Gene Expression http://www.ncbi.nlm.nih.gov/books/bv.fcgi?call=bv.View..ShowTOC&rid=mboc4.TOC&depth=2
Prokaryotic
Translation is concurrent with transcription
No barrier restricts movement of transcript to translation apparatus
Single RNA polymerase synthesizes all RNA species
Eukaryotic
Transcript must be processed
Capping, splicing, polyA addition
mRNA is sequestered as RNP in the nucleus, must be transported to cytoplasm
Genes are often split - coding sequence is not contiguous
3 different RNA polymerases required to synthesize RNA classes
Polycistronic Transcripts
Operon - gene cluster
DNA
mRNA Polycistronic transcript multiple genes
Examples: Proteins perform a Carbohydrate degradation coordinated function Amino acid biosynthesis
1 Eukaryotic Transcripts
5’ 7-methylgaunosine cap structure
Post-transcriptional modification - after ~ 25 nucleotides
Prevents degradation by 5’ exonucleases
Helps in the export from the nucleus
Poly-adenylated tail
Post-transcriptional modification
Helps in stability of the mRNA
Mature transcript
Kinetoplastid Transcription
Discovered by D. Baltimore - immunoglobin heavy chain
Increases the diversity of protein repertoire
Improper alternative splicing can lead to disease
Cis-Splicing Mechanism
3 Splicing is mediated by the Spliceosome
• Several steps in the splicing reaction require ATP
Splicesome mediated - simplified
Composed of snRNPs
Small nuclear ribonucleoprotein
Small nuclear U-rich RNA (snRNA)
Each complexed with ~ 7 proteins
Highly simplified version
1. U1 base-pairs with the 5’ splice-site 2. U2 binds/pairs with the branch point; also pairs with U6 in the assembled spliceosome 3. U4 pairs with U6 in snRNPs, but releases during spliceosome assembly 4. U5 interacts with both exons (only 1-2 nt adjacent to intron); helps bring exons together 5. U6 displaces U1 at the 5’ splice-site (pairs with nt in the intron); it also pairs with U2 in the catalytic center of the spliceosome
4 Trans-splicing: 1st discovered in trypanosomes
To date: ALL but 2 coding sequences are trans-spliced!
Gene A Gene B Gene C Gene D Gene E
DNA
Trans-splicing Polyadenylation Polycistronic No evidence of transcript operons
SL RNA
AAAA AAAA Individual mRNAs each AAAA AAAA with a SL and poly A tail
AAAA
Comparison of cis- and trans-splicing
transesterification
Lariat Y-branch intermediate intermediate
transesterification
Intramolecular Intermolecular
5 Comparison of Spliceosomes
New Technology - SMaRT
Defects in alternative splicing can lead to human disease
Use of artificial trans-splicing to “repair” and give rise to a functional mRNA
Spliceosome-mediated RNA Trans-splicing
www.intronn.com
Correcting at the pre-mRNA level!
6 kDNA - organized in a disk structure
kDNA
Kinetoplast
Nucleus
Mitochondrion
Kinetoplast is always associated with the flagellar basal body
kDNA components
Two types of catenated ring circles kDNA network
1. Maxicircle: ~23kb, 25 • Encode electron transport subunits. • Require extensive posttranscriptional editing
Maxicircle Minicircle 3. Minicircle: 1kb, 5000 • Heterogeneous, 250 classes • Encode guide RNAs. 500nm 500nm kDNA is essential for the parasite survival
7 kDNA Replication Model
kDNA disk Primase Pol β -PAK DNA Ligase kα DNA Pol β DNA ligase kβ
Topo II SSE1
UMSBP
Pol IB Pol ID recruitment? Pol IC Pol IA ? kDNA repair?
What are the specialized roles?
Minicircle Replication Leading (L) strand
UMSBP
Unknown replicase + proteins
UMS Singly and Multiply Gapped Progeny UMS Lagging (H) strand
8 kDNA Replication Model
Trypanosomatid Mitochondrial RNA editing
Single mitochondrion
Unique mitochondrial DNA
Catenated structure composed of mini- and maxicircles
Size of molecules varies with species (15-80 kb) (1 - 2.5 kb)
50 maxicircles/network
5000-10,000 minicircles/network Maxicircle Minicircle 20 kb 1 kb Minicircles were initially thought to be nonfunctional, just a structural component
9 Maxicircle sequence
Initial sequencing of the T. brucei maxicircles demonstrated that it encoded apocytochrome b, subunits 1 and 2 of cytochrome c oxidase (cox) and some unassigned reading frames (MURFs) (some later turned out to be subunits of NADH dehydrogenase). However some pseudogene features – e.g. cox2 had a –1 frameshift and this was conserved between kinetoplastid species. Sequence determination of cox2 cDNA in 1984 showed an insertion at the precise position of the frameshift converting GA to UUGUAU. This wasn’t accepted at first – there were 50 maxicircles and maybe one had the difference or the gene was encoded in the nucleus. Extensive analysis showed no conventional cox2 genes existed in the nucleus or mitochondrion but a mechanism of adding in U’s was way too outlandish to be accepted at that time.
Maxicircle Sequence
Sequencing of other mitochondrial cDNAs and their comparison to the genomic sequence showed not only the addition of U’s but also their deletion. In 1986 the first CAUTIOUS paper on a “co- or post-transcriptional nucleotide insertion process” was published (Benne et al.,1986 Cell 46, 819-826 - 18 page paper). Although the data showed deletion of one U, the authors didn’t dare to conclude that this form of editing could also occur. Other groups of investigators found similar editing processes and the number of edited trypanosomatid RNAs expanded. The mystery of missing AUG translational start codons was solved as these are provided by RNA editing by both addition and deletion of U’s
10 Mitochondrial RNA editing
Cryptic mRNAs produced mRNA sequence DOES NOT exactly Cell correspond with genomic DNA sequence * * ** ** * Requires insertion of uridine residues ** *** (u) or deletion (*) to create a * *** functional ORF **** *** * * Extreme example is ND7 *** * ** * >90% of mRNA is edited *** Process is more active in *** ** ** ** procyclic form parasites **** **** * Minicircles encode gRNAs (guide **** ** * *** RNAs) that act as templates for * * *** **** insertion and deletion (1991) * *** * Process is essential (2001) * ** ******
Demonstrated by gene silencing in Edited T. brucei ND7 mRNA bloodstream form parasites
Maxicircle Comparison
Ribosomal RNA sequences ARE NOT edited
11 Insertional RNA editing
Primary transcript (Maxicircle encoded) 5' GCGGAGAAAAAAGAAAGGGUCUUUUAAUG (A)n ::|:|||| ||:|||||||| 3'-UUUUUUUUUU CAGAAAAUUACppp5' U A Guide RNA U A (Minicircle encoded) Poly(U) tail U C A A Anchor C U U U U A
Editing Edited mRNA
5' GCGGAGAAAAAAUGAAAUGUGUUGUCUUUUAAUG (A)n ::|:||||||||||||||:||||||||||||| 3'-UUUUUUUUUUUUUACUUUAUACAACAGAAAAUUACppp5'
Pan-editing of the L. tarentolae A6 mRNA
Precursor mRNA Edited mRNA
Precursor mRNA
Edited mRNA
Precursor mRNA
Edited mRNA
Precursor mRNA
Edited mRNA
12 Mechanism of RNA Editing
Insertion Deletion
RNA Editing Proteins
13 Mediated by Protein Complex
Metabolic T. brucei Life Cycle = adaptation
Bloodstream form non-dividing dividing fuel=? fuel=glucose mVSG coat VSG coat mito=? mito=“off”
Procyclic form dividing non-dividing fuel=amino acids fuel=glucose Procyclin coat VSG coat mito=“on” mito=“low”
14 Trypanosomatid Metabolism
Cooperation among organelles for central metabolism
Important Players
Glycosomes Bloodstream form metabolism Mitochondrion
Cytoplasm
Acidocalicosomes
Abundant microbodies = glycosome
Glycosomes
What? Glycosomes are essential
Microbody - single membrane for both BSF and Procyclics
Divergent peroxisomes
Peroxisomal metabolic diversity BSF - 90% of proteins content
Contains most enzymes of is glycolytic glycolysis - unique
Low permeability of membrane
Glycolysis When?
Not found in closest relative - Euglena sp. Why?
Metabolic flexibility
How?
Complicated - multiple mechanisms likely Purine salvage
15 Bloodstream Form Metabolism
Most simplified form of metabolism in trypanosomes
Glucose (sugars) are main source of energy
Consumption and production of ATP is balanced INSIDE the glycosome
Net ATP production occurs outside of the glycosome
Major end-product - pyruvate
Hexokinase (1), Phosphofructokinase (3) steps ARE NOT regulated
Pyruvate kinase IS regulated (12)
GPO/GAPDH shuttle - maintains redox balance
Alternative Oxidase (CN- insensitive) Pyruvate excreted in host bloodstream *
Procyclic Form Metabolism
Previously, thought there was complete TCA cycle function.
Aconitase Knockout cell lines - aconitase is non-essential!!
Glucose and amino acids (Pro, Thr) as energy source
End products - Succinate, Acetate, Alanine
Phosphoglycerate kinase is now cytosolic.
Incomplete TCA cycle -
no complete oxidation to CO2 Branched electron transport - classical Cytochrome oxidase + alternative oxidase
16 Added complexity
Anabolic functions as well
Fatty acid synthesis
Gluconeogenesis
Branched electron transport
Cytochrome oxidase
Cyanide sensitive
Alternative oxidase
Cyanide insensitive gluco- neogenesis
Fatty Acid Synthesis - Primer
Dr. Kim Paul Iterative elongation of acyl chains
Growth of chain by 2 C
Type I (Eukaryotic)
Multiple enzymatic activities on a single large multifunctional protein
Type II (Prokaryotic)
Each activity is on a separate polypeptide
17 The Fatty Acid Dilemma
14 BSF cannot incorporate [ C]- acetate in FA.
Parasite salvages FA, however free FA are not abundant in serum.
Also enormous requirement for myristate (C14) for VSG GPI anchor structure.
More classical Type II - synthesis of lipoic acid (α-keto DH complexes)
Third Mechanism - Elongation
18 Acidocalcisomes
What?
Membrane bound - acidic compartment
Calcium storage
Polyphosphate storage When?
Multiple lineages contain these organelles
Trypanosomatids, Apicomplexans, fungi, algae, bacteria
Mammals lack these organelles!
Why?
Potential role is for response to environmental stress
Additional production of energy
Storage and Energy Generation?
19 RNAi in protist parasites
Comparative biology reveals RNAi machinery in only a subset of protozoan parasites
20