Functional Analysis of Meloidogyne Graminicola C-Type Lectins and Their Role in the Nematode – Rice Interaction

University of Ghent Faculty of Science Department of Biology

Academic year 2013 – 2015

Functional Analysis of Meloidogyne graminicola C-type Lectins and their Role in the Nematode – Rice Interaction

Romnick Latina

Promotor: Prof. Dr. Godelieve Gheysen Thesis submitted to obtain the degree Supervisor: Silke Nowak of Master of Science in Nematology

Functional analysis of Meloidogyne graminicola C-type lectins and their role in the nematode – rice interaction Romnick LATINA Faculty of Science, Department of Biology, Ghent University, K.L. Ledeganckstraat 35, B-9000 Ghent, Belgium Summary – Due to rice cropping intensification and increasing water scarcity, Meloidogyne graminicola has become a threat to rice production. With the aid of molecular tools and techniques, the host-nematode interaction has long been studied in the hope of finding control measures for this ominous rice root-knot nematode. In many investigations, proteins termed as effectors have been shown to mediate mechanisms and processes essential for pathogenesis of plant parasitic nematodes. Many of these effectors have been identified to unravel their functional roles. In this present work, two putative effector genes (UK41 and UK42) coding C-type lectins were investigated to know their roles in the M. graminicola - rice interaction. To gain some insights on their action site, eGFP fusion constructs were transiently expressed in N. benthamiana. Subcellular localizations revealed that UK41 localized to both the cytoplasm and nucleus while UK42 showed strong nuclear localization. To check their effect on host defenses, ETI and PTI assays were performed using transient expression in tobacco plants. Based on the R/Avr-gene pairs tested, both C-type lectins were found to be non-suppressive of the ETI. Transient assay using the PAMP, INF1, also indicated non-suppression of PTI. However, ROS production as a result of flg22- triggered PTI was found to be affected by both lectin genes. The oxidative burst in tobacco leaves was found to be delayed in the presence of both C-type lectins. Since there were some variabilities using the parameter maximum peak or oxidative burst, the new parameter, rate of reaction, was utilized. This parameter revealed that UK41 and UK42-treated leaves had lower reaction rates similar to MP10-treated leaves reflective of suppressed ROS production. These results suggest a role for C-type lectins in the M. graminicola and rice interaction. For future research, the nematode effector genes were transformed into rice and in the course of my MSc thesis, the transformed lines were studied for the presence and expression of the transgenes. Differential expression was found in both UK41 and UK42 transformed rice plants although in general, UK42 transformants had higher gene expression.

Keywords – M. graminicola, C-type lectins, confocal microscopy, ROS assay, oxidative burst, flg22, qPCR, effector

The rice root-knot nematode, Meloidogyne graminicola, has been one of the most economically and globally important plant-parasitic nematodes. This species was first described in 1965 by Golden and Birchfield from grasses and oats in Louisiana. Since then, it has been found infecting primarily upland, irrigated and deep-water rice planted in South and Southeast Asia, China, South Africa, United States of America, Colombia and Brazil. M. graminicola is well- adapted to flooded conditions and can survive as eggs in egg masses or as juveniles in waterlogged conditions for a long time, particularly in rice remnants and it can remain viable for 14 months. It prefers 20-30% soil moisture, and thrives in dry soils during the tillering and panicle initiation of the rice plant (Dutta et al., 2012; Prot & Matias, 1995). In India, this nematode is more prevalent in dry nursery beds than in wet beds (Dongre & Simon, 2013) while in Myanmar, the population density of second stage juveniles in irrigated lowland fields is higher during summer compared to the rainfed season (Win et al., 2013).

Meloidogyne graminicola has a very short life cycle that can be completed in 15 days at 27-37°C (Jaiswal & Singh, 2010). The swollen female lays her eggs in masses within the root cortex and juveniles hatch from the eggs. The infective juveniles (J2) remain in the maternal gall or migrate in the same root allowing them to multiply even under flooded conditions. In flooded conditions, these nematodes cannot invade rice plants but they can quickly resume their invasion when fields are drained by attacking behind the root tip. They can also thrive in some common rice field weeds such as Echinocloa, Cyperus and Panicum (Bridge & Starr, 2007). They use their stylet to penetrate the root cells, inject secretions and extract cell nutrients. After penetration inside the roots, they migrate in between the cortex cells to the region of cell differentiation. This intercellular movement causes the separation of the cells along the middle lamella. The J2 nematodes move towards the root tip and turn around when they reach the apical meristems to overcome the barrier formed by the endodermis and move back to the zone of differentiation. At this zone, they become sessile and start to swell with their head feeding on the protoxylem and protophloem cells. This is also where they induce the development of giant cells as part of their permanent feeding site (Karssen et al., 2013).

In recent years, the complex interaction of plant-parasitic nematodes including M. graminicola with their host plants has been scrutinized. Since the discovery of the first ‘parasitism gene’ isolated from Globodera rostochiensis and Heterodera glycines and encoding β-1,4-

endoglucanase that degrades cellulose in plant cell walls during migration (Smant et al., 1998), other genes encoding for proteins termed as ‘effectors’ that are involved in nematode parasitism have been unearthed and studied (Haegeman et al, 2013). Most of these effectors have roles in migration and penetration such as expansins, (Qin et al., 2004), arabinogalactan endo-1,4-beta- galactosidase (Vanholme et al., 2009) and pectate lyase (Kudla et al., 2007), plant defense suppression such as SPRYSECs from G. pallida (secreted SPla and the RYanodine Receptor- containing proteins) (Postma et al., 2012) and Hs10A06 from H. schachtii (Hewezi et al., 2010), nematode protection like the GSTs or glutathione-S-transferases from M. incognita (Dubreuil et al., 2007) and feeding site maintenance and induction such as the 19CO7 from H. schachtii (Lee et al., 2011) and Hg-eng-1 from H. glycines (Bakhetia et al., 2007).

In the M. graminicola J2 transcriptome, Haegeman et al. (2013) identified several putative effectors that are functional during early parasitism. The presence of signal peptides combined with the absence of a transmembrane domain is an identifier of a secreted protein and was considered in the analysis. These putative efffectors include homologues of plant cell wall- modifying enzymes such as expansins and pectate lyase, secreted proteins for detoxification, fatty acid and retinol-binding protein, annexin, calreticulin, chitinase, transthyretin-like protein, mitogen-activated protein (MAP-1), galectin, C-type lectins (CTLs) etc. In-situ hybridization of these putative effectors revealed their expression in the amphids, dorsal glands and subventral glands. Among these putative effector proteins, C-type lectins have been found abundantly not just in M. graminicola but in other nematodes as well. These types of lectins are calcium-dependent and previously known to be just carbohydrate-binding animal proteins. However, evolutionary studies have revealed that many CTL domains (CTLDs) have evolved to specifically recognize protein, lipid and inorganic ligands as well (Zelensky & Gready, 2005). Generally, CTLDS function in adhesion and pathogen recognition and phagocytosis (Cambi & Figdor, 2003). In the genome of the model organism, C. elegans, 278 CTLDs containing proteins were found. Some of these genes (61 genes or 22% of all CTLD proteins) are found to be upregulated in the presence of a pathogen and 45 of these have a signal sequence. These secreted pathogen-induced proteins were proposed to contribute not only to pathogen recognition but are also involved in antigen- antibody interaction or possess antimicrobial activity (Schulenberg et al., 2008). CTLs have also been found in the gastrointestinal nematode parasites Heligmosomoides polygyrus,

Nippostrongylus brasiliensis (Harcus et al., 2009), Ancylostoma ceylanicum (Brown et al., 2007) and Toxocara canis (Loukas et al., 1999). In M. chitwoodi, the nematode secretome was found to have a CTL domain which is homologous to CTLs found in snake venoms (Roze et al., 2008). Very recent studies demonstrated that also in the reniform nematode, Rotylenchulus reniformis, the transcriptome of parasitic females has sequences homologous to CTLs (Ganji et al., 2014) and in G. pallida, the transcriptome of J2 nematodes contains CTL domains (Cotton et al., 2014). Even though it has always been implicated that CTLs play an important role in the immune system and parasitism of nematodes, there is no direct evidence yet on their function in plant- nematode interactions. The fact that these CTLs in M. graminicola contain signal peptides without a transmembrane domain, are found in the subventral glands of J2 nematodes and are upregulated in J2, is very suggestive of their involvement in nematode parasitism. Hence, this study was designed to identify the function of M. graminicola C-type lectins in rice-nematode interaction through their subcellular localization, and role in plant defense suppression.

Materials and methods

GATEWAY® CLONING WORK FLOW

MAKING ATTB-FLANKED AMPLICONS THROUGH POLYMERASE CHAIN REACTION (PCR) Clones containing M. graminicola effector genes identified as C-type lectins (UK41 and UK42) were made available in the vector pGEM-T with or without signal peptides (SP). Two subsequent standard PCRs were performed using the BIO-RAD T100TM thermal cycler (Singapore) for the amplification of the fragments with or without signal peptides. For the initial PCR, 1 µl of the plasmid (1:50 dilution) was mixed with 1 µl dNTPs (5 mM), 1 µl forward and reverse UK41 and UK42-gene specific with part of attb primers (see Table 1), 0.5 µl Taq DNA polymerase, 3 µl 10x PCR buffer (MgCl2 included) and 22.5 µl distilled water. The second PCR was carried out using 3 µl of the PCR1 amplicons mixed with 1 µl dNTPs (5 mM), forward attb and reverse attb primers, 0.5 µl Taq DNA polymerase, 3 µl 10x PCR buffer (MgCl2 included) and 20.5 µl distilled water. The PCR conditions for both were as follows; initial denaturation under 95°C for 10 min, 5 cycles of 94°C for 15 sec (denaturation step), 45°C for 25 sec (annealing) and 72°C for 1 min 30 sec (extension) and 15 cycles consist of 94°C for 15 sec, 54°C for 25 sec and 72°C for 1 min 30 sec. The amplicons were resolved in a 1.5 % agarose gel for 23 minutes under 135 volts.

Table 1. Primer pairs used for this study Primers Sequences UK41 with SP + attB_F 5’- aaaaagcaggcttcATGTCTTTAATTTCTTTTAT -3’ UK41 with SP + attB_R 5’- agaaagctgggtgAATATCCTGAGCAG -3’ UK42 with SP + attB_F 5’- aaaaagcaggcttcATGAATTTTCTCGCTAATTT -3’ UK42 with SP + attB_R 5’- agaaagctgggtgTGCTGAACAGTCC - 3’ UK41 w/o SP + attB_F 5’- aaaaagcaggcttcATGCAAAAAGTACCAAAC-3’ UK41 w/o SP + attB_R 5’- agaaagctgggtgAATATCCTGAGCAG -3’ UK42 w/o SP + attB_F 5’- aaaaagcaggcttcATGGACTGTTCAGATGATTG -3’ UK42 w/o SP + attB_R 5’- agaaagctgggtgTGCTGAACAGTCC -3’ attB1 5’- ACAAGTTTGTACAAAAAAGCA -3’ attB2 5’- CCACTTTGTACAAGAAAGCT -3’ EXP_F 5’- TGTGAGCAGCTTCTCGTTTG -3’ EXP_R 5’- TGTTGTTGCCTGTGAGATCG -3’ EXP-Narcai_F 5’- AGGAACATGGAGAAGAACAAGG -3’ EXP-Narcai_R 5’- CAGAGGTGGTGCAGATGAAA -3’ EIF5C_F 5’- CACGTTACGGTGACACCTTTT -3’ EIF5C_R 5’- GACGCTCTCCTTCTTCCTCAG -3’ *nucleotides in red are partial sequences of attb regions

BP REACTION In a 1.5 ml microcentrifuge tube, 2 µl of attB-PCR products from PCR 2 and 2 µl of pDONR™ 221 (Fig. 1) were mixed at room temperature. 1 µl of ice-thawed BP ClonaseTM II enzyme mix was then added to the tubes and mixed briefly. The tubes were incubated at 25° C overnight. These entry clones were introduced to heat-shock (HS) competent Escherichia coli (Invitrogen OneShot® TOP10, California). Tubes containing 50 µl HS competent E. coli TOP10 cells were thawed on ice and 4 µl of the ligation mix was added in. The cells were then incubated on ice for 30 minutes and subjected to heat-shock at 42 °C for 45 seconds. The tubes were then put on ice for 1 minute then 300 µl of LB medium was added. The cell mixture was incubated for one hour at 25 °C. The bacterial cultures were then streaked on LB plates containing kanamycin (100 μg/ml) and grown overnight at 37 °C. Randomly selected single colonies that grew were picked up for colony PCR using attb primers and re-streaked on kanamycin-treated plates and grown overnight at 37°C. Colony PCR amplification is carried out by using 35 cycles of denaturation (35 seconds at 95°), annealing (35 seconds at 54 °C ) and extension (1 minute at 72 °C ) and was resolved by gel electrophoresis. The master mix for a sample contains 3 µl of 10x

PCR buffer (MgCl included), 0.5 µl of dNTPs, forward (attB1) and reverse (attB2) primers, 15.4 µl of distilled water and 0.1 µl Taq DNA polymerase. Colonies with amplicons corresponding to the specific size of the genes were grown in 5 ml of LB broth with the same concentration of kanamycin under shaking conditions and purified according to the protocol of GeneJet Plasmid Miniprep Kit (ThermoScientific, Lithuania). The concentration of each purified sample was measured using a NanoDrop® ND-1000 Spectrophotometer (ThermoScientific). 100 ng of each DNA were prepared and sent to LGC Genomics for sequencing. To distinguish vector sequences and DNA sequence, the program Vecscreen was used. Alignment of the sample sequence and the known sequence was checked using BLAST. In cases where there were very few nucleotide differences (97-99%), DNA sequences were translated using the program Expasy translate and subsequently subjected to protein alignment in BLAST. Those with 100% correct corresponding DNA/protein sequence were processed for glycerol stocks prepared through mixing 750 µl of the culture with 50% of sterile glycerol and stored at –80°C.

Fig 1. pDONR™ vector map (Lifetechnologies, 2003)

LR REACTION An LR Gateway® recombination reaction was done to create expression clones of C- (pK7FWG2) and N- terminal eGFP fusions (pK7WGF2) (Fig. 2) of UK41 and UK42 effector genes. Two µl of the entry clones (UK41 and UK42 with or without signal peptides in pDONR) was mixed with the destination vectors and 1 µl of LR clonase was added. The reactions were incubated overnight at 25°C. The ligation mixes were then incorporated to E. coli TOP10 cells by

heat-shock and the cells were grown in LB medium for one hour at 37°C in shaking conditions. The mixture was then streaked onto LB plates containing spectinomycin and grown overnight with the same temperature. Randomly selected single colonies were picked up for colony PCR using attb primers and re-streaked on spectinomycin-containing plates and grown overnight at 37°C. Colonies with amplicons corresponding to the specific size of the genes were grown in 5 ml of LB broth with the same concentration of spectinomycin. 750 µl of the bacterial culture was mixed with 50% of sterile glycerol and stored as stock at –80°C. Plasmid DNA isolation and quantification were done as described above and DNA samples were sent for sequencing.

Fig 2. Vector Map and some descriptions of pK7WGF2.0 (N-terminal eGFP-fusion) and pK7FWG2.0 (C-terminal eGFP fusion). (Heven Sze Lab, 2007)

TRANSFORMATION OF AGROBACTERIUM TUMEFACIENS GV3101

PREPARATION OF HEAT-SHOCK COMPETENT CELLS Stock cultures of A. tumefaciens cells were first grown overnight in 5 ml of LB Broth containing gentamycin (50 μg/ml) at 28°C. Two ml of this overnight culture was added to 50 ml of LB medium with the same concentration of gentamycin in a sterile 250 ml flask. The culture was grown at 28°C under shaking conditions until optical density (OD600) of 0.6 was reached. The determination of OD600 was carried out using SmartSpec™ PLUS spectrophotometer (BIORAD, USA). The culture was then transferred to a sterile 50 ml falcon tube and was chilled on ice for 5 min, after which the tube was centrifuged at 3,000 g for 5 min at 4°C. The supernatant was poured off and the bacterial pellet was resuspended in 1 ml of ice-cold sterile 20 mM CaCl2. This rinsing was repeated thrice. Finally, the cells were dispensed into 100 μl aliquots in pre- chilled 1.5 microcentrifuge tubes. Afterwards, these tubes were frozen in liquid nitrogen and stored at –80°C.

HEAT-SHOCKING 1.5 ml microcentrifuge tubes, containing competent A. tumefaciens GV3101 cells, were thawed on ice. 1 μg of purified plasmid DNA for each expression clone was added to the cells and the mixture was flash-frozen in liquid nitrogen. Immediately afterwards, the frozen mixture was thawed in a 37°C water bath for 5 min. 1 ml of LB medium was added and the tubes were shaken at 25°C for 2 h. The cultures were then centrifuged at maximum speed for 30 sec. The supernatant was removed and bacterial pellet was resuspended in approximately 100 μl of left-over liquid. The bacteria was surface-plated onto LB Agar plates containing both spectinomycin (100 μg/ml) and gentamicin (50 μg/ml) and incubated at 28°C for 2-3 days. The colonies that grew after incubation were checked by colony PCR with the same profile as described above. The resulting amplicons were run on a 1.5% agarose gel. Positive cultures were also grown in liquid LB with proper antibiotics for 2 days at 28 °C under shaking conditions. Glycerol stocks were then prepared from these cultures.

AGROBACTERIUM TUMEFACIENS-MEDIATED TRANSIENT EXPRESSION OF EFFECTOR CONSTRUCTS IN NICOTIANA BENTHAMIANA LEAVES

SUBCELLULAR LOCALIZATION A. tumefaciens GV3101-containing effector fusion constructs (in the pK7FWG2 and pK7WGF2 vectors) were initially grown in liquid LB with proper antibiotics, gentamicin (50 μg/ml) plus spectinomycin (100 μg/ml), under shaking conditions at 28°C overnight. The bacterial suspensions were pelleted by centrifugation at 3000 rpm for 10 minutes at 4°C. The supernatant was decanted and the bacterial cells are resuspended in 5 ml infiltration buffer (1M MgCl2, 0.5M 2-N-morpholinoethanesulphonic acid (MES), pH 5.6, 0.1M acetosyringone). The optical density

(OD600) readings of each suspension (100 μL suspension diluted in 900 μL infiltration buffer) was measured and the final OD600 was adjusted to 0.6 and 1.5. The cultures were incubated in the dark for 2-3 hours prior to infiltration. On the abaxial side of tobacco leaves, the bacterial suspensions were inoculated by initially puncturing the leaves with a needle and then delivering the suspension by a sterile needleless syringe. The tobacco plants were incubated under room conditions and leaf samples were harvested at 48 h post inoculation. Infiltrated leaf sections were mounted in water and the GFP fluorescence was visualized at an excitation wavelength of 488 nm, with emission collected between 510 and 550 nm on a Nikon A1R inverted confocal microscope.

EFFECTOR/PAMP-TRIGGERED IMMUNITY (ETI/PTI) ASSAY

UK41 and UK42 effector constructs carried by A. tumefaciens GV3101 (in the vector pK7WG2) were initially grown in liquid LB with proper antibiotics under shaking condition at 28 °C overnight. The bacterial suspensions were pelleted by centrifugation at 3000 rpm for 10 minutes at 4 °C. The supernatant was decanted and the bacterial cells were resuspended in 5 ml infiltration buffer. The optical density (OD600) readings of each suspension (100 μL suspension diluted in 900 μL infiltration buffer) was measured and the final OD600 was adjusted to 0.6 and 1.5. The cultures were incubated in the dark for 2-3 hours. The following mixes were prepared prior to infiltration:

1:1:1 AVR gene + R gene + UK41 1:1:1 AVR gene + R gene + UK42 1:1:1 AVR gene + R gene + GFP 1:1:1 AVR gene + R gene + Empty A. tumefaciens 1:1 UK41 + infiltration buffer

1:1 UK42 + infiltration buffer 1:1 R gene + infiltration buffer 1:1 Avr gene + infiltration buffer 1:1 GFP/Empty + infiltration buffer

The abaxial side of four leaves of 4-week-old Nicotiana benthamiana plants were infiltrated with the above listed mixes. The infiltrated plants are kept in room temperature and hypersensitivity response (HR) was observed 2-4 days after infiltration. The HR was scored by giving 1 if the localized cell death covered 50-100% of the spot of infiltration and 0 if it has less than 50 % to no HR response.

REACTIVE OXYGEN SPECIES DETERMINATION (ROS ASSAY) UK41 and UK42 constructs with SP, MP10 constructs (effector from Myzus persicae known to suppress flg22-induced PTI based on the study of Bos et al., 2010) and free eGFP- construct in the vector pK7WG2 were transiently expressed in N. benthamiana leaves using A. tumefaciens. Initially, the bacterial cultures were grown overnight, pelleted through centrifugation and diluted with the infiltration buffer. The bacterial suspensions with an OD600nm of 0.3 were spot-inoculated on the abaxial side of the leaves. After 30 hours post-inoculation, leaf discs were collected using a cork borer (size no. 2) and floated on milliQ water overnight in 96-well microtitre plates (16 replicates per construct sampled from 8 different plants). For each well, the water is replaced by 100 μl of the reaction mix (for each 1 ml of milliQ water, there should be 25 μl of 20 mM/ml L-012 (luminol-based molecule), 2 μl of 10mg/ml horse radish peroxidase (HRP) and 2 μl flg22). The plate was left open and loaded to a TECAN Infinite F200 PRO luminometer/fluorimeter. Luminescence was measured for 1 hour with 46 secs interval time and 750 millisecs integration time. Relative luminescence unit (RLU) was plotted against time (mins). Average maximum RLUs which account for the oxidative burst were analyzed using RStudio© version 0.98.501. Results were then compared using one way ANOVA followed by post hoc Tukey HSD test for multiple comparisons. Significance was determined at P < 0.05.

DETERMINATION OF GENE EXPRESSION IN UK41 AND UK42-TRANSFORMED RICE LINES

SOWING AND MAINTENANCE OF RICE PLANTS

Different seeds of various transformed Nipponbare rice lines were sowed in petri plates lined with moistened tissue paper for 5 days under 30°C in an incubator with continuous light. Thereafter, the seedlings were transferred to pots and maintained in the rice room at 28°C. Each week, the plants were watered with an iron solution (0.9 g (NH4)2SO4 and 1.8 g FeSO4.7H2O in 1 liter of water). After 30 days, the rice shoots were harvested and maintained in -80 °C for DNA and RNA extraction.

PLANT GENOMIC DNA EXTRACTION FOR CONFIRMATION OF TRANSFORMANTS

Shoots of 30-day old transformed Nipponbare rice plants were cut into smaller pieces of about 5mm thick and transferred into a 1.5 ml microcentrifuge tube. To the plant tissues 400 ml extraction buffer was added (final concentration of 200 mM TrisHCl pH 7.5, 250 mM NaCl, 25 mM EDTA and 0.5% SDS), this was inverted a couple of times and then shaken for 40 minutes at 95°C. Afterwards, 50 μl of chloroform was mixed into each tube. Subsequently, the tubes were centrifuged for 5 minutes at 13000 rpm. From each centrifuged tube, 200 μl of the upper layer was collected and transferred into a new 1.5 ml tube. These new tubes were then centrifuged again for 10 minutes and the resulting supernatant was discarded. After that, the DNA pellet (sometimes invisible) remaining on the tubes was washed with 70 % ethanol. The tubes were left open for 3 minutes and then, ethanol was pippeted out. Another 5 minutes was allotted for the tubes to finally dry out. Finally, the pellet was dissolved in 30 μl of RNAse-free water and kept at -20 °C until use. The extracted DNA was subjected to PCR to check for the inserts with the following profile: initial denaturation at 95°C for 5 mins, 35 cycles of 95 °C for 5 mins, 54° C for 45 secs and 72°C for 30 sec, and final extension at 72° C for 5 min. Both sets of UK41 and UK42 w/o SP + attB primer pairs were used to amplify the specific C-type lectin gene and EXP primers (see Table 1) were used to amplify the reference gene. For the EXP primers, the annealing temperature used was 55°C. The resulting amplicons were resolved in 1.5 % agarose for 23 minutes. Rice plants containing empty constructs were used as the control.

RNA EXTRACTION AND DNASE TREATMENT

Prior to RNA extraction using the RNeasy® Plant Miniprep Kit (QIAGEN, Germany), the samples were mechanically grinded using liquid nitrogen. At least 100 μg of the sample was used. The concentration of RNA extracted for each sample was determined and adjusted to 3ng/µl with a final volume of 13.2 µl. For each tube, 1.8 µL of buffer with MgCl2 and 2 µl of DNAse were mixed in. Afterwards, the tubes were incubated at 37 °C for 30 minutes. Lastly, 2 µl of EDTA (25mM) was added and the tubes were incubated at 65°C for 10 minutes. cDNA synthesis was performed immediately after.

CDNA SYNTHESIS AND REVERSE TRANSCRIPTASE-PCR (RT-PCR) The first-strand cDNA synthesis was performed by initially preparing the mix in a sterile microcentrifuge tube containing 4 µl of RNAse-free water, 20 µl DNAse-treated RNA, 1 µl of oligo DT and 2 µl of 10 mM dNTPs. Subsequently, the tubes were placed in a slightly shaking heat block at 65° for 5 mins and returned to ice after. From then on, 8 µl of 5x first strand buffer and 4 µl of 0.1 M DTT were mixed into each tubes. The mixes were incubated again at 42° C for 2 minutes and then returned to ice. Finally, 1 µl of Reverse Transcriptase was added to the mixture. The tubes were incubated at 42°C for 2 hours. Prior to PCR amplification for checking, each cDNA sample was diluted by adding 60 µl of sterile distilled water. EXP and UK41/UK42 without SP+attB primer pairs were used. The same PCR profile for genomic DNA amplification was used.

QUANTITATIVE PCR (QPCR) FOR EXPRESSION ANALYSIS

Constructed cDNA from positive transformed lines based on RT-PCR were utilized to check the level of expression of the lectin gene in each sample. Using a programmable dispensing robot (CorbettRobotics) based on the number of reference and target genes and cDNA samples, the qPCR mix with a final volume of 20 µl containing 10 µl of Sensimix (BIOLINE Sensimix ™ SYBR No-ROX kit), 1 µl of each primer pair, 1 µl cDNA and 7 µl sterile distilled water was pippeted to each PCR tube. For the reference genes, EXP, EXP-Narcai and EIF5C primers (see Table 1) designed for qPCR were used. qRT-PCR was performed using Rotor Gene RG-3000 (Corbett Research). Relative expression of the genes were analyzed using REST 2009 (Relative Expression Software Tool).

Results

SUBCELLULAR LOCALIZATION OF M. GRAMINICOLA C-TYPE LECTINS The predicted subcellular localization of the two C-type lectins (UK41 and UK42) was determined using the predictor softwares PSORTII (Nakai and Horton, 1999) and WolfPSORT (Horton et al., 2007) with the signal peptide sequence removed. The UK41 effector was predicted by PSORTII to localize in the nucleus while UK42 was predicted to be cytoplasmic. On the other hand, WolfPSORT predicted that both effectors have extracellular localization (Table 2).

Table 2. Prediction of subcellular localization of M. graminicola C-type lectins Effectors PSORTII prediction WolfPSORT prediction UK41 34.8 %: nuclear extracellular: 22 30.4 %: cytoplasmic cytoplasmic/nuclear: 6.5 26.1 %: mitochondrial nuclear: 5.5 4.3 %: peroxisomal cytoplasmic: 4.5 4.3 %: plasma membrane UK42 52.2 %: cytoplasmic extracellular: 13 21.7 %: nuclear cytoplasmic/nuclear: 10.5 13.0 %: mitochondrial cytoplasmic: 9 4.3 %: vacuolar nuclear: 8 4.3 %: vesicles of secretory system 4.3 %: endoplasmic reticulum

A. tumefaciens GV3101-containing UK41 and UK42 effectors fused with GFP (in the vectors pK7FWG2 and pK7WGF2) were spot-inoculated on the leaves of N. benthamiana plants for transient expression and localization. Leaf tissues were examined and fluorescence was observed under a confocal microscope. In general, C-terminal GFP constructs showed stronger signals compared to N-terminal constructs. There was no signal obtained from N-terminal GFP constructs without SP. As expected, transient expression of UK41 and UK42 with signal peptides showed apoplastic localization. The fusion proteins can also be seen in some endoplasmic reticulum filaments which are the starting point of the secretory pathway and where the cleavage of the SP occurs (Fig. 3B & 3C). Meanwhile, UK41 without signal peptide showed cytoplasmic and nuclear localization (Fig. 3D) similar to the localization of the free GFP control construct (Fig. 3A). UK42, on the other hand, exhibited a strong nuclear localization. However, some weaker signals of cytoplasmic localization were also obtained from the UK42 effector (Fig. 3E). Obviously, there

was not quite a positive correlation between the predicted localizations and the localizations from transient expression assays.

A B C

D E

FigA 3. Subcellular localization of M. graminicola C- type lectins. A. Free-eGFP control constructs showing cytoplasmic and nuclear localization. B and C. Apoplastic and cytoplasmic localization of UK41 and UK42 containing SP, respectively (pK7FWG2). D. Cytoplasmic and nuclear localization of UK41 (pK7FWG2). E. Nuclear localization of UK42 (pK7FWG2).

TRANSIENT EXPRESSION IN N. BENTHAMIANA FOR EFFECTOR-TRIGGERED AND PATHOGEN/MICROBE- ASSOCIATED MOLECULAR PATTERN-TRIGGERED IMMUNITY ASSAY (ETI AND PTI)

UK41 and UK42 constructs (in the pK7WG2 vector) were transiently expressed in N. benthamiana leaves for 2-4 days together with R/Avr-gene pairs, Cf4 & AvrCf4, R3a & AvrR3a and Gpa2 & Gp-Rbp-1. Three trials were conducted for the Cf4 combination while two trials were done for the other gene pairs. In general, a lot of variations in hypersensitivity response was observed in the experiment. In some cases, unexpected hypersensitive responses from negative

controls were obtained while instances of no responses for all the treatments in majority of the leaves infiltrated were also noted. However, in general, hypersensitive responses were also present in UK41 and UK42 mixes indicating that there was no ETI suppression (Fig. 4).

Uk42 + Rgene + AVRgene

Empty + Rgene + AVRgene Empty + Buffer Rgene + Buffer

GFP+ Rgene + AVRgene

Uk41 + Rgene + AVRgene Rgene + Buffer GFP + Buffer

A B Fig 4. ETI/ PTIassay in N. benthamiana leaves. A. Infiltrated spots showing strong HR. B. Negative control treatments showing no HR response.

Similar to the ETI assay, INF1-induced PTI was not suppressed by any of the C-type lectins in 2 trials. Most of the plants showed very strong hypersensitive response 2 days after infiltration which is indicative of non-suppression.

ROS ASSAY The activity of M. graminicola C-type lectins on ROS production of N. benthamiana leaves as induced by flg22 was examined through a luminol-dependent luminescence assay. Figure 5 illustrates the time-course ROS production as reflected by the RLUs in a one-hour assay. Stimulation of ROS in GFP-treated leaves was found to dramatically increase and peak at 8 to 20 minutes post plate loading. On the other hand, MP10, UK41 and UK42-treated leaves exhibited a more delayed ROS production which peaked from 12 to 25 minutes post plate loading.

4.5 TRIAL 1 12 4 GFP MP10 UK41 GFP MP10 UK42 3.5 10 a a 3 8 2.5 6 2 ab 1.5 4 b b 1 2

0.5 b Relative Luminescence Units (RLUx1000) Units Luminescence Relative Relative Luminescence Units (RLUx1000) Units Luminescence Relative 0 0 0 10 20 30 40 50 60 0 10 20 30 40 50 60 Exposure Time (mins) Exposure Time (mins)

30 TRIAL 2 30 25 a 25 GFP MP10 UK41 a GFP MP10 UK42 20 20

15 ab 15 a

10 b 10 a

5 5 Relative Luminescence Units (RLUx1000) Units Luminescence Relative

0 (RLUx1000) Units Luminescence Relative 0 0 10 20 30 40 50 60 0 10 20 30 40 50 60 Exposure Time (mins) Exposure Time (mins)

Fig 5. ROS production of N. benthamiana leaf discs overexpressing MP10, UK41, UK42 and eGFP in response to flg22. Points in the graph represent the mean of 14-16 replicates/wells per treatment. Error bars=standard errors of the mean. Peaks with the same letter are not significantly different (Tukey HSD test, p<0.05)

One parameter to represent the oxidative burst of ROS is the mean maximum peak during the whole reaction. However, under two trials for each lectin gene, UK41 was the only lectin which exhibited statistically comparable suppression of ROS induction. UK42 showed a strong suppression during the first trial but was inconsistent during the second trial. The effector MP10 as a positive control or suppressor was also observed to be very inconsistent in the different trials. Lower peaks were theoretically expected from N. benthamiana leaves inoculated with A. tumefaciens expressing MP10 constructs since it was found to be a strong suppressor of flg22- induced PTI (Bos et al., 2010). Since using the maximum peak was not so reliable, another parameter taking into account the time where the maximum reaction rate occurs was investigated. Adapted from a study regarding respiratory burst of ovine neutrophil (Tung et al., 2009), the reaction rate as one of the parameters was calculated from the average of five data points which correspond to the steepest part of the curve over time.

A B

1800 1400

1600 1200 1400 1000 1200 a 800 a 1000

800 600

RLU/MIN RLU/MIN 600 b 400 400 b b b 200 200 c b 0 0 GFP MP10 UK41 GFP MP10 UK42 CONSTRUCTS CONSTRUCTS

Fig 6. Rate of ROS production (RLU/min) of N. benthamiana leaves. A-B. Comparison of ROS reaction rate among GFP, MP10 and UK41/UK42-overexpressing leaf discs. N=15, 5 replicates per treatment. Means with the same letter are not significantly different. (Tukey HSD, p<0.05). Error bars=Standard error. Results were consistent for 2 trials.

N. benthamiana overexpressing UK41, UK42 and MP10 constructs displayed significantly lower reaction rates (320.0 ± 36.7 RLU/min, 432.5 ± 25.7 RLU/min and 662.8 ± 32.5 RLU/min /443.7±33.4 RLU/min, respectively) compared to GFP-overexpressing leaves (1410.7±208.1 RLU/min/1033.1 ± 140.9 RLU/min). As a matter of fact, transient expression of these proteins resulted to a reduction of more than half in reaction rate (Fig. 6). Moreover, the effect of these C- type lectins in the overall reaction rate also reflects their indirect activity on the substrate-enzyme

(H202 and HRP) interaction. Since H202 is an integral feature of flg22-triggered immunity (Chinchilla et al., 2007), the parameter somehow demonstrates the probable influence of M. graminicola C-type lectins in suppression of PTI signaling.

SELECTION OF TRANSGENIC RICE LINES USING QRT-PCR

RT-PCR coupled with qPCR was performed to determine the gene expression of the transgenic rice lines. Those with relatively high expression will be utilized for further experiments such as infectivity assays and plant hormone analysis. 36 seedlings from UK41 F1 lines representing 7 transformation events were used for PCR detection on a DNA extract. 19 of these seedlings were found to contain the UK41 gene. Meanwhile, only 16 seedlings representing 4 events were used for UK42 F1 lines. All chosen seedlings from UK42-transformed rice lines were found to contain the gene (Fig. 7gDNA). Using the RNA isolated from the shoots of 30-day old positive rice lines, RT-PCR was done to qualitatively analyze the gene expression of the C-type lectins. Most of the positive plants from gDNA PCR detection were identified to be expressing the transcripts. Most of the strong signals were present in UK42-transformed plants especially those from Lines 5 and 6. For UK41- transformed plants there was quite a lower signal which indicated lower expression of the gene relative to UK42 lines. Rice plants transformed with empty vectors served as the control group and exhibited no expression. In general, differential expression in between and among the different rice lines for both genes was observed (Fig. 7cDNA).

A 1.1 1.2 1.4 2.2 2.4 2.6 3.1 3.2 3.4 3.5 3.6 3.7 4.6 6.1 6.2 6.3 8.2 8.5 8.6 emp + -

gDNA

cDNA

B L2.1 L2.2 L2.3 L2.4 L4.1 L4.2 L5.1 L5.2 L5.3 L5.4 L5.5 L6.1 L6.2 L6.3 L6.4 L6.5 emp + -

gDNA

cDNA

Fig 7. (Upper panel) PCR amplification of M. graminicola C-type lectin genes from genomic DNA (gDNA) of (A) UK41 and (B) UK42-overexpressing transformed rice plants. (Lower panels). RT- PCR analysis of UK41 and UK42 gene expression. DNA and RNA were both extracted from a single plant shoot belonging to a specific line. Rice lines transformed with empty vector were used as the negative control while plasmids containing the constructs were used as the positive control. Amplicon sizes for UK41 and UK42 were approximately 650kb and 520kb, respectively.

10 EXPRESSION LEVELEXPRESSION

0 UK42-L2 UK42-L4 UK42-L5 UK42-L6 RICE LINES

Fig 8. qPCR Analysis of UK42 mRNA levels in UK42 transgenic rice lines. EXP-Narcai and EIF5C were used as reference genes and transformed rice with empty vector as the control. Mean and error bars represent 2 biological and 3 technical replicates.

To supplement the molecular analysis of the expression of the UK41/UK42 transgenic lines based on RT-PCR, qPCR was performed as well. The level of transcript expression was measured

relative to the empty controls and the reference genes, EXP-Narcai and EIF5C. However, for this experiment, only UK42-transformed plants were considered. Based on REST analysis, UK42- transformed rice lines, showed expression of the C-type lectin gene. Lines 5 and 6 showed higher expression level of more than 50% compared to Line 4 and more than 25% compared to Line 2 (Fig. 8).

Discussion

Meloidogyne graminicola, just like most of the plant-parasitic nematodes, secretes repertoires of proteins called effectors into the plant. Most of these effectors are delivered via the stylet and facilitate penetration, establishment and ultimately, parasitism. With the advent of molecular tools, many of these effectors have been identified and analyzed to unravel their functional roles in host-parasite interaction. In recent years, transcriptome analysis of many plant parasitic nematodes revealed that these organisms also secrete CTLs. These include M. graminicola, (Haegeman et al., 2013), M. chitwoodi (Roze et al., 2008) and Rotylenchulus reniformis (Ganji et al., 2014). Whereas some studies focused more on identification of C-type lectins, this work concentrated on functional analysis of M. graminicola C-type lectins which were initially found to be present in subventral glands of infective juveniles (Haegeman et al., 2013) and investigated their possible roles in the rice-nematode interaction.

After the deposition of effectors by the nematode through the stylet, the real complex issue is where these proteins perform their function. Characterization of nematode effectors as reported in different literatures has provided concrete evidences for extracellular, cytoplasmic and nuclear targeting, suggesting a wide range of functional activities of these proteins in the plant cell (Hewezi & Baum, 2013). In this study, the two M. graminicola C-type lectins (UK41and UK42) were transiently expressed in N. benthamiana plants and their subcellular localizations were observed. Most constructs exhibited relatively low levels of expression but it was still possible to observe their localizations. Predictor softwares PSORTII (Nakai & Horton, 1999) and WolfPSORT (Horton et al., 2007) were also used to compare hypothetical and experimental localizations. In general, the predictors gave a different localization compared to experimental results. PSORTII prediction for UK41 is nuclear and cytoplasmic for UK42. WolfPSORT predicted that both effectors have extracellular localization. Experimentally, UK41 protein was found to localize in

both the cytoplasm and nucleus while UK42 protein showed a very strong nuclear localization. Discrepancies found between the predictors and experiments regarding subcellular localizations of proteins have been also observed in other organisms. Since computerized predictors are based on algorithms that detect known sorting signals or signal motifs (Horton et al., 2007; Nakai and Horton, 1999), there is a chance that highly similar sequences can be identified as signal motifs in the query protein but are actually non-functional in planta. In general, it was also observed that C- terminal GFP constructs that were secreted outside the cell (apoplastic) showed stronger signals compared to N-terminal constructs. There was also no signal obtained from N-terminal GFP constructs without signal peptides which is probably caused by the protein folding that could happen in the N-terminal side (Palmer & Freeman, 2004).

Nuclear localization of both UK41 and UK42 C-type lectins can be explained by two possible mechanisms of protein transportation. It can be that the protein just contains a nuclear signal motif that allowed itself to localize in the nucleus. Alternatively, it is also probable that it targets a host protein that has a nuclear localization. Nevertheless, localization in the plant nucleus could mean that these effectors play a role in host gene expression modification or plant defense signaling suppression (Elling et al., 2007). In a study regarding the functional role of the M. incognita effector 16D10, Huang et al. (2006) found out that this protein directly interacts with plant SCARECROW-like (SCL) transcription factors that have important roles in plant growth and development. Similarly, nematode effectors localized in the cytoplasm like UK41 can also be involved with defense suppression as some nematode effectors target transmembrane proteins such as NB-LRR-resistance proteins (nucleotide-binding site leucine-rich repeat) and other defense- related proteins (Jaouannet & Rosso, 2013). For instance, the Hs10A06 effector of H. schachtii was found to interact with plant spermidine synthase in the cytoplasm in order to modulate salicylic acid signaling and antioxidant machinery thereby modulating the plant defense response (Hewezi et al., 2010). In a study done by Rehman et al. (2009), the effector SPRYSEC-19 of G. rostochiensis was found to interact with the LRR domain of SW5F, a member of the tomato SW5 gene cluster which comprise of several pathogen resistance genes. Although both genes encode for C-type lectins, there was quite a difference in their subcellular localization which could signify different functions for each protein. In a study done by Jones et al. (2009), it was mentioned that variation in the Globodera pallida SPRYSEC family of proteins may reflect different functional roles for each individual protein or differences in the localization of the targeted plant proteins.

To further investigate the function of these lectins in defense suppression, ETI and PTI assays were performed. UK41 and UK42 constructs were transiently expressed in N. benthamiana leaves for 2-4 days together with R/Avr-gene pairs, Cf4 & AvrCf4, R3a & AvrR3a and Gpa2 & Gp-Rbp-1 and Phytophthora infestans PAMP protein INF1. In general, localized cell death was observed in all R/Avr-gene pairs and INF1 co-infiltrated with UK41 and UK42 proteins. This indicates non-suppression of the basal plant defense and effector-triggered defense. However, in some trials anomalies were also found in the hypersensitive responses elicited by the treatments. There were some cases of contradictory responses which can be due to cross contamination, innate condition of N. benthamiana and maybe some unfavorable environmental conditions. While it is true that agro-infiltration has been an efficient and robust technique in effector studies, some limitations such as transformation efficiency which can be below the threshold to detect responses and nonspecific defense responses of plant genotypes to A. tumefaciens have to be considered as well (Du et al., 2014) . Aside from defense-related protein production, plants have evolved a lot more defense mechanisms. These include stomatal closure, restricted translocation, production and secretion of antimicrobial compounds such as phytoalexins and generation of reactive oxygen species (Bigeard et al., 2015). Among these mechanisms, this study focused on apoplastic or extracellular ROS production in N. benthamiana leaves in response to flg22 (flagellin). flg22 is a 22-amino acid sequence from the conserved N-terminal part of flagellin and is known to be an elicitor of plant defense (PAMP). In Arabidopsis thaliana, flg22-induced ROS production rapidly takes place at 2 to 3 minutes post induction and peaks around 10-14 minutes (Chinchilla et al., 2007). In this study, ROS production was found to be significantly lower with MP10, UK41 and UK42 than for the control GFP construct. Generally, treated leaf discs exhibited a more delayed ROS production with the effector proteins. However, ROS burst measured through the maximum peak displayed inconsistent results not amenable to a generalization leading to ROS suppression. This can also be brought about by the fact that oxidative burst is not just caused by biotic factors such as presence of the pathogen but also some abiotic factors or stresses (Yoshioka et al., 2008). To shed light into this, reaction rate based on substrate-enzyme interaction was introduced which takes into account the steepest points in the curve representing the maximum reaction rate and the corresponding duration. Using this parameter, it was found that MP10 and the C-type lectins-inoculated leaf discs had lower reaction rates indicating suppressed or altered ROS production.

In essence, it was shown that these C-type lectins secreted by second-stage juveniles of M. graminicola target PTI signaling induced by a known PAMP, flg22, possibly by altering the immune response of the plant. Hence, there is a need to understand the early molecular events that initiate distinct signaling leading to PTI. It is also probable that these C-type lectins target other proteins that form immune receptor complexes with pathogen recognition receptors (PRRs) which are necessary for a normal PAMP/MAMP perception and signal transduction (Monaghan & Zipfel, 2012). flg22-ROS production associated with early PTI signaling response is also involved in oxidative signaling and is considered as a signal transducer (del Rio, 2015). Basically, an alteration in ROS production can greatly affect a lot of signal transduction events such as mitogen-activated protein kinase (MAPK) cascades which direct the elicitation of specific cellular responses (Fig. 9). Most of these responses are defense-related cascades (Torres et al., 2006; Torres 2010).

Fig 9. ROS signaling in plant cells due to pathogen recognition. A simple diagram showing how ROS, produced in plant cells in response to PAMP, can trigger signal transduction events, leading to specific cellular responses. ROS-dependent cellular processes is mediated by a balance between the maintenance of their generation and their scavenging by different antioxidant systems. Thin arrows depict signaling events that point to apoplastic and internal ROS production. Double- headed arrow indicates cross-talk between the apoplast and inside the cell. Thick arrows point to the function of ROS in relation to plant defense (Torres, 2009).

Definitely, there are ROS signaling networks connecting the apoplast, chloroplast and the nucleus. Apoplastic ROS might enter the cell through plasma membrane channels and/or react with extracellular or transmembrane receptors ultimately resulting in changes in gene expression through intracellular signaling pathways. This ROS production is also sensed via yet unknown mechanisms in the chloroplast where ROS generation by the electron transfer chain (ETC)

subsequently increases. Elevated ROS inside the chloroplast results in transcriptional reprogramming through identified and unknown components of the stress and hormone signaling such as salicylic acid (SA) (Shapiguzov et al., 2012).

Another strategy for functional analysis of effectors is the constitutive expression of these proteins in the plant. One of the most widely used technique is the Agrobacterium-mediated transformation (Hamamouch et al., 2012; Chen et al., 2015; Jaouannet et al., 2013). As different transformation events occur in different transgenic lines, molecular analysis is done to confirm the transformation and to also know the level of expression in each line (Duan et al., 2012). PCR and RT-PCR analyses of the genomic DNA and RNA respectively from the UK41/UK42-transformed rice shoots reveal the integration and expression of the genes in the rice genome. For the chosen transgenic lines of UK41, only 50% revealed the integration of the gene while in the UK42 lines, all chosen ones were transgenic. qRT-PCR analysis of the C-type lectin genes, specifically the UK42 gene revealed differential expression of this gene in the rice genome. Such differential expression can be attributed to the fact that gene integration is a random event during recombination thus where a gene would integrate itself cannot be controlled. In addition, the copy numbers and the integrity of the transgenes are also unpredictable and several cell-specific and post-translational factors also affect the level of gene expression (Kohli et al., 2006). In conclusion, both M. graminicola C-type lectins displayed nuclear and cytoplasmic localization suggestive of their role in modifying gene expression or suppressing plant defense signals. Functional analysis done in this study also revealed that these C-type lectins have no effect on effector-triggered immunity as induced by some R/Avr gene pairs and PAMP-triggered immunity as induced by INF1. On the other hand, flg22-induced ROS production as a part of plant defense signaling cascade of the N. benthamiana was found to be suppressed by both lectins based on the time of oxidative burst induction and reaction rate. However, generalization of their function based on these experiments has to be taken with circumspection because of the variations present. Same goes for the ROS assay which also displayed non-repeatability in terms of the maximum peak parameter. Moreover, there is a need to repeat, optimize and further evaluate the framework of these experiments. To elucidate the function of C-type lectins in the rice-nematode interaction, RNAi knockdown of the effector genes, plant hormone analysis and infection assays of the transgenic plants are also needed so as to directly assess the impact of these proteins on the plant.

It is also imperative to know the proteins they can interact with in yeast and plant cells. Likewise, further characterization of these M. graminicola C-type lectins which includes agglutination activity, specific carbohydrate binding and molecular modelling is also a prerequisite for a deeper understanding of their functionality.

Acknowledgement I would like to sincerely thank Prof. Dr. Godelieve Gheysen for her unwavering support and enthusiasm during this whole thesis work. I also extend my gratefulness to Silke Nowak, my supervisor, for the provision of the research topic and some protocols during the conduct of my study. I would also like to express my wholehearted appreciation to all staffs especially to Isabel Verbeke for her technical assistance and encouragements, and to the very supportive Phd students working in the Molecular Biotechnology Laboratory, Faculty of Bio-Science Engineering. I am also deeply thankful to my Nematology family, Nic Smol, Inge Dehennin and to my brilliant colleagues who shared with me two wonderful academic years in Ghent University and to the VLIR-UOS Scholarship Program Committee for making my graduate study possible.

References Bakhetia, M., Urwin, P. E., & Atkinson, H. J. (2007). QPCR analysis and RNAi define pharyngeal gland cell-expressed genes of Heterodera glycines required for initial interactions with the host. Mol Plant Microbe Interact, 20(3), 306-312. doi: 10.1094/MPMI-20-3-0306

Bigeard, J., Colcombet, J., & Hirt, H. (2015). Signaling mechanisms in pattern-triggered immunity (PTI). Mol Plant, 8(4), 521-539. doi: 10.1016/j.molp.2014.12.022

Bos, J. I., Prince, D., Pitino, M., Maffei, M. E., Win, J., & Hogenhout, S. A. (2010). A functional genomics approach identifies candidate effectors from the aphid species Myzus persicae (green peach aphid). PLoS Genet, 6(11), e1001216. doi: 10.1371/journal.pgen.1001216

Bridge, J. & Starr J. L. . (2007). Plant nematodes of agricultural importance: a colorful handbook. USA. Academic Press.

Brown, A. C., Harrison, L. M., Kapulkin, W., Jones, B. F., Sinha, A., Savage, A., Villalon, N. & Cappello, M. (2007). Molecular cloning and characterization of a C-type lectin from Ancylostoma ceylanicum: evidence for a role in hookworm reproductive physiology. Mol Biochem Parasitol, 151(2), 141-147. doi: 10.1016/j.molbiopara.2006.10.017

Cambi, A., & Figdor, C. G. (2003). Dual function of C-type lectin-like receptors in the immune system. Curr Opin Cell Biol, 15(5), 539-546.

Chen, S., Lang, P., Chronis, D., Zhang, S., De Jong, W. S., Mitchum, M. G., & Wang, X. (2015). In planta processing and glycosylation of a nematode CLAVATA3/ENDOSPERM SURROUNDING REGION-like effector and its interaction with a host CLAVATA2-like receptor to promote parasitism. Plant Physiol, 167(1), 262-272. doi: 10.1104/pp.114.251637

Chinchilla, D., Zipfel, C., Robatzek, S., Kemmerling, B., Nurnberger, T., Jones, J. D. & Boller, T. (2007). A flagellin-induced complex of the receptor FLS2 and BAK1 initiates plant defence. Nature, 448(7152), 497-500. doi: 10.1038/nature05999

Cotton, J. A., Lilley, C. J., Jones, L. M., Kikuchi, T., Reid, A. J., Thorpe, P. & Urwin, P. E. (2014). The genome and life-stage specific transcriptomes of Globodera pallida elucidate key aspects of plant parasitism by a cyst nematode. Genome Biol, 15(3), R43. doi: 10.1186/gb- 2014-15-3-r43

Del Rio, L. A. (2015). ROS and RNS in plant physiology: an overview. J Exp Bot, 66(10), 2827- 2837. doi: 10.1093/jxb/erv099

Dongre, M. & Simon, S. (2013). Infestation and host studies of Meloidogyne graminicola in rice: nurseries of Allahabad. International Journal of Botany and Research 3, 27-34.

Du, J., Rietman, H., & Vleeshouwers, V. G. (2014). Agroinfiltration and PVX agroinfection in potato and Nicotiana benthamiana. J Vis Exp(83), e50971. doi: 10.3791/50971

Duan, Y., Zhai, C., Li, H., Li, J., Mei, W., Gui, H., & Yang, J. (2012). An efficient and high- throughput protocol for Agrobacterium-mediated transformation based on phosphomannose isomerase positive selection in Japonica rice (Oryza sativa L.). Plant Cell Rep, 31(9), 1611-1624. doi: 10.1007/s00299-012-1275-3

Dubreuil, G., Magliano, M., Deleury, E., Abad, P., & Rosso, M. N. (2007). Transcriptome analysis of root-knot nematode functions induced in the early stages of parasitism. New Phytol, 176(2), 426-436. doi: 10.1111/j.1469-8137.2007.02181.x

Dutta, T. K., Ganguly, A. K., & Gaur, H. S. (2012). Global status of rice root-knot nematode, Meloidogyne graminicola. African Journal of Microbiology Research, 6(31), 6016-6021. doi: 10.5897/ajmr12.707

Elling, A. A., Davis, E. L., Hussey, R. S., & Baum, T. J. (2007). Active uptake of cyst nematode parasitism proteins into the plant cell nucleus. Int J Parasitol, 37(11), 1269-1279. doi: 10.1016/j.ijpara.2007.03.012

Ganji, S., Jenkins, J. N., & Wubben, M. J. (2014). Molecular characterization of the reniform nematode C-type lectin gene family reveals a likely role in mitigating environmental stresses during plant parasitism. Gene, 537(2), 269-278. doi: 10.1016/j.gene.2013.12.048

Haegeman, A., Bauters, L., Kyndt, T., Rahman, M. M., & Gheysen, G. (2013). Identification of candidate effector genes in the transcriptome of the rice root knot nematode Meloidogyne graminicola. Molecular Plant Pathology, 14(4), 379-390. doi: 10.1111/mpp.12014

Hamamouch, N., Li, C., Hewezi, T., Baum, T. J., Mitchum, M. G., Hussey, R. S. & Davis, E. L. (2012). The interaction of the novel 30C02 cyst nematode effector protein with a plant beta-1,3-endoglucanase may suppress host defence to promote parasitism. J Exp Bot, 63(10), 3683-3695. doi: 10.1093/jxb/ers058

Harcus, Y., Nicoll, G., Murray, J., Filbey, K., Gomez-Escobar, N., & Maizels, R. M. (2009). C- type lectins from the nematode parasites Heligmosomoides polygyrus and Nippostrongylus brasiliensis. Parasitol Int, 58(4), 461-470. doi: 10.1016/j.parint.2009.08.011

Heven Sze Lab. (2007). GFP-CHX (pK7WGF2) and CHX-GFP (pK7FWG2) constructs. Retrieved from: http://www.life.umd.edu/CBMG/faculty/sze/lab/CHX/RES/gfp/chx_gfp. html

Hewezi, T., & Baum, T. J. (2013). Manipulation of plant cells by cyst and root-knot nematode effectors. Mol Plant Microbe Interact, 26(1), 9-16. doi: 10.1094/MPMI-05-12-0106-FI

Hewezi, T., Howe, P. J., Maier, T. R., Hussey, R. S., Mitchum, M. G., Davis, E. L., & Baum, T. J. (2010). Arabidopsis spermidine synthase is targeted by an effector protein of the cyst nematode Heterodera schachtii. Plant Physiology, 152(2), 968-984. doi: DOI 10.1104/pp.109.150557

Horton, P., Park, K. J., Obayashi, T., Fujita, N., Harada, H., Adams-Collier, C. J., & Nakai, K. (2007). WoLF PSORT: protein localization predictor. Nucleic Acids Res, 35(Web Server issue), W585-587. doi: 10.1093/nar/gkm259

Huang, G., Dong, R., Allen, R., Davis, E. L., Baum, T. J., & Hussey, R. S. (2006). A root-knot nematode secretory peptide functions as a ligand for a plant transcription factor. Mol Plant Microbe Interact, 19(5), 463-470. doi: 10.1094/MPMI-19-0463

Jaiswal, R. K. & Singh, K. P. . (2010). A technique for studying the life cycle of Meloidogyne graminicola in rice roots. Pest Science and Management, 1-3.

Jaouannet, M., Magliano, M., Arguel, M. J., Gourgues, M., Evangelisti, E., Abad, P., & Rosso, M. N. (2013). The Root-knot nematode calreticulin Mi-CRT is a key effector in plant defense suppression. Molecular Plant-Microbe Interactions, 26(1), 97-105. doi: Doi 10.1094/Mpmi-05-12-0130-R

Jaouannet, M., & Rosso, M. N. (2013). Effectors of root sedentary nematodes target diverse plant cell compartments to manipulate plant functions and promote infection. Plant Signal Behav, 8(9). doi: 10.4161/psb.25507

Jones, J. T., Kumar, A., Pylypenko, L. A., Thirugnanasambandam, A., Castelli, L., Chapman, S. & Blok, V. C. (2009). Identification and functional characterization of effectors in expressed sequence tags from various life cycle stages of the potato cyst nematode Globodera pallida. Mol Plant Pathol, 10(6), 815-828. doi: 10.1111/j.1364- 3703.2009.00585.x

Karssen, G., Wesemael, & W. Moens, M. (2013). Root-knot nematodes. In R. M. Perry, M. (Ed.), Plant nematology. Wallingford, UK. CABI. pp. 73-80

Kohli, A., Melendi, P. G., Abranches, R., Capell, T., Stoger, E., & Christou, P. (2006). The quest to understand the basis and mechanisms that control expression of introduced transgenes in crop plants. Plant Signal Behav, 1(4), 185-195.

Kudla, U., Milac, A. L., Qin, L., Overmars, H., Roze, E., Holterman, M. & Smant, G. (2007). Structural and functional characterization of a novel, host penetration-related pectate lyase from the potato cyst nematode Globodera rostochiensis. Molecular Plant Pathology, 8(3), 293-305. doi: Doi 10.1111/J.1364-3703.2007.00394.X

Lee, C., Chronis, D., Kenning, C., Peret, B., Hewezi, T., Davis, E. L., & Mitchum, M. G. (2011). The novel cyst nematode effector protein 19C07 interacts with the Arabidopsis auxin influx transporter LAX3 to control feeding site development. Plant Physiol, 155(2), 866-880. doi: 10.1104/pp.110.167197

Lifetechnologies. (2003). Gateway technology. Retrieved from: https://tools.lifetechnologies. com/content/sfs/manuals/ gatewayman.pdf

Loukas, A., Mullin, N. P., Tetteh, K. K. A., Moens, L., & Maizels, R. M. (1999). A novel C-type lectin secreted by a tissue-dwelling parasitic nematode. Current Biology, 9(15), 825-828. doi: Doi 10.1016/S0960-9822(99)80366-2

Monaghan, J., & Zipfel, C. (2012). Plant pattern recognition receptor complexes at the plasma membrane. Curr Opin Plant Biol, 15(4), 349-357. doi: 10.1016/j.pbi.2012.05.006

Nakai, K., & Horton, P. (1999). PSORT: a program for detecting sorting signals in proteins and predicting their subcellular localization. Trends Biochem Sci, 24(1), 34-36.

Palmer, E., & Freeman, T. (2004). Investigation into the use of C- and N-terminal GFP fusion proteins for subcellular localization studies using reverse transfection microarrays. Comp Funct Genomics, 5(4), 342-353. doi: 10.1002/cfg.405

Postma, W. J., Slootweg, E. J., Rehman, S., Finkers-Tomczak, A., Tytgat, T. O., van Gelderen, K., Smant, G. (2012). The effector SPRYSEC-19 of Globodera rostochiensis suppresses CC- NB-LRR-mediated disease resistance in plants. Plant Physiol, 160(2), 944-954. doi: 10.1104/pp.112.200188

Prot, J. C., & Matias, D. M. (1995). Effects of water regime on the distribution of Meloidogyne graminicola and other root-parasitic nematodes in a rice field toposequence and pathogenicity of M. graminicola on rice cultivar UPLR15. Nematologica, 41(2), 219-228.

Qin, L., Kudla, U., Roze, E. H., Goverse, A., Popeijus, H., Nieuwland, J. & Helder, J. (2004). Plant degradation: a nematode expansin acting on plants. Nature, 427(6969), 30. doi: 10.1038/427030a

Rehman S., Postma W. Tytgat T., Prins P., Qin L., Overmars H. Vossen, J., Spiridon, L. N., Petrescu, A. J., Goverse, A., Bakker, J. & Smant, G., et al. A secreted SPRY domain- containing protein (SPRYSEC) from the plant-parasitic nematode Globodera rostochiensis interacts with a CC-NB-LRR protein from a susceptible tomato. Molecular Plant-Microbe Interactions 22, 330-40: doi.10.1094/MPMI-22-3-0330

Roze, E., Hanse, B., Mitreva, M., Vanholme, B., Bakker, J., & Smant, G. (2008). Mining the secretome of the root-knot nematode Meloidogyne chitwoodi for candidate parasitism genes. Molecular Plant Pathology, 9(1), 1-10. doi: Doi 10.1111/J.1364- 3703.2007.00435.X

Schulenburg, H., Hoeppner, M. P., Weiner, J., 3rd, & Bornberg-Bauer, E. (2008). Specificity of the innate immune system and diversity of C-type lectin domain (CTLD) proteins in the nematode Caenorhabditis elegans. Immunobiology, 213(3-4), 237-250. doi: 10.1016/j.imbio.2007.12.004

Shapiguzov, A., Vainonen, J. P., Wrzaczek, M., & Kangasjarvi, J. (2012). ROS-talk - how the apoplast, the chloroplast, and the nucleus get the message through. Front Plant Sci, 3, 292. doi: 10.3389/fpls.2012.00292

Smant, G., Stokkermans, J. P., Yan, Y., de Boer, J. M., Baum, T. J., Wang, X., Hussey, R.S., Gommers, F. J., Henrissat, B., Davis E. L., Helder, J., Schots, A. & Bakker, J. (1998). Endogenous cellulases in animals: isolation of beta-1, 4-endoglucanase genes from two species of plant-parasitic cyst nematodes. Proc Natl Acad Sci U S A, 95(9), 4906-4911.

Torres, M. A. (2010). ROS in biotic interactions. Physiol Plant, 138(4), 414-429. doi: 10.1111/j.1399-3054.2009.01326.x

Torres, M. A., Jones, J. D., & Dangl, J. L. (2006). Reactive oxygen species signaling in response to pathogens. Plant Physiol, 141(2), 373-378. doi: 10.1104/pp.106.079467

Tung, J. P., Fraser, J. F., Wood, P., & Fung, Y. L. (2009). Respiratory burst function of ovine neutrophils. BMC Immunol, 10, 25. doi: 10.1186/1471-2172-10-25

Vanholme, B., Haegeman, A., Jacob, J., Cannoot, B., & Gheysen, G. (2009). Arabinogalactan endo-1,4-beta-galactosidase: a putative plant cell wall-degrading enzyme of plant-parasitic nematodes. Nematology, 11, 739-747. doi: Doi 10.1163/156854109x404599

Win, P. P., Kyi, P. P., Maung, Z. T. Z., & De Waele, D. (2013). Population dynamics of Meloidogyne graminicola and Hirschmanniella oryzae in a double rice-cropping sequence in the lowlands of Myanmar. Nematology, 15, 795-807. doi: 10.1163/15685411-00002719

Yoshioka, H., Bouteau, F., & Kawano, T. (2008). Discovery of oxidative burst in the field of plant immunity: Looking back at the early pioneering works and towards the future development. Plant Signal Behav, 3(3), 153-155.

Zelensky, A. N., & Gready, J. E. (2005). The C-type lectin-like domain superfamily. FEBS J, 272(24), 6179-6217. doi: 10.1111/j.1742-4658.2005.05031.x