bioRxiv preprint doi: https://doi.org/10.1101/742932; this version posted August 27, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
1 Oncogenic herpesvirus engages the endothelial transcription factors SOX18 and PROX1 to
2 increase viral genome copies and virus production
3
4 Silvia Gramolelli 1, Endrit Elbasani 1,Veijo Nurminen 1#, Krista Tuohinto 1#, Thomas Günther 2,
5 Riikka E. Kallinen 1, Seppo P. Kaijalainen 1, Raquel Diaz 1, Adam Grundhoff 2, Caj Haglund 1,3,
6 Joseph M. Ziegelbauer 4, Mark Bower 5, Mathias Francois 6, and Päivi M. Ojala 1,7,*
7
8 AUTHOR LIST FOOTNOTE
9 1 Translational Cancer Medicine Research Program, Faculty of Medicine, University of Helsinki,
10 Helsinki, 00014; Finland
11 2 Heinrich Pette Institute, Leibniz Institute for Experimental Virology, Hamburg, 205052; Germany
12 3 Department of Surgery, University of Helsinki and Helsinki University Hospital, Helsinki, 00014;
13 Finland
14 4 HIV and AIDS Malignancy Branch, Center for Cancer Research, National Cancer Institute, National
15 Institutes of Health, Bethesda, MD 20892; USA
16 5 National Centre for HIV Malignancy, Chelsea & Westminster Hospital, London, SW10 9NH; UK
17 6 Institute of Molecular Biosciences, The University of Queensland, Brisbane, QLD 4072;
18 Australia
19 7 Department of Infectious Diseases, Imperial College London, London, W2 1PG; United Kingdom
20
21 * Correspondence to: [email protected]
22
23 # Equal contribution.
24
25
1 bioRxiv preprint doi: https://doi.org/10.1101/742932; this version posted August 27, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
26 ABSTRACT
27
28 Kaposi sarcoma (KS) is a tumour of endothelial origin caused by KS herpesvirus (KSHV) infection
29 and suggested to originate from lymphatic endothelial cells (LECs). While KSHV establishes latency
30 in virtually all susceptible cell types, LECs support a spontaneous lytic gene expression program with
31 high viral genome copies and release of infectious virus. Here, we investigated the role of PROX1,
32 SOX18 and COUPTF2, drivers of lymphatic endothelial fate during embryogenesis, in this unique
33 KSHV infection program. We found that these factors were co-expressed in KS tumours with the
34 viral lytic marker K8.1, and that SOX18 and PROX1 regulate KSHV infection via two independent
35 mechanisms. SOX18 binds to the viral origins of replication and its depletion or chemical inhibition
36 significantly reduced the KSHV genome copies in LECs. PROX1 interacts with ORF50, the initiator
37 of the lytic cascade, increases lytic gene expression and virus production and its depletion reduces
38 KSHV spontaneous lytic reactivation. Upon lytic replication, PROX1 binds to the KSHV genome in
39 the promoter region of ORF50 and enhances its transactivation activity. These results demonstrate
40 the importance of two endothelial transcription factors in the regulation of the KSHV life cycle and
41 introduce SOX18 inhibition as a potential, novel therapeutic modality for KS.
42
43
44 KEYWORDS
45 Kaposi sarcoma, KSHV, herpesvirus, K8.1, transcription factors, PROX1, SOX18, lymphatic
46 endothelial cells, viral genome replication, viral reactivation.
47
2 bioRxiv preprint doi: https://doi.org/10.1101/742932; this version posted August 27, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
48 MAIN
49 Kaposi sarcoma (KS) is an angiogenic endothelial tumour caused by KS herpesvirus (KSHV). KS is
50 the most common cancer among AIDS patients and a frequent malignancy in Sub-Saharan Africa1.
51 KS presents with skin lesions that progress from patch to plaque and ultimately to nodular tumours;
52 in advanced disease visceral involvement is also seen2,3. The histopathological hallmark of KS is the
53 presence of KSHV-positive spindle cells (SC), the tumour cells of KS2,3. The cell of origin of SC has
54 been debated for two decades3. The prevailing hypothesis suggests lymphatic endothelial origin,
55 although blood endothelial cells or mesenchymal cells are also candidates1,4. In vitro, latency is the
56 default replication program in KSHV-infected cells with undetectable levels of lytic genes expressed.
57 However, KSHV infection of lymphatic, but not blood, endothelial cells (LEC and BEC) leads to a
58 unique infection program characterized by high KSHV genome copies, spontaneous lytic gene
59 expression and release of infectious virus5-8.
60
61 During embryonic development, LEC precursors originate from COUPTF2/SOX18 double-positive
62 BECs that physically separate from the cardinal vein to establish a primary lymphatic vascular plexus.
63 In this process, COUPTF2 and SOX18 drive the expression of PROX1 thereby orchestrating LEC
64 differentiation9,10. Here, we explored the role of these transcription factors (TF), instrumental for
65 establishment and maintenance of LEC identity, on the spontaneously lytic KSHV infection program
66 in LEC.
67
68 We identified SOX18 and PROX1, both expressed in KSHV-positive SCs in tumours, as key
69 regulators of the unique KSHV infection program in LECs. SOX18 binds to the viral origins of
70 replication and increases viral genome copies. Chemical inhibition or depletion of SOX18 reduced
71 intracellular viral genomes and titers. PROX1 enhances the expression of KSHV lytic genes and virus
72 production. During the lytic cycle, it binds to the promoter region of ORF50, the viral initiator of the
3 bioRxiv preprint doi: https://doi.org/10.1101/742932; this version posted August 27, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
73 lytic cascade. This study uncovers that TFs essential for maintaining the LEC identity are utilized by
74 KSHV to support its spontaneous lytic infection program in LECs, the proposed cells of origin of
75 KS-SCs.
4 bioRxiv preprint doi: https://doi.org/10.1101/742932; this version posted August 27, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
76 RESULTS
77 PROX1, SOX18, COUPTF2 and K8.1 are expressed in KS tumours
78 To study the expression of PROX1, SOX18 and COUPTF2 in KS tumours, we stained consecutive
79 sections from nine KS patients (seven AIDS-KS and two classic-KS) and compared their expression
80 to skin from KS-negative donors. While PROX1 expression in KS tumours has been shown
81 previously11-14, SOX18 and COUPTF2 expression has not been reported. Consecutive KS sections
82 were also stained for latency-associated nuclear antigen (LANA) and K8.1, markers of KSHV latent
83 and lytic infection, respectively. In the analysed KS tumours, SOX18, PROX1 and COUPTF2 were
84 highly expressed while in KS-negative skin samples their expression was restricted to the vascular
85 endothelium, as expected. Notably, SOX18, PROX1 and COUPTF2, all followed the distribution of
86 LANA and K8.1, indicating that these TFs are expressed in SCs together with the late lytic protein
87 K8.1 (Fig.1a,b, Supplementary Fig.1a,b). K8.1 and other lytic transcripts have been recently detected
88 in KS lesions by RNA-Seq15. Here, we observed a cytoplasmic K8.1 staining, consistent with the
89 predicted distribution of the protein. No K8.1 signal was detected on either normal skin or using an
90 isotype control antibody on KS sections, confirming the specificity of the staining (Supplementary
91 Fig.1c, d).
92 Overall, SOX18, PROX1 and COUPTF2 are expressed in KS-SC together with latent (LANA) and
93 late lytic (K8.1) proteins, supporting the relevance to study their role in the KSHV life cycle.
94
95
96
97
98
99
100
5 bioRxiv preprint doi: https://doi.org/10.1101/742932; this version posted August 27, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
101
102 Fig. 1 PROX1, SOX18, COUPTF2 and K8.1 are expressed in KS tumours.
103 (a,b) Representative images of consecutive sections from (a) five AIDS-KS biopsies and (b) Skin
104 from a KS negative donor stained with the indicated antibodies.
105
106
107
108
109
110
111
112
6 bioRxiv preprint doi: https://doi.org/10.1101/742932; this version posted August 27, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
113 Endothelial TFs and lytic genes are highly expressed in KSHV-infected LECs
114 KSHV infection has been shown to skew the LEC and BEC identity and modulate PROX1
115 transcription so that it is downregulated in KSHV-infected LECs (KLECs) and upregulated in KSHV-
116 infected BECs (KBECs)12,14,16-18. In these studies, however, SOX18 and COUPTF2 levels were not
117 analysed and PROX1 protein levels were not rigorously compared. To address this, BECs and LECs
118 were infected with rKSHV.219, a recombinant virus expressing GFP and RFP during latent and lytic
119 phase, respectively19.
120 The expression levels of PROX1, SOX18 and COUPTF2, together with infection (GFP), latent
121 (LANA) and lytic (ORF50, ORF45 and K8.1) markers were monitored either during a 14 day-time
122 course of infection or analysed 14 days post-infection (d.p.i.) (Fig.2a-e, Supplementary Fig.2 a-c). As
123 previously reported12,14, PROX1 transcripts, initially low in BEC, were upregulated in KBECs
124 increasing up to three-fold by 14.d.p.i. and downregulated to four-fold in KLECs by 14 d.p.i. (Fig.2a).
125 KSHV infection increased SOX18 transcripts in KBECs (three-fold by 10 d.p.i.) and KLECs (three-
126 fold already at 3 d.p.i.), while COUPTF2 expression did not change (Fig.2a). While we observed an
127 initial expression of lytic markers in KBECs, followed by their downregulation and latency
128 establishment, KSHV gene expression program was different in KLECs. In accordance with the
129 unique infection program in KLECs, the lytic expression increased throughout the timepoints
130 analysed, except at day10 p.i. where we consistently observed a downregulation of both viral and TFs
131 proteins (Fig.2b,c,e, Supplementary Fig.2a).
132 Despite the transcriptional downregulation, comparable levels of PROX1 protein were detected by
133 immunoblotting in LECs and KLECs infected with either rKSHV.219 or wild-type-(WT) KSHV and
134 confirmed by immunofluorescence at single cell level (Fig.2b-e Supplementary Fig.2b,c). SOX18
135 protein levels were increased in both KLECs and KBECs, while COUPTF2 levels did not vary
136 significantly (Fig.2b,c,d, Supplementary Fig.2b,c). At 14 d.p.i., spontaneous production of high titers
7 bioRxiv preprint doi: https://doi.org/10.1101/742932; this version posted August 27, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
137 (105 - 106 IU/ml) was observed only from KLECs, and not from KBECs infected with two different
138 KSHV strains, rKSHV.219 and WT-KSHV (Fig.2f, Supplementary Fig.2d).
139 Thus, SOX18, PROX1 and COUPTF2 were all highly expressed in KLECs, which, compared to the
140 latently-infected KBECs, expressed lytic markers and produced high titers. This points to KLECs as
141 a physiologically-relevant model to study SOX18, PROX1 and COUPTF2 in KSHV infection.
8 bioRxiv preprint doi: https://doi.org/10.1101/742932; this version posted August 27, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
142
9 bioRxiv preprint doi: https://doi.org/10.1101/742932; this version posted August 27, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
143 Fig. 2. Endothelial TFs and lytic genes are highly expressed in KSHV-infected LECs .
144 (a-f) Primary BECs and LECs were infected with rKSHV.219 or left uninfected and analysed at the
145 indicated timepoints (a,b) and 14 d.p.i. (days post-infection) (c-f). (a) RT-qPCR for the indicated
146 cellular targets at the indicated timepoint in BEC (upper panel) and LEC (lower panel); single data
147 from n=3 independent experiments ± SD are shown for each timepoints; p values were calculated
148 using ordinary one way-anova followed by Dunnett´s correction for multiple comparisons. *:
149 p<0.033; **: p<0.02, ***: p<0.001. Exact p values are shown in Supplementary Table3. (b)
150 Immunoblot of BEC (upper panel) and LEC (lower panel) treated as in (a) for the indicated targets
151 and gamma-tubulin (TUBG1) as a loading control. The experiment was repeated three independent
152 times. Representative cropped blots are shown, uncropped blots are shown in Supplementary Fig.6.
153 (c) Immunoblot for the indicated cellular targets 14 d.p.i., and gamma-tubulin (TUBG1) as a loading
154 control. The experiment was repeated three independent times. Representative cropped blots are
155 shown, uncropped blots are shown in Supplementary Fig.6. (d) IF staining for PROX1, SOX18, and
156 COUPTF2 in the indicated cell types treated as in (c). Representative images from two independent
157 experiments are shown. (e) IF staining in the indicated cell types 14 d.p.i. for K8.1 (red), nuclei are
158 counterstained with Hoechst 33342. Representative images from two independent experiments are
159 shown. (f) Titration of cell free supernatant from KBECs and KLECs 14 d.p.i. Single values from
160 n=4 biological replicates are shown. Bars represent mean ± SD. P value was calculated using two-
161 tailed paired t-test.
162
163
164
165
166
167
10 bioRxiv preprint doi: https://doi.org/10.1101/742932; this version posted August 27, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
168 SOX18 and PROX1 regulate KSHV infection through different mechanisms
169 To investigate SOX18, PROX1 and COUPTF2 in KSHV infection, KLECs treated with control
170 siRNA or siRNAs targeting these TFs for 72h were analysed for viral mRNAs, protein expression
171 and titers (Fig.3a-c, Supplementary Fig.3a-d). PROX1 and SOX18 depletion significantly decreased
172 the lytic transcript and protein levels, while COUPTF2 depletion caused a modest increase in lytic
173 gene expression. Of note, SOX18 depletion had a marked negative effect on LANA mRNA and
174 protein levels while PROX1 depletion reduced LANA transcripts to a half, but only marginally its
175 protein levels (Fig.3a,b, Supplementary Fig.2a). KSHV titers were reduced by a half upon PROX1
176 depletion and more severely after SOX18 silencing, while COUPTF2 silencing did not affect the
177 titers, despite the decreased lytic protein expression.
178
179 In KLECs PROX1 depletion did not change SOX18 levels whereas SOX18 depletion decreased the
180 PROX1 mRNA and slightly its protein levels (Fig.3b, Supplementary Fig.3d). Since SOX18
181 positively regulates PROX1 during LEC development, we explored the reciprocal effect of depletion
182 of these TFs also in non-infected LECs. In the absence of KSHV, silencing of either PROX1, SOX18
183 or COUPTF2 negatively affected the levels of all the other TFs. This was particularly evident for
184 PROX1 and even more for SOX18. PROX1 expression decreased upon both SOX18 and COUPTF2
185 silencing, and similarly, decreased SOX18 expression upon PROX1 and COUPTF2 depletion was
186 observed in non-infected LECs (Supplementary Fig.3e). This suggests that in KLECs KSHV
187 infection has uncoupled the reciprocal regulation of PROX1, SOX18 and COUPTF2 expression.
188
189 Since SOX18 depletion affected not only the lytic genes but also the latent LANA expression, we
190 investigated whether this was due to a diminished number of intracellular viral genomes (episomes).
191 While PROX1 silencing modestly decreased viral episome numbers (by 10%), SOX18 depletion
11 bioRxiv preprint doi: https://doi.org/10.1101/742932; this version posted August 27, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
192 decreased them by about 70% (Fig.3d), suggesting that SOX18 may contribute to the high episome
193 copies in KLECs.
194
195 Next, we co-silenced PROX1 and SOX18 to test if they reduce KSHV lytic gene expression and titers
196 independently of each other. As a positive control, we also treated KLECs with phosphonoacetic acid
197 (PAA), an inhibitor of the viral DNA polymerase which inhibits the late lytic program and virus
198 production (Fig.3e,f). As expected, PAA treatment decreased slightly transcription of the
199 intermediate-early ORF45 gene and more dramatically the late lytic K8.1, whereas PROX1 and
200 SOX18 co-silencing reduced both viral gene expression (early and late) and the reduction in titers,
201 more efficient if compared to their individual silencing, was comparable to PAA treatment.
202
203 These results suggest that PROX1 and SOX18 regulate the spontaneous virus production in KLECs
204 via different mechanisms, SOX18 by controlling the KSHV episome numbers while PROX1
205 regulates lytic viral gene expression.
206
12 bioRxiv preprint doi: https://doi.org/10.1101/742932; this version posted August 27, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
207
208 Fig. 3. SOX18 and PROX1 regulate KSHV production through different mechanisms.
209 (a-d) KLECs were treated 14 d.p.i. with the indicated siRNA for 72 h and analysed. (a) RT-qPCR for
210 the indicated viral-encoded targets. Single values from n=3 independent experiments are shown. Bars
211 represent mean ± SD. (b) Immunoblot for the indicated targets and actin as a loading control. The
212 experiment was repeated three independent times. Representative cropped blots are shown,
213 uncropped blots are shown in Supplementary Fig.6. (c) Titration for released infectious virus. Single
214 values from n=3 independent replicates are shown. Bars represent mean ± SD (d) Relative number of
215 intracellular KSHV genomes. Single values from n=3 independent experiments are shown. Bars
216 represent mean ± SD. (e,f) KLECs were treated 14 d.p.i. with the indicated siRNAs or 0.5mM PAA
217 for 72h. (e) Cells were analysed by RT-qPCR for the indicated viral targets. Single values from n=3
13 bioRxiv preprint doi: https://doi.org/10.1101/742932; this version posted August 27, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
218 independent experiments are shown. Bars represent mean ± SD. (f) Titration of the cell-free
219 supernatant. Single values from n=2 independent experiments are shown. Bars represent mean ± SD.
220 P values were calculated in panels (a), (c-f) using ordinary one way-anova followed by Dunnett´s
221 correction for multiple comparisons. *: p<0.033; **: p<0.02, ***: p<0.001. Exact p values are shown
222 in Supplementary Table3.
223
14 bioRxiv preprint doi: https://doi.org/10.1101/742932; this version posted August 27, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
224 SOX18 inhibition efficiently decreases KSHV genome copies and infectious virus release
225 SOX18 homo- and heterodimerization can be inhibited by a small molecule, SM420-22 and by an FDA-
226 approved beta blocker, propranolol23. Propranolol is produced as a 1:1 racemic mixture of R(+) and
227 S(-) enantiomers. The S(-) form exhibits beta-adrenergic blocking activity, while the less potent R(+)
228 enantiomer is carried over during the production. Similar to SM4, R(+) propranolol blocks SOX18
229 homo- and heterodimerization23, as a result, SOX18 fails to regulate a subset of its target genes21.
230
231 Given the significant reduction in viral episome numbers and titers upon SOX18 silencing in KLECs,
232 we explored whether its targeting by SM4 and R(+) propranolol would produce a similar outcome.
233 KLECs were treated with SM4, the propranolol racemic mixture (R+S) or the pure enantiomers R(+)
234 and S(-) (Fig.4a-d) using the same range of inhibitor concentrations shown to inhibit SOX18-
235 mediated activation of EC-specific genes21. We observed a dose-dependent decrease in KSHV
236 episomes and titers in SM4 and R(+)propranolol-treated KLECs compared to the DMSO-treated
237 control (Fig.4a-d). The racemic propranolol and the S(-) enantiomer increased both KSHV episomes
238 and titers. This agrees with a previous report where propranolol treatment of immortalized KLECs
239 induced to lytic cycle by phorbol esters increased lytic KSHV gene expression and titers, likely by
240 interfering with the cell cycle24, rather than having a SOX18-specific effect.
241
242 To further assess the specificity of the inhibitors, we tested these drugs on the SOX18-negative
243 iSLK.219 cells transduced with a control (myc-NLS-mCherry) or a myc-tagged SOX18-expressing
244 lentivirus. iSLK.219 is a cancer-derived cell line stably infected with rKSHV.219 and expressing
245 KSHV-ORF50 that drives lytic reactivation from a doxycycline (dox)-inducible promoter25. In the
246 absence of dox these cells are strictly latent. KSHV episomes were quantified in latently-infected
247 cells or cells reactivated with dox for 48h and treated with the indicated inhibitors or DMSO (Fig.4e).
248 SOX18 expression significantly increased KSHV episome copies both in latent and lytic cells. SM4
15 bioRxiv preprint doi: https://doi.org/10.1101/742932; this version posted August 27, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
249 and R(+) propranolol treatments reduced episome copies in iSLK.219 ectopically expressing SOX18
250 but not in the controls, supporting the specificity of the SOX18 chemical inhibition.
251 Therefore, these results provide a proof of principle that targeting SOX18 could represent a future
252 strategy for KS treatment.
253
16 bioRxiv preprint doi: https://doi.org/10.1101/742932; this version posted August 27, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
254
255 Fig. 4. Selective inhibition of SOX18 efficiently decreases the number of KSHV episomes.
256 (a-d) KLECs 10 d.p.i. were treated for six days with the indicated compounds at the concentrations
257 shown. The relative number of intracellular KSHV genome copies was quantified (a,c), and the
258 released infectious virus in the supernatant was measured (b,d). Single values from n=3 independent
259 replicates are shown. Bars represent mean ± SD. P values were calculated using ordinary one way-
260 anova followed by Dunnett´s correction for multiple comparisons. Exact p values are shown. (e)
261 iSLK.219 were transduced with lentiviruses expressing either SOX18 or NLS-mCherry (indicated as
17 bioRxiv preprint doi: https://doi.org/10.1101/742932; this version posted August 27, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
262 mCherry) vector control. One day later cells were treated either with DMSO or with the indicated
263 drug for 48h in the presence (orange bars) or absence (blue bars) of dox for the induction of the lytic
264 cycle. The relative number of intracellular KSHV genome copies was quantified. Single values from
265 n=3 biological experiments are shown. Bars represent mean ± SD. P value were calculated using two-
266 tailed paired t-test.
267
18 bioRxiv preprint doi: https://doi.org/10.1101/742932; this version posted August 27, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
268 SOX18 binds to the KSHV genome in the proximity of the origins of replication
269 To further investigate the effect of SOX18 on the KSHV episomes, iSLK.219 cells were transduced
270 with the mCherry- or increasing amounts of SOX18-expressing lentiviruses and KSHV episomes
271 were quantified 48h post-transduction (Fig.5a). We observed a significant, dose-dependent increase
272 of KSHV episome copy number. We tested whether this was due to increased proliferation of SOX18-
273 expressing iSLK.219 by 5-ethynyl-2'-deoxyuridine (EdU) treatment (Supplementary Fig.5a). No
274 change in the percentage of proliferating (EdU-positive) cells was found following SOX18
275 expression. Additionally, KSHV gene, protein expression and titers were monitored for 72h in
276 iSLK.219 after dox-induced reactivation (Supplementary Fig.5b-d). SOX18 ectopic expression
277 mildly increased KSHV lytic transcripts and proteins without increasing the titers. These data suggest
278 that SOX18 expression increases viral genome copies without increasing cell proliferation and only
279 slightly contributes to lytic gene expression upon dox induction.
280
281 During latency, KSHV replication occurs mainly by a LANA-dependent mechanism from the
282 terminal-repeat (TR) region of the KSHV genome and, to a minor extent, through a LANA-
283 independent mechanism from the OriA region, adjacent to the origin of lytic replication (OriLyt)26,27.
284 We measured the activity of luciferase-reporters harbouring either seven copies of the TR region
285 (7XTR) or the OriA fused to OriLyt upstream of an SV40 promoter and a firefly luciferase reporter
286 (Fig.5b,c, Supplementary Fig.5e,f). ORF50, that binds to the OriLyt and is a potent activator of this
287 reporter28, was used as a positive control. In the presence of LANA, SOX18 expression increased
288 the activity of the 7XTR reporter in a dose-dependent manner. SOX18 expression also increased the
289 activity of the OriA+OriLyt reporter in an ORF50-independent manner. SOX18 did not change the
290 activity of a reporter plasmid harbouring the ORF50 promoter (Supplementary Fig.5g,) supporting
291 the specificity of the activation observed in the 7XTR and OriA+OriLyt reporters.
19 bioRxiv preprint doi: https://doi.org/10.1101/742932; this version posted August 27, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
292 Since the reporter assays suggested that SOX18 might bind to the KSHV origins of replication, we
293 assessed this further by ChIP-qPCR in iSLK.219 ectopically expressing a myc-tagged SOX18
294 (Fig.5d,e). Binding of SOX18 to the KSHV genome was observed in regions adjacent to the TR and
295 within and adjacent to the OriA region. SOX18 drives EC fate through the regulation of a subset of
296 genes harbouring in their promoter an IR5 consensus motif, composed of two SOX18-binding sites
297 spaced by five nucleotides (nt)21. Notably, one of these motifs was located adjacent to the KSHV-
298 TR region bound by SOX18 (Fig.5d).
299 Overall these results indicate that SOX18 binds at the proximity of KSHV origins of latent replication,
300 and it increases in viral episome copies.
301
20 bioRxiv preprint doi: https://doi.org/10.1101/742932; this version posted August 27, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
302
303 Fig. 5. SOX18 binds to the proximity of KSHV origins of replication.
304 (a) iSLK.219 were transduced with increasing amounts of lentiviruses expressing either SOX18 or
305 mCherry vector control. 48h later, the relative number of intracellular KSHV genome copies was
306 quantified. Single values for n=3 biological replicates are shown. Bars represent mean ± SD. (b,c)
307 Luciferase reporter assays in HeLa cells transfected as indicated. Single values from (b) n=8 and (c)
308 n=4 biological replicates are shown. Bars represent mean ± SEM. (d;e) Upper panels: schematic
21 bioRxiv preprint doi: https://doi.org/10.1101/742932; this version posted August 27, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
309 representation of the promoter regions amplified by qPCR following chromatin immunoprecipitation
310 (ChIP) using either myc antibody to precipitate myc-tagged SOX18 or control HA antibody; numbers
311 indicate the nucleotides upstream or downstream of the black regions; bottom panels: ChIP in
312 iSLK.219 transduced with lentivirus expressing Myc-tagged SOX18. Single values for n=3 biological
313 replicates are shown. Bars represent mean ± SEM.
314 P values in all panels were calculated using ordinary one way-anova followed by Dunnett´s correction
315 for multiple comparisons; *: p<0.033; **: p<0.02, ***: p<0.001. Exact p values are shown in
316 Supplementary Table3.
317
22 bioRxiv preprint doi: https://doi.org/10.1101/742932; this version posted August 27, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
318 PROX1 enhances viral gene expression, binds to ORF50 and its promoter during KSHV lytic
319 replication cycle
320 To obtain a comprehensive picture of the PROX1-mediated KSHV lytic gene regulation, we
321 performed RNA-seq of KLECs transfected for 72 h with either control or PROX1-targeting siRNA
322 and of dox-treated (24h) iSLK.219 cells expressing a myc-tagged PROX1 from a lentivirus. PROX1
323 silencing in KLECs significantly reduced expression of viral genes and viral circular RNAs,
324 expressed during the lytic cycle29,30 (Fig.6a, Supplementary Fig.5a). Analysis of differentially
325 expressed genes (DEG; Supplementary Table1) revealed several cellular pathways involved in
326 oncogenesis (e.g. p53 signalling, viral carcinogenesis, and transcription misregulation in cancer)
327 altered by PROX1 silencing in KLECs (Supplementary Fig.5b), supporting the pivotal role of PROX1
328 in KS pathogenesis. Conversely, PROX1 reintroduction in iSLK.219 cells induced with dox led to an
329 overall increase in viral gene expression (Fig.6a). The analysis of DEG (Supplementary Table2) in
330 iSLK.219 did not identify differentially regulated pathways.
331 We further characterized iSLK.219 cells transduced with lentiviruses encoding a Myc-tagged
332 PROX1, either WT or a mutant (MUT) harbouring two point mutations at the DNA binding site
333 (N624A and N626A) and lacking transcriptional activity31, as well as a control vector. One day after
334 dox-induced lytic reactivation PROX1 WT, but not MUT, expression increased the transcription of
335 lytic KSHV genes and immunoblot analysis revealed higher lytic protein levels in the presence of
336 PROX1 WT (Supplementary Fig.5c,d). High-content image analysis in iSLK.219 cells 24h after dox-
337 induced reactivation, revealed that PROX1 WT, but not MUT, increased the percentage of cells
338 positive for early (RFP, ORF57) and late (K8.1) lytic markers (Supplementary Fig.5e). KSHV titers
339 were significantly higher in iSLK.219 cells expressing PROX1 WT when compared to MUT or
340 controls (Supplementary Fig.5f). These results suggest that, upon lytic reactivation, a
341 transcriptionally active PROX1 increases KSHV lytic gene expression and titers.
23 bioRxiv preprint doi: https://doi.org/10.1101/742932; this version posted August 27, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
342 To assess if PROX1 could induce spontaneous lytic reactivation in latent iSLK.219, they were
343 transduced with PROX1 (either WT or MUT) lentiviruses or controls in the absence of dox. This led
344 to about two- to ten-fold increase in lytic mRNAs, but not in lytic proteins (Supplementary Fig.5g,
345 h). Therefore, we hypothesized that an early viral lytic factor was needed for PROX1 to significantly
346 enhance KSHV lytic cycle. Since KSHV-ORF50 is sufficient to trigger the complete lytic cascade,
347 we investigated whether PROX1 would act in concert with ORF50 to increase the lytic gene
348 expression. We first performed a luciferase-reporter assay using the ORF50 promoter upstream of a
349 luciferase gene (ORF50-luc) and measured its activity upon ectopic expression of PROX1, WT or
350 MUT, or ORF50 expression plasmid alone and in combination with the PROX1 constructs (Fig.6b,
351 Supplementary Fig.4i). PROX1 alone did not increase the ORF50 promoter activity beyond the basal
352 levels, in agreement with its inability to induce a strong, spontaneous reactivation in iSLK.219 cells.
353 However, PROX1 WT, but not the transcriptionally inactive MUT, enhanced significantly the
354 ORF50-mediated transcription from its own promoter. We also found that PROX1 WT, but not
355 PROX1 MUT, co-immunoprecipitated ORF50 in iSLK.219 reactivated for 24h by dox-treatment
356 (Fig.6c). Furthermore, in LECs infected with WT-KSHV, ORF50 and PROX1 co-localized in the
357 viral replication and transcription compartments32,33 (Pearson´s correlation coefficient, PCC=0.65,
358 Fig.6d). To test whether PROX1 would bind to the ORF50 promoter in infected cells, ChIP was
359 performed in iSLK.219 (latent or dox-induced for 24h) to precipitate the Myc-tagged PROX1-bound
360 chromatin with two different antibodies (anti-PROX1 and anti-Myc) followed by RT-qPCR to
361 amplify the ORF50 promoter region up to 850nt upstream of the ORF50 TSS. While PROX1 bound
362 to the proximal regions of the ORF50 promoter (up to 600nt upstream of the TSS) during the lytic
363 cycle, (Fig.6f), it did not bind during latency (Supplementary Fig.5j). PROX1 binding to the ORF50
364 promoter was also confirmed in KLECs (Fig.6f, lower panel).
365
24 bioRxiv preprint doi: https://doi.org/10.1101/742932; this version posted August 27, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
366 To investigate the co-expression of PROX1 and viral lytic protein we stained consecutive sections
367 of additional 36 KS biopsies (31 AIDS-KS and 5 AIDS-negative KS of which 26 from skin/lymph
368 node lesions (LN) and 10 from gastro-intestinal (GI) lesions) with PROX1 and K8.1 antibodies, and
369 observed that 92% of the skin/LN cases (24/26) and 50% (5/10) of the GI-KS were co-expressing
370 PROX1 and K8.1 (Fig.6g). This suggests that PROX1 expression is associated with KSHV lytic
371 protein expression also in KS tumours.
372
373 This data indicates that PROX1 enhances KSHV lytic gene expression, binds to the initiator of the
374 KSHV lytic cycle, ORF50, and during the lytic cycle it binds to the ORF50 promoter. PROX1 also
375 enhances the auto-activation of ORF50 promoter in an ORF50-dependent manner. In addition, in the
376 majority of the analysed skin KS tumours PROX1 expression coincided with the expression of the
377 late lytic marker K8.1, thus suggesting an important role for PROX1 in enhancing KSHV lytic gene
378 expression in KS.
379
25 bioRxiv preprint doi: https://doi.org/10.1101/742932; this version posted August 27, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
380
381
26 bioRxiv preprint doi: https://doi.org/10.1101/742932; this version posted August 27, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
382 Fig. 6. PROX1 is a positive regulator of viral gene expression, binds to ORF50
383 and to ORF50 promoter during KSHV lytic replication cycle.
384 (a) KLECs (left) and iSLK.219 (right) were treated in n=3 independent replicates, as indicated and
385 subjected to RNA-seq. Fold change ±SEM in the viral transcripts over the appropriate control is
386 shown. (b) Luciferase reporter assay in HEK293FT transfected with the indicated plamids for 36h.
387 Single values for n=4 biological replicates are shown, bars represent mean ± SD. (c) Co-
388 Immunoprecipitation of Myc-tagged PROX1 WT or MUT with ORF50 in iSLK.219 cells reactivated
389 (dox) for 24h. The experiment was repeated two independent times. Representative cropped blots are
390 shown, uncropped blots are shown in Supplementary Fig.6. (d) Immunofluorescence for PROX1
391 (red) and ORF50 (green) in KLECs infected with WT KSHV 16 d.p.i. A representative image is
392 shown, the experiment was done two times. (e) Upper panel: schematic representation of the ORF50
393 promoter regions amplified by qPCR following Chromatin immunoprecipitation (ChIP); numbers
394 indicate the nucleotides upstream of the ORF50 TSS; middle panel: ChIP in iSLK.219 transduced
395 with lentivirus expressing Myc-tagged PROX1 reactivated (dox) for 24 h, chromatin was
396 immunoprecipitated with two antibodies for PROX1 (anti-PROX1 and anti-Myc) and DNA was
397 amplified in the promoter regions of the ORF50 gene; lower panel: ChIP in KLECs 14 d.p.i. using
398 PROX1 antibody as above. Bars represent mean ± SD. (f) KS lesions from skin or lymph node (LN)
399 lesions from 26 patients and gastro-intestinal (GI) KS lesions from 10 patients were analysed for co-
400 distribution of PROX1 and K8.1 staining in consecutive sections (left panel); representative image
401 (right panels).
402 P values in panels a,b,e were calculated using ordinary one way-anova followed by Dunnett´s
403 correction for multiple comparisons. *: p<0.033; **: p<0.02, ***: p<0.001. Exact p values are shown
404 in Supplementary Table3.
405
406
27 bioRxiv preprint doi: https://doi.org/10.1101/742932; this version posted August 27, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
407
408 DISCUSSION
409 KSHV infection of BECs or LECs results to different viral expression programs in the infected cells.
410 While the virus is strictly latent in KBECs, it displays a unique, spontaneous lytic replication program
411 in KLECs5. Multiple evidence supports a lymphatic rather than blood endothelial origin for KS-SC3.
412 Our findings that SOX18, PROX1 and COUPTF2 are all expressed in KS-SC further support the
413 lymphatic origin of KS-SC. We found that SOX18 and PROX1, both essential for maintaining the
414 LEC identity, regulate KSHV life cycle through two different mechanisms in KLECs. COUPTF2
415 instead, although also expressed in KS, had no role in KSHV replication in KLECs.
416
417 SOX18 is listed among the 1482 genes differentially regulated in KS compared to normal skin17, but
418 its role in the KSHV biology has been little explored. Here we show that SOX18 binds to the KSHV
419 episome and increases their number. This is the first time that SOX18 is associated to a key function
420 in viral life cycle. It has so far been linked to the transcriptional regulation of ECs and to the
421 progression of solid cancers34,35. SOX18 forms a dimer20,21, able to bind to the viral and cellular
422 genomes. This may lead to a stronger viral episome tethering to the host genome, thus improving the
423 efficiency of KSHV genome retention. Supporting this hypothesis is the finding that SOX18 chemical
424 inhibition of homo and heterodimerization reduced KSHV genomes. While the less characterized
425 SM4 molecule will need further testing, the enantiopure R propranolol has already been proven safe36
426 and could in principle be repurposed to treat KS patients.
427
428 PROX1 has been studied in KSHV-induced EC reprogramming but little is known about its role in
429 the KSHV life cycle. We found that PROX1 acts at the initiation of KSHV lytic cascade by enhancing
430 transcription from the ORF50 promoter in an ORF50-dependent manner. However, we do not exclude
28 bioRxiv preprint doi: https://doi.org/10.1101/742932; this version posted August 27, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
431 that PROX1 might also govern the expression of cellular regulator(s) of lytic reactivation and/or
432 interact with other viral/cellular products and thereby enhance also other phases of the lytic cycle.
433
434 We further show that the late lytic protein K8.1 is expressed in the majority of the studied KS biopsies,
435 suggesting that, similar to KLECs in culture, lytic protein expression is likely a common feature of
436 KS tumours. This is supported by detection of the lytic proteins K5 and K15 in KS biopsies37,38 and
437 a recent RNA-seq study on African-KS lesions where KSHV lytic transcripts were detected in the
438 tumours analysed15. It is not known whether KS-SCs, like the KLEC cultures, constitutively produce
439 and release infectious virus.
440
441 KS is an atypical tumour: the SCs are diploid, depend on extracellular supply of growth factors for
442 their survival, and viral persistence is necessary to support tumourigenesis2,3,39,40. However, KSHV
443 genome maintenance is inefficient and viral genomes are lost during cell division41,42. Sporadic lytic
444 reactivation and release of infectious virus is required in vivo to replenish the population of KSHV-
445 infected SCs. Therefore, SOX18 and PROX1, as positive regulators of viral episome copies and
446 productive lytic replication, are important not only for the KSHV life cycle but also for KS
447 pathogenesis. Differently from the non-infected LECs, in KLECs PROX1, SOX18 and COUPTF2
448 expression are not interdependent. KSHV infection maintains high levels of these TFs and, in turn,
449 PROX1 and SOX18 sustain viral infection. This suggests that the virus renders its cellular
450 microenvironment optimal for its own persistence.
451
452 Overall, our findings revealed KLECs as a faithful in vitro model for KS research and answer some
453 long-standing questions on the physiological control of KSHV spontaneous lytic gene expression
454 pointing to endothelial TFs as important players in this process.
455
29 bioRxiv preprint doi: https://doi.org/10.1101/742932; this version posted August 27, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
456 METHODS
457
458 Human subjects
459 Paraffin embedded KS sections were kindly provided by Dr. Justin Weir (Charing Cross Hospital,
460 and the London Clinic, London). All KS cases analysed in the study were obtained from adult males.
461 The study was covered by Riverside Research Ethics Committee (Study title: Kaposi’s Sarcoma
462 Herpes Virus Infection And Immunity, REC reference: 04/Q0401/80); all patients gave written
463 informed consent.
464
465 FFPE KS-negative skin biopsies were obtained from the archives of the Department of Pathology,
466 Helsinki University Hospital, according to the Finnish laws and regulations by permission of the
467 director of the health care unit. The tissue samples were de-identified and analysed anonymously.
468
469 Cell culture
470 Primary human dermal lymphatic (C-12216) and blood (C-12211) endothelial cells (LECs and BECs)
471 were purchased from Promocell. Each experiment was repeated using cells from at least two different
472 donors.
473 Primary human LECs and BECs were grown in Lonza EBM-2 (00190860) supplemented with
474 EGMTM-2 MV Microvascular Endothelial SingleQuotsTM(CC-4147). HEK293FT (Thermofisher
475 Scientific, R70007), U2OS (ATCC:HTB-96), HeLa (ATCC® CCL-2™)and iSLK.219 were grown in
476 DMEM, supplemented with 10% foetal calf serum, 1%L-glutamate, 1% pen/strep. iSLK.219 were
477 also supplied with 10 ug/ml puromycin, 600μg/mL hygromycin B, 400μg/mL G418.
478 TREx BCBL1-Rta43 were grown in RPMI1640 supplemented with 20% foetal calf serum, 1%L-
479 glutamate, 1% pen/strep.
480
30 bioRxiv preprint doi: https://doi.org/10.1101/742932; this version posted August 27, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
481 rKSHV.219 or WT KSHV production
482 rKSHV.219 was produced from iSLK.219 cells reactivated using 0.2 µg/ml doxycycline and 1.35mM
483 NaB for 72h. WT KSHV was produced from TREx BCBL1-Rta43 reactivated with dox(1µg/ml) for
484 96h.Supernatant was then harvested, spun down (2000 rpm 5min) and sterile filtered using 45 µm
485 pore-size filters. Subsequently the supernatant was ultracentrifuged at 22000 rpm for 2h. The
486 concentrated virus was then aliquoted and stored at -80°C.
487
488 Virus titers were determined by infecting U2OS cells with serial dilutions of the concentrated virus
489 preparation and assessing the amount of GFP+ or LANA+ cells 24h post-infection by automated
490 high-content microscopy (see below in the virus titration section).
491
492 KSHV infection of endothelial cells
493 Early passage LECs or BECs (less than 6) were grown to semi-confluency and infected at MOI of
494 1.5 and 3, respectively (to achieve the same number of virus positive cells) by spinoculation (450g,
495 30 min RT) in the presence of 8µg/ml of polybrene. Media was replaced every third day. At 7-9 d.p.i.
496 cells were split at 1:2 or 1:3 ratio and the experiments started after additional 2-4 days when cells
497 reached again confluency and organized spindling and RFP expression (as a marker of lytic
498 expression) were observed.
499
500 Plasmids and lentivirus constructs
501 The following plasmids were used in this study: pAMC Prox1 WT, pAMC Prox1 MUT, pAMC
502 (described in 31); pcDNA ORF50 (described in 44); pcDNA LANA; pcDNA 3.1 (Thermo Fisher);
503 pGL2-ORF50 (described in 44); pGL2-basic (Promega); pGL3-7XTR (provided by TF Schulz,
504 Hannover Medical School) and pGL3-basic (Promega).
505
31 bioRxiv preprint doi: https://doi.org/10.1101/742932; this version posted August 27, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
506 PROX1 WT and PROX1 MUT expressing lentiviruses were described previously20. The control
507 pFuW-myc-NLS-mCherry was generated from the pFuW-myc-BirA-NLS-mCherry (a kind gift by
508 R.Kivela, University of Helsinki). SOX18 gene sequence was codon optimized and synthesized by
509 GeneArt (Thermo Fisher). The codon optimized SOX18 was cloned in the pFuW-myc by Gibson
510 Assembly using as an initial backbone pFuW-myc-NLS-mCherry. Backbone and insert were
511 assembled using the NEB HiFi DNA assembly (New England BioLabs, E2611).
512 Inserts were verified by Sanger sequencing and the integrity of the backbone by restriction analysis.
513
514 Lentivirus production and transduction
515 5x106 HEK293FT cells were plated in a T75 flask. Next day cells were transfected with 3rd generation
516 lentivirus packaging plasmids (2.83 µg pLP1, 1.33 µg pLP2, 1.84 µg pLP/VSVg) and 5 µg of
517 expression plasmid of interest using 20 µl/flask of Lipofectamine 2000. Next day, media was changed
518 and the virus was collected 48h later. The lentivirus was then concentrated using PEG-IT (System
519 Biosciences) according to the manufacturer instructions.
520
521 iSLK.219 cells were plated for transduction at a density of 2.5x105 cells/ml. On the next day
522 transduction was done by spinoculation (450g, 30 min, RT) in the presence of 8µg/ml of polybrene.
523 On the next day, cells were supplied with fresh media.
524
525 Plasmids and siRNAs transfections
526 DNA transient transfections were performed using Lipofectamine 2000 (Invitrogen) for lentivirus
527 preparation (see above) and FuGENE XD (Promega) for luciferase reporter assays at a ratio 1µg
528 DNA:4 µl FuGENE XD.
529
32 bioRxiv preprint doi: https://doi.org/10.1101/742932; this version posted August 27, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
530 Transient transfection of siRNA in a semi-confluent culture of rKSHVLEC was done using 3 µl of
531 Lipofectamine RNAiMAX (Invitrogen) and 150pmol siRNA in a 6 well plate and following
532 manufacturer instructions. Next day cells were supplied with fresh media. The following siRNA -
533 were used: Stealth RNAi™ Prox1-1 and 2 (HSS 108596; HSS 108597) and Stealth RNAi™ Negative
534 Control (HSS 12935200) from Invitrogen; ON-TARGETplus SOX18 siRNA (L-019035-00); ON-
535 TARGETplus COUPTF2siRNA (L-003422-00) and ON-TARGETplus Non-targeting pool siRNA
536 (D-001810-10) from Dharmacon.
537
538 Virus titration
539 One day prior titration 8000 U2OS/well were plated on viewPlate-96black (6005182, Perkin Elmer).
540 Cells were infected in triplicate by spinoculation (450g, 30 min, RT) in the presence of 8µg/ml of
541 polybrene with serial dilution of pre-cleared (by centrifugation 8-10 min at 1000g) supernatant from
542 cells treated as indicated. Next day cells were fixed in 4%PFA, stained with GFP (a kind gift from J.
543 Mercer; UCL, UK) or LANA (Rat monoclonal HHV-8 (LN-35) ab4103; Abcam) and Hoechst 44432
544 (1 µg/ml).
545 Plates were imaged using Thermo-Scientific Cell Insight High Content Screening (HCS) system;
546 images from 9 fields/well were taken.
547
548 Inhibitor treatments
549 PAA (Cat#284270); R-Propranolol (Cat#P0689), S-Propranolol (Cat#P8688) and R-S Propanolol
550 (Cat#P0884) were obtained from Sigma-Aldrich; Sm4 was kindly provided by M. Francois20 .
551 KLECs or iSLK.219 cells were treated for six and two days, respectively with the indicated inhibitor
552 at the concentrations stated in the Figure panels prior to the experiments.
553 During the 6-day drug treatment, the media was changed with fresh media-containing drug every 2
554 days.
33 bioRxiv preprint doi: https://doi.org/10.1101/742932; this version posted August 27, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
555
556 Luciferase Reporter assay
557 2.5x105 HEK293FT/ml were plated in 24well plates (500ml/well). Next day each well was
558 transfected using FuGENE XD (Promega) with 0.1 µg of reporter plasmid (or the corresponding
559 vector controls), 0.25 µg of RTA (or the corresponding vector control), 0.25 µg of the plasmid of
560 interest (PROX1 WT or MUT). Alternatively, HeLa cells were transfected with 0.1 µg of reporter
561 plasmid (or the corresponding vector controls), 0.2 µg of LANA (or the corresponding vector
562 control), 0.25, 0.5 or 1 µg of SOX18-expressing plasmid or the mCherry vector control. 32-36h post-
563 transfection cells were lysed in 1Xpassive lysis buffer (Promega). Experiments were done at least
564 two times in duplicates, bars represent the average and the error bars the SD across the different
565 experiments.
566
567 Quantification of virus genome copy number
568 Equal number of cells (106) were harvested and cellular and viral DNA was isolated with NucleoSpin
569 Tissue Kit (Macherey-Nagel, Cat#740988). The extracted DNA was then analysed by qPCR using
570 primers for genomic actin (AGAAAATCTGGCACCACACC; AACGGCAGAAGAGAGAACCA)
571 and K8.1 (AAAGCGTCCAGGCCACCACAGA; GGCAGAAAATGGCACACGGTTAC).
572
573 Co-immunoprecipitation (Co-IP)
574 iSLK.219 cells were transduced with Myc-tagged PROX1 (WT or MUT) lentiviral vectors or an
575 empty pSIN control vector. 24h later cells were reactivated with 0.2 µg/ml doxycycline and one day
576 later cells were lysed in IP buffer (150 mM NaCl, 25 mM tris HCl pH 7,6, 1 mM EDTA, 1% glycerol,
577 0.2% NP-40).
578
34 bioRxiv preprint doi: https://doi.org/10.1101/742932; this version posted August 27, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
579 Pre-cleared lysates were incubated with either mouse monoclonal Myc-tag (1:100) or normal mouse
580 IgG (1:100) antibodies O/N at 4°C with gentle rotation and, subsequently, 30 µl of pre-washed Protein
581 G sepharose beads (ab 193259, Abcam) were added and incubated for 2h at 4°C with gentle rotation.
582 Beads were then washed 3 times in ice-cold IP buffer and the protein complexes analysed by western
583 blot. Experiments were done at least two independent times, representative, cropped blots are shown,
584 uncropped blots are shown in Supplementary Fig.6.
585
586 Chromatin-immunoprecipitation (ChIP)
587 For each ChIP one 10 cm dish of iSLK.219 cells transduced with the vector of interest were used.
588 The experiments were performed using the Simple ChIP enzymatic chromatin IP kit (Cell Signaling
589 Technology, cat# 9003S ). For chromatin IP the following antibodies were used: rabbit polyclonal
590 anti-PROX1 (Cat#11067-2-AP, Proteintech Group), mouse monoclonal anti-Myc (Cat#2276, Cell
591 Signaling Technology), normal mouse or rabbit IgG (sc-2025 and sc-3888, Santa cruz
592 biotechnology), mouse monoclonal anti-HA.11(16B12, BD Pharmingen).
593
594 The experiments were done at least two independent times, Graphs show the average across the
595 different experiments ±SEM (Fig.5) or SD (Fig.6).
596
597 The isolated DNA was amplified with the following primers:
598 ORF50 -620-850 (F;R) gtggtagagccagcagacgttc; tgtagcgccatctctgccc
599 ORF50 -320-610 (F;R) gggtgatttcttctaccacggtcat; ccgagcgtattctcagaggtct
600 ORF50 0-320 (F;R) tggcattttgttgcgcgcatgatc; ccgagcgtattctcagaggtc
601 OriA1 (F;R) ctccccggcaacaacctg; gggggttatatgcgcgtgc
602 OriA2 (F;R) caagcacgcgcatataaccc; gggatatgcttccgcctcat
603 OriA3 (F;R) caccgtgttagtgtcaccca; caccgtgttagtgtcaccca
35 bioRxiv preprint doi: https://doi.org/10.1101/742932; this version posted August 27, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
604 Orilyt1 (F;R) attcaaagggggcacagagg; atgctgggacagaatagccg
605 Orilyt 2 (F;R) tctgtcccagcataggctc; cctgtgcccaaatctgtcct
606 Orilyt 3 (F;R) cacgcgggttgtttgaaagt; ccacttgggtgcacagagat
607 TR1 (F;R) cataaatattccggatacaaggctcg; gactcctcgcacagtagagagag
608 TR2 (F;R) actgacaaacaaaatgcacataacaag; actgacaaacaaaatgcacataacaag
609 TR3 (F;R) gaacatcagggatgggtctatgatc; gataaccctcacctaccatggaaat
610 TR4 (F;R) gataaccctcacctaccatggaaat; agagctacgagtgtcataaatacaaga
611
612 Immunohistochemistry
613 After deparaffinization in xylene and rehydration, for antigen retrieval, sections were treated in a
614 PreTreatment module (Lab Vision Corp., Fremont, CA, USA) in Tris-HCl (pH 8.5) and in Tris-EDTA
615 (pH 9.0) buffer for 20 minutes at 98°C. Sections were stained in an Autostainer 480 (Lab Vision).
616 Tissues were incubated with the indicated antibodies (mouse anti Sox18, 1:100; mouse anti
617 COUPTF2, 1:150; mouse anti K8.1, 1:250) overnight at room temperature. For detection,
618 ImmPRESS HRP Polymer Detection Kit, Peroxidase, (Vector Laboratories, Burlingame, CA, USA)
619 was used.
620 LANA staining was done O/N at 4 °C in humidified chambers using rabbit polyclonal antibody (a
621 kind gift from B. Chandran, University of South Florida) after washing 3 times the slides in PBS-T,
622 sections were stained with goat anti-rabbit Alexa594 conjugated antibody for 1 hour at RT, nuclei
623 were counterstained with Hoechst 33342 (1ug/ml).
624 Samples were imaged in a Panoramic 250 viewer (Genome Biology Unit, Research Programs Unit,
625 University of Helsinki), representative snapshots are shown.
626
627
628
36 bioRxiv preprint doi: https://doi.org/10.1101/742932; this version posted August 27, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
629 RNA-sequencing (RNA-seq)
630 RNA from iSLK.219 cells and KLECs treated as indicated and from 3 independent experiments, was
631 extracted using NucleoSpin RNA extraction kit (Macherey Nagel). Ribosomal RNA (rRNA) was
632 depleted using ribo-zero rRNA removal kit (Illumina) and the quality of the samples was monitored
633 with Bioanalyzer RNA Kit (Agilent). Libraries were prepared using NEB Next Ultra Directional
634 RNA library Prep Kit for Illumina (New England BioLabs) and sequencing was done with NextSeq
635 High Output 1X75bp (75SE).
636 FASTQ data was aligned to the annotated human reference genome hg38 and using STAR 45with the
637 build in gene quantification function. Differential gene expression (DGE) of the quantified genes was
638 performed using DeSeq2 46. Significantly DGE (FDR < 0.1 and log2FoldChange >= +/- 1) were
639 subjected to Kyoto Encyclopedia of Genes and Genomes (KEGG) pathway analysis to identify
640 regulated pathways (FDR < 0.1). Concerning viral gene expression differences FASTQ data was
641 aligned to the rKSHV.219 reference sequence which is identical to BAC16 (Genbank Acc.:
642 GQ994935) using STAR. We inserted the panPromoter-RFP, GFP and PuroR cassette according to
643 the original publication into the reference for analysis 19, since it was not part of the deposited
644 Genbank sequence. Read counting of viral ORFs was performed using FeatureCounts 47. KSHV
645 specific counts were normalized using the estimated size factors generate for the human dataset to
646 correct for sequencing depth-based bias. DGE for KSHV genes was performed using DeSeq2.
647 To detect KSHV- encoded circular RNAs, FASTQ files were aligned using STAR to the human
648 (hg19) + KSHV hybrid genome file. CIRCexplorer2 was used to detect back-spliced junctions in the
649 KSHV genome. All back-spliced junctions were mapped in 200 nucleotide-sized bins and plotted.
650
651 RNA-seq raw data have been deposited in the European nucleotide Archive (ENA) under the ID code:
652 ena-STUDY-UNIVERSITY OF HELSINKI-13-02-2019-22:25:30:309-452 and the accession
653 number: PRJEB31253.
37 bioRxiv preprint doi: https://doi.org/10.1101/742932; this version posted August 27, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
654 Data available at the following URL: http://www.ebi.ac.uk/ena/data/view/PRJEB31253.
655
656
657 RT-qPCR
658 Total RNA was extracted from cells using NucleoSpin RNA extraction kit (Macherey Nagel) and
659 reverse transcribed as described in11 . Transcripts were measured using 2XSYBR reaction mix
660 (Fermentas) and unlabeled primers (F;R) listed below:
661 PROX1 (F;R) TGTTCACCAGCACACCCGCC; TCCTTCCTGCATTGCACTTCCCG;
662 SOX18 (F;R) CTTCATGGTGTGGGCAAAG; GCGTTCAGCTCCTTCCAC;
663 COUPTF2(F;R) GCAAGTGGAGAAGCTCAAGG; TCCACATGGGCTACATCAGA;
664 Actin(F;R) TCACCCACACTGTGCCATCTACGA; TCACCCACACTGTGCCATCTACGA;
665 Orf73(F;R) ACTGAACACACGGACAACGG; CAGGTTCTCCCATCGACGA;
666 Orf50 (F;R) CACAAAAATGGCGCAAGATGA; TGGTAGAGTTGGGCCTTCAGTT;
667 Orf 57 (F;R) TGGACATTATGAAGGGCATCCTA; CGGGTTCGGACAATTGCT;
668 Orf45 (F;R) CCTCGTCGTCTGAAGGTGA; GGGATGGGTTAGTCAGGATG;
669 K8.1 (F;R) AAAGCGTCCAGGCCACCACAGA; GGCAGAAAATGGCACACGGTTAC
670
671 Each sample was measured in triplicate and normalized to the Actin levels. Experiments were done
672 at least two independent times, the graphs show the average and error bars the SD across the
673 experiments.
674
675 Western Blotting and antibodies
676 Cells were lysed in RIPA buffer (150 mM NaCl, 1% Igepal CA630, 0.5% Na deoxycholate, 0.1%
677 SDS, 50 mM Tris-HCl-PH 8.0), supplemented with protease and phosphatase (Pierce™ 88666,
38 bioRxiv preprint doi: https://doi.org/10.1101/742932; this version posted August 27, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
678 88667). After pre-clearing by centrifugation, lysates were mixed with 5X laemli sample buffer and
679 run for 40 min at 55mA on Criterion TGX precast gels (Bio-Rad).
680
681 Transfer on nitrocellulose membrane was done using trans-blot Turbo Transfer system (Bio-Rad).
682 Blocking was performed in 5% non-fat dry milk in TBS-T (0.1% Tween) for 1h RT. Membranes
683 were incubated in primary antibody O/N 4°C (either 5% BSA or non-fat dry milk in TBS-T,
684 according to the primary antibody manufacturer´s recommendation). The following primary
685 antibodies were used: Mouse monoclonal anti- actin (Santa Cruz Biotechnology , sc-8432);
686 Mouse monoclonal anti-gamma-tubulin (Sigma-Aldrich, T6557); Rabbit monoclonal anti-PROX1
687 (Cell Signaling Technology D2J6J); Mouse monoclonal anti SOX18 (D-8) (Santa Cruz
688 Biotechnology, sc-166025); Mouse monoclonal anti COUP-TFII (Perseus Proteomics,PP-
689 H7147-00); Rat monoclonal HHV-8 (LN-35) (Abcam, ab4103) Mouse monoclonal anti KSHV
690 ORF57 (Santa Cruz Biotechnology, sc-135746); Mouse monoclonal anti KSHV ORF45 (Santa
691 Cruz Biotechnology, sc-53883); Mouse monoclonal anti KSHV K8.1 (Santa Cruz Biotechnology
692 sc-65446); Rabbit monoclonal anti GFP (Cell Signaling Technology, 2956); Rabbit polyclonal
693 anti ORF50 ( Kind gift from C. Arias).
694
695 After three rounds of washing in TBS-T, membranes were incubated in the appropriate HRP-
696 conjugated secondary antibody (from Cell Signaling Technology) diluted in blocking solution for
697 4h RT. Luminescent signal was revealed with Wester-Bright Sirius detection Kit (Advansta).
698 Experiments were done at least two independent times, representative experiments are shown.
699 Cropped immunoblots are presented in each figure, the corresponding uncropped membranes are
700 presented in Supplementary Fig.6.
701 The Fiji software (https://imagej.net/Fiji) was used to quantify the intensity of the bands. For each
702 sample, band intensities relative to the corresponding loading control is shown.
39 bioRxiv preprint doi: https://doi.org/10.1101/742932; this version posted August 27, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
703
704 Immunofluorescence
705 2x10^4/ml primary BEC and LEC infected or not with rKSHV.219 were plated on coverslips for 4
706 days. 10^3 iSLK.219 were plated on viewPlate-96 black (6005182, Perkin Elmer) transduced as
707 indicated after 24h and, one day later reactivated with Doxycycline for 24h.
708
709 Coverslips and plates were fixed in 4%PFA 20 min RT, permeabilized (0.3% tritonX in PBS) and
710 stained with Hoechst 33342 (1 µg/ml) 10 min RT. Blocking, washings and antibody incubations were
711 done in 0.5%BSA in PBS. Coverslips were incubated in primary and, after washing, in secondary
712 antibody in humidified chambers for 2h RT and then mounted in Mowiol. Experiments were done at
713 least two independent times. The following antibodies were used: Goat polyclonal anti-PROX1 R&D
714 Systems, AF2727); Mouse monoclonal anti SOX18 (D-8) (Santa Cruz Biotechnology, sc-166025);
715 Mouse monoclonal anti COUP-TFII (Perseus Proteomics,PP-H7147-00); Rabbit polyclonal anti
716 LANA (kind gift from B. Chandran); Mouse monoclonal anti KSHV ORF57 (Santa Cruz
717 Biotechnology, sc-135746); Mouse monoclonal anti KSHV K8.1 (Santa Cruz Biotechnology sc-
718 65446); Rabbit polyclonal anti ORF50 ( a kind gift from C. Arias, University of California, Santa
719 Barbara?). All secondary antibodies were from Thermo Fischer Scientific: Goat anti-Rabbit IgG
720 (H+L) (A-11034); Goat anti-Rabbit IgG (H+L) Highly Cross-Adsorbed (A32733); Goat anti-
721 Mouse IgG (H+L) Cross-Adsorbed (A32728); Goat anti-rat IgG (H+L) Cross-Adsorbed Alexa
722 Fluor 647 (A-21247).
723
724 Coverslips were imaged in Zeiss LSM 780 confocal microscope. Plates were imaged using Thermo
725 Scientific Cell Insight High Content Screening (HCS) system.
726
727
40 bioRxiv preprint doi: https://doi.org/10.1101/742932; this version posted August 27, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
728 Analysis of cell proliferation
729 Cells were maintained for 1 h in media containing 10 µM 5-ethynyl-2'-deoxyuridine (EdU) and fixed
730 in 4% paraformaldehyde in PBS. The EdU-incorporated in the cell DNA was coupled to Alexa Fluor
731 647 as per instructions provided in the Click-iT EdU Alexa Fluor 647 Imaging Kit (Thermo Fischer
732 Scientific). Images were acquired using a CellInsight High Content microscope (Thermo Fischer
733 Scientific).
734
735 The portion of EdU containing cells was quantified using the Cell Profiler software.
736
737 Quantification of virus titers, lytic cells and fluorescent signal intensity
738 The number of positive cells were quantified over the total amount of cells (number of nuclei) using
739 Cell Profiler (http://cellprofiler.org). The graph shows the average of virus titers or positive cells per
740 each condition, error bars indicate SD across at least two experiments. The virus titers were calculated
741 as IU/ml. Average signal intensity was calculated with appropriate cell profiler pipeline, the graph
742 shows the average intensity per condition and the error bars indicates the SD across n>100
743 cells/condition/staining.
744
745 Co-localization was assessed by Pearson´s co-localization coefficient calculated using Coloc2 plug-
746 in in Fiji software package (https://imagej.net/Fiji).
747
748 Statistical analysis
749 Experimental data were plotted and analysed with Prism GraphPad versions 7 and 8. Unless
750 differently stated in the legend, the graphs show the single values of each biological replicate (for
751 n<20), the mean and the error bars indicate the SD across the biological replicates.
41 bioRxiv preprint doi: https://doi.org/10.1101/742932; this version posted August 27, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
752 Ordinary one-way Anova followed by Dunnett´s correction for multiple comparisons or or by two-
753 tailed paired t-test were performed to assess the statistical significance of the differences between the
754 different treatments and the control sample. The significance is shown in the Figures as follows: *:
755 p<0.033; **: p<0.02, ***: p<0.001. Exact P values are indicated in the appropriate graphs or in the
756 Supplementary Table3.
757
758 Data availability
759 The data that support the findings of this study are available from the corresponding author upon
760 reasonable request.
761
762 RNA-seq raw data have been deposited in the European nucleotide Archive (ENA) under the ID code:
763 ena-STUDY-UNIVERSITY OF HELSINKI-13-02-2019-22:25:30:309-452 and the accession
764 number: PRJEB31253.
765 Data available at the following URL: http://www.ebi.ac.uk/ena/data/view/PRJEB31253.
766
767 SUPPLEMENTARY MATERIAL
768 Supplementary Figures 1-6.
769 Supplementary Tables 1-3.
770
771
772
42 bioRxiv preprint doi: https://doi.org/10.1101/742932; this version posted August 27, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
773 ACKNOWLEDGEMENTS
774
775 We are grateful to Paul Farrell for critical comments on the manuscript and to Takanobu Takawa for
776 the technical support in the detection of Kcirc RNAs. We thank the Biomedicum Imaging Unit (BIU)
777 and Genome Biology Unit (GBU) at the University of Helsinki for support in imaging as well as the
778 Functional Genomic Unit (FuGU, University of Helsinki) for technical support during the RNA-seq.
779 Dr. Justin Weir (Imperial College Healthcare NHS Trust) is acknowledged for kindly providing the
780 KS biopsies. We are also extremely grateful to Nadezhda Zinovkina and Pia Foxell (University of
781 Helsinki) for the valuable technical help. Bala Chandran (University of South Florida) and Carolina
782 Arias (University of California Santa Barbara) are thanked for antibodies to LANA and ORF50,
783 respectively.
784
785 The study was supported by the Academy of Finland Centre of Excellence grant (Translational
786 Cancer Biology; PMO) and the Academy of Finland postdoctoral researcher grant (SG), Finnish
787 Cancer Foundations (P.M.O) and Sigrid Juselius Foundation (P.M.O.).
788
789 AUTHOR CONTRIBUTIONS
790 Conceptualization: SG, EE, PMO; Methodology: SG, EE; Validation: SG, KT; Formal Analysis: SG,
791 EE, KT, TG; Investigation: SG, KT, VN, TG, REK, RD; Resources: SPK, MB, CH, MF; Data
792 Curation: SG, TG, AG ; Writing- Original Draft: SG, PMO; Writing- Review & editing: SG, EE, AG,
793 JMZ, MB, MF, PMO; Visualization: SG, PMO; Supervision: SG, PMO; Project Administration:
794 PMO; Funding Acquisition: SG, PMO.
795
796 DECLARATION OF INTERESTS
797 The authors declare no conflicts of interest.
43 bioRxiv preprint doi: https://doi.org/10.1101/742932; this version posted August 27, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
798 REFERENCES
799
800 1 Gramolelli, S. & Schulz, T. F. The role of Kaposi sarcoma-associated herpesvirus in the
801 pathogenesis of Kaposi sarcoma. J Pathol 235, 368-380, doi:10.1002/path.4441 (2015).
802 2 Ojala, P. M. & Schulz, T. F. Manipulation of endothelial cells by KSHV: implications for
803 angiogenesis and aberrant vascular differentiation. Semin Cancer Biol 26, 69-77,
804 doi:10.1016/j.semcancer.2014.01.008 (2014).
805 3 Gramolelli, S. & Ojala, P. M. Kaposi's sarcoma herpesvirus-induced endothelial cell
806 reprogramming supports viral persistence and contributes to Kaposi's sarcoma
807 tumorigenesis. Curr Opin Virol 26, 156-162, doi:10.1016/j.coviro.2017.09.002 (2017).
808 4 Li, Y. et al. Evidence for Kaposi Sarcoma Originating from Mesenchymal Stem Cell through
809 KSHV-induced Mesenchymal-to-Endothelial Transition. Cancer Res 78, 230-245,
810 doi:10.1158/0008-5472.CAN-17-1961 (2018).
811 5 Chang, H. H. & Ganem, D. A unique herpesviral transcriptional program in KSHV-infected
812 lymphatic endothelial cells leads to mTORC1 activation and rapamycin sensitivity. Cell Host
813 Microbe 13, 429-440, doi:10.1016/j.chom.2013.03.009 (2013).
814 6 Yogev, O. & Boshoff, C. Redefining KSHV latency. Cell Host Microbe 13, 373-374,
815 doi:10.1016/j.chom.2013.04.003 (2013).
816 7 Cheng, F. et al. KSHV-initiated notch activation leads to membrane-type-1 matrix
817 metalloproteinase-dependent lymphatic endothelial-to-mesenchymal transition. Cell Host
818 Microbe 10, 577-590, doi:10.1016/j.chom.2011.10.011 (2011).
819 8 Golas, G., Alonso, J. D. & Toth, Z. Characterization of de novo lytic infection of dermal
820 lymphatic microvascular endothelial cells by Kaposi's sarcoma-associated herpesvirus.
821 Virology 536, 27-31, doi:10.1016/j.virol.2019.07.028 (2019).
44 bioRxiv preprint doi: https://doi.org/10.1101/742932; this version posted August 27, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
822 9 Francois, M. et al. Sox18 induces development of the lymphatic vasculature in mice. Nature
823 456, 643-647, doi:10.1038/nature07391 (2008).
824 10 Srinivasan, R. S. et al. The nuclear hormone receptor Coup-TFII is required for the initiation
825 and early maintenance of Prox1 expression in lymphatic endothelial cells. Genes Dev 24, 696-
826 707, doi:10.1101/gad.1859310 (2010).
827 11 Gramolelli, S. et al. PROX1 is a transcriptional regulator of MMP14. Sci Rep 8, 9531,
828 doi:10.1038/s41598-018-27739-w (2018).
829 12 Hong, Y. K. et al. Lymphatic reprogramming of blood vascular endothelium by Kaposi
830 sarcoma-associated herpesvirus. Nat Genet 36, 683-685, doi:10.1038/ng1383 (2004).
831 13 Miettinen, M. & Wang, Z. F. Prox1 transcription factor as a marker for vascular tumors-
832 evaluation of 314 vascular endothelial and 1086 nonvascular tumors. Am J Surg Pathol 36,
833 351-359, doi:10.1097/PAS.0b013e318236c312 (2012).
834 14 Yoo, J. et al. Opposing regulation of PROX1 by interleukin-3 receptor and NOTCH directs
835 differential host cell fate reprogramming by Kaposi sarcoma herpes virus. PLoS Pathog 8,
836 e1002770, doi:10.1371/journal.ppat.1002770 (2012).
837 15 Rose, T. M. et al. Quantitative RNAseq analysis of Ugandan KS tumors reveals KSHV gene
838 expression dominated by transcription from the LTd downstream latency promoter. PLoS
839 Pathog 14, e1007441, doi:10.1371/journal.ppat.1007441 (2018).
840 16 Cancian, L., Hansen, A. & Boshoff, C. Cellular origin of Kaposi's sarcoma and Kaposi's
841 sarcoma-associated herpesvirus-induced cell reprogramming. Trends Cell Biol 23, 421-432,
842 doi:10.1016/j.tcb.2013.04.001 (2013).
843 17 Wang, H. W. et al. Kaposi sarcoma herpesvirus-induced cellular reprogramming contributes
844 to the lymphatic endothelial gene expression in Kaposi sarcoma. Nat Genet 36, 687-693,
845 doi:10.1038/ng1384 (2004).
45 bioRxiv preprint doi: https://doi.org/10.1101/742932; this version posted August 27, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
846 18 Carroll, P. A., Brazeau, E. & Lagunoff, M. Kaposi's sarcoma-associated herpesvirus infection
847 of blood endothelial cells induces lymphatic differentiation. Virology 328, 7-18,
848 doi:10.1016/j.virol.2004.07.008 (2004).
849 19 Vieira, J. & O'Hearn, P. M. Use of the red fluorescent protein as a marker of Kaposi's sarcoma-
850 associated herpesvirus lytic gene expression. Virology 325, 225-240,
851 doi:10.1016/j.virol.2004.03.049 (2004).
852 20 Fontaine, F. et al. Small-Molecule Inhibitors of the SOX18 Transcription Factor. Cell Chem
853 Biol 24, 346-359, doi:10.1016/j.chembiol.2017.01.003 (2017).
854 21 Moustaqil, M. et al. Homodimerization regulates an endothelial specific signature of the
855 SOX18 transcription factor. Nucleic Acids Res 46, 11381-11395, doi:10.1093/nar/gky897
856 (2018).
857 22 Overman, J. et al. Pharmacological targeting of the transcription factor SOX18 delays breast
858 cancer in mice. Elife 6, doi:10.7554/eLife.21221 (2017).
859 23 Overman, J. et al. R-propranolol is a small molecule inhibitor of the SOX18 transcription
860 factor in a rare vascular syndrome and hemangioma. Elife 8, doi:10.7554/eLife.43026 (2019).
861 24 McAllister, S. C., Hanson, R. S. & Manion, R. D. Propranolol Decreases Proliferation of
862 Endothelial Cells Transformed by Kaposi's Sarcoma-Associated Herpesvirus and Induces Lytic
863 Viral Gene Expression. J Virol 89, 11144-11149, doi:10.1128/JVI.01569-15 (2015).
864 25 Myoung, J. & Ganem, D. Generation of a doxycycline-inducible KSHV producer cell line of
865 endothelial origin: maintenance of tight latency with efficient reactivation upon induction. J
866 Virol Methods 174, 12-21, doi:10.1016/j.jviromet.2011.03.012 (2011).
867 26 Verma, S. C., Lan, K., Choudhuri, T., Cotter, M. A. & Robertson, E. S. An autonomous
868 replicating element within the KSHV genome. Cell Host Microbe 2, 106-118,
869 doi:10.1016/j.chom.2007.07.002 (2007).
46 bioRxiv preprint doi: https://doi.org/10.1101/742932; this version posted August 27, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
870 27 Verma, S. C. et al. Single molecule analysis of replicated DNA reveals the usage of multiple
871 KSHV genome regions for latent replication. PLoS Pathog 7, e1002365,
872 doi:10.1371/journal.ppat.1002365 (2011).
873 28 Chen, J., Ye, F., Xie, J., Kuhne, K. & Gao, S. J. Genome-wide identification of binding sites for
874 Kaposi's sarcoma-associated herpesvirus lytic switch protein, RTA. Virology 386, 290-302,
875 doi:10.1016/j.virol.2009.01.031 (2009).
876 29 Tagawa, T. et al. Discovery of Kaposi's sarcoma herpesvirus-encoded circular RNAs and a
877 human antiviral circular RNA. Proc Natl Acad Sci U S A 115, 12805-12810,
878 doi:10.1073/pnas.1816183115 (2018).
879 30 Toptan, T. et al. Circular DNA tumor viruses make circular RNAs. Proc Natl Acad Sci U S A 115,
880 E8737-E8745, doi:10.1073/pnas.1811728115 (2018).
881 31 Petrova, T. V. et al. Lymphatic endothelial reprogramming of vascular endothelial cells by
882 the Prox-1 homeobox transcription factor. EMBO J 21, 4593-4599 (2002).
883 32 Baquero-Perez, B. & Whitehouse, A. Hsp70 Isoforms Are Essential for the Formation of
884 Kaposi's Sarcoma-Associated Herpesvirus Replication and Transcription Compartments.
885 PLoS Pathog 11, e1005274, doi:10.1371/journal.ppat.1005274 (2015).
886 33 Schmid, M., Speiseder, T., Dobner, T. & Gonzalez, R. A. DNA virus replication compartments.
887 J Virol 88, 1404-1420, doi:10.1128/JVI.02046-13 (2014).
888 34 Francois, M., Harvey, N. L. & Hogan, B. M. The transcriptional control of lymphatic vascular
889 development. Physiology (Bethesda) 26, 146-155, doi:10.1152/physiol.00053.2010 (2011).
890 35 Olbromski, M., Podhorska-Okolow, M. & Dziegiel, P. Role of the SOX18 protein in neoplastic
891 processes. Oncol Lett 16, 1383-1389, doi:10.3892/ol.2018.8819 (2018).
892 36 Stensrud, P. & Sjaastad, O. Short-term clinical trial of phopranolol in racemic form (Inderal),
893 D-propranolol and placebo in migraine. Acta Neurol Scand 53, 229-232 (1976).
47 bioRxiv preprint doi: https://doi.org/10.1101/742932; this version posted August 27, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
894 37 Abere, B. et al. The Kaposi's sarcoma-associated herpesvirus (KSHV) non-structural
895 membrane protein K15 is required for viral lytic replication and may represent a therapeutic
896 target. PLoS Pathog 13, e1006639, doi:10.1371/journal.ppat.1006639 (2017).
897 38 Pantanowitz, L., Moses, A. V. & Fruh, K. CD31 immunohistochemical staining in Kaposi
898 Sarcoma. Arch Pathol Lab Med 136, 1329; author reply 1330, doi:10.5858/arpa.2012-0153-
899 LE (2012).
900 39 Barillari, G. et al. Inflammatory cytokines synergize with the HIV-1 Tat protein to promote
901 angiogenesis and Kaposi's sarcoma via induction of basic fibroblast growth factor and the
902 alpha v beta 3 integrin. J Immunol 163, 1929-1935 (1999).
903 40 Biberfeld, P., Ensoli, B., Sturzl, M. & Schulz, T. F. Kaposi sarcoma-associated
904 herpesvirus/human herpesvirus 8, cytokines, growth factors and HIV in pathogenesis of
905 Kaposi's sarcoma. Curr Opin Infect Dis 11, 97-105 (1998).
906 41 Chiu, Y. F., Sugden, A. U., Fox, K., Hayes, M. & Sugden, B. Kaposi's sarcoma-associated
907 herpesvirus stably clusters its genomes across generations to maintain itself
908 extrachromosomally. J Cell Biol 216, 2745-2758, doi:10.1083/jcb.201702013 (2017).
909 42 Grundhoff, A. & Ganem, D. Inefficient establishment of KSHV latency suggests an additional
910 role for continued lytic replication in Kaposi sarcoma pathogenesis. J Clin Invest 113, 124-
911 136, doi:10.1172/JCI17803 (2004).
912 43 Nakamura, H. et al. Global changes in Kaposi's sarcoma-associated virus gene expression
913 patterns following expression of a tetracycline-inducible Rta transactivator. J Virol 77, 4205-
914 4220, doi:10.1128/jvi.77.7.4205-4220.2003 (2003).
915 44 Deng, H., Young, A. & Sun, R. Auto-activation of the rta gene of human herpesvirus-
916 8/Kaposi's sarcoma-associated herpesvirus. J Gen Virol 81, 3043-3048, doi:10.1099/0022-
917 1317-81-12-3043 (2000).
48 bioRxiv preprint doi: https://doi.org/10.1101/742932; this version posted August 27, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.
918 45 Dobin, A. et al. STAR: ultrafast universal RNA-seq aligner. Bioinformatics 29, 15-21,
919 doi:10.1093/bioinformatics/bts635 (2013).
920 46 Love, M. I., Huber, W. & Anders, S. Moderated estimation of fold change and dispersion for
921 RNA-seq data with DESeq2. Genome Biol 15, 550, doi:10.1186/s13059-014-0550-8 (2014).
922 47 Liao, Y., Smyth, G. K. & Shi, W. featureCounts: an efficient general purpose program for
923 assigning sequence reads to genomic features. Bioinformatics 30, 923-930,
924 doi:10.1093/bioinformatics/btt656 (2014).
925
926
49