Development of Bat Flight: Morphologic and Molecular Evolution of Bat Wing Digits

Development of bat flight: Morphologic and molecular evolution of bat wing digits

Karen E. Sears*, Richard R. Behringer†, John J. Rasweiler IV‡, and Lee A. Niswander*§

*Howard Hughes Medical Institute, Department of Pediatrics, Section of Developmental Biology, University of Colorado at Denver and Health Sciences Center, 12800 East 19th Avenue, Aurora, CO 80045; †Department of Molecular Genetics, University of Texas M. D. Anderson Cancer Center, 1515 Holcombe Boulevard, Houston, TX 77030; and ‡Department of Obstetrics and Gynecology, State University of New York Downstate Medical Center, Brooklyn, NY 11203

Edited by Cliff Tabin, Harvard Medical School, Boston, MA, and accepted by the Editorial Board March 14, 2006 (received for review November 8, 2005) The earliest fossil bats resemble their modern counterparts in used morphometric analyses to quantitatively demonstrate the possessing greatly elongated digits to support the wing mem- similarity of the wing supportive digits between the earliest fossil brane, which is an anatomical hallmark of powered flight. To and modern bats. quantitatively confirm these similarities, we performed a morpho- Because of the similarity between the forelimb digits of the metric analysis of wing bones from fossil and modern bats. We earliest preserved and modern bats, the fossil record currently found that the lengths of the third, fourth, and fifth digits (the can provide little evidence of the evolutionary transitions that primary supportive elements of the wing) have remained constant led to the elongation of bat forelimb digits and the associated relative to body size over the last 50 million years. This absence of evolution of powered flight in mammals, although this situation transitional forms in the fossil record led us to look elsewhere to may change with the discovery of additional fossil material. The understand bat wing evolution. Investigating embryonic develop- fossil record, as well as molecular-clock studies (2, 9), suggest ment, we found that the digits in bats (Carollia perspicillata) are that bats achieved powered flight in a few million years, which initially similar in size to those of mice (Mus musculus) but that, is a relatively short span of geologic time. However, these data subsequently, bat digits greatly lengthen. The developmental do not preclude the morphological prerequisites of powered timing of the change in wing digit length points to a change in flight (e.g., elongated digits) having evolved by means of gradual longitudinal cartilage growth, a process that depends on the processes. relative proliferation and differentiation of chondrocytes. We Several studies (10, 11–15) have shown that major morpho- found that bat forelimb digits exhibit relatively high rates of logical transitions can be accommodated by a few key develop- chondrocyte proliferation and differentiation. We show that bone mental genetic changes. Here, we provide functional and mo- morphogenetic protein 2 (Bmp2) can stimulate cartilage prolifer- lecular comparisons of the development of the forelimb digits of ation and differentiation and increase digit length in the bat the short-tailed fruit bat Carollia perspicillata with the digits of embryonic forelimb. Also, we show that Bmp2 expression and Bmp the bat hind limb and the digits of the forelimb of a more signaling are increased in bat forelimb embryonic digits relative to generalized quadruped, the mouse Mus musculus. Using these mouse or bat hind limb digits. Together, our results suggest that an data, we identified uniquely derived developmental features of up-regulation of the Bmp pathway is one of the major factors in the bat wing digits. Doing so allows us to highlight a key develop- developmental elongation of bat forelimb digits, and it is poten- mental genetic change and suggest evolutionary mechanisms tially a key mechanism in their evolutionary elongation as well. underlying bat digit elongation. Developmental elongation of the digits (and other long bones) ͉ ͉ Chiroptera Bmp cartilage is achieved by means of the relative rates of proliferation and differentiation of cartilage cells (chondrocytes) in the growth s a consequence of their achievement of powered flight, bats plate. Within the growth plate of developing digits, chondrocytes A(order Chiroptera) underwent one of the greatest adaptive go through the following series of maturation steps: resting (in radiations in the history of mammalian evolution and now the Resting zone), proliferation (Proliferative zone), early dif- constitute one of every five mammalian species (1). A key ferentiation (Prehypertrophic zone), and terminal differentia- innovation that enabled this extraordinary radiation is the bat tion (Hypertrophic zone) (16). Upon differentiation, chondro- wing. The bat wing consists of a membrane of skin stretched cyte cell division ceases. Subsequently, the hypertrophic between dramatically elongated third, fourth, and fifth forelimb chondrocytes secrete extracellular matrix in which ossification digits. Because of their importance in wing support, understand- begins. When the cartilage matrix ossifies, the hypertrophic ing the mechanisms that are responsible for the elongation of bat chondrocytes undergo apoptosis. Several genes that have a role forelimb digits is key to understanding the evolutionary tempo in chondrocyte maturation have been identified (i.e., Ihh, Ffg and morphological transitions that underlie this major mamma- genes, Bmp genes, and Pthrp, etc.). The bone morphogenetic lian radiation. protein (Bmp) family of secreted growth factors is of particular Molecular phylogenetic evidence suggests that Chiroptera interest. Members of the Bmp family are involved in almost every (consisting of both microbats and megabats) is a monophyletic aspect of chondrogenesis, from chondrocyte commitment to clade that is nested within the Laurasiatheria, which is a group terminal differentiation (17). In the mouse limb, Bmps are that comprises carnivorans, pangolins, ungulates, and ‘‘core’’ insectivores (or, eulipotyphlans; e.g., shrews, hedgehogs, moles, and solenodons) (2–5). There is a general consensus that the Conflict of interest statement: No conflicts declared. common ancestor of bats was a small, quadrupedal mammal, This paper was submitted directly (Track II) to the PNAS office. C.T. is a guest editor invited with a limb morphology that was similar to that of mice (6, 7). by the Editorial Board. The earliest known bats appear in the fossil record Ϸ50 million Abbreviations: Bmp, bone morphogenetic protein; En, embryonic day n; PC, principal years ago, and they appear suddenly and already possessing the component. anatomical hallmarks of powered flight (including elongated Data deposition: The sequences reported in this paper have been deposited in the GenBank third, fourth, and fifth forelimb digits) (6–8). Thus, it seems to database (accession nos. DQ279782–DQ279785). EVOLUTION be likely that the earliest known fossil bats were already capable §To whom correspondence should be addressed. E-mail: [email protected]. of powered flight (3–5). In the first component of this study, we © 2006 by The National Academy of Sciences of the USA

www.pnas.org͞cgi͞doi͞10.1073͞pnas.0509716103 PNAS ͉ April 25, 2006 ͉ vol. 103 ͉ no. 17 ͉ 6581–6586 Downloaded by guest on September 27, 2021 weakly expressed within the growth plate in proliferating (Bmp7), prehypertrophic (Bmp4), and hypertrophic (Bmp2) cells, and they are moderately expressed in the perichondrium (a dense fibrous connective tissue) that surrounds the growth plate (Bmp2–Bmp5 and Bmp7) (18). Proliferation and maturation of chondrocytes are the result of many complex interactions between the perichondrium and the growth plate. Bmp from both the perichondrium and the growth plate itself interacts with other factors within the growth plate and, thus, mediates chondrocyte maturation (17). Intriguingly, it has been shown that mouse and rat limbs that are cultured in the presence of Bmp2 protein increase in overall length, whereas mouse and rat limbs that are cultured in the presence of the Bmp antagonist Noggin result in stunted digits (19, 20). Bmp2 protein affects these changes by stimulating proliferation and the transition to hypertrophic differentiation and by inhibiting the most terminal stages of hypertrophic differentiation (19). To determine the developmental basis of bat digit elongation, we compared the embryonic development of the digits of the bat forelimb and hind limb and mouse forelimb in terms of (i) their gross and cellular morphology throughout development; (ii) their relative rates of chondrocyte proliferation and differentiation during digit elongation; (iii) the response of the limbs to culture in the presence of Bmp2 protein or a Bmp antagonist (Noggin); and (iv) the expression of many important developmental genes, including several members of the Bmp family. Our results demonstrate that bat digit length can be altered in response to changes in Bmp. Also, we show that, in the bat forelimb, there is a dramatic change in the intensity of Bmp2 expression and Bmp signaling relative to the bat hind limb and mouse forelimb. This species- and limb-specific change suggests that Bmp2 has a major role in the developmental elongation of bat wing digits. By linking small changes in molecular patterning to dramatically different phenotypes, we provide a potential explanation for the evolution of the wings of bats, which is a key innovation in mammalian history. Results Forelimb Digits of Fossil and Modern Bats Are Highly Similar. First, we compared the wing elements of the earliest known fossil (Fig. 1a) and modern bats (Fig. 1b) by using a morphometric analysis of length and width data from the forelimb bones of several fossil bats and representative species from many modern bat families. Independent regressions of the lengths of the metacarpals and phalanges of the third, fourth, and fifth digits (the primary supportive elements of the wing membrane) on a proxy for body size [principal component (PC)1] show that digits from extinct bats are not proportionally different from those of modern bats (Fig. 1c). As expected, PC1 was highly and evenly positively correlated with many variables (data not shown), suggesting that it is highly correlated with body size and, therefore, is an Fig. 1. The relative length of bat forelimb digits has not changed in 50 appropriate body-size proxy. These findings indicate that the bat million years. (a) Icaronycteris index (American Museum of Natural History wing digit proportions have not changed substantially during the specimen no. 125000), which is a 50-million-year-old bat fossil. (b) Extant adult past 50 million years of evolution. bat skeleton. The metacarpals (red arrows) of the first fossil bats are already elongated and closely resemble modern bats. This observation is confirmed by morphometric analysis of bat forelimb skeletal elements. (c) Results of regres- Initial Digit Condensations Are Similar in Proportion in Embryonic Bats sion analysis of the log of fifth metacarpal length versus a proxy for body size and Mice. To study when during ontogeny the changes in bat wing (PC1). (c and d) Extinct bats are indicated by red crosses, and modern bats are digit elongation occur, we examined embryonic stages of devel- indicated by blue circles. Modern and extinct bats fall along the same regres- opment and compared the bat forelimb with both the bat hind sion line, indicating that their metacarpals are similar in relative length. limb and mouse forelimb. Mice are thought to be similar in morphology to the ancestor of bats, and much is known about mouse limb development (21). The early cartilage condensations limb digits do not begin their rapid elongation relative to those and segmentation (i.e., joint) patterns of the bat embryo (stage of mouse until stage 20 (Fig. 2d). 16; Fig. 2a), as revealed by Alcian blue staining, are relatively similar in size and position to those of a comparably aged mouse Later-Stage Bat Wing Digits Have a Greatly Enlarged Hypertrophic embryo [embryonic day (E)12.5 or Carnegie stage 16; Fig. 2b] Zone and Increased Proliferation Relative to Mice. To study the until bat stage 20. Examination of skeletal preparations of bat histological changes that may underlie the elongation of the bat embryos from progressively later stages indicates that bat fore- wing digits, we examined the developing cartilage at the cellular

6582 ͉ www.pnas.org͞cgi͞doi͞10.1073͞pnas.0509716103 Sears et al. Downloaded by guest on September 27, 2021 Fig. 2. Developmental elongation of bat digits occurs after the initial cartilage condensations are formed. (a and b) Cartilage revealed by Alcian blue staining of stage-16 bat forelimb (a; courtesy of C. Cretekos, University of Texas M. D. Anderson Cancer Center) and E12.5 mouse forelimb (b; courtesy of M. Barna, Fox Chase Cancer Center, Philadelphia). (c) Percentage of metacarpal composed of resting (white), proliferative (green), prehypertrophic (yellow), hypertrophic (blue), and ossification (red) zones in mice (Left) and bats (Right) at stages 18–24. The size of the hypertrophic zone is initially comparable in bat and mouse digits, and it then increases in relative size in the bat forelimb at stage 20. (d) Size of the bat hypertrophic zone (blue; measured as a percentage of the total length of the fifth metacarpal) and length of the bat fifth metacarpal (purple; measured in micrometers) against bat developmental stage. At stage 20, the hypertrophic zone greatly increases in size, along with the beginning of a phase of exponential lengthening of the bat digits.

level. These analyses reveal that the major difference in the contrast, Noggin treatment resulted in significantly shorter morphology of the bat growth plate is a great expansion of the metacarpals (average decrease, 183 ␮m; P ϭ 0.015) and a hypertrophic zone of differentiated chondrocytes in the meta- significantly smaller hypertrophic zone compared with controls carpals and phalanges of the third, fourth, and fifth digits, (average decrease, 6.8%; n ϭ 12, P ϭ 0.046). relative to mouse (Fig. 2c). In mice, the metacarpal hypertrophic zone comprises, at its maximum, Ϸ12% of the growth plate (Fig. Bat Forelimb Digits Express Higher Levels of Bmp2 than the Digits of 2c). At stages 18 and 19, bat forelimb metacarpals have a similar Either Bat Hind Limbs or Mouse Forelimbs. To assess whether the bat percentage of the growth plate occupied by the hypertrophic exhibits a different pattern of Bmp expression relative to mouse, zone (Fig. 2 c and d). Strikingly, by stage 20, the relative size of we performed immunofluorescence and semiquantitative RT- the hypertrophic zones in the third, fourth, and fifth bat meta- PCR to assay Bmp protein localization and gene-expression carpals have increased to Ͼ30% of the bat growth plate (Fig. 2d). levels, respectively. In mice, Bmp2, Bmp4, and a known down- This abrupt increase in the extent of the bat hypertrophic zone stream component of Bmp signaling (phospho-Smad proteins corresponds with the onset of exponential elongation in the bat 1͞5͞8) are expressed at moderate levels in the perichondrium of forelimb digits (Fig. 2d). In addition to increased chondrocyte the metacarpals and metatarsals with weaker levels within the hypertrophy, bat forelimb digits also display increased rates of hypertrophic zone (Bmp2) and immediately adjacent areas proliferation within the growth plate at stage 20 relative to bat (Bmp4) (17–18) (Fig. 3 g and k). We detected no major differ- hind limbs and mouse forelimbs of comparable stages, as re- ences in the general protein localization of Bmp2͞4 and phos- vealed by phospho-histone H3 (Ser-10) Ab staining (Fig. 3 a–c). pho-Smad in the bat forelimb metacarpals (Fig. 3 d, e, and i) and bat hindlimb metatarsals (Fig. 3 f and j) at stages 18, 19, 20, 21, Changing the Levels of BMP Can Alter Embryonic Bat Digit Length. To or 22 or mouse forelimb metacarpals (Fig. 3 g and k) at E13.5, test the ability of bat forelimb digits to respond to gain or loss of E14, E14.5, E15, and E15.5. Strikingly however, both Bmp and Bmp signaling, we cultured the bat embryonic handplate in phospho-Smad proteins are more intense and continuous in the control media or media supplemented with either Bmp2 or perichondrium of stage-20 bat forelimb metacarpals (Fig. 3 d, e, Noggin protein. Cultures containing Bmp2 caused a significant and i) than they are in the homologous elements of the bat hind increase in metacarpal length compared with the contralateral limb (Fig. 3 f and j) or mouse forelimb (Fig. 3 g and k)of bat forelimb cultured in control media (average increase, 239 comparable stages. We confirmed this difference in expression ␮m; P ϭ 0.003). Also, Bmp2 increased the relative proportion of level by semiquantitative RT-PCR performed on stage-20 bat the growth plate composed of the hypertrophic zone compared and mouse metacarpals. By using 18S rRNA as a control, we EVOLUTION with controls (average increase, 16.9%; n ϭ 10, P ϭ 0.028). In found that Bmp2 expression is significantly higher (Ϸ31%; P ϭ

Sears et al. PNAS ͉ April 25, 2006 ͉ vol. 103 ͉ no. 17 ͉ 6583 Downloaded by guest on September 27, 2021 Fig. 3. Proliferation and Bmp levels are increased in bat forelimb digits relative to mouse forelimb and bat hind limb digits. (a–c) phospho-histone H3 (Ser-10) Ab staining of proliferating cells in a stage-20 bat metacarpal (a), stage-20 bat metatarsal (b), and E14.5 (stage 20) mouse metacarpal (c). Bat forelimb metacarpals show areas of increased proliferation in the growth plate (white arrows). (d–g) Bmp2͞4 Ab staining (red; blue is hematoxylin counterstain) of an entire stage-20 bat metacarpal (d) and high-magniﬁcation views of the bat metacarpal perichondrium (e), a stage-20 bat metatarsal perichondrium (f) and an E14.5 mouse metacarpal perichondrium of a comparable region (g). (i–k) Phospho-Smad 1͞5͞8 Ab staining and a high-magniﬁcation view of a similar region of the perichondrium as shown in d–g of a stage-20 bat metacarpal (i), stage 20 bat metatarsal (j), and E14.5 mouse metacarpal (k). Bmp2͞4 and phospho-Smad 1͞5͞8 proteins are similarly localized in bat digits as they are in mice (18), but strikingly, these proteins are more intensely expressed in the perichondrium of bats metacarpals than they are in either mouse metacarpals or bat metatarsals. (h) Semiquantitative RT-PCR of Bmp2 RNA from stage-20 bat and stage-20 mouse metacarpals by using 18S rRNA as a control. Bat Bmp2 RNA is expressed at Ϸ30% higher levels relative to mouse.

0.04) in bat metacarpals relative to mice (Fig. 3h). This increase logical transitions in mammalian evolutionary history, that of the was confirmed by using ␤-actin as an additional control (Ϸ35% elongation of bat forelimb digits to support the wing membrane, increase in Bmp2 expression in bat metacarpals). To determine can currently be gleaned from the fossil record. whether this difference was specific to Bmp2, we also performed Here, we used morphological and molecular techniques to semiquantitative RT-PCR for Bmp4 and Bmp7. Our results with uncover the developmental basis of the elongation of the digits 18S rRNA and ␤-actin as controls indicate that Bmp4 and Bmp7 of the bat forelimb. We find that the early embryonic bat digits expression levels are not significantly increased in bats relative (immediately after the formation of joints) are similar in size to to mice (data not shown). Also, we examined the expression those of mouse embryos of a comparable age. This finding patterns of several genes that are known to be associated with the suggests that the major developmental changes resulting in maturation of chondrocytes within the growth plate (i.e., Ihh, elongated bat forelimb digits occur after the early condensations Pthrp, Fgfr1, Fgfr2, and ColX) by using RNA in situ hybridization, and after segmentation relative to the ancestral, mouse-like and we did not observe any notable differences between bat and pattern. This result therefore points to developmental changes in mouse digits (data not shown). These data demonstrate a the regulation of longitudinal growth and differentiation within significant and specific increase in Bmp2 expression as well as individual cartilage elements. Within bat and mouse all of the phosphorylation of Smad proteins, the Bmp signal transducers, elements of the forelimb (i.e., phalanges, radius, ulna, and which also serve as a read-out of active Bmp signaling, in the bat humerus) are similar in length at the time of segmentation. Thus, forelimb digits. the similar length of the phalanges in bats and mice may be a result of a developmental constraint on skeletal development. In Discussion this respect, it could be that the segmentation program is set up The great evolutionary success of bats can be attributed in large to create skeletal primordia of similar size, thus forcing adaptive part to their achievement of powered flight. Bat powered flight change in relative lengths to be controlled by subsequent post- is made possible by several key morphological innovations, one segmental growth. Postsegmental longitudinal growth is con- of the most crucial being the elongation of the forelimb digits trolled by the rates of chondrocyte proliferation and differenti- (specifically, digits three, four, and five) to support the wing ation in the growth plate of the developing digits. We find that membrane. Our morphometric analyses indicate that the relative the region of the bat growth plate occupied by terminally lengths of these bat digits have not significantly changed since the differentiated chondrocytes, the hypertrophic zone, is greatly time when bats were first fossilized Ͼ50 million years ago. expanded in bats relative to mouse. Intriguingly, the increase in Therefore, little knowledge regarding one of the key morpho- the relative size of the bat hypertrophic zone corresponds to the

6584 ͉ www.pnas.org͞cgi͞doi͞10.1073͞pnas.0509716103 Sears et al. Downloaded by guest on September 27, 2021 onset of the relative lengthening of the bat forelimb digits, as well as from published photographs (8). In total, 10 extant and suggesting a causative relationship between these two phenom- four extinct bat species were measured. The extant bats species ena. In addition to the increase in size of the hypertrophic zone, span a broad phylogenetic range and were as follows: Rousettus the cartilage cells of bat forelimb digits also display higher rates egyptiacus, Glossophaga soricina, Nycteris macrotis, Rhinopoma of proliferation relative to those of either bat hind limbs or hardwickei, Hipposideros commersoni, Pteronotus parnellii, Nata- mouse forelimbs. Together, these findings suggest that increases lus stramineus, Balantiopteryx io, Eptesicus fuscus, and Tadarida in the extent of chondrocyte proliferation and differentiation are brasiliensis. The extinct bat species are were as follows: Icaro- responsible for the remarkable elongation of bat forelimb digits nycteris index (AMNH specimen nos. 125000 and 39501), Hip- during their development. posideros sp. (AMNH specimen nos. 10019 and 10020), Archae- To understand the underlying molecular mechanisms by which onycteris trigonodon [original Senckenburg Museum (Frankfurt) proliferation and differentiation are affected in bat forelimb 80͞1379; ref. 8], Paleochiropteryx tupaidodon (cast AMNH spec- digits, we took a clue from studies in mice and rats. In mice, imen no. 107679, original Senckenburg Museum Messel Fossil numerous Bmps (2–5 and 7) are expressed within the growth Locality 10; ref. 8). Measurements were taken three times and plate and perichondrium of the developing digits (17, 18). Also, averaged to minimize the effect of measurement error. For mouse and rat digits that are cultured in the presence of Bmp2 extant bats, three specimens were measured and the results protein grow longer than their controls, whereas digits that are averaged. Measurements of Ͻ150 mm were taken with Mitutoyo cultured in the presence of Noggin (a known Bmp antagonist) absolute digimatic calipers, and measurements from 150 mm to are shorter (19, 20). Bmp2 protein affects these changes by 30 cm were taken with Fowler vernier calipers. Linear measure- stimulating both chondrocyte proliferation and initial hypertro- ments were log-transformed before analysis to standardize their phic differentiation and inhibiting terminal hypertrophic differ- variances. entiation (19), a pattern that is strikingly similar to the pattern Linear regression analyses, with the lengths of the third, of cartilage differentiation observed in bat wing digits. fourth, and fifth metacarpal as the dependent variables and PC1 By using a similar limb-culture system, we demonstrate that (as a proxy for body size) as the independent variable, were the addition of Bmp2 protein can stimulate the further elonga- performed to compare the relative lengths of the metacarpals of tion of bat forelimb digits and increase the hypertrophic zone extinct and extant bats. Only the data from extant bats were used whereas the application of Noggin protein stunts their growth to generate regression lines. This approach allows for compar- and decreases the hypertrophic zone. These results suggest that ison of the observed digit lengths of extinct bats with the either an increase in Bmp expression or a decrease in the expected digit lengths of modern bats of a comparable size. PC1 Bmp Noggin expression of antagonists such as could have driven was determined from a PC analysis (PCA) that was performed the developmental elongation of bat forelimb digits. Although on the correlation matrix that was obtained by using the com- the spatial expression of Bmp2, Bmp4, and Bmp7 are similar in bined length and width data of all forelimb elements of these bats and mice, we found that there is a dramatic change in the groups. PCA is a multivariate statistical technique that summa- level of Bmp2 expression in the bat forelimb digits. This result rizes the variation that is present in a data set on a series of was confirmed by semiquantitative RT-PCR. Also, Bmp signal- orthogonal axes, or PCs (24). PC1 summarizes most of the ing is greatly increased in the bat forelimb digits relative to bat variation in the data, and as a result, it is commonly highly hind limb or mouse, as assayed by the phosphorylation of the Smad proteins, the Bmp signal transducers. correlated with body size. If so, PC1 can be used as an appro- Together, our results indicate the up-regulation of the Bmp priate proxy for regression analysis. pathway as a major and fundamental (although not necessarily the only) mechanism responsible for the developmental elon- Embryos. C. perspicillata makes an excellent model taxon because gation of bat forelimb digits. Based on our results, we raise the of its great abundance in the wild (25), the existence of proce- intriguing possibility that a similar up-regulation of the Bmp dures for maintaining and breeding it in the laboratory (26), and pathway had a role in the evolutionary elongation of bat forelimb its recent use in several developmental studies (27–29). C. digits, which is an event that was critical to the achievement of perspicillata embryos were collected from wild-caught, pregnant powered flight in bats. Recent studies (22, 23) have suggested females captured on Trinidad. Bat embryos were dissected, that modifications to the cis-regulatory elements of develop- staged (30), and compared with WT C3H mouse embryos at a mental genes have central roles in the evolutionary diversifica- similar stage in development (mice were staged according to the tion of morphology. Our evidence that Bmp2, but not Bmp4 or Carnegie staging system). Bmp7, is differentially expressed in the bat wing digits is sug- gestive of a cis-regulatory change that affects the level, but not Limb Cultures. Bat metacarpals from embryos of various stages the temporal or spatial regulation, of Bmp2 expression. By (19–22) were stripped of skin and muscle and cultured for 4 days linking a simple change in a single developmental pathway to in BGJb medium (GIBCO͞BRL), antibiotic͞antimycotic (Life dramatically different morphologies, we provide a potential Technologies, Grand Island, NY), and 0.1% BSA at 37°C with ͞ explanation as to how bats were able to achieve powered flight 5% CO2 (19, 31). Cultures were supplemented with 500 ng ml soon after they diverged from other mammals nearly 65 million recombinant human Bmp2 (R & D Systems) or 500 ng͞ml years ago (2, 9). recombinant mouse Noggin protein (R & D Systems). The right limb from a given embryo was compared with the left limb from Materials and Methods the same embryo that was cultured in unsupplemented media. Adult Skeletal Morphometrics. To evaluate the digit dimensions from fossil and modern bats, we performed a morphometric Tissue Processing. For skeletal analysis, embryos at stages Ͻ20 analysis. Measurement data of the lengths (distal to proximal were fixed overnight in Bouin’s solution and stained for acidic and parallel to axis of the diaphysis) and widths (at the diaphysis glycosaminoglycans (cartilage) with Alcian blue; older embryos midpoint) of all long bones of the forelimb and hindlimb (i.e., were fixed overnight in 4% paraformaldehyde and stained for humerus, radius, ulna, femur, tibia, fibula, metacarpals, meta- cartilage and calcium (bone) with Alcian blue and Alizarin red, tarsals, and phalanges) were obtained from osteological speci- respectively. At least two bat and five mouse embryos from all mens of adult bats housed primarily at the Field Museum of stages 16–24 were examined. For histology, at least three bat and EVOLUTION Natural History (Chicago) (extant bats) and the American three mouse embryos from stages 18–22 were fixed overnight in Museum of Natural History (AMNH; New York) (extinct bats), 4% paraformaldehyde, and the limbs were embedded in paraf-

Sears et al. PNAS ͉ April 25, 2006 ͉ vol. 103 ͉ no. 17 ͉ 6585 Downloaded by guest on September 27, 2021 fin, sectioned at 10 ␮m, stained in hematoxylin͞eosin, and Bmp7 (GenBank accession no. DQ279783). The conserved analyzed. Bmp4 primers (which span a 429-bp region) are as follows: In situ hybridization was performed on embryos that were CTCATCACACGACTACTGGAC (sense) and GCAGTA- fixed overnight in 4% paraformaldehyde, embedded in paraffin, GAAGGCCTGGTAGC (antisense). The conserved Bmp7 sectioned at 10 ␮m, and processed by using digoxigenin-labeled primers (which span a 410-bp region) are as follows: RNA probes. In all cases, mouse riboprobes with known func- CAGGGCTTCTCCTACCCCTAC (sense) and TGACCAC- tions in the mammalian growth plate (i.e., Ihh, Pthrp, and Bmp2, CCAGTGGTTGCTGG (antisense). etc.) also recognized bat transcripts as shown by comparison of Semiquantitative RT-PCR using 18S rRNA as a control was expression in various embryonic tissues. Immunohistochemistry performed with a QuantumRNA Universal 18S Internal Stan- and immunofluorescence were performed on frozen 10-␮m dard kit (the primers of which isolate a 315-bp fragment) ͞ according to the manufacturer’s protocol (Ambion, Austin, TX) sections with Abs against Bmp2 4 (Santa Cruz Biotechnology), ͞ phosphorylated Smad 1͞5͞8 (Cell Signaling Technology, Bev- and a primer competimer ratio of 2:8 and 42 PCR cycles. To perform semiquantitative RT-PCR using ␤-actin RNA as erly, MA), and phosphorylated histone H3 (Ser-10) (Cell Sig- a control, we generated conserved primers for ␤-actin (GenBank naling Technology). In the immunohistochemical experiments, accession no. DQ279785) as described for Bmp2. The conserved hematoxylin was used as a counterstain. At least two bat and two primers homologous to both bat and mouse ␤-actin (spanning a mouse embryos from stages 18–22 were analyzed by immuno- 569-bp region) are as follows: CCATCCTGCGTCTGGACCTG fluorescence and in situ hybridization. (sense) and ACGATGGAGGGGCCGGACTC (antisense). Be- cause ␤-actin is expressed at a much higher level than Bmp2 Semiquantitative RT-PCR. To quantify Bmp2, Bmp4, and Bmp7 within metacarpal tissues, we used differing cycles (20 for ␤-actin transcripts in bat and mouse, we performed two separate and 55 for Bmp2) to be within the linear range. We used the semiquantitative RT-PCR analyses, one analysis using 18S following PCR conditions: 94°C for 20 sec, 55°C for 30 sec, and rRNA and the other analysis using ␤-actin RNA as a control. 72°C for 45 sec. PCR products were run on 1.5% agarose gels, Metacarpals were dissected from comparably aged bat (stage 20) and the resulting bands were quantified by using QUANTITY ONE and mouse (E14.5, equivalent to Carnegie stage 20) embryos; 1D analysis software (Bio-Rad). Significance of differences samples from three bats and three mice were used. RNA was between bat and mouse levels were evaluated by using Mann– extracted (RNeasy kit; Qiagen, Valencia, CA), and cDNA was Whitney U tests (32). generated for each sample with the SuperScript III First-Strand Synthesis system for RT-PCR (Invitrogen). We thank Chris Cretekos and Scott Weatherbee for field support and To generate conserved primers for Bmp2, we first performed stimulating discussions; Jonathan Marcot and three anonymous review- RT-PCR to amplify fragments of bat Bmp2 by using E90 bat ers for critical manuscript review; the collections staff of the Field Museum of Natural History and American Museum of Natural History; testes mRNA (GenBank accession no. DQ279784). Degenera- Simeon Williams, Dr. Indira Omah-Maharaj, and the Department of Life tive primer sequences were obtained by aligning Bmp2 sequences Sciences at the University of the West Indies (St. Augustine, Trinidad) from human (Homo), mouse (Mus), chick (Gallus), frog (Xeno- for help with fieldwork in Trinidad; and the Wildlife Section, Forestry pus), and fish (Danio). The bat fragments were sequenced and Division, Ministry of Agriculture, Land, and Marine Resources (cur- aligned with mouse sequences to find conserved regions to rently in the Ministry of Public Utilities and the Environment) of the generate the following primers (which span a 407-bp region) that Republic of Trinidad and Tobago for the issuance of required collecting and export permits. This work was supported by National Research are homologous to both bat and mouse: GCCTGCAGCAGC- Service Award F32 HD050042-01 (to K.E.S.), National Science Foun- CAACTTG (sense) and CAGTCATTCCACCCCACATC (an- dation Grant IBN 0220458 (to R.R.B.), and National Institutes of Health tisense). We followed the same procedure to generate conserved Grant HD32427 (to L.A.N.). L.A.N. is an Investigator of the Howard primers for Bmp4 (GenBank accession no. DQ279782) and Hughes Medical Institute.

1. Nowak, R. M. (1994) Walker’s Bats of the World (Johns Hopkins Univ. Press, 18. Solloway, M. J., Dudley, A. T., Bikoff, E. K., Lyons, K. M., Hogan, B. L. M. Baltimore). & Robertson, E. J. (1998) Dev. Genet. 22, 321–339. 2. Teeling, E. C., Springer, M. S., Madsen, O., Bates, P., O’Brien, S. J. & Murphy, 19. Minina, E., Wenzel, H., Kreschel, C., Karp, S., Gaffield, W., McMahon, A. & W. J. (2005) Science 307, 580–584. Vortkamp, A. (2001) Development (Cambridge, U.K.) 128, 4523–4534. 3. Teeling, E. C., Scally, M., Kao, D. J., Romagnoli, M. L., Springer, M. S. & 20. De Luca, F., Barnes, K. M., Uyeda, J. A., De-Levi, S., Abad, V., Palese, T., Stanhope, M. J. (2000) Nature 403, 188–192. Mericq, V. & Baron, J. (2001) Endocrinology 142, 430–436. 4. Stanhope, M. J., Czelusniak, J., Si, J. S., Nickerson, J. & Goodman, M. (1992) 21. Niswander, L. (2003) Nat. Rev. Genet. 4, 133–143. Mol. Phylogenet. Evol. 1, 148–160. 22. Gompel, N., Prud’homme, B., Wittkopp, P. J., Kassner, V. A. & Carroll, S. B. 5. Springer, M. S., Stanhope, M. J., Madsen, O. & de Jong, W. W. (2004) Trends (2005) Nature 433, 481–487. Ecol. Evol. 19, 430–438. 23. Shapiro, M. D., Marks, M. E., Peichel, C. L., Blackman, B. K., Nereng, K. S., 6. Thewissen, J. G. M. & Babcock, S. K. (1992) Bioscience 42, 340–345. Jonsson, B., Schluter, D. & Kingsley, D. M. (2004) Nature 428, 717–723. 7. Speakman, J. R. (2001) Mamm. Rev. 31, 111–130. 24. Reyment, R. & Joreskog, K. G. (1993) Applied Factor Analysis in the Natural 8. Simmons, N. B. & Geisler, J. H. (1998) Bull. Am. Mus. Nat. Hist. 235, Sciences (Cambridge Univ. Press, Cambridge, U.K.). 4–182. 25. Fleming, T. H. (1988) The Short-Tailed Fruit Bat (Univ. of Chicago Press, 9. Cao, Y., Fujiwara, M., Nikaido, M., Okada, N. & Hasegawa, M. (2000) Gene Chicago). 259, 149–158. 26. Rasweiler, J. J., IV, & Badwaik, N. K. (1996) Lab. Anim. Sci. 2, 171–181. 10. Valentine, J. W., Jablonski, D. & Erwin, D. H. (1999) Development (Cambridge, 27. Evarts, J. L., Rasweiler, J. J., IV, Behringer, R. R., Hennighausen, L. & U.K.) 126, 851–859. Robinson, G. W. (2004) Biol. Reprod. 70, 1573–1579. 11. Rutherford, S. L. & Lindquist, S. (1998) Nature 396, 336–342. 28. Cretekos, C. J., Rasweiler, J. J., IV, & Behringer, R. R. (2001) Reprod. Fertil. 12. Jernvall, J. (2000) Proc. Natl. Acad. Sci. USA 97, 2641–2645. Dev. 13, 691–695. 13. Cohn, M. J. & Tickle, C. (1999) Nature 399, 474–479. 29. Chen, C. H., Cretekos, C. J., Rasweiler, J. J., IV, & Behringer, R. R. (2005) 14. Fondon, J. W. & Garner, H. R. (2004) Proc. Natl. Acad. Sci. USA 101, Evol. Dev. 7, 130–141. 18058–18063. 30. Cretekos, C. J., Weatherbee, S. D., Chen, C. H., Badwaik, N. K., Niswander, 15. Abzhanov, A., Protas, M., Grant, B. R., Grant, P. R. & Tabin, C. J. (2004) L., Behringer, R. R. & Rasweiler, J. J., IV (2005) Dev. Dyn. 233, 721–728. Science 305, 1462–1465. 31. Vortkamp, A., Lee, K., Lanske, B., Segre, G. V., Kronenberg, H. M. & Tabin, 16. Ballock, R. T. & O’Keefe, R. J. (2003) J. Bone Joint Surg. 85A, 715–726. C. J. (1996) Science 273, 613–622. 17. Yoon, B. S. & Lyons, K. M. (2004) J. Cell. Biochem. 93, 93–103. 32. Sokal, R. R. & Rohlf, F. J. (1995) Biometry (Freeman, New York).

6586 ͉ www.pnas.org͞cgi͞doi͞10.1073͞pnas.0509716103 Sears et al. Downloaded by guest on September 27, 2021