DOCSLIB.ORG

SECIS Elements in the Coding Regions of Selenoprotein Transcripts Are Functional in Higher Eukaryotes

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
SECIS Elements in the Coding Regions of Selenoprotein Transcripts Are Functional in Higher Eukaryotes University of Nebraska - Lincoln DigitalCommons@University of Nebraska - Lincoln Vadim Gladyshev Publications Biochemistry, Department of August 2006 Supplementary Material for: SECIS elements in the coding regions of selenoprotein transcripts are functional in higher eukaryotes Heiko Mix University of Nebraska-Lincoln Alexey V. Lobanov University of Nebraska-Lincoln Vadim Gladyshev University of Nebraska-Lincoln, [email protected] Follow this and additional works at: https://digitalcommons.unl.edu/biochemgladyshev Part of the Biochemistry, Biophysics, and Structural Biology Commons Mix, Heiko; Lobanov, Alexey V.; and Gladyshev, Vadim, "Supplementary Material for: SECIS elements in the coding regions of selenoprotein transcripts are functional in higher eukaryotes" (2006). Vadim Gladyshev Publications. 18. https://digitalcommons.unl.edu/biochemgladyshev/18 This Article is brought to you for free and open access by the Biochemistry, Department of at DigitalCommons@University of Nebraska - Lincoln. It has been accepted for inclusion in Vadim Gladyshev Publications by an authorized administrator of DigitalCommons@University of Nebraska - Lincoln. Supplementary Material for: SECIS elements in the coding regions of selenoprotein transcripts are functional in higher eukaryotes Heiko Mix, Alexey V. Lobanov, and Vadim N. Gladyshev* Department of Biochemistry, University of Nebraska, Beadle Center Lincoln, NE 68588, USA *To whom correspondence should be addressed. Tel: +1 402 472 4948; Fax: +1 402 472 7842; Email: [email protected] Received September 13, 2006; Revised November 6, 2006; Accepted November 7, 2006. Main article published in Nucleic Acids Research 2007 January; 35(2): 414–423. Published online 2006 December 14. doi: 10.1093/nar/gkl1060. Copyright © 2006 Heiko Mix, Alexey V. Lobanov, and Vadim N. Gladyshev Contents Figure S1. Nucleotide sequence alignment of GPx4 sequences. For: M. musculus, H. sapiens, G. gallus, A. thaliana, Fowlpox virus, and Canarypox virus Figure S2. Alignment of GPx4 SECIS elements. For: H. sapiens, M. musculus, G. gallus, Fowlpox, Canarypox, and MCV Supplementary Table S1. Viral genome sequences used in a computational analysis From Abelson murine leukemia virus through Zygosaccharomyces bailii virus Z Figure S1. Nucleotide sequence alignment of GPx4 sequences. Location of SECIS elements is highlighted in red and their conserved regions are indicated. M.musculus 1 ATGAGCTGGGGCCGTCTGAGCCGCTTACTTAAGCCAGCACTGCTGTGCGGGGCTCTGGCT H.sapiens 1 ATGAGCCTCGGCCGCCTTTGCCGCCTACTGAAGCCGGCGCTGCTCTGTGGGGCTCTGGCC G.gallus 1 ------------------------------------------------------------ A.thaliana 1 ------------------------------------------------------------ Fowlpox virus 1 ------------------------------------------------------------ Canarypox virus 1 ------------------------------------------------------------ M.musculus 61 GCGCCTGGTCTGGCAGGCACCATGTGTGCATCCCGCGATGATTGGCGCTGTGCGCGCTCC H.sapiens 61 GCGCCTGGCCTGGCCGGGACCATGTGCGCGTCCCGGGACGACTGGCGCTGTGCGCGCTCC G.gallus 1 ---------------------ATGTGCGCTCAGGCGGACGAGTGGCGCTCGGCCACCTCC A.thaliana 1 ---------------------ATGGGTGCTTC------TGCTTCGGTTCCCGAGAGATCC Fowlpox virus 1 ---------------------ATGAATG---------ATGATTGGATATTGCATCATACC Canarypox virus 1 ---------------------ATGGATG---------ACGATTGGATACTTAAACATAAT M.musculus 121 ATGCACGAATTCTCAGCCAAGGACATCGACGGGCACATGGTCTGCCTGGATAAGTACAGG H.sapiens 121 ATGCACGAGTTTTCCGCCAAGGACATCGACGGGCACATGGTTAACCTGGACAAGTACCGG G.gallus 40 ATCTACGACTTCCACGCGCGGGACATCGACGGCCGCGATGTGTCCCTGGAGCAGTACAGG A.thaliana 34 GTCCATCAATTCACTGTAAAGGATAGCTCCGGCAAGGACCTGAATATGAGCATTTACCAA Fowlpox virus 31 ATTTATAATTTTAACCTCAATCTATTAAATGGGGAGAGTTTTGACTTTAAAACATATAAA Canarypox virus 31 ATTTATGGATTTAATATTAATCTCATAAATGGAAAAAACTTCAAGTTATCCGCATATAAA M.musculus 181 GGTTTCGTGTGCATCGTCACCAACGTGGCCTCGCAATGAGGCAAAACTGACGTAAACTAC H.sapiens 181 GGCTTCGTGTGCATCGTCACCAACGTGGCCTCCCAGTGAGGCAAGACCGAAGTAAACTAC G.gallus 100 GGCTTCGTCTGCATCATCACCAACGTGGCGTCCAAATGAGGAAAGACCGCGGTGAATTAC A.thaliana 94 GGGAAAGTCCTCCTCATCGTCAATGTTGCTTCCAAATGCGGTTTCACCGAAACAAACTAT Fowlpox virus 91 GATAAGATATGTATATTTGTAAACGTAGCATCGGAATGACGACTAGCTGACAGGAATTAT Canarypox virus 91 GATCGCATATGCTTGTTTGTTAACGTAGCTAGTGAATGCCAACTGGCCGATAAAAATTAT M.musculus 241 ACTCAGCTAGTCGATCTGCATGCCCGATATGCTGAGTGTGGTTTACGAATCCTGGCCTTC H.sapiens 241 ACTCAGCTCGTCGACCTGCACGCCCGATACGCTGAGTGTGGTTTGCGGATCCTGGCCTTC G.gallus 160 ACTCAGCTCGTCGATCTGCACGCGCGATACGCTGAGAAGGGGCTGCGCATCCTGGCCTTC A.thaliana 154 ACACAGCTCACCGAACTTTACCGGAAATACAAGGACCAAGATTTTGAGATCTTGGCATTC Fowlpox virus 151 AAGGAACTTACAAAATTATACGACAGGTATTTTTGTGATGGATTACGTATAATGGCATTT Canarypox virus 151 AAAGAACTTACAGAACTATATTCCAAATATTTTTATGATGGATTACGTATAATGGCCTTT M.musculus 301 CCCTGCAACCAGTTTGGGAGGCAGGAGCCAGGAAGTAATCAAGAAATCAAGGAGTTTGCA H.sapiens 301 CCGTGTAACCAGTTCGGGAAGCAGGAGCCAGGGAGTAACGAAGAGATCAAAGAGTTCGCC G.gallus 220 CCCTGCAACCAGTTCGGGAAGCAGGAGCCCGGGGACGACGCGCAGATCAAAGCCTTTGCG A.thaliana 214 CCTTGCAACCAGTTTCTATACCAGGAGCCCGGCACAAGTCAAGAGGCTCATGAATTTGCC Fowlpox virus 211 CCTTGTAACCAGTTTGGTGGACAAGAACCAGGTGGTGTCAAAGAAATAATGGAAACCATA Canarypox virus 211 CCTTGTAACCAATTTGGTAAACAAGAACCAGGTAATAAAAAAGAGATAATGAATACGTTA M.musculus 361 ---GCCGGCTACAACGTCAAGTTTGACATGTACAGCAAGATCTGTGTAAATGGGGACGAT H.sapiens 361 ---GCGGGCTACAACGTCAAATTCGATATGTTCAGCAAGATCTGCGTGAACGGGGACGAC gallus 280 ---GAGGGCTACGGGGTGAAGTTCGACATGTTCAGCAAAATTGAGGTCAATGGGGACGGC A.thaliana 274 TGCGAACGCTTTAAGGCCGAATACCCTGTTTTCCAAAAGGTACGCGTAAACGGTCAAAAC Fowlpox virus 271 ---AAGAAATATTCGGTATTATTTGATGTGTCCGAAAAGGTAATAGTAAATACCATATAC Canarypox virus 271 ---AAAAAATATTCTGTATTATTCGACGTATCTGAAAAGGTACTAGTTAATACTATATAC M.musculus 418 GCCCACCCACTGTGGAAATGGATGAAAGTCCAGCCCAAGGGCAGGGGCATGCTGGGAAAT H.sapiens 418 GCCCACCCGCTGTGGAAGTGGATGAAGATCCAACCCAAGGGCAAGGGCATCCTGGGAAAT G.gallus 337 GCCCACCCGCTGTGGAAGTGGCTGAAGGAGCAGCCCAAGGGCCGGGGCACGCTGGGGAAT A.thaliana 334 GCAGCACCAATCTATAAATTCCTTAAGG--CAAGTAAA----CCCACCTTTCTGGGTTCC Fowlpox virus 328 GCGCATCCTTTATGGAAGTGGTTACAAACAAGGCCTATA---CTGGGAGATGTGCCCGGT Canarypox virus 328 GCTCATCCATTATGGAAATGGTTACAGACTAGAGCCGCA---CTAGGCGATATAGCGGGT M.musculus 478 GCCATCAAATGGAACTTTACCAAGTTTCTCATTGATAAGAACGGCTGCGTGGTGAAGCGC H.sapiens 478 GCCATCAAGTGGAACTTCACCAAGTTCCTCATCGACAAGAACGGCTGCGTGGTGAAGCGC G.gallus 397 GCCATCAAGTGGAACTTCACTAAGTTTCTTATCAACCGTGAGGGCCAAGTGGTGAAAAGG A.thaliana 388 AGAATTAAGTGGAACTTCACCAAGTTCTTGGTCGGCAAAGATGGCTTAGTGATTGATCGT Fowlpox virus 385 CCTATAAAATGGAATTTTTGTAAGTTTCTAATAAGTCCTTTTGGTTACGTTATTAAGAGA Canarypox virus 385 CCTATCAGATGGAATTTTTGTAAGTTCCTTATAAGTCCAATGGGTTATGTCATTAAAAGA M.musculus 538 TATGGTCCCATGGAGGAGCCCCAGGTGATAGAGAAGGACCTGCCGTGCTATCTCTAG--- H.sapiens 538 TACGGACCCATGGAGGAGCCCCTGGTGATAGAGAAGGACCTGCCCCACTATTTCTAG--- G.gallus 457 TACAGCCCAATGGAGGATCCTTACGTGATCGAGAAGGATCTGCCCGCCTACCTGTAG--- A.thaliana 448 TATGGCACGATGGTTACACCGCTATCAATCGAGAAAGACATCAAGAAAGCTCTTGAAGAC Fowlpox virus 445 TTCGATCCTGAAGTCAACCCTATGTCGATACAAAAAGATATAGAACATGTTATAGAACAA Canarypox virus 445 TACGATCCGGTAATTAACCCTATGAGTATTGAAAATGATATAAAAAAAGTCATAGAACAA M.musculus ------------------------------------------------------------ H.sapiens ------------------------------------------------------------ G.gallus ------------------------------------------------------------ A.thaliana 508 GCTTGA------------------------------------------------------ Fowlpox virus 505 CGTGCTAATGAAGAAATGACTATAAATAGATGGGTCATGCCTGACACGCATTGTTCTGAG Canarypox virus 505 CGAGATAATGAAGAAATGGTCCTAAACAGATGGGTCGTTCCTGACACCCCGTGTTCTGAA M.musculus ------------------------------------------ H.sapiens ------------------------------------------ G.gallus ------------------------------------------ A.thaliana ------------------------------------------ Fowlpox virus 565 GAAGAATCTCTTTCTAAAGATGTGTTAAATGACGTATAA--- Canarypox virus 565 GAC-AAT--------AACAAAATACCAGGCGACGTATACTGA Figure S2. Alignment of GPx4 SECIS elements. SECIS core SECIS core H.sapiens ACGCCCTCGGAGCCTTCCACC--GGCACTC ATGAC GGCCTGCCTGC AA ACC----TGC TGGTGGGGCAGACC CGAA AATCCAGCGTGCACCC-C-GCC M.musculus TGACCCCTGGAGCCTTCCACCCCGGCACTC ATGAA GGTCTGCCTGA AA ACCAGCCTGC TGGTGGGGCAGTCC TGAG GACCTGGCGTGCATCC-CTGCC G.gallus GCTCCCCGTGGGCCCCCTCCTCCAGCAC-C ATGAC GGCCTGCCTTG AA GCCAGCTTGC TGGTGAGGCAGACC CGAA GATTCGGCGTGCACCTGCTGGA Fowlpox ATATAGAACATGTTATAGAACAACGTGCTA ATGAA GAAATGACTAT AA ATA------- –GATGGGTCATGCC TGAC -ACGCATTGT---TCTGAGGAA Canarypox ATATAAAAAAAGTCATAGAACAACGAGATA ATGAA GAAATGGTCCT AA ACA------- –GATGGGTCGTTCC TGAC -ACCCCGTGT---TCTGAAGAC MCV CCTTGGCGGGGATCTTGCGTGCCTTCGCCA ATGAC GGCGTCTCTCG AA CACCGACAAG GAGGGAGAGCTGCC CGAG TTTCGGAAGAGCAAGCGAGAGA Supplementary Table S1.
Load more

Recommended publications
  • Genome Sequencing by Random Priming Methods for Viral Identification
    Genome sequencing by random priming methods for viral identification Rosseel Toon Dissertation submitted in fulfillment of the requirements for the degree of Doctor of Philosophy (PhD) in Veterinary Sciences, Faculty of Veterinary Medicine, Ghent University, 2015 Promotors: Dr. Steven Van Borm Prof. Dr. Hans Nauwynck “The real voyage of discovery consist not in seeking new landscapes, but in having new eyes” Marcel Proust, French writer, 1923 Table of contents Table of contents ....................................................................................................................... 1 List of abbreviations ................................................................................................................. 3 Chapter 1 General introduction ................................................................................................ 5 1. Viral diagnostics and genomics ....................................................................................... 7 2. The DNA sequencing revolution ................................................................................... 12 2.1. Classical Sanger sequencing .................................................................................. 12 2.2. Next-generation sequencing ................................................................................... 16 3. The viral metagenomic workflow ................................................................................. 24 3.1. Sample preparation ...............................................................................................
    [Show full text]
  • Changes to Virus Taxonomy 2004
    Arch Virol (2005) 150: 189–198 DOI 10.1007/s00705-004-0429-1 Changes to virus taxonomy 2004 M. A. Mayo (ICTV Secretary) Scottish Crop Research Institute, Invergowrie, Dundee, U.K. Received July 30, 2004; accepted September 25, 2004 Published online November 10, 2004 c Springer-Verlag 2004 This note presents a compilation of recent changes to virus taxonomy decided by voting by the ICTV membership following recommendations from the ICTV Executive Committee. The changes are presented in the Table as decisions promoted by the Subcommittees of the EC and are grouped according to the major hosts of the viruses involved. These new taxa will be presented in more detail in the 8th ICTV Report scheduled to be published near the end of 2004 (Fauquet et al., 2004). Fauquet, C.M., Mayo, M.A., Maniloff, J., Desselberger, U., and Ball, L.A. (eds) (2004). Virus Taxonomy, VIIIth Report of the ICTV. Elsevier/Academic Press, London, pp. 1258. Recent changes to virus taxonomy Viruses of vertebrates Family Arenaviridae • Designate Cupixi virus as a species in the genus Arenavirus • Designate Bear Canyon virus as a species in the genus Arenavirus • Designate Allpahuayo virus as a species in the genus Arenavirus Family Birnaviridae • Assign Blotched snakehead virus as an unassigned species in family Birnaviridae Family Circoviridae • Create a new genus (Anellovirus) with Torque teno virus as type species Family Coronaviridae • Recognize a new species Severe acute respiratory syndrome coronavirus in the genus Coro- navirus, family Coronaviridae, order Nidovirales
    [Show full text]
  • (12) United States Patent (10) Patent No.: US 9,096,585 B2 Shaw Et Al
    US009096585B2 (12) United States Patent (10) Patent No.: US 9,096,585 B2 Shaw et al. (45) Date of Patent: Aug. 4, 2015 (54) ANTIVIRAL COMPOUNDS AND USES (2013.01); C07D 413/10 (2013.01); C07D THEREOF 413/12 (2013.01); A61 K 3 1/5377 (2013.01); A61 K3I/55 (2013.01) (75) Inventors: Megan Shaw, New York, NY (US); (58) Field of Classification Search Hans-Heinrich Hoffmann, New York, CPC. A61K 31/4245; A61K31/5377; A61K31/55 NY (US); Adolfo Garcia-Sastre, New USPC .................................... 514/364, 217.1, 236.2 York, NY (US); Peter Palese, Leonia, NJ See application file for complete search history. US (US) (56) References Cited (73) Assignee: Icahn School of Medicine at Mount Sinai, New York, NY (US) U.S. PATENT DOCUMENTS 6,384,064 B2 5, 2002 Camden (*) Notice: Subject to any disclaimer, the term of this 8,278,342 B2 10/2012 Ricciardi patent is extended or adjusted under 35 Continued U.S.C. 154(b) by 210 days. (Continued) (21) Appl. No.: 13? 700,049 FOREIGN PATENT DOCUMENTS y x- - - 9 (22) PCT Filed1C Mavay 31,51, 2011 WO WO 2009,136979 A2 11/2009 OTHER PUBLICATIONS (86). PCT No.: PCT/US2011/038515 Chu et al. "Analysis of the endocytic pathway mediating the infec S371 (c)(1), tious entry of mosquito-borne flavivirus West Nile into Aedes (2), (4) Date: Feb. 14, 2013 albopictus mosquito (C6/36) cells.” Virology, 2006, vol. 349, pp. 463-475. (87) PCT Pub. No.: WO2011/150413 (Continued) PCT Pub. Date: Dec. 1, 2011 Primary Examiner — Shengjun Wang (65) Prior Publication Data (74) Attorney, Agent, or Firm — Jones Day US 2013/O137678A1 May 30, 2013 (57) ABSTRACT O O Described herein are Compounds, compositions comprising Related U.S.
    [Show full text]
  • Viral Gastroenteritis
    viral gastroenteritis What causes viral gastroenteritis? y Rotaviruses y Caliciviruses y Astroviruses y SRV (Small Round Viruses) y Toroviruses y Adenoviruses 40 , 41 Diarrhea Causing Agents in World ROTAVIRUS Family Reoviridae Genus Segments Host Vector Orthoreovirus 10 Mammals None Orbivirus 11 Mammals Mosquitoes, flies Rotavirus 11 Mammals None Coltivirus 12 Mammals Ticks Seadornavirus 12 Mammals Ticks Aquareovirus 11 Fish None Idnoreovirus 10 Mammals None Cypovirus 10 Insect None Fijivirus 10 Plant Planthopper Phytoreovirus 12 Plant Leafhopper OiOryzavirus 10 Plan t Plan thopper Mycoreovirus 11 or 12 Fungi None? REOVIRUS y REO: respiratory enteric orphan, y early recognition that the viruses caused respiratory and enteric infections y incorrect belief they were not associated with disease, hence they were considered "orphan " viruses ROTAVIRUS‐ PROPERTIES y Virus is stable in the environment (months) y Relatively resistant to hand washing agents y Susceptible to disinfection with 95% ethanol, ‘Lyy,sol’, formalin STRUCTURAL FEATURES OF ROTAVIRUS y 60‐80nm in size y Non‐enveloped virus y EM appearance of a wheel with radiating spokes y Icosahedral symmetry y Double capsid y Double stranded (ds) RNA in 11 segments Rotavirus structure y The rotavirus genome consists of 11 segments of double- stranded RNA, which code for 6 structural viral proteins, VP1, VP2, VP3, VP4, VP6 and VP7 and 6 non-structural proteins, NSP1-NSP6 , where gene segment 11 encodes both NSP5 and 6. y Genome is encompassed by an inner core consisting of VP2, VP1 and VP3 proteins. Intermediate layer or inner capsid is made of VP6 determining group and subgroup specifici ti es. y The outer capsid layer is composed of two proteins, VP7 and VP4 eliciting neutralizing antibody responses.
    [Show full text]
  • Diversity and Classification of Reoviruses in Crustaceans: a Proposal
    Journal of Invertebrate Pathology 182 (2021) 107568 Contents lists available at ScienceDirect Journal of Invertebrate Pathology journal homepage: www.elsevier.com/locate/jip Diversity and classification of reoviruses in crustaceans: A proposal Mingli Zhao a, Camila Prestes dos Santos Tavares b, Eric J. Schott c,* a Institute of Marine and Environmental Technology, University of Maryland, Baltimore County, Baltimore, MD 21202, USA b Integrated Group of Aquaculture and Environmental Studies, Federal University of Parana,´ Rua dos Funcionarios´ 1540, Curitiba, PR 80035-050, Brazil c Institute of Marine and Environmental Technology, University of Maryland Center for Environmental Science, Baltimore, MD 21202, USA ARTICLE INFO ABSTRACT Keywords: A variety of reoviruses have been described in crustacean hosts, including shrimp, crayfish,prawn, and especially P virus in crabs. However, only one genus of crustacean reovirus - Cardoreovirus - has been formally recognized by ICTV CsRV1 (International Committee on Taxonomy of Viruses) and most crustacean reoviruses remain unclassified. This Cardoreovirus arises in part from ambiguous or incomplete information on which to categorize them. In recent years, increased Crabreovirus availability of crustacean reovirus genomic sequences is making the discovery and classification of crustacean Brachyuran Phylogenetic analysis reoviruses faster and more certain. This minireview describes the properties of the reoviruses infecting crusta­ ceans and suggests an overall classification of brachyuran crustacean reoviruses based on a combination of morphology, host, genome organization pattern and phylogenetic sequence analysis. 1. Introduction fish, crustaceans, marine protists, insects, ticks, arachnids, plants and fungi (Attoui et al., 2005; Shields et al., 2015). Host range and disease 1.1. Genera of Reoviridae family symptoms are also important indicators that help to identify viruses of different genera (Attoui et al., 2012).
    [Show full text]
  • Diversity of Large DNA Viruses of Invertebrates ⇑ Trevor Williams A, Max Bergoin B, Monique M
    Journal of Invertebrate Pathology 147 (2017) 4–22 Contents lists available at ScienceDirect Journal of Invertebrate Pathology journal homepage: www.elsevier.com/locate/jip Diversity of large DNA viruses of invertebrates ⇑ Trevor Williams a, Max Bergoin b, Monique M. van Oers c, a Instituto de Ecología AC, Xalapa, Veracruz 91070, Mexico b Laboratoire de Pathologie Comparée, Faculté des Sciences, Université Montpellier, Place Eugène Bataillon, 34095 Montpellier, France c Laboratory of Virology, Wageningen University, Droevendaalsesteeg 1, 6708 PB Wageningen, The Netherlands article info abstract Article history: In this review we provide an overview of the diversity of large DNA viruses known to be pathogenic for Received 22 June 2016 invertebrates. We present their taxonomical classification and describe the evolutionary relationships Revised 3 August 2016 among various groups of invertebrate-infecting viruses. We also indicate the relationships of the Accepted 4 August 2016 invertebrate viruses to viruses infecting mammals or other vertebrates. The shared characteristics of Available online 31 August 2016 the viruses within the various families are described, including the structure of the virus particle, genome properties, and gene expression strategies. Finally, we explain the transmission and mode of infection of Keywords: the most important viruses in these families and indicate, which orders of invertebrates are susceptible to Entomopoxvirus these pathogens. Iridovirus Ó Ascovirus 2016 Elsevier Inc. All rights reserved. Nudivirus Hytrosavirus Filamentous viruses of hymenopterans Mollusk-infecting herpesviruses 1. Introduction in the cytoplasm. This group comprises viruses in the families Poxviridae (subfamily Entomopoxvirinae) and Iridoviridae. The Invertebrate DNA viruses span several virus families, some of viruses in the family Ascoviridae are also discussed as part of which also include members that infect vertebrates, whereas other this group as their replication starts in the nucleus, which families are restricted to invertebrates.
    [Show full text]
  • Virus World As an Evolutionary Network of Viruses and Capsidless Selfish Elements
    Virus World as an Evolutionary Network of Viruses and Capsidless Selfish Elements Koonin, E. V., & Dolja, V. V. (2014). Virus World as an Evolutionary Network of Viruses and Capsidless Selfish Elements. Microbiology and Molecular Biology Reviews, 78(2), 278-303. doi:10.1128/MMBR.00049-13 10.1128/MMBR.00049-13 American Society for Microbiology Version of Record http://cdss.library.oregonstate.edu/sa-termsofuse Virus World as an Evolutionary Network of Viruses and Capsidless Selfish Elements Eugene V. Koonin,a Valerian V. Doljab National Center for Biotechnology Information, National Library of Medicine, Bethesda, Maryland, USAa; Department of Botany and Plant Pathology and Center for Genome Research and Biocomputing, Oregon State University, Corvallis, Oregon, USAb Downloaded from SUMMARY ..................................................................................................................................................278 INTRODUCTION ............................................................................................................................................278 PREVALENCE OF REPLICATION SYSTEM COMPONENTS COMPARED TO CAPSID PROTEINS AMONG VIRUS HALLMARK GENES.......................279 CLASSIFICATION OF VIRUSES BY REPLICATION-EXPRESSION STRATEGY: TYPICAL VIRUSES AND CAPSIDLESS FORMS ................................279 EVOLUTIONARY RELATIONSHIPS BETWEEN VIRUSES AND CAPSIDLESS VIRUS-LIKE GENETIC ELEMENTS ..............................................280 Capsidless Derivatives of Positive-Strand RNA Viruses....................................................................................................280
    [Show full text]
  • Origin and Evolution of Emerging Liaoning Virus（Genus Seadornavirus, Family Reoviridae)
    Origin and Evolution of Emerging Liaoning Virusgenus Seadornavirus, family Reoviridae) Jun Zhang Shandong University of Technology Hong Liu ( [email protected] ) Shandong University of Technology https://orcid.org/0000-0002-5182-4750 Jiahui Wang Shandong University of Technology Jiheng Wang Shandong University of Technology Jianming Zhang Shandong University of Technology Jiayue Wang Shandong University of Technology Xin Zhang Shandong University of Technology Hongfang Ji Shandong University of Technology Zhongfen Ding Shandong University of Technology Han Xia Chinese Academy of Sciences Chunyang Zhang Shandong University of Technology Qian Zhao Shandong University of Technology Guodong Liang Chinese Center for Disease Control and Prevention Research Keywords: Liaoning virus, LNV, Seadornavirus, Evolution, Migration Posted Date: January 15th, 2020 DOI: https://doi.org/10.21203/rs.2.20915/v1 License: This work is licensed under a Creative Commons Attribution 4.0 International License. Read Full License Page 1/13 Abstract Background:Liaoning virus(LNV) is a member of the genus Seadornavirus, family Reoviridae and has been isolated from kinds of sucking insects in Asia and Australia. However, there are no systematic studies describe the molecular genetic evolution and migration of LNVs isolated from different time, regions and vectors. Methods:Here, a phylogenetic analysis using Bayesian Markov chain Monte Carlo simulations was conducted on the LNVs isolated from a variety of vectors during 1990-2014,worldwide. Results:The phylogenetic analysis demonstrated that the LNV could be divided into 3 genotypes, of which genotype 1 mainly composed of LNVs isolated from Australia during 1990 to 2014 as well as the original LNV strain(LNV-NE97-31) isolated from Liaoning province in northern China in 1997,genotype 2 comprised of the isolates all from Xinjiang province in western China and genotype 3 consisted the isolates from Qinghai and Shanxi province of central China.
    [Show full text]
  • ICTV Code Assigned: 2011.001Ag Officers)
    This form should be used for all taxonomic proposals. Please complete all those modules that are applicable (and then delete the unwanted sections). For guidance, see the notes written in blue and the separate document “Help with completing a taxonomic proposal” Please try to keep related proposals within a single document; you can copy the modules to create more than one genus within a new family, for example. MODULE 1: TITLE, AUTHORS, etc (to be completed by ICTV Code assigned: 2011.001aG officers) Short title: Change existing virus species names to non-Latinized binomials (e.g. 6 new species in the genus Zetavirus) Modules attached 1 2 3 4 5 (modules 1 and 9 are required) 6 7 8 9 Author(s) with e-mail address(es) of the proposer: Van Regenmortel Marc, [email protected] Burke Donald, [email protected] Calisher Charles, [email protected] Dietzgen Ralf, [email protected] Fauquet Claude, [email protected] Ghabrial Said, [email protected] Jahrling Peter, [email protected] Johnson Karl, [email protected] Holbrook Michael, [email protected] Horzinek Marian, [email protected] Keil Guenther, [email protected] Kuhn Jens, [email protected] Mahy Brian, [email protected] Martelli Giovanni, [email protected] Pringle Craig, [email protected] Rybicki Ed, [email protected] Skern Tim, [email protected] Tesh Robert, [email protected] Wahl-Jensen Victoria, [email protected] Walker Peter, [email protected] Weaver Scott, [email protected] List the ICTV study group(s) that have seen this proposal: A list of study groups and contacts is provided at http://www.ictvonline.org/subcommittees.asp .
    [Show full text]
  • Isolation of a Novel Fusogenic Orthoreovirus from Eucampsipoda Africana Bat Flies in South Africa
    viruses Article Isolation of a Novel Fusogenic Orthoreovirus from Eucampsipoda africana Bat Flies in South Africa Petrus Jansen van Vuren 1,2, Michael Wiley 3, Gustavo Palacios 3, Nadia Storm 1,2, Stewart McCulloch 2, Wanda Markotter 2, Monica Birkhead 1, Alan Kemp 1 and Janusz T. Paweska 1,2,4,* 1 Centre for Emerging and Zoonotic Diseases, National Institute for Communicable Diseases, National Health Laboratory Service, Sandringham 2131, South Africa; [email protected] (P.J.v.V.); [email protected] (N.S.); [email protected] (M.B.); [email protected] (A.K.) 2 Department of Microbiology and Plant Pathology, Faculty of Natural and Agricultural Science, University of Pretoria, Pretoria 0028, South Africa; [email protected] (S.M.); [email protected] (W.K.) 3 Center for Genomic Science, United States Army Medical Research Institute of Infectious Diseases, Frederick, MD 21702, USA; [email protected] (M.W.); [email protected] (G.P.) 4 Faculty of Health Sciences, University of the Witwatersrand, Johannesburg 2193, South Africa * Correspondence: [email protected]; Tel.: +27-11-3866382 Academic Editor: Andrew Mehle Received: 27 November 2015; Accepted: 23 February 2016; Published: 29 February 2016 Abstract: We report on the isolation of a novel fusogenic orthoreovirus from bat flies (Eucampsipoda africana) associated with Egyptian fruit bats (Rousettus aegyptiacus) collected in South Africa. Complete sequences of the ten dsRNA genome segments of the virus, tentatively named Mahlapitsi virus (MAHLV), were determined. Phylogenetic analysis places this virus into a distinct clade with Baboon orthoreovirus, Bush viper reovirus and the bat-associated Broome virus.
    [Show full text]
  • The Flavivirus NS5 Protein Is a True RNA Guanylyltransferase That Catalyzes a Two-Step Reaction to Form the RNA Cap Structure
    Downloaded from rnajournal.cshlp.org on September 24, 2021 - Published by Cold Spring Harbor Laboratory Press The flavivirus NS5 protein is a true RNA guanylyltransferase that catalyzes a two-step reaction to form the RNA cap structure MOHESHWARNATH ISSUR,1,4 BRIAN J. GEISS,2,3,4 ISABELLE BOUGIE,1 FRE´DE´RIC PICARD-JEAN,1 SIMON DESPINS,1 JOANNIE MAYETTE,1 SARAH E. HOBDEY,3 and MARTIN BISAILLON1 1De´partement de Biochimie, Faculte´ de Me´decine, Universite´ de Sherbrooke, Sherbrooke, Que´bec J1H 5N4, Canada 2Department of Microbiology, Immunology, and Pathology, Colorado State University, Fort Collins, Colorado 80523, USA 3Department of Biochemistry and Molecular Biology, Colorado State University, Fort Collins, Colorado 80523, USA ABSTRACT m7 The 59-end of the flavivirus genome harbors a methylated GpppA29OMe cap structure, which is generated by the virus-encoded RNA triphosphatase, RNA (guanine-N7) methyltransferase, nucleoside 29-O-methyltransferase, and RNA guanylyltransferase. The presence of the flavivirus guanylyltransferase activity in NS5 has been suggested by several groups but has not been empirically proven. Here we provide evidence that the N-terminus of the flavivirus NS5 protein is a true RNA guanylyl- transferase. We demonstrate that GTP can be used as a substrate by the enzyme to form a covalent GMP–enzyme intermediate via a phosphoamide bond. Mutational studies also confirm the importance of a specific lysine residue in the GTP binding site for the enzymatic activity. We show that the GMP moiety can be transferred to the diphosphate end of an RNA transcript harboring an adenosine as the initiating residue. We also demonstrate that the flavivirus RNA triphosphatase (NS3 protein) stimulates the RNA guanylyltransferase activity of the NS5 protein.
    [Show full text]
  • Virus-Mediated Suppression of Host Non-Self Recognition Facilitates
    University of Kentucky UKnowledge Plant Pathology Faculty Publications Plant Pathology 3-23-2017 Virus-Mediated Suppression of Host Non-Self Recognition Facilitates Horizontal Transmission of Heterologous Viruses Songsong Wu Huazhong Agricultural University, China Jiasen Cheng Huazhong Agricultural University, China Yanping Fu Huazhong Agricultural University, China Tao Chen Huazhong Agricultural University, China Daohong Jiang Huazhong Agricultural University, China See next page for additional authors CFolicllokw h ethire st oa ndlet ausdd knitionow alho wwork accse asts: thott thips://uknos documewnlet bedgnee.ukfitsy. eoydu/pu. lantpath_facpub Part of the Pathogenic Microbiology Commons, Plant Pathology Commons, and the Viruses Commons Repository Citation Wu, Songsong; Cheng, Jiasen; Fu, Yanping; Chen, Tao; Jiang, Daohong; Ghabrial, Said A.; and Xie, Jiatao, "Virus-Mediated Suppression of Host Non-Self Recognition Facilitates Horizontal Transmission of Heterologous Viruses" (2017). Plant Pathology Faculty Publications. 68. https://uknowledge.uky.edu/plantpath_facpub/68 This Article is brought to you for free and open access by the Plant Pathology at UKnowledge. It has been accepted for inclusion in Plant Pathology Faculty Publications by an authorized administrator of UKnowledge. For more information, please contact [email protected]. Authors Songsong Wu, Jiasen Cheng, Yanping Fu, Tao Chen, Daohong Jiang, Said A. Ghabrial, and Jiatao Xie Virus-Mediated Suppression of Host Non-Self Recognition Facilitates Horizontal Transmission of Heterologous Viruses Notes/Citation Information Published in PLOS Pathogens, v. 13, 3, e1006234, p. 1-25. © 2017 Wu et al. This is an open access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
    [Show full text]