that mediate ER Ca2+ release (Fig 1.1). The ER serves as a major Ca2+ storage compartment with a Ca2+ concentration range estimate of 100–700

μM(Bezprozvanny & Ehrlich, 1995; Guse, Roth, & Emmrich, 1993). TCR-

2+ mediated InsP3R activation leads to transient increases in intracellular Ca levels to ~500 nM(Feske, 2007; Lewis, 2001). The concomitant decrease in ER

Ca2+ content is ‘sensed’ by the single pass ER transmembrane protein, STIM1 via its luminal canonical EF hand (cEF;) (Liou, Fivaz, Inoue, & Meyer, 2007;

- 8 -

Stathopulos, Zheng, Li, Plevin, & Ikura, 2008). Interestingly, a second non-Ca2+- binding “hidden” EF hand (hEF) was later identified as critical to the transduction of Ca2+-dependent conformational change to the sterile alpha motif (SAM) that initiates the process of oligomerization (Stathopulos et al., 2008). This oligomerization seems to be necessary and sufficient to drive membrane localization and Orai1 activation Luik, Wang, Prakriya, Wu, & Lewis, 2008).

Interestingly, although SAM domains initiate the process of oligomerization, domains located on the cytosolic side of STIM1 are the primary mediators of

STIM-STIM interactions (Williams et al., 2002). It has since been shown that it is the STIM-Orai activating Region (SOAR) (Yuan et al., 2009); also known as

CAD(Park et al., 2009)) that mediates oligomerization (Covington, Wu, & Lewis,

2010); significant, in that SOAR is also the minimal required component of STIM1 required for Orai1 activation (Park et al., 2009; Yuan et al., 2009). Hence, loss of

Ca2+ from the STIM1 EF hand drives association between SAM domains, relieving auto-inhibition of SOAR by coiled-coil 1 (CC1)(Korzeniowski, Manjarres,

Varnai, & Balla, 2010; Zhou et al., 2013) to drive SOAR-mediated aggregation, thereby facilitating interaction/gating of Orai1 by SOAR (reviewed in (Derler,

Madl, Schutz, & Romanin, 2012; Kim & Muallem, 2011; Soboloff, Rothberg,

Madesh, & Gill, 2012)). Interactions between c-terminal lysine rich domains and negatively charged phospholipids in the PM also support STIM-Orai interactions

(Liou et al., 2007) although this does not seem to be required for this process.

As suggested above, the CRAC channel Orai1 is indispensable for Ca2+ entry in T cells. Identified using genome-wide RNAi screens(Zhang et al., 2006),

- 9 -

Orai1 has four transmembrane segments (TM1-TM4) with its N and C terminus facing the cytoplasm (Fig. 1.3). TM1 lines the pore of Orai1 and has been shown to be important for both selectivity and gating as it contains key residues involved in both(McNally, Somasundaram, Jairaman, Yamashita, & Prakriya, 2013;

McNally, Somasundaram, Yamashita, & Prakriya, 2012). The conserved residue

E106 (TM1) has been identified as the primary Ca2+ co-ordinating residue, as evidenced by the markedly reduced selectivity for Ca2+ in channels when this residue is mutated(McNally, Yamashita, Engh, & Prakriya, 2009; Prakriya et al.,

2006; Vig, Beck, et al., 2006; Yeromin et al., 2006). Channel opening is mediated through interaction of both the cytoplasmic N and C terminals to STIM1. STIM1 recruits Orai1 to puncta via interaction to the C-terminal cytoplasmic tail of Orai1.

Deletion of this tail results in failure to colocalize with STIM1 and support CRAC current upon store depletion(Z. Li et al., 2007; Muik et al., 2008). Additionally, deletion of the N terminal cytoplasmic tail of Orai1 results in no CRAC current, even though it is able to accumulate at STIM1 puncta(Lewis, 2011; McNally et al., 2013; McNally et al., 2009; Yamashita, Navarro-Borelly, McNally, & Prakriya,

2007).

T cells obtained from Stim1−/− or from Orai1−/− mice exhibit defects in

SOCe, proliferation and cytokine production (reviewed in (Hogan, Lewis, & Rao,

2010; Shaw & Feske, 2012)). Interestingly Orai1-/- can still secrete low amounts of IL2 and other cytokines(Gwack et al., 2008). Additionally, STIM2, a homologue of STIM1, has been shown to contribute slightly to SOCe and its expression can reconstitute cytokine production in STIM1-/- cells(Oh-Hora et al., 2008). Put

- 10 -

together, these findings show that STIM1 and Orai1 are the primary mediators of

SOCe in TCR signaling with their homologs serving a limited role.

- 11 -

- 12 -

FIGURE 1.2: STIM DOMAINS (Taken from unpublished manuscript

(Samakai et al., 2017)). Domains of STIM isoforms showing canonical EF-hand

(cEF), hidden EF-hand (hEF), sterile alpha motif (SAM), transmembrane (TM), coiled-coil (CC1), STIM1 Orai1 activation region (SOAR), inactivation domain

(ID), serine/proline-rich region (S/P), proline/histidine-rich region (P/H), lysine-rich region (K).

- 13 -

- 14 -

FIGURE 1.3: ORAI DOMAINS. (Taken from an unpublished manuscript

(Samakai et al., 2017)) Domains of Orai isoforms including proline-rich region

(P), arginine-rich region (R), transmembrane domains (TM), and coiled-coil domain (CC). Within cells, Orai subunits form hexamers with a Ca2+-permeable pore created between the 6 TM1 domains.

- 15 -

STIM2

STIM2 is a close homolog of STIM1 bears a marked resemblance to

STIM1 in terms of sequence identity (Fig. 1.2). It, like STIM1, also contains a pair of canonical and non-canonical EF-hands, a SAM domain, and 3 coiled-coil domains. STIM2 diverges from STIM1 in the adjacent C-terminal region, but contains a proline- and histidine-rich motif, which resembles the serine- and proline-rich motif in STIM1(Frischauf et al., 2008; Stathopulos, Zheng, & Ikura,

2009; Y. Wang et al., 2009). STIM2 is also expressed in T cells and contributes to Ca2+ homeostasis and T cell activation. Similar to STIM1, STIM2 is an ER Ca2+ sensor and an Orai1 activator, but is activated at higher ER Ca2+ concentrations(Brandman, Liou, Park, & Meyer, 2007) with slower kinetics

(Stathopulos et al., 2009; Stathopulos et al., 2008; Zhou et al., 2009) and decreased efficiency(X. Wang et al., 2014; Zhou et al., 2009). These features of

STIM2 likely contribute to its inability to compensate for loss of STIM1, since the presence of STIM2 fails to prevent severe immunodeficiency in both STIM1-null mice (Oh-Hora et al., 2008) and human patients exhibiting STIM1 mutations

(Picard et al., 2009). However, this does not mean that STIM2 serves no role in

Ca2+ signaling in T cells. Indeed, STIM2-null mice exhibit defects in T cell activation (Oh-Hora et al., 2008) and STIM1/STIM2 double knockout mice develop complex autoimmunity (Cheng et al., 2012; J. Ma, McCarl, Khalil, Luthy,

& Feske, 2010; Oh-Hora et al., 2008) not observed in STIM1-null animals.

- 16 -

ORAI2 and ORAI3

Members of the Orai family serve as required channels in SOCe (Feske et al., 2006; Vig, Peinelt, et al., 2006; Zhang et al., 2006). These are highly Ca2+- selective ion channels gated almost exclusively by STIM1 and/or STIM2

(reviewed in (Derler et al., 2012; Prakriya, 2013; Soboloff et al., 2012)).

Interestingly, although all 3 Orai channels can be activated by STIM proteins when overexpressed (Lis et al., 2007; Mercer et al., 2006), loss of Orai1 seems to eliminate SOCE in most, but not all cell types. This includes human, but not murine T cells, which seem to be able to utilize Orai2 in the absence of Orai1

(Shaw & Feske, 2012). While a role for Orai3 in T cells has not been defined, several studies have implicated it as a key component of Arachidonate-regulated

Ca2+ (ARC) channels whose activation is store-independent (Gonzalez-Cobos et al., 2013; Mignen, Thompson, & Shuttleworth, 2008). While future investigations may shed further light on the roles of these Orai homologs in Ca2+ signaling,

Orai1 seems to be the primary mediator of endogenous SOCe, particularly in T cells.

- 17 -

PART II: Concerted action of Ca2+ homeostatic proteins at the IS

In addition to inducing robust proliferative, transcriptional, and secretory responses generally associated with T cell activation, a very early feature of

TCR-antigen engagement is the formation of very intimate contacts between T cells and APCs. Subsequent dramatic actin cytoskeleton, organelle reorganization and re-distribution of membrane and intracellular signaling proteins (Fooksman et al., 2010) result in the formation of a specialized junction called the Immunological Synapse (IS). The mature IS adopts a concentric architecture with the central domain containing a cluster of TCR called the central supramolecular activation cluster (cSMAC) surrounded by a ring of adhesion molecules [peripheral SMAC (pSMAC)] (Dustin, 2008; Kupfer & Kupfer, 2003). At the edge of the pSMAC is the distal SMAC (dSMAC), which consists of a circular array of filamentous actin (F-actin) (Freiberg et al., 2002). On the opposite side of the IS is the Distal pole complex (DPC), which is thought to sequester negative regulators of T-cell activation(Allenspach et al., 2001; Cullinan, Sperling, &

Burkhardt, 2002). This quantitative distribution of receptors and signaling molecules to different cellular compartments is linked to the qualitative response of a T cell. Interestingly, this polarized distribution is also seen with SOCe components (Lioudyno et al., 2008; Quintana et al., 2011; Ritchie et al., 2012).

Experimentally, the IS can be visualized by immunostaining or fluorescently tagging molecules that tend to accumulate at the interface of the T cell and the APC like actin and the CD3 chains (Gascoigne et al., 2009). The same approach can be used to identify proteins that may accumulate and are

- 18 -

involved with signaling at the IS. After T cell activation, STIM1 and Orai1 have been shown to be rapidly recruited to the IS. Additionally T cell activation induces increases in expression of both STIM1 and Orai1 (Lioudyno et al., 2008;

Quintana et al., 2011; Ritchie et al., 2012). A consequence of this relocalization and increased concentration of SOCE components is enhanced localized Ca2+ influx and sustained Ca2+ signals at the T cell-APC interface (Barr et al., 2008;

Lioudyno et al., 2008) (Fig 1.5). Interestingly, STIM1 and Orai1 also reveal significant accumulation in ‘distal caps’ at the opposite side of the cell, but without exhibiting the enhanced signaling seen at the IS (Barr et al., 2008).

Differential regulation of various other Ca2+ homeostatic proteins and organelles have been implicated in these resulting disparate Ca2+ signals between the IS and distal caps (Quintana et al., 2011; Ritchie et al., 2012). Although this thesis focuses mainly on the contribution of PMCA regulation, the potential role of mitochondria is discussed in the results of this thesis. As such, both are reviewed below.

Inhibition of PMCA at the IS

Ca2+ signals are achieved by interplay of Ca2+ influx and efflux pathways.

Although Ca2+ entry mechanisms have been given the most attention,

Ca2+ clearance pathways are becoming increasingly well recognized as powerful influences over amplitude, duration, and dynamics of the net Ca2+ signal

(Bautista, Hoth, & Lewis, 2002; Lewis, 2001). Varying contributions from different plasma membrane pumps, intracellular channels, mitochondria and intracellular buffers can lead to unique Ca2+ signatures in response dependent on both

- 19 -

stimulus and cell type. The two main systems for Ca2+ extrusion at the PM are a low affinity, high capacity Na+-Ca2+ exchanger (NCX), and a high-affinity, low- capacity Ca2+-ATPase, the plasma-membrane Ca2+-ATPase (PMCA). In the early

90s, experiments in Human T cells and Jurkat T cell lines provided evidence that although Na+/Ca2+ exchange contributes to Ca2+ clearance, PMCA pumps provide the dominant mechanism for Ca2+ clearance at the PM in T cells

(Balasubramanyam, Kimura, Aviv, & Gardner, 1993; Donnadieu, Bismuth, &

Trautmann, 1992; Donnadieu & Trautmann, 1993).

Overview of PMCA

The PMCA pump belongs to the family of P-type ATPases, which use ATP to transport Ca2+ to the extracellular environment with a one to one ratio of ATP to Ca2+ (Hao, Rigaud, & Inesi, 1994; Niggli, Sigel, & Carafoli, 1982). Although a relatively low abundant membrane protein, PMCA’s high affinity to Ca2+ allow it to function very efficiently and also to play a significant role in Ca2+ homeostasis

(Brini & Carafoli, 2011). At very low Ca2+ concentrations the PMCAs are nearly inactive. When Ca2 + increases in the cytosol, it binds to EF hands on calmodulin

(CaM), which in turn leads to binding to PMCA (Gopinath & Vincenzi, 1977;

Jarrett & Penniston, 1977). Binding of Ca2 +–CaM to the PMCA releases auto- inhibition of the pump and consequently, it becomes active and removes

Ca2 + from the cytosol. Subsequent decreases in intracellular Ca2+ levels eventually terminates the signal (Brini & Carafoli, 2011; Enyedi, Flura, Sarkadi,

Gardos, & Carafoli, 1987; Falchetto, Vorherr, Brunner, & Carafoli, 1991;

Falchetto, Vorherr, & Carafoli, 1992; James et al., 1988). Based on sequence

- 20 -

comparison between P-type ATPases, the predicted structure of PMCA consists of 10 helical transmembrane domains, two large intracellular loops, and amino- and carboxyterminal cytoplasmic tails (Brini & Carafoli, 2011; Verma et al., 1988)

(Fig 1.4). The first cytoplasmic loop between the first and third transmembrane contains an acidic phospholipid binding domain, one of two calmodulin binding sites and an A splice site (Zvaritch et al., 1990). The second cytoplasmic loop connects transmembrane domains four and five and contains an ATP binding site and the second calmodulin binding site (Rossi, Garrahan, & Rega, 1986;

Sarkadi, Szasz, & Gardos, 1980; Zvaritch et al., 1990). The transmembrane helices contain Ca2+ binding residues that co-ordinate each Ca2+ ion as it is extruded (Niggli et al., 1982). There are four PMCA isoforms, PMCA 1-4; products of 4 separate genes (Brandt, Ibrahim, Bruns, & Neve, 1992; Latif et al.,

1993; Olson, Wang, Carafoli, Strehler, & McBride, 1991; M. G. Wang et al.,

1994). The transcripts of each of these genes can be subject to alternative splicing. The sites in which splicing occurs are named A and C. Splicing at site

A alters the length of the first intracellular loop (A domain) that affects targeting while splicing at site C alters the length of the C-terminal tail that gives different regulatory and trafficking characteristics to the variants (Brandt et al., 1992;

Strehler & Zacharias, 2001). The splice variants achieved from splice site C have varying affinity and extent of activation. The products of splice site C are classified by a or b, depending on the translated c-terminal tail (Fig 1.4). a-splice forms generally show lower CaM affinity but higher basal (CaM-independent) activity than the b-splice forms (Enyedi et al., 1994). Currently about 30 splice

- 21 -

variants have been detected at the RNA or protein level. Although expressed ubiquitously, the expression of each PMCA isoform is tissue specific. Whereas

PMCA1 and PMCA4 are expressed in most tissues, PMCA2 and PMCA3 are expressed almost exclusively in excitable cells such as brain and striated muscle

(Brini & Carafoli, 2011). Detailed studies of the sub-cellular localization, regulation and kinetics reveal that different PMCA isoforms and variants function uniquely from each other to fulfill specific Ca2+ handling needs of a cell (Brown et al., 1996; De Jaegere, Wuytack, Eggermont, Verboomen, & Casteels, 1990;

Greeb & Shull, 1989; Reinhardt, Filoteo, Penniston, & Horst, 2000; Stauffer,

Guerini, & Carafoli, 1995). PMCA2/3 are activated faster in response to rises in intracellular Ca2+ when compared to PMCA1/4 (Caride et al., 2001). PMCA4a and 4b, which only differ by the length and sequence of the C-terminal tail, have different inactivation rates. The rate for CaM activation of PMCA4b is slow (t1/2 ~

2+ 1 min at 0.5 µM Ca ) compared to PMCA4a (t1/2 ~ 20 sec)(Caride et al., 1999).

Unfortunately, currently there is little known about the kinetic characteristics of

PMCA1.

As mentioned above, CaM is required for PMCA activation. In the absence of CaM binding (i.e. in unstimulated PMCA), PMCA have a poor affinity for

Ca2+ (Kd >10µM), essentially leaving PMCA inactive at resting cytosolic Ca2+ concentrations (Falchetto et al., 1991; Falchetto et al., 1992). This is due to autoinhibition from internal binding of the C terminal tail to both intracellular loops. When Ca2+-CaM binds to the C-terminal tail, a conformational change leads to displacement of the auto-inhibitory tail, lowering its Kd to values as low

- 22 -

as about 200 nM (Falchetto et al., 1991; Falchetto et al., 1992). Release of auto- inhibition has also been shown to be facilitated by other means, including by acidic phospholipids, protein kinase A- or C-mediated phosphorylation of specific serine/threonine residues in the C-terminal tail, partial proteolytic cleavage of the tail (e.g., by calpain or caspases), or dimerization via the C-terminal tail

(Hofmann, James, Vorherr, & Carafoli, 1993; James et al., 1988; Vanags, Porn-

Ares, Coppola, Burgess, & Orrenius, 1996; K. K. Wang et al., 1991). This multimodal regulation allows for the possible integration of multiple cellular pathways contributing to distinct regulation in different cell types.

- 23 -

- 24 -

FIGURE 1.4: Structure of PMCA (Adapted from (Strehler, 2013)). PMCA consists of an N-terminal domain, 10 transmembrane domains, 4 cytosolic loops and a regulatory C-terminal domain. Calmodulin (CaM) binding to the autohibitory domain (yellow) displaces the auto-inhibitory tail from the major catalytic domain (red). The two major sites of alternative splicing are also indicated, and the main C-terminal splice variants “a“ and “b“ are shown with separate C-tails to indicate their sequence divergence.

- 25 -

STIM1-mediated PMCA inhibition

Although still not shown in primary T cells, based on analyses in Jurkat T cell lines, it has been suggested that the predominant isoform in T cells is

PMCA4 (Caride et al., 2001). Recent investigations have identified a new mode of PMCA regulation in activated T cells revealing that the mechanisms regulating

Ca2+ signaling elevation in activated T cells are more complex than initially imagined. Hence, PMCA4 has recently been shown to be inhibited at the IS in activated T cells (Quintana et al., 2011; Ritchie et al., 2012), although disparate mechanisms were proposed for this phenomenon. In this section, I focus on the study I am an author on, which shows that STIM1 and PMCA not only co- localize, but are also physically associated at the IS (Ritchie et al., 2012). This interaction of PMCA with STIM1 reduces PMCA-mediated Ca2 + clearance thus leading to sustained elevation of intracellular Ca2+ levels (Fig 1.5). We also showed that a STIM1 mutant lacking the proline-rich domain (aa 600- 629) failed to associate with and inhibit PMCA activity despite exhibiting no defect in Orai1 activation. Intriguingly, examination of the dynamics of Ca2+ entry and release in activated T cells revealed an unexpected directionality to both. Hence, when extracellular Ca2+ was increased from 0 to 1 mM in store-depleted activated T cells, Ca2+ elevation occurred at the ‘cap’ side of the cell prior to the IS side of the cell. Further, when extracellular Ca2+ was again removed, cytosolic

Ca2+ concentration rapidly decreased at the cap side of the cell, but this recovery was delayed at the IS. This, combined with the apparent accumulation of STIM1,

PMCA4 and Orai1 at both the IS and the cap (Barr et al., 2008; Ritchie et al.,

- 26 -

2012) has led to the proposal that both the entry and exit Ca2+ occur predominantly at the cap in activated T cells, while accumulation of STIM1 at the

IS may primarily function as an inhibitor of Ca2+ clearance. Given the approximately 105-fold difference in Ca2+ concentration between the cytosol and the extracellular milieu, this mechanism would provide a remarkably energy efficient and simple strategy for locally elevating cytosolic Ca2+ concentration while still maintaining the capacity to remove Ca2+ in other parts of the cell to protect against Ca2+ overload. Based upon the ability of STIM1 and PMCA to co- immunoprecipitate in a manner dependent on the presence of the STIM1 proline- rich domain (Ritchie et al., 2012), it was tempting to speculate that STIM1 and

PMCA associate via a conformational coupling model similar to the manner in which STIM1 regulates Orai1. Indeed, using Förster Resonance Energy Transfer

(FRET), ongoing work in my current lab finds that STIM1 and PMCA closely interact in situ (unpublished observations). Future studies will focus on identifying possible molecular mediators of this interaction. Regardless of the mode of interaction, it is obvious that STIM1-PMCA4 interactions play an important role in shaping Ca2+ signals and thus may be important to physiological function of T cells. Identifying the functional effects of STIM1-mediated PMCA inhibition modulation is a major subject of this thesis and will be explored further.

- 27 -

- 28 -

Figure 1.5: Proposed model for co-ordination of Ca2+ signals in activated T cells (Samakai, Hooper, & Soboloff, 2013). Engagement of the T Cell Receptor

(TCR) by an antigen leads to the formation of the immunological synapse (IS).

Within the IS, STIM1, PMCA and POST accumulate, leading to inhibition of Ca2+ extrusion and local, sustained Ca2+ elevation. At the opposite end of the cell, a

‘distal cap’ forms, within which STIM1 and Orai1 accumulate. At this site, Orai1 activation leads to transient elevation of cytosolic Ca2+ levels from which Ca2+ can freely diffuse throughout the cell.

- 29 -

Mitochondrial Ca2+ uptake at the IS

Mechanism of Ca2+ uptake

Although the primary and most studied role of mitochondria is in ATP production, it has long been recognized Ca2+ fluxes across the inner mitochondrial membrane (IMM) contribute to cellular bioenergetics and regulation of cell death. Additionally, and more relevant to this thesis, mitochondria serve as

Ca2+ buffers which can contribute to shaping of Ca2+ signals within the cytoplasm

(Balaban, 2009; Denton & McCormack, 1980; Duchen, Verkhratsky, & Muallem,

2008; Glancy & Balaban, 2012; Gunter, Gunter, Sheu, & Gavin, 1994;

Hajnoczky, Robb-Gaspers, Seitz, & Thomas, 1995; Orrenius, Zhivotovsky, &

Nicotera, 2003). Although ions and uncharged small molecules can freely traverse across the outer mitochondrial membrane (OMM), the IMM is impermeable to most molecules with various transport proteins tightly regulating movement across the membrane and into the mitochondrial matrix. Ca2+ uptake is driven by the negative membrane potential (ΔΨ) generated by the respiratory chain across the IMM in which protons are pumped by the respiratory complexes toward the intermembrane space (IMS) (Rottenberg & Scarpa, 1974; Santo-

Domingo & Demaurex, 2010). Within the mitochondrial matrix, Ca2+ activates to several dehydrogenases and carriers leading to an increase in respiratory rate,

H+ extrusion and ATP production (Rizzuto, De Stefani, Raffaello, & Mammucari,

2012). Mitochondria have a low resting Ca2+ concentration of about 100 nM, but can increase to greater than 100uM in some stimulated cells(Marchi & Pinton,

2014). The molecular components of mitochondrial Ca2+ uptake have been

- 30 -

identified within the last few years. In the early 2000s, patch clamp studies on isolated mitoplasts revealed that Ca2 + influx was mediated by a highly

Ca2 + selective ion channel(Kirichok, Krapivinsky, & Clapham, 2004). Subsequent studies identified Mitochondrial Calcium Uniporter (MCU) as the high affinity, high permeability Ca2+ uniporter (reviewed in (Marchi & Pinton, 2014)). MCU is predicted to have two transmembrane domains connected with a short linker that contains several acidic residues, termed the DIME motif (Baughman et al., 2011;

De Stefani, Raffaello, Teardo, Szabo, & Rizzuto, 2011). High Ca2+ permeability of

MCU has been attributed to multiple occupancy of Ca2+ ions on the DIME motif. It has been shown that mutations of acidic residues within this motif leads to an attenuation of mitochondrial Ca2+ entry. Interestingly, the open probability of

MCU was shown to be nearly 100% with saturation levels reaching levels exceeding 20mM (Foskett & Philipson, 2015; Kirichok et al., 2004). Based on these observations, it was recognized earlier that regulatory mechanisms existed to limit MCU activity thus preventing potential Ca2+ overload.

Recent rapid developments have led to the recognition that MCU consists of a complex of regulatory proteins associated with a pore-forming subunit. One key regulator, Mitochondrial Ca2+ Uptake 1 (MICU1), was actually identified prior to the identification of MCU itself. Proteomic and structural analysis have suggested that MICU1 is a soluble protein residing in the intermembrane space

(Drago, Pizzo, & Pozzan, 2011; Nicholls, 2005). Although it was initially identified as the Ca2+ transporter (Perocchi et al., 2010), it is now accepted as a

‘gatekeeper’ of MCU. Indeed, in 2012, it was shown that cells in which MICU1

- 31 -

was knocked down were constitutively overloaded with Ca2+ (Mallilankaraman et al., 2012). Shortly after, another study showed that mitochondrial Ca2+ uptake is less efficient in the absence of MICU1 (Csordas et al., 2013). Bases on these data, MICU1 is regarded as dual functional; controlling the threshold of Ca2+ uptake and also contributing to the activation of MCU at high Ca2+ concentrations. Although other regulators have been identified in regulating MCU activity including EMRE and MICUR1, preferential focus has been placed on

MICU1 in this thesis due to the fact that it is, to date, the most extensively studied.

Ca2+ sequestration at IS

Until recently, mitochondrial-mediated Ca2+ signaling was not considered as important to T cell physiology as with other cell types like neurons and cardiomyocytes. It has previously been shown that mitochondria accumulate at the IS (Quintana et al., 2007; Schwindling, Quintana, Krause, & Hoth, 2010).

Interestingly enough, in contrast to the previously described finding that PMCA is inhibited by STIM1 at the IS (Ritchie et al., 2012), another study showed PMCA function was decreased due to localized sequestration of Ca2+ by mitochondria thereby decreasing PMCA pumping activity via loss of Ca2+ availability (Quintana et al., 2011). In this study, it was shown that TCR engagement induces colocalizion of PMCA and mitochondria at the IS. This colocalization resulted in enhanced global Ca2+ signals attributed to modulation of PMCA activity by mitochondria through possibly increased Ca2+ uptake. Disruption of mitochondrial translocation to the IS or inhibiting mitochondrial Ca2+ uptake both resulted in

- 32 -

increased Ca2+ levels at the IS (Quintana et al., 2011). Despite the different mechanisms offered between this study and the Ritchie et al study(Ritchie et al.,

2012), common to these 2 studies is that sustained Ca2+ signals at the IS are maintained via increased localization of multiple Ca2+ signaling molecules and altered functions. Given the importance of sustained TCR signals for T cell activation, it seems likely that these numerous changes in the localization and function of Ca2+ signaling molecules all contribute to the maintenance of the IS and TCR signaling. In this thesis, I focus on STIM1-mediated PMCA inhibition, although contribution of mitochondrial Ca2+ signaling components is considered is considered in my findings.

- 33 -

PART III: Downstream Effects of Ca2+ signals

Ca2+ signals have been shown to be crucial to both early and late downstream signaling events such as activation, gene expression, differentiation and effector function events. Discussed below are some key Ca2+-mediated processes at various stages post-TCR engagement.

Role in early TCR Activation

As aforementioned, TCR engagement leads to ITAM phosphorylation, primarily by Lck (Palacios & Weiss, 2004). In resting T cells, interactions between positively charged ITAMs and negatively charged phospholipids on the plasma membrane lead to ITAM insertion into the hydrophobic core of the PM, thereby minimizing potential contact with Lck and avoiding spontaneous phosphorylation

(Aivazian & Stern, 2000; DeFord-Watts et al., 2011; Xu et al., 2008). Recently, it was shown that Ca2+ elevation relieves this phenomenon via electrostatic interactions, thereby amplifying proximal TCR signaling at the earliest possible stage (Shi et al., 2013). Considering that elevated Ca2+ levels are sustained for hours after TCR engagement, this positive feedback likely facilitates sustained

TCR engagement by continually maintaining the availability of ITAMs for phosphorylation and signaling.

Immunological Synapse formation

An immunological synapse is formed at the interface of the T cell and

Antigen Presenting cell. TCR engagement induces actin cytoskeleton, organelle reorganization and re-distribution of membrane and intracellular signaling proteins (Fooksman et al., 2010). Interesting, Ca2+ elevation directly facilitates

- 34 -

gelsolin interactions with actin filaments, contributing to the rapid cytoskeletal changes occurring upon TCR engagement (Gremm & Wegner, 2000).

Additionally, it was recently shown that acutely blocking Ca2+ influx in Jurkat T cells and primary lymphocytes after the synapse was fully formed resulted in disrupted actin organization at the synapse (Hartzell, Jankowska, Burkhardt, &

Lewis, 2016). Therefore, SOCE is not only involved in cytoskeletal remodeling to form the IS, but was also required to maintain it. However, while increases in cytosolic Ca2+ are necessary for actin rearrangement, there is also evidence that cytoskeletal rearrangements may also shape downstream Ca2+ signals (Gomez et al., 2005; Nolz et al., 2006). Hence, interruptions to actinomyosin retrograde flow leads to loss of PLC-γ phosphorylation by Itk, halting DAG and InsP3 production (Babich et al., 2012). Additionally, Ca2+-dependent retrograde actin flow corrals ER tubule extensions and STIM1/Orai1 complexes to the synapse center, creating a self-organizing process for CRAC channel localization (Hartzell et al., 2016). Thus, it seems there exists feedback loops in which Ca2+ serves as a critical regulator of actin organization and dynamics at the synapse, which in turn modulate TCR-Ca2+ signaling.

Nuclear Factor of Activated T Cells (NFAT)

The key family of transcription factors to T cell activation is comprised of five nuclear factor of activated T cells (NFAT) proteins (Biswas,

Anandatheerthavarada, Zaidi, & Avadhani, 2003; Crabtree & Olson, 2002). They share a highly conserved DNA binding domain, the Rel homology region (RHR) as well as fourteen phosphorylation sites distributed among a transactivation

- 35 -

domain (TAD), serine-rich region (SRR), serine/proline (SP) motif, and lysine/threonine/serine (KTS) motif (Macian, 2005). As evidenced by immunodeficiencies arising from STIM and Orai mutations, T cells are dependent upon SOCe-induced increases in cytosolic Ca2+ content which drive NFAT activity during T cell activation. Inactive NFAT is heavily phosphorylated by the dual-specificity tyrosine-phosphorylation regulated kinases (DYRK), casein kinase (CK), and glycogen synthase kinase 3 (GSK3) and resides in the cytoplasm (Beals, Sheridan, Turck, Gardner, & Crabtree, 1997; Gwack et al.,

2006; Okamura et al., 2004; Porter, Havens, & Clipstone, 2000; Zhu et al., 1998).

Upon Ca2+ elevation, Ca2+/calmodulin activates the serine/threonine protein phosphatase calcineurin which dephosphorylates NFAT, allowing it to enter the nucleus and act as a transcription factor (Hogan, Chen, Nardone, & Rao, 2003;

Jain et al., 1993; Muller & Rao, 2010; H. Wu, Peisley, Graef, & Crabtree, 2007).

Critical for the success of this process is the persistence of the Ca2+ signal

(Dolmetsch, Lewis, Goodnow, & Healy, 1997) due to the relatively weak binding of NFAT to DNA, and to counteract the activity of kinases that regulate its export from the nucleus (Chen, Glover, Hogan, Rao, & Harrison, 1998; Macian, Lopez-

Rodriguez, & Rao, 2001). Hence, NFAT phosphorylation leads to export from the nucleus by allowing its nuclear export sequence (NES) to bind exportin protein chromosome maintenance 1 (Crm1). Conversely, NFAT dephosphorylation by calcineurin blocks the NES and allows transport into the nucleus via importins

(Gwack et al., 2006).

- 36 -

While NFAT5 is Ca2+-insensitive, NFATc1-c4 depend on Ca2+ signals for nuclear localization. The degree to which these different isoforms couple to the

Ca2+ signal exhibits marked differences. Hence, NFATc3 import and export occurs ~5-10 times the rate of NFATc2 (Yissachar et al., 2013). As such,

NFATc3 activity would tend to be turned on much more quickly than NFATc2, but might also tend to shut off quickly while NFATc2 activity would tend to persist through relatively short decreases in cytosolic Ca2+ levels. Recently, differences in the sensitivity of NFATc2 and NFATc3 to local vs. global Ca2+ content were observed, with NFATc2 translocation to the nucleus being closely matched to

CRAC activity, and NFATc3 relying more on increases in both local Ca2+ and within the nucleus itself (Kar & Parekh, 2015). Future investigations may provide further insight into subtype-dependent differences between these and other

NFAT isoforms in the process of T cell activation.

Nuclear Factor Kappa-Light-Chain-Enhancer of Activated B Cells (NF-κB)

Transcription factor NF-κB is also critical to T cell activation. Inhibition of

NF-κB is able to block T cell differentiation and proliferation in response to

αCD3/CD28 stimulation of the TCR(Costello et al., 1993). NF-κB proteins are a family of transcription factors that share a highly conserved DNA-binding Rel homology domain (Sullivan, Kalaitzidis, Gilmore, & Finnerty, 2007), and which form homodimers and heterodimers to target expression of different genes

(Gilmore, 2006). This includes cRel, RelA, and RelB, which contain transactivation domains, and p50 and p52 (processed forms of p100 and p105, respectively) which are only functional in complex with cRel, RelA or RelB .

- 37 -

In canonical NF-κB signaling, NF-κB proteins are kept inactive in the cytosol by inhibitory IκB proteins which exclude NF-κB from the nucleus and also block NF-κB DNA binding ability (Gilmore, 2006; Wegener et al., 2006). The IκB kinase complex (IKK) is composed of kinase subunits IKKα, IKKβ, and regulatory protein NEMO (Scheidereit, 2006). When IκB is phosphorylated by IKK complexes, it is ubiquitinated and degraded, releasing NF-κB to translocate to the nucleus (Vallabhapurapu & Karin, 2009). Although there are several TCR- dependent pathways leading to NF-κB activation, one of the key routes is downstream of PLCγ via Ca2+-independent DAG-mediated recruitment of PKCθ

(Y. Li, Sedwick, Hu, & Altman, 2005). Interestingly, T cells lacking expression of the NF-κB subunits p50 and cRel show decreases in activation-induced phosphorylation of ZAP70 and LAT, which serve as docking sites for PLC-

γ(Bronk et al., 2014). Correspondingly, decreases in PLCγ activity, proliferation, and IL-2 production are observed, revealing the existence of a feedback loop between PLCγ and NF-κB. Similar observations were made in PKCθ-/- T cells

(Bronk et al., 2014). The Tec family kinase Itk has been proposed as a potential link between PKCθ and PLCγ regulation, as Itk overexpression strongly activates

PLCγ, and Itk-deficient mouse T cells show similar Ca2+ signaling defects to

PKCθ-/-, p50-/- and cRel-/- T cells(R. Liu, Zhao, Gurney, & Landau, 1998; Sun et al., 2000; Tomlinson et al., 2004). Therefore, NF-κB may play an additional constitutive role in regulating PLCγ activation, thus regulating activation-induced

Ca2+ release(Bronk et al., 2014; Manicassamy, Gupta, & Sun, 2006).

- 38 -

NF-κB has long been considered a Ca2+-dependent transcription factor

(Dolmetsch et al., 1997; Frantz et al., 1994), although the mechanisms whereby

Ca2+ activates NF-κB have never been completely clear. This is at least in part due to the fact that, unlike NFAT, Ca2+ is not obligatory for NF-κB activity. Rather, there are Ca2+-dependent pathways that intersect with NF-κB signaling, which can lead to NF-κB activation. Indeed, unlike for NFAT, a Ca2+ signal is insufficient to activate NF-κB, generally requiring co-activation of PKC via the introduction of

PMA (Frantz et al., 1994). Further, unlike NFAT which requires sustained Ca2+ elevation for activation, NF-κB is fully engaged by transient Ca2+ responses

(Dolmetsch et al., 1997). There are at least 2 Ca2+-dependent pathways that have been identified as leading to IκBα degradation and NF-κB activation.

Hence, calcineurin has been shown to activate c-rel (Frantz et al., 1994) via inactivation of IκBβ(Biswas et al., 2003). More recently, Liu et al. found that Ca2+ influx via SOCe controls the nuclear localization and transcriptional activity of NF-

κB protein p65 via phosphorylation by PKCα (X. Liu et al., 2016). Irrespective of which pathway, it is clear that the Ca2+ and NF-κB signaling pathways crosstalk in multiple ways downstream of TCR engagements.

Future studies will require the use of genetically modified model systems combined with precise control of Ca2+ signals. In particular, future investigations using STIM1 and Orai knockout mice may provide new insights into Ca2+- mediated control of NF-κB signaling. Hence, patients with STIM1 or Orai1 deficiencies share symptoms with patients who have mutations affecting NF-κB activation. Immunodeficiency and ectodermal dysplasia was observed in patients

- 39 -

with mutations in NEMO and IκBα that impaired activation of NF-κB transcription

(Courtois et al., 2003; Doffinger et al., 2001; Feske, 2009; Puel, Picard, Ku,

Smahi, & Casanova, 2004). This may suggest closer relationships between

SOCE and NF-κB signaling than is currently recognized.

CREB-AP1 pathway

Although NFAT and NF-κB are the best studied Ca2+-dependent transcription factor in T cell activation, Ca2+ signaling modulates numerous other critical pathways. cAMP response element binding protein (CREB) is, best known as downstream of cAMP signaling, however, Ca2+ signals are also known to regulate its nuclear localization via calmodulin-dependent kinase IV (CaMKIV)- mediated phosphorylation (Yu, Shih, & Lai, 2001). CaMKIV binding to calmodulin is mutually exclusive from PP2A binding; therefore CaMKIV is kept inhibited and bound to PP2A until TCR activation leads to increases in Ca2+/calmodulin that displace PP2A and activate CaMKIV (K. A. Anderson, Noeldner, Reece,

Wadzinski, & Means, 2004). There, CREB binds to cAMP response elements to regulate the transcription of several genes including c-Fos, which forms part of transcription factor heterodimer AP-1 (Kuo & Leiden, 1999; Yu et al., 2001). AP-1 is critical for T cell activation, forming a complex with NFAT to induce the expression of a distinct subsets of genes (Chen et al., 1998; Macian et al., 2002).

Interestingly, over the long-term, Ca2+ signals also stimulate inhibitory pathways via the CREB modulator CREM which negatively regulating IL-2 production when phosphorylated by CAMKIV (Juang et al., 2005; Solomou, Juang, & Tsokos,

2001).

- 40 -

PART IV: STIM1 and T cell development

Early stages of thymic development

CLPs generated within bone marrow travel through the circulatory system into the thymus (D. Ma, Wei, & Liu, 2013), where they go through successive stages of T cell development, with each stage distinguishable by a temporally coordinated repertoire of cell surface receptors. Initially, T cell precursors lack both CD4 and CD8 expression and are referred to as Double Negative (DN) thymocytes. DN thymocytes proceed through 4 stages of differentiation within the cortex where extensive interactions with non-hematopoietic stromal cells dictate their progress towards maturity (G. Anderson & Jenkinson, 2001).

Rearrangement of the TCR (β, γ, and δ loci) and lineage commitment towards either the α/β or γ/δ lineages cannot be detected until the DN3 (CD25+CD44-) stage, at which point the TCR becomes critical for survival and differentiation.

Following lineage commitment, α/β T cells progress through the DN4 stage, progressively gaining a fully functional α chain and eventually migrate to the medulla. Here they begin to express CD4 and CD8 receptors (now referred to as

Double Positive (DP) thymocytes) (Starr, Jameson, & Hogquist, 2003).

Very little is known about the role of CRAC during early thymic development, however, there remains indirect evidence implicating the involvement of STIM1 at multiple developmental stages. For example, early thymic development is regulated by local levels of chemokines and cytokines

(Bunting, Comerford, & McColl, 2011), many of which signal via Phospholipase

C, thereby leading to STIM1-mediated Ca2+ entry. In addition, it was shown that

- 41 -

strong TCR signals drive differentiation towards the γ/δ fate via the transcription factor Early Growth Response 1 (EGR1) (Hayes, Li, & Love, 2005; Lauritsen et al., 2009). We have shown that EGR1 positively regulates STIM1 expression and that increases in STIM1 expression lead to more sustained Ca2+ signals in T cells

(Ritchie et al., 2012; Ritchie, Yue, Zhou, Houghton, & Soboloff, 2010). Hence,

TCR signal strength (and by extension, differentiation towards the γ/δ fate) could be determined, at least in part, by STIM1 expression. Interestingly, a recent paper concluded that STIM was dispensable for early thymic development based on relatively small differences in the numbers of DN, DP and SP cells (Oh-Hora et al., 2013). This conclusion contrasts with the severe developmental defects observed in thymocytes lacking PLC-γ (Fu et al., 2010), which requires STIM1 to maintain Ca2+ signals. Whether this difference reflects knockout-specific compensatory mechanisms or the involvement of alternative Ca2+ signaling mechanisms during early thymic development remains an important and unresolved question

- 42 -

- 43 -

Figure 1.6: Progression of T cell differentiation (Samakai et al., 2013).

Common Lymphoid progenitors (CLP) that arise from hematopoietic stem cells in the bone marrow migrate to the thymus near the cortico-medullary junction. Upon entry into the thymus, these precursors lack expression of CD4 and CD8 and are called double negative (DN). DN cells move through the cortex (orange) as they cells progress through DN subsets, DN1 (CD44+/CD25−) and DN2

(CD44+/CD25+). As these cells progress to the DN3 (CD44-/CD25+) stage, rearrangement of the TCR β, γ and δ loci is evident and two distinct lineages of T cells (α/β and γ/δ) form. Following lineage commitment after the DN4 stage

(CD44-/CD25−), α/β lineage cells migrate into the medulla (pink), expand and begin to express CD4 and CD8, a stage referred to as double positive (DP). As discussed in the text, DP cells undergo positive and negative selection before downregulating one of their CD4/CD8 receptors to become single positive (SP) cells which exit the thymus and enter the circulatory system. Within the periphery, these naïve SP cells can be activated upon exposure to antigens.

- 44 -

Positive Selection

During positive selection, highly motile DP cells within the cortex encounter self-peptide/major histocompatibility (pMHC) complexes on the surface of stromal cells. Low to moderate avidity interactions between pMHC complexes and the TCR lead to Ca2+ entry (Daniels et al., 2006) which promotes survival, maturation and commitment to either CD4 or CD8 lineage(Romagnani,

2006) via calcineurin/NFAT4 activation (Starr et al., 2003). Interestingly, using three dimensional imaging of thymic splices, it was shown that pauses of migrating thymocytes during positive selection coincide with persistent and substantial Ca2+ oscillations (Bhakta, Oh, & Lewis, 2005) that promote productive interactions between thymocytes and stromal cells. Interestingly, in the absence of PLC-γ, progression beyond the DP stage was severely compromised (Fu et al., 2010), yet STIM knockout thymocytes progressed to the semi-mature SP thymocyte stage (CD24+) before exhibiting a developmental delay (Oh-Hora et al., 2013). Similar to DN thymocytes then, progression through the DP stage involves PLC-dependent Ca2+ signals, yet the dependence upon STIM is not entirely clear. Whether or not this indicates the involvement of alternative Ca2+ signaling pathways is not known, although examination of Ca2+ signals in thymic slices (as in (Bhakta et al., 2005)) from STIM-KO mice could address this question.

- 45 -

Negative Selection

Post-positive selection, surviving T cells then migrate to the medulla where high avidity interactions between pMHC complexes on medullary epithelial cells and the TCR result in death by apoptosis, also known as clonal deletion.

This process leads to elimination of self-reactive T cells (Romagnani, 2006).

Intriguingly, STIM1-deficient mice exhibited a moderate increase in total CD8+ T cells after negative selection (Oh-Hora et al., 2013). If, in fact, this reflects defective negative selection, then this increase in CD8+ T cells could reflect subpopulations of self-reactive T cells which could lead to autoimmunity, which is observed in CRAC-deficient patients (Feske, 2010), although the link to negative selection is not entirely clear due to the additional loss of suppressive T cell subtypes discussed further below.

Non-Conventional T cell development

While the major developmental pathways were described above, there are a number of rare T cell subsets that are also generated within the thymus such as regulatory T cells (Tregs), invariant natural killer T cells (iNKT) and CD8αα intestinal intraepithelial lymphocytes (CD8αα-IELs) which function as negative regulators of T cell activation (Corthay, 2009; Ronchi & Falcone, 2008; van Wijk

& Cheroutre, 2009). Intriguingly, decreased precursor numbers of all three of these rare T cells is observed in the absence of STIM . Development of these rare T cell subsets is thought to arise from exposure to alternate cytokines that rescue DP thymocytes from strong antigen receptor signals that would normally result in clonal deletion (Wirnsberger, Hinterberger, & Klein, 2011). Therefore,

- 46 -

the fact that STIM-KO thymocytes exhibited decreased expression of CD122, the common β chain of IL-2 and IL-15 receptors provides a potential explanation for the unique dependence of these cell types on STIM expression. As such, during development, STIM-mediated Ca2+ signals serve a prominent multi-faceted role in the negative regulation of immune function.

- 47 -

PART V: Role of Early Growth Response Transcription Factors in T cells

Global changes in gene expression are a key feature of T cell activation.

As such induction or activation of key transcription factors is important for T cell function. As previously stated, TCR engagement leads to increases in STIM1 and PMCA expression, and these changes in expression are important for sustained Ca2+ signals in activated T cells (Ritchie et al., 2012).

The Early Growth Receptor (EGR) family of zinc finger transcription factors consists of 4 closely related members (EGR1-4) whose activity is induced by a wide variety of extracellular stimuli including activation, growth and differentiation signals, tissue injury and apoptotic signals(Beckmann, Matsumoto,

& Wilce, 1997; Gashler & Sukhatme, 1995). While EGRs are only transiently induced, the effects downstream of their activation could have relatively long term impacts. EGRs show extensive conservation along the DNA-binding zinc finger domains, displaying about 90% homology (Benos, Lapedes, & Stormo,

2002; Ritchie, Zhou, & Soboloff, 2011a). Nevertheless, their divergent flanking regions allow for separate and specific functions of individual proteins (Gallitano-

Mendel et al., 2007; Lee et al., 1996; Tourtellotte, Nagarajan, Bartke, &

Milbrandt, 2000; Wei, Xu, Qu, Milbrandt, & Zhuo, 2000). A major component of this thesis is how EGR1 and its family members affect expression of Ca2+ homeostatic proteins in T cells. Additionally, I explore their influence on T cell activation and function.

- 48 -

EGR regulation of Ca2+ homeostatic proteins

As stated above, Ca2+ signals are essential for T cell activation and function. In this thesis, I explore the transcriptional regulation of Ca2+ homeostatic proteins after TCR engagement. To date, the most extensively studied EGR has been EGR1 and it has been implicated in the expression of several Ca2+ homeostatic proteins. EGR1 has been shown to regulate SERCA expression(Arai et al., 2000; Hara et al., 2008) possibly through post- transcriptional mechanisms Brady et al., 2003). Additionally, EGR1 has also been shown to negatively regulate NCX (C. Wang, Dostanic, Servant, &

Chalifour, 2005) and the calcium binding protein, Calsequestrin (Kasneci,

Kemeny-Suss, Komarova, & Chalifour, 2009). More relevant to this thesis, it has been shown that EGR1 positively regulates STIM1 expression (Ritchie, Zhou, &

Soboloff, 2011b). In this study, analysis of several organs including the liver, spleen and brain from the EGR1 knockout (EGR1-/-) mouse revealed decreased expression of STIM1. This was also supported by transient knockdown of Human

Embryonic kidney (HEK cells), in which loss of EGR1 resulted in decreased

STIM1 expression and decreased Ca2+ entry(Ritchie et al., 2010). Interestingly, the EGR-/- thymus (which contains about 90% immature T cells) displayed an increase in STIM1 expression(Ritchie et al., 2010). Previous studies have reported functional compensation by EGR4 in EGR1-Dependent Luteinizing

Hormone Regulation and Leydig Cell Steroidogenesis (Tourtellotte et al., 2000); therefore in this thesis I hypothesize that EGR4 compensates for the loss of

EGR1 in immature T cells. As such, my investigation focuses on the contribution

- 49 -

of both EGR1 and EGR4 to STIM1 expression and their effects on Ca2+ signals and subsequent T cell activation and function.

EGRs in T cell development, Activation and Function

The roles of EGR1, EGR2 and EGR3 in T cell development and function have been well studied. EGR-responsive elements have been identified in the promoters of many pro-inflammatory genes including IL-2 (Skerka, Decker, &

Zipfel, 1995) and TNF-α (Kramer, Meichle, Hensel, Charnay, & Kronke, 1994).

Additional studies have shown that heterodimeric complexing between EGR family members and also with other transcription factors such as NFAT and NF-

κB (Cron et al., 2006; Decker et al., 2003). EGR family members have been shown to be differentially regulated and sometimes play different roles within each T cell subtype(Lohoff et al., 2010). For example, T helper type 2 (Th2) T cells express more EGR1 than T helper type 1 (Th1) T cells. This difference in expression allows Th2 cells to express substantially more IL-4 than Th1 cells thereby resulting differentiating their functions (Lohoff et al., 2010). Additionally, studies have revealed opposing functions between the EGRs in T cell activation;

EGR1 has been shown to promote T cell activation by enhancing IL-2, TNF-α,

CD154 and IL-2r transcription (Cron et al., 2006; Decker et al., 2003; Decker,

Skerka, & Zipfel, 1998; J. X. Lin & Leonard, 1997), whereas EGR2 and EGR3 have generally been characterized as negative regulators of T cell activation. It has been shown that EGR2 and EGR3 are upregulated when T cells are placed in anergy inducing conditions (i.e. in the absence of co-stimulation) and regulate the expression of genes involved in inhibiting T cell activation through inhibition

- 50 -

of EGR1 expression (Safford et al., 2005) and through positive regulation of activation suppressor genes such as Suppressor Of Cytokine Signaling-1

(SOCS1) and SOCS3 (S. Li et al., 2012). Their action also serves to optimize inflammatory responses against pathogens as loss of EGR2 and EGR3 results in autoimmune diseases due to the hyperactivation of T cells(S. Li et al., 2012). It should be noted that although generally characterized as a negative regulator, studies show that EGR2 can also exert positive regulatory effects. Recently,

EGR2 null T cells were shown to have defects in cytokine production such as IL-

4 and IFN-γ, proliferation and differentiation. This was shown both in vitro and in vivo after influenza virus infection (Du et al., 2014).

During thymic development, EGR1, EGR2, and EGR3 are induced by pre-

TCR signaling (Carleton et al., 2002). Overexpression of these proteins in thymocytes in the absence of stimulation leads to partial progression through the

β-selection checkpoint, indicating a significant role in thymic development

(Carleton et al., 2002). EGR1-null mice exhibit a dramatic increase in thymic cells, but maintain similar percentages of thymic subpopulations when compared to WT cells (Bettini, Xi, Milbrandt, & Kersh, 2002). Interestingly, there is currently no reported developmental defect downstream of DN differentiation. It has also been suggested that EGR1 may regulate positive selection by promoting both the survival and differentiation of TCR-signaled DP thymocytes (Bettini et al., 2002).

Loss of EGR2 in DP thymocytes results in decreases of the single positive (SP) T cells through mechanisms independent of negative selection(Lauritsen et al.,

2008). EGR3 null thymocytes do no progress efficiently through the DN3 stage

- 51 -

(Carter, Lefebvre, Wiest, & Tourtellotte, 2007; Xi & Kersh, 2004). Additionally,

EGR1/3 double knockout (DKO) results in thymic atrophy; a phenotype not observed when only one of the genes is knocked out (Carter et al., 2007).

Collectively, these studies show EGRs play crucial roles in T cell physiology.

Additionally, it seems that EGR family members can play redundant roles in regulation of certain genes. Interestingly, no significant role has emerged for

EGR4 in T cell physiology (Fig 1.7). Additionally, its expression has only been reported in cell lines, but not primary cells (Skerka, Decker, & Zipfel, 1997).

Although the EGR4 knockout (EGR4-/-) mouse was generated back in 1999, these studies focused on male infertility due to defects in spermatogenesis

(Carter et al., 2007; Tourtellotte, Nagarajan, Auyeung, Mueller, & Milbrandt,

1999; Tourtellotte et al., 2000). In this study we use this EGR4-/- mouse to assess the functional role of EGR4 in T cells.

- 52 -

- 53 -

Figure 1.7: Role of EGRs in T cell Development and Activation. (A)

Development: In conventional T cell development, β selection is associated with proliferation, survival and differentiation to the Double Positive (DP) Stage.

EGR1, EGR2 and EGR3 are upregulated in response to pre-TCR signaling to aid in progression from Double Negative (DN) stage to DP stage. EGR1 also plays a role in positive selection as evidenced by EGR1 null mice displaying a reduction in the number of Single Positive T cells. (B) Activation: EGRs induce (green text) or inhibit (red text) expression of various genes in response to TCR signaling. In the presence of costimulation, EGR1 positively regulates genes involved in TCR activation. To avoid an overactive immune response or in the absence of costimulation, EGR2 and EGR3 negatively regulate TCR activation by inducing expression of inhibitors of T cell activation. Additionally, they can also do this through inhibiting expression of genes involved in activation.

- 54 -

PART VI: EGR mediated Ca2+ Signaling in a Disease Model

Studies in human patients harboring genetic mutations in SOCe components and also studies in knockout mice lacking either STIM1 or Orai1 have revealed that SOCe is an important for immune function as dysregulated

Ca2+ signals can lead to immunodeficiency and autoimmunity (reviewed in (Shaw

& Feske, 2012)).The work in this thesis focuses on the identification and understanding of new mechanisms regulating Ca2+ signals with the hope that these studies may also eventually aid in the development newer therapies against relevant diseases As such, I looked at the contribution of transcriptional regulation of Ca2+ signaling to T cell dysfunction in an intact immune system. To do this, the Graft versus Host disease (GVHD) mouse model was used due to the extensive role of T cell function in its activation and progression (discussed below).

Graft-Versus-Host Disease

Currently, allogeneic hematopoietic stem cell transplantation (HSCT) is the only curative option available for many hematological malignancies like lymphomas. This procedure involves the transfer of hematopoietic stem cells from a genetically similar healthy donor to the patient (Blazar, Murphy, & Abedi,

2012). To prepare for HSCTs, patients undergo a myelosuppressive and immunosuppressive conditioning regimen which usually involves a course of cytotoxic drugs and/or irradiation (Blazar et al., 2012; Ramadan & Paczesny,

2015; Zeiser, Socie, & Blazar, 2016). Although this treatment depletes host stem cells making room for donor stem cells and decreasing risk of graft rejection, the

- 55 -

toxicity of the treatment can cause tissue damage and induce inflammation, frequently targeting the skin, liver, GI tract and thymus(Zeiser et al., 2016). This damage triggers a signaling cascade in which an immune response is mounted against host tissue resulting in organ damage, clinically characterized as

GVHD(Blazar et al., 2012; Owens & Santos, 1971; Zeiser et al., 2016). Clinically,

GVHD can present in two different forms, acute GVHD (aGVHD) and chronic

GVHD (cGVHD). They generally differ in pathogenesis, symptoms, and organ involvement. Classically, aGVHD develops within the first 100 days of transplantation with typical targets include gastrointestinal tract, skin, and liver. It affects up to 50% of the patients and accounts for 15% of post-transplantation mortality (Blazar et al., 2012). cGVHD mainly targets the skin, mouth, eye, and liver and develops later in about 50% of long term survivors of HSCT. Unlike aGVHD, the pathogenesis of cGVHD is not clearly understood, but seems to manifest more like an autoimmune disease. Here, we focus our discussion on the more clearly defined aGVHD.

Pathophysiology of GVHD

aGVHD is broadly categorized into three phases. In the first phase of

GVHD progression, following radiation and/or chemotherapy conditioning, damaged tissue triggers the release of inflammatory mediators like cytokines such as TNF-α and IL-1, reactive oxygen species (ROS), Patter-associated and

Damage-associated molecular patterns (PAMPs and DAMPs)(Kornblit et al.,

2010; Paczesny et al., 2010; Penack, Holler, & van den Brink, 2010; Ramadan &

Paczesny, 2015; Schwab et al., 2014). These signals allows activation of APCs

- 56 -

and innate effector cells such as macrophages (Hill, 2009). Apart from activation of APCs, the cytokines produced in the initial phase can cause direct tissue inflammation that allows T cells to access their target tissues. In the second phase, host APCs cross present host antigens to donor T cells(Shlomchik et al.,

1999). T cells are then activated and start proliferating and differentiating into diverse subset depending on the microenvironment they are exposed to. This stage is further enhanced by the presence of cytokines produced in the first phase (Bollyky et al., 2010). In the final phase, T cells respond to chemokines and migrate to target tissues(Wysocki, Panoskaltsis-Mortari, Blazar, & Serody,

2005) and trigger tissue damage through production of cytokines that mediate apoptosis like TNF-α and IL-1 and/or by killing mediated through direct interaction with cytotoxic T cells(Teshima et al., 2002; Theiss-Suennemann et al.,

2015).

Another key unique feature that precipitates GVHD is damage to the thymic epithelium (Boieri, Shah, Dressel, & Inngjerdingen, 2016). As mentioned in previous sections, negative selection during thymic T cell development plays a key role in induction of T cell tolerance toward self-antigens. Thymic damage due to initial conditioning and destruction from alloreactive donor T cells results in decreased negative selection leading to escape of autoreactive T cells. These cells are released into the periphery and have been shown to also contribute to the pathogenesis of chronic GVHD (Dertschnig, Hauri-Hohl, Vollmer, Hollander,

& Krenger, 2015). The identification of this mechanistic link between acute and

- 57 -

chronic GVHD provides new potential of finding potent therapies that target

GVHD on a broader spectrum.

Treatment of aGVHD

Despite progress understanding transplant immunology and its underlying causes, aGVHD, remains a major cause of morbidity and mortality in transplant patients. As mentioned above, cellular components of both the innate and adaptive immune system have been implicated in the progression of aGVHD.

Current studies show that targeting Dendritic cells and other APCs could have therapeutic potential in preventing aGVHD (Markey et al., 2009; Toubai et al.,

2012). Additionally, clinical studies have shown that depletion of B cells reduces the incidence and severity of aGVHD (Kharfan-Dabaja & Cutler, 2011;

Shimabukuro-Vornhagen, Hallek, Storb, & von Bergwelt-Baildon, 2009).

Nevertheless, studies have shown that T cell activation is the most potent instigator of aGVHD. Indeed, T cell depletion from the graft has been shown to eliminate GVHD (Prentice et al., 1984; Zeiser et al., 2016). However, the presence of donor T cells has been shown to be beneficial in mounting immune responses against cancer cells in the recipient, commonly referred to as the Graft versus Tumor (GVT) effect (Weiden et al., 1979). Thus although T cell depletion is beneficial in the prevention of aGVD, the increase in risk of cancer relapse rates associated with it have limited its use as a major therapy (Apperley et al.,

1988). Interestingly, a subset of T cells, memory T cells have been shown to mediate GVT responses, but do not appear to induce GVHD (Wan et al., 2008;

Zheng et al., 2008). Currently, there are ongoing clinical trials assessing whether

- 58 -

the transfer of memory T cells alone is an effective approach to preventing aGVHD (Blazar et al., 2012). The current standard primary therapy for aGVHD is systemic corticosteroid treatments (Blazar et al., 2012). This treatment has anti- inflammatory and immunosuppressive effects and although beneficial, comes with a plethora of side effects including congestive cardiac failure, myopathy and osteoporosis (Blazar et al., 2012; Owens & Santos, 1971). Today, the major focus of aGVHD research is finding therapies that specifically target various point of signaling in TCR activation, proliferation, cytokine and chemotaxis that can impede overall alloreactive T cell activity while maintaining enough function to maintain the benefits of GVT, and prevent opportunistic infections and graft failure. There are several different approaches used or being tested including small molecules, antibodies and chemotherapeutic agents that target different stages of T cell activation and function in GVHD (reviewed in (Dhir, Slatter, &

Skinner, 2014) ). For example, calcineurin inhibitors like cyclosporine A (CsA) or tacrolimus (FK506) are used to target NFAT activation in patients with GVHD, but these treatments are often accompanied by severe side effects and loss of

GVT responses (Blazar et al., 2012). Downstream events of TCR engagement are also targeted including chemotaxis of T cells. For example, agonists against chemokine receptors CCR5 and sphingosine 1-phosphate receptor (S1PR) are being currently being evaluated in a clinical study as it was shown that T cell egress from lymph nodes and subsequent migration to target organs is inhibited agonists of these chemokines (Taylor et al., 2007; Taylor et al., 2012).

Additionally, antibodies against components of SOCe are also being evaluated

- 59 -

for their therapeutic potential (Cox et al., 2013). Nevertheless, today no single treatment has proven to be efficacious for treating aGVHD and maintaining GVT effects. In this thesis, we assess the contribution of transcriptional control of Ca2+ signaling to features of aGVHD progression and later discuss the therapeutic potential of inhibiting components of this pathway.

- 60 -

CHAPTER 2: STATEMENT OF GOALS

The T-Cell Receptor (TCR) is a complex of integral membrane proteins that participates in the activation of T cells in response to the presentation of antigen. When T cells are engaged by antigen presenting cells, an immunological synapse forms resulting in TCR-mediated phospholipase C-γ (PLC-γ) activation and the release of Ca2+ from intracellular stores. Increased cytosolic Ca2+ in turn leads to calcineurin activation which dephosphorylates Nuclear Factor of

Activated T cells (NFAT), resulting in its nuclear translocation (J. Lin & Weiss,

2001; Smith-Garvin, Koretzky, & Jordan, 2009). Due to the presence of nuclear kinases, this translocation is highly transient; sustained nuclear localization of

NFAT therefore requires sustained Ca2+ elevation. This thesis focuses on the understanding the regulation and impact of recently identified regulatory mechanisms that allow for maintenance of elevated cytosolic Ca2+ levels on T cell physiology.

A central mediator of elevated Ca2+ levels is the endoplasmic reticulum transmembrane protein, Stromal Interaction Molecule 1 (STIM1). Decreases in

ER Ca2+ content are ‘sensed’ by STIM1, causing it to translocate within the ER towards the PM where it interacts with the Orai1 channel, resulting in its activation and Ca2+ influx (reviewed in (Soboloff et al., 2012)). It has been well established that this is a required event for nuclear localization of NFAT activation and T cell activation (Gwack et al., 2008; Oh-Hora et al., 2013; Oh-

Hora et al., 2008). It was recently published that in addition to stimulating Ca2+

- 61 -

entry, translocation of STIM1 and plasma membrane Ca2+/ATPase 4 (PMCA4) to the immunological synapse leads to loss of PMCA4 function and a decreased

Ca2+ clearance rate (Quintana et al., 2011; Ritchie et al., 2012). Based on this, I hypothesized that transcriptional control of STIM1 and PMCA4 resulted in altered

Ca2+ signals which led to efficient activation of NFAT. A major aim of this thesis was to understand the effects of this inhibition of Ca2+ clearance on activation and downstream effector functions both in vitro and in vivo.

Upon TCR engagement, both STIM1 and PMCA4 become upregulated

(Ritchie et al., 2012). Since STIM1 knockdown attenuated its ability to inhibit

PMCA4 while STIM1 overexpression led to PMCA4 inhibition independent of T cell activation state, I hypthothesized that transcriptional mechanisms regulating the expression of these proteins may be the first step in the engagement of this interaction. In a previous study, it was shown that the transcription factor Early

Growth Response 1 (EGR1) is a positively regulator of STIM1 expression(Ritchie et al., 2010). Although EGR1 upregulation was observed with T cell activation

(Ritchie et al., 2012), no loss of STIM1 expression was observed in EGR1 knockout (EGR1KO) thymus (Ritchie et al., 2010). EGR1 is a member of the

EGR family of zinc finger transcription factors; the roles of the remaining 3 family members in STIM1 regulation was not determined. It has been shown that EGR family members can regulate the same genes. Based on this, I hypothesized that

EGR1 or its family members are capable of regulating STIM1 expression.

- 62 -

CHAPTER 3: MATERIALS AND METHODS

PART I: Reagents

Antibodies

Anti-STIM1 (#4149) was from Cell Signaling Technologies. Anti EGR1 (C-

19) was from Santa Cruz (San Diego, CA). Horseradish peroxidase‐conjugated goat anti‐rabbit and rabbit anti‐mouse antibodies were obtained from Invitrogen

(CA). Anti-Human CD3 and Anti-Human CD28 are from Affymetrix (CA).

Ca2+ Imaging

Fura-2/acetoxymethylester, Thapsigargin were from EMD Biosciences

(San Diego, CA).

PART II: Cell Culture

Jurkat T cells and thymocytes cells were cultured in RPMI1640 supplemented with 10% FBS and antibiotics. All cells were maintained at 37°C;

5% CO2.

CD4 an CD8-positive T cells: cells were isolated from mouse spleens using the EasySep® CD4/CD8 negative selection kits following the manufacturer’s instructions, and were cultured in RPMI1640 supplemented with

10% FBS and antibiotics in the presence of 2 ng/mL recombinant interleukin-2.

For T cell activation, cells were incubated on plates coated with 10 ug/mL murine anti CD3 and costimulated with 5 ug/ml soluble anti CD28 or activated with 3 ug/ml of soluble anti CD3/CD28 (as indicated by experiment).

- 63 -

PART III: Animal Colonies

Maintenance

C57/Bl/6 wildtype and both homozygous and heterozygous EGR1 and

EGR4 knockout mice were maintained in our animal housing facilities for breeding purposes in accordance with our approved IACUC protocol (#3221).

DNA isolation

In order to genotype our mice, mouse tails were clipped (0.5 cm) and incubated overnight in lysis buffer (100 mM Tris pH 8.5, 5 mM EDTA, 200 mM

NaCl, 0.2 % SDS, 10 mg/ml Proteinase K) at 55o C, cleared by centrifugation and genotyped by PCR.

Genotyping PCR conditions for EGR1 knockout

PCR reaction ran for 5 min at 94oC followed by 34 cycles of 94oC 1 min,

55oC 14 sec, 72oC 1.5 min

Genotyping PCR conditions for EGR4 knockout

PCR reaction ran for 2 min at 94oC followed by 35 cycles of 94oC 10 sec,

60oC 30 sec, 72oC 1 min

- 64 -

Table 2.1: PCR primers for genotyping

Target Sequence EGR1 Forward AACCGGCCCAGCAAGACACC EGR1 Reverse GGGCACAGGGGATGGGAATG EGR1 Neo Forward CTCGTGCTTTACGGTATCGC EGR4 Forward CGGCGGCGAAGGCGGAGAGT EGR4 Reverse TGGTCGCTGCGGCTGAAGTTGC EGR4 Neo Forward CGGAACACGGCGGCATCAGAG

PART IV: Cytosolic Ca2+ Measurements

Cells were plated on coverslips coated with either poly-L-Lysine (Sigma) or anti-CD3 and anti-CD28 antibodies (Affymetrix) and placed in cation-safe solution (107 mM NaCl, 7.2 mM KCl, 1.2 mM MgCl2, 11.5 mM glucose, 20 mM

Hepes-NaOH, 1 mM CaCl2, pH 7.2) and loaded with fura-2/acetoxymethylester (2

µM) for 30 min at 24°C. Cells were washed, and dye was allowed to de-esterify for a minimum of 30 min at 24°C. Approximately 85% of the dye was confined to the cytoplasm as determined by the signal remaining after saponin permeabilization. Ca2+ measurements were made using a Leica DMI 6000B fluorescence microscope controlled by Slidebook Software (Intelligent Imaging

Innovations; Denver, CO). Fluorescence emission at 505 nm was monitored while alternating between 340 and 380 nm excitation wavelengths at a frequency of 0.67 Hz; intracellular Ca2+ measurements are shown as 340/380 nm ratios obtained from groups (35 to 45) of single cells. For measurement of Ca2+

- 65 -

clearance, cells were cultured in serum-free medium containing 0.5 % BSA for 12 hours prior to a 2 hr activation period before beginning each experiment. To both induce SOCe and measure PMCA-mediated Ca2+ clearance, the function of

SERCA was inhibited by the addition of thapsigargin (Tg; 2 µM). Ca2+ was added after recovery of cytosolic Ca2+ content and then removed once peak levels had been reached to measure Ca2+ clearance (see Fig 4.4A in Results section) .

Non-linear regression constants for clearance assays were calculated the

(-X/ τ ) (-X/ τ ) (-X/ τ ) equations: Y=B + A1*e 1 + A2*e 2 or Y= B + A1*e 1 , where B is the plateau of decay, τ1 and τ2 are time constants for the fast and slow phase, respectively. A1 and A2 are the amplitudes for the fast and slow phase of decay, respectively. X is time.

PART V: Chromatin Immunoprecipitation

Chromatin immunoprecipitation (ChIP) assays were performed according to the protocol provided by Upstate Biotechnology, Inc., with minor modifications, as previously described (Tempera, Klichinsky, & Lieberman, 2011; Tempera,

Wiedmer, Dheekollu, & Lieberman, 2010). Additional modifications were as follows: Cells were fixed in 1% formaldehyde for 15 min. DNA was sonicated using a sonic Dismembrator (Fisher Scientific) to generate 200- to 300-bp DNA fragments. Real-time PCR was performed with SYBR green on a 7300 Real

Time PCR machine (Applied Biosystems) using 1% of the ChIP DNA. Chromatin was immunoprecipitated with a polyclonal antibodies for EGR1 (Santa Cruz) and

IgG (Santa Cruz).

- 66 -

PART VI: Protein Analysis

Cell lysis

Cells were lysed in Chaps lysis buffer (35 mM CHAPS, 150 mM NaCl,

100 mM Tris-HCl, 10 mM EDTA pH 8.0 with protease inhibitors), cleared by centrifugation and normalized for protein content (determined using the DC protein assay kit; BioRad).

SDS PAGE

For western blot, protein extracts (25 µg per lane or total immunopreciptant) were resolved on SDS-polyacrylamide gels and electroblotted onto Bio-Rad Immun-Blot PVDF membranes. The percentage of the SDS gel was 10% based on the resolution needed to view our target proteins. The resulting PVDF membranes were blocked (1h, room temperature) in Tris- buffered saline-Tween 20 (TBST; 10 mM Tris-HCl, pH 8.0, 150 mM NaCl, 0.1%

Tween 20) containing membrane blocking agent (5% BSA) (Sigma) and subsequently incubated with corresponding primary antibodies (1h, 22°C).

Membranes were washed three times (5 min) in TBST and incubated with secondary antibody (1h, IgG conjugated to horseradish peroxidase).

Subsequently, membranes were washed three times (5 min) in TBST followed by a single wash (5 min) in Tris-buffered saline (TBS; 150 mM NaCl,10 mM Tris-

HCl, pH 8.0). Peroxidase activity was visualized using the ECL kit as according to the manufacturer’s instructions (Amersham Biosciences) with FluorChem HD2 imaging system from Alpha Innotech.

- 67 -

PART VII: Quantitative PCR

RNA extraction

RNA was extracted using RNA Bee reagent (Teltest). Briefly, 1 ml of

RNA bee reagent was added per 10 cm culture dish. Homogenate was stored on ice for 5 min followed by the addition of 0.2 ml chloroform to allow for phase separation. The mixture was incubated at room temperature for 10 minutes and then centrifuged at 4°C at 12,000g for 15 minutes. Aqueous phase was removed and mixed with 0.5 ml Isopropanol followed by centrifugation at 4°C at 12,000g for 5 minutes to allow for RNA precipitation. RNA was then washed with 1ml ethanol followed by centrifugation at 4°C at 6,000g for 5 minutes. cDNA Synthesis cDNA synthesis was carried using High Capacity cDNA Reverse Transcription

(Applied Biosystems) as per manufacturer’s instructions.

RT-qPCR

RT-qPCR was completed as a two-step process using High Capacity cDNA

Reverse Transcription (Applied Biosystems) followed by Sybr Green PCR

(Applied Biosystems) on a 7300 Real Time PCR machine (Applied

Biosystems).The real-time reaction was carried out by a ten min incubation at

95°C and 40 cycles at 95°C for 15 seconds and 60°C 1 min for annealing. Data is presented as a level relative to the expression of control sequence

- 68 -

Table 2.2: Oligonucleotide sequences of primers used for qPCR

Target GenBank Orientation Sequence (5’-3’)

Human EGR1 NM_001964.2 Forward CCCTCAATACCAGCTACCA Reverse TCCACTGGGCAAGCGTAA Human EGR2 NM_001136178 Forward CAAGTTCTCCATTGACCCTC Reverse GGTGACGCTGGATGAGG Human EGR3 NM_001199881.1 Forward GCCAGGACAACATCATTAG Reverse TAGAGGTCGCCGCAGT Human EGR4 NM_001965 Forward GCGAAGGCGGAGAGTTCCT Reverse CTGAAGTTGCGCAGGCAGATG Human STIM2 NM_00119118.1 Forward TAAGGGTGGTGGACTATCT Reverse TATTCCCTATGCCTTGTG Human Orai1 NM_032790.3 Forward CGCTGACCACGACTACCCA Reverse CTCCTTGACCGAGTTGAGATT Human Orai2 NM_001271819.1 Forward CCTCATCTTCGTGGTCTT Reverse CTCGATCTCGCGGTTG Human Orai3 NM_152288.2 Forward GGGGCTCGTGTGTTTGTG Reverse GCAGGCGATTCAGTTC Human MICU1 XM_005269386.2 Forward TGTGCGATCCATAACACCCAATGA Reverse TCGTTCCTGGGAAATTTTCTTTCCA Human TBP NM_001172085.1 Forward CAGCCGTTCAGCAGTCAA Reverse GGAGGGATACAGTGGAGT Mouse EGR1 NM_007913.5 Forward CGATGGTGGAGACGAGTT Reverse GCGGCCAGTATAGGTGAT Mouse EGR2 NM_010118.3 Forward TCCCGTATCCGAGTAGC Reverse TTGCCCATGTAAGTGAAG Mouse EGR3 NM_001289925.1 Forward CGACTCGGTAGCCCATTACA Reverse AGTAGGTCACGGTCTTGTTGC Mouse EGR4 NM_020596.2 Forward CAGCGACCACCTCACCA Reverse CTGTGCCGTTTCTTCTCGT Mouse CCR7 NM_007719.2 Forward GGCAGACATCCTTTTCCTCCT Reverse CCTTACACAGGTAGACGCCA Mouse cMET NC_000068.7 Forward GGAACTGGCTACTGCTCTGG Reverse CATGCCAAGCGTTCTGCTAC Mouse GAPDH NM_008084.3 Forward CTCGCTCCTGGAAGATGG Reverse ATTCAACGGCACAGTCAA

- 69 -

PART VIII: Transfection Protocols

Standard Electroporation protocol

DNA constructs and RNA sequences were introduced by electroporation using the Gene Pulser Xcell Electroporation system (Bio-Rad) under cell specific conditions. Before electroporation, cells were harvested, centrifuged and resuspended in 500 µl of OPTI-MEM (GIBCO). This cell suspension was then transferred to an Eppendorf Electroporation cuvette (4 mm gap, 800 µl volume).

Elecctroporation protocol settings for Jurkat T cells were as follows; Protocol type: exponential, Volts: 250, Pulse length: NA, Number of pulses: 1,

Capacitance: 300 µF, Resistance: 1000Ω. After electroporation, the cell suspension is transferred to a petri dish and left in the incubator in OPTI-MEM +

Glutamax. 3 Hours after electroporation, 10% serum is added.

Amaxa Nucleofection protocol

Transfections were carried out using the nucleofactor™ device corresponding kits (Amaxa, Inc., Cologne Germany). Transfection protocols were performed following the manufacturer's instructions using the X-005 program or modified using OPTI-MEM instead of proprietary SE solution and supplement.

Transfection efficacy was determined to be comparable (Fig 2.1)

- 70 -

- 71 -

Fig 2.1: Amaxa Transfection using different solutions. STIM1 knockout T cells generated using CRISPR Cas9 based genome modification where co- transfected with a YFP-STIM1 plasmid, NFAT-luciferase plasmid and a renilla plasmid using the Amaxa kit. The three solutions used were the proprietary supplemented SE solution (Amaxa Sltn), Gibco’s Opti-MEM media (Opti) and 1X

Phosphate Buffered Saline. A) Expression of STIM1 was assessed using western blotting and was found to be comparable using any of the media. B)

Cells were also treated with CD3/CD28 antibodies for 6 hours and luciferase activity was assessed using a GloMax®-Multi Detection System (Promega). Cells transfected using the Amaxa solution had higher generally higher readouts than the other two conditions, but overall fold increase between untreated and treated cells was similar in all 3 conditions.

- 72 -

Table 2.3. Summary of DNA constructs

Insert Vector Tag Antibiotic

resistance

Human WT STIM1 pIRES YFP Amp

Human STIM1 pIRES YFP Amp

Δ597**

Human EGR1 pPac none Kana

Human EGR2 unknown none Amp

Human EGR3 unknown none Amp

Human EGR4 pCMV6 DDK-Myc Kana

*STIM1Δ597 truncation is at aa 597

- 73 -

Table 2.4: Summary of RNAi sequences and constructs

Target Sequence (5’-3’) Position

Human EGR1 siRNA CAUCCAACGACAGCAGUCCCAUUUA 854

(Invitrogen) GCUUUCGGACAUGACAGCAACCUUU 1493

Human EGR4 siRNA GCGAUGAGAAGAAACGGCACAGCAAA 1733

(Invitrogen)

Human STIM2 siRNA AAGGCAAGGAGUGUGGUGUGUGUUG 2170

(Invitrogen)

Human PMCA4 Proprietary. Cat:SR300346, SR300349 N/A siRNA (Origene)

- 74 -

PART IX: CRISPR/CAS9 system targeting human STIM1 and stable cell line generation

Human CRISPR/CAS9 guide RNA(gRNA) primers were designed at

CRISPR.MIT.EDU, targeting exon 1 of human STIM1. Two STIM1 gRNA sequences were chosen based on predicted specificity: STIM1gRNA:

5’TATGCGTCCGTCTTGCCCTG-3’ and 5’AGGCGACAGGAACCA GCTCG-3’.

These sequences were cloned into the pSpCAS9 (BB)-2A-Puro (PX459) and pYSY-gRNA-mCherry vectors, generously provided by Jian Huang (Temple

University). The plasmids were then co-transfected into Jurkat cells by electroporation using Gene pulser (Bio-Rad, Hercules, CA, USA). Cells were selected with 2 μg/ml puromycin, sorted for mCherry expression and then cloned.

After several weeks of growth, cells were screened for loss of SOCe by fluorescence microscopy; successful deletion of STIM1 was confirmed by

Western analysis and sequencing (Genewiz).

PART X: Functional Assays

Luciferase reporter gene assay

The enzymatic activity of NFAT and STIM1 was quantified by using the

Dual-Luciferase Reporter Assay System (Promega, Madison, WI, USA) according to the manufacturer's instructions. After 48 h transfection with 8 μg o luciferase reporter gene and 2 μg of Renilla gene to normalize for luciferase activity and control for transfection efficiency, Jurkat T cells were activated with antibodies against CD3 and CD28 for 8 hrs. Cell lysates were prepared and

- 75 -

luciferase activity was measured with a GloMax®-Multi Detection System

(Promega)using the dual-luciferase reporter system according to the manufacturer (Promega). Note: The STIM1 luciferase vector was generated by insertion of a 780 bp sequence (-538 to +242 bp; synthesized by Genscript) from the Human STIM1 promoter into a firefly luciferase vector (hereafter referred to as S1-Luc).

Cytokine Expression assay

Donor CD4+ and CD8+ T cells were derived from WT or EGR4-/- B6 mice were transplanted with B6 T cell depleted (TCD) bone marrow into lethally irradiated BALB/C recipients. At indicated time points after transplantation, the spleen cells and liver T cells were collected and stimulated with CD3 (1g/ml) +

CD28 (1g/ml) antibodies for 6 hours. Brefeldin A (5g/ml) was added to the culture for the last 5 hours. The cells were collected for flow cytometry.

Graft versus Host (GVH) competitive Assay

WT CD4+ and CD8+ T cells (0.5x106 cells for each) were derived from

B6/SJL mice (CD45.1+, H2b+) and EGR4-/- CD4+ and CD8+ T cells (0.5x106 cells for each) T cells were derived from B6 mice (CD45.2+). All cells derived from WT and EGR4-/- mice were mixed at a ratio of 1:1 and transplanted with B6 T cell depleted (TCD) bone marrow (5x106) into lethally irradiated BALB/C (H2d+) recipients. Cells were recovered from the spleen and liver at day 4 using flow cytometric analysis.

- 76 -

Flow cytometry

Flow cytometry was carried out by staining the cells with the relevant antibodies at saturating concentrations in PBS plus 2% FBS and analyzing them on a

FACSAria (BD Biosciences). The following mAbs were obtained from eBioscience PE anti-CD4 (clone GK1.5), PE-CY7 anti-CD3 (clone 145-2C11),

FITC anti-Cd8 (clone 53-6.7) and were used according to the manufacturer’s protocol.

Proliferation Assays

Cell proliferation assays were performed with CellTiter96 Aqueous Solution

Cell Proliferation Assay kit (Promega; Madison, WI) measured with a GloMax®-

Multi Detection System (Promega) at 490nm absorbance after a 2-hour incubation.

Migration Assays

After isolation, T cells were resuspended in RPMI 1640 supplemented in

10%FBS. Chemokine solutions (CCL9 cat: RD172385150 or HGF cat:

RBG20077020; Biovendor) were added to the lower chambers of a 5um pore size Disposable chemotaxis system plate Cat: 116-5 (Neuroprobe). 50ul cell suspensions (50,000 cells) were added to the top of the plate and allowed to migrate for one hour. Migrated cells were counted using a hemacytometer.

- 77 -

PART XI: Statistical Analysis

Prism software (GraphPad, San Diego) was used for statistical analysis.

Results were analyzed using the Student’s t test to assess significance and one- way and two-way ANOVA as indicated. Values of * p<0.05, ** p<0.01, *** p<0.001 and **** p<0.0001 were considered statistically significant. Error bars were shown to represent standard error of the mean (SEM).

- 78 -

CHAPTER 4: RESULTS

PART I: EGR-mediated STIM1 Upregulation during T cell activation

Modulates Ca2+ Signals and NFAT Activation

Control of STIM1 and PMCA4 expression by the EGR family of transcription factors

In a prior study investigating control of STIM1 expression by EGR1, it was observed that EGR1 deficiency caused marked loss of STIM1 expression in kidney, liver, spleen and brain, but not in whole thymus (Ritchie et al., 2010).

Insensitivity of thymic STIM1 expression to EGR1 deficiency could reflect thymus-specific compensation by other EGR family members. Hence, it was important to assess whether other EGR family members can regulate STIM1 expression in T cells. Accordingly, I coexpressed each EGR isoform in Jurkat T cells together with a luciferase reporter controlled by the proximal STIM1 promoter containing multiple EGR binding sites (Fig 4.1A). For unknown reasons, ectopic expression of EGR3 and EGR4 was considerably higher than EGR1 or

EGR2, despite equivalent transfection efficiencies, (Fig 4.1B). Nevertheless, these experiments clearly showed that only EGR1 and EGR4 could induce reporter expression (Fig. 4.1C). This indicates that EGR1 and EGR4 exhibit the capacity to activate the STIM1 promoter, while EGR2 and EGR3 lack this ability.

Interestingly, the ability of EGR4 to compensate for loss of EGR1 function was previously reported for control of Luteinizing Hormone expression (Tourtellotte et al., 2000). Given that EGR1 and EGR4 share unique capacity among EGR family

- 79 -

members to control STIM1 transcription, I assessed the potential relevance of dual regulation by EGR1 and EGR4 for controlling STIM1 expression in a T cell model, as outlined below.

- 80 -

- 81 -

Figure 4.1: Modulation of STIM1 expression by EGR4 knockdown (Samakai et al., 2016). Jurkat T cells were transfected with each our STIM1 Luciferase along with each EGR family member and the Renilla control vector. (A) The vector map of a STIM1 luciferase vector in which EGR binding site containing region of the STIM1 promoter was inserted 5’ to the luciferase gene. (B)

Overexpression of each EGR was verified with quantitative PCR. Each bar represents relative expression of each gene in overexpressed cells to control cells (C) Luciferase activity obtained from cells 24 hours after transfection. Each bar represents relative luciferase activity in overexpressed cells to control cells.

Statistical analysis was performed by one way ANOVA with Dunnett’s multiple comparisons test.

- 82 -

Redundant EGR1/EGR4-mediated control of STIM1 and PMCA4 expression

To assess the relative roles of EGR1 and EGR4 as regulators of STIM1 expression, each gene was knocked down in Jurkat T cells using a specific

RNAi. The effect of knockdown was compared in unstimulated versus anti-

CD3/CD28 activated Jurkat T cells. Activation led to rapid upregulation of EGR1 protein, as revealed by Western blot (Fig. 4.2C; presumably the same is true for

EGR4 protein, although there is no suitable antibody to detect it). RNAi-mediated knockdown attenuated EGR1 induction by ~50% and EGR4 induction by 40%

(Fig 4.2A-D). Neither individual knockdown led to any significant reduction in

STIM1 expression in Jurkat T cells under either control or activated conditions.

However, knockdown of both EGR1 and EGR4 caused a significant reduction in

STIM1 expression in cells activated with anti-CD3/CD28 antibodies (Fig 4.2C,E).

Given our previous finding that T cell activation also leads to increased expression of PMCA4 (Ritchie et al., 2012), I examined whether this PMCA4 upregulation was dependent on EGR1 and/or EGR4. Interestingly, like STIM1,

PMCA4 was significantly reduced in response to simultaneous knockdown of

EGR1 and EGR4, but not individual knockdown in activated cells only (Fig

4.2C,F). To the best of my knowledge, this is the first evidence that EGR1 and

EGR4 cooperatively regulate either STIM1 or PMCA4 expression.

- 83 -

The level of expression of any protein reflects both the rate of translation and the rate of degradation. While it was initially surprising to see rapid reduction in both STIM1 and PMCA4 expression upon T cell activation it is important to recognize that upregulation of protein degradation pathways is a defining feature of T cell activation (Bronietzki, Schuster, & Schmitz, 2015; Deretic, Saitoh, &

Akira, 2013; Puleston & Simon, 2014; Valdor et al., 2014). Hence, the somewhat modest increases in STIM1 expression observed without EGR1/EGR4 knockdown may actually reflect a much larger EGR1/EGR4-dependent increase in STIM1 transcription/translation, tempered by increased protein degradation.

Considering that EGR1 and EGR4 are transcription factors, a study of protein of protein degradation pathways were outside the scope of this study. Instead, I have focused on direct transcriptional effects of EGR1 and EGR4. To determine whether EGR-mediated control of both STIM1 and PMCA4 expression is direct, I examined EGR binding to their proximal promoters by ChIP.

- 84 -

- 85 -

Figure 4.2: EGR1/4 are both required for STIM1 expression (Samakai et al.,

2016). The expression levels of STIM1 and PMCA4 were determined after knockdown of EGR1 and/or EGR4. (A, B) Knockdown of both EGR1 (A) and

EGR4 (B) were confirmed by qPCR. (C) Representative Western blot of EGR1,

STIM1 and PMCA4 expression levels in Jurkat T cells transfected with EGR1 and/or EGR4 siRNA. Cells were activated with anti-cd3 and anti-cd28 antibodies for the time periods indicated. (D-F) Densitometric analysis of EGR1 (D), STIM1

(E), PMCA4 (F) expression level determined from Western blots as depicted in panel C (n=3). Data were analyzed by two way ANOVA with Fisher’s multiple comparisons. In panel D, data marked by ‘a’ was statistically different from data marked by ‘b’ (p < 0.05). In panels E and F, statistically different data was marked by * (p < 0.05)

- 86 -

Defining EGR binding sites on the STIM1 and PMCA4 promoters

It has been previously shown that EGR1 binds directly to the STIM1 promoter in HEK293 and G401 rhabdoid tumor cells (Ritchie et al., 2010), but T cells were not examined. These studies identified 4 EGR consensus sites within the STIM1 promoter, 2 of which were shown to be functional (Ritchie et al., 2010)

(Fig 4.3A; blue regions in DNA segments labelled -433 and +56). Additional analysis of proximal sequences near the STIM1 transcriptional start site (TSS) revealed another potential site about 200 bp further upstream (Fig 4.3A; blue regions in DNA segments labelled -594). Similar analysis of the PMCA promoter revealed 2 potential EGR response elements upstream of the TSS and 1 downstream of the TSS (Fig 4.3E). Given my hypothesis that EGR1 and EGR4 regulate STIM1 expression in conjunction, it would be ideal to determine by ChIP whether each of these sites binds EGR1, EGR4 or both. However, since ChIP- quality EGR4 antibodies are not currently available, the analysis was restricted to

EGR1. Unstimulated T cells do not show any EGR1 binding to either the STIM1 or PMCA4 promoters (Fig 4.3B,F), since they do not express detectable EGR1

(Fig 4.2). Upon activation, substantial EGR1 binding was observed at each putative consensus site within the STIM1 and PMCA4 promoters (Fig 4.3B, F).

As expected, transfection with EGR1 siRNA eliminated EGR1 binding at all sites

(Fig 4.3C,G). Interestingly, EGR4 knockdown decreased EGR1 binding to both the STIM1 and PMCA4 promoters; particularly the PMCA4 promoter and the +56 site of the STIM1 promoter where no significant EGR1 binding could be detected in activated cells (Fig 4.3D,H). These observations indicate that decreased EGR4

- 87 -

expression has a substantial negative impact on EGR1 binding and support a cooperative model in which EGR4 promotes binding of EGR1 to the STIM1 and

PMCA4 promoters, thereby facilitating upregulation of both STIM1 and PMCA4 upon T cell activation.

- 88 -

- 89 -

Figure 4.3: ChIP analysis of EGR1 binding to the STIM1 and PMCA promoter in T cells (Samakai et al., 2016). (A,E) Sequence analysis reveals several putative EGR binding sites near the STIM1 and PMCA4 transcriptional start sites. (B, F) Analysis of ChIP efficiency by qPCR reveals distinct binding patterns for EGR1 before and 2 hrs after T cell activation. EGR1 binding was also assessed after EGR1 (C,G) and EGR4 (E,F) RNAi. Data were analyzed by two way ANOVA with Tukey’s multiple comparisons test.

- 90 -

Loss of both EGR1/4 expression affects Ca2+ clearance and not Ca2+ entry

Given the primary role of STIM1 and PMCA4 as regulators of Ca2+ signalling, Ca2+ entry and clearance assays were performed using a modified version of a previously described approach (Ritchie et al., 2012), to test whether

EGR knockdown impairs Ca2+ signalling. Briefly, Jurkat T cells were plated on either poly-L-lysine (control) or anti-cd3/28 antibodies (activated) for 2 hrs, and then, treated with thapsigargin (Tg) in the absence of extracellular Ca2+ to deplete ER Ca2+ stores. Subsequent addition of extracellular Ca2+ induces a change in cytosolic Ca2+ that reflects Store-operated Ca2+ entry (SOCe), while the rate at which cytosolic Ca2+ returns to baseline after extracellular Ca2+ removal reflects PMCA-mediated Ca2+ clearance (Fig 4.4A). Ca2+ clearance was fit to exponential decay, utilizing an F-test to determine whether or not 2-phase or

1-phase decay was appropriate. Consistent with prior studies (Ritchie et al.,

2012), Jurkat cells transfected with scrambled RNAi showed close fit of Ca2+ clearance to 2-phase exponential decay (see Table 4.1), while cd3/cd28-induced activation delayed the 2nd, slower phase of Ca2+ clearance (Fig 4.4B). However, after knocking down EGR1 and EGR4, no activation-induced PMCA inhibition was observed (Fig 4.4C,E). Moreover, after EGR1/4 knockdown, the second, slow Ca2+ clearance phase was severely attenuated, such that the difference in τ was reduced from a 4 to 6-fold difference in WT Jurkat cells to an only 2-fold difference in resting cells (Fig 4.4E; Table 4.1). Further, after activation, the second phase of Ca2+ clearance was essentially eliminated with no significant difference between τ1 and τ2 (Table 4.1). As expected, Tg responses were

- 91 -

similar in cells transfected with scrambled or EGR1 and EGR4 siRNA (Fig. 4.5), so differences in store depletion or SERCA inhibition did not contribute to these changes. Finally, since EGR1 and EGR4 are transcription factors with multiple targets, STIM1 was co-expresssed with EGR1 and EGR4 siRNA to assess the

STIM1 dependence of the Ca2+ clearance differences reported above. Co-

2+ expression of STIM1WT with EGR1 and EGR4 siRNA both restored 2-phase Ca clearance dynamics and profoundly delayed the second Ca2+ clearance phase

(Fig 4.4D; Table 1). In contrast, co-expressing siRNA targeting EGR1 and EGR4 with STIM1Δ597, a truncation mutant incapable of inhibiting PMCA, failed to restore the 2nd phase of Ca2+ clearance (Fig 4.4D; Table 4.1). Based on these findings, it seems clear that during T cell activation, EGR-mediated STIM1 upregulation is a required component of delayed Ca2+ clearance.

STIM1 is most widely studied as a required component of SOCe and I initially predicted that increases in STIM1 expression would lead to increases in

SOCe. As such, it was initially somewhat surprising that changes in STIM1 expression had relatively small effects on Ca2+ entry (Table 1, Fig 4.4F, 4.6).

Thus, although a significant increase in peak Ca2+ levels was observed between non-activated EGR1/EGR4 siRNA-transfected cells and those activated with cd3/cd28 or co-transfected with STIM1WT or STIM1Δ597, no differences were observed between these stimulated groups. This is consistent with past reports that STIM1 overexpression alone has very little effect on the magnitude of SOCe unless co-expressed with Orai1 (Mercer et al., 2006; Peinelt et al., 2006;

Soboloff, Spassova, Hewavitharana, et al., 2006; Soboloff, Spassova, Tang, et

- 92 -

al., 2006). This likely reflects a relative STIM1:Orai1 expression ratio that is above that necessary for optimal SOCe. While we do not have any data on the stoichiometry of STIM1-PMCA4 interactions, the sensitivity of Ca2+ clearance dynamics to STIM1 expression levels suggests a somewhat different ratio than that observed for STIM1 and Orai1.

Although the changes were relatively small, it was consistently observed that cells transfected with EGR1/EGR4 siRNA exhibited statistically significant activation-dependent increases in SOCe (Fig 4.4F). Considering that STIM1 expression levels were decreased under these conditions (Fig 4.2C, E), this finding was somewhat surprising, so this scenario was further explored. Because

STIM2 expression also increases when Jurkat T cells are activated(Ritchie et al.,

2012), the potential contribution of STIM2 levels to this phenomenon was assessed. Consistent with a prior report, activating Jurkat T cells leads to an increase in STIM2 expression (Ritchie et al., 2012)(Fig 4.4G). However, transfecting cells with siRNA targeting both EGR1 and EGR4 also increased

STIM2 expression, with no further activation-dependent differences observed

(Fig 4.4G). To assess how elevated STIM2 expression contributes to SOCe in control and activated Jurkat T cells, STIM2 expression was decreased with RNAi

(Fig 4.4H). Interestingly, this manipulation eliminated all activation-dependent differences in peak SOCe, irrespective of the level of expression of EGR1 or

EGR4. On the basis of this finding, the EGR-dependent differences in peak

Ca2+entry were attributed primarily to differences in STIM2 rather than STIM1 expression. Future investigations may shed new light into the dynamics of this

- 93 -

functional shift in STIM dependence. In my efforts to Ca2+ entry mechanisms in

EGR1/EGR4 siRNA-transfected cells, I also noticed an increase in expression of

Orai1 and MICU1 (Fig 4.7). Although not assessed in this thesis, it is not far- fetched to assume that these changes in these and other Ca2+ homeostatic proteins may contribute to maintained Ca2+ entry in these cells and as such should be a focus of future studies.

- 94 -

- 95 -

Figure 4.4: EGR1/4 knockdown reduced activation-dependent inhibition of

Ca2+ clearance (Samakai et al.). Ca2+ entry and clearance was measured in

Jurkat T cells plated for 2 hrs on coverslips coated with poly-L-lysine (control) or anti-CD3/CD28 (3 µg/ml; activated). ER Ca2+ stores of fura-2-loaded cells were

2+ depleted with Tg (2 µM) in the absence of [Ca ]e. (Sample of whole trace shown

2+ 2+ in (A)). Subsequent elevation of [Ca ]e to 1 mM led to elevated [Ca ]c; the rates

2+ 2+ of Ca clearance were then measured starting from the point that [Ca ]e was again removed. (B,C,E) Ca2+ clearance measured in T cells transfected with scrambled RNA (B) or both EGR1 and EGR4 siRNA (C,E). (D) Ca2+ clearance measured in T cells transfected with both EGR1 and EGR4 siRNA along with

2+ either STIM1WT or STIM1Δ597. (F) Peak Ca entry was measured from experiments depicted in panels B through E and compared in all conditions by one way ANOVA with multiple comparisons. ** indicates P < 0.01 in comparison to non-activated cells transfected with EGR1/4 siRNA. (G)STIM2 expression was measured in control cells and cells transfected with both EGR1 and EGR4 siRNA. H) T cells transfected with STIM2 siRNA and efficiency was determined using RT-qPCR. I) Cells were treated as indicated and peak Ca2+ entry was assessed

- 96 -

- 97 -

- 98 -

Figure 4.5: EGR1/4 knock-down does not alter the Tg-releasable Ca2+ pool

(Samakai et al., 2016): ER Ca2+ stores of fura-2-loaded Jurkat T cells transfected with either scrambled or both EGR1 and EGR4 siRNA and plated for

2 hours on coverslips coated with poly-L-lysine were depleted with Tg (2 µM) in the absence of extracellular Ca2+. (A) Representative traces of Tg-evoked Ca2+ responses (B) Area under the curve (A.U.C) between Tg addition and return to baseline was calculated from multiple traces and plotted using Graph Pad Prism

6.0. Data was acquired from 3 separate experiments consisting of 40 to 60 cells each. No significant differences in Tg-induced Ca2+ release were observed (p >

0.05). Note that F340/380 ratios were normalized to Rmin to minimize inter- experimental variability.

- 99 -

- 100 -

Figure 4.6: EGR1/4 knock-down or STIM1 over-expression does not significantly alter the peak Ca2+ entry (Samakai et al., 2016): Ca2+ entry and clearance was measured in Jurkat T cells transfected with either scrambled siRNA (A), siRNA targeting both EGR1 and EGR4 alone (B) or in combination with expression plasmids containing STIM1WT or STIM1Δ597 (C) as outlined in figure 4. (D,E) Jurkat T cells were transfected with STIM2 siRNA alone (D) or combination with siRNA targeting both EGR1 and EGR4 (E) prior to measuring

Ca2+ entry and clearance as depicted in figure 4. Prior to experimentation, cells were plated for 2 hrs on coverslips coated with poly-L-lysine (control) or anti-

CD3/CD28 (3 µg/ml; activated). ER Ca2+ stores of fura-2-loaded cells were

2+ 2+ depleted with Tg (2 µM) in the absence of [Ca ]e followed by elevation of [Ca ]e

2+ to 1 mM leading to elevated [Ca ]c. Note that F340/380 ratios were normalized to

Rmin to minimize inter-experimental variability.

- 101 -

Role of STIM1-mediated PMCA inhibition for control NFAT activation in activated T cells

NFAT activation is critical for T cell activation and highly sensitive to changes in cytosolic Ca2+ content. Therefore, I assessed whether or not inhibition of Ca2+ clearance contributes to NFAT activation in stimulated Jurkat T cells by comparing NFAT luciferase activity in cells expressing STIM1WT or STIM1Δ597.

For these studies, CRISPR–Cas9 system was used to generate STIM1-null

Jurkat T cells. Cells were transfected with 2 plasmids to introduce both Cas9 and

2 gRNA sequences targeting STIM1 exon 1 (see methods). Cells were cloned and then screened using SOCe to identify candidate cell lines exhibiting STIM1 deletion (Fig 4.8). Clear loss of SOCe was observed in both clones #1 and #2.

Therefore, these cells were transfected with empty vector, STIM1WT or STIM1Δ597 followed by Western analysis and Ca2+ entry and clearance assays. Western analysis revealed successful STIM1 deletion in both cell lines (Fig 4.9A, B). The

STIM1WT or STIM1Δ597 moieties expressed with similar efficiency, although higher expression was observed in clone #1. The activation-induced inhibition of Ca2+ clearance was examined, observing a clear delay in the 2nd phase of Ca2+ clearance in cells expressing STIM1WT, but not STIM1Δ597 (Fig 4.9C,E). I next analysed NFAT activity by co-expressing each STIM moiety with an NFAT luciferase vector generously provided by Dr. Joel Pomerantz (Johns Hopkins

University). While no luciferase activity was observed without STIM1 re- expression, re-expression of STIM1WT, but not STIM1Δ597 led to a modest increase in NFAT-driven luciferase activity in unstimulated cells in clone #1, but

- 102 -

not clone #2 (Fig 4.9D,F). Activation with anti-CD3/CD28 antibodies led to many- fold increases in NFAT-luciferase activity in either clone, although clone#2 was considerably more responsive than clone#1 (Fig 4.9D,F). Despite these apparent clonal differences in the efficiency of STIM1 re-expression and NFAT-luciferase activity, I observed a 50% reduction in luciferase activity in cells expressing

STIM1Δ597 relative to STIM1WT. Since there were no differences in the expression of either STIM1 moiety (Fig 4.9A,B) and no differences in their ability to facilitate

Ca2+ entry (Fig 4.4F, 4.5), these findings reveal a previously unidentified role for

STIM1-mediated PMCA4 inhibition for control of NFAT activity during T cell activation.

- 103 -

****

6 0 0

C T L P

E G R 1 /4 K D

B T

/

n 4 0 0

o i

s

s

e r

p x

E **** 2 0 0

N S

N S 0

i1 i2 i3 1 a a a U r r r C O O O I M

Figure 4.7: Altered expression of Ca2+ homeostatic proteins after EGR1/4 knock-down. Jurkat T cells transfected with either scrambled or both EGR1 and

EGR4 siRNA and mRNA expression of Orai1, Orai2, Orai3 and MICU1 was assessed using RT-qPCR. Data were analyzed by two way ANOVA with Sidak’s multiple comparisons test.

- 104 -

- 105 -

Figure 4.8: Crispr-Cas9 knock-out of STIM1 in Jurkat T cells (Samakai et al.,

2016). Jurkat T cells transfected with Crispr-Cas9 constructs targeted to human

STIM1 were cloned and screened for the presence of STIM1 protein by Western blot (A) and loss of SOCe by fura-2 imaging (B) Clones 1 and 2 were selected for further analysis while all other clones were stored in liquid nitrogen and not examined further. Note that F340/380 ratios were normalized to Rmin to minimize inter-experimental variability.

- 106 -

- 107 -

Figure 4.9: PMCA inhibition is required for NFAT activation (Samakai et al.,

2016): STIM1-KO Jurkat T cells were transfected with STIM1WT or STIM1Δ597 and activated with anti-cd3 & anti-cd28 antibodies. (A, B) STIM1 expression levels were determined in STIM1-KO#1 (A) and #2 (B) after transfection with empty vector, STIM1WT or STIM1Δ597. Expression differences were validated by

Western analysis. (C, E) Ca2+ clearance was measured in STIM1-KO#1 (C) and

#2 (E) transfected as in panel A after plating on poly-lysine (Control) or anti- cd3/cd28 for 2 hrs. (D,F) STIM1-KO#1 (D) and #2 (F) were transfected as in panel A, except for the inclusion of the NFAT luciferase and Renilla vectors. Cells were incubated in either media or anti-cd3/cd28 for 8 hrs before lysis and quantitation of luciferase activity. Data was first normalized to renilla fluorescence followed by normalization to control NFAT luciferase activity. Two way ANOVA with Tukey’s multiple comparisons revealed significant activation- and STIM1- dependent differences in NFAT activity with 3 statistically significant groups marked as ‘a’, ‘b’ and ‘c’ (p < 0.001).

- 108 -

PART II: Assessing Functional Consequences of EGR-mediated Ca2+

Modulation in T cells using an in vivo model

Expression of EGR4 in Primary T cells

In the first part of thesis, I look at the regulation of STIM1 by EGRs in

Jurkat T cells and its effect on T cell activation. In the second part of this thesis, I use WT, EGR1-/- and EGR4-/- mice to investigate if my prior results can be recapitulated in primary T cells and also to assess the physiological relevance of

EGR mediated expression to Ca2+ signals and T cell function.

Although EGR4 expression has been shown in Jurkat T cells (Skerka et al.,

1997), to date, EGR4 expression levels in primary T cells have not been reported. Additionally, most studies have focused primarily on steady state expression levels whereas we know that EGR genes are dynamically regulated and are primarily expressed in activated T cells. Therefore, I examined both

EGR1 and EGR4 expression in thymocytes, CD4 positive (CD4+) and CD8 positive (CD8+) T cells isolated from wildtype (WT) before and after stimulation with anti-CD3 and anti-CD28 antibodies (Fig 4.10). As with EGR1 expression, while very low EGR4 expression could be detected in unstimulated cells, many- fold increases in EGR4 expression were observed in immature in all 3 subtypes

(Fig 4.10). This is first time induction of EGR4 expression has been reported in T cells to the best of my knowledge. Interestingly, expression of both EGR1 and

EGR4 are most increased (i.e largest fold difference of expression in activated cells compared to control) in CD8+ T cells upon stimulation. In the first part of this thesis, I show that EGR1 and EGR4 can regulate STIM1 expression, thus I also

- 109 -

assessed STIM1 expression in these cells (Fig 4.10C). Like EGRs, STIM1 expression increased with stimulation. Again, STIM1 expression was induced the most in CD8+ T cells. Overall, I show that both EGR1 and EGR4 are expressed in primary T cells. Large increases in EGR1 and EGR4 expression correlate with large increases in STIM1 observed in CD8+ T cells, thus supporting my previous work in the first half of this thesis that EGR1 and EGR4 regulate STIM1 expression in T cells (Samakai et al., 2016).

- 110 -

c t l a n ti-C D 3 /C D 2 8

H 8 0 A : E G R 1 7 5 B : E G R 4

6 C : S T IM 1

D P

A 6 0

) G

/ 5 0

0 4

n

0

o 1

i 4 0

X

s

( s

e 2 5 2

r 2 0

p

x E 0 0 0

P + + P + + P + + D 4 8 D 4 8 D 4 8 D D D D D D C C C C C C

Figure 4.10: EGR4 is expressed in Primary T cells: Double Positive, CD4+ and CD8+ T cells were isolated from WT mice and expression of EGR1 (A),

EGR4 (B) and STIM1 (C) before and after 2 hour stimulation was assessed using

RT-qPCR

- 111 -

EGR4 is involved in thymic development

Unlike EGR4 knockout mice, T cells development in EGR1 knockout T cells has been extensively characterized (see introduction). To address how

EGR4 expression might affect the development of T cells, population analyses on thymic samples were done using flow cytometry in these mice. WT and

EGR4-/- mice displayed similar numbers of double positive (DP) and single positive (SP) T cells (Fig 4.11A,B). However, in the double negative (DN) population, there was a marked developmental shift towards DN4 at the expense of DN2 and DN3 (Fig 1C; quantified in Fig 4.11C,D). Interestingly, beta-selection and lineage separation occurs during the DN3 stage (Ciofani, Knowles, Wiest, von Boehmer, & Zuniga-Pflucker, 2006). And enhanced progression through these stages in the absence of an altered CD4/CD8 distribution has been suggested to indicate a development shift towards γδ T cell generation,(Xiong &

Raulet, 2007). Therefore, a suggested future direction of this study is to assess changes in γδ T cells. Notably, EGR1KO mice do not exhibit a similar shift

(Bettini et al., 2002), implying distinct developmental roles for these transcription factors.

- 112 -

- 113 -

Figure 4.11: EGR4 plays a role in DN development: T cell populations from

WT and EGR4-/- thymic samples were analysed using flow cytometry. (A) CD4+,

CD8+, DP and DN populations percentages were assessed (quantified in B). (C)

DN1-4 population percentages were assessed (quantified in D). Data were analyzed by two way ANOVA with Sidak’s multiple comparisons test

- 114 -

Control of STIM1 expression by EGR4 in primary T cells

In the first half of this thesis, I show that simultaneous knockdown of both

EGR1 and EGR4 is required to abolish EGR-mediated STIM1 upregulation upon

T cell activation in Jurkat T cells (Samakai et al., 2016). To assess the relative contributions of EGR1 and EGR4 in primary T cells, I examined STIM1 expression in WT, EGR1-/- and EGR4-/- thymoctes, CD4+ and CD8+ T cells using western analysis. Cells were incubated with anti-CD3/CD28 antibodies for the indicated time periods (Fig 4.12). Although basal STIM1 expression in WT and EGR4-/- thymocytes was similar, increases in STIM1 expression upon

CD3/28 stimulation were only observed in WT thymocytes and not in EGR4-/- thymocytes (Fig 4.12A,B). In contrast, basal STIM1 expression in EGR1-/- thymocytes was higher compared to WT and EGR4-/- thymocytes. This supports previously reported data showing increased expression of STIM1 in crushed

EGR1-/- thymuses(Ritchie et al., 2010) possibly indicating compensation by other transcription factors (including EGR4) in the absence of EGR1 in the thymus.

Nevertheless, stimulation of these cells leads to reduced levels of STIM1 to match those observed in unstimulated WT and EGR4-/- thymocytes. Overall these data indicate that both EGR1 and EGR4 are required for STIM1 upregulation and maintenance in primary thymocytes.

Both Wildtype CD4+ and CD8+ T cells show a consistent increase in

STIM1 expression after stimulation (Fig 4.12C,D), although only CD8+ increases appear to be significant. Loss of either EGR1 or EGR4 have varying effects on

STIM1 expression depending on cell type. CD8+ T cells require both EGR1 and

- 115 -

EGR4 to maintain basal level expression of STIM1 and upregulate it upon stimulation; Loss of both EGR1 or EGR4 in CD8+ T cells leads to both reduced basal level expression and an inability to increase STIM1 expression after stimulation. On the other hand, STIM1 upregulation in CD4+ T cells seem to be more dependent on EGR1. EGR1-/- CD4+ T cells have similar basal STIM1 expression to WT CD4+ T cells, but expression is dramatically reduced upon stimulation. I explored whether loss of STIM1 expression in these cells (also seen in EGR1-/- thymocytes) upon activation could be due to proteolytic and/or autophagic degradation, both of which have been shown to be activated in stimulated T cells (Bronietzki et al., 2015; X. Wang, Luo, Chen, Duguid, & Wu,

1998), but could not implicate either pathway (data not shown). EGR4-/- CD4+ T cells show increased basal STIM1 expression when compared to WT cells which was maintained upon stimulation. It is possible that this increase could indicate either a compensatory mechanism by other transcription factors or the potentiation of a transcriptional pathway that is otherwise negatively regulated by

EGR4. Nevertheless, changes in STIM1 expression patterns upon loss of EGR1 or EGR4 indicate involvement of EGRs in STIM1 expression in these T cell subsets. Additionally, differences in response to loss of EGRs indicate varying dependence on EGRs in regulating STIM1 expression between subsets. Overall, these data show that EGR1 and EGR4 regulate STIM1 expression in primary T cells. These data also indicate that EGR1 and EGR4 possibly work co- operatively, especially in thymocytes and CD8+ T cells, as loss of only one of these factors is enough to impede upregulation of STIM1 expression. However, I

- 116 -

do recognize that regulation of STIM1 in primary T cells probably integrates signals from multiple transcriptional factors contributing the complexities of these results.

- 117 -

- 118 -

Figure 4.12: STIM1 expression is dysregulated in EGR4-/- T cells:

Experiments were performed on freshly isolated T cells obtained from wildtype,

EGR1-/- and EGR4-/- mice. (A) Thymocytes were incubated on plate-bound

CD3/CD28 antibodies for 0,2,4 hrs before lysis and western analysis as depicted

(quantified in B). (C) (quantified in D) CD4+ and CD8+ cells were isolated from splenocytes by negative selection using beads before incubating on plate bound

CD3/28 antibodies for 0 or 2 hrs before lysis and western analysis as depicted.

Data were analyzed by two way ANOVA with Sidak’s multiple comparisons test

- 119 -

EGR4 regulates Ca2+ Clearance Inhibition

Although the functional consequences of the loss of EGR1-3 have been explored in single positive (SP) primary T cells (see introduction), little is known about the functional role of EGR4 in these cells. Additionally, I show that EGR- mediated changes in STIM1 expression upon activation in T cells result in slower

Ca2+ clearance leading to defects in T cell activation (Ritchie et al., 2012;

Samakai et al., 2016). To examine the role of EGR4 in Ca2+-dependent T cell function, Ca2+ entry and clearance assays were performed using a modified version of a previously described approach (Ritchie et al., 2012) to test whether

EGR4-/- impairs Ca2+ signalling. As expected, CD4+ and CD8+ WT T cells plated on CD3/28 antibodies exhibit a fairly dramatic Ca2+ clearance delay (Fig. 4.13);

EGR4-/- CD4+ T cells displayed drastically faster clearance when compared to

WT cells analysed under identical conditions (Fig 4.13A). This was somewhat surprising as STIM1 levels were increased in activated EGR4-/- CD8+ T cells. As

EGRs have been implicated in the regulation of several Ca2+ homeostatic proteins (see introduction), it is possible that loss of EGR4 in CD4 T cells leads to faster clearance through alterations of other Ca2+ handling mechanisms including mitochondrial Ca2+ loading (see discussion). Activated EGR4 -/- CD8+ cells also displayed faster clearance than WT, although the difference was less dramatic than that observed with CD4+ T cells (Fig 4.13B). Additionally, EGR-mediated changes in STIM1 expression seem to affect only clearance, but maintain Ca2+ entry (Fig 4.13). Overall, these data suggest that EGR4 is important in the

- 120 -

inhibition of Ca2+ clearance. Next, I explored the possible functional roles that this

EGR-mediated modulation of Ca2+ clearance could play in SP T cells.

- 121 -

Figure 4.13: EGR4-/- T cells display faster clearance: (A)CD4+ or (B) CD8+ T cells were plated for 2 hrs on coverslips coated with anti-CD3/CD28 (3 µg/ml; activated). Ca2+ entry and clearance were measured in Fura-loaded cells as previously described (see methods).

- 122 -

EGR4-mediated STIM1 upregulation is required for effective Proliferation and Migration

Maintaining elevated Ca2+ signals after TCR engagement is important for several features that lead to efficient T cell activation including synapse maintenance and NFAT activation (see introduction). Thus, I postulated that faster clearance due to loss of EGR4 would lead to defects in T cell function due to inefficient activation. To assess the impact of EGR4 loss on T cell function, I looked at two Ca2+-dependent functions; proliferation and migration(Feske,

2007). To assess proliferation, freshly isolated CD4+ and CD8+ T cells were incubated on plate-bound CD3/CD28 antibodies for 0, 2 and 4 days. Proliferation was measured using colorimetric quantification (Fig 4.14 A, B). WT CD4+ T cells expanded more rapidly than CD8+ T cells, although increased cell numbers were observed in both cell types (Fig 4.14A, B). However, in EGR4-/- CD4+ T cells, a very minimal change in cell number was observed (Fig 4.14A); EGR4-dependent differences in CD8+ T cell expansion were only observed at day 4 (Fig 4.14B).

Overall, this shows that EGR4 is required for efficient proliferation of T cells. This is the first time anyone has shown the importance of EGR4 to T cell physiology.

Interestingly, EGR4-/- CD4+ T cells had more pronounced defects in clearance inhibition than CD8+ T cells (Fig 4.14). Here I show a correlation between slower extrusion of Ca2+ after activation and efficient proliferation of T cells. Based on this, I postulate that EGR4-mediated clearance inhibition may be, at least in part, important for proliferation of T cells.

- 123 -

Constitutive expression of certain chemokines are important for controlling

T cell motility during homeostasis. These ligands, such as (C-C motif) ligand 19

(CCL19), are essential for homing of T cells to lymph nodes where they can eventually make physical contacts with APCs allowing for antigen-specific activation(Forster, Davalos-Misslitz, & Rot, 2008; Stein & Nombela-Arrieta,

2005). After activation, T cells can then respond to other chemokines and are capable of migrating to all tissues to mount an immune response. As such defects in migration in both naive and activated T cells can lead to weakened immune responses(Stein & Nombela-Arrieta, 2005). Therefore, I assessed the chemotactic ability of knockout T cells using a homing chemokine (CCL19)

(Forster et al., 2008)) and one important in migrating to peripheral tissues

(Hepatocyte growth factor ;HGF (Komarowska et al., 2015)). Unlike with the proliferation experiment, here I also included EGR1-/- T cells because unlike proliferation in EGR1-/- T cells(Du et al., 2014), I could not find any literature assessing chemotaxis of EGR4-/- T cells in vitro or in vivo. Unstimulated or stimulated (48 hours) CD4+ and CD8+ cells or were incubated on Neuroprobe® migration plates over media alone or media containing CCL19 or HGF. Percent migrated cells was calculated after 2 hours incubation. In response to CCL19, naive EGR1-/- and EGR4-/- had reduced migration in both the CD4+ and CD8+ T cell population(Fig 4.14 C,D). Additionally, this defect was even further enhanced after cells were activated (Fig 4.14 E,F). This was somewhat surprising as

CCL19 is known to primarily play a role in homing of naive T cells (Forster et al.,

2008). Interestingly enough, these results support the emerging idea that CCL19

- 124 -

is important for the exit of effector T cells from peripheral tissue and back to draining lymph nodes (Bromley, Thomas, & Luster, 2005). Regardless, our results reveal an importance of EGR1 and EGR4 in the homing of T cells to lymph nodes, at the very least in response to CCL19 and possibly other chemokines.

In response to HGF, naive WT and both EGR-/- T cells migrated to a similar extent in both CD4+ and CD8+ T cell populations (Fig 4.14 C,D). After stimulation, both activated EGR1-/- and EGR4 -/- had reduced migration when compared to WT, although only the CD4+ population showed statistical significance (Fig 4.14 E,F). As such we show that both EGR1 and EGR4 are important for migration of activated T cells. Interestingly, the extent of migration defects are similar between EGR1-/- and EGR4-/- supporting prior evidence that these two transcription factors work can co-operatively in T cells.

To eliminate the uncertainty that these differences arose from changes in receptor expression, we measured the level of expression of the chemokine receptors CCR7 (CCL19 receptor) and c MET (HGF receptor) by qRT-PCR. We found that receptor expression was similar between naïve WT and EGR4-/- in both CD4+ and CD8+ T cells (Fig 4.15A, C). CD3/28-mediated activation of EGR4

-/- T cells led to a dramatic increase in the expression of both c-Met (in both

CD4+ and CD8+) and CCR7 (in CD4+) (Fig 4.15B, D). Since differences in receptor expression cannot account for the decreased rate of migration observed in T cells lacking either EGR1 or EGR4, these data reveal fundamental roles for both EGR1 and EGR4 as facilitators of chemokine-induced migration, particularly

- 125 -

after TCR ligation. Considered collectively with the failure of EGR4-/- T cells to expand (Fig 4.14A,B), our investigations reveal unique differences between these 2 transcription factors consistent with a unique role for EGR4 in TCR- induced T cell expansion and migration. Collectively, these data also suggest that EGR-mediated Ca2+ signal modulation plays a role, at least in part, in the control of proliferation and migration. Although hard to fully investigate in primary

T cells, follow-up studies can be done in more malleable cell models to definitively assess the contribution of EGR-dependent changes in STIM1 expression/Ca2+ signals to proliferation, migration and other features of T cell activation.

- 126 -

- 127 -

Figure 4.14: Defective Proliferation in EGR1-/- and EGR4-/- T cells. CD4+ and

CD8+ T cells isolated from the spleen of WT, EGR1-/- and EGR4-/- mice using negative selection. ( A) CD4+ and (B) CD8+ T cells were incubated on plate- bound CD3/CD28 antibodies and proliferation was assessed by colorimetric analysis using the MTS (Promega) at day 0, 2, 4. Migration was measured in

Naïve (C) CD4+ T cells and CD8+ T cells (D) were incubated in the presence or absence of CCL19 or HGF on a neuprobe transwell plate for 2 hours. Migrated T cells were counted and % migration was calculated as (migrated cells/total cells plated)*100. (E) CD4+ T cells and (F) CD8+ T cells were also incubated on plate bound CD3/CD28 FOR 2 days and then incubated in the presence or absence of

CCL19 or HGF on a neuprobe transwell plate for 2 hours. Migrated T cells were counted and % migration calculated. Data were analyzed by two way ANOVA with Sidak’s multiple comparisons test

- 128 -

Naive CD4 Active CD4 (2 days) 6 6 WT

n EGR4KO o

i EGR1KO s 4

s 4 e

r p x 2

E 2

% 0 0 CCR7 c-Met CCR7 c-Met Naive CD8 Active CD8 (2 days)

9 9 n

o

i s

s 6 6 e

r

p x

E 3 3

% 0 0 CCR7 c-Met CCR7 c-Met

Figure 4.15: CCR7 and c-Met expression in EGR-/- T cells: CD4+ and CD8+ T cells isolated from the spleen of WT, EGR1-/- and EGR4-/- mice using negative selection. Freshly isolated Naive ( A) CD4+ and (B) CD8+ T cells were lysed and c-Met and HGF expression was measured using RT-qPCR. C) CD4+ and D)

CD8+ T cells were activated by incubation on plate-bound CD3/CD28 antibodies for 2 days. Cell were also then lysed and measured for c-Met and HGF expression using RT-qPCR

- 129 -

EGR4-/- T cells have defective tissue infiltration and cytokine production

Altered Ca2+ signalling, proliferation and migration of T cells can affect T cell function in an intact immune system resulting in aberrant immune responses.

Thus, we investigated the role of EGR regulation of Ca2+ signals in an intact animal model using a Graft versus Host disease mouse model (GVHD). In this model, the adoptively transferred T cells mount a deleterious immune response against the immunocompromised recipient often resulting in death. The progression of GVHD is highly dependent on the Ca2+-dependent transcription factor NFAT to mediate tissue infiltration (Vaeth et al., 2015) and requires efficient activation and migration of T cells to progress (Wen et al., 2013). As such, I hypothesized that loss of activation-induced Ca2+ clearance (Fig 4.13) and defective migration and proliferation (Fig 4.14) observed in EGR4-/- T cells might contribute to an inability of T cells mount an immune response in vivo.

Lethally irradiated BALB/C mice were transplanted with T cell–depleted bone marrow from B6 mice with WT and EGR4 -/- T cells (schematic: Fig 4.16A). Mice were sacrificed after 3 days and T cells populations in spleen and livers were assesses. As hypothesized, WT CD4+ and CD8+ T cells infiltrated the spleen (Fig

4.16C-F) and the liver (Fig 4.16G-J) with higher frequency than EGR4-/- T cells.

Interestingly, inconsistent with our in vitro Ca2+ clearance studies and consistent with our STIM1 expression data, more severe EGR4-dependent differences were observed with CD8+ than CD4+ T cells. This could be a reflection of the more complex in vivo environment as many factors affect tissue infiltration in vivo.

Nevertheless, as EGR4-/- T cells have defective proliferation and migratory

- 130 -

ability in vivo (Fig 4.14), it is likely that they contribute to diminished tissue infiltration.

To further asses their functionality, the infiltrated T cells were also assessed for cytokine production. IL-2, IFN-γ, and TNF-α are a few of the cytokines shown to be important in differentiation and/or tissue damage in

GVHD(Henden & Hill, 2015; Wen et al., 2013).CD4+ and CD8+ T cells were isolated from the spleen and liver of irradiated mice 4 days after transplantation.

The T cells were then activated with CD3/CD28 antibodies for 6 hours and cytokine levels were measured using intracellular staining (Fig 4.17). EGR4-/- T cells had decreased expression of TNF-α in both CD4+ and CD8+ T cells (Fig

4.17 A-D). In contrast, differences in IFN-γ and IL-2 expression were dependent on where the T cells were isolated from. Hence, IFN-γ expression was significantly reduced in EGR4-/- CD4+ T cells from spleen (Fig 4.17A) but not liver (Fig 4.17C). However, EGR4-/- CD8+ T cells had decreased IFN-γ expression in both spleen and liver (Fig 4.15B, D). IL-2 expression was significantly decreased in EGR4 -/- CD4+ T cells from spleen (Fig 4.17B) and also in CD8+ T cells from liver and spleen (Fig 4.17B, D). In none of the cases did

EGR4-/- T cells have increased cytokine production when compared to WT T cells. As T cells isolated from either liver or spleen have been shown to be phenotypic ally different due to both intrinsic and environmental factors (Katz et al., 2005), it is likely that those factors contribute to differential regulation observed between spleen and liver T cells in EGR4-/- cells. Nonetheless, collectively these data show the importance of EGR4 in overall T cell function,

- 131 -

which could be partly through regulation of STIM1 expression and/or Ca2+ clearance inhibition. Defective activation, proliferation and tissue infiltration observed in EGR-/- T cells make targeting of EGRs in GVHD a promising therapeutic option.

- 132 -

- 133 -

Figure 4.16: Decreased Invasion capacity of EGR4-/- T cells: Schematic in

(A). Donor CD4+ and CD8+ T cells were isolated from WT and EGR4-/- (B) and an equal number of cells were transplanted into a lethally irradiated BALB/C recipient. The BALB/C recipient was sacrificed at day 4. Cells were recovered from Spleens (C, E; quantified in D,F) and livers (G, I; quantified in H, J) and

CD4+ and CD8+ T cell percentages were assessed using flow cytometric analysis. Data were analyzed by two way ANOVA with Sidak’s multiple comparisons test

- 134 -

- 135 -

Figure 4.17: EGR4-/- T cells exhibit impairment in cytokine production in vivo CD4+ and CD8+ T cells derived from WT or EGR4-/- B6 mice were transplanted into lethally irradiated BALB/C recipients. Four days after transplantation, the spleen cells and liver cells were collected and stimulated with

CD3 Ab (1g/ml) + CD28 Ab (1g/ml) for 6 hours. Brefeldin A (5g/ml) was added to the culture for the last 5 hours. CD4+ and CD8+ T cells from the spleen

(A, B) and liver (C, D) were collected and assessed for IFN-γ, TNF-α and IL-2 expression for using flow cytometry. Data were analyzed by two way ANOVA with Sidak’s multiple comparisons test

- 136 -

CHAPTER 5: SUMMARY AND DISCUSSION

PART I: Regulation of Ca2+ homeostatic proteins by EGR Family members

In the first part of this thesis, I thoroughly explore the ability of EGR Family members to regulate STIM1 expression in T cells using Jurkat T cells. Here I show through luciferase assay, western analysis and RT-qPCR that EGR1 and

EGR4 are capable of regulating STIM1 expression. Additionally, EGR1 regulates

STIM1 and PMCA4 expression through direct binding to their promoters.

Although assessment of exact regulation by EGR4 is limited by the lack of appropriate antibodies, I show that EGR1 and EGR4 are both required for upregulation of these signaling molecules via cooperative rather than competitive mechanisms. The development of improved tools for studying EGR4 may provide further insights into the dynamics of these transcriptional mechanisms in future studies. Irrespective, in the in vitro studies, I show the importance of EGR1 and

EGR4 to STIM1 transcription in T cells. The results of EGR-regulated STIM1 expression obtained the mouse model are slightly more complex. Although

EGR4-/- thymocytes and CD8+ T cells show decreased STIM1 expression, CD4+

T cells seem less dependent on EGRs for STIM1 expression. This could reflect a complex cellular environment in which multiple transcription factors contribute to

STIM1 expression and subsets are differentially regulated. Interestingly, NF-κB has been shown to regulate STIM1 expression (Eylenstein et al., 2012).

Additionally, several lines of evidence suggest differential activity of NF-κB due to different cellular needs in different T cell subsets. Indeed, NF-κB has been shown

- 137 -

to play more significant role in the differentiation and survival of CD4+ than CD8+

(Jimi, Strickland, Voll, Long, & Ghosh, 2008) suggesting that transcriptional contribution to T cell subsets can be uneven. Thus, it is possible that STIM1 expression in CD8+ and thymocytes is more dependent on EGR expression, whereas CD4+ STIM1 expression is more dependent on NF-κB. How the functions of these different transcription factors are coordinated remains unclear, nor is it certain how many other factors control the expression of STIM1 and other critical Ca2+ signaling genes. Interestingly, I show changes in the expression of key Ca2+ homeostatic genes after knockdown of both EGR1 and

EGR4 in Jurkat T cells (Fig 4.4H, 4.7). More global approaches may provide new insights into the extent of EGR regulation of Ca2+ homeostatic proteins, as well as the contribution of other transcription factors, with considerable potential implications to how Ca2+ signals regulate the development and function of specific T cell subsets.

- 138 -

PART II: EGR-mediated changes in Ca2+ Clearance

The role of STIM1 in Ca2+ entry through interaction with CRAC channels has been extensively studied. However, newer roles of STIM1 modulating Ca2+ signals through interaction with various proteins are emerging. Previously, it was shown that that interaction of STIM1 and PMCA4 led to a decrease in Ca2+ clearance rates (Ritchie et al., 2012). Here I show that EGR-mediated upregulation of STIM1 and PMCA4 mediate inhibition of Ca2+ clearance; loss of both EGR1 and EGR4 lead to decreased expression of both STIM1 and PMCA4 in activated T cells, thus leading to faster clearance due to lack of interaction via the STIM1 C-terminal domain at the IS (Fig 4.2, 4.4).

I also address questions as to why dramatic decreases in STIM1 expression do not result in expected decreases in Ca2+ entry. I show that STIM2 expression increases upon loss of EGRs to compensate for loss of STIM1 expression (Fig 4.4). Whether this is due to ablation of negative regulation by

EGRs or a feedback loop employed by T cells in response to loss of STIM1 is yet to be investigated. Interestingly enough, several putative EGR binding sites within the STIM2 promoter have been identified (data not shown).

One unanswered question that seems rather paradoxical is why cells with diminished PMCA4 expression (after knockdown of EGR1/4) exhibit faster clearance? As mentioned in the introduction of this thesis, PMCA isoforms are coded by different genes. What is missing in the literature is the delineation of contribution of each isoform to different effects in T cells. Although my lab and others have previously shown that PMCA4 is the main isoform in T cells, it is

- 139 -

possible that PMCA1 or other isoforms also contribute to Ca2+ clearance in the event of PMCA4 loss. Again, whether this is a result of direct EGR regulation or a compensatory feedback mechanism is yet to be explored.

Another consideration is the contribution of mitochondria on clearance in

EGR null cells. Previously, work from my lab showed that mitochondrial Ca2+ loading didn’t influence Ca2+ clearance in activated T cells(Ritchie et al., 2012).

Interestingly, when I looked at Jurkat T cells, MICU1 expression was upregulated after EGR1 and EGR4 knockdown in Jurkat T cells (Fig 4.7). Both MICU1 silencing and overexpression have been shown to increase mitochondrial Ca2+ loading(Patron et al., 2014), therefore an increase in expression could lead to a dynamic change in Ca2+ handling in these cells leading to increased clearance via the mitochondria. Further experiments are needed to determine the relative contribution mitochondrial Ca2+ loading in these cells. In the latter part of this thesis, using primary T cells, I assess the functional consequences of EGR- mediated STIM1 expression in T cells. Based on the data, it becomes apparent that EGR1 and EGR4 influence both Ca2+ clearance and downstream functions through both STIM1-dependendent and –independent methods. Indeed, although not all cells had decreased STIM1 expression in EGR1 or EGR4 knockout population (Fig. 4.12), these CD4+ and CD8+ T cells exhibited multiple defects downstream of TCR engagement (Fig 4.14, 4.16, 4.17). As such, it is important that future studies focus on measuring the contribution of other EGR-regulated proteins on Ca2+ clearance.

- 140 -

PART III: EGR4 in T cell Development

In this second half of this thesis, I use primary T cells and mouse models to assess the importance of EGRs in T cell development and function. Prior to this work, unlike other EGRs, the importance of EGR4 to T cell development had been largely dismissed. Here, I show that EGR4 plays a role in development of the thymic T cell population as seen by the dysregulation in the DN population

(Fig 4.11). Although I do not see defects continue in the conventional SP T cell population, I did not explore how these changes affect the development of non- conventional T cells. Indeed, γδ T cells arise from the DN2/3 population and changes in DN numbers could indicate a dysregulation of this population(Xiong &

Raulet, 2007). Interestingly, γδ T cells have been shown as potent players in both innate and adaptive immunity (Hayes, Laird, & Love, 2010; Munoz-Ruiz et al., 2016). Additionally, it is emerging that these cells have great therapeutic potential in anti-infection and cancer immunotherapies (Y. L. Wu et al., 2014).

Therefore exploring the potential regulation by EGR4 and possibly other EGR family members could reveal new ways to better manipulate these cells for therapeutic use.

Interestingly, EGR1 null T cells also display defects in the thymic development (Carter et al., 2007), albeit different for EGR4 null mice. As we have shown that EGR1 and EGR4 can work in a co-operative manner, the question arises whether the defects seen in the loss of one gene are a complete consequence of gene loss or also include compensation effects by the other

- 141 -

gene. With respect to that, further studies in our lab are currently being done to assess the developmental defects in the EGR1/4 double knockout mouse.

Missing from this study is a measure of the relative contribution of STIM1 expression to these EGR-dependent developmental effects. Although studies showing the importance of PLCγ or TCR signal strength to thymic development provide indirect evidence of the importance of STIM1 and downstream Ca2+ signals, very little is known about the role of STIM1 and/or Ca2+ clearance directly affect differentiation of thymic populations. Nevertheless, I show that EGR4-/- thymocytes have a dramatic reduction in STIM1 expression. Ideally, we could compare DN populations from the STIM-/- mice to EGR4-/- mice. Additionally, currently underway is an assessment of our newly generated STIM1∆597 mice to see if they display similar defects to EGR4-/- which would allude to the importance of EGR4-mediated control of Ca2+ clearance to T cell development.

- 142 -

PART IV: The Importance of STIM1-mediated PMCA Inhibition in T cell

Activation and Function

In the introduction, I outline several features of T cell activation that have been shown or suggested to benefit from sustained elevation of Ca2+ signals including NFAT activation, ITAM availability for phosphorylation and synapse maintenance.

Although studies looking at effects downstream of TCR engagement like

NFAT activation have established the importance of the generation of long term

Ca2+ signals to T cell activation, very little has been shown to describe how this is achieved mechanistically. In our prior study, we showed that one way this could be achieved is through interaction of the c-terminal domain of STIM1 to PMCA4, thus inhibiting Ca2+ clearance (Ritchie et al., 2012). In this thesis, I overexpress either STIM1WT or STIM1∆597 in STIM1 knockout T cells coupled with luciferase assays to show that full engagement of NFAT requires inhibition of Ca2+ clearance initiated by transcriptional upregulation of STIM1 and PMCA4 (Fig 4.9).

This shows direct evidence of the importance inhibited Ca2+ clearance to T cell activation. Thus this thesis shows that this novel mechanism of sustaining Ca2+ signals is physiologically relevant to the T cell.

After TCR engagement, downstream of NFAT activation, T cells gain the ability to proliferate, differentiate and migrate to sites of infection as a result of global alteration in gene expression patterns. In the second half of this thesis, I also look at how EGR-dependent transcription affects key features of T cell activation and function. I first look at the ability of isolated primary T cells to proliferate in

- 143 -

vitro and find that EGR4-/- T cells have defective proliferation (Fig 4.14). In addition, when I look at the migration of WT, EGR1-/- and EGR4-/- T cells in response to the chemotactic factors HGF and CCL19 (Fig 4.14), I find that both

EGR1-/- and EGR4-/- display defects in migration. These data show that EGR1 and EGR4 are required for proliferation and migration. Additionally, using our

GVHD in vivo model, I show that loss of EGR4-/- results in diminished function, in terms of tissue invasion capacity and cytokine production. To the best of my knowledge, this is the first time EGR4 has been shown to be important in the function of T cells. As proliferation, migration and cytokine production are Ca2+- dependent processes, I provide in vivo evidence supporting my in vitro work showing that EGR-mediated sustained Ca2+ levels are important for T cell activation, thus affecting downstream functions. Interestingly, whereas the migratory defects between CD4+ and CD8+ T cells when EGRs are lost are pretty similar, proliferative defects seem to correlate with the extent of defects in clearance inhibition. Indeed, activated CD4+ T cells display a bigger difference in clearance between WT and EGR4-/-T than CD8+ T cells (Fig 4.13, 4.14). Again, I believe this could reflect differential transcriptional regulation based on the needs of each T cell subset. A challenge I encountered with our primary T cell model was distinguishing between STIM1-dependent and –independent features. I tried to explore this aspect by attempting to re-express STIM1 in EGR1-/- and EGR4-/- primary T cells. Unfortunately, I was impeded by the difficulty of transfecting primary T cells. Nevertheless, I do show that knockout CD4+ T cells mostly maintain expression of STIM1, whereas CD8+ T cells have dramatically reduced

- 144 -

levels. Thus, I hypothesize that changes of STIM1 expression in CD8+ T cells are more influenced by EGR1/4 expression than CD8+ T cells are. Additionally, it is possible that loss of one EGR is compensated by the other EGR in CD4+ T cells as seen in other cell systems (Tourtellotte et al., 2000). This could and will be easily explored by looking at STIM1 expression in EGR1/4 DKO mice.

.

PART V: Therapeutic Potential of EGR-Dependent Ca2+ Clearance

The use of CRAC inhibitors to ameliorate autoimmune diseases is currently a clinical option and continues to be investigated. One major problem of the use of these inhibitors is the side effects from damage other organs due to the broad expression and importance of SOCE components(Tian, Du, Zhou, & Li, 2016).

My in vitro work shows EGR-mediated modulation of Ca2+ clearance affects T cell activation. Additionally, I show that EGR4-/- have dampened T cell function in the GVHD model (Fig 4.16, 4.17). Therefore, targeting STIM1-mediated clearance may provide a safer alternative than SOCE inhibition to treating T cell dependent autoimmune and alloimmune diseases. Studies in our lab are currently focused on identifying PMCA sites important in the interaction to STIM1 in this process. Identification of these sites could help in creating specific small molecules that can disrupt STIM1/PMCA interactions at the synapse.

Interestingly, EGR1 has been shown to be upregulated in immune cells of patients suffering from cardiac allograft rejection (Autieri, Kelemen, Gaughan, &

Eisen, 2004). Additionally, several studies have implicated EGR1 in the inception and progression of certain diseases including atherosclerosis and cardiac

- 145 -

hypertrophy (Khachigian, 2006). It is possible that the role of EGRs in STIM1 regulation and/or Ca2+ clearance could be an important component in the progression of these diseases and should be explored. Therefore this study could help identify therapeutic targets in both T cell and non T cell related diseases.

- 146 -

CHAPTER 6: CONCLUSION

This thesis provides mechanistic insight into how T cells achieve long term Ca2+ signals to support efficient activation and effector function through transcriptional regulation of Ca2+ homeostatic proteins. I show that EGR4, a largely ignored transcription factor in T cell studies, plays a key role in T cell physiology seemingly through both Ca2+ -dependent and –independent means. Further investigations are required to assess the relative contribution of EGR1 and EGR4 to modulation of Ca2+ signals and T cell function in vivo. Regardless, the obvious importance of both inhibition of Ca2+ clearance and EGR-mediated transcriptional control to T cell function now provide new elements that shed more light on T cell mediated immunity. Additionally, these findings can be used in the discovery of new therapies or modification of current therapies to treat diseases with heavy T cell involvement.

- 147 -

REFERENCES CITED Aivazian, D., & Stern, L. J. (2000). Phosphorylation of T cell receptor zeta is regulated by a lipid dependent folding transition. Nat Struct Biol, 7(11), 1023-1026. doi:10.1038/80930

Allenspach, E. J., Cullinan, P., Tong, J., Tang, Q., Tesciuba, A. G., Cannon, J. L., Takahashi, S. M., Morgan, R., Burkhardt, J. K., & Sperling, A. I. (2001). ERM-dependent movement of CD43 defines a novel protein complex distal to the immunological synapse. Immunity, 15(5), 739-750.

Anderson, G., & Jenkinson, E. J. (2001). Lymphostromal interactions in thymic development and function. Nat Rev Immunol, 1(1), 31-40. doi:10.1038/35095500

Anderson, K. A., Noeldner, P. K., Reece, K., Wadzinski, B. E., & Means, A. R. (2004). Regulation and function of the calcium/calmodulin-dependent protein kinase IV/protein serine/threonine phosphatase 2A signaling complex. J Biol Chem, 279(30), 31708-31716. doi:10.1074/jbc.M404523200

Apperley, J. F., Mauro, F. R., Goldman, J. M., Gregory, W., Arthur, C. K., Hows, J., Arcese, W., Papa, G., Mandelli, F., Wardle, D., & et al. (1988). Bone marrow transplantation for chronic myeloid leukaemia in first chronic phase: importance of a graft-versus- leukaemia effect. Br J Haematol, 69(2), 239-245.

Arai, M., Yoguchi, A., Takizawa, T., Yokoyama, T., Kanda, T., Kurabayashi, M., & Nagai, R. (2000). Mechanism of doxorubicin-induced inhibition of sarcoplasmic reticulum Ca(2+)-ATPase gene transcription. Circ Res, 86(1), 8-14.

Arrol, H. P., Church, L. D., Bacon, P. A., & Young, S. P. (2008). Intracellular calcium signalling patterns reflect the differentiation status of human T cells. Clin Exp Immunol, 153(1), 86- 95. doi:10.1111/j.1365-2249.2008.03677.x

Asherson, G. L., Davey, M. J., & Goodford, P. J. (1970). Increased uptake of calcium by human lymphocytes treated with phytohaemagglutinin. J Physiol, 206(2), 32P-33P.

Autieri, M. V., Kelemen, S. E., Gaughan, J. P., & Eisen, H. J. (2004). Early growth responsive gene (Egr)-1 expression correlates with cardiac allograft rejection. Transplantation, 78(1), 107-111.

Babich, A., Li, S., O'Connor, R. S., Milone, M. C., Freedman, B. D., & Burkhardt, J. K. (2012). F- actin polymerization and retrograde flow drive sustained PLCgamma1 signaling during T cell activation. J Cell Biol, 197(6), 775-787. doi:10.1083/jcb.201201018

- 148 -

Balaban, R. S. (2009). The role of Ca(2+) signaling in the coordination of mitochondrial ATP production with cardiac work. Biochim Biophys Acta, 1787(11), 1334-1341. doi:10.1016/j.bbabio.2009.05.011

Balasubramanyam, M., Kimura, M., Aviv, A., & Gardner, J. P. (1993). Kinetics of calcium transport across the lymphocyte plasma membrane. Am J Physiol, 265(2 Pt 1), C321-327.

Barr, V. A., Bernot, K. M., Srikanth, S., Gwack, Y., Balagopalan, L., Regan, C. K., Helman, D. J., Sommers, C. L., Oh-Hora, M., Rao, A., & Samelson, L. E. (2008). Dynamic movement of the calcium sensor STIM1 and the calcium channel Orai1 in activated T-cells: puncta and distal caps. Mol Biol Cell, 19(7), 2802-2817. doi:E08-02-0146 [pii] 10.1091/mbc.E08-02-0146

Baughman, J. M., Perocchi, F., Girgis, H. S., Plovanich, M., Belcher-Timme, C. A., Sancak, Y., Bao, X. R., Strittmatter, L., Goldberger, O., Bogorad, R. L., Koteliansky, V., & Mootha, V. K. (2011). Integrative genomics identifies MCU as an essential component of the mitochondrial calcium uniporter. Nature, 476(7360), 341-345. doi:10.1038/nature10234 nature10234 [pii]

Bautista, D. M., Hoth, M., & Lewis, R. S. (2002). Enhancement of calcium signalling dynamics and stability by delayed modulation of the plasma-membrane calcium-ATPase in human T cells. J Physiol, 541(Pt 3), 877-894. doi:PHY_16154 [pii]

Beals, C. R., Sheridan, C. M., Turck, C. W., Gardner, P., & Crabtree, G. R. (1997). Nuclear export of NF-ATc enhanced by glycogen synthase kinase-3. Science, 275(5308), 1930-1934.

Beckmann, A. M., Matsumoto, I., & Wilce, P. A. (1997). AP-1 and Egr DNA-binding activities are increased in rat brain during ethanol withdrawal. J Neurochem, 69(1), 306-314.

Benos, P. V., Lapedes, A. S., & Stormo, G. D. (2002). Probabilistic code for DNA recognition by proteins of the EGR family. J Mol Biol, 323(4), 701-727.

Bettini, M., Xi, H., Milbrandt, J., & Kersh, G. J. (2002). Thymocyte development in early growth response gene 1-deficient mice. J Immunol, 169(4), 1713-1720.

Bezprozvanny, I., & Ehrlich, B. E. (1995). The inositol 1,4,5-trisphosphate (InsP3) receptor. J Membr Biol, 145(3), 205-216.

Bhakta, N. R., Oh, D. Y., & Lewis, R. S. (2005). Calcium oscillations regulate thymocyte motility during positive selection in the three-dimensional thymic environment. Nat Immunol, 6(2), 143-151. doi:10.1038/ni1161

- 149 -

Biswas, G., Anandatheerthavarada, H. K., Zaidi, M., & Avadhani, N. G. (2003). Mitochondria to nucleus stress signaling: a distinctive mechanism of NFkappaB/Rel activation through calcineurin-mediated inactivation of IkappaBbeta. J Cell Biol, 161(3), 507-519. doi:10.1083/jcb.200211104

Blazar, B. R., Murphy, W. J., & Abedi, M. (2012). Advances in graft-versus-host disease biology and therapy. Nat Rev Immunol, 12(6), 443-458. doi:10.1038/nri3212

Boieri, M., Shah, P., Dressel, R., & Inngjerdingen, M. (2016). The Role of Animal Models in the Study of Hematopoietic Stem Cell Transplantation and GvHD: A Historical Overview. Front Immunol, 7, 333. doi:10.3389/fimmu.2016.00333

Bollyky, P. L., Evanko, S. P., Wu, R. P., Potter-Perigo, S., Long, S. A., Kinsella, B., Reijonen, H., Guebtner, K., Teng, B., Chan, C. K., Braun, K. R., Gebe, J. A., Nepom, G. T., & Wight, T. N. (2010). Th1 cytokines promote T-cell binding to antigen-presenting cells via enhanced hyaluronan production and accumulation at the immune synapse. Cell Mol Immunol, 7(3), 211-220. doi:10.1038/cmi.2010.9

Brady, M., Koban, M. U., Dellow, K. A., Yacoub, M., Boheler, K. R., & Fuller, S. J. (2003). Sp1 and Sp3 transcription factors are required for trans-activation of the human SERCA2 promoter in cardiomyocytes. Cardiovasc Res, 60(2), 347-354.

Brandman, O., Liou, J., Park, W. S., & Meyer, T. (2007). STIM2 is a feedback regulator that stabilizes basal cytosolic and endoplasmic reticulum Ca2+ levels. Cell, 131(7), 1327-1339.

Brandt, P., Ibrahim, E., Bruns, G. A., & Neve, R. L. (1992). Determination of the nucleotide sequence and chromosomal localization of the ATP2B2 gene encoding human Ca(2+)- pumping ATPase isoform PMCA2. Genomics, 14(2), 484-487.

Brini, M., & Carafoli, E. (2011). The plasma membrane Ca(2)+ ATPase and the plasma membrane sodium calcium exchanger cooperate in the regulation of cell calcium. Cold Spring Harb Perspect Biol, 3(2). doi:10.1101/cshperspect.a004168

Bromley, S. K., Thomas, S. Y., & Luster, A. D. (2005). Chemokine receptor CCR7 guides T cell exit from peripheral tissues and entry into afferent lymphatics. Nat Immunol, 6(9), 895-901. doi:10.1038/ni1240

Bronietzki, A. W., Schuster, M., & Schmitz, I. (2015). Autophagy in T-cell development, activation and differentiation. Immunol Cell Biol, 93(1), 25-34. doi:10.1038/icb.2014.81

- 150 -

Bronk, C. C., Yoder, S., Hopewell, E. L., Yang, S., Celis, E., Yu, X. Z., & Beg, A. A. (2014). NF-kappaB is crucial in proximal T-cell signaling for calcium influx and NFAT activation. Eur J Immunol, 44(12), 3741-3746. doi:10.1002/eji.201444904

Brown, B. J., Hilfiker, H., DeMarco, S. J., Zacharias, D. A., Greenwood, T. M., Guerini, D., & Strehler, E. E. (1996). Primary structure of human plasma membrane Ca(2+)-ATPase isoform 3. Biochim Biophys Acta, 1283(1), 10-13.

Bunting, M. D., Comerford, I., & McColl, S. R. (2011). Finding their niche: chemokines directing cell migration in the thymus. Immunol Cell Biol, 89(2), 185-196. doi:10.1038/icb.2010.142

Caride, A. J., Elwess, N. L., Verma, A. K., Filoteo, A. G., Enyedi, A., Bajzer, Z., & Penniston, J. T. (1999). The rate of activation by calmodulin of isoform 4 of the plasma membrane Ca(2+) pump is slow and is changed by alternative splicing. J Biol Chem, 274(49), 35227- 35232.

Caride, A. J., Filoteo, A. G., Penheiter, A. R., Paszty, K., Enyedi, A., & Penniston, J. T. (2001). Delayed activation of the plasma membrane calcium pump by a sudden increase in Ca2+: fast pumps reside in fast cells. Cell Calcium, 30(1), 49-57. doi:10.1054/ceca.2001.0212 S014341600190212X [pii]

Carleton, M., Haks, M. C., Smeele, S. A., Jones, A., Belkowski, S. M., Berger, M. A., Linsley, P., Kruisbeek, A. M., & Wiest, D. L. (2002). Early growth response transcription factors are required for development of CD4(-)CD8(-) thymocytes to the CD4(+)CD8(+) stage. J Immunol, 168(4), 1649-1658.

Carter, J. H., Lefebvre, J. M., Wiest, D. L., & Tourtellotte, W. G. (2007). Redundant role for early growth response transcriptional regulators in thymocyte differentiation and survival. J Immunol, 178(11), 6796-6805.

Chen, L., Glover, J. N., Hogan, P. G., Rao, A., & Harrison, S. C. (1998). Structure of the DNA- binding domains from NFAT, Fos and Jun bound specifically to DNA. Nature, 392(6671), 42-48. doi:10.1038/32100

Cheng, K. T., Alevizos, I., Liu, X., Swaim, W. D., Yin, H., Feske, S., Oh-hora, M., & Ambudkar, I. S. (2012). STIM1 and STIM2 protein deficiency in T lymphocytes underlies development of the exocrine gland autoimmune disease, Sjogren's syndrome. Proc Natl Acad Sci U S A, 109(36), 14544-14549. doi:10.1073/pnas.1207354109

- 151 -

Ciofani, M., Knowles, G. C., Wiest, D. L., von Boehmer, H., & Zuniga-Pflucker, J. C. (2006). Stage- specific and differential notch dependency at the alphabeta and gammadelta T lineage bifurcation. Immunity, 25(1), 105-116. doi:10.1016/j.immuni.2006.05.010

Corthay, A. (2009). How do regulatory T cells work? Scand J Immunol, 70(4), 326-336. doi:10.1111/j.1365-3083.2009.02308.x

Costello, R., Lipcey, C., Algarte, M., Cerdan, C., Baeuerle, P. A., Olive, D., & Imbert, J. (1993). Activation of primary human T-lymphocytes through CD2 plus CD28 adhesion molecules induces long-term nuclear expression of NF-kappa B. Cell Growth Differ, 4(4), 329-339.

Courtois, G., Smahi, A., Reichenbach, J., Doffinger, R., Cancrini, C., Bonnet, M., Puel, A., Chable- Bessia, C., Yamaoka, S., Feinberg, J., Dupuis-Girod, S., Bodemer, C., Livadiotti, S., Novelli, F., Rossi, P., Fischer, A., Israel, A., Munnich, A., Le Deist, F., & Casanova, J. L. (2003). A hypermorphic IkappaBalpha mutation is associated with autosomal dominant anhidrotic ectodermal dysplasia and T cell immunodeficiency. J Clin Invest, 112(7), 1108-1115. doi:10.1172/JCI18714

Covington, E. D., Wu, M. M., & Lewis, R. S. (2010). Essential role for the CRAC activation domain in store-dependent oligomerization of STIM1. Mol Biol Cell, 21(11), 1897-1907. doi:10.1091/mbc.E10-02-0145

Cox, J. H., Hussell, S., Sondergaard, H., Roepstorff, K., Bui, J. V., Deer, J. R., Zhang, J., Li, Z. G., Lamberth, K., Kvist, P. H., Padkjaer, S., Haase, C., Zahn, S., & Odegard, V. H. (2013). Antibody-mediated targeting of the Orai1 calcium channel inhibits T cell function. PLoS One, 8(12), e82944. doi:10.1371/journal.pone.0082944

Crabtree, G. R., & Olson, E. N. (2002). NFAT signaling: choreographing the social lives of cells. Cell, 109 Suppl, S67-79.

Cron, R. Q., Bandyopadhyay, R., Genin, A., Brunner, M., Kersh, G. J., Yin, J., Finkel, T. H., & Crow, M. K. (2006). Early growth response-1 is required for CD154 transcription. J Immunol, 176(2), 811-818.

Csordas, G., Golenar, T., Seifert, E. L., Kamer, K. J., Sancak, Y., Perocchi, F., Moffat, C., Weaver, D., de la Fuente Perez, S., Bogorad, R., Koteliansky, V., Adijanto, J., Mootha, V. K., & Hajnoczky, G. (2013). MICU1 controls both the threshold and cooperative activation of the mitochondrial Ca(2)(+) uniporter. Cell Metab, 17(6), 976-987. doi:10.1016/j.cmet.2013.04.020

Cullinan, P., Sperling, A. I., & Burkhardt, J. K. (2002). The distal pole complex: a novel membrane domain distal to the immunological synapse. Immunol Rev, 189, 111-122.

- 152 -

Daniels, M. A., Teixeiro, E., Gill, J., Hausmann, B., Roubaty, D., Holmberg, K., Werlen, G., Hollander, G. A., Gascoigne, N. R., & Palmer, E. (2006). Thymic selection threshold defined by compartmentalization of Ras/MAPK signalling. Nature, 444(7120), 724-729. doi:10.1038/nature05269

Danilova, N. (2012). The evolution of adaptive immunity. Adv Exp Med Biol, 738, 218-235. doi:10.1007/978-1-4614-1680-7_13

De Jaegere, S., Wuytack, F., Eggermont, J. A., Verboomen, H., & Casteels, R. (1990). Molecular cloning and sequencing of the plasma-membrane Ca2+ pump of pig smooth muscle. Biochem J, 271(3), 655-660.

De Stefani, D., Raffaello, A., Teardo, E., Szabo, I., & Rizzuto, R. (2011). A forty-kilodalton protein of the inner membrane is the mitochondrial calcium uniporter. Nature, 476(7360), 336- 340. doi:10.1038/nature10230

Decker, E. L., Nehmann, N., Kampen, E., Eibel, H., Zipfel, P. F., & Skerka, C. (2003). Early growth response proteins (EGR) and nuclear factors of activated T cells (NFAT) form heterodimers and regulate proinflammatory cytokine gene expression. Nucleic Acids Res, 31(3), 911-921.

Decker, E. L., Skerka, C., & Zipfel, P. F. (1998). The early growth response protein (EGR-1) regulates interleukin-2 transcription by synergistic interaction with the nuclear factor of activated T cells. J Biol Chem, 273(41), 26923-26930.

DeFord-Watts, L. M., Dougall, D. S., Belkaya, S., Johnson, B. A., Eitson, J. L., Roybal, K. T., Barylko, B., Albanesi, J. P., Wulfing, C., & van Oers, N. S. (2011). The CD3 zeta subunit contains a phosphoinositide-binding motif that is required for the stable accumulation of TCR-CD3 complex at the immunological synapse. J Immunol, 186(12), 6839-6847. doi:10.4049/jimmunol.1002721

Denton, R. M., & McCormack, J. G. (1980). The role of calcium in the regulation of mitochondrial metabolism. Biochem Soc Trans, 8(3), 266-268.

Deretic, V., Saitoh, T., & Akira, S. (2013). Autophagy in infection, inflammation and immunity. Nat Rev Immunol, 13(10), 722-737. doi:10.1038/nri3532

Derler, I., Madl, J., Schutz, G., & Romanin, C. (2012). Structure, regulation and biophysics of I(CRAC), STIM/Orai1. Adv Exp Med Biol, 740, 383-410. doi:10.1007/978-94-007-2888- 2_16

- 153 -

Dertschnig, S., Hauri-Hohl, M. M., Vollmer, M., Hollander, G. A., & Krenger, W. (2015). Impaired thymic expression of tissue-restricted antigens licenses the de novo generation of autoreactive CD4+ T cells in acute GVHD. Blood, 125(17), 2720-2723. doi:10.1182/blood- 2014-08-597245

Dhir, S., Slatter, M., & Skinner, R. (2014). Recent advances in the management of graft-versus- host disease. Arch Dis Child, 99(12), 1150-1157. doi:10.1136/archdischild-2013-304832

Dittmar, M. T., McKnight, A., Simmons, G., Clapham, P. R., Weiss, R. A., & Simmonds, P. (1997). HIV-1 tropism and co-receptor use. Nature, 385(6616), 495-496. doi:10.1038/385495a0

Doffinger, R., Smahi, A., Bessia, C., Geissmann, F., Feinberg, J., Durandy, A., Bodemer, C., Kenwrick, S., Dupuis-Girod, S., Blanche, S., Wood, P., Rabia, S. H., Headon, D. J., Overbeek, P. A., Le Deist, F., Holland, S. M., Belani, K., Kumararatne, D. S., Fischer, A., Shapiro, R., et al. (2001). X-linked anhidrotic ectodermal dysplasia with immunodeficiency is caused by impaired NF-kappaB signaling. Nat Genet, 27(3), 277- 285. doi:10.1038/85837

Dolmetsch, R. E., Lewis, R. S., Goodnow, C. C., & Healy, J. I. (1997). Differential activation of transcription factors induced by Ca2+ response amplitude and duration. Nature, 386(6627), 855-858.

Donnadieu, E., Bismuth, G., & Trautmann, A. (1992). Calcium fluxes in T lymphocytes. J Biol Chem, 267(36), 25864-25872.

Donnadieu, E., & Trautmann, A. (1993). Is there a Na+/Ca2+ exchanger in macrophages and in lymphocytes? Pflugers Arch, 424(5-6), 448-455.

Drago, I., Pizzo, P., & Pozzan, T. (2011). After half a century mitochondrial calcium in- and efflux machineries reveal themselves. EMBO J, 30(20), 4119-4125. doi:10.1038/emboj.2011.337

Du, N., Kwon, H., Li, P., West, E. E., Oh, J., Liao, W., Yu, Z., Ren, M., & Leonard, W. J. (2014). EGR2 is critical for peripheral naive T-cell differentiation and the T-cell response to influenza. Proc Natl Acad Sci U S A, 111(46), 16484-16489. doi:10.1073/pnas.1417215111

Duchen, M. R., Verkhratsky, A., & Muallem, S. (2008). Mitochondria and calcium in health and disease. Cell Calcium, 44(1), 1-5. doi:10.1016/j.ceca.2008.02.001

Dustin, M. L. (2008). T-cell activation through immunological synapses and kinapses. Immunol Rev, 221, 77-89. doi:10.1111/j.1600-065X.2008.00589.x

- 154 -

Enyedi, A., Flura, M., Sarkadi, B., Gardos, G., & Carafoli, E. (1987). The maximal velocity and the calcium affinity of the red cell calcium pump may be regulated independently. J Biol Chem, 262(13), 6425-6430.

Enyedi, A., Verma, A. K., Heim, R., Adamo, H. P., Filoteo, A. G., Strehler, E. E., & Penniston, J. T. (1994). The Ca2+ affinity of the plasma membrane Ca2+ pump is controlled by alternative splicing. J Biol Chem, 269(1), 41-43.

Eylenstein, A., Schmidt, S., Gu, S., Yang, W., Schmid, E., Schmidt, E. M., Alesutan, I., Szteyn, K., Regel, I., Shumilina, E., & Lang, F. (2012). Transcription Factor NF-kappaB Regulates Expression of Pore-forming Ca2+ Channel Unit, Orai1, and Its Activator, STIM1, to Control Ca2+ Entry and Affect Cellular Functions. J Biol Chem, 287(4), 2719-2730. doi:M111.275925 [pii] 10.1074/jbc.M111.275925

Falchetto, R., Vorherr, T., Brunner, J., & Carafoli, E. (1991). The plasma membrane Ca2+ pump contains a site that interacts with its calmodulin-binding domain. J Biol Chem, 266(5), 2930-2936.

Falchetto, R., Vorherr, T., & Carafoli, E. (1992). The calmodulin-binding site of the plasma membrane Ca2+ pump interacts with the transduction domain of the enzyme. Protein Sci, 1(12), 1613-1621. doi:10.1002/pro.5560011209

Feske, S. (2007). Calcium signalling in lymphocyte activation and disease. Nat Rev Immunol, 7(9), 690-702.

Feske, S. (2009). ORAI1 and STIM1 deficiency in human and mice: roles of store-operated Ca2+ entry in the immune system and beyond. Immunol Rev, 231(1), 189-209. doi:10.1111/j.1600-065X.2009.00818.x

Feske, S. (2010). CRAC channelopathies. Pflugers Arch, 460(2), 417-435. doi:10.1007/s00424- 009-0777-5

Feske, S., Gwack, Y., Prakriya, M., Srikanth, S., Puppel, S. H., Tanasa, B., Hogan, P. G., Lewis, R. S., Daly, M., & Rao, A. (2006). A mutation in Orai1 causes immune deficiency by abrogating CRAC channel function. Nature, 441(7090), 179-185.

Fooksman, D. R., Vardhana, S., Vasiliver-Shamis, G., Liese, J., Blair, D. A., Waite, J., Sacristan, C., Victora, G. D., Zanin-Zhorov, A., & Dustin, M. L. (2010). Functional anatomy of T cell activation and synapse formation. Annu Rev Immunol, 28, 79-105. doi:10.1146/annurev- immunol-030409-101308

- 155 -

Forster, R., Davalos-Misslitz, A. C., & Rot, A. (2008). CCR7 and its ligands: balancing immunity and tolerance. Nat Rev Immunol, 8(5), 362-371. doi:10.1038/nri2297

Foskett, J. K., & Philipson, B. (2015). The mitochondrial Ca(2+) uniporter complex. J Mol Cell Cardiol, 78, 3-8. doi:10.1016/j.yjmcc.2014.11.015

Frantz, B., Nordby, E. C., Bren, G., Steffan, N., Paya, C. V., Kincaid, R. L., Tocci, M. J., O'Keefe, S. J., & O'Neill, E. A. (1994). Calcineurin acts in synergy with PMA to inactivate I kappa B/MAD3, an inhibitor of NF-kappa B. Embo J, 13(4), 861-870.

Freiberg, B. A., Kupfer, H., Maslanik, W., Delli, J., Kappler, J., Zaller, D. M., & Kupfer, A. (2002). Staging and resetting T cell activation in SMACs. Nat Immunol, 3(10), 911-917. doi:10.1038/ni836

Frischauf, I., Schindl, R., Derler, I., Bergsmann, J., Fahrner, M., & Romanin, C. (2008). The STIM/Orai coupling machinery. Channels (Austin), 2(4), 261-268. doi:6705 [pii]

Fu, G., Chen, Y., Yu, M., Podd, A., Schuman, J., He, Y., Di, L., Yassai, M., Haribhai, D., North, P. E., Gorski, J., Williams, C. B., Wang, D., & Wen, R. (2010). Phospholipase C{gamma}1 is essential for T cell development, activation, and tolerance. J Exp Med, 207(2), 309-318. doi:10.1084/jem.20090880

Gallitano-Mendel, A., Izumi, Y., Tokuda, K., Zorumski, C. F., Howell, M. P., Muglia, L. J., Wozniak, D. F., & Milbrandt, J. (2007). The immediate early gene early growth response gene 3 mediates adaptation to stress and novelty. Neuroscience, 148(3), 633-643. doi:S0306- 4522(07)00597-0 [pii] 10.1016/j.neuroscience.2007.05.050

Gascoigne, N. R., Ampudia, J., Clamme, J. P., Fu, G., Lotz, C., Mallaun, M., Niederberger, N., Palmer, E., Rybakin, V., Yachi, P. P., & Zal, T. (2009). Visualizing intermolecular interactions in T cells. Curr Top Microbiol Immunol, 334, 31-46. doi:10.1007/978-3-540- 93864-4_2

Gashler, A., & Sukhatme, V. P. (1995). Early growth response protein 1 (Egr-1): prototype of a zinc-finger family of transcription factors. Prog Nucleic Acid Res Mol Biol, 50, 191-224.

Gilmore, T. D. (2006). Introduction to NF-kappaB: players, pathways, perspectives. Oncogene, 25(51), 6680-6684. doi:10.1038/sj.onc.1209954

- 156 -

Glancy, B., & Balaban, R. S. (2012). Role of mitochondrial Ca2+ in the regulation of cellular energetics. Biochemistry, 51(14), 2959-2973. doi:10.1021/bi2018909

Gomez, T. S., Hamann, M. J., McCarney, S., Savoy, D. N., Lubking, C. M., Heldebrant, M. P., Labno, C. M., McKean, D. J., McNiven, M. A., Burkhardt, J. K., & Billadeau, D. D. (2005). Dynamin 2 regulates T cell activation by controlling actin polymerization at the immunological synapse. Nat Immunol, 6(3), 261-270. doi:10.1038/ni1168

Gonzalez-Cobos, J. C., Zhang, X., Zhang, W., Ruhle, B., Motiani, R. K., Schindl, R., Muik, M., Spinelli, A. M., Bisaillon, J. M., Shinde, A. V., Fahrner, M., Singer, H. A., Matrougui, K., Barroso, M., Romanin, C., & Trebak, M. (2013). Store-Independent Orai1/3 Channels Activated by Intracrine LeukotrieneC4: Role in Neointimal Hyperplasia. Circ Res, 112(7), 1013-1025. doi:10.1161/CIRCRESAHA.111.300220

Gopinath, R. M., & Vincenzi, F. F. (1977). Phosphodiesterase protein activator mimics red blood cell cytoplasmic activator of (Ca2+-Mg2+)ATPase. Biochem Biophys Res Commun, 77(4), 1203-1209.

Greeb, J., & Shull, G. E. (1989). Molecular cloning of a third isoform of the calmodulin-sensitive plasma membrane Ca2+-transporting ATPase that is expressed predominantly in brain and skeletal muscle. J Biol Chem, 264(31), 18569-18576.

Gremm, D., & Wegner, A. (2000). Gelsolin as a calcium-regulated actin filament-capping protein. Eur J Biochem, 267(14), 4339-4345.

Gunter, T. E., Gunter, K. K., Sheu, S. S., & Gavin, C. E. (1994). Mitochondrial calcium transport: physiological and pathological relevance. Am J Physiol, 267(2 Pt 1), C313-339.

Guse, A. H., Roth, E., & Emmrich, F. (1993). Intracellular Ca2+ pools in Jurkat T-lymphocytes. Biochem J, 291 ( Pt 2), 447-451.

Gwack, Y., Sharma, S., Nardone, J., Tanasa, B., Iuga, A., Srikanth, S., Okamura, H., Bolton, D., Feske, S., Hogan, P. G., & Rao, A. (2006). A genome-wide Drosophila RNAi screen identifies DYRK-family kinases as regulators of NFAT. Nature, 441(7093), 646-650.

Gwack, Y., Srikanth, S., Oh-Hora, M., Hogan, P. G., Lamperti, E. D., Yamashita, M., Gelinas, C., Neems, D. S., Sasaki, Y., Feske, S., Prakriya, M., Rajewsky, K., & Rao, A. (2008). Hair loss and defective T- and B-cell function in mice lacking ORAI1. Mol Cell Biol, 28(17), 5209- 5222.

Hajnoczky, G., Robb-Gaspers, L. D., Seitz, M. B., & Thomas, A. P. (1995). Decoding of cytosolic calcium oscillations in the mitochondria. Cell, 82(3), 415-424.

- 157 -

Hao, L., Rigaud, J. L., & Inesi, G. (1994). Ca2+/H+ countertransport and electrogenicity in proteoliposomes containing erythrocyte plasma membrane Ca-ATPase and exogenous lipids. J Biol Chem, 269(19), 14268-14275.

Hara, S., Arai, M., Tomaru, K., Doi, H., Koitabashi, N., Iso, T., Watanabe, A., Tanaka, T., Maeno, T., Suga, T., Yokoyama, T., & Kurabayashi, M. (2008). Prostaglandin F2alpha inhibits SERCA2 gene transcription through an induction of Egr-1 in cultured neonatal rat cardiac myocytes. Int Heart J, 49(3), 329-342.

Hartzell, C. A., Jankowska, K. I., Burkhardt, J. K., & Lewis, R. S. (2016). Calcium influx through CRAC channels controls actin organization and dynamics at the immune synapse. Elife, 5. doi:10.7554/eLife.14850

Hayes, S. M., Laird, R. M., & Love, P. E. (2010). Beyond alphabeta/gammadelta lineage commitment: TCR signal strength regulates gammadelta T cell maturation and effector fate. Semin Immunol, 22(4), 247-251. doi:10.1016/j.smim.2010.04.006

Hayes, S. M., Li, L., & Love, P. E. (2005). TCR signal strength influences alphabeta/gammadelta lineage fate. Immunity, 22(5), 583-593. doi:10.1016/j.immuni.2005.03.014

Henden, A. S., & Hill, G. R. (2015). Cytokines in Graft-versus-Host Disease. J Immunol, 194(10), 4604-4612. doi:10.4049/jimmunol.1500117

Hill, G. R. (2009). Inflammation and bone marrow transplantation. Biol Blood Marrow Transplant, 15(1 Suppl), 139-141. doi:10.1016/j.bbmt.2008.11.008

Hofmann, F., James, P., Vorherr, T., & Carafoli, E. (1993). The C-terminal domain of the plasma membrane Ca2+ pump contains three high affinity Ca2+ binding sites. J Biol Chem, 268(14), 10252-10259.

Hogan, P. G., Chen, L., Nardone, J., & Rao, A. (2003). Transcriptional regulation by calcium, calcineurin, and NFAT. Genes Dev, 17(18), 2205-2232.

Hogan, P. G., Lewis, R. S., & Rao, A. (2010). Molecular basis of calcium signaling in lymphocytes: STIM and ORAI. Annu Rev Immunol, 28, 491-533.

Hoth, M., & Penner, R. (1992). Depletion of intracellular calcium stores activates a calcium current in mast cells. Nature, 355(6358), 353-356. doi:10.1038/355353a0

- 158 -

Imboden, J. B., & Stobo, J. D. (1985). Transmembrane signalling by the T cell antigen receptor. Perturbation of the T3-antigen receptor complex generates inositol phosphates and releases calcium ions from intracellular stores. J Exp Med, 161(3), 446-456.

Imboden, J. B., Weiss, A., & Stobo, J. D. (1985). The antigen receptor on a human T cell line initiates activation by increasing cytoplasmic free calcium. J Immunol, 134(2), 663-665.

Jain, J., McCaffrey, P. G., Miner, Z., Kerppola, T. K., Lambert, J. N., Verdine, G. L., Curran, T., & Rao, A. (1993). The T-cell transcription factor NFATp is a substrate for calcineurin and interacts with Fos and Jun. Nature, 365(6444), 352-355. doi:10.1038/365352a0

James, P., Maeda, M., Fischer, R., Verma, A. K., Krebs, J., Penniston, J. T., & Carafoli, E. (1988). Identification and primary structure of a calmodulin binding domain of the Ca2+ pump of human erythrocytes. J Biol Chem, 263(6), 2905-2910.

Jarrett, H. W., & Penniston, J. T. (1977). Partial purification of the Ca2+-Mg2+ ATPase activator from human erythrocytes: its similarity to the activator of 3':5' - cyclic nucleotide phosphodiesterase. Biochem Biophys Res Commun, 77(4), 1210-1216.

Jimi, E., Strickland, I., Voll, R. E., Long, M., & Ghosh, S. (2008). Differential role of the transcription factor NF-kappaB in selection and survival of CD4+ and CD8+ thymocytes. Immunity, 29(4), 523-537. doi:10.1016/j.immuni.2008.08.010

Juang, Y. T., Wang, Y., Solomou, E. E., Li, Y., Mawrin, C., Tenbrock, K., Kyttaris, V. C., & Tsokos, G. C. (2005). Systemic lupus erythematosus serum IgG increases CREM binding to the IL-2 promoter and suppresses IL-2 production through CaMKIV. J Clin Invest, 115(4), 996- 1005. doi:10.1172/JCI22854

Kar, P., & Parekh, A. B. (2015). Distinct spatial Ca2+ signatures selectively activate different NFAT transcription factor isoforms. Mol Cell, 58(2), 232-243. doi:10.1016/j.molcel.2015.02.027

Kasneci, A., Kemeny-Suss, N. M., Komarova, S. V., & Chalifour, L. E. (2009). Egr-1 negatively regulates calsequestrin expression and calcium dynamics in ventricular cells. Cardiovasc Res, 81(4), 695-702.

Katz, S. C., Pillarisetty, V. G., Bleier, J. I., Kingham, T. P., Chaudhry, U. I., Shah, A. B., & DeMatteo, R. P. (2005). Conventional liver CD4 T cells are functionally distinct and suppressed by environmental factors. Hepatology, 42(2), 293-300. doi:10.1002/hep.20795

Khachigian, L. M. (2006). Early growth response-1 in cardiovascular pathobiology. Circ Res, 98(2), 186-191. doi:10.1161/01.RES.0000200177.53882.c3

- 159 -

Kharfan-Dabaja, M. A., & Cutler, C. S. (2011). Rituximab for prevention and treatment of graft- versus-host disease. Int J Hematol, 93(5), 578-585. doi:10.1007/s12185-011-0855-2

Kim, J. Y., & Muallem, S. (2011). Unlocking SOAR releases STIM. EMBO J, 30(9), 1673-1675. doi:10.1038/emboj.2011.107

Kirichok, Y., Krapivinsky, G., & Clapham, D. E. (2004). The mitochondrial calcium uniporter is a highly selective ion channel. Nature, 427(6972), 360-364. doi:10.1038/nature02246

Komarowska, I., Coe, D., Wang, G., Haas, R., Mauro, C., Kishore, M., Cooper, D., Nadkarni, S., Fu, H., Steinbruchel, D. A., Pitzalis, C., Anderson, G., Bucy, P., Lombardi, G., Breckenridge, R., & Marelli-Berg, F. M. (2015). Hepatocyte Growth Factor Receptor c-Met Instructs T Cell Cardiotropism and Promotes T Cell Migration to the Heart via Autocrine Chemokine Release. Immunity, 42(6), 1087-1099. doi:10.1016/j.immuni.2015.05.014

Kornblit, B., Masmas, T., Petersen, S. L., Madsen, H. O., Heilmann, C., Schejbel, L., Sengelov, H., Muller, K., Garred, P., & Vindelov, L. (2010). Association of HMGB1 polymorphisms with outcome after allogeneic hematopoietic cell transplantation. Biol Blood Marrow Transplant, 16(2), 239-252. doi:10.1016/j.bbmt.2009.10.002

Korzeniowski, M. K., Manjarres, I. M., Varnai, P., & Balla, T. (2010). Activation of STIM1-Orai1 involves an intramolecular switching mechanism. Sci Signal, 3(148), ra82. doi:3/148/ra82 [pii] 10.1126/scisignal.2001122

Kramer, B., Meichle, A., Hensel, G., Charnay, P., & Kronke, M. (1994). Characterization of an Krox-24/Egr-1-responsive element in the human tumor necrosis factor promoter. Biochim Biophys Acta, 1219(2), 413-421.

Kuo, C. T., & Leiden, J. M. (1999). Transcriptional regulation of T lymphocyte development and function. Annu Rev Immunol, 17, 149-187. doi:10.1146/annurev.immunol.17.1.149

Kupfer, A., & Kupfer, H. (2003). Imaging immune cell interactions and functions: SMACs and the Immunological Synapse. Semin Immunol, 15(6), 295-300. doi:10.1016/j.smim.2003.09.001

Latif, F., Duh, F. M., Gnarra, J., Tory, K., Kuzmin, I., Yao, M., Stackhouse, T., Modi, W., Geil, L., Schmidt, L., & et al. (1993). von Hippel-Lindau syndrome: cloning and identification of the plasma membrane Ca(++)-transporting ATPase isoform 2 gene that resides in the von Hippel-Lindau gene region. Cancer Res, 53(4), 861-867.

- 160 -

Lauritsen, J. P., Kurella, S., Lee, S. Y., Lefebvre, J. M., Rhodes, M., Alberola-Ila, J., & Wiest, D. L. (2008). Egr2 is required for Bcl-2 induction during positive selection. J Immunol, 181(11), 7778-7785.

Lauritsen, J. P., Wong, G. W., Lee, S. Y., Lefebvre, J. M., Ciofani, M., Rhodes, M., Kappes, D. J., Zuniga-Pflucker, J. C., & Wiest, D. L. (2009). Marked induction of the helix-loop-helix protein Id3 promotes the gammadelta T cell fate and renders their functional maturation Notch independent. Immunity, 31(4), 565-575. doi:10.1016/j.immuni.2009.07.010

Lee, S. L., Sadovsky, Y., Swirnoff, A. H., Polish, J. A., Goda, P., Gavrilina, G., & Milbrandt, J. (1996). Luteinizing hormone deficiency and female infertility in mice lacking the transcription factor NGFI-A (Egr-1). Science, 273(5279), 1219-1221.

Lewis, R. S. (2001). Calcium signaling mechanisms in T lymphocytes. Annu Rev Immunol, 19, 497- 521. doi:19/1/497 [pii] 10.1146/annurev.immunol.19.1.497

Lewis, R. S. (2011). Store-operated calcium channels: new perspectives on mechanism and function. Cold Spring Harb Perspect Biol, 3(12). doi:10.1101/cshperspect.a003970

Li, S., Miao, T., Sebastian, M., Bhullar, P., Ghaffari, E., Liu, M., Symonds, A. L., & Wang, P. (2012). The transcription factors Egr2 and Egr3 are essential for the control of inflammation and antigen-induced proliferation of B and T cells. Immunity, 37(4), 685-696. doi:10.1016/j.immuni.2012.08.001

Li, Y., Sedwick, C. E., Hu, J., & Altman, A. (2005). Role for protein kinase Ctheta (PKCtheta) in TCR/CD28-mediated signaling through the canonical but not the non-canonical pathway for NF-kappaB activation. J Biol Chem, 280(2), 1217-1223. doi:10.1074/jbc.M409492200

Li, Z., Lu, J., Xu, P., Xie, X., Chen, L., & Xu, T. (2007). Mapping the interacting domains of STIM1 and Orai1 in Ca2+ release-activated Ca2+ channel activation. J Biol Chem, 282(40), 29448- 29456.

Lin, J., & Weiss, A. (2001). T cell receptor signalling. J Cell Sci, 114(Pt 2), 243-244.

Lin, J. X., & Leonard, W. J. (1997). The immediate-early gene product Egr-1 regulates the human interleukin-2 receptor beta-chain promoter through noncanonical Egr and Sp1 binding sites. Mol Cell Biol, 17(7), 3714-3722.

- 161 -

Liou, J., Fivaz, M., Inoue, T., & Meyer, T. (2007). Live-cell imaging reveals sequential oligomerization and local plasma membrane targeting of stromal interaction molecule 1 after Ca2+ store depletion. Proc Natl Acad Sci U S A, 104(22), 9301-9306. doi:10.1073/pnas.0702866104

Liou, J., Kim, M. L., Heo, W. D., Jones, J. T., Myers, J. W., Ferrell, J. E., Jr., & Meyer, T. (2005). STIM is a Ca2+ sensor essential for Ca2+-store-depletion-triggered Ca2+ influx. Curr Biol, 15(13), 1235-1241.

Lioudyno, M. I., Kozak, J. A., Penna, A., Safrina, O., Zhang, S. L., Sen, D., Roos, J., Stauderman, K. A., & Cahalan, M. D. (2008). Orai1 and STIM1 move to the immunological synapse and are up-regulated during T cell activation. Proc Natl Acad Sci U S A, 105(6), 2011-2016. doi:0706122105 [pii] 10.1073/pnas.0706122105

Lis, A., Peinelt, C., Beck, A., Parvez, S., Monteilh-Zoller, M., Fleig, A., & Penner, R. (2007). CRACM1, CRACM2, and CRACM3 are store-operated Ca2+ channels with distinct functional properties. Curr Biol, 17(9), 794-800.

Liu, R., Zhao, X., Gurney, T. A., & Landau, N. R. (1998). Functional analysis of the proximal CCR5 promoter. AIDS Res Hum Retroviruses, 14(17), 1509-1519. doi:10.1089/aid.1998.14.1509

Liu, X., Berry, C. T., Ruthel, G., Madara, J. J., MacGillivray, K., Gray, C. M., Madge, L. A., McCorkell, K. A., Beiting, D. P., Hershberg, U., May, M. J., & Freedman, B. D. (2016). T cell receptor-induced NF-kappaB signaling and transcriptional activation are regulated by STIM1- and Orai1-mediated calcium entry. J Biol Chem. doi:10.1074/jbc.M115.713008

Lohoff, M., Giaisi, M., Kohler, R., Casper, B., Krammer, P. H., & Li-Weber, M. (2010). Early growth response protein-1 (Egr-1) is preferentially expressed in T helper type 2 (Th2) cells and is involved in acute transcription of the Th2 cytokine interleukin-4. J Biol Chem, 285(3), 1643-1652. doi:10.1074/jbc.M109.011585

Luik, R. M., Wang, B., Prakriya, M., Wu, M. M., & Lewis, R. S. (2008). Oligomerization of STIM1 couples ER calcium depletion to CRAC channel activation. Nature, 454(7203), 538-542.

Ma, D., Wei, Y., & Liu, F. (2013). Regulatory mechanisms of thymus and T cell development. Dev Comp Immunol, 39(1-2), 91-102. doi:10.1016/j.dci.2011.12.013

- 162 -

Ma, J., McCarl, C. A., Khalil, S., Luthy, K., & Feske, S. (2010). T-cell-specific deletion of STIM1 and STIM2 protects mice from EAE by impairing the effector functions of Th1 and Th17 cells. Eur J Immunol, 40(11), 3028-3042. doi:10.1002/eji.201040614

Macian, F. (2005). NFAT proteins: key regulators of T-cell development and function. Nat Rev Immunol, 5(6), 472-484. doi:10.1038/nri1632

Macian, F., Garcia-Cozar, F., Im, S. H., Horton, H. F., Byrne, M. C., & Rao, A. (2002). Transcriptional mechanisms underlying lymphocyte tolerance. Cell, 109(6), 719-731.

Macian, F., Lopez-Rodriguez, C., & Rao, A. (2001). Partners in transcription: NFAT and AP-1. Oncogene, 20(19), 2476-2489. doi:10.1038/sj.onc.1204386

Mallilankaraman, K., Doonan, P., Cardenas, C., Chandramoorthy, H. C., Muller, M., Miller, R., Hoffman, N. E., Gandhirajan, R. K., Molgo, J., Birnbaum, M. J., Rothberg, B. S., Mak, D. O., Foskett, J. K., & Madesh, M. (2012). MICU1 is an essential gatekeeper for MCU- mediated mitochondrial Ca(2+) uptake that regulates cell survival. Cell, 151(3), 630-644. doi:10.1016/j.cell.2012.10.011

Manicassamy, S., Gupta, S., & Sun, Z. (2006). Selective function of PKC-theta in T cells. Cell Mol Immunol, 3(4), 263-270.

Marchi, S., & Pinton, P. (2014). The mitochondrial calcium uniporter complex: molecular components, structure and physiopathological implications. J Physiol, 592(5), 829-839. doi:10.1113/jphysiol.2013.268235

Markey, K. A., Banovic, T., Kuns, R. D., Olver, S. D., Don, A. L., Raffelt, N. C., Wilson, Y. A., Raggatt, L. J., Pettit, A. R., Bromberg, J. S., Hill, G. R., & MacDonald, K. P. (2009). Conventional dendritic cells are the critical donor APC presenting alloantigen after experimental bone marrow transplantation. Blood, 113(22), 5644-5649. doi:10.1182/blood-2008-12-191833

McNally, B. A., Somasundaram, A., Jairaman, A., Yamashita, M., & Prakriya, M. (2013). The C- and N-terminal STIM1 binding sites on Orai1 are required for both trapping and gating CRAC channels. J Physiol, 591(11), 2833-2850. doi:10.1113/jphysiol.2012.250456

McNally, B. A., Somasundaram, A., Yamashita, M., & Prakriya, M. (2012). Gated regulation of CRAC channel ion selectivity by STIM1. Nature, 482(7384), 241-245. doi:10.1038/nature10752

- 163 -

McNally, B. A., Yamashita, M., Engh, A., & Prakriya, M. (2009). Structural determinants of ion permeation in CRAC channels. Proc Natl Acad Sci U S A, 106(52), 22516-22521. doi:0909574106 [pii] 10.1073/pnas.0909574106

Melichar, H. J., Ross, J. O., Herzmark, P., Hogquist, K. A., & Robey, E. A. (2013). Distinct temporal patterns of T cell receptor signaling during positive versus negative selection in situ. Sci Signal, 6(297), ra92. doi:10.1126/scisignal.2004400

Mercer, J. C., Dehaven, W. I., Smyth, J. T., Wedel, B., Boyles, R. R., Bird, G. S., & Putney, J. W., Jr. (2006). Large store-operated calcium selective currents due to co-expression of Orai1 or Orai2 with the intracellular calcium sensor, Stim1. J Biol Chem, 281(34), 24979-24990. doi:10.1074/jbc.M604589200

Mignen, O., Thompson, J. L., & Shuttleworth, T. J. (2008). Both Orai1 and Orai3 are essential components of the arachidonate-regulated Ca2+-selective (ARC) channels. J Physiol, 586(1), 185-195. doi:jphysiol.2007.146258 [pii] 10.1113/jphysiol.2007.146258

Muik, M., Frischauf, I., Derler, I., Fahrner, M., Bergsmann, J., Eder, P., Schindl, R., Hesch, C., Polzinger, B., Fritsch, R., Kahr, H., Madl, J., Gruber, H., Groschner, K., & Romanin, C. (2008). Dynamic coupling of the putative coiled-coil domain of ORAI1 with STIM1 mediates ORAI1 channel activation. J Biol Chem, 283(12), 8014-8022. doi:10.1074/jbc.M708898200

Muller, M. R., & Rao, A. (2010). NFAT, immunity and cancer: a transcription factor comes of age. Nat Rev Immunol, 10(9), 645-656. doi:nri2818 [pii] 10.1038/nri2818

Munoz-Ruiz, M., Ribot, J. C., Grosso, A. R., Goncalves-Sousa, N., Pamplona, A., Pennington, D. J., Regueiro, J. R., Fernandez-Malave, E., & Silva-Santos, B. (2016). TCR signal strength controls thymic differentiation of discrete proinflammatory gammadelta T cell subsets. Nat Immunol, 17(6), 721-727. doi:10.1038/ni.3424

Nicholls, D. G. (2005). Mitochondria and calcium signaling. Cell Calcium, 38(3-4), 311-317.

Niggli, V., Sigel, E., & Carafoli, E. (1982). The purified Ca2+ pump of human erythrocyte membranes catalyzes an electroneutral Ca2+-H+ exchange in reconstituted liposomal systems. J Biol Chem, 257(5), 2350-2356.

- 164 -

Nolz, J. C., Gomez, T. S., Zhu, P., Li, S., Medeiros, R. B., Shimizu, Y., Burkhardt, J. K., Freedman, B. D., & Billadeau, D. D. (2006). The WAVE2 complex regulates actin cytoskeletal reorganization and CRAC-mediated calcium entry during T cell activation. Curr Biol, 16(1), 24-34. doi:10.1016/j.cub.2005.11.036

Oh-Hora, M., Komatsu, N., Pishyareh, M., Feske, S., Hori, S., Taniguchi, M., Rao, A., & Takayanagi, H. (2013). Agonist-selected T cell development requires strong T cell receptor signaling and store-operated calcium entry. Immunity, 38(5), 881-895. doi:10.1016/j.immuni.2013.02.008

Oh-Hora, M., Yamashita, M., Hogan, P. G., Sharma, S., Lamperti, E., Chung, W., Prakriya, M., Feske, S., & Rao, A. (2008). Dual functions for the endoplasmic reticulum calcium sensors STIM1 and STIM2 in T cell activation and tolerance. Nat Immunol, 9(4), 432-443.

Okamura, H., Garcia-Rodriguez, C., Martinson, H., Qin, J., Virshup, D. M., & Rao, A. (2004). A conserved docking motif for CK1 binding controls the nuclear localization of NFAT1. Mol Cell Biol, 24(10), 4184-4195.

Olson, S., Wang, M. G., Carafoli, E., Strehler, E. E., & McBride, O. W. (1991). Localization of two genes encoding plasma membrane Ca2(+)-transporting ATPases to human chromosomes 1q25-32 and 12q21-23. Genomics, 9(4), 629-641.

Orrenius, S., Zhivotovsky, B., & Nicotera, P. (2003). Regulation of cell death: the calcium- apoptosis link. Nat Rev Mol Cell Biol, 4(7), 552-565.

Owens, A. H., Jr., & Santos, G. W. (1971). The effect of cytotoxic drugs on graft-versus-host disease in mice. Transplantation, 11(4), 378-382.

Paczesny, S., Braun, T. M., Levine, J. E., Hogan, J., Crawford, J., Coffing, B., Olsen, S., Choi, S. W., Wang, H., Faca, V., Pitteri, S., Zhang, Q., Chin, A., Kitko, C., Mineishi, S., Yanik, G., Peres, E., Hanauer, D., Wang, Y., Reddy, P., et al. (2010). Elafin is a biomarker of graft-versus- host disease of the skin. Sci Transl Med, 2(13), 13ra12. doi:10.1126/scitranslmed.3000406

Palacios, E. H., & Weiss, A. (2004). Function of the Src-family kinases, Lck and Fyn, in T-cell development and activation. Oncogene, 23(48), 7990-8000. doi:10.1038/sj.onc.1208074

Park, C. Y., Hoover, P. J., Mullins, F. M., Bachhawat, P., Covington, E. D., Raunser, S., Walz, T., Garcia, K. C., Dolmetsch, R. E., & Lewis, R. S. (2009). STIM1 clusters and activates CRAC channels via direct binding of a cytosolic domain to Orai1. Cell, 136(5), 876-890.

- 165 -

Patron, M., Checchetto, V., Raffaello, A., Teardo, E., Vecellio Reane, D., Mantoan, M., Granatiero, V., Szabo, I., De Stefani, D., & Rizzuto, R. (2014). MICU1 and MICU2 finely tune the mitochondrial Ca2+ uniporter by exerting opposite effects on MCU activity. Mol Cell, 53(5), 726-737. doi:10.1016/j.molcel.2014.01.013

Patterson, R. L., van Rossum, D. B., & Gill, D. L. (1999). Store-operated Ca2+ entry: evidence for a secretion-like coupling model. Cell, 98(4), 487-499.

Peinelt, C., Vig, M., Koomoa, D. L., Beck, A., Nadler, M. J., Koblan-Huberson, M., Lis, A., Fleig, A., Penner, R., & Kinet, J. P. (2006). Amplification of CRAC current by STIM1 and CRACM1 (Orai1). Nat Cell Biol, 8(7), 771-773.

Penack, O., Holler, E., & van den Brink, M. R. (2010). Graft-versus-host disease: regulation by microbe-associated molecules and innate immune receptors. Blood, 115(10), 1865- 1872. doi:10.1182/blood-2009-09-242784

Perocchi, F., Gohil, V. M., Girgis, H. S., Bao, X. R., McCombs, J. E., Palmer, A. E., & Mootha, V. K. (2010). MICU1 encodes a mitochondrial EF hand protein required for Ca(2+) uptake. Nature, 467(7313), 291-296. doi:10.1038/nature09358

Picard, C., McCarl, C. A., Papolos, A., Khalil, S., Luthy, K., Hivroz, C., LeDeist, F., Rieux-Laucat, F., Rechavi, G., Rao, A., Fischer, A., & Feske, S. (2009). STIM1 mutation associated with a syndrome of immunodeficiency and autoimmunity. N Engl J Med, 360(19), 1971-1980. doi:360/19/1971 [pii] 10.1056/NEJMoa0900082

Porter, C. M., Havens, M. A., & Clipstone, N. A. (2000). Identification of amino acid residues and protein kinases involved in the regulation of NFATc subcellular localization. J Biol Chem, 275(5), 3543-3551.

Prakriya, M. (2013). Store-operated Orai channels: structure and function. Curr Top Membr, 71, 1-32. doi:10.1016/B978-0-12-407870-3.00001-9

Prakriya, M., Feske, S., Gwack, Y., Srikanth, S., Rao, A., & Hogan, P. G. (2006). Orai1 is an essential pore subunit of the CRAC channel. Nature, 443(7108), 230-233.

Prentice, H. G., Blacklock, H. A., Janossy, G., Gilmore, M. J., Price-Jones, L., Tidman, N., Trejdosiewicz, L. K., Skeggs, D. B., Panjwani, D., Ball, S., & et al. (1984). Depletion of T lymphocytes in donor marrow prevents significant graft-versus-host disease in matched allogeneic leukaemic marrow transplant recipients. Lancet, 1(8375), 472-476.

- 166 -

Puel, A., Picard, C., Ku, C. L., Smahi, A., & Casanova, J. L. (2004). Inherited disorders of NF- kappaB-mediated immunity in man. Curr Opin Immunol, 16(1), 34-41.

Puleston, D. J., & Simon, A. K. (2014). Autophagy in the immune system. Immunology, 141(1), 1- 8. doi:10.1111/imm.12165

Putney, J. W., Jr. (1978). Stimulus-permeability coupling: role of calcium in the receptor regulation of membrane permeability. Pharmacol Rev, 30(2), 209-245.

Putney, J. W., Jr. (1986). A model for receptor-regulated calcium entry. Cell Calcium, 7(1), 1-12.

Quintana, A., Pasche, M., Junker, C., Al-Ansary, D., Rieger, H., Kummerow, C., Nunez, L., Villalobos, C., Meraner, P., Becherer, U., Rettig, J., Niemeyer, B. A., & Hoth, M. (2011). Calcium microdomains at the immunological synapse: how ORAI channels, mitochondria and calcium pumps generate local calcium signals for efficient T-cell activation. Embo J, 30(19), 3895-3912. doi:10.1038/emboj.2011.289 emboj2011289 [pii]

Quintana, A., Schwindling, C., Wenning, A. S., Becherer, U., Rettig, J., Schwarz, E. C., & Hoth, M. (2007). T cell activation requires mitochondrial translocation to the immunological synapse. Proc Natl Acad Sci U S A, 104(36), 14418-14423. doi:0703126104 [pii] 10.1073/pnas.0703126104

Ramadan, A., & Paczesny, S. (2015). Various forms of tissue damage and danger signals following hematopoietic stem-cell transplantation. Front Immunol, 6, 14. doi:10.3389/fimmu.2015.00014

Rao, A., Luo, C., & Hogan, P. G. (1997). Transcription factors of the NFAT family: regulation and function. Annu Rev Immunol, 15, 707-747. doi:10.1146/annurev.immunol.15.1.707

Reinhardt, T. A., Filoteo, A. G., Penniston, J. T., & Horst, R. L. (2000). Ca(2+)-ATPase protein expression in mammary tissue. Am J Physiol Cell Physiol, 279(5), C1595-1602.

Ritchie, M. F., Samakai, E., & Soboloff, J. (2012). STIM1 is required for attenuation of PMCA- mediated Ca2+ clearance during T-cell activation. Embo J, 31(5), 1123-1133. doi:10.1038/emboj.2011.495 emboj2011495 [pii]

- 167 -

Ritchie, M. F., Yue, C., Zhou, Y., Houghton, P. J., & Soboloff, J. (2010). Wilms tumor suppressor 1 (WT1) and early growth response 1 (EGR1) are regulators of STIM1 expression. J Biol Chem, 285(14), 10591-10596. doi:M109.083493 [pii] 10.1074/jbc.M109.083493

Ritchie, M. F., Zhou, Y., & Soboloff, J. (2011a). Transcriptional mechanisms regulating Ca(2+) homeostasis. Cell Calcium, 49(5), 314-321. doi:S0143-4160(10)00148-X [pii] 10.1016/j.ceca.2010.10.001

Ritchie, M. F., Zhou, Y., & Soboloff, J. (2011b). WT1/EGR1-mediated control of STIM1 expression and function in cancer cells. Front Biosci, 17, 2402-2415. doi:3862 [pii]

Rizzuto, R., De Stefani, D., Raffaello, A., & Mammucari, C. (2012). Mitochondria as sensors and regulators of calcium signalling. Nat Rev Mol Cell Biol, 13(9), 566-578. doi:10.1038/nrm3412

Romagnani, S. (2006). Regulation of the T cell response. Clin Exp Allergy, 36(11), 1357-1366. doi:10.1111/j.1365-2222.2006.02606.x

Ronchi, F., & Falcone, M. (2008). Immune regulation by invariant NKT cells in autoimmunity. Front Biosci, 13, 4827-4837.

Roos, J., Digregorio, P. J., Yeromin, A. V., Ohlsen, K., Lioudyno, M., Zhang, S., Safrina, O., Kozak, J. A., Wagner, S. L., Cahalan, M. D., Velicelebi, G., & Stauderman, K. A. (2005). STIM1, an essential and conserved component of store-operated Ca2+ channel function. J Cell Biol, 169(3), 435-445.

Rossi, J. P., Garrahan, P. J., & Rega, A. F. (1986). The activation of phosphatase activity of the Ca2+-ATPase from human red cell membranes by calmodulin, ATP and partial proteolysis. Biochim Biophys Acta, 858(1), 21-30.

Rottenberg, H., & Scarpa, A. (1974). Calcium uptake and membrane potential in mitochondria. Biochemistry, 13(23), 4811-4817.

Safford, M., Collins, S., Lutz, M. A., Allen, A., Huang, C. T., Kowalski, J., Blackford, A., Horton, M. R., Drake, C., Schwartz, R. H., & Powell, J. D. (2005). Egr-2 and Egr-3 are negative regulators of T cell activation. Nat Immunol, 6(5), 472-480. doi:10.1038/ni1193

Samakai, E., Go, C. K., & Soboloff, J. (2017). Defining the roles of Ca2+ signals during T cell activation (unpublished). Manuscript for: CRC Methods in Signal Transduction.

- 168 -

Samakai, E., Hooper, R., Martin, K. A., Shmurak, M., Zhang, Y., Kappes, D. J., Tempera, I., & Soboloff, J. (2016). Novel STIM1-dependent control of Ca2+ clearance regulates NFAT activity during T-cell activation. FASEB J. doi:10.1096/fj.201600532R

Samakai, E., Hooper, R., & Soboloff, J. (2013). The critical role of STIM1-dependent Ca2+ signalling during T-cell development and activation. Int J Biochem Cell Biol, 45(11), 2491- 2495. doi:10.1016/j.biocel.2013.07.014

Santo-Domingo, J., & Demaurex, N. (2010). Calcium uptake mechanisms of mitochondria. Biochim Biophys Acta, 1797(6-7), 907-912. doi:10.1016/j.bbabio.2010.01.005

Sarkadi, B., Szasz, I., & Gardos, G. (1980). Characteristics and regulation of active calcium transport in inside-out red cell membrane vesicles. Biochim Biophys Acta, 598(2), 326- 338.

Scheidereit, C. (2006). IkappaB kinase complexes: gateways to NF-kappaB activation and transcription. Oncogene, 25(51), 6685-6705. doi:10.1038/sj.onc.1209934

Schwab, L., Goroncy, L., Palaniyandi, S., Gautam, S., Triantafyllopoulou, A., Mocsai, A., Reichardt, W., Karlsson, F. J., Radhakrishnan, S. V., Hanke, K., Schmitt-Graeff, A., Freudenberg, M., von Loewenich, F. D., Wolf, P., Leonhardt, F., Baxan, N., Pfeifer, D., Schmah, O., Schonle, A., Martin, S. F., et al. (2014). Neutrophil granulocytes recruited upon translocation of intestinal bacteria enhance graft-versus-host disease via tissue damage. Nat Med, 20(6), 648-654. doi:10.1038/nm.3517

Schwindling, C., Quintana, A., Krause, E., & Hoth, M. (2010). Mitochondria positioning controls local calcium influx in T cells. J Immunol, 184(1), 184-190. doi:jimmunol.0902872 [pii] 10.4049/jimmunol.0902872

Shaw, P. J., & Feske, S. (2012). Regulation of lymphocyte function by ORAI and STIM proteins in infection and autoimmunity. J Physiol, 590(Pt 17), 4157-4167. doi:10.1113/jphysiol.2012.233221

Shi, X., Bi, Y., Yang, W., Guo, X., Jiang, Y., Wan, C., Li, L., Bai, Y., Guo, J., Wang, Y., Chen, X., Wu, B., Sun, H., Liu, W., Wang, J., & Xu, C. (2013). Ca2+ regulates T-cell receptor activation by modulating the charge property of lipids. Nature, 493(7430), 111-115. doi:10.1038/nature11699

Shimabukuro-Vornhagen, A., Hallek, M. J., Storb, R. F., & von Bergwelt-Baildon, M. S. (2009). The role of B cells in the pathogenesis of graft-versus-host disease. Blood, 114(24), 4919- 4927. doi:10.1182/blood-2008-10-161638

- 169 -

Shlomchik, W. D., Couzens, M. S., Tang, C. B., McNiff, J., Robert, M. E., Liu, J., Shlomchik, M. J., & Emerson, S. G. (1999). Prevention of graft versus host disease by inactivation of host antigen-presenting cells. Science, 285(5426), 412-415.

Skerka, C., Decker, E. L., & Zipfel, P. F. (1995). A regulatory element in the human interleukin 2 gene promoter is a binding site for the zinc finger proteins Sp1 and EGR-1. J Biol Chem, 270(38), 22500-22506.

Skerka, C., Decker, E. L., & Zipfel, P. F. (1997). Coordinate expression and distinct DNA-binding characteristics of the four EGR-zinc finger proteins in Jurkat T lymphocytes. Immunobiology, 198(1-3), 179-191. doi:10.1016/S0171-2985(97)80039-3

Smith-Garvin, J. E., Koretzky, G. A., & Jordan, M. S. (2009). T cell activation. Annu Rev Immunol, 27, 591-619. doi:10.1146/annurev.immunol.021908.132706 10.1146/annurev.immunol.021908.132706 [pii]

Soboloff, J., Rothberg, B. S., Madesh, M., & Gill, D. L. (2012). STIM proteins: dynamic calcium signal transducers. Nat Rev Mol Cell Biol, 13(9), 549-565. doi:10.1038/nrm3414

Soboloff, J., Spassova, M. A., Hewavitharana, T., He, L. P., Xu, W., Johnstone, L. S., Dziadek, M. A., & Gill, D. L. (2006). STIM2 is an inhibitor of STIM1-mediated store-operated Ca2+ Entry. Curr Biol, 16(14), 1465-1470. doi:S0960-9822(06)01634-4 [pii] 10.1016/j.cub.2006.05.051

Soboloff, J., Spassova, M. A., Tang, X. D., Hewavitharana, T., Xu, W., & Gill, D. L. (2006). Orai1 and STIM reconstitute store-operated calcium channel function. J Biol Chem, 281(30), 20661-20665. doi:C600126200 [pii] 10.1074/jbc.C600126200

Solomou, E. E., Juang, Y. T., & Tsokos, G. C. (2001). Protein kinase C-theta participates in the activation of cyclic AMP-responsive element-binding protein and its subsequent binding to the -180 site of the IL-2 promoter in normal human T lymphocytes. J Immunol, 166(9), 5665-5674.

Starr, T. K., Jameson, S. C., & Hogquist, K. A. (2003). Positive and negative selection of T cells. Annu Rev Immunol, 21, 139-176. doi:10.1146/annurev.immunol.21.120601.141107

Stathopulos, P. B., Zheng, L., & Ikura, M. (2009). Stromal Interaction Molecule (STIM) 1 and STIM2 Calcium Sensing Regions Exhibit Distinct Unfolding and Oligomerization Kinetics. J Biol Chem, 284(2), 728-732.

- 170 -

Stathopulos, P. B., Zheng, L., Li, G. Y., Plevin, M. J., & Ikura, M. (2008). Structural and mechanistic insights into STIM1-mediated initiation of store-operated calcium entry. Cell, 135(1), 110-122.

Stauffer, T. P., Guerini, D., & Carafoli, E. (1995). Tissue distribution of the four gene products of the plasma membrane Ca2+ pump. A study using specific antibodies. J Biol Chem, 270(20), 12184-12190.

Stein, J. V., & Nombela-Arrieta, C. (2005). Chemokine control of lymphocyte trafficking: a general overview. Immunology, 116(1), 1-12. doi:10.1111/j.1365-2567.2005.02183.x

Strehler, E. E. (2013). Plasma membrane calcium ATPases as novel candidates for therapeutic agent development. J Pharm Pharm Sci, 16(2), 190-206.

Strehler, E. E., & Zacharias, D. A. (2001). Role of alternative splicing in generating isoform diversity among plasma membrane calcium pumps. Physiol Rev, 81(1), 21-50.

Sullivan, J. C., Kalaitzidis, D., Gilmore, T. D., & Finnerty, J. R. (2007). Rel homology domain- containing transcription factors in the cnidarian Nematostella vectensis. Dev Genes Evol, 217(1), 63-72. doi:10.1007/s00427-006-0111-6

Sun, Z., Arendt, C. W., Ellmeier, W., Schaeffer, E. M., Sunshine, M. J., Gandhi, L., Annes, J., Petrzilka, D., Kupfer, A., Schwartzberg, P. L., & Littman, D. R. (2000). PKC-theta is required for TCR-induced NF-kappaB activation in mature but not immature T lymphocytes. Nature, 404(6776), 402-407. doi:10.1038/35006090

Takemura, H., Hughes, A. R., Thastrup, O., & Putney, J. W., Jr. (1989). Activation of calcium entry by the tumor promoter thapsigargin in parotid acinar cells. Evidence that an intracellular calcium pool and not an inositol phosphate regulates calcium fluxes at the plasma membrane. J Biol Chem, 264(21), 12266-12271.

Taylor, P. A., Ehrhardt, M. J., Lees, C. J., Tolar, J., Weigel, B. J., Panoskaltsis-Mortari, A., Serody, J. S., Brinkmann, V., & Blazar, B. R. (2007). Insights into the mechanism of FTY720 and compatibility with regulatory T cells for the inhibition of graft-versus-host disease (GVHD). Blood, 110(9), 3480-3488. doi:10.1182/blood-2007-05-087940

Taylor, P. A., Kelly, R. M., Bade, N. D., Smith, M. J., Stefanski, H. E., & Blazar, B. R. (2012). FTY720 markedly increases alloengraftment but does not eliminate host anti-donor T cells that cause graft rejection on its withdrawal. Biol Blood Marrow Transplant, 18(9), 1341-1352. doi:10.1016/j.bbmt.2012.06.007

- 171 -

Tempera, I., Klichinsky, M., & Lieberman, P. M. (2011). EBV latency types adopt alternative chromatin conformations. PLoS Pathog, 7(7), e1002180. doi:10.1371/journal.ppat.1002180

Tempera, I., Wiedmer, A., Dheekollu, J., & Lieberman, P. M. (2010). CTCF prevents the epigenetic drift of EBV latency promoter Qp. PLoS Pathog, 6(8), e1001048. doi:10.1371/journal.ppat.1001048

Teshima, T., Ordemann, R., Reddy, P., Gagin, S., Liu, C., Cooke, K. R., & Ferrara, J. L. (2002). Acute graft-versus-host disease does not require alloantigen expression on host epithelium. Nat Med, 8(6), 575-581. doi:10.1038/nm0602-575

Thastrup, O., Cullen, P. J., Drobak, B. K., Hanley, M. R., & Dawson, A. P. (1990). Thapsigargin, a tumor promoter, discharges intracellular Ca2+ stores by specific inhibition of the endoplasmic reticulum Ca2(+)-ATPase. Proc Natl Acad Sci U S A, 87(7), 2466-2470.

Theiss-Suennemann, J., Jorss, K., Messmann, J. J., Reichardt, S. D., Montes-Cobos, E., Luhder, F., Tuckermann, J. P., H, A. W., Dressel, R., Grone, H. J., Strauss, G., & Reichardt, H. M. (2015). Glucocorticoids attenuate acute graft-versus-host disease by suppressing the cytotoxic capacity of CD8(+) T cells. J Pathol, 235(4), 646-655. doi:10.1002/path.4475

Tian, C., Du, L., Zhou, Y., & Li, M. (2016). Store-operated CRAC channel inhibitors: opportunities and challenges. Future Med Chem, 8(7), 817-832. doi:10.4155/fmc-2016-0024

Tomlinson, M. G., Kane, L. P., Su, J., Kadlecek, T. A., Mollenauer, M. N., & Weiss, A. (2004). Expression and function of Tec, Itk, and Btk in lymphocytes: evidence for a unique role for Tec. Mol Cell Biol, 24(6), 2455-2466.

Toubai, T., Tawara, I., Sun, Y., Liu, C., Nieves, E., Evers, R., Friedman, T., Korngold, R., & Reddy, P. (2012). Induction of acute GVHD by sex-mismatched H-Y antigens in the absence of functional radiosensitive host hematopoietic-derived antigen-presenting cells. Blood, 119(16), 3844-3853. doi:10.1182/blood-2011-10-384057

Tourtellotte, W. G., Nagarajan, R., Auyeung, A., Mueller, C., & Milbrandt, J. (1999). Infertility associated with incomplete spermatogenic arrest and oligozoospermia in Egr4-deficient mice. Development, 126(22), 5061-5071.

Tourtellotte, W. G., Nagarajan, R., Bartke, A., & Milbrandt, J. (2000). Functional compensation by Egr4 in Egr1-dependent luteinizing hormone regulation and Leydig cell steroidogenesis. Mol Cell Biol, 20(14), 5261-5268.

- 172 -

Vaeth, M., Bauerlein, C. A., Pusch, T., Findeis, J., Chopra, M., Mottok, A., Rosenwald, A., Beilhack, A., & Berberich-Siebelt, F. (2015). Selective NFAT targeting in T cells ameliorates GvHD while maintaining antitumor activity. Proc Natl Acad Sci U S A, 112(4), 1125-1130. doi:10.1073/pnas.1409290112

Valdor, R., Mocholi, E., Botbol, Y., Guerrero-Ros, I., Chandra, D., Koga, H., Gravekamp, C., Cuervo, A. M., & Macian, F. (2014). Chaperone-mediated autophagy regulates T cell responses through targeted degradation of negative regulators of T cell activation. Nat Immunol, 15(11), 1046-1054. doi:10.1038/ni.3003

Vallabhapurapu, S., & Karin, M. (2009). Regulation and function of NF-kappaB transcription factors in the immune system. Annu Rev Immunol, 27, 693-733. doi:10.1146/annurev.immunol.021908.132641 van Leeuwen, J. E., & Samelson, L. E. (1999). T cell antigen-receptor signal transduction. Curr Opin Immunol, 11(3), 242-248. van Panhuys, N., Klauschen, F., & Germain, R. N. (2014). T-cell-receptor-dependent signal intensity dominantly controls CD4(+) T cell polarization In Vivo. Immunity, 41(1), 63-74. doi:10.1016/j.immuni.2014.06.003 van Wijk, F., & Cheroutre, H. (2009). Intestinal T cells: facing the mucosal immune dilemma with synergy and diversity. Semin Immunol, 21(3), 130-138. doi:10.1016/j.smim.2009.03.003

Vanags, D. M., Porn-Ares, M. I., Coppola, S., Burgess, D. H., & Orrenius, S. (1996). Protease involvement in fodrin cleavage and phosphatidylserine exposure in apoptosis. J Biol Chem, 271(49), 31075-31085.

Verma, A. K., Filoteo, A. G., Stanford, D. R., Wieben, E. D., Penniston, J. T., Strehler, E. E., Fischer, R., Heim, R., Vogel, G., Mathews, S., & et al. (1988). Complete primary structure of a human plasma membrane Ca2+ pump. J Biol Chem, 263(28), 14152-14159.

Vig, M., Beck, A., Billingsley, J. M., Lis, A., Parvez, S., Peinelt, C., Koomoa, D. L., Soboloff, J., Gill, D. L., Fleig, A., Kinet, J. P., & Penner, R. (2006). CRACM1 multimers form the ion- selective pore of the CRAC channel. Curr Biol, 16(20), 2073-2079. doi:S0960- 9822(06)02153-1 [pii] 10.1016/j.cub.2006.08.085

Vig, M., Peinelt, C., Beck, A., Koomoa, D. L., Rabah, D., Koblan-Huberson, M., Kraft, S., Turner, H., Fleig, A., Penner, R., & Kinet, J. P. (2006). CRACM1 is a plasma membrane protein essential for store-operated Ca2+ entry. Science, 312(5777), 1220-1223.

- 173 -

Wan, N., Dai, H., Wang, T., Moore, Y., Zheng, X. X., & Dai, Z. (2008). Bystander central memory but not effector memory CD8+ T cells suppress allograft rejection. J Immunol, 180(1), 113-121.

Wang, C., Dostanic, S., Servant, N., & Chalifour, L. E. (2005). Egr-1 negatively regulates expression of the sodium-calcium exchanger-1 in cardiomyocytes in vitro and in vivo. Cardiovasc Res, 65(1), 187-194.

Wang, K. K., Wright, L. C., Machan, C. L., Allen, B. G., Conigrave, A. D., & Roufogalis, B. D. (1991). Protein kinase C phosphorylates the carboxyl terminus of the plasma membrane Ca(2+)- ATPase from human erythrocytes. J Biol Chem, 266(14), 9078-9085.

Wang, M. G., Yi, H., Hilfiker, H., Carafoli, E., Strehler, E. E., & McBride, O. W. (1994). Localization of two genes encoding plasma membrane Ca2+ ATPases isoforms 2 (ATP2B2) and 3 (ATP2B3) to human chromosomes 3p26-->p25 and Xq28, respectively. Cytogenet Cell Genet, 67(1), 41-45.

Wang, X., Luo, H., Chen, H., Duguid, W., & Wu, J. (1998). Role of proteasomes in T cell activation and proliferation. J Immunol, 160(2), 788-801.

Wang, X., Wang, Y., Zhou, Y., Hendron, E., Mancarella, S., Andrake, M. D., Rothberg, B. S., Soboloff, J., & Gill, D. L. (2014). Distinct Orai-coupling domains in STIM1 and STIM2 define the Orai-activating site. Nat Commun, 5, 3183. doi:10.1038/ncomms4183

Wang, Y., Deng, X., Zhou, Y., Hendron, E., Mancarella, S., Ritchie, M. F., Tang, X. D., Baba, Y., Kurosaki, T., Mori, Y., Soboloff, J., & Gill, D. L. (2009). STIM protein coupling in the activation of Orai channels. Proc Natl Acad Sci U S A, 106(18), 7391-7396. doi:0900293106 [pii] 10.1073/pnas.0900293106

Wegener, E., Oeckinghaus, A., Papadopoulou, N., Lavitas, L., Schmidt-Supprian, M., Ferch, U., Mak, T. W., Ruland, J., Heissmeyer, V., & Krappmann, D. (2006). Essential role for IkappaB kinase beta in remodeling Carma1-Bcl10-Malt1 complexes upon T cell activation. Mol Cell, 23(1), 13-23. doi:10.1016/j.molcel.2006.05.027

Wei, F., Xu, Z. C., Qu, Z., Milbrandt, J., & Zhuo, M. (2000). Role of EGR1 in hippocampal synaptic enhancement induced by tetanic stimulation and amputation. J Cell Biol, 149(7), 1325- 1334.

Weiden, P. L., Flournoy, N., Thomas, E. D., Prentice, R., Fefer, A., Buckner, C. D., & Storb, R. (1979). Antileukemic effect of graft-versus-host disease in human recipients of

- 174 -

allogeneic-marrow grafts. N Engl J Med, 300(19), 1068-1073. doi:10.1056/NEJM197905103001902

Weiss, A., Imboden, J., Shoback, D., & Stobo, J. (1984). Role of T3 surface molecules in human T- cell activation: T3-dependent activation results in an increase in cytoplasmic free calcium. Proc Natl Acad Sci U S A, 81(13), 4169-4173.

Wen, H. S., Wang, J. M., Zhou, H., Gong, S. I., Gao, L., & Wu, Y. (2013). Migration and activation of T cells during development of graft-versus-host disease in a mouse model. Transplant Proc, 45(2), 713-718. doi:10.1016/j.transproceed.2012.12.004

Whitfield, J. F., Perris, A. D., & Youdale, T. (1968). The role of calcium in the mitotic stimulation of rat thymocytes by detergents, agmatine and poly-L-lysine. Exp Cell Res, 53(1), 155- 165.

Williams, R. T., Senior, P. V., Van Stekelenburg, L., Layton, J. E., Smith, P. J., & Dziadek, M. A. (2002). Stromal interaction molecule 1 (STIM1), a transmembrane protein with growth suppressor activity, contains an extracellular SAM domain modified by N-linked glycosylation. Biochim Biophys Acta, 1596(1), 131-137.

Wirnsberger, G., Hinterberger, M., & Klein, L. (2011). Regulatory T-cell differentiation versus clonal deletion of autoreactive thymocytes. Immunol Cell Biol, 89(1), 45-53. doi:10.1038/icb.2010.123

Wu, H., Peisley, A., Graef, I. A., & Crabtree, G. R. (2007). NFAT signaling and the invention of vertebrates. Trends Cell Biol, 17(6), 251-260. doi:10.1016/j.tcb.2007.04.006

Wu, Y. L., Ding, Y. P., Tanaka, Y., Shen, L. W., Wei, C. H., Minato, N., & Zhang, W. (2014). gammadelta T cells and their potential for immunotherapy. Int J Biol Sci, 10(2), 119-135. doi:10.7150/ijbs.7823

Wysocki, C. A., Panoskaltsis-Mortari, A., Blazar, B. R., & Serody, J. S. (2005). Leukocyte migration and graft-versus-host disease. Blood, 105(11), 4191-4199. doi:10.1182/blood-2004-12- 4726

Xi, H., & Kersh, G. J. (2004). Early growth response gene 3 regulates thymocyte proliferation during the transition from CD4-CD8- to CD4+CD8+. J Immunol, 172(2), 964-971.

Xiong, N., & Raulet, D. H. (2007). Development and selection of gammadelta T cells. Immunol Rev, 215, 15-31. doi:10.1111/j.1600-065X.2006.00478.x

- 175 -

Xu, C., Gagnon, E., Call, M. E., Schnell, J. R., Schwieters, C. D., Carman, C. V., Chou, J. J., & Wucherpfennig, K. W. (2008). Regulation of T cell receptor activation by dynamic membrane binding of the CD3epsilon cytoplasmic tyrosine-based motif. Cell, 135(4), 702-713. doi:10.1016/j.cell.2008.09.044

Yamashita, M., Navarro-Borelly, L., McNally, B. A., & Prakriya, M. (2007). Orai1 mutations alter ion permeation and Ca2+-dependent fast inactivation of CRAC channels: evidence for coupling of permeation and gating. J Gen Physiol, 130(5), 525-540. doi:jgp.200709872 [pii] 10.1085/jgp.200709872

Yao, Y., Ferrer-Montiel, A. V., Montal, M., & Tsien, R. Y. (1999). Activation of store-operated Ca2+ current in Xenopus oocytes requires SNAP-25 but not a diffusible messenger. Cell, 98(4), 475-485.

Yeromin, A. V., Zhang, S. L., Jiang, W., Yu, Y., Safrina, O., & Cahalan, M. D. (2006). Molecular identification of the CRAC channel by altered ion selectivity in a mutant of Orai. Nature, 443(7108), 226-229.

Yissachar, N., Sharar Fischler, T., Cohen, A. A., Reich-Zeliger, S., Russ, D., Shifrut, E., Porat, Z., & Friedman, N. (2013). Dynamic response diversity of NFAT isoforms in individual living cells. Mol Cell, 49(2), 322-330. doi:10.1016/j.molcel.2012.11.003

Yu, C. T., Shih, H. M., & Lai, M. Z. (2001). Multiple signals required for cyclic AMP-responsive element binding protein (CREB) binding protein interaction induced by CD3/CD28 costimulation. J Immunol, 166(1), 284-292.

Yuan, J. P., Zeng, W., Dorwart, M. R., Choi, Y. J., Worley, P. F., & Muallem, S. (2009). SOAR and the polybasic STIM1 domains gate and regulate Orai channels. Nat Cell Biol, 11(3), 337- 343.

Zeiser, R., Socie, G., & Blazar, B. R. (2016). Pathogenesis of acute graft-versus-host disease: from intestinal microbiota alterations to donor T cell activation. Br J Haematol, 175(2), 191- 207. doi:10.1111/bjh.14295

Zhang, S. L., Yeromin, A. V., Zhang, X. H., Yu, Y., Safrina, O., Penna, A., Roos, J., Stauderman, K. A., & Cahalan, M. D. (2006). Genome-wide RNAi screen of Ca(2+) influx identifies genes that regulate Ca(2+) release-activated Ca(2+) channel activity. Proc Natl Acad Sci U S A, 103(24), 9357-9362.

Zheng, H., Matte-Martone, C., Li, H., Anderson, B. E., Venketesan, S., Sheng Tan, H., Jain, D., McNiff, J., & Shlomchik, W. D. (2008). Effector memory CD4+ T cells mediate graft-

- 176 -

versus-leukemia without inducing graft-versus-host disease. Blood, 111(4), 2476-2484. doi:10.1182/blood-2007-08-109678

Zhou, Y., Mancarella, S., Wang, Y., Yue, C., Ritchie, M., Gill, D. L., & Soboloff, J. (2009). The short N-terminal domains of STIM1 and STIM2 control the activation kinetics of Orai1 channels. J Biol Chem, 284(29), 19164-19168. doi:C109.010900 [pii] 10.1074/jbc.C109.010900

Zhou, Y., Srinivasan, P., Razavi, S., Seymour, S., Meraner, P., Gudlur, A., Stathopulos, P. B., Ikura, M., Rao, A., & Hogan, P. G. (2013). Initial activation of STIM1, the regulator of store- operated calcium entry. Nat Struct Mol Biol, 20(8), 973-981. doi:10.1038/nsmb.2625

Zhu, J., Shibasaki, F., Price, R., Guillemot, J. C., Yano, T., Dotsch, V., Wagner, G., Ferrara, P., & McKeon, F. (1998). Intramolecular masking of nuclear import signal on NF-AT4 by casein kinase I and MEKK1. Cell, 93(5), 851-861.

Zvaritch, E., James, P., Vorherr, T., Falchetto, R., Modyanov, N., & Carafoli, E. (1990). Mapping of functional domains in the plasma membrane Ca2+ pump using trypsin proteolysis. Biochemistry, 29(35), 8070-8076.

Zweifach, A., & Lewis, R. S. (1993). Mitogen-regulated Ca2+ current of T lymphocytes is activated by depletion of intracellular Ca2+ stores. Proc Natl Acad Sci U S A, 90(13), 6295-6299.

- 177 -