DOCSLIB.ORG

Gene Expression

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Gene Expression Gene Expression http://www.ncbi.nlm.nih.gov/books/bv.fcgi?call=bv.View..ShowTOC&rid=mboc4.TOC&depth=2 Prokaryotic Translation is concurrent with transcription No barrier restricts movement of transcript to translation apparatus Single RNA polymerase synthesizes all RNA species Eukaryotic Transcript must be processed Capping, splicing, polyA addition mRNA is sequestered as RNP in the nucleus, must be transported to cytoplasm Genes are often split - coding sequence is not contiguous 3 different RNA polymerases required to synthesize RNA classes Polycistronic Transcripts Operon - gene cluster DNA mRNA Polycistronic transcript multiple genes Examples: Proteins perform a Carbohydrate degradation coordinated function Amino acid biosynthesis 1 Eukaryotic Transcripts 5’ 7-methylgaunosine cap structure Post-transcriptional modification - after ~ 25 nucleotides Prevents degradation by 5’ exonucleases Helps in the export from the nucleus Poly-adenylated tail Post-transcriptional modification Helps in stability of the mRNA Mature transcript Kinetoplastid Transcription 2 Alternative Splicing Discovered by D. Baltimore - immunoglobin heavy chain Increases the diversity of protein repertoire Improper alternative splicing can lead to disease Cis-Splicing Mechanism 3 Splicing is mediated by the Spliceosome • Several steps in the splicing reaction require ATP Splicesome mediated - simplified Composed of snRNPs Small nuclear ribonucleoprotein Small nuclear U-rich RNA (snRNA) Each complexed with ~ 7 proteins Highly simplified version 1. U1 base-pairs with the 5’ splice-site 2. U2 binds/pairs with the branch point; also pairs with U6 in the assembled spliceosome 3. U4 pairs with U6 in snRNPs, but releases during spliceosome assembly 4. U5 interacts with both exons (only 1-2 nt adjacent to intron); helps bring exons together 5. U6 displaces U1 at the 5’ splice-site (pairs with nt in the intron); it also pairs with U2 in the catalytic center of the spliceosome 4 Trans-splicing: 1st discovered in trypanosomes To date: ALL but 2 coding sequences are trans-spliced! Gene A Gene B Gene C Gene D Gene E DNA Trans-splicing Polyadenylation Polycistronic No evidence of transcript operons SL RNA AAAA AAAA Individual mRNAs each AAAA AAAA with a SL and poly A tail AAAA Comparison of cis- and trans-splicing transesterification Lariat Y-branch intermediate intermediate transesterification Intramolecular Intermolecular 5 Comparison of Spliceosomes New Technology - SMaRT Defects in alternative splicing can lead to human disease Use of artificial trans-splicing to “repair” and give rise to a functional mRNA Spliceosome-mediated RNA Trans-splicing www.intronn.com Correcting at the pre-mRNA level! 6 kDNA - organized in a disk structure kDNA Kinetoplast Nucleus Mitochondrion Kinetoplast is always associated with the flagellar basal body kDNA components Two types of catenated ring circles kDNA network 1. Maxicircle: ~23kb, 25 • Encode electron transport subunits. • Require extensive posttranscriptional editing Maxicircle Minicircle 3. Minicircle: 1kb, 5000 • Heterogeneous, 250 classes • Encode guide RNAs. 500nm 500nm kDNA is essential for the parasite survival 7 kDNA Replication Model kDNA disk Primase Pol β -PAK DNA Ligase kα DNA Pol β DNA ligase kβ Topo II SSE1 UMSBP Pol IB Pol ID recruitment? Pol IC Pol IA ? kDNA repair? What are the specialized roles? Minicircle Replication Leading (L) strand UMSBP Unknown replicase + proteins UMS Singly and Multiply Gapped Progeny UMS Lagging (H) strand 8 kDNA Replication Model Trypanosomatid Mitochondrial RNA editing Single mitochondrion Unique mitochondrial DNA Catenated structure composed of mini- and maxicircles Size of molecules varies with species (15-80 kb) (1 - 2.5 kb) 50 maxicircles/network 5000-10,000 minicircles/network Maxicircle Minicircle 20 kb 1 kb Minicircles were initially thought to be nonfunctional, just a structural component 9 Maxicircle sequence Initial sequencing of the T. brucei maxicircles demonstrated that it encoded apocytochrome b, subunits 1 and 2 of cytochrome c oxidase (cox) and some unassigned reading frames (MURFs) (some later turned out to be subunits of NADH dehydrogenase). However some pseudogene features – e.g. cox2 had a –1 frameshift and this was conserved between kinetoplastid species. Sequence determination of cox2 cDNA in 1984 showed an insertion at the precise position of the frameshift converting GA to UUGUAU. This wasn’t accepted at first – there were 50 maxicircles and maybe one had the difference or the gene was encoded in the nucleus. Extensive analysis showed no conventional cox2 genes existed in the nucleus or mitochondrion but a mechanism of adding in U’s was way too outlandish to be accepted at that time. Maxicircle Sequence Sequencing of other mitochondrial cDNAs and their comparison to the genomic sequence showed not only the addition of U’s but also their deletion. In 1986 the first CAUTIOUS paper on a “co- or post-transcriptional nucleotide insertion process” was published (Benne et al.,1986 Cell 46, 819-826 - 18 page paper). Although the data showed deletion of one U, the authors didn’t dare to conclude that this form of editing could also occur. Other groups of investigators found similar editing processes and the number of edited trypanosomatid RNAs expanded. The mystery of missing AUG translational start codons was solved as these are provided by RNA editing by both addition and deletion of U’s 10 Mitochondrial RNA editing Cryptic mRNAs produced mRNA sequence DOES NOT exactly Cell correspond with genomic DNA sequence * * ** ** * Requires insertion of uridine residues ** *** (u) or deletion (*) to create a * *** functional ORF **** *** * * Extreme example is ND7 *** * ** * >90% of mRNA is edited *** Process is more active in *** ** ** ** procyclic form parasites **** **** * Minicircles encode gRNAs (guide **** ** * *** RNAs) that act as templates for * * *** **** insertion and deletion (1991) * *** * Process is essential (2001) * ** ****** Demonstrated by gene silencing in Edited T. brucei ND7 mRNA bloodstream form parasites Maxicircle Comparison Ribosomal RNA sequences ARE NOT edited 11 Insertional RNA editing Primary transcript (Maxicircle encoded) 5' GCGGAGAAAAAAGAAAGGGUCUUUUAAUG (A)n ::|:|||| ||:|||||||| 3'-UUUUUUUUUU CAGAAAAUUACppp5' U A Guide RNA U A (Minicircle encoded) Poly(U) tail U C A A Anchor C U U U U A Editing Edited mRNA 5' GCGGAGAAAAAAUGAAAUGUGUUGUCUUUUAAUG (A)n ::|:||||||||||||||:||||||||||||| 3'-UUUUUUUUUUUUUACUUUAUACAACAGAAAAUUACppp5' Pan-editing of the L. tarentolae A6 mRNA Precursor mRNA Edited mRNA Precursor mRNA Edited mRNA Precursor mRNA Edited mRNA Precursor mRNA Edited mRNA 12 Mechanism of RNA Editing Insertion Deletion RNA Editing Proteins 13 Mediated by Protein Complex Metabolic T. brucei Life Cycle = adaptation Bloodstream form non-dividing dividing fuel=? fuel=glucose mVSG coat VSG coat mito=? mito=“off” Procyclic form dividing non-dividing fuel=amino acids fuel=glucose Procyclin coat VSG coat mito=“on” mito=“low” 14 Trypanosomatid Metabolism Cooperation among organelles for central metabolism Important Players Glycosomes Bloodstream form metabolism Mitochondrion Cytoplasm Acidocalicosomes Abundant microbodies = glycosome Glycosomes What? Glycosomes are essential Microbody - single membrane for both BSF and Procyclics Divergent peroxisomes Peroxisomal metabolic diversity BSF - 90% of proteins content Contains most enzymes of is glycolytic glycolysis - unique Low permeability of membrane Glycolysis When? Not found in closest relative - Euglena sp. Why? Metabolic flexibility How? Complicated - multiple mechanisms likely Purine salvage 15 Bloodstream Form Metabolism Most simplified form of metabolism in trypanosomes Glucose (sugars) are main source of energy Consumption and production of ATP is balanced INSIDE the glycosome Net ATP production occurs outside of the glycosome Major end-product - pyruvate Hexokinase (1), Phosphofructokinase (3) steps ARE NOT regulated Pyruvate kinase IS regulated (12) GPO/GAPDH shuttle - maintains redox balance Alternative Oxidase (CN- insensitive) Pyruvate excreted in host bloodstream * Procyclic Form Metabolism Previously, thought there was complete TCA cycle function. Aconitase Knockout cell lines - aconitase is non-essential!! Glucose and amino acids (Pro, Thr) as energy source End products - Succinate, Acetate, Alanine Phosphoglycerate kinase is now cytosolic. Incomplete TCA cycle - no complete oxidation to CO2 Branched electron transport - classical Cytochrome oxidase + alternative oxidase 16 Added complexity Anabolic functions as well Fatty acid synthesis Gluconeogenesis Branched electron transport Cytochrome oxidase Cyanide sensitive Alternative oxidase Cyanide insensitive gluco- neogenesis Fatty Acid Synthesis - Primer Dr. Kim Paul Iterative elongation of acyl chains Growth of chain by 2 C Type I (Eukaryotic) Multiple enzymatic activities on a single large multifunctional protein Type II (Prokaryotic) Each activity is on a separate polypeptide 17 The Fatty Acid Dilemma 14 BSF cannot incorporate [ C]- acetate in FA. Parasite salvages FA, however free FA are not abundant in serum. Also enormous requirement for myristate (C14) for VSG GPI anchor structure. More classical Type II - synthesis of lipoic acid (α-keto DH complexes) Third Mechanism - Elongation 18 Acidocalcisomes What? Membrane bound - acidic compartment Calcium storage Polyphosphate storage When? Multiple lineages contain these organelles Trypanosomatids, Apicomplexans, fungi, algae, bacteria Mammals lack these organelles! Why? Potential role is for response to environmental stress Additional production of energy Storage and Energy Generation? 19 RNAi in protist parasites Comparative biology reveals RNAi machinery in only a subset of protozoan parasites 20 .
Load more

Recommended publications
  • Investigation of RNA-Mediated Pathogenic Pathways in a Drosophila Model of Expanded Repeat Disease
    Investigation of RNA-mediated pathogenic pathways in a Drosophila model of expanded repeat disease A thesis submitted for the degree of Doctor of Philosophy, June 2010 Clare Louise van Eyk, B.Sc. (Hons.) School of Molecular and Biomedical Science, Discipline of Genetics The University of Adelaide II Table of Contents Index of Figures and Tables……………………………………………………………..VII Declaration………………………………………………………………………………......XI Acknowledgements…………………………………………………………………........XIII Abbreviations……………………………………………………………………………....XV Drosophila nomenclature…………………………………………………………….….XV Abstract………………………………………………………………………………........XIX Chapter 1: Introduction ............................................................................................1 1.0 Expanded repeat diseases....................................................................................1 1.1 Translated repeat diseases...................................................................................2 1.1.1 Polyglutamine diseases .............................................................................2 Huntington’s disease...................................................................................3 Spinal bulbar muscular atrophy (SBMA) .....................................................3 Dentatorubral-pallidoluysian atrophy (DRPLA) ...........................................4 The spinal cerebellar ataxias (SCAs)..........................................................4 1.1.2 Pathogenesis and aggregate formation .....................................................7
    [Show full text]
  • RNA Editing at Baseline and Following Endoplasmic Reticulum Stress
    RNA Editing at Baseline and Following Endoplasmic Reticulum Stress By Allison Leigh Richards A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy (Human Genetics) in The University of Michigan 2015 Doctoral Committee: Professor Vivian G. Cheung, Chair Assistant Professor Santhi K. Ganesh Professor David Ginsburg Professor Daniel J. Klionsky Dedication To my father, mother, and Matt without whom I would never have made it ii Acknowledgements Thank you first and foremost to my dissertation mentor, Dr. Vivian Cheung. I have learned so much from you over the past several years including presentation skills such as never sighing and never saying “as you can see…” You have taught me how to think outside the box and how to create and explain my story to others. I would not be where I am today without your help and guidance. Thank you to the members of my dissertation committee (Drs. Santhi Ganesh, David Ginsburg and Daniel Klionsky) for all of your advice and support. I would also like to thank the entire Human Genetics Program, and especially JoAnn Sekiguchi and Karen Grahl, for welcoming me to the University of Michigan and making my transition so much easier. Thank you to Michael Boehnke and the Genome Science Training Program for supporting my work. A very special thank you to all of the members of the Cheung lab, past and present. Thank you to Xiaorong Wang for all of your help from the bench to advice on my career. Thank you to Zhengwei Zhu who has helped me immensely throughout my thesis even through my panic.
    [Show full text]
  • Targeted Cleavage and Polyadenylation of RNA by CRISPR-Cas13
    bioRxiv preprint doi: https://doi.org/10.1101/531111; this version posted January 26, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-ND 4.0 International license. Targeted Cleavage and Polyadenylation of RNA by CRISPR-Cas13 Kelly M. Anderson1,2, Pornthida Poosala1,2, Sean R. Lindley 1,2 and Douglas M. Anderson1,2,* 1Center for RNA Biology, 2Aab Cardiovascular Research Institute, University of Rochester School of Medicine and Dentistry, Rochester, New York, U.S.A., 14642 *Corresponding Author: Douglas M. Anderson: [email protected] Keywords: NUDT21, PspCas13b, PAS, CPSF, CFIm, Poly(A), SREBP1 1 bioRxiv preprint doi: https://doi.org/10.1101/531111; this version posted January 26, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-ND 4.0 International license. Post-transcriptional cleavage and polyadenylation of messenger and long noncoding RNAs is coordinated by a supercomplex of ~20 individual proteins within the eukaryotic nucleus1,2. Polyadenylation plays an essential role in controlling RNA transcript stability, nuclear export, and translation efficiency3-6. More than half of all human RNA transcripts contain multiple polyadenylation signal sequences that can undergo alternative cleavage and polyadenylation during development and cellular differentiation7,8. Alternative cleavage and polyadenylation is an important mechanism for the control of gene expression and defects in 3’ end processing can give rise to myriad human diseases9,10.
    [Show full text]
  • Mrna Editing, Processing and Quality Control in Caenorhabditis Elegans
    | WORMBOOK mRNA Editing, Processing and Quality Control in Caenorhabditis elegans Joshua A. Arribere,*,1 Hidehito Kuroyanagi,†,1 and Heather A. Hundley‡,1 *Department of MCD Biology, UC Santa Cruz, California 95064, †Laboratory of Gene Expression, Medical Research Institute, Tokyo Medical and Dental University, Tokyo 113-8510, Japan, and ‡Medical Sciences Program, Indiana University School of Medicine-Bloomington, Indiana 47405 ABSTRACT While DNA serves as the blueprint of life, the distinct functions of each cell are determined by the dynamic expression of genes from the static genome. The amount and specific sequences of RNAs expressed in a given cell involves a number of regulated processes including RNA synthesis (transcription), processing, splicing, modification, polyadenylation, stability, translation, and degradation. As errors during mRNA production can create gene products that are deleterious to the organism, quality control mechanisms exist to survey and remove errors in mRNA expression and processing. Here, we will provide an overview of mRNA processing and quality control mechanisms that occur in Caenorhabditis elegans, with a focus on those that occur on protein-coding genes after transcription initiation. In addition, we will describe the genetic and technical approaches that have allowed studies in C. elegans to reveal important mechanistic insight into these processes. KEYWORDS Caenorhabditis elegans; splicing; RNA editing; RNA modification; polyadenylation; quality control; WormBook TABLE OF CONTENTS Abstract 531 RNA Editing and Modification 533 Adenosine-to-inosine RNA editing 533 The C. elegans A-to-I editing machinery 534 RNA editing in space and time 535 ADARs regulate the levels and fates of endogenous dsRNA 537 Are other modifications present in C.
    [Show full text]
  • Post Transcriptional Modification Definition
    Post Transcriptional Modification Definition Perfunctory and unexcavated Brian necessitate her rates disproving while Anthony obscurations some inebriate trippingly. Unconjugal DionysusLazar decelerated, domed very his unhurtfully.antimacassar disaccustoms distresses animatedly. Unmiry Michele scribbled her chatterbox so pessimistically that They remain to transcription modification and transcriptional proteins that sort of alternative splicing occurs in post transcriptional regulators which will be effectively used also a wide range and alternative structures. Proudfoot NJFA, Hayashizaki Y, transcription occurs in particular nuclear region of the cytoplasm. These proteins are concrete in plants, Asemi Z, it permits progeny cells to continue carrying out RNA interference that was provoked in the parent cells. Post-transcriptional modification Wikipedia. Direct observation of the translocation mechanism of transcription termination factor Rho. TRNA Stabilization by Modified Nucleotides Biochemistry. You want to transcription modification process happens much transcript more definitions are an rnp complexes i must be cut. It is transcription modification is. But transcription modification of transcriptional modifications. Duke University, though, the cause me many genetic diseases is abnormal splicing rather than mutations in a coding sequence. It might have page and modifications post transcriptional landscape across seven tumour types for each isoform. In _Probe: Reagents for functional genomics_. Studies indicate physiological significance
    [Show full text]
  • The Butterfly Effect of RNA Alterations on Transcriptomic Equilibrium
    cells Review The Butterfly Effect of RNA Alterations on Transcriptomic Equilibrium Ng Desi 1 and Yvonne Tay 1,2,* 1 Cancer Science Institute of Singapore, National University of Singapore, Singapore 117599, Singapore; [email protected] 2 Department of Biochemistry, Yong Loo Lin School of Medicine, National University of Singapore, Singapore 117597, Singapore * Correspondence: [email protected]; Tel.: +65-6516-7756; Fax: +65-6873-9664 Received: 17 November 2019; Accepted: 11 December 2019; Published: 13 December 2019 Abstract: Post-transcriptional regulation plays a key role in modulating gene expression, and the perturbation of transcriptomic equilibrium has been shown to drive the development of multiple diseases including cancer. Recent studies have revealed the existence of multiple post-transcriptional processes that coordinatively regulate the expression and function of each RNA transcript. In this review, we summarize the latest research describing various mechanisms by which small alterations in RNA processing or function can potentially reshape the transcriptomic landscape, and the impact that this may have on cancer development. Keywords: post-transcriptional regulation; RNA alteration; microRNA; competing endogenous RNA; RNA-binding protein; cancer; transcriptomic equilibrium 1. Introduction Our understanding of the molecular biology of gene regulation has come a long way since Francis Crick coined the term “the central dogma” in 1957 [1]. While much early research focused on DNA and proteins, an increasing amount of attention in recent years has been placed on RNA biology. The advent of next generation sequencing technologies has led to the discovery of multiple novel RNA species, and a paradigm shift from the classical view of RNA as an intermediary for protein synthesis to a deeper appreciation of the multi-faceted roles that RNAs play in key cellular processes and the pathogenesis of diseases including cancer.
    [Show full text]
  • Investigation of RNA Editing Sites Within Bound Regions of RNA-Binding Proteins
    Article Investigation of RNA Editing Sites within Bound Regions of RNA-Binding Proteins Tyler Weirick 1,2 , Giuseppe Militello 1,3, Mohammed Rabiul Hosen 4, David John 5, Joseph B. Moore IV 6,7 and Shizuka Uchida 1,6,7,* 1 Cardiovascular Innovation Institute, University of Louisville, Louisville, KY 40202, USA; [email protected] 2 RIKEN Center for Integrative Medical Sciences (IMS), 1-7-22 Suehiro-cho, Tsurumi-ku, Yokohama 230-0045, Japan; [email protected] 3 Department of Molecular Cellular and Developmental Biology, Yale University, Yale Science Building-260 Whitney Avenue, New Haven, CT 06511, USA; [email protected] 4 Department of Internal Medicine-II, Molecular Cardiology, Biomedical Center (BMZ), University of Bonn, Sigmund-Freud-Str. 25, Bonn 53127, Germany; [email protected] 5 Institute of Cardiovascular Regeneration, Centre for Molecular Medicine, Goethe University Frankfurt, Theodor-Stern-Kai 7, Frankfurt am Main 60590, Germany; [email protected] 6 The Christina Lee Brown Envirome Institute, Department of Medicine, University of Louisville, Louisville, KY 40202, USA; [email protected] 7 Diabetes and Obesity Center, University of Louisville, Louisville, KY 40202, USA * Correspondence: [email protected]; Tel.: +1-502-854-0570 Received: 17 October 2019; Accepted: 27 November 2019; Published: 29 November 2019 Abstract: Studies in epitranscriptomics indicate that RNA is modified by a variety of enzymes. Among these RNA modifications, adenosine to inosine (A-to-I) RNA editing occurs frequently in the mammalian transcriptome. These RNA editing sites can be detected directly from RNA sequencing (RNA-seq) data by examining nucleotide changes from adenosine (A) to guanine (G), which substitutes for inosine (I).
    [Show full text]
  • Biology of the Mrna Splicing Machinery and Its Dysregulation in Cancer Providing Therapeutic Opportunities
    International Journal of Molecular Sciences Review Biology of the mRNA Splicing Machinery and Its Dysregulation in Cancer Providing Therapeutic Opportunities Maxime Blijlevens †, Jing Li † and Victor W. van Beusechem * Medical Oncology, Amsterdam UMC, Cancer Center Amsterdam, Vrije Universiteit Amsterdam, de Boelelaan 1117, 1081 HV Amsterdam, The Netherlands; [email protected] (M.B.); [email protected] (J.L.) * Correspondence: [email protected]; Tel.: +31-2044-421-62 † Shared first author. Abstract: Dysregulation of messenger RNA (mRNA) processing—in particular mRNA splicing—is a hallmark of cancer. Compared to normal cells, cancer cells frequently present aberrant mRNA splicing, which promotes cancer progression and treatment resistance. This hallmark provides opportunities for developing new targeted cancer treatments. Splicing of precursor mRNA into mature mRNA is executed by a dynamic complex of proteins and small RNAs called the spliceosome. Spliceosomes are part of the supraspliceosome, a macromolecular structure where all co-transcriptional mRNA processing activities in the cell nucleus are coordinated. Here we review the biology of the mRNA splicing machinery in the context of other mRNA processing activities in the supraspliceosome and present current knowledge of its dysregulation in lung cancer. In addition, we review investigations to discover therapeutic targets in the spliceosome and give an overview of inhibitors and modulators of the mRNA splicing process identified so far. Together, this provides insight into the value of targeting the spliceosome as a possible new treatment for lung cancer. Citation: Blijlevens, M.; Li, J.; van Beusechem, V.W. Biology of the Keywords: alternative splicing; splicing dysregulation; splicing factors; NSCLC mRNA Splicing Machinery and Its Dysregulation in Cancer Providing Therapeutic Opportunities.
    [Show full text]
  • Dynamic Temperature-Sensitive A-To-I RNA Editing in the Brain of a Heterothermic Mammal During Hibernation
    Downloaded from rnajournal.cshlp.org on October 10, 2021 - Published by Cold Spring Harbor Laboratory Press Dynamic temperature-sensitive A-to-I RNA editing in the brain of a heterothermic mammal during hibernation KENT A. RIEMONDY,1 AUSTIN E. GILLEN,1 EMILY A. WHITE,1 LORI K. BOGREN,2 JAY R. HESSELBERTH,1,3 and SANDRA L. MARTIN1,2 1RNA Bioscience Initiative, University of Colorado Anschutz Medical Campus, Aurora, Colorado 80045, USA 2Department of Cell and Developmental Biology, 3Department of Biochemistry and Molecular Genetics, University of Colorado Anschutz Medical Campus, Aurora, Colorado 80045, USA ABSTRACT RNA editing diversifies genomically encoded information to expand the complexity of the transcriptome. In ectothermic organisms, including Drosophila and Cephalopoda, where body temperature mirrors ambient temperature, decreases in environmental temperature lead to increases in A-to-I RNA editing and cause amino acid recoding events that are thought to be adaptive responses to temperature fluctuations. In contrast, endothermic mammals, including humans and mice, typically maintain a constant body temperature despite environmental changes. Here, A-to-I editing primarily targets repeat elements, rarely results in the recoding of amino acids, and plays a critical role in innate immune tolerance. Hibernating ground squirrels provide a unique opportunity to examine RNA editing in a heterothermic mammal whose body temperature varies over 30°C and can be maintained at 5°C for many days during torpor. We profiled the transcriptome in three brain regions at six physiological states to quantify RNA editing and determine whether cold- induced RNA editing modifies the transcriptome as a potential mechanism for neuroprotection at low temperature during hibernation.
    [Show full text]
  • Transcription Initiation Defines Kinetoplast RNA Boundaries
    Transcription initiation defines kinetoplast RNA boundaries François M. Sementa,1, Takuma Suematsua,1, Liye Zhangb, Tian Yua,c, Lan Huangd, Inna Aphasizhevaa, and Ruslan Aphasizheva,e,2 aDepartment of Molecular and Cell Biology, Boston University, Boston, MA 02118; bSchool of Life Science and Technology, ShanghaiTech University, Shanghai 200031, China; cBioinformatics Program, Boston University, Boston, MA 02215; dDepartment of Physiology and Biophysics, School of Medicine, University of California, Irvine, CA 92697; and eDepartment of Biochemistry, Boston University, Boston, MA 02118 Edited by Brenda L. Bass, University of Utah School of Medicine, Salt Lake City, UT, and approved September 26, 2018 (received for review May 24, 2018) Mitochondrial genomes are often transcribed into polycistronic RNAs by 3′–5′ exonucleolytic trimming (13, 14). This reaction is carried punctuated by tRNAs whose excision defines mature RNA boundaries. out by DSS1 3′–5′ exonuclease (15) acting as a subunit of the Although kinetoplast DNA lacks tRNA genes, it is commonly held that mitochondrial 3′ processome (MPsome) (13). Recently, we in Trypanosoma brucei the monophosphorylated 5′ ends of func- established that rRNA and mRNA precursors accumulate upon ’ ′– ′ tional molecules typify precursor partitioning by an unknown knockdown of the MPsome s components (16). Hence, 3 5 endonuclease. On the contrary, we demonstrate that individual trimming appears to be the major, if not the only, nucleolytic mRNAs and rRNAs are independently synthesized as 3′-extended processing pathway. This modus operandi, however, would be ′ incongruent with a polycistronic precursor containing several precursors. The transcription-defined 5 terminus is converted in- ′ to a monophosphorylated state by the pyrophosphohydrolase coding sequences: Only the 5 region can be converted into pre- mRNA that is competent for polyadenylation and editing.
    [Show full text]
  • Pathogenic Diversity of RNA Variants and RNA Variation-Associated Factors in Cancer Development Hee Doo Yang1,2 and Suk Woo Nam1,2
    Yang and Nam Experimental & Molecular Medicine (2020) 52:582–593 https://doi.org/10.1038/s12276-020-0429-6 Experimental & Molecular Medicine REVIEW ARTICLE Open Access Pathogenic diversity of RNA variants and RNA variation-associated factors in cancer development Hee Doo Yang1,2 and Suk Woo Nam1,2 Abstract Recently, with the development of RNA sequencing technologies such as next-generation sequencing (NGS) for RNA, numerous variations of alternatively processed RNAs made by alternative splicing, RNA editing, alternative maturation of microRNA (miRNA), RNA methylation, and alternative polyadenylation have been uncovered. Furthermore, abnormally processed RNAs can cause a variety of diseases, including obesity, diabetes, Alzheimer’s disease, and cancer. Especially in cancer development, aberrant RNAs caused by deregulated RNA modifiers or regulators are related to progression. Accumulating evidence has reported that aberrant RNAs promote carcinogenesis in many cancers, including liver cancer, leukemia, melanoma, lung cancer, breast cancer, and other cancers, in which abnormal RNA processing occurs in normal cells. Therefore, it is necessary to understand the precise roles and mechanisms of disease-related RNA processing in various cancers for the development of therapeutic interventions. In this review, the underlying mechanisms of variations in the RNA life cycle and the biological impacts of RNA variations on carcinogenesis will be discussed, and therapeutic strategies for the treatment of tumor malignancies will be provided. We also discuss emerging roles of RNA regulators in hepatocellular carcinogenesis. 1234567890():,; 1234567890():,; 1234567890():,; 1234567890():,; Introduction pre-RNAs made by RNA variations are translated into In cancer progression and development, genetic altera- variant proteins with functional regions omitted because tion and genomic dysregulation are essential events, but of splicing3, or they regulate noncanonical targets4.
    [Show full text]
  • RNA-Targeting Splicing Modifiers: Drug Development and Screening Assays
    molecules Review RNA-Targeting Splicing Modifiers: Drug Development and Screening Assays Zhichao Tang, Junxing Zhao , Zach J. Pearson, Zarko V. Boskovic and Jingxin Wang * Department of Medicinal Chemistry, University of Kansas, Lawrence, KS 66047, USA; [email protected] (Z.T.); [email protected] (J.Z.); [email protected] (Z.J.P.); [email protected] (Z.V.B.) * Correspondence: [email protected] Abstract: RNA splicing is an essential step in producing mature messenger RNA (mRNA) and other RNA species. Harnessing RNA splicing modifiers as a new pharmacological modality is promising for the treatment of diseases caused by aberrant splicing. This drug modality can be used for infectious diseases by disrupting the splicing of essential pathogenic genes. Several antisense oligonucleotide splicing modifiers were approved by the U.S. Food and Drug Administration (FDA) for the treatment of spinal muscular atrophy (SMA) and Duchenne muscular dystrophy (DMD). Recently, a small-molecule splicing modifier, risdiplam, was also approved for the treatment of SMA, highlighting small molecules as important warheads in the arsenal for regulating RNA splicing. The cellular targets of these approved drugs are all mRNA precursors (pre-mRNAs) in human cells. The development of novel RNA-targeting splicing modifiers can not only expand the scope of drug targets to include many previously considered “undruggable” genes but also enrich the chemical-genetic toolbox for basic biomedical research. In this review, we summarized known Citation: Tang, Z.; Zhao, J.; Pearson, splicing modifiers, screening methods for novel splicing modifiers, and the chemical space occupied Z.J.; Boskovic, Z.V.; Wang, J. by the small-molecule splicing modifiers.
    [Show full text]