Integrative Taxonomy of Goezia Spinulosa (Nematoda: Raphidascarididae) MARK from Arapaimas in the Northwestern Brazil

Veterinary Parasitology 242 (2017) 14–21 Contents lists available at ScienceDirect Veterinary Parasitology journal homepage: www.elsevier.com/locate/vetpar Research paper Integrative taxonomy of Goezia spinulosa (Nematoda: Raphidascarididae) MARK from arapaimas in the northwestern Brazil Maralina Torres da Silvaa,c,e, Pedro Hercílio de Oliveira Cavalcanteb,c,e, Ana Carolina Alves de Camargoc, Vanessa Aparecida das Chagas Moutinhoc, ⁎ Everton Gustavo Nunes dos Santosc,d, Cláudia Portes Santosc, a Instituto Federal do Acre – IFAC, Rio Branco, AC, Brazil b Instituto Federal do Acre – IFAC, Xapuri, AC, Brazil c Laboratório de Avaliação e Promoção da Saúde Ambiental, Instituto Oswaldo Cruz, Fiocruz, Rio de Janeiro, RJ, Brazil d Fundação Instituto de Pesca do Estado do Rio de Janeiro – FIPERJ, Escritório Regional Metropolitano II, Duque de Caxias, RJ, Brazil e Programa de Pós-Graduação em Biodiversidade e Saúde, Instituto Oswaldo Cruz, Fiocruz, Brazil ARTICLE INFO ABSTRACT Keywords: Arapaima gigas,afish with a high market value, has been farmed in different localities within Brazil. Among its Arapaima gigas parasites, adults of Goezia spinulosa are reported to cause ulcers in the stomach and to result in the death of Brazil farmed fingerlings. Due to the veterinary importance of this nematode in cultured arapaimas, an integrative Nematoda taxonomic study is proposed, combining morphological, ultrastructural and genetic profiles of this parasite. The Scanning electron microscopy fish were obtained from semi-intensive fish farming in Acre State, Brazil. The fish measured 7–42 cm in total 18S rDNA length and the intensity of infection was 1–60 parasites per fish. The site of infection was mainly the stomach. 28S rDNA fi ITS1 5.8S and ITS2 Morphological and ultrastructural analyses of G. spinulosa showed the importance of its spiny body in rmly cox1 mtDNA attaching the worm to the gastric mucosa, resulting in lesions, ulcers and deep gastric perforations of the cox2 mtDNA stomach wall. New sequences for partial 18S rDNA, ITS1, 5.8S and ITS2 rDNA, partial 28S rDNA, cox1 mtDNA and for cox2 mtDNA are presented. Phylogenetic reconstructions based on the partial 18S and 28S rDNA shows species of Goezia occur in a clade well separated from other genera in both analyses. Both the partial 18S and 28S rDNA genes represented good genetic markers for distinguishing genera of the Raphidascarididae, with exception of Hysterothylacium. This integrated taxonomic study produced a robust profile for G. spinulosa that will aid the diagnosis of both adults and larval stages from arapaimas and possible intermediate hosts. 1. Introduction only a single monogenean species was found. In the semi-intensive system, the prevalence of G. spinulosa was 29.7% (Silva et al., 2016). The nematode Goezia spinulosa (Diesing, 1839) has been reported Due to the veterinary importance of G. spinulosa in farmed parasitizing Arapaima gigas (Schinz, 1822) in different geographical arapaimas, an integrative taxonomic study, including morphological, localities of Brazil (Moravec, 1998; Thatcher, 2006; Santos and Gibson, ultrastructural and genetic data, was undertaken in order to better 2007; Araujo et al., 2009; Santos and Moravec, 2009; Eiras et al., 2010; characterize this nematode parasite in arapaimas and thus contribute to Marinho et al., 2013; Andrade-Porto et al., 2015 and Silva et al., 2016). a better specific diagnosis of adult and larval stages. Adults of G. spinulosa are reported to cause ulcers in the stomach of their fish hosts and to cause the death of farmed fingerlings (Santos and 2. Materials and methods Moravec, 2009). Recently, we studied the helminth community structure of A. gigas 2.1. Ethics statement from semi-intensive and intensive culture systems in the State of Acre, Brazil (Silva et al., 2016). These results indicated that fish from the This study was authorized by the Brazilian Institute of Environment semi-intensive system had nine parasite species with significantly and Renewable Natural Resources (IBAMA, license no. 39106/2013) in higher levels of infection than those from the intensive system, where accordance with the guidelines of the Brazilian College for Animal ⁎ Corresponding author at: Laboratório de Avaliação e Promoção da Saúde Ambiental, Instituto Oswaldo Cruz, Fiocruz, Av. Brasil. E-mail address: cpsantos@ioc.fiocruz.br (C.P. Santos). http://dx.doi.org/10.1016/j.vetpar.2017.05.011 Received 9 December 2016; Received in revised form 11 April 2017; Accepted 17 May 2017 0304-4017/ © 2017 Elsevier B.V. All rights reserved. M.T.d. Silva et al. Veterinary Parasitology 242 (2017) 14–21 Experiments (COBEA). Table 1 List of the species of Raphidascarididae and outgroup used in the phylogenetic reconstructions using sequences of the partial 28S and 18S rDNA genes. 2.2. Study areas and collection of parasites Species GenBank access numbers fi The sh were obtained from Fazenda Boa Esperança, a semi- 28S 18S intensive fish farm, in the municipality of Bujari (9°45′24.5″S 68°04′25.0″W), Acre State, associated with the southwestern reaches Goezia spinulosa* KY198734 KY198732 – of the Amazon. The organs of 64 arapaimas were examined in saline Goezia spinulosa JF803924 fi Goezia pelagia U94758 U94372 medium under a stereomicroscope. Any parasites recovered were xed Hysterothylacium fortalezae U94760 U94374 in 70% ethanol. Some specimens were cleared and examined as Hysterothylacium pelagicum U94761 U94375 temporary mounts using glycerine. Drawings were made with the aid Raphidascaroides moraveci KP726279 KP726278 of a drawing tube and redrawn using Adobe Illustrator CS6. Raphidascaroides brasiliensis KP726275 KP726274 Raphidascaris lanfrediae KX859075 KX859076 Measurements are presented in micrometres as the range followed by Hysterothylacium reliquens U94762 U94376 the mean in parentheses, unless otherwise stated. Specimens were Hysterothylacium reliquens KX815300 – deposited at the Helminthological Collection of Instituto Oswaldo Cruz, Heterocheilus tunicatus U94759 U94373 Brazil, no. 38.520. 2.5. Phylogenetic analysis 2.3. Scanning electron microscopy (SEM) The best-fit substitution model of partial 18S and 28S dataset was The specimens were fixed in 4% formaldehyde solution, washed in the GTR + I + G model of nucleotide substitution selected under the 0.1 M sodium cacodylate buffer and post-fixed overnight in a solution Akaike information criterion (AIC) using MrModelTest 2 with the aid of 1% osmium tetroxide and potassium ferrocyanide 0.8% in the dark. PAUP4.0a147 (Nylander, 2004). The dataset was aligned using the E- Specimens were then dehydrated in an alcohol series (30–100%), INS-i algorithm of the program MAFFT (Katoh et al., 2002). Tree critical point dried with CO2, coated with gold and observed in a reconstructions were carried out using Bayesian Inference (BI) via the JEOL JSM 6390 LV SEM microscope. software MrBayes 3.2.6, where the Markov chain Monte Carlo (MCMC) was set to 4 × 106 generations, with sampling frequency every 4 × 103 generations and discarding the initial 1/4 of sampled trees (1 × 106)as 2.4. Genetic analysis burn-in (Pereira and Luque, 2016). The remaining trees were used to generate a consensus tree and to calculate the Bayesian posterior The genomic DNA was extracted using a QIAamp DNA Mini Kit probabilities (Bpp) of all branches using a majority-rule consensus (QIAGEN) according to the manufacturer's recommendations. The approach. Maximum-likelihood (ML) analysis was constructed with fi partial region spanning the 18S rDNA was ampli ed by PCR using set PhyML 3.1 and nodal support was estimated by performing 1000 ′ − ′ of primers SSU18A (5 - AAAGATTAAGCCATGCATG 3 ) and SSU26R bootstrap replicates (Swofford, 2002). Trees were rooted by Hetero- ′ − ′ (5 - CATTCTTGGCAAATGCTTTC 3 ) with the PCR following Floyd cheilus tunicatus, based upon previous phylogenies of the Ascaridoidea et al. (2002). The rDNA region spanning the ITS1, 5.8S and ITS2 was using similar genes (Nadler and Hudspeth 1998, 2000). Tree topologies fi ′ ampli ed by PCR using the primers NC5 (5 - GTAGGTGAACCTGCGG- were visualized in FigTree 1.4.2 (2014). Taxa, for which sequences ′ ′ AAGGATCATT-3 )(Zhu et al., 1998) and BD2 (5 -TATGCTTAARTTCA- from GenBank were used for phylogenetic analysis, are listed in ′ GCGGGT-3 )(Luton et al., 1992) under the following conditions: 94 °C Table 1. for 3 min, followed by 40 cycles of 95 °C, 30 s, 55 °C, 30 s, 72 °C, 60 s and 72 °C for 7 min. The partial region spanning 28S rRNA was amplified by PCR using the primers C1 (5′-ACCCGCTGAATTTAAGCA- 3. Results T-3′) and D2 (5′-TGGTCCGTGTTTCAAGAC-3′)(Hassouna et al., 1984; after Chisholm et al., 2001) under the following conditions: 95 °C for 3.1. Fish and intensity of infection 5 min, 40 cycles at 95 °C, 60 s, 56.2 °C, 45 s, 72 °C, 60 s and 72 °C for fi – – 5 min. The mtDNA citochrome oxidase subunit 1 (cox1) region was The sh measured 7 42 cm in total length and weighed 2 392 g. amplified by PCR using a set primer “cocktail” as described in Prosser The site of infection was mainly the stomach, less often the intestine. et al. (2015). The mtDNA citochrome oxidase subunit 2 (cox2) region The prevalence was 29.69%, and the intensity of infection with Goezia – fi was amplified by PCR using 210 (5′- CACCAACTCTTAAAATTATC −3′) spinulosa was 1 60 parasites per sh. and 211 (5′- TTTTCTAGTTATATAGATTGRTTTYAT −3′)(Nadler and Hudspeth, 2000). PCR assays were carried out in a total volume of 15 μl 3.2. Goezia spinulosa (Diesing, 1839) ® containing 7.5 μl of 2 × GoTaq Colorless Master Mix (Promega), 0.5 μl Mg2+ (50 mM concentration), 1.5 μl of each primers with final 3.2.1. Male (measurements of 12 specimens) concentration at 0.5 μM, 2.0 μl of cDNA sample and ultrapure water Length of body 7.8–16.6 (10.9) mm; maximum width 425–720 to complete. (595). Length (height) of lips 35–70 (50); width of body at level of lips PCR products were visualized after electrophoresis on a 1.5% 140–220 (169) (Figs.

Load more