Inflammasome-Mediated Activation of Microglia Tissue-Specific Features of Innate Immunity

Inflammasome-mediated activation of microglia Tissue-specific features of innate immunity

Saskia Maria Burm

Inflammasome-mediated activation of microglia Tissue-specific features of innate immunity

Inflammasoom-gemedieerde activatie van microglia Brein-specifieke kenmerken van aangeboren immuniteit

(met een samenvatting in het Nederlands)

Proefschrift

ter verkrijging van de graad van doctor aan de Universiteit Utrecht op gezag van de rector magnificus, prof.dr. G.J. van der Zwaan, ingevolge het besluit van het college voor promoties

in het openbaar te verdedigen op woensdag 8 juni 2016 des ochtends te 10.30 uur

door

Saskia Maria Burm

geboren op 21 november 1986 te Leiderdorp Promotor: Prof. dr. R. E. Bontrop Copromotor: Dr. J. J. Bajramovic

This thesis was accomplished with financial support from the Dutch MS Research Foundation (MS grant 12-805). Voor mijn vader

“Success is not final, failure is not fatal: it is the courage to continue that counts.”

Winston Churchill Beoordelingscommissie:

Prof. dr. R.J. de Boer Prof. dr. C.F.M. Hendriksen Prof. dr. E.M. Hol Prof. dr. S. Amor Prof. dr. K.P. Biber

The research described in this thesis was performed at the Alternatives Unit of the Biomedical Primate Research Centre, Rijswijk, the Netherlands

Financial support for publication of this thesis was provided by U-CyTech, the Dutch MS Research Foundation and the BPRC.

Illustrations: Henk van Westbroek, Francisca van Hassel and Saskia Burm Lay-out: Francisca van Hassel Cover design: Walter Vermeij Printed by: Ridderprint BV ISBN: 978-94-6299-335-8 Table of Contents

Chapter 1: General introduction ...... 9

Chapter 2: Expression of IL-1β in rhesus EAE and MS lesions is mainly induced in the CNS itself ...... 57

Chapter 3: Inflammasome-induced IL- 1β secretion in microglia is characterized by delayed kinetics and is only partially dependent on inflammatory caspases...... 79

Chapter 4: ATP-induced IL-1β secretion is selectively impaired in microglia. . . . .99

Chapter 5: Alternative methods for the use of non-human primates in biomedical research...... 121

Chapter 6: General discussion...... 139

Appendices...... 161

Abbreviations ...... 163 English summary...... 166 Nederlandse samenvatting ...... 170 Dankwoord ...... 174 Curriculum vitae...... 178 List of publications ...... 180

CHAPTER 1

General introduction Chapter 1

Multiple sclerosis (MS) is a chronic demyelinating disease of the central nervous system (CNS) that affects approximately 2.3 million people worldwide1. Symptoms of MS are caused by focal areas of demyelination (lesions or plaques) within the CNS, in which protective layer surrounding axons (the myelin sheaths) is degraded leading to hampered neuronal signaling. Activation of the tissue resident macrophages of the CNS, called microglia, is a common hallmark of MS lesions2. Studying the mechanisms that underlie activation of microglia in MS will provide insight in their involvement in the development of MS lesions and may lead to the identification of novel targets for therapeutic intervention. Receptors of the innate immune system are likely involved in the activation of microglia in MS lesions. Recently, a new family of cytoplasmic innate immune receptors, the nucleotide-binding oligomerization domain (NOD)-like receptors (NLR), has been 3identified . NLR can form large complexes called inflammasomes that link the sensing of microbial or self-antigens and perturbances in cellular homeostasis to the production of pro-inflammatory cytokines, such as interleukin (IL)-1β4. The pathological potential of NLRs in the CNS is highlighted by the recent identification of the inflammasome as key player in microglia activation during Alzheimer’s disease (AD)5. Yet, our knowledge on NLR expression and the formation of inflammasomes in microglia is limited and mainly derived from rodent studies6. This, together with the notion that defects in the regulation of inflammasome activation are associated with several autoinflammatory conditions7, provides a strong impetus for studies on the role of inflammasomes in microglia activation in MS lesions. In this thesis, a combined approach of in vitro primary rhesus monkey microglia cultures and in situ analysis was used to study inflammasome-mediated activation of microglia and its involvement in the development of MS lesions.

Multiple sclerosis

Clinical features MS usually develops during young adulthood with a mean age of onset of 30 years. It has a prevalence of 33 per 100.000, a female-to-male ratio of 12 and is diagnosed by the McDonald criteria. These are based on clinical symptoms in combination with detection of lesions by magnetic resonance imaging (MRI)8. Most common clinical symptoms of MS include fatigue, visual and balance disturbances, pain, spasticity, bladder dysfunction and, in a late disease stage, paralysis9. The disease course of MS is highly variable. The majority of the patients (about 80%) first present with an acute episode of symptoms, known as clinically isolated syndrome. Relapsing-remitting multiple sclerosis (RRMS) is clinically diagnosed upon a second episode in association with the detection of lesions by MRI. In RRMS, periods with clinical symptoms, called relapses, are alternated with periods of (partial) improvement. However, over time the recovery from each relapse becomes more incomplete and persistent symptoms accumulate. In 65% of RRMS patients, the disease develops into secondary progressive MS (SPMS), where the symptoms become progressively worse without periods of remission9. Figure 1 illustrates the hallmarks of RRMS disease progression. By contrast, about 15% of MS patients are diagnosed with primary progressive MS (PPMS), in which clinical symptoms are continuously worsening straight from the onset of the disease without periods of remission10.

10 General introduction 1

Figure 1. MS clinical course. In the preclinical phase of MS, lesions in the CNS may occur without apparent symptoms. In the relapse-remitting phase periods with clinical symptoms (indicated by the orange area), called relapses, are alternated with periods of (partial) improvement. These relapses are associated with the formation of new lesions and inflammation (indicated by the arrows), although not all lesions lead to clinical symptoms. Over time the recovery from each relapse becomes more incomplete and persistent symptoms accumulate. During the secondary progressive phase the symptoms become progressively worse without periods of remission. This phase is characterized by fewer inflammatory lesions. In primary progressive MS clinical symptoms are continuously worsening straight fromthe onset of the disease without periods of remission. Over time, axonal loss (indicated by the red line) in the CNS accumulates, while the brain volume (indicated by the brown line) of MS patients decreases.

Aetiology Although the exact cause of MS is still unknown, various genetic and environmental factors are associated with increased MS susceptibility. The involvement of a genetic factor is demonstrated by the increased risk of developing MS for relatives of MS patients11. Monozygotic twin studies indicate that genetic factors account for approximately 50% to disease susceptibility12. The strongest genetic associations with MS susceptibility are polymorphisms in the human leukocyte antigen (HLA)-class13 IIgenes . In particular, DRB1*15:01, DQB2*06:02, DQA1*01:02 alleles are associated with increased MS susceptibility, whereasDRB1*14:01 and DRB1*11 are associated with protection from MS13-16. In addition, genome-wide association studies and meta-analyses have identified more than 100 risk genes outside the HLA-class II loci. Most of these genes are associated with the immune system, including genes involved in nuclear factor (NF)-κB and other immune signaling cascades17-19. In addition to genetic predisposition, various environmental factors influence MS susceptibility20, 21. The strongest environmental association with MS susceptibility is latitude9, 21. The lowest prevalence of MS is found around the equator and increases with distance north and south of the equator. Migration during childhood from a high prevalence area to a low prevalence area decreases the risk of developing MS compared to the population of origin, and vice versa22, 23. Differential exposure to sunlight is hypothesized to contribute to this unequal geographical distribution of MS prevalence21, 24. Sunlight exposure is essential for vitamin D metabolism to its bioactive form after being taken up from the diet25. Subsequently, bioactive vitamin D displays immunosuppressive effects on both the innate and adaptive immune system26. Indeed, reduced blood levels of vitamin D are associated with increased MS susceptibility as well27. Therefore, vitamin D supplements are often prescribed to MS patients, although properly designed clinical trials are still required to determine if this is an effective treatment option. Other environmental factors that may influence MS susceptibility include cigarette smoking, obesity and increased

11 Chapter 1

dietary salt intake20, 21. How these factors contribute to MS pathogenesis remains to be established. Over the years, various infections have been associated with MS susceptibility, including Epstein-Barr virus (EBV), measles virus and Chlamydia Pneumoniae20, 21. Whereas the involvement of measles virus and Chlamydia Pneumoniae in MS pathogenesis is still controversial, recent systematic reviews and meta-analyses have confirmed a strong association between EBV and MS susceptibility20. Nearly 100% of patients with MS are seropositive for EBV compared to 90-95% of healthy people28. Disease mechanisms linking EBV infection to MS pathology are to date largely hypothetical. Suggested mechanisms through which EBV infection can contribute toCNS inflammation include activation of autoreactive T-cells by EBV through molecular mimicry, selective enrichment and activation of EBV-infected B cells in ectopic meningeal follicles and perivascular inflammatory CNS infiltrates, enhanced breakdown and presentation of self-antigens or expression of viral superantigens29.

Pathology MS pathology is characterized by focal demyelinating lesions in the CNS. These can occur in both gray and white matter tissueTable ( 1)30 and can be detected with MRI8. White matter lesions are classified based on activation of the immune system and the extent of demyelination2. Active MS lesions are characterized by ongoing demyelination and activation of innate and adaptive immune cells. In active MS lesions, the blood-brain barrier (BBB) is compromised allowing monocyte-derived macrophages and T cells to invade the lesion area and to initiate the demyelination process2, 31, 32. Demyelination is induced by destruction of myelin sheaths, the protective layer surrounding axons, as well as by loss of oligodendrocytes, the cells that produce the myelin33. Within active lesions, activated microglia and infiltrating macrophages engulf large amounts of myelin, which induces a foamy appearance34. Other common hallmarks of active lesions are axonal damage and neuronal loss, which correlate to the degree of inflammation in the lesion35, 36. Active lesions may progress into chronic active lesions over time, in which demyelination by microglia and macrophages is limited to the rim of the lesion, where myelin is still present. The centre of such chronic active lesions is completely demyelinated, devoid of innate immune cells and populated by hypertrophic astrocytes that form a gliotic scar2, 37. Once the immune response completely resides these lesions are called inactive2. Recently, subtle abnormalities in the normal appearing white matter (NAWM) of MS patients have been described. Clusters of microglia that express high levels of HLA-DR and CD45 are observed in tissue without evident signs of demyelination or infiltration. These clusters can be found in the vicinity of established lesions, but also in NAWM unrelated to other lesions2, 38. Microglia clusters are associated with oxidative stress, axonal damage, oligodendrocyte abnormalities and elevated levels of heat shock proteins38-41, and have been suggested as a primary event leading to lesion formation, so called ‘pre-active lesions’. Whether these microglia clusters indeed represent an initial step in lesion formation is still debated, but it is likely that the majority of them resolve without progressing into an active demyelinating lesion38. Over time, remyelination of MS white matter lesions may occur, which can – partially – restore axon function. Remyelination is facilitated by oligodendrocyte precursor cells. These are recruited into the lesions and differentiate into remyelinating oligodendroctyes42. Indeed, thinly myelinated

12 General introduction 1

axons, indicative of remyelination, are observed in demyelinated lesions43, 44. In combination with functional reorganization of the brain, a process in which healthy brain regions take over the function of damaged areas45, remyelination may explain the relapsing-remitting nature of symptoms during early stages of MS. However, although remyelination may be extensive in early disease stages, the capacity for myelin repair declines over time, which may contribute to the progressive nature of the disease42, 46. Gray matter lesions are classified by their anatomical location47. Leukocortical (type I) lesions extend in both white and gray matter. Type II and IV lesions are intracortical lesions. Type II lesions are small lesions that do not touch the pial surface nor the white matter border, whereas type IV lesions cover the cortex from the pia to the white matter border. Type III lesions are subpial lesions, which are the most common gray matter lesions and can extent several gyri47. Pathology of gray matter lesions differs from that of white matter as they lack obvious BBB dysfunction, infiltration of macrophages and T cells as well as astrogliosis47, 48. However, significant axonal transection and neuronal loss have been demonstrated in gray matter lesions, which may account for cortical thinning as observed in MS patients. This thesis mainly focuses on white matter lesions, as these are most clearly associated with extensive activation of microglia.

White matter lesions Microglia nodules Clusters of HLA-DR+ cells in otherwise NAWM Active Characterized by demyelination, neurodegeneration and infiltration and activation of innate and adaptive immune cells Chronic active Characterized by a demyelinated centre that is populated by hypertrophic astrocytes and surrounded by a rim of activated immune cells Inactive Demyelinated scar populated by hypertrophic astrocytes; no activated immune cells present Gray matter lesions Type I Leukocortical; extend in both white and gray matter Type II Intracortical; small lesions that do not touch the pial surface nor the white matter border Type III Subpial lesions Type IV Intracortical; covers the cortex from the pia to the white matter border

Tabel 1. Overview of MS lesion types

Treatment A wide range of disease-modifying treatment options are available. Current therapeutical efforts are mainly targeted at dampening the immune response and are particularly effective in controlling acute exacerbations during the relapsing remitting phaseFigure ofMS( 1). Acute exacerbations, defined as new neurological symptoms that have progressed over the last 24-48 hours not triggered by a metabolic cause, are treated with glucocorticoids to reduce the duration and severity of the attack49. For long-term treatment of RRMS, commonly used treatment options include β-interferons (IFNβ), glatiramer and dimethyl fumarate. These drugs prevent accumulation of new brain lesions and delay conversion to definite MS50. Although these drugs have been in use for years, their working mechanisms are still not completely understood. In general they are

13 Chapter 1

well tolerated51-54, but they are not effective in all patients55, 56. Other treatment options include mitoxantrone, fingolimod or monoclonal antibodies, such as natalizumab and alemtuzumab. Mitoxantrone is a type II topoisomerase inhibitor that inhibits proliferation of lymphocytes and macrophages57. Fingolimod binds to and downregulates sphingosine 1 phosphate receptors and thereby regulates lymphocyte egress from lymphoid tissues into the circulation58. Natalizumab binds to very late activation antigen (VLA)-4 and thereby inhibits migration of lymphocytes into the CNS59. Alemtuzumab binds to CD52 and thereby induces depletion of lymphocytes60. These therapies effectively limit clinical symptoms and the formation of new lesions57, 61. However, they are often associated with serious adverse effects, such as potentially fatal progressive multifocal leukoencephalopathy, leading to discontinuation of the treatment57, 61. Whereas current therapeutic strategies are effective during the relapsing remitting phase when the immune system plays a prominent role, they are in general ineffective during the progressive phase50, 62. As the progressive phase is characterized by neurodegeneration and axonal loss, efforts to develop therapies are now aiming at neuroprotection and initiation of the remyelination process63. However, there are no therapeutical options currently available to effectively treat the progressive phase of the disease.

Experimental autoimmune encephalomyelitis For both exploratory and applied research into MS, models have been developed in which an experimental form of neuroinflammation is induced in animals64-66. The most widely used animal model is experimental autoimmune encephalomyelitis (EAE). Active EAE is induced by immunization with myelin proteins, such as myelin oligodendrocyte glycoprotein (MOG) or proteolipid protein (PLP), in combination with an adjuvant. Adjuvants are immunostimulating agents that act to accelerate, prolong, or enhance antigen-specific immune responses without having any specific antigenic effect in itself67, 68. EAE can be induced in several species, such as mice, rat, guinea pigs, and non-human primates (NHP)66, 69. NHP models include outbred marmosets and rhesus macaques70, 71, which are relevant species due to their close immunological proximity to humans72. In adult, outbred rhesus macaques EAE can be induced by immunization with recombinant human (rh)MOG. Rhesus EAE is characterized by an early disease onset and very rapid disease progression73-76. Clinical symptoms include loss of appetite, ataxia, visual problems and paralysis. Pathological characteristics include edema and large inflammatory foci with extensive demyelination. Activation of innate as well as adaptive immune cells is observed within these lesions73, 76. Rhesus EAE models have mainly been used to study the effect of immunotherapies targeting T and B cells, as MOG-reactive T and B cells are present in this model73, 74, 76. However, these models are also suitable to study activation of innate immune cells, as increased microglia activation and infiltration of peripheral monocyte-derived macrophages are observed in focal inflammatory lesions as well75, 76. In this thesis rhesus EAE models will be used for comparison of in situ findings in MS tissue. In vivo disease models can be complemented and refined by using in vitro methodology, including primary (co-)cultures of CNS cells and organotypic brain slice cultures66. Such methods can be used as pre-in vivo screening tool for potential therapeutic compounds and to study fundamental biological questions that are difficult to study in vivo. In this thesis, in vitro primary

14 General introduction 1

microglia cultures derived from brain tissue of adult, healthy rhesus macaques were used to study microglia activation in detail.

In vitro microglia Various in vitro methods to study microglia have been developed, including microglia cell lines, stem cell-derived microglia cultures and dissociated primary cell cultures. Each of these methods has specific advantages and limitations. Most microglia cell lines are derived from primary cell cultures of the brain or spinal cord, which were immortalized by transfection with oncogenes (e.g. v-myc, v-raf, v-mil, SV40 T antigen). Non-transformed microglia cell lines have been derived from microglia precursors with prolonged proliferative capacity. Commercially available microglia cell lines are of mouse, rat and human origin (Table 2). The main advantage of using microglia cell lines is their easy maintenance and abundant availability due to their high and unrestricted proliferative capacity77. Thereby, these cells are suitable for high throughput screening assays where high cell numbers are required. Major disadvantages of microglia cell lines include that they are highly susceptible to dedifferentiation and are prone to the selection of specific phenotypes over78 time . Furthermore, viral transformation or immortalization may alter the microglial phenotype, which warrants caution when interpreting results.

Species Cell line Immortalization procedure Reference Mouse BV2 Neonatal murine microglia transformed with v-raf/v-myc oncogene 79 carrying retrovirus (J2) N3, N9, N11, Primary cultures from embryonic mouse brain transformed with 80 N13 v-myc or v-mil oncogenes of the avian retrovirus MH2. Clones N3, N9, N11 and N13 express microglia markers F4/80, FcR and MAC-1. EOC-2, Non-virus transformed CSF-1-dependent cell lines derived from 81 EOC-13.31, individual microglia precursors; EOC-2 does not express MHCII EOC-20 C8-B4 Derived from a committed microglia precursor 82 MG5 Neonatal murine microglia derived from p53-deficient mice 83 MG6 Neonatal murine microglia transformed with the c-myc oncogene 84 MG20 Neonatal murine microglia derived from tga20 prion protein- 85 overexpressing mice transformed with the c-myc oncogene SIM-A9 Neonatal murine microglia with prolonged proliferative capacity. 86 Express microglia/macrophage markers CD68 and Iba-1. RA2 Non-enzymatic and non-virus transformed GM-CSF-dependent 87 clonal microglia cell line derived from neonatal mice Rat MLS9 Immortalized cells derived from neonatal rat brain tissue, cultured 88 for several weeks on CSF-1 and then withdrawn from CSF-1. Express microglia markers isolectin-4B, OX-42 and ED-1. HAPI Aggressively proliferating immortalized cells derived from cultures 89 that have been enriched for microglia. Express microglia markers isolectin-4B, OX-42 and GLUT5. Human HMO6 Embryonic human microglia transformed with a v-myc oncogene 90 carrying retroviral vector (PASK 1.2) CHME/ Embryonic human brain-derived macrophages transformed with a 91 C13-NJ plasmid encoding for the large T antigen of SV 40

Table 2. Overview of available microglia cell lines derived from mouse, rat and human origin

15 Chapter 1

Murine or human mature monocytes or bone marrow-derived immature monocytic cells have been reported to differentiate into microglia-like cells when co-cultured with astrocytes or exposed to glial cell-conditioned medium92-95. However, recent studies have demonstrated that microglia originate from immature myeloid progenitor cells rather than from hematopoietic progenitors96. Promising novel methods have therefore been developed to generate microglia from murine and human embryonic stem cells or from human induced pluripotent stem (iPS) cells97-100. Although this methodology may provide researchers with a readily available source of microglia, these cells have never been exposed to the CNS microenvironment. How this lack of exposure to CNS-specific environmental cues affects microglial differentiation and function remains to be established. Dissociated cultures of primary microglia can be derived from mouse, rat, NHP and human brain tissue. Primary microglia from mice and rat are generally derived from brain tissueof neonatal animals101, although more studies are now reporting the use of adult animals as well78. The advantage of using rodent primary microglia is that these animals form a genetic homogenous, specific pathogen free (SPF) population where ante mortem conditions and post mortem delay can be tightly controlled. Furthermore, the use of primary microglia derived from transgenic mice has been instrumental in delineating the role of specific genes in microglia activation. Limitations of rodent primary microglia include their evolutionary divergence from humans and lack of heterozygosity due to inbreeding and their aseptic housing conditions102. Differences between rodent and human in innate immune responses as well as microglia activation have been described to hamper translation of rodent (neuro)immunological studies to the clinic102, 103. To enable research using human brain tissue, brain banks have been set up worldwide (e.g. the Netherlands Brain Bank; http://www.brainbank.nl/). Dissociated cultures of human primary microglia can either be derived from fetal tissue that becomes available after abortion or from post mortem brain tissue that becomes available from deceased human donors104, 105. Interestingly, microglia can be isolated from human brain tissue from a range of neurological disease states. Thereby, specific features of these ‘diseased’ microglia can be studied. The use of human microglia allows better translation of preclinical research findings to the clinic. Primary human microglia are derived from different individuals reflecting the genetic variability within a population and translation of results is not hampered by the use of a genetically divergent species102. Limitations of human primary microglia include the limited availability of (healthy) human brain tissue, and the limited control over the ante mortem conditions and post mortem delay106. Alternatively, our group uses primary in vitro microglia derived from rhesus macaques (Macacca mulatta)107. These can be used to bridge the gap between rodent and human primary microglia models. Microglia are isolated from outbred, healthy adult monkeys with control over ante mortem conditions and post mortem delay. As NHP are in close evolutionary proximity to humans, their genetic repertoire more closely resembles that of humans when compared to rodents. An overview of specific characteristics of each model is provided inTable 3102, 106, 108.

16 General introduction 1

Human Non-human primate Rodent Genetic distance None Close evolutionary Considerable evolutionary to humans proximity to humans divergence from humans Breeding Outbred Outbred Inbred Environment Non-SPF Non-SPF SPF Ante mortem Incontrollable and often Controllable and well Controllable and well conditions unknown described described Post mortem delay 4-24 hours at best None None Donor age Fetal or aged adults Adult Fetal/neonatal (most often) Donor characteristics Neurological disease, Free of neurological Free of neurological (most often) shortage of non-diseased diseases diseases donors Availability Limited: brain banks Limited: primate centers Widely available Microglia yields 0.1-0.5 *106 cells/gram 0.6-1.2 *106 cells/gram 0.3-1*106 cells/brain; can wet brain tissue; often 1-2 wet brain tissue; 25 gram be pooled from multiple gram available109 available107 brains of inbred animals110 Availability other Limited Good Good tissues from the same donor

Table 3. Comparison of human, non-human primate and rodent microglia models

Microglia

Origin and phenotypes Microglia were first described by del Rio-Hortega early inth the20 century. Microglia are tissue-resident innate immune cells of the CNS that constitute about 5-10% of all CNS cells111. As mentioned above, microglia are derived from primordial progenitors that seed the CNS during embryonic development96, 112, 113. Throughout adult life microglia are maintained by local self- renewal without replenishment from hematopoietic progenitors. Thereby, they form a distinct population from circulating blood monocytes and hematopoietic macrophages96, 112, 114, 115. Microglia continuously survey their microenvironment with their highly motile processes116, 117. They are subject to many inhibitory signals from their microenvironment and, in the absence of strong activating signals, will remain in a resting state. Transforming growth factor-β (TGFβ) is an anti-inflammatory cytokine that is constitutively expressed in the CNS and inhibits microglia activation in the non-inflamed brain118. Furthermore, cell-cell interactions between microglia and neurons yield inhibitory signals for microglia. For example, neuronal cell surface proteins CD47, CD200, and CD22 interact with CD172, CD200 receptor (CD200R), and CD45 on microglia respectively119, 120. Loss or disruption of constitutive inhibitory signaling leads to a more activated microglia phenotype118, 121. For example, loss of CD200-CD200R signaling leads to the increased expression of activation markers CD11b and CD45 on microglia in healthy CNS tissue. In addition, these microglia loose their ramified morphology and can form aggregates, which are normally not observed in healthy CNS tissue. This more activated microglial state is associated with a more

17 Chapter 1

rapid onset of EAE, implicating that these inhibitory signals are important to regulate microglia function in healthy and diseased CNS tissue121. Exposure to specific growth factors and cytokines can lead to polarization of microglia. Classically, exposure to IFNγ and lipopolysaccharide (LPS) in vitro induces a pro-inflammatory phenotype, which is characterized by upregulation of cell surface markers CCR7, CD74, CD80, CD86, CD40 and CD64 as well as by production of IL-12p40 and CXCL10104, 122. Alternatively, exposure to IL-4 induces an anti-inflammatory phenotype, which is characterized by upregulation of the cell surface markers mannose receptor (MR), CD209 and CD163, as well as by production of CCL22104, 122. However, microglia retain their plasticity to switch between pro- and anti- inflammatory phenotypes and can display a spectrum of intermediate phenotypes104, 123.

Function during homeostasis Microglia are a major source of neurotrophic and growth factors within the CNS, including insulin-like growth factor 1 (IGF1), brain derived neurotrophic factor (BDNF), nerve growth factor (NGF) and TGFβ124-128. These factors regulate proliferation of neuronal progenitors, survival of neurons and oligodendrocytes, axon growth, synapse formation and oligodendrocyte differentiation129-131. Thereby, microglia contribute to normal CNS development. In addition to supporting neurogenesis, microglia contribute to the clearance of superfluous neurons during CNS development and adult neurogenesis132, 133. Such apoptotic neurons can secrete ‘find-me’ signals to attract microglia, including adenosine 5’- triphosphate (ATP), uridine 5’-triphosphate (UTP) and chemokines such as CXCL10 and CX3CL1134. Microglia recognize these signals by purinergic receptors and chemokine receptors CXCR3 and CX3CR1 that direct their migration116, 135-137. In addition, apoptotic cells express ‘eat-me’ signals that can induce phagocytosis, including expression of phosphatidylserine (PtdSer) on the cell surface and secretion of uridine 5’-diphosphate (UDP) and soluble milk fat globule-EGF-factor 8 (MFG-E8)136, 138, 139. Microglia express different receptors that recognize these signals, including T cell immunoglobulin mucin 4 (TIM-4), purinergic receptor P2Y6 and triggering receptor expressed on myeloid cells-2 (TREM2). Activation of these receptors facilitates phagocytosis and clearance of apoptotic cellular debris. As this is in general not associated with the production ofpro- inflammatory mediators, microglia protect reminiscent neurons by preventing collateral inflammation-induced damage136, 140, 141. Furthermore, microglia are involved in synapse elimination or synaptic pruning, which is required to establish efficient neuronal networks. Inappropriate synaptic connections are tagged by complement components C1q and C3142. Microglia express the complement C3 receptor (CR3/ Mac-1/CD11b-CD18), which enables phagocytosis of complement-tagged synaptic material. Thereby, microglia contribute to restructuring of neuronal connections by phagocytosis of synaptic material143.

Function during stress Microglia form the first line of defense against pathogens and injury within the CNS. Microglia activation has been associated with infectious CNS diseases, neurodegenerative diseases, traumatic brain injury (TBI) and ischemia, neuropsychiatric disorders and autoimmune diseases. When activating signals are encountered, microglia switch their behavior from patrolling the CNS

18 General introduction 1

to shielding of the injured site116, 144. By extending their processes and moving towards the affected site microglia form a physical barrier between healthy and injured tissue, preventing further spreading of cellular stress within the CNS. By expression of various innate immune receptors (as described in detail below) microglia can recognize molecules expressed by pathogens and danger signals derived from necrotic, damaged or stressed neurons145. Such danger signals include matrix metallopeptidase (MMP)-3, α-synuclein, neuromelanin, ATP, heat shock proteins and high mobility group box 1 (HMGB1)116, 146-148. Activated microglia can attract other innate and adaptive immune cells to the site of inflammation by the secretion of various chemokines. Chemokines produced by microglia include CCL2, -3, -4, -22, CXCL8 and -10, macrophage inflammatory protein (MIP)-1α and -1β104, 107, which attract peripheral immune cells to infiltrate the brain parenchyma. In addition, microglia can present antigens to cells of the adaptive immune system. Microglia express Fc receptors (FcR), including FcγR I, II and III, and complement receptors CR1, -3, -4 and C1qRp143, 145, 149, 150. These opsonic receptors facilitate phagocytosis of pathogens and cellular debris that are tagged by antibodies or complement proteins. This not only contributes to clearance of pathogens and cellular debris from CNS tissue, but also induces presentation of derived antigens to the adaptive immune system. Microglial antigen presentation maygo accompanied by the increased expression of major histocompatibility complex (MHC) molecules and co-stimulatory molecules, such as CD40, CD80 and CD86104, 107, 151. Whether microglial antigen presentation leads to the induction/re-activation of antigen-specific adaptive immune responses or rather to tolerization is dependent on additional environmental cues, such as the presence of pro- or anti-inflammatory cytokines107, 151-154. Microglia themselves can produce a plethora of pro- and anti-inflammatory cytokines104, 107. Pro-inflammatory cytokines produced by microglia include IL-1β, IFNγ, tumor-necrosis factor (TNF)α, IL-6 and IL-12104, 107, 155, 156. Secretion of these cytokines can induce, amplify and/or skew pro-inflammatory responses. For example, IL-1β can specifically induce and amplify Th17 responses157-159, whereas IL-12 skews towards Th1 responses160. Anti-inflammatory cytokines produced by microglia include IL-1-receptor antagonist (IL-1RA), TGFβ and IL-10104, 156. In contrast to pro-inflammatory cytokines, secretion of these cytokines can dampen pro-inflammatory responses and induce regulatory responses. For example, IL-1RA prevents IL-1β-mediated signaling by binding to the IL-1 receptor without subsequent activation161, while IL-10 induces regulatory T cells151. Thereby, these anti-inflammatory cytokines can prevent or contribute to the resolution of an inflammatory response. In summary, microglia can efficiently aid in the removal of pathogens and other potential harmful substances from the CNS and can help to induce an efficient, appropriate immune response thereby reinforcing tissue homeostasis under pathological conditions. However, exaggerated or persistent activation of microglia can contribute to tissue damage and neurodegeneration146. For example, chronic human immunodeficiency virus (HIV) infection within the CNS, accumulation of amyloid β plaques in AD, or the production of autoantibodies in MS have been reported to cause overactivation or dysregulation of microglia146, 162. This is associated with oligodendrocyte death, demyelination and increased neuronal vulnerability. Furthermore, production of neurotoxic factors by microglia, such as reactive oxygen species (ROS), nitric oxide, IL-1β and TNFα, can directly lead to neurodegeneration146.

19 Chapter 1

Microglia and multiple sclerosis Activated microglia are observed in all types of MS lesions2, 38 and may influence the disease course positively and negatively. As microglia can phagocytose cellular and myelin debris, they can clear potential neurotoxic components from the CNS and thereby protect surrounding cells. In fact, clearance of myelin debris is required for effective remyelination of MS 163lesions . In addition, microglial production of neurotrophic factors may be important for neuronal survival and neuroregeneration164, 165. Furthermore, microglia may regulate the immune response by the production of anti-inflammatory cytokines, such as IL-1041. By contrast, microglia can orchestrate a detrimental immune response by the production of chemokines, pro-inflammatory cytokines, and by efficient antigen presentation. Activated microglia and macrophages in pre-active and active lesions produce a wide range of pro-inflammatory cytokines, including IL-23 and TNF, and chemokines, including monocyte chemotactic protein (MCP)-1, MIP-1α and MIP-1β41, 166-168. In addition, microglial expression of MHC class II molecules and of costimulatory factors, such as CD40, CD86, and CD80, is increased in active lesions2, 38, 104, 169. This is indicative of antigen presentation to T cells, which may be autoreactive or otherwise pathogenic. Furthermore, microglia and macrophages produce large amounts of ROS and nitric oxide by increased expression of NADPH oxidase and inducible nitric oxide synthetase41, 170, 171. As this causes damage to lipids, proteins and DNA of surrounding cells, microglia can directly contribute to cellular injury, which may lead to a self-sustaining mechanism of microglia activation. Until recently microglia could not be distinguished from peripheral monocyte-derived macrophages that have entered the CNS78. This has hampered researchers to establish the relative contribution of microglia and macrophages to MS pathogenesis, which remains to be further investigated. Although the exact cause of microglia activation in MS is not known, pattern recognition receptors (PRR) of the innate immune system are likely involved as they can recognize a wide range of ligands that are associated with MS pathogenesis.

Expression of pattern recognition receptors In addition to the FcR and CR that are involved in phagocytosis149, 150, microglia express various PRR that recognize pathogen- (PAMP) or danger-associated molecular patterns (DAMP), including integrin CD11b, MR, LPS-binding CD14, Toll-like receptors (TLR), NLR and retinoic acid-inducible gene I-like receptors (RLR)104, 107, 172-175. TLRs are the most extensively studied PRR in microglia119. TLRs are trans-membrane proteins that scan the extracellular space and lumen of intracellular vesicles for the presence of pathogens or molecules associated with damaged cells and tissue injury. Ligand recognition induces activation of the transcription factors NFκB, AP1 and IRF3 via multiple intracellular signaling cascades. This subsequently leads to the production of pro-inflammatory mediators and to the upregulation of molecules that are implicated in activation of the adaptive immune system119, 176. Multiple TLRs are constitutively expressed on microglia or can be induced during viraland bacterial infections and during CNS auto-inflammatory responses107, 176, 177. In addition to TLRs, microglia can express various NLRs and RLRs172-175. These cytosolic receptors scan the intracellular compartment for the presence of intracellular pathogens or endogenous molecules associated with cellular stress. Like TLRs, activation of RLRs and specific NLRs induces transcription of antiviral or pro-inflammatory cytokines through activation of

20 General introduction 1

transcription factors178-180. In addition, NLRs can also form large complexes called inflammasomes that are involved in the post-translational modification of pro-inflammatory cytokines, such as pro-IL-1β4, which will be the main focus of this thesis.

Inflammasomes

Inflammasomes are key components of the innate immune system. Their function as central platforms for the processing and secretion of cytokines of the IL-1 family was first described in 20023. Inflammasomes are cytosolic multiprotein complexes consisting of NLRs and inflammatory caspases that can assemble either directly or indirectly via adaptor proteins. Thereby, inflammasomes link perturbances in cellular homeostasis, sensed by NLRs, to caspase-dependent processing and secretion of pro-inflammatory cytokines as IL-1β4.

Structure NLR NLRs are cytosolic PRR that scan the intracellular compartment for invading pathogens and endogenous molecules associated with cellular stress. To date 23 human NLRs have been described (Table 4)4. Various NLRs have been described to form functional inflammasomes3, 181- 185. In addition, NOD1 and NOD2 can directly induce transcription of pro-inflammatory cytokines and chemokines via NFκB and IRF3-signalling180. Other NLRs are involved in regulation of TLR- and inflammasome-mediated activation, as described in detail below, or appear to be more involved in non-immune pathways such as embryonic development186. NLRs are multidomain proteins containing a C-terminal leucine rich repeat (LRR) thatis involved in ligand recognition, a central NOD (also called NACHT) domain that allows oligomerization of NLRs, and an N-terminal effector domain that is involved in recruitment of inflammatory caspases to the NLR4. In contrast to other NLRs, the absent in melanoma 2 (AIM2) receptor contains a C-terminal HIN200 domain that specifically recognizes non-sequence-specific cytosolic DNA187. The effector domain of a NLR can be a caspase recruitment domain (CARD), a pyrin domain (PYD) or a baculoviral IAP repeat (BIR). CARD-containing NLRs can directly oligomerize with inflammatory caspases188, 189. By contrast, PYD- and BIR-containing NLRs cannot directly oligomerize with inflammatory caspases and are dependent on adaptor proteins for the recruitment of inflammatory caspases Figure( 2)181, 182, 185, 190.

Adaptor proteins Apoptosis-associated speck-like protein containing a CARD (ASC) is the most widely studied adaptor protein involved in inflammasome activation. ASC contains a N-terminal PYD anda C-terminal CARD through which it can physically interact with NLRs and inflammatory caspases respectively3, 273, 274. Thereby, ASC can facilitate formation of the inflammasome complex. Multiple binding sites on the PYD of ASC allow for interaction with the NLR as well as for self-oligomerisation. This leads to formation of large intracellular complexes, called specks, consisting of multiple NLR, ASC and caspase molecules275, 276. Recently, the formation of ASC specks was proposed as a good read-out for inflammasome activation277. In most cells only one or two of these specks are

21 Chapter 1

NLR family Gene name Human Rhesus Mouse Exogenous ligands Endogenous ligands Target Ref protein orthologue orthologue PYD-containing NLRP1 NALP1 NALP1 NALP1a-c Anthrax lethal toxin, Toxoplasma Intracellular ATP depletion, neuronal Activate: ASC, CASP1, CASP5 3, 188, 191-200 NLRs gondii, muramyl dipeptide, stress, Aβ, low intracellular [K+] NLRP2 NALP2 NALP2 NALP2 Fusobacterium nucleatum ATP Activate: ASC, CASP1 184, 201-203 Regulate: IKK, NIK, TBK1 NLRP3 NALP3 NALP3 NALP3 Bacterial pore forming toxins, ATP, ROS, mitochondrial dysfunction, Activate: ASC, CASP1, CASP5 198, 204-207 viral proteins, crystal structures, lysosomal acidification, protein abnormal protein aggregates aggregates, low intracellular [K+] NLRP4 NALP4 NALP4 NALP4a-g Viral double-stranded RNA, Double-stranded RNA or DNA Regulate: TBK1, Beclin1 208, 209 Streptococcus pyogenes NLRP5 NALP5 NALP5 NALP5 Not known Not known - NLRP6 NALP6 NALP6 NALP6 Not known Not known Regulate: MAPK, NFκB 210-213 NLRP7 NALP7 NALP7 - FSL-1, MALP-2, PAM2CSK4, Not known Activate: ASC, CASP1 182, 214 PAM3CSK4, bacterial diacylated Regulate: NLRP3, FAF1 lipopeptides,Mycoplasma spp. NLRP8 NALP8 NALP8 - Not known Not known - NLRP9 NALP9 NALP9 NALP9a-c Not known Not known - NLRP10 NALP10 NALP10 NALP10 Not known; Lacks LRRs ASC, NOD1 Regulate: ASC, CASP1, NOD1, NEMO, RIP2, TAK1 215-218 NLRP11 NALP11 NALP11 - Not known Not known - NLRP12 NALP12 NALP12 NALP12 Acylated lipid A Not known Activate: ASC, CASP1 185, 212, 219-221 Regulate: NIK, IRAK1, TRAF3 NLRP13 NALP13 NALP13 - Not known Not known - NLRP14 NALP14 NALP14 NALP14 Not known Not known - AIM2 AIM2 AIM2 AIM2 Viral and bacterial double Cytosolic apoptotic or mitochondrial Activate: ASC, CASP1, PKR 181, 222-229 stranded DNA, L. monocytogenes DNA BIR-containing NAIP NAIP NAIP NAIPa-g Flagellin, inner rod proteins of Not known Activate: IPAF/NLRC3 230-234 NLR the T3SS proteins, needle proteins of the T3SS CARD- NLRC4 NLRC4 NLRC4 NLRC4 Flagellin, T3SS proteins, P. Palmitate, ceremide Activate: ASC, CASP1, CASP8 183, 189, 232, containing aeruginosa, S. typhimurium, 234-245 NLRs Shigella flexneri, B. pseudomallei, L. monocytogenes NOD1 NOD1 NOD1 NOD1 Bacterial peptidoglycan-derived Lauric acid Activate: CASP9, RIP2, NFκB 179, 180, 246-248 meso-diaminopimelic acid and mesolanthionine, NOD2 NOD2 NOD2 NOD2 Bacterial peptidoglycan-derived Lauric acid Activate: RIP2, NEMO, TAK1, NFκB, MAPK, IRF3, 179, 180, 205, muramyl dipeptide, viral ssRNA DUOX2, OAS2, NLRP1, CASP1 249-255 NLRC3 NOD3 NLRC3-like NLRC3 Not known Not known Regulate: STING, TRAF6, ASC, IκBα 256-259 NLRC5 NOD4 NLRC5 NLRC5 Rhinovirus Disturbed intracellular Ca2+ Activate: NLRP3, ASC, CASP1 260-263 homeostasis Regulate: RFX protein complex, CREB/ATF1; IKKα/β; RIG-I; MDA5 NLRX1 NOD5 NLRX1 NOD5 Viral protein PB1-F2, Rhinovirus (dsRNA/ssRNA; Hong?) Activate: CASP8, DRP1, TUFM 205, 264-272 RNA, poly(I:C), viral dsRNA, viral Regulate: MAVS, TRAF6, TRAF3, NEMO, IKK ssRNA

Table 4. Overview of NLR subfamilies, human NLRs, rhesus and murine ortologues, their endogenous and exogenous ligands and their targets for activation or inhibition.

22 General introduction 1

23 Chapter 1

Figure 2. Inflammasome structure. NLRs are multidomain proteins containing a C-terminal LRR, a central NOD and an N-terminal effector domain that can be a PYD, BIR or CARD. PYD-containing NLRs are dependent on adaptor proteins, such as ASC, for the recruitment of caspase 1. ASC contains a N-terminal PYD and a C-terminal CARD. ASC can bind to the NLR and caspase 1 through homotypic PYD-PYD and CARD-CARD interactions, respectively. By contrast, CARD- containing NLRs can directly oligomerize with caspase 1 through homotypic CARD-CARD interactions.

formed upon inflammasome activation, which can be visualized microscopically as theycan reach a size of 1 μm278. Interestingly, these ASC specks can be passively released into the extracellular space during pyroptosis, taken up by neighboring cells via phagocytosis and thereby further propagate inflammation275. ASC specks can also be detected in serum and tissue fluids of diseased patients and they are currently considered as a therapeutic target275, 279. Another adaptor protein that can facilitate inflammasome complex formation is CARD- containing protein 8 (CARD8, also known as CARDINAL)190. Much less is known about this adaptor protein, since it is not expressed in rodents4. CARD8 contains a N-terminal function to find (FIIND) domain and C-terminal CARD190. The FIIND domain can interact with the NOD domain of NACHT-, LRR- and PYD-containing protein (NALP)2 and NALP3. Furthermore, the CARD domain can physically interact with the CARD domain of caspase 1, thereby facilitating formation of the inflammasome complex190, 280. Although CARD8 can be involved in IL-1β maturation through activation of caspase190 1 , CARD8 can also negatively regulate NALP3-mediated IL-1β secretion280, 281. Therefore its role as adaptor protein is still disputed. In addition to these adaptor proteins that allow oligomerisation of the inflammasome complex, other proteins have been suggested to facilitate inflammasome activation, including protein kinase R (PKR), end binding protein-1 (EBP-1) and PKCδ224, 282, 283. Furthermore, neuronal apoptosis inhibitor protein (NAIP) is required for activation of the NLR family, CARD domain containing 4 (NLRC4) inflammasome, as it can directly bind to bacterial ligands, such as flagellin or the inner rod component of bacterial type III secretion systems234, and subsequently activates the NLRC4 inflammasome230, 231, 244.

24 General introduction 1

Caspases Caspases form a family of cysteine proteases that are mainly known for their essential roles in apoptotic cell death, proliferation and differentiation. Inflammatory caspases are involvedin innate immune responses and include caspase 1, 4, 5, 11 and 12 (Table 5)284. These caspases are synthesized as inactive enzyme precursors and need oligomerization and/or undergo proteolytic cleavage to become active284. Inflammatory caspases express a large N-terminal CARD domain, through which they can be recruited to inflammasome complexes and activated. Upon activation, inflammatory caspases are able to cleave and activate inflammatory substrates284. Caspase 1 was previously known as IL-1β converting enzyme (ICE) and is the best-characterized inflammatory caspase. As its former name indicates, caspase 1 can convert precursor proteins of the IL-1 family to mature, bioactive cytokines. Caspase 1 is transcribed as procaspase 1 zymogen, and resides inactive in the cytosol until it becomes proteolytically activated. Caspase 1 can be activated via NALP1, -3, -7, -12, AIM2 and NLRC4 inflammasomes3, 181, 182, 285, 286. By formation of an inflammasome, multiple caspase 1 molecules are brought in close proximity3, leading to self- activation and the formation of active 10- and 20-kilodalton (kDa) subunits that can form an enzymatically active tetramer consisting of two of each subunits3, 287-289. Activated caspase 1 can subsequently cleave specific substrates after aspartic acid residues, including pro-IL-1β, pro-IL-18 and pro-IL-33. Other, less well-characterized, inflammatory caspases are also involved in innate immune responses. Murine caspase 11 plays a similar role as caspase 1 during inflammation, since caspase 11 deficient mice have a comparable phenotype as caspase 1 deficient mice290. However, many studies on caspase 1 deficient mice involve CASP1-/-/CASP11-/- double knockout mice291. A recent study used true CASP1-/- and CASP11-/- deficient mice, in which theCASP1 or CASP11 gene has been reintroduced in double knock-out mice. This study showed that murine caspase 11 can bind to and activate caspase 1 and induces IL-1β secretion in response to E.Coli, Citrobacter rodentium and Vibrio cholerae, but is dispensable for IL-1β secretion in response to ATP and monosodium urate (MSU). Furthermore, caspase 11 rather than caspase 1 is required for noncanonical inflammasome-triggered cell death and mortality in mice to a lethal dose of LPS291. Caspase 4 and 5 are thought to be the human orthologues of murine caspase 11, although they resemble caspase 11 for only 60% and 54% respectively (protein alignments for all transcript variants). Caspase 5 can form an inflammasome complex with NALP1, ASC and caspase 1. Whereas binding of caspase 5 to the NALP1 receptor is sufficient to induce proteolytic activation of caspase 5 and subsequent processing of pro-IL-1β, this is most efficient when caspase 1 is simultaneously activated3. By contrast, caspase 4 cannot physically interact with NALP1, NALP3, AIM2 or ASC, and therefore it is not likely that it can form functional inflammasomes. However, caspase 4 can physically interact with the p20 subunit of caspase 1 (but not the CARD domain) and thereby support caspase 1 activation and caspase 1-dependent maturation of pro-IL-1β292. Whereas murine caspase 12 is involved in endoplasmatic reticulum stress-induced apoptosis293, human caspase 12 is expressed as an enzymatically inactive form, due to a polymorphism in the human gene294. Thereby, human caspase 12 is involved in dominant negative regulation of the IL-1 pathway, and grouped with the regulatory proteins. In this thesis the expression of NLR, adaptor proteins and caspases in microglia will be extensively characterized.

25 Chapter 1

26 General introduction 1

Human NHP Rodent Caspase 1 Caspase 1 Caspase 1 Caspase 4 Caspase 4 - Caspase 5 Caspase 5 - - - Caspase 11 Caspase 12 (inactive) Caspase 12 (active) Caspase 12 (active)

Table 5. Overview of inflammatory caspases expressed in human, NHP and rodents

Function Inflammasomes are critical for activation of cytokines of the IL-1 cytokine family, including pro-inflammatory cytokines IL-1α, IL-1β, IL-18 and IL-33, and the anti-inflammatory cytokine IL-374, 295-297. These cytokines are produced as inactive precursors that cannot be secreted via classical secretory pathways and therefore remain in the cytosol in their inactive form. These precursor proteins express a cleavage site for inflammatory caspases and they are processed to their active forms and secreted upon inflammasome activation3. This thesis will mainly focus on the pro-inflammatory cytokine IL-1β. In general, the secretion of IL-1β is regulated by two independent signals: NFκB-mediated signaling induces the production of the precursor protein (Signal 1), and inflammasome-mediated caspase activation leads to the processing to its bioactive, secreted form (Signal 2; Figure 3)298. Active IL-1β is a potent mediator of inflammation and induces fever, the recruitment and activation of immune cells, and the production of secondary cytokines299, 300. In addition to the processing of precursor proteins, inflammasome activation induces a specific form of programmed cell death called pyroptosis4, 296. Pyroptosis differs from apoptosis and necrosis, since it is induced in a caspase 1-dependent manner. Pyroptosis is characterized by cellular lysis and release of the cytosolic content into the extracellular space. This can further amplify the inflammasome-induced immune response, as intracellular pathogens and danger signals are released into the extracellular space240, 301. Released danger signals include HMGB1, lactate dehydrogenase and uric acid302-305. Interestingly, activated inflammasome complexes and pro-IL-1β can be released together into the extracellular space by pyroptosis275, 279, further propagating processing of extracellular pro-IL-1β. In addition, such activated inflammasome complexes can be phagocytosed by neighbouring cells and propagate inflammasome activation in these cells as well275, 279.

Figure 3. Inflammasome activation and function. Production of active IL-1β is regulated by two independent signals. NFκB-mediated signaling induces the production of the precursor protein pro-IL-1β, and inflammasome-mediated caspase activation leads to the processing to its bioactive, secreted form. In addition, inflammasome activation induces a specific form of programmed cell death called pyroptosis, which is characterized by cellular lysis and release of the cytosolic content into the extracellular space. Activation of the inflammasome can be induced a wide variety of signals, including pathogens (both bacteria and viruses), engulfment of large extracellular particles or protein aggregates, and molecules associated with cellular stress, including high extracellular ATP, mitochondrial damage, production of ROS, lysosomal destabilization and pore formation in the cell membrane.

27 Chapter 1

Activation Inflammasomes are involved in both infectious and sterile inflammation and can be activated by PAMPs as well as by DAMPs of endogenous and exogenous origin (Table 4; Figure 3). Seven NLRs have been described to form functional inflammasomes. These are named after the presence of the NALP1-3, -7, -12, AIM2 or NLRC4 receptors3, 181-185. Pathogens, including bacteria and viruses, can activate specific inflammasomes when their products are released into the host cytosol. Intracellular bacterial products activate NALP1, -3, -7, -12, AIM2 and NLRC4 inflammasomes188, 223, 226, 240, 244, 306. Bacterial PAMPs that are recognized by NLR include double stranded (ds)DNA, muramyl dipeptide, (di)acylated lipopeptides, flagellins and bacterial type III secretion systems (T3SS) proteins. Furthermore, intracellular viruses activate AIM2 and NALP3 inflammasomes105, 181, 204, 207, 225, 307, 308. Viral PAMPs that are recognized by NLRs include viral dsDNA or RNA, RNase L, virulence and envelope proteins as well as virally- induced ATP secretion, ion imbalances or production of ROS. Not only pathogens, but also exogenous DAMPs can induce inflammasome activation. These include particulate matter, such as asbestos, silica and other nanoparticles309, 310. After being taken up by the cell, these structures can induce the production of ROS and secretion of ATP, which triggers activation of the NALP3 inflammasome. A plethora of endogenous DAMPs have been described to activate NALP1-3, AIM2 and NLRC4 inflammasomes. These DAMPs include normal host products that are detected at an abnormal location (e.g. cytosolic dsDNA) or in abnormal concentrations (e.g. high extracellular ATP, low intracellular [K+]) as well as misfolded proteins (e.g. superoxide dismutase (SOD)1 mutant protein) or protein aggregates (e.g. amyloid β aggregates)206, 222, 229, 237, 311. Of all inflammasomes, the NALP3 inflammasome is the most widely studied. Although a wide range of exogenous and endogenous stimuli can lead to activation of the NALP3 inflammasome, the actual ligand binding to the NALP3 receptor remains elusive. Several common mechanism were proposed to be involved in NALP3 activation, including ATP release, mitochondrial damage, production of ROS, lysosomal damage and pore formation in the cell235, membrane 312-314. Although all these DAMPs can activate the NALP3 inflammasome, it was recently shown that K+ efflux is the sole common denominator induced by all NALP3-activating stimuli206. K+ efflux is both necessary and sufficient for caspase 1 activation via the NALP3 inflammasome. Howa decrease in intracellular [K+] leads to activation of the NALP3 inflammasome requires further research.

Inflammasome activation in CNS cells Expression of inflammasome components has been documented for all cells of the CNS, including neurons, oligodendrocytes, astrocytes and microglia6. Neurons express various inflammasome components, including NALP1, AIM2, NLRC4, ASC and caspase 1, whereas the expression of NALP3 is still debated173, 193, 315-320. Neuronal expression of NALP1, ASC and caspase 1 is increased after spinal cord injury (SCI), TBI and stroke, which is associated with increased activation of caspase 1 and processing of IL-1β173, 321-323. Although the mechanisms leading to neuronal NALP1 activation in SCI, TBI and stroke have not been elucidated yet, numerous cellular events are considered plausible, including energy depletion, acidosis, increased ROS production and ion imbalances324. Other stimuli that can induce NALP1

28 General introduction 1

inflammasome activation in neurons include high extracellular K+ levels325, hyperglycemia317, exposure to amyloid β protein200 and ethanol326. In addition, DNA released from damaged cells after TBI induces activation of the AIM2 inflammasome in cortical neurons and subsequent neuronal pyroptosis315, 327. Although oligodendrocytes express caspase 1328, 329, there is to date no description of NLR or ASC expression in oligodendrocytes or evidence for inflammasome-mediated activation of these cells. Interestingly, although caspase 1 activation in oligodendrocytes leads to pyroptosis, this process appears to be mediated via Fas/FADD, TNFα receptor or IFNγ receptor signaling rather than via inflammasome activation330. Astrocytes express NALP1-2, AIM2, NLRC4 and caspase 1, whereas the expression of NALP3 and ASC is still disputed173, 184, 237, 331-334. Different studies strongly suggest that functional inflammasomes can be formed in astrocytes. Astrocytic release of IL-1β can be induced by ATP (activating NALP2 and NALP3 inflammasomes), saturated fatty acids as palmitate (activating the NLRC4 inflammasome), ethanol (activating NALP1 and NALP3 inflammasomes) and degraded mitochondrial nucleotides184, 331, 333, 335-337. By contrast, other studies suggested that astrocytic NALP3 inflammasome activation and IL-1β secretion is hampered by the fact that astrocytes do not express NALP3 and ASC and that translation of IL-1β is actively suppressed332, 338. These contrasting results may be caused by species-specific differences or by differences in astrocyte isolation protocols. Future research will hopefully lead to consensus on this issue. Microglia express multiple inflammasome components, including NALP1, NALP3, NLRC4, ASC and caspase 1173-175. There is much literature on microglial activation via the NALP3 inflammasome6. Microglial NALP3 expression is increased by hypoxia-ischemia339, exposure to HMGB1340, 341, oxidized lipid products342, prion peptides343, 344, and glucocorticoids340. In line with this, microglial IL-1β secretion can be induced in by various classical NALP3 inflammasome activating stimuli, including ATP318, 332, nigericin, alum332, ROS344-346 and depletion of intracellular K+ ions344, 347. Furthermore, microglial NALP3 inflammasome activation and IL-1β secretion is induced by amyloid β105, 173, 311, 332, 348-350. In addition to NALP3 inflammasomes, microglia can be induced to form functional NLRC4 inflammasomes174. Inflammasome-mediated activation of microglia has been linked to both infectious343, 345, 351 and neurodegenerative173, 311, 352 diseases. Studies on inflammasome-mediated activation in microglia have mainly been performed using murine primary microglia and the BV2 microglia cell line. The involvement of NALP3, ASC and caspase 1 in inflammasome-mediated activation of microglia was confirmed in primary cells derived from transgenic NLRP3-/-, ASC-/- and CASP1-/- mice5, 311, 348. In this thesis, we used primary microglia derived from brain tissue of adult, healthy rhesus macaques, of which the genetic repertoire of inflammasome components and regulatory proteins closely resembles that of humans (Table 4-6)353.

Involvement of inflammasome activation in CNS pathology Infections In the CNS, inflammasomes can be activated by bacterial and viral infections that cause acute encephalitis or meningitis, as well as by accumulation or aggregation of proteins likeprion proteins or amyloid β. Bacterial pathogens that have been reported to cause NALP3 or NLRC4 inflammasome-mediated activation of microglia includeS. aureus, S. pneumoniae, M. tuberculosis

29 Chapter 1

and L. pneumophila174, 345, 348, 354. In mouse models for S. pneumoniae-induced meningitis, NALP3- induced cytokine responses exacerbated pathogenic inflammatory responses within the CNS without limiting the bacterial growth354, 355. The effect of inflammasome activation in response to other bacterial pathogens in vivo still remains to be studied. By contrast, IL-1β and IL-18 signaling has neuroprotective effects in mouse models of acute viral encephalitis caused by West Nile Virus (WNV), Japanese encephalitis virus (JEV), influenza A and herpes simplex351, virus 356-358. NALP3 inflammasomes in particular have been linked to viral infections of the CNS. JEV infection leads to NALP3 activation in in vitro cultured microglia and deletion of NLRP3 or ASC reduces survival rates after WNV infection in 351,mice 356. Together these results implicate that inflammasome-mediated activation may contribute to initiating host defense responses to infections of the CNS, but can also exacerbate pathogenic inflammatory responses and thereby cause extensive CNS damage.

Endogenous molecules that are associated with damaged cells, tissue injury (e.g. ROS, high extracellular ATP, ion imbalances) or specific disease-associated molecules (e.g. prion protein, amyloid β, α-synuclein or SOD1 aggregates) can also activate inflammasomes206, 311, 314, 350, 352, 359-362. In line with this, inflammasome-mediated activation has been reported to contribute toa plethora of CNS diseases such as prion diseases, acute CNS injury, AD, Parkinson’s disease (PD) and MS.

Prion diseases Prion diseases are neurodegenerative diseases caused by an abnormal form of prion protein, PrPsc. During prion disease, normal prion protein PrPc converts to protease-resistant PrPsc, which leads to the accumulation of scPrP aggregates within the CNS, spongiform degeneration and neuronal loss363. Misfolded proteins or protein aggregates are potent activators of inflammasomes364 and multiple studies have reported that PrP fibrils can activate the NLRP3 inflammasome in microglia and induce IL-1β 343,release 344, 347. These PrPsc-activated microglia have neurotoxic effects when co-cultured with neuronal 347cells . In mouse models for prion disease, IL-1R-deficiency significantly delays the onset of neurodegeneration and prolongs survival times365, 366.

Acute CNS injury Acute CNS injury can be induced by mechanical stress or ischemic injury following stroke. The pathophysiological processes following acute CNS injury are complex and extensive, and include bioenergetic failure, loss of cell ion homeostasis, acidosis, increased intracellular calcium levels, excitotoxicity, ROS-mediated toxicity, generation of arachidonic acid products, cytokine-mediated cytotoxicity, activation of neuronal and glial cells, complement activation, disruption ofthe blood–brain barrier and infiltration of leukocytes324, 367. Recent studies strongly suggest that inflammasome activation plays a role in the pathogenesis following acute CNS injury. Increased expression of NALP1, ASC and caspase 1 is observed in spinal cord and brain tissue of patients with acute CNS injury321. In addition, higher levels of NALP1, ASC and caspase 1 are detected in the CSF of patients with acute CNS injury, which is associated with poor prognosis321, 327. In animal models for acute CNS injury, CNS expression of NALP1, ASC, caspase 1 and caspase 11 is increased,

30 General introduction 1

which is associated with increased activation of caspase 1 and processing of IL-1β. Inhibition of the NALP1 inflammasome in neurons with a neutralizing antibody against the adaptor protein ASC decreases inflammation and improves histopathological and functional outcomes after acute CNS injury322, 323. Also, a neutralizing antibody against NALP1 inhibits NALP1 inflammasome activation after stroke leading to decreased inflammation173. Mice deficient in IL-1α, IL-1β, ASC, AIM2, NLRC4 or caspase 1 showed reduced ischemic brain injury368, 369. Interfering with inflammasome activation after acute CNS injury is therefore now considered as a therapeutic strategy321.

Alzheimer’s disease AD is a chronic, progressive, irreversible neurodegenerative disease characterized by widespread neuronal death and progressive dementia. AD pathology includes extracellular deposition of amyloid β in senile plaques andintracellular accumulation of hyper-phosphorylated tau protein and neurofibrillary tangles370. Multiple studies have reported that phagocytosis of fibrillar amyloid β by cultured microglia and macrophages activate the NALP3 inflammasome leading to caspase 1 activation and IL-1β secretion311, 350, 361, 362. In line with these results, expression of IL-1β and increased levels of NLRC4, ASC and active caspase 1 are observed in brain tissue of AD patients5, 237. Furthermore, increased levels of IL-1β are detected in the cerebrospinal fluid (CSF) and serum of AD patients5, 371-373. In APP/PS1 mice, an animal model for AD, knockout of NLRP3 or CASP1 protected from memory deficits and improved neurobehavioral disturbances. This was associated with reduced caspase 1 and IL-1β activation and enhanced amyloid β clearance in the brain5. Recent studies have also demonstrated that IL-1β-induced signaling enhances amyloid β production and tau phosphorylation in neurons and inhibits microglial amyloid β clearance237, 374, 375, which may lead to a self-sustaining mechanism of inflammasome- mediated activation in AD pathology376.

Parkinson’s disease PD is one of the most common neurodegenerative diseases and is associated with considerable motor disability. PD pathology is characterized by loss of dopaminergic neurons in the substantia nigra pars compacta of the brain and by the formation of Lewy bodies that consist of fibrilar α-synuclein377. Aggregated α-synuclein induces TLR2-mediated synthesis of pro-IL-1β and activates the NALP3 inflammasome leading to caspase 1 dependent IL-1β secretion in vitro cultures of monocytes and macrophages359, 360. In line with these results, expression of IL-1β is increased in brain tissue of PD patients378, 379. In MPTP-treated animals, an animal model for PD, NALP3 inflammasome activation and elevated IL-1β levels are observed333, 380. Subsequently, IL-1β contributes to the dopaminergic neuronal cell death, suggesting that inflammasome activation is involved in PD pathogenesis162, 378, 381.

Multiple sclerosis Although the exact cause of MS remains elusive, there is direct and indirect evidence suggesting that inflammasome activation contributes to MS pathogenesis. IL-1β levelsare elevated in CSF and blood of MS patients and correlate with disease susceptibility, severity and progression382-387. Furthermore, patients with active inflammatory lesions are characterized by

31 Chapter 1

increased IL-1β/IL-1RA ratios in their 388 CSF . Although some studies suggest that IL-1β is prominently expressed in (chronic) active MS lesions389, 390, this is disputed by others391. In rodent EAE, expression of NALP1, NALP3, ASC and caspase 1 is increased in the spinal cord392, 393. Furthermore, NLRP3-/-, ASC-/- or caspase 1-/- transgenic mice showed delayed onset of disease and less severe clinical symptoms of EAE392, 394-396. Loss of NALP3 and subsequent loss of IL-1β signaling ameliorates the EAE disease course by reducing T cell priming and subsequent T cell trafficking into the CNS392, 394, 397 and treatment of animals with a caspase 1 inhibitor attenuated clinical signs of EAE397. Indirect evidence is derived from studies using established MS therapies. Levels of IL- 1RA, the natural inhibitor of the IL-1 receptor, are increased in the blood by MS therapies, including IFNβ, glatiramer or steroid treatment383, 398, 399. Furthermore, IFNβ treatment decreased EAE pathology by reducing serum IL-1β and caspase 1 activation, although this was only effective against EAE when development of the disease depended on the NALP3 inflammasome400. Although these studies suggest a role for IL-1β in MS pathogenesis, this remains to be studied in more detail. For example, it is yet unclear during which stages of lesion development IL-1β is produced and by which cells. In this thesis, we characterized IL-1β expression in brain tissue of MS patients, which included different types of MS lesions, and compared this to IL-1β expression in brain tissue of rhesus macaques with EAE Chapter( 2).

Regulation Although inflammasome activation is necessary for clearing infections and harmful substances, excessive activation of the inflammasome can lead to serious disorders. This can also be learned from hereditary fever syndromes, in which gain-of-function mutations in the NLPR3 gene lead to a constitutively active NALP3 receptor and spontaneous release of IL-1β causing spontaneous periodic fevers4, 190. To prevent overt IL-1β production, tight regulation of inflammasome activation has evolved. Regulation exists in the form of regulatory proteins, IFNβ and autophagy401. In addition, purinergic receptor signaling can regulate inflammasome activation309, 313. As release of active IL-1β requires transcription of pro-IL-1β as well as inflammasome-mediated processing of IL-1β, regulation may occur at both levels.

Regulation of pro-IL-1β transcription As transcription of precursor proteins of the IL-1 family is induced by TLR-, IL-1 receptor (IL-1R)- and TNF receptor-mediated signaling, inhibition of these pathways limits the availability of IL-1β precursor proteins. Regulation of TLR signaling has been extensively reviewed previously119 and therefore will not be discussed in detail here. In general, transcription of TLR regulatory proteins, like A20, is induced by TLR activation itself, thereby providing a negative feedback loop to limit overshooting of inflammatory responses. In addition, various NLRs, including NALP2, -4, -6, -10, -12 and NOD3-4, have recently been described to regulate NFκB, AP-1 and IRF3 activation201, 208, 211, 216, 219, 257, 402-405. Thereby, these NLRs regulate the transcription of pro-inflammatory cytokines, limiting the pool of intracellular pro-IL-1β that is available for processing by activated inflammasomes.

32 General introduction 1

Regulation of inflammasome activation a. Regulatory proteins Multiple inflammasome-specific regulatory proteins have been described including CARD- only proteins (COP), pyrin-only proteins (POPs) as well as ASC isoforms that are incapable of assembling functional inflammasomesTable ( 6)406. These regulatory proteins have a dominant negative effect on inflammasome assembly, as they can interact with specific domains from NLR, ASC and inflammatory caspases without activating them406. Multiple COPs have been described in humans, including COP (pseudo-ICE; CARD16), inhibitory CARD (INCA; CARD17), ICEBERG (CARD18) and caspase 12294, 353, 407. These COPs can bind to pro-caspase 1 by homotypic CARD-CARD interactions, thereby preventing recruitment to the inflammasome complex and activation of caspase408-411 1 . To date, four POPs have been identified in humans, including POP1 (ASC2; PYDC1), POP2 (PYDC2), POP3 and POP4406, 407, 412. POPs can bind to NLRs (e.g. NALP2, AIM2) or ASC by homotypic PYD-PYD interactions, thereby preventing assembly of the inflammasome complex413-415. Recently described ASC isoforms that are incapable of assembling a functional inflammasome have been described to block inflammasome assembly in a similar fashion as POPs406. In addition, some NLRs can also be grouped with the regulatory proteins. Like COPs and POPs, NALP7 and -10 can bind to inflammasome components without activating them, thereby limiting the ability to form functional inflammasomes203, 217, 218. Furthermore, AIM2 is negatively regulated by IFI16 and p202 proteins416, 417. Noteworthy, many of these inflammasome regulatory proteins are not expressed in rodents, whereas COPs and POPs are in general well conserved in non-human primates353. For example, rodents lack ortologues for COP, INCA, and ICEBERG353. Furthermore, no murine ortologues for POP1 and 2 can be retrieved, although two other POPs (pydc3 and pydc4) are predicted in mice406. These differences suggest that inflammasome regulation in rodents may differ importantly from that in humans and non-human primates353. b. Autophagy Accumulating evidence indicates that autophagy can limit inflammasome-mediated IL-1β secretion. Autophagy is a catabolic process that facilitates the recycling of damaged cellular proteins and organelles420. Autophagy can limit IL-1β secretion by targeting pro-IL-1β and ubiquitinated inflammasomes for degradation421, 422. In addition, autophagy is involved in the removal of fibrilar amyloid-β and damaged mitochondria, limiting generation of ROS and release of mitochondrial DNA into the cytosol314, 423, 424. Thereby autophagy limits the availability of ligands that may activate the inflammasome.

33 Chapter 1

Regulatory Human NHP Rodent Target Ref protein family COP CARD16 (COP) CARD16 - Caspase 1; RIP2; INCA; 353, 406 ICEBERG CARD17 (INCA) CARD17-like - Caspase 1; COP; ICEBERG 353, 406 CARD18 CARD18-like - Caspase 1; COP 353, 406 (ICEBERG) Caspase 12-S Caspase 12 Caspase 12 Caspase 1 353, 406 (inactive) (active) (active) ASCc Not known Not known Caspase 1; ASC 406 POP POP1 - - ASC; IKKα; IKKβ 406 POP2 POP2 - ASC; NALP1; NALP2, NALP4; 406, 418 NALP12, NFκB POP3 - - AIM2; IFI16 406 POP4 POP4 - NFκB 406, 412 - - PYDC3 Not known 406 - - PYDC4 Not known 406 NLR NALP7 NALP7 - Caspase 1; pro-IL-1β 203 NALP10 NALP10 NALP10 ASC 217, 218 Other NOD2-S Not known NOD2-S NOD2; RIP2K 406, 419 IFI16 IFI16 - AIM2 406 p202 p202 p202 AIM2 406

Table 6. Overview of inflammasome regulatory proteins in human, NHP and rodent

c. IFNβ IFNβ has been described to regulate inflammasome-mediated activation in myeloid cells. Type I interferons can inhibit NALP1- and NALP3-induced caspase 1 activation and IL-1β secretion, but are not effective in inhibiting AIM2 or NLRC4 inflammasomes400, 425, 426. IFNβ can inhibit inflammasome-mediated activation by inhibition of pro-IL-1β transcription, by decreasing the availability of NALP3-activating ligands and by directly inhibiting NALP3 and caspase 1 activation via post-translational modifications400, 425, 426. These findings are in particular interesting in the context of MS, since IFNβ is used as a disease-modifying treatment and its working mechanism in MS is still not fully understood. Recently, it was shown that IFNβ treatment decreased EAE pathology by reducing serum IL-1β and caspase 1 activation, although this was only effective against EAE when development of the disease depended on the NALP3 inflammasome400. These results suggest that part of the therapeutic effect of IFNβ in MS may be attributed to inhibition of inflammasome activation, though more extensive studies are needed to confirm this. d. Purinergic receptors Recent studies demonstrate that inflammasome activation can be induced or modulated via purinergic receptor signaling206, 309, 427-429. As purinergic receptor-mediated signaling is at the basis of many CNS diseases430, 431, this provides an interesting angle for further research. The purinergic receptor family consists of seven ATP-selective ionotropic P2X receptors and eight metabotropic P2Y receptors that recognize a wide range of extracellular purines, including

34 General introduction 1

ATP, UTP and their derivates (Table 7)432, 433. P2X receptors are ligand-gated ion channels whose activation by ATP increases+ Na , K+ and Ca2+ permeability433, 434. P2Y receptors are G-protein coupled receptors. In general, P2Y1, -2, -4, -6 and -11 are coupled to Gq proteins and activate phospholipase C. P2Y12-14 are coupled to Gi proteins, of which the activation results in the inhibition of adenylyl cyclases and the reduction of intracellular cAMP432. Ligand sensitivity varies considerably between receptors. For example, P2Y receptors detect ATP at nano-molar concentrations, while P2X7 requires micro- to milli-molar concentrations433, 435, 436. The amounts and combination of different purines in the extracellular space and the purinergic receptors expressed together determine the cellular response. In the CNS, all cells express purinergic receptors. The expression profile of P2X and P2Y receptors differs between different types of neurons437-439. Oligodendrocyte progenitors express P2X1, -2, -3, -4, and -7 as well as P2Y1, -2, -4, -6, -11 and -13440, 441. Astrocytes express all P2X receptors and P2Y1, -2, -4, -6, -13 and -14438, 442, 443. Microglia are characterized by a predominant expression of P2X4 and P2X7, although they also express P2X1, -5, -6 and P2Y1, -2, -4, -6, -12, -13 and -14444-447.

P2X receptors Ligand P2Y receptors Ligand P2X1 ATP P2Y1 ADP/ATP P2X2 ATP P2Y2 UTP/ATP P2X3 ATP P2Y4 UTP/ATP P2X4 ATP P2Y6 UDP P2X5 ATP P2Y11 ATP/UTP P2X6 ATP P2Y12 ADP/ATP P2X7 ATP P2Y13 ADP P2Y14 UDP-sugars

Table 7. Overview of purinergic receptors, their ligands and expression in CNS cells. Ligands are represented with the most potent agonist first432, 433, 435.

Nucleotides can be released into the extracellular space under homeostatic conditions via exocytosis, membrane transporters, connexin and pannexin hemichannels448, 449. The actual concentration of extracellular nucleotides is determined by the dilution of the nucleotides in the extracellular space, their possible confinement to a protected compartment (e.g. synaptic cleft) and the action of the nucleotide degrading ubiquitous ecto-ATPases and ecto-nucleotidases448. For example, ATP can be processed to ADP, AMP and finally adenosine by ecto-nucleotidases, such as tissue-non-specific alkaline phosphatase, CD39 and CD73, thereby changing the availability of these nucleotides in the extracellular space450. In the CNS, purinergic signaling is essential for normal embryonic and adult neurogenesis and neuronal activity. During embryonic development purines can be secreted by radial glia, neurons and astrocytes451-453. Extracellular nucleotides promote proliferation of neuronal progenitors, their synchronization in the S phase of the cell cycle453 and migration of neuronal progenitors to the subventricular zone (SVZ) of the developing brain454. Furthermore, ATP and ADP can control axon growth and myelination455-458. Importantly, in the healthy adult CNS, purinergic signaling is a modulator of neuronal activity. Nucleotides are stored at high concentrations (up to 200 mM) in

35 Chapter 1

neuronal synaptic vesicles437, 459, 460, which can be released into the synaptic cleft by exocytosis after an action potential461. In addition, astrocytes can release ATP via connexin channels and vesicular release to modulate synaptic transmission441, 462-464. Subsequently, these nucleotides bind to purinergic receptors at dendritic spines, nerve terminals and astrocytes, thereby affecting neurotransmitter release and glial calcium waves448. Thus, synaptic nucleotides are regarded as neurotransmitters in intracellular communication between neurons and glia cells465, although there is no evidence that ATP can generate action potentials by itself456. In addition, extracellular nucleotides are involved in adult neurogenesis, as they promote proliferation of neuronal progenitors in the adult neurogenic niches, such as the hippocampus, and migration of these neuronal precursors466, 467. During inflammation, purines can be released into the extracellular space either actively by apoptotic or inflammatory cells or passively by membrane-rupture of necrotic cells448, 449, 468. ATP is present at a concentration of 5-10 mM in the cytosol of most cells and it can be released in large amounts following plasma membrane damage or acute cell death437, 468, 469. Furthermore, up to 15% of the total cellular ATP can be released by inflammatory cells via non-lytic pathways470, 471. During neuroinflammation, activation of purinergic receptors on microglia can induce migration to and shielding of the injured site, phagocytosis of apoptotic neurons and secretion of pro-inflammatory cytokines116, 136, 144, 311, 348. Thereby, purines can activate protective, regenerative and also harmful mechanisms437, 448, 469. Extracellular purines and purinergic receptor-mediated signaling are involved in the pathogenesis of different CNS disorders, including MS and EAE431, 472-474. Increased expression of P2X7 is observed in reactive astrocytes and microglia/macrophages associated with MS lesions474, 475. Furthermore, treatment of mice with chronic EAE with a P2X7 antagonist reduces demyelination by preventing oligodendrocytic cell death and ameliorates neurological symptoms472. More strikingly, transgenic P2X7 knockout mice do not develop EAE-associated symptoms at all473. Therefore, P2X7-mediated signaling may contribute to MS pathogenesis, although the exact mechanism remains to be further investigated. Recent studies show that purinergic receptor-mediated signaling can induce or modulate inflammasome activation. As described above, high concentrations of extracellular ATP induce activation of the P2X7 and subsequent opening of ion channels. This facilitates effluxof intracellular K+ ions, which induces NALP3 inflammasome activation206, 429. P2X4-mediated signaling can enhance P2X7-induced inflammasome activation by increasing2+ Ca influx, by the production of ROS and by suppression of autophagy427, 428, 476, 477. In addition, P2Y receptor- mediated signaling has been described to modulate NALP3 inflammasome activation309, 313. It is well known that activation of P2X7 on microglia by high concentrations of extracellular ATP induces inflammasome activation311, 318, 348. However, our knowledge on the involvement of other purinergic receptors or extracellular nucleotides in inflammasome-mediated activation of microglia is limited. Chapter 4 of this thesis contains a study aiming to enlarge our knowledge on this subject.

36 General introduction 1

Thesis outline

IL-1β is a pro-inflammatory cytokine that plays a role in the pathogenesis of MS and EAE, the animal model for MS. In chapter 2, we performed an extensive characterization of IL-1β expression in brain tissue of MS patients, which included different stages of MSlesion development. In a side-by-side comparison, we characterized IL-1β expression in brain tissue of rhesus macaques with EAE. We performed in depth analyses of the cellular sources of IL-1β expression and phenotyped these cells immunologically. As we uncovered that IL-1β in both EAE and MS is mainly produced by microglia and not or much less by infiltrating monocytes/macrophages, we further focused on inflammasome- mediated activation of microglia. Despite extensive studies on inflammasome-mediated activation and modulation in other myeloid cells, much less is known about these responses in microglia. Most data on inflammasome-mediated activation in microglia are derived from rodent studies6, even though the genetic repertoire of inflammasome components and regulatory proteins exhibits some important differences between rodent and humans4, 353. We used in vitro cultures of primary microglia obtained from adult rhesus macaques. As microglia originate from a distinct progenitor compared to hematopoietic macrophages, form a long-lived self renewing population and are continuously exposed to the CNS microenvironment96, 114, we compared microglial inflammasome-mediated responses to those of hematopoietic macrophages derived from the same donors. In chapter 3 we analyzed the expression profile of NLR, adaptor proteins and inflammatory caspases and describe some unanticipated differences in inflammasome activation and regulation between microglia and other macrophages. In chapter 4 we analyzed the expression profile of purinergic receptors, and characterized inflammasome activation by extracellular nucleotides and the involvement of different purinergic receptors. Again, we found that microglial inflammasome activation differs from that in other macrophages. An important part of the work described in this thesis was performed using rhesus macaque primary cell cultures. NHP are used for biomedical research due to their strong resemblance to humans, which is true in particular for their immune system and their central nervous system. No animals were exclusively sacrificed for the aim of our studies, since we used tissue that became available when animals were sacrificed for other purposes (e.g. as they were taking part in other studies). The development and application of our in vitro cultures thereby contribute to the optimal use of experimental animals and form part of the active program to replace, reduce and refine (3Rs) the use of experimental animals at the Biomedical Primate Research Centre (BPRC). In chapter 5 we discuss how the use of NHP may be further reduced by development and implementation of 3R methods for studying biomedical research questions. Finally, chapter 6 provides an overall discussion of the results and future perspectives regarding IL-1β expression in MS lesion development, inflammasome-mediated activation in microglia and hematopoietic macrophages, and the use of NHPin vitro models.

37 Chapter 1

References

1. MSIF, Vol. 2015 (Multiple Sclerosis International Federation,http://www.msif.org; 2013).

2. van der Valk, P. & De Groot, C.J. Staging of multiple sclerosis (MS) lesions: pathology of the time frame of MS.Neuropathology and applied neurobiology 26, 2-10 (2000). 3. Martinon, F., Burns, K. & Tschopp, J. The inflammasome: a molecular platform triggering activation of inflammatory caspases and processing of proIL-beta. Mol Cell 10, 417-426 (2002).

4. Martinon, F., Mayor, A. & Tschopp, J. The inflammasomes: guardians of the body.Annu Rev Immunol 27, 229-265 (2009).

5. Heneka, M.T. et al. NLRP3 is activated in Alzheimer’s disease and contributes to pathology in APP/PS1 mice.Nature 493, 674-678 (2013).

6. Walsh, J.G., Muruve, D.A. & Power, C. Inflammasomes in the CNS.Nat Rev Neurosci 15, 84-97 (2014). 7. McGonagle, D., Savic, S. & McDermott, M.F. The NLR network and the immunological disease continuum of adaptive and innate immune-mediated inflammation against self.Semin Immunopathol 29, 303-313 (2007).

8. Katz Sand, I. Classification, diagnosis, and differential diagnosis of multiple sclerosis.Current opinion in neurology 28, 193-205 (2015).

9. Compston, A. & Coles, A. Multiple sclerosis. Lancet 372, 1502-1517 (2008). 10. Antel, J., Antel, S., Caramanos, Z., Arnold, D.L. & Kuhlmann, T. Primary progressive multiple sclerosis: part of the MS disease spectrum or separate disease entity?Acta neuropathologica 123, 627-638 (2012). 11. Sadovnick, A.D., Ebers, G.C., Dyment, D.A. & Risch, N.J. Evidence for genetic basis of multiple sclerosis. The Canadian Collaborative Study Group. Lancet 347, 1728-1730 (1996).

12. Fagnani, C. et al. Twin studies in multiple sclerosis: A meta-estimation of heritability and environmentality.Mult Scler 21, 1404- 1413 (2015).

13. Hollenbach, J.A. & Oksenberg, J.R. The immunogenetics of multiple sclerosis: A comprehensive review.J Autoimmun 64, 13-25 (2015).

14. Barcellos, L.F. et al. Heterogeneity at the HLA-DRB1 locus and risk for multiple sclerosis. Hum Mol Genet 15, 2813-2824 (2006).

15. Ramagopalan, S.V. et al. The inheritance of resistance alleles in multiple sclerosis.PLoS Genet 3, 1607-1613 (2007).

16. Schmidt, H., Williamson, D. & Ashley-Koch, A. HLA-DR15 haplotype and multiple sclerosis: a HuGE review.Am J Epidemiol 165, 1097-1109 (2007).

17. De Jager, P.L. et al. Meta-analysis of genome scans and replication identify CD6, IRF8 and TNFRSF1A as new multiple sclerosis susceptibility loci.Nat Genet 41, 776-782 (2009). 18. International Multiple Sclerosis Genetics, C. et al. Analysis of immune-related loci identifies 48 new susceptibility variants for multiple sclerosis.Nat Genet 45, 1353-1360 (2013).

19. International Multiple Sclerosis Genetics, C. et al. Risk alleles for multiple sclerosis identified by a genomewide study.N Engl J Med 357, 851-862 (2007). 20. Belbasis, L., Bellou, V., Evangelou, E., Ioannidis, J.P. & Tzoulaki, I. Environmental risk factors and multiple sclerosis: an umbrella review of systematic reviews and meta-analyses.The Lancet. Neurology 14, 263-273 (2015).

21. Ebers, G.C. Environmental factors and multiple sclerosis.The Lancet. Neurology 7, 268-277 (2008). 22. Elian, M., Nightingale, S. & Dean, G. Multiple sclerosis among United Kingdom-born children of immigrants from the Indian subcontinent, Africa and the West Indies.J Neurol Neurosurg Psychiatry 53, 906-911 (1990). 23. Hammond, S.R., English, D.R. & McLeod, J.G. The age-range of risk of developing multiple sclerosis: evidence from a migrant population in Australia.Brain : a journal of neurology 123 ( Pt 5), 968-974 (2000).

24. van der Mei, I.A. et al. Past exposure to sun, skin phenotype, and risk of multiple sclerosis: case-control study.BMJ 327, 316 (2003).

25. Nair, R. & Maseeh, A. Vitamin D: The “sunshine” vitamin. J Pharmacol Pharmacother 3, 118-126 (2012).

26. Wei, R. & Christakos, S. Mechanisms Underlying the Regulation of Innate and Adaptive Immunity by Vitamin D.Nutrients 7, 8251- 8260 (2015).

27. Duan, S. et al. Vitamin D status and the risk of multiple sclerosis: a systematic review and meta-analysis.Neurosci Lett 570, 108-113 (2014).

28. Pohl, D. Epstein-Barr virus and multiple sclerosis.J Neurol Sci 286, 62-64 (2009). 29. Owens, G.P. & Bennett, J.L. Trigger, pathogen, or bystander: the complex nexus linking Epstein- Barr virus and multiple sclerosis. Mult Scler 18, 1204-1208 (2012).

38 General introduction 1

30. Frohman, E.M., Racke, M.K. & Raine, C.S. Multiple sclerosis--the plaque and its pathogenesis.N Engl J Med 354, 942-955 (2006). 31. Oksenberg, J.R. et al. Selection for T-cell receptor V beta-D beta-J beta gene rearrangements with specificity for a myelin basic protein peptide in brain lesions of multiple sclerosis.Nature 362, 68-70 (1993).

32. Ortiz, G.G. et al. Role of the blood-brain barrier in multiple sclerosis.Arch Med Res 45, 687-697 (2014).

33. Ozawa, K. et al. Patterns of oligodendroglia pathology in multiple sclerosis.Brain : a journal of neurology 117 ( Pt 6), 1311-1322 (1994).

34. Bogie, J.F. et al. Myelin alters the inflammatory phenotype of macrophages by activating PPARs.Acta Neuropathol Commun 1, 43 (2013).

35. Bitsch, A., Schuchardt, J., Bunkowski, S., Kuhlmann, T. & Bruck, W. Acute axonal injury in multiple sclerosis. Correlation with demyelination and inflammation.Brain : a journal of neurology 123 ( Pt 6), 1174-1183 (2000).

36. Trapp, B.D. et al. Axonal transection in the lesions of multiple sclerosis.N Engl J Med 338, 278-285 (1998).

37. Kipp, M., van der Valk, P. & Amor, S. Pathology of multiple sclerosis.CNS Neurol Disord Drug Targets 11, 506-517 (2012).

38. van der Valk, P. & Amor, S. Preactive lesions in multiple sclerosis.Current opinion in neurology 22, 207-213 (2009). 39. Bsibsi, M. et al. Alpha-B-crystallin induces an immune-regulatory and antiviral microglial response in preactive multiple sclerosis lesions. Journal of neuropathology and experimental neurology 72, 970-979 (2013).

40. Singh, S. et al. Microglial nodules in early multiple sclerosis white matter are associated with degenerating axons.Acta neuropathologica 125, 595-608 (2013). 41. van Horssen, J. et al. Clusters of activated microglia in normal-appearing white matter show signs of innate immune activation. Journal of neuroinflammation 9, 156 (2012).

42. Chang, A., Tourtellotte, W.W., Rudick, R. & Trapp, B.D. Premyelinating oligodendrocytes in chronic lesions of multiple sclerosis.N Engl J Med 346, 165-173 (2002).

43. Chang, A. et al. Cortical remyelination: a new target for repair therapies in multiple sclerosis.Annals of neurology 72, 918-926 (2012).

44. Prineas, J.W. & Connell, F. Remyelination in multiple sclerosis.Annals of neurology 5, 22-31 (1979).

45. Schoonheim, M.M., Geurts, J.J. & Barkhof, F. The limits of functional reorganization in multiple sclerosis.Neurology 74, 1246-1247 (2010).

46. Patrikios, P. et al. Remyelination is extensive in a subset of multiple sclerosis patients.Brain : a journal of neurology 129, 3165-3172 (2006).

47. Calabrese, M. et al. Exploring the origins of grey matter damage in multiple sclerosis.Nat Rev Neurosci 16, 147-158 (2015). 48. van Horssen, J., Brink, B.P., de Vries, H.E., van der Valk, P. & Bo, L. The blood-brain barrier in cortical multiple sclerosis lesions. Journal of neuropathology and experimental neurology 66, 321-328 (2007).

49. Filippini, G. et al. Corticosteroids or ACTH for acute exacerbations in multiple sclerosis.Cochrane Database Syst Rev, CD001331 (2000).

50. Gajofatto, A. & Benedetti, M.D. Treatment strategies for multiple sclerosis: When to start, when to change, when to stop?World J Clin Cases 3, 545-555 (2015). 51. Durelli, L. et al. Every-other-day interferon beta-1b versus once-weekly interferon beta-1a for multiple sclerosis: results of a 2-year prospective randomised multicentre study (INCOMIN).Lancet 359, 1453-1460 (2002). 52. Jacobs, L.D. et al. Intramuscular interferon beta-1a therapy initiated during a first demyelinating event in multiple sclerosis. CHAMPS Study Group. N Engl J Med 343, 898-904 (2000).

53. Kappos, L. et al. Long-term subcutaneous interferon beta-1a therapy in patients with relapsing-remitting MS.Neurology 67, 944- 953 (2006).

54. Randomised double-blind placebo-controlled study of interferon beta-1a in relapsing/remitting multiple sclerosis. PRISMS (Prevention of Relapses and Disability by Interferon beta-1a Subcutaneously in Multiple Sclerosis) Study Group.Lancet 352, 1498- 1504 (1998).

55. Filippini, G. et al. Immunomodulators and immunosuppressants for multiple sclerosis: a network meta-analysis.Cochrane Database Syst Rev 6, CD008933 (2013). 56. Maurer, M. et al. Health care situation of patients with relapsing-remitting multiple sclerosis receiving immunomodulatory therapy: a retrospective survey of more than 9000 German patients with MS.Eur J Neurol 18, 1036-1045 (2011).

57. Cocco, E. & Marrosu, M.G. The current role of mitoxantrone in the treatment of multiple sclerosis. Expert Rev Neurother 14, 607- 616 (2014).

58. Chun, J. & Hartung, H.P. Mechanism of action of oral fingolimod (FTY720) in multiple sclerosis.Clin Neuropharmacol 33, 91-101 (2010).

39 Chapter 1

59. Rice, G.P., Hartung, H.P. & Calabresi, P.A. Anti-alpha4 integrin therapy for multiple sclerosis: mechanisms and rationale.Neurology 64, 1336-1342 (2005).

60. Coles, A.J. Alemtuzumab therapy for multiple sclerosis.Neurotherapeutics 10, 29-33 (2013). 61. Hoepner, R., Faissner, S., Salmen, A., Gold, R. & Chan, A. Efficacy and side effects of natalizumab therapy in patients with multiple sclerosis. J Cent Nerv Syst Dis 6, 41-49 (2014). 62. Feinstein, A., Freeman, J. & Lo, A.C. Treatment of progressive multiple sclerosis: what works, what does not, and what is needed. The Lancet. Neurology 14, 194-207 (2015).

63. Comi, G. Disease-modifying treatments for progressive multiple sclerosis.Mult Scler 19, 1428-1436 (2013). 64. Ben-Nun, A. et al. From classic to spontaneous and humanized models of multiple sclerosis: impact on understanding pathogenesis and drug development. J Autoimmun 54, 33-50 (2014). 65. Gold, R., Linington, C. & Lassmann, H. Understanding pathogenesis and therapy of multiple sclerosis via animal models: 70 years of merits and culprits in experimental autoimmune encephalomyelitis research.Brain : a journal of neurology 129, 1953-1971 (2006).

66. van der Star, B.J. et al. In vitro and in vivo models of multiple sclerosis.CNS Neurol Disord Drug Targets 11, 570-588 (2012).

67. Israeli, E., Agmon-Levin, N., Blank, M. & Shoenfeld, Y. Adjuvants and autoimmunity. Lupus 18, 1217-1225 (2009).

68. Libbey, J.E. & Fujinami, R.S. Experimental autoimmune encephalomyelitis as a testing paradigm for adjuvants and vaccines.Vaccine 29, 3356-3362 (2011).

69. Furlan, R., Cuomo, C. & Martino, G. Animal models of multiple sclerosis.Methods Mol Biol 549, 157-173 (2009). 70. Jagessar, S.A. et al. Induction of progressive demyelinating autoimmune encephalomyelitis in common marmoset monkeys using MOG34-56 peptide in incomplete freund adjuvant.Journal of neuropathology and experimental neurology 69, 372-385 (2010).

71. t Hart, B.A. et al. A new primate model for multiple sclerosis in the common marmoset.Immunol Today 21, 290-297 (2000). 72. t Hart, B.A., Bauer, J., Brok, H.P. & Amor, S. Non-human primate models of experimental autoimmune encephalomyelitis: Variations on a theme. Journal of neuroimmunology 168, 1-12 (2005). 73. Haanstra, K.G. et al. Selective Blockade of CD28-Mediated T Cell Costimulation Protects Rhesus Monkeys against Acute Fatal Experimental Autoimmune Encephalomyelitis.Journal of immunology 194, 1454-1466 (2015). 74. Haanstra, K.G. et al. Antagonizing the alpha4beta1 integrin, but not alpha4beta7, inhibits leukocytic infiltration of the central nervous system in rhesus monkey experimental autoimmune encephalomyelitis.Journal of immunology 190, 1961-1973 (2013). 75. Haanstra, K.G. et al. Induction of experimental autoimmune encephalomyelitis with recombinant human myelin oligodendrocyte glycoprotein in incomplete Freund’s adjuvant in three non-human primate species. Journal of neuroimmune pharmacology : the official journal of the Society on NeuroImmune Pharmacology 8, 1251-1264 (2013). 76. Kerlero de Rosbo, N. et al. Rhesus monkeys are highly susceptible to experimental autoimmune encephalomyelitis induced by myelin oligodendrocyte glycoprotein: characterisation of immunodominant T- and B-cell epitopes.Journal of neuroimmunology 110, 83-96 (2000). 77. Stansley, B., Post, J. & Hensley, K. A comparative review of cell culture systems for the study of microglial biology in Alzheimer’s disease. Journal of neuroinflammation 9, 115 (2012).

78. Butovsky, O. et al. Identification of a unique TGF-beta-dependent molecular and functional signature in microglia.Nature neuroscience 17, 131-143 (2014). 79. Blasi, E., Barluzzi, R., Bocchini, V., Mazzolla, R. & Bistoni, F. Immortalization of murine microglial cells by a v-raf/v-myc carrying retrovirus. Journal of neuroimmunology 27, 229-237 (1990).

80. Righi, M. et al. Monokine production by microglial cell clones.European journal of immunology 19, 1443-1448 (1989). 81. Walker, W.S., Gatewood, J., Olivas, E., Askew, D. & Havenith, C.E. Mouse microglial cell lines differing in constitutive and interferon- gamma-inducible antigen-presenting activities for naive and memory CD4+ and CD8+ T cells.Journal of neuroimmunology 63, 163-174 (1995).

82. Alliot, F., Marty, M.C., Cambier, D. & Pessac, B. A spontaneously immortalized mouse microglial cell line expressing CD4. Brain Res Dev Brain Res 95, 140-143 (1996). 83. Ohsawa, K., Imai, Y., Nakajima, K. & Kohsaka, S. Generation and characterization of a microglial cell line, MG5, derived from a p53- deficient mouse.Glia 21, 285-298 (1997). 84. Takenouchi, T., Ogihara, K., Sato, M. & Kitani, H. Inhibitory effects of U73122 and U73343 on Ca2+ influx and pore formation induced by the activation of P2X7 nucleotide receptors in mouse microglial cell line.Biochim Biophys Acta 1726, 177-186 (2005). 85. Iwamaru, Y. et al. Microglial cell line established from prion protein-overexpressing mice is susceptible to various murine prion strains. J Virol 81, 1524-1527 (2007).

86. Nagamoto-Combs, K., Kulas, J. & Combs, C.K. A novel cell line from spontaneously immortalized murine microglia. J Neurosci Methods 233, 187-198 (2014).

40 General introduction 1

87. Sawada, M. et al. Brain-specific gene expression by immortalized microglial cell-mediated gene transfer in the mammalian brain. FEBS letters 433, 37-40 (1998).

88. Zhou, W., Cayabyab, F.S., Pennefather, P.S., Schlichter, L.C. & DeCoursey, T.E. HERG-like K+ channels in microglia. J Gen Physiol 111, 781-794 (1998).

89. Cheepsunthorn, P., Radov, L., Menzies, S., Reid, J. & Connor, J.R. Characterization of a novel brain-derived microglial cell line isolated from neonatal rat brain. Glia 35, 53-62 (2001). 90. Nagai, A. et al. Generation and characterization of immortalized human microglial cell lines: expression of cytokines and chemokines. Neurobiol Dis 8, 1057-1068 (2001). 91. Janabi, N., Peudenier, S., Heron, B., Ng, K.H. & Tardieu, M. Establishment of human microglial cell lines after transfection of primary cultures of embryonic microglial cells with the SV40 large T antigen.Neurosci Lett 195, 105-108 (1995).

92. Leone, C. et al. Characterization of human monocyte-derived microglia-like cells.Glia 54, 183-192 (2006).

93. Noto, D. et al. Development of a culture system to induce microglia-like cells from haematopoietic cells.Neuropathology and applied neurobiology 40, 697-713 (2014). 94. Schmidtmayer, J., Jacobsen, C., Miksch, G. & Sievers, J. Blood monocytes and spleen macrophages differentiate into microglia-like cells on monolayers of astrocytes: membrane currents. Glia 12, 259-267 (1994).

95. Servet-Delprat, C. et al. Flt3+ macrophage precursors commit sequentially to osteoclasts, dendritic cells and microglia.BMC Immunol 3, 15 (2002).

96. Ginhoux, F. et al. Fate mapping analysis reveals that adult microglia derive from primitive macrophages.Science 330, 841-845 (2010).

97. Almeida, S. et al. Induced pluripotent stem cell models of progranulin-deficient frontotemporal dementia uncover specific reversible neuronal defects. Cell reports 2, 789-798 (2012). 98. Karlstetter, M. et al. Translocator protein (18 kDa) (TSPO) is expressed in reactive retinal microglia and modulates microglial inflammation and phagocytosis.Journal of neuroinflammation 11, 3 (2014).

99. Napoli, I., Kierdorf, K. & Neumann, H. Microglial precursors derived from mouse embryonic stem cells. Glia 57, 1660-1671 (2009).

100. Schwartz, M.P. et al. Human pluripotent stem cell-derived neural constructs for predicting neural toxicity.Proceedings of the National Academy of Sciences of the United States of America 112, 12516-12521 (2015).

101. Giulian, D. & Baker, T.J. Characterization of ameboid microglia isolated from developing mammalian brain.The Journal of neuroscience : the official journal of the Society for Neuroscience 6, 2163-2178 (1986).

102. Smith, A.M. & Dragunow, M. The human side of microglia. Trends in neurosciences 37, 125-135 (2014).

103. Seok, J. et al. Genomic responses in mouse models poorly mimic human inflammatory diseases.Proceedings of the National Academy of Sciences of the United States of America 110, 3507-3512 (2013). 104. Peferoen, L.A. et al. Activation status of human microglia is dependent on lesion formation stage and remyelination in multiple sclerosis. Journal of neuropathology and experimental neurology 74, 48-63 (2015).

105. Walsh, J.G. et al. Rapid inflammasome activation in microglia contributes to brain disease in HIV/AIDS.Retrovirology 11, 35 (2014). 106. Watkins, L.R. & Hutchinson, M.R. A concern on comparing ‘apples’ and ‘oranges’ when differences between microglia used in human and rodent studies go far, far beyond simply species: comment on Smith and Dragunow. Trends in neurosciences 37, 189- 190 (2014).

107. Zuiderwijk-Sick, E.A. et al. Differentiation of primary adult microglia alters their response to TLR8-mediated activation but not their capacity as APC. Glia 55, 1589-1600 (2007).

108. Smith, A.M. & Dragunow, M. Response to Watkins and Hutchinson. Trends in neurosciences 37, 190 (2014).

109. Olah, M. et al. An optimized protocol for the acute isolation of human microglia from autopsy brain samples.Glia 60, 96-111 (2012).

110. Ni, M. & Aschner, M. Neonatal rat primary microglia: isolation, culturing, and selected applications.Current protocols in toxicology / editorial board, Mahin D. Maines Chapter 12, Unit 12 17 (2010). 111. Lawson, L.J., Perry, V.H., Dri, P. & Gordon, S. Heterogeneity in the distribution and morphology of microglia in the normal adult mouse brain. Neuroscience 39, 151-170 (1990).

112. Kierdorf, K. et al. Microglia emerge from erythromyeloid precursors via Pu.1- and Irf8-dependent pathways. Nature neuroscience 16, 273-280 (2013).

113. Schulz, C. et al. A lineage of myeloid cells independent of Myb and hematopoietic stem cells.Science 336, 86-90 (2012). 114. Ajami, B., Bennett, J.L., Krieger, C., Tetzlaff, W. & Rossi, F.M. Local self-renewal can sustain CNS microglia maintenance and function throughout adult life. Nature neuroscience 10, 1538-1543 (2007).

41 Chapter 1

115. Gomez Perdiguero, E. et al. Tissue-resident macrophages originate from yolk-sac-derived erythro-myeloid progenitors. Nature 518, 547-551 (2015).

116. Davalos, D. et al. ATP mediates rapid microglial response to local brain injury in vivo. Nature neuroscience 8, 752-758 (2005).

117. Santambrogio, L. et al. Developmental plasticity of CNS microglia.Proceedings of the National Academy of Sciences of the United States of America 98, 6295-6300 (2001). 118. Brionne, T.C., Tesseur, I., Masliah, E. & Wyss-Coray, T. Loss of TGF-beta 1 leads to increased neuronal cell death and microgliosis in mouse brain. Neuron 40, 1133-1145 (2003).

119. Bajramovic, J.J. Regulation of innate immune responses in the central nervous system.CNS Neurol Disord Drug Targets 10, 4-24 (2011).

120. Ransohoff, R.M. & Cardona, A.E. The myeloid cells of the central nervous system parenchyma.Nature 468, 253-262 (2010).

121. Hoek, R.M. et al. Down-regulation of the macrophage lineage through interaction with OX2 (CD200).Science 290, 1768-1771 (2000).

122. Durafourt, B.A. et al. Comparison of polarization properties of human adult microglia and blood-derived macrophages.Glia 60, 717-727 (2012).

123. Vogel, D.Y. et al. Macrophages in inflammatory multiple sclerosis lesions have an intermediate activation status.Journal of neuroinflammation 10, 35 (2013). 124. Battista, D., Ferrari, C.C., Gage, F.H. & Pitossi, F.J. Neurogenic niche modulation by activated microglia: transforming growth factor beta increases neurogenesis in the adult dentate gyrus. Eur J Neurosci 23, 83-93 (2006).

125. Bessis, A., Bechade, C., Bernard, D. & Roumier, A. Microglial control of neuronal death and synaptic properties.Glia 55, 233-238 (2007).

126. Gomes, C. et al. Activation of microglial cells triggers a release of brain-derived neurotrophic factor (BDNF) inducing their proliferation in an adenosine A2A receptor-dependent manner: A2A receptor blockade prevents BDNF release and proliferation of microglia. Journal of neuroinflammation 10, 16 (2013).

127. Parkhurst, C.N. et al. Microglia promote learning-dependent synapse formation through brain-derived neurotrophic factor.Cell 155, 1596-1609 (2013). 128. Suh, H.S., Zhao, M.L., Derico, L., Choi, N. & Lee, S.C. Insulin-like growth factor 1 and 2 (IGF1, IGF2) expression in human microglia: differential regulation by inflammatory mediators.Journal of neuroinflammation 10, 37 (2013). 129. D’Ercole, A.J., Ye, P. & O’Kusky, J.R. Mutant mouse models of insulin-like growth factor actions in the central nervous system. Neuropeptides 36, 209-220 (2002).

130. Huang, E.J. & Reichardt, L.F. Neurotrophins: roles in neuronal development and function.Annu Rev Neurosci 24, 677-736 (2001).

131. Walton, N.M. et al. Microglia instruct subventricular zone neurogenesis. Glia 54, 815-825 (2006).

132. Marin-Teva, J.L. et al. Microglia promote the death of developing Purkinje cells. Neuron 41, 535-547 (2004).

133. Sierra, A. et al. Microglia shape adult hippocampal neurogenesis through apoptosis-coupled phagocytosis. Cell Stem Cell 7, 483-495 (2010).

134. Dekkers, M.P., Nikoletopoulou, V. & Barde, Y.A. Cell biology in neuroscience: Death of developing neurons: new insights and implications for connectivity.J Cell Biol 203, 385-393 (2013).

135. Biber, K., Neumann, H., Inoue, K. & Boddeke, H.W. Neuronal ‘On’ and ‘Off’ signals control microglia.Trends in neurosciences 30, 596-602 (2007).

136. Koizumi, S. et al. UDP acting at P2Y6 receptors is a mediator of microglial phagocytosis.Nature 446, 1091-1095 (2007).

137. Rappert, A. et al. CXCR3-dependent microglial recruitment is essential for dendrite loss after brain lesion. The Journal of neuroscience : the official journal of the Society for Neuroscience 24, 8500-8509 (2004).

138. Ravichandran, K.S. “Recruitment signals” from apoptotic cells: invitation to a quiet meal.Cell 113, 817-820 (2003).

139. Ravichandran, K.S. & Lorenz, U. Engulfment of apoptotic cells: signals for a good meal.Nat Rev Immunol 7, 964-974 (2007).

140. Mazaheri, F. et al. Distinct roles for BAI1 and TIM-4 in the engulfment of dying neurons by microglia.Nat Commun 5, 4046 (2014). 141. Takahashi, K., Rochford, C.D. & Neumann, H. Clearance of apoptotic neurons without inflammation by microglial triggering receptor expressed on myeloid cells-2. J Exp Med 201, 647-657 (2005).

142. Stevens, B. et al. The classical complement cascade mediates CNS synapse elimination.Cell 131, 1164-1178 (2007).

143. Schafer, D.P. et al. Microglia sculpt postnatal neural circuits in an activity and complement-dependent manner.Neuron 74, 691-705 (2012).

144. Nimmerjahn, A., Kirchhoff, F. & Helmchen, F. Resting microglial cells are highly dynamic surveillants of brain parenchyma in vivo. Science 308, 1314-1318 (2005).

42 General introduction 1

145. Aloisi, F. Immune function of microglia.Glia 36, 165-179 (2001).

146. Block, M.L., Zecca, L. & Hong, J.S. Microglia-mediated neurotoxicity: uncovering the molecular mechanisms. Nat Rev Neurosci 8, 57-69 (2007).

147. Chopp, M. et al. Neuronal injury and expression of 72-kDa heat-shock protein after forebrain ischemia in the rat.Acta neuropathologica 83, 66-71 (1991). 148. Faraco, G. et al. High mobility group box 1 protein is released by neural cells upon different stresses and worsens ischemic neurodegeneration in vitro and in vivo.Journal of neurochemistry 103, 590-603 (2007).

149. Ulvestad, E. et al. Reactive microglia in multiple sclerosis lesions have an increased expression of receptors for the Fc part of IgG.J Neurol Sci 121, 125-131 (1994). 150. Webster, S.D., Park, M., Fonseca, M.I. & Tenner, A.J. Structural and functional evidence for microglial expression of C1qR(P), the C1q receptor that enhances phagocytosis. J Leukoc Biol 67, 109-116 (2000).

151. Ebner, F. et al. Microglial activation milieu controls regulatory T cell responses.Journal of immunology 191, 5594-5602 (2013). 152. Aloisi, F., Ria, F. & Adorini, L. Regulation of T-cell responses by CNS antigen-presenting cells: different roles for microglia and astrocytes. Immunol Today 21, 141-147 (2000). 153. Aloisi, F. et al. Relative efficiency of microglia, astrocytes, dendritic cells and B cells in naive CD4+ T cell priming and Th1/Th2 cell restimulation.European journal of immunology 29, 2705-2714 (1999).

154. Lambert, C. et al. Dendritic cell differentiation signals induce anti-inflammatory properties in human adult microglia.Journal of immunology 181, 8288-8297 (2008).

155. Hanisch, U.K. Microglia as a source and target of cytokines. Glia 40, 140-155 (2002).

156. Van Der Putten, C. et al. Statins amplify TLR-induced responses in microglia via inhibition of cholesterol biosynthesis.Glia 60, 43-52 (2012).

157. Chung, Y. et al. Critical regulation of early Th17 cell differentiation by interleukin-1 signaling.Immunity 30, 576-587 (2009). 158. Sutton, C.E. et al. Interleukin-1 and IL-23 induce innate IL-17 production from gammadelta T cells, amplifying Th17 responses and autoimmunity. Immunity 31, 331-341 (2009). 159. Veldhoen, M., Hocking, R.J., Atkins, C.J., Locksley, R.M. & Stockinger, B. TGFbeta in the context of an inflammatory cytokine milieu supports de novo differentiation of IL-17-producing T cells.Immunity 24, 179-189 (2006).

160. Langrish, C.L. et al. IL-23 drives a pathogenic T cell population that induces autoimmune inflammation.J Exp Med 201, 233-240 (2005).

161. Wang, D. et al. Structural insights into the assembly and activation of IL-1beta with its receptors.Nature immunology 11, 905-911 (2010).

162. Block, M.L. & Hong, J.S. Microglia and inflammation-mediated neurodegeneration: multiple triggers with a common mechanism. Progress in neurobiology 76, 77-98 (2005). 163. Kotter, M.R., Li, W.W., Zhao, C. & Franklin, R.J. Myelin impairs CNS remyelination by inhibiting oligodendrocyte precursor cell differentiation.The Journal of neuroscience : the official journal of the Society for Neuroscience 26, 328-332 (2006). 164. Brundula, V., Rewcastle, N.B., Metz, L.M., Bernard, C.C. & Yong, V.W. Targeting leukocyte MMPs and transmigration: minocycline as a potential therapy for multiple sclerosis.Brain : a journal of neurology 125, 1297-1308 (2002).

165. Miron, V.E. et al. M2 microglia and macrophages drive oligodendrocyte differentiation during CNS remyelination.Nature neuroscience 16, 1211-1218 (2013).

166. Li, Y. et al. Increased IL-23p19 expression in multiple sclerosis lesions and its induction in microglia.Brain : a journal of neurology 130, 490-501 (2007). 167. Selmaj, K., Raine, C.S., Cannella, B. & Brosnan, C.F. Identification of lymphotoxin and tumor necrosis factor in multiple sclerosis lesions. J Clin Invest 87, 949-954 (1991). 168. Simpson, J.E., Newcombe, J., Cuzner, M.L. & Woodroofe, M.N. Expression of monocyte chemoattractant protein-1 and other beta- chemokines by resident glia and inflammatory cells in multiple sclerosis lesions.Journal of neuroimmunology 84, 238-249 (1998). 169. Windhagen, A. et al. Expression of costimulatory molecules B7-1 (CD80), B7-2 (CD86), and interleukin 12 cytokine in multiple sclerosis lesions. J Exp Med 182, 1985-1996 (1995). 170. Marik, C., Felts, P.A., Bauer, J., Lassmann, H. & Smith, K.J. Lesion genesis in a subset of patients with multiple sclerosis: a role for innate immunity? Brain : a journal of neurology 130, 2800-2815 (2007).

171. van der Goes, A. et al. Reactive oxygen species are required for the phagocytosis of myelin by macrophages.Journal of neuroimmunology 92, 67-75 (1998). 172. Furr, S.R., Chauhan, V.S., Sterka, D., Jr., Grdzelishvili, V. & Marriott, I. Characterization of retinoic acid-inducible gene-I expression in primary murine glia following exposure to vesicular stomatitis virus.Journal of neurovirology 14, 503-513 (2008).

43 Chapter 1

173. Abulafia, D.P. et al. Inhibition of the inflammasome complex reduces the inflammatory response after thromboembolic stroke in mice. J Cereb Blood Flow Metab 29, 534-544 (2009). 174. Jamilloux, Y. et al. Inflammasome activation restricts Legionella pneumophila replication in primary microglial cells through flagellin detection.Glia 61, 539-549 (2013).

175. Shi, F. et al. Prion protein participates in the regulation of classical and alternative activation of BV2 microglia.Journal of neurochemistry 124, 168-174 (2013). 176. Olson, J.K. & Miller, S.D. Microglia initiate central nervous system innate and adaptive immune responses through multiple TLRs. Journal of immunology 173, 3916-3924 (2004). 177. Bsibsi, M., Ravid, R., Gveric, D. & van Noort, J.M. Broad expression of Toll-like receptors in the human central nervous system. Journal of neuropathology and experimental neurology 61, 1013-1021 (2002).

178. Furr, S.R. & Marriott, I. Viral CNS infections: role of glial pattern recognition receptors in neuroinflammation.Front Microbiol 3, 201 (2012).

179. Kanneganti, T.D., Lamkanfi, M. & Nunez, G. Intracellular NOD-like receptors in host defense and disease.Immunity 27, 549-559 (2007).

180. Ting, J.P., Duncan, J.A. & Lei, Y. How the noninflammasome NLRs function in the innate immune system.Science 327, 286-290 (2010).

181. Hornung, V. et al. AIM2 recognizes cytosolic dsDNA and forms a caspase-1-activating inflammasome with ASC.Nature 458, 514- 518 (2009).

182. Khare, S. et al. An NLRP7-containing inflammasome mediates recognition of microbial lipopeptides in human macrophages. Immunity 36, 464-476 (2012).

183. Mariathasan, S. et al. Differential activation of the inflammasome by caspase-1 adaptors ASC and Ipaf.Nature 430, 213-218 (2004).

184. Minkiewicz, J., de Rivero Vaccari, J.P. & Keane, R.W. Human astrocytes express a novel NLRP2 inflammasome.Glia 61, 1113-1121 (2013).

185. Wang, L. et al. PYPAF7, a novel PYRIN-containing Apaf1-like protein that regulates activation of NF-kappa B and caspase-1- dependent cytokine processing. The Journal of biological chemistry 277, 29874-29880 (2002).

186. Lupfer, C. & Kanneganti, T.D. Unsolved Mysteries in NLR Biology.Frontiers in immunology 4, 285 (2013). 187. Jin, T. et al. Structures of the HIN domain:DNA complexes reveal ligand binding and activation mechanisms of the AIM2 inflammasome and IFI16 receptor.Immunity 36, 561-571 (2012).

188. Faustin, B. et al. Reconstituted NALP1 inflammasome reveals two-step mechanism of caspase-1 activation.Mol Cell 25, 713-724 (2007).

189. Sutterwala, F.S. & Flavell, R.A. NLRC4/IPAF: a CARD carrying member of the NLR family.Clin Immunol 130, 2-6 (2009). 190. Agostini, L. et al. NALP3 forms an IL-1beta-processing inflammasome with increased activity in Muckle-Wells autoinflammatory disorder. Immunity 20, 319-325 (2004).

191. Chavarria-Smith, J. & Vance, R.E. The NLRP1 inflammasomes.Immunol Rev 265, 22-34 (2015).

192. Finger, J.N. et al. Autolytic proteolysis within the function to find domain (FIIND) is required for NLRP1 inflammasome activity.The Journal of biological chemistry 287, 25030-25037 (2012). 193. Kaushal, V. et al. Neuronal NLRP1 inflammasome activation of Caspase-1 coordinately regulates inflammatory interleukin-1-beta production and axonal degeneration-associated Caspase-6 activation.Cell death and differentiation 22, 1676-1686 (2015).

194. Levinsohn, J.L. et al. Anthrax lethal factor cleavage of Nlrp1 is required for activation of the inflammasome.PLoS Pathog 8, e1002638 (2012).

195. Liao, K.C. & Mogridge, J. Activation of the Nlrp1b inflammasome by reduction of cytosolic ATP.Infect Immun 81, 570-579 (2013).

196. Moayeri, M., Sastalla, I. & Leppla, S.H. Anthrax and the inflammasome.Microbes Infect 14, 392-400 (2012). 197. Newman, Z.L., Crown, D., Leppla, S.H. & Moayeri, M. Anthrax lethal toxin activates the inflammasome in sensitive rat macrophages. Biochemical and biophysical research communications 398, 785-789 (2010).

198. Petrilli, V. et al. Activation of the NALP3 inflammasome is triggered by low intracellular potassium concentration.Cell death and differentiation 14, 1583-1589 (2007). 199. Reubold, T.F., Hahne, G., Wohlgemuth, S. & Eschenburg, S. Crystal structure of the leucine-rich repeat domain of the NOD-like receptor NLRP1: implications for binding of muramyl dipeptide.FEBS letters 588, 3327-3332 (2014).

200. Tan, M.S. et al. Amyloid-beta induces NLRP1-dependent neuronal pyroptosis in models of Alzheimer’s disease. Cell Death Dis 5, e1382 (2014).

201. Bruey, J.M. et al. PAN1/NALP2/PYPAF2, an inducible inflammatory mediator that regulates NF-kappaB and caspase-1 activation in macrophages. The Journal of biological chemistry 279, 51897-51907 (2004).

44 General introduction 1

202. Ji, S. et al. Toll-like receptor 2 and NALP2 mediate induction of human beta-defensins by fusobacterium nucleatum in gingival epithelial cells. Infect Immun 77, 1044-1052 (2009). 203. Kinoshita, T., Wang, Y., Hasegawa, M., Imamura, R. & Suda, T. PYPAF3, a PYRIN-containing APAF-1-like protein, is a feedback regulator of caspase-1-dependent interleukin-1beta secretion.The Journal of biological chemistry 280, 21720-21725 (2005).

204. Chakrabarti, A. et al. RNase L activates the NLRP3 inflammasome during viral infections.Cell Host Microbe 17, 466-477 (2015).

205. Lupfer, C. & Kanneganti, T.D. The expanding role of NLRs in antiviral immunity.Immunol Rev 255, 13-24 (2013). 206. Munoz-Planillo, R. et al. K(+) efflux is the common trigger of NLRP3 inflammasome activation by bacterial toxins and particulate matter.Immunity 38, 1142-1153 (2013).

207. Wang, X. et al. RNA viruses promote activation of the NLRP3 inflammasome through a RIP1-RIP3-DRP1 signaling pathway.Nature immunology 15, 1126-1133 (2014). 208. Cui, J. et al. NLRP4 negatively regulates type I interferon signaling by targeting the kinase TBK1 for degradation via the ubiquitin ligase DTX4. Nature immunology 13, 387-395 (2012).

209. Jounai, N. et al. NLRP4 negatively regulates autophagic processes through an association with beclin1.Journal of immunology 186, 1646-1655 (2011).

210. Anand, P.K. & Kanneganti, T.D. NLRP6 in infection and inflammation.Microbes Infect 15, 661-668 (2013).

211. Anand, P.K. et al. NLRP6 negatively regulates innate immunity and host defence against bacterial pathogens.Nature 488, 389-393 (2012).

212. Chen, G.Y. Role of Nlrp6 and Nlrp12 in the maintenance of intestinal homeostasis.European journal of immunology 44, 321-327 (2014).

213. Janowski, A.M., Kolb, R., Zhang, W. & Sutterwala, F.S. Beneficial and Detrimental Roles of NLRs in Carcinogenesis.Frontiers in immunology 4, 370 (2013). 214. Radian, A.D., de Almeida, L., Dorfleutner, A. & Stehlik, C. NLRP7 and related inflammasome activating pattern recognition receptors and their function in host defense and disease.Microbes Infect 15, 630-639 (2013).

215. Imamura, R. et al. Anti-inflammatory activity of PYNOD and its mechanism in humans and mice.Journal of immunology 184, 5874- 5884 (2010).

216. Lautz, K. et al. NLRP10 enhances Shigella-induced pro-inflammatory responses.Cellular microbiology 14, 1568-1583 (2012). 217. Murphy, N., Grehan, B. & Lynch, M.A. Glial uptake of amyloid beta induces NLRP3 inflammasome formation via cathepsin- dependent degradation of NLRP10.Neuromolecular Med 16, 205-215 (2014).

218. Wang, Y. et al. PYNOD, a novel Apaf-1/CED4-like protein is an inhibitor of ASC and caspase-1. Int Immunol 16, 777-786 (2004). 219. Allen, I.C. et al. NLRP12 suppresses colon inflammation and tumorigenesis through the negative regulation of noncanonical NF- kappaB signaling. Immunity 36, 742-754 (2012). 220. Lich, J.D. & Ting, J.P. Monarch-1/PYPAF7 and other CATERPILLER (CLR, NOD, NLR) proteins with negative regulatory functions. Microbes Infect 9, 672-676 (2007).

221. Vladimer, G.I. et al. The NLRP12 inflammasome recognizes Yersinia pestis.Immunity 37, 96-107 (2012).

222. Dombrowski, Y. et al. Honey bee (Apis mellifera) venom induces AIM2 inflammasome activation in human keratinocytes.Allergy 67, 1400-1407 (2012).

223. Gomes, M.T. et al. Critical role of ASC inflammasomes and bacterial type IV secretion system in caspase-1 activation and host innate resistance to Brucella abortus infection.Journal of immunology 190, 3629-3638 (2013).

224. Lu, B. et al. Novel role of PKR in inflammasome activation and HMGB1 release.Nature 488, 670-674 (2012).

225. Rathinam, V.A. et al. The AIM2 inflammasome is essential for host defense against cytosolic bacteria and DNA viruses.Nature immunology 11, 395-402 (2010).

226. Saiga, H. et al. Critical role of AIM2 in Mycobacterium tuberculosis infection.Int Immunol 24, 637-644 (2012).

227. Warren, S.E. et al. Cutting edge: Cytosolic bacterial DNA activates the inflammasome via Aim2.Journal of immunology 185, 818- 821 (2010).

228. Wu, J., Fernandes-Alnemri, T. & Alnemri, E.S. Involvement of the AIM2, NLRC4, and NLRP3 inflammasomes in caspase-1 activation by Listeria monocytogenes. J Clin Immunol 30, 693-702 (2010). 229. Zhang, W. et al. AIM2 facilitates the apoptotic DNA-induced systemic lupus erythematosus via arbitrating macrophage functional maturation.J Clin Immunol 33, 925-937 (2013).

230. Kofoed, E.M. & Vance, R.E. Innate immune recognition of bacterial ligands by NAIPs determines inflammasome specificity.Nature 477, 592-595 (2011).

45 Chapter 1

231. Lightfield, K.L. et al. Differential requirements for NAIP5 in activation of the NLRC4 inflammasome.Infect Immun 79, 1606-1614 (2011).

232. Suzuki, S. et al. Shigella type III secretion protein MxiI is recognized by Naip2 to induce Nlrc4 inflammasome activation independently of Pkcdelta. PLoS Pathog 10, e1003926 (2014). 233. Tenthorey, J.L., Kofoed, E.M., Daugherty, M.D., Malik, H.S. & Vance, R.E. Molecular basis for specific recognition of bacterial ligands by NAIP/NLRC4 inflammasomes.Mol Cell 54, 17-29 (2014).

234. Zhao, Y. et al. The NLRC4 inflammasome receptors for bacterial flagellin and type III secretion apparatus.Nature 477, 596-600 (2011).

235. Franchi, L. et al. NLRC4-driven production of IL-1beta discriminates between pathogenic and commensal bacteria and promotes host intestinal defense.Nature immunology 13, 449-456 (2012). 236. Hepburn, L. et al. Innate immunity. A Spaetzle-like role for nerve growth factor beta in vertebrate immunity to Staphylococcus aureus. Science 346, 641-646 (2014). 237. Liu, L. & Chan, C. IPAF inflammasome is involved in interleukin-1beta production from astrocytes, induced by palmitate; implications for Alzheimer’s Disease.Neurobiol Aging 35, 309-321 (2014). 238. Man, S.M. et al. Salmonella infection induces recruitment of Caspase-8 to the inflammasome to modulate IL-1beta production. Journal of immunology 191, 5239-5246 (2013).

239. Matusiak, M. et al. Flagellin-induced NLRC4 phosphorylation primes the inflammasome for activation by NAIP5.Proceedings of the National Academy of Sciences of the United States of America 112, 1541-1546 (2015).

240. Miao, E.A. et al. Caspase-1-induced pyroptosis is an innate immune effector mechanism against intracellular bacteria.Nature immunology 11, 1136-1142 (2010).

241. Miao, E.A. et al. Innate immune detection of the type III secretion apparatus through the NLRC4 inflammasome.Proceedings of the National Academy of Sciences of the United States of America 107, 3076-3080 (2010).

242. Sutterwala, F.S. et al. Immune recognition of Pseudomonas aeruginosa mediated by the IPAF/NLRC4 inflammasome.J Exp Med 204, 3235-3245 (2007). 243. Torres, I.M. et al. Acidosis potentiates the host proinflammatory interleukin-1beta response to Pseudomonas aeruginosa infection. Infect Immun 82, 4689-4697 (2014). 244. Vijay-Kumar, M., Carvalho, F.A., Aitken, J.D., Fifadara, N.H. & Gewirtz, A.T. TLR5 or NLRC4 is necessary and sufficient for promotion of humoral immunity by flagellin.European journal of immunology 40, 3528-3534 (2010). 245. Warren, S.E., Mao, D.P., Rodriguez, A.E., Miao, E.A. & Aderem, A. Multiple Nod-like receptors activate caspase 1 during Listeria monocytogenes infection.Journal of immunology 180, 7558-7564 (2008). 246. Chamaillard, M., Girardin, S.E., Viala, J. & Philpott, D.J. Nods, Nalps and Naip: intracellular regulators of bacterial-induced inflammation.Cellular microbiology 5, 581-592 (2003).

247. Girardin, S.E. et al. Nod1 detects a unique muropeptide from gram-negative bacterial peptidoglycan.Science 300, 1584-1587 (2003).

248. Inohara, N. et al. Nod1, an Apaf-1-like activator of caspase-9 and nuclear factor-kappaB.The Journal of biological chemistry 274, 14560-14567 (1999).

249. Abbott, D.W., Wilkins, A., Asara, J.M. & Cantley, L.C. The Crohn’s disease protein, NOD2, requires RIP2 in order to induce ubiquitinylation of a novel site on NEMO.Curr Biol 14, 2217-2227 (2004). 250. Dugan, J.W. et al. Nucleotide oligomerization domain-2 interacts with 2’-5’-oligoadenylate synthetase type 2 and enhances RNase-L function in THP-1 cells.Mol Immunol 47, 560-566 (2009).

251. Girardin, S.E. et al. Nod2 is a general sensor of peptidoglycan through muramyl dipeptide (MDP) detection.The Journal of biological chemistry 278, 8869-8872 (2003). 252. Hsu, L.C. et al. A NOD2-NALP1 complex mediates caspase-1-dependent IL-1beta secretion in response to Bacillus anthracis infection and muramyl dipeptide.Proceedings of the National Academy of Sciences of the United States of America 105, 7803-7808 (2008).

253. Lipinski, S. et al. DUOX2-derived reactive oxygen species are effectors of NOD2-mediated antibacterial responses.J Cell Sci 122, 3522-3530 (2009).

254. Ogura, Y. et al. Nod2, a Nod1/Apaf-1 family member that is restricted to monocytes and activates NF-kappaB.The Journal of biological chemistry 276, 4812-4818 (2001). 255. Windheim, M., Lang, C., Peggie, M., Plater, L.A. & Cohen, P. Molecular mechanisms involved in the regulation of cytokine production by muramyl dipeptide.Biochem J 404, 179-190 (2007).

256. Conti, B.J. et al. CATERPILLER 16.2 (CLR16.2), a novel NBD/LRR family member that negatively regulates T cell function.The Journal of biological chemistry 280, 18375-18385 (2005).

46 General introduction 1

257. Schneider, M. et al. The innate immune sensor NLRC3 attenuates Toll-like receptor signaling via modification of the signaling adaptor TRAF6 and transcription factor NF-kappaB.Nature immunology 13, 823-831 (2012).

258. Shiau, C.E., Monk, K.R., Joo, W. & Talbot, W.S. An anti-inflammatory NOD-like receptor is required for microglia development.Cell reports 5, 1342-1352 (2013). 259. Zhang, L. et al. NLRC3, a member of the NLR family of proteins, is a negative regulator of innate immune signaling induced by the DNA sensor STING. Immunity 40, 329-341 (2014).

260. Benko, S., Magalhaes, J.G., Philpott, D.J. & Girardin, S.E. NLRC5 limits the activation of inflammatory pathways.Journal of immunology 185, 1681-1691 (2010).

261. Meissner, T.B. et al. NLRC5 cooperates with the RFX transcription factor complex to induce MHC class I gene expression.Journal of immunology 188, 4951-4958 (2012).

262. Neerincx, A. et al. The N-terminal domain of NLRC5 confers transcriptional activity for MHC class I and II gene expression.Journal of immunology 193, 3090-3100 (2014). 263. Triantafilou, K., Kar, S., van Kuppeveld, F.J. & Triantafilou, M. Rhinovirus-induced calcium flux triggers NLRP3 and NLRC5 activation in bronchial cells. Am J Respir Cell Mol Biol 49, 923-934 (2013). 264. Allen, I.C. et al. NLRX1 protein attenuates inflammatory responses to infection by interfering with the RIG-I-MAVS and TRAF6-NF- kappaB signaling pathways. Immunity 34, 854-865 (2011). 265. Hong, M., Yoon, S.I. & Wilson, I.A. Structure and functional characterization of the RNA-binding element of the NLRX1 innate immune modulator. Immunity 36, 337-347 (2012).

266. Imbeault, E., Mahvelati, T.M., Braun, R., Gris, P. & Gris, D. Nlrx1 regulates neuronal cell death.Mol Brain 7, 90 (2014). 267. Jaworska, J. et al. NLRX1 prevents mitochondrial induced apoptosis and enhances macrophage antiviral immunity by interacting with influenza virus PB1-F2 protein.Proceedings of the National Academy of Sciences of the United States of America 111, E2110- 2119 (2014).

268. Lei, Y. et al. The mitochondrial proteins NLRX1 and TUFM form a complex that regulates type I interferon and autophagy. Immunity 36, 933-946 (2012).

269. Moore, C.B. et al. NLRX1 is a regulator of mitochondrial antiviral immunity.Nature 451, 573-577 (2008).

270. Singh, K. et al. NLRX1 acts as tumor suppressor by regulating TNF-alpha induced apoptosis and metabolism in cancer cells.Biochim Biophys Acta 1853, 1073-1086 (2015).

271. Unger, B.L. et al. Nod-like receptor X-1 is required for rhinovirus-induced barrier dysfunction in airway epithelial cells.J Virol 88, 3705-3718 (2014).

272. Xia, X. et al. NLRX1 negatively regulates TLR-induced NF-kappaB signaling by targeting TRAF6 and IKK.Immunity 34, 843-853 (2011).

273. Manji, G.A. et al. PYPAF1, a PYRIN-containing Apaf1-like protein that assembles with ASC and regulates activation of NF-kappa B. The Journal of biological chemistry 277, 11570-11575 (2002).

274. Srinivasula, S.M. et al. The PYRIN-CARD protein ASC is an activating adaptor for caspase-1.The Journal of biological chemistry 277, 21119-21122 (2002).

275. Franklin, B.S. et al. The adaptor ASC has extracellular and ‘prionoid’ activities that propagate inflammation.Nature immunology 15, 727-737 (2014).

276. Vajjhala, P.R., Mirams, R.E. & Hill, J.M. Multiple binding sites on the pyrin domain of ASC protein allow self-association and interaction with NLRP3 protein.The Journal of biological chemistry 287, 41732-41743 (2012).

277. Stutz, A., Horvath, G.L., Monks, B.G. & Latz, E. ASC speck formation as a readout for inflammasome activation.Methods Mol Biol 1040, 91-101 (2013). 278. Karmakar, M. et al. Neutrophil IL-1beta processing induced by pneumolysin is mediated by the NLRP3/ASC inflammasome and caspase-1 activation and is dependent on K+ efflux.Journal of immunology 194, 1763-1775 (2015). 279. Baroja-Mazo, A. et al. The NLRP3 inflammasome is released as a particulate danger signal that amplifies the inflammatory response. Nature immunology 15, 738-748 (2014).

280. Razmara, M. et al. CARD-8 protein, a new CARD family member that regulates caspase-1 activation and apoptosis.The Journal of biological chemistry 277, 13952-13958 (2002). 281. Ito, S., Hara, Y. & Kubota, T. CARD8 is a negative regulator for NLRP3 inflammasome, but mutant NLRP3 in cryopyrin-associated periodic syndromes escapes the restriction.Arthritis Res Ther 16, R52 (2014).

282. Qu, Y. et al. Phosphorylation of NLRC4 is critical for inflammasome activation.Nature 490, 539-542 (2012). 283. Wang, L.J. et al. Interactome-wide analysis identifies end-binding protein 1 as a crucial component for the speck-like particle formation of activated absence in melanoma 2 (AIM2) inflammasomes.Mol Cell Proteomics 11, 1230-1244 (2012).

47 Chapter 1

284. Martinon, F. & Tschopp, J. Inflammatory caspases: linking an intracellular innate immune system to autoinflammatory diseases.Cell 117, 561-574 (2004). 285. Franchi, L. et al. Cytosolic flagellin requires Ipaf for activation of caspase-1 and interleukin 1beta in salmonella-infected macrophages. Nature immunology 7, 576-582 (2006). 286. Sutterwala, F.S. et al. Critical role for NALP3/CIAS1/Cryopyrin in innate and adaptive immunity through its regulation of caspase-1. Immunity 24, 317-327 (2006).

287. Cerretti, D.P. et al. Molecular cloning of the interleukin-1 beta converting enzyme.Science 256, 97-100 (1992).

288. Thornberry, N.A. et al. A novel heterodimeric cysteine protease is required for interleukin-1 beta processing in monocytes. Nature 356, 768-774 (1992).

289. Wilson, K.P. et al. Structure and mechanism of interleukin-1 beta converting enzyme.Nature 370, 270-275 (1994).

290. Wang, S. et al. Murine caspase-11, an ICE-interacting protease, is essential for the activation of ICE.Cell 92, 501-509 (1998).

291. Kayagaki, N. et al. Non-canonical inflammasome activation targets caspase-11.Nature 479, 117-121 (2011). 292. Sollberger, G., Strittmatter, G.E., Kistowska, M., French, L.E. & Beer, H.D. Caspase-4 is required for activation of inflammasomes. Journal of immunology 188, 1992-2000 (2012).

293. Szegezdi, E., Fitzgerald, U. & Samali, A. Caspase-12 and ER-stress-mediated apoptosis: the story so far. Ann N Y Acad Sci 1010, 186- 194 (2003).

294. Saleh, M. et al. Differential modulation of endotoxin responsiveness by human caspase-12 polymorphisms.Nature 429, 75-79 (2004).

295. Bulau, A.M. et al. Role of caspase-1 in nuclear translocation of IL-37, release of the cytokine, and IL-37 inhibition of innate immune responses. Proceedings of the National Academy of Sciences of the United States of America 111, 2650-2655 (2014).

296. Lamkanfi, M. Emerging inflammasome effector mechanisms.Nat Rev Immunol 11, 213-220 (2011). 297. Palomo, J., Dietrich, D., Martin, P., Palmer, G. & Gabay, C. The interleukin (IL)-1 cytokine family - Balance between agonists and antagonists in inflammatory diseases.Cytokine 76, 25-37 (2015). 298. Netea, M.G. et al. Differential requirement for the activation of the inflammasome for processing and release of IL-1beta in monocytes and macrophages. Blood 113, 2324-2335 (2009).

299. Dinarello, C. et al. IL-1 family nomenclature. Nature immunology 11, 973 (2010).

300. Dinarello, C.A. Interleukin-1 beta, interleukin-18, and the interleukin-1 beta converting enzyme.Ann N Y Acad Sci 856, 1-11 (1998).

301. Miao, E.A., Rajan, J.V. & Aderem, A. Caspase-1-induced pyroptotic cell death.Immunol Rev 243, 206-214 (2011).

302. Lamkanfi, M. et al. Inflammasome-dependent release of the alarmin HMGB1 in endotoxemia.Journal of immunology 185, 4385- 4392 (2010).

303. Rayamajhi, M., Zhang, Y. & Miao, E.A. Detection of pyroptosis by measuring released lactate dehydrogenase activity.Methods Mol Biol 1040, 85-90 (2013).

304. Rock, K.L. & Kono, H. The inflammatory response to cell death.Annual review of pathology 3, 99-126 (2008).

305. Shi, Y., Evans, J.E. & Rock, K.L. Molecular identification of a danger signal that alerts the immune system to dying cells.Nature 425, 516-521 (2003).

306. Ewald, S.E., Chavarria-Smith, J. & Boothroyd, J.C. NLRP1 is an inflammasome sensor for Toxoplasma gondii.Infect Immun 82, 460- 468 (2014).

307. McAuley, J.L. et al. Activation of the NLRP3 inflammasome by IAV virulence protein PB1-F2 contributes to severe pathophysiology and disease. PLoS Pathog 9, e1003392 (2013).

308. Triantafilou, K. & Triantafilou, M. Ion flux in the lung: virus-induced inflammasome activation.Trends Microbiol 22, 580-588 (2014).

309. Baron, L. et al. The NLRP3 inflammasome is activated by nanoparticles through ATP, ADP and adenosine.Cell Death Dis 6, e1629 (2015).

310. Dostert, C. et al. Innate immune activation through Nalp3 inflammasome sensing of asbestos and silica.Science 320, 674-677 (2008).

311. Halle, A. et al. The NALP3 inflammasome is involved in the innate immune response to amyloid-beta.Nature immunology 9, 857- 865 (2008).

312. Latz, E. The inflammasomes: mechanisms of activation and function.Curr Opin Immunol 22, 28-33 (2010).

313. Riteau, N. et al. ATP release and purinergic signaling: a common pathway for particle-mediated inflammasome activation.Cell Death Dis 3, e403 (2012).

48 General introduction 1

314. Zhou, R., Yazdi, A.S., Menu, P. & Tschopp, J. A role for mitochondria in NLRP3 inflammasome activation.Nature 469, 221-225 (2011).

315. Adamczak, S.E. et al. Pyroptotic neuronal cell death mediated by the AIM2 inflammasome.J Cereb Blood Flow Metab 34, 621-629 (2014).

316. Furuya, T. et al. Caspase-11 mediates inflammatory dopaminergic cell death in the 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine mouse model of Parkinson’s disease. The Journal of neuroscience : the official journal of the Society for Neuroscience 24, 1865- 1872 (2004).

317. Meng, X.F. et al. Nod-like receptor protein 1 inflammasome mediates neuron injury under high glucose.Mol Neurobiol 49, 673-684 (2014).

318. Ramaswamy, V. et al. Inflammasome induction in Rasmussen’s encephalitis: cortical and associated white matter pathogenesis. Journal of neuroinflammation 10, 152 (2013).

319. Chen, L. et al. Chemical stimulation of the intracranial dura activates NALP3 inflammasome in trigeminal ganglia neurons.Brain Res 1566, 1-11 (2014). 320. Lammerding, L., Slowik, A., Johann, S., Beyer, C. & Zendedel, A. Post-Stroke Inflammasome Expression and Regulation in the Peri- Infarct Area by Gonadal Steroids after Transient Focal Ischemia in the Rat Brain.Neuroendocrinology (2015).

321. de Rivero Vaccari, J.P. et al. Exosome-mediated inflammasome signaling after central nervous system injury.Journal of neurochemistry (2015).

322. de Rivero Vaccari, J.P. et al. Therapeutic neutralization of the NLRP1 inflammasome reduces the innate immune response and improves histopathology after traumatic brain injury.J Cereb Blood Flow Metab 29, 1251-1261 (2009). 323. de Rivero Vaccari, J.P., Lotocki, G., Marcillo, A.E., Dietrich, W.D. & Keane, R.W. A molecular platform in neurons regulates inflammation after spinal cord injury.The Journal of neuroscience : the official journal of the Society for Neuroscience 28, 3404- 3414 (2008).

324. Fann, D.Y. et al. Pathogenesis of acute stroke and the role of inflammasomes.Ageing Res Rev 12, 941-966 (2013).

325. Silverman, W.R. et al. The pannexin 1 channel activates the inflammasome in neurons and astrocytes.The Journal of biological chemistry 284, 18143-18151 (2009).

326. Wang, X. et al. Ethanol directly induced HMGB1 release through NOX2/NLRP1 inflammasome in neuronal cells.Toxicology 334, 104-110 (2015).

327. Adamczak, S. et al. Inflammasome proteins in cerebrospinal fluid of brain-injured patients as biomarkers of functional outcome: clinical article.J Neurosurg 117, 1119-1125 (2012). 328. Buntinx, M. et al. Cytokine-induced cell death in human oligodendroglial cell lines. II: Alterations in gene expression induced by interferon-gamma and tumor necrosis factor-alpha. J Neurosci Res 76, 846-861 (2004). 329. Wang, Y. et al. STAT1/IRF-1 signaling pathway mediates the injurious effect of interferon-gamma on oligodendrocyte progenitor cells. Glia 58, 195-208 (2010). 330. Patel, J. & Balabanov, R. Molecular mechanisms of oligodendrocyte injury in multiple sclerosis and experimental autoimmune encephalomyelitis.International journal of molecular sciences 13, 10647-10659 (2012). 331. Alfonso-Loeches, S., Urena-Peralta, J.R., Morillo-Bargues, M.J., Oliver-De La Cruz, J. & Guerri, C. Role of mitochondria ROS generation in ethanol-induced NLRP3 inflammasome activation and cell death in astroglial cells.Front Cell Neurosci 8, 216 (2014).

332. Gustin, A. et al. NLRP3 Inflammasome Is Expressed and Functional in Mouse Brain Microglia but Not in Astrocytes.PloS one 10, e0130624 (2015).

333. Lu, M. et al. Uncoupling protein 2 deficiency aggravates astrocytic endoplasmic reticulum stress and nod-like receptor protein 3 inflammasome activation.Neurobiol Aging 35, 421-430 (2014).

334. Suk, K., Kim, S.Y. & Kim, H. Essential role of caspase-11 in activation-induced cell death of rat astrocytes.Journal of neurochemistry 80, 230-238 (2002). 335. Mathew, A. et al. Degraded mitochondrial DNA is a newly identified subtype of the damage associated molecular pattern (DAMP) family and possible trigger of neurodegeneration.Journal of Alzheimer’s disease : JAD 30, 617-627 (2012). 336. Zeis, T. et al. Metabolic gene expression changes in astrocytes in Multiple Sclerosis cerebral cortex are indicative of immune- mediated signaling. Brain Behav Immun 48, 313-325 (2015).

337. Zou, J. & Crews, F.T. Inflammasome-IL-1beta Signaling Mediates Ethanol Inhibition of Hippocampal Neurogenesis.Front Neurosci 6, 77 (2012).

338. Tarassishin, L., Casper, D. & Lee, S.C. Aberrant expression of interleukin-1beta and inflammasome activation in human malignant gliomas. PloS one 9, e103432 (2014). 339. Ystgaard, M.B. et al. Early Upregulation of NLRP3 in the Brain of Neonatal Mice Exposed to Hypoxia-Ischemia: No Early Neuroprotective Effects of NLRP3 Deficiency.Neonatology 108, 211-219 (2015).

49 Chapter 1

340. Frank, M.G. et al. The redox state of the alarmin HMGB1 is a pivotal factor in neuroinflammatory and microglial priming: a role for the NLRP3 inflammasome.Brain Behav Immun (2015).

341. Weber, M.D., Frank, M.G., Tracey, K.J., Watkins, L.R. & Maier, S.F. Stress induces the danger-associated molecular pattern HMGB-1 in the hippocampus of male Sprague Dawley rats: a priming stimulus of microglia and the NLRP3 inflammasome.The Journal of neuroscience : the official journal of the Society for Neuroscience 35, 316-324 (2015). 342. Indaram, M. et al. 7-Ketocholesterol increases retinal microglial migration, activation, and angiogenicity: a potential pathogenic mechanism underlying age-related macular degeneration.Sci Rep 5, 9144 (2015). 343. Chang, J. et al. Antibody-mediated inhibition of integrin alpha5beta1 blocks neurotoxic prion peptide PrP106-126-induced activation of BV2 microglia.J Mol Neurosci 48, 248-252 (2012).

344. Shi, F. et al. The NALP3 inflammasome is involved in neurotoxic prion peptide-induced microglial activation.Journal of neuroinflammation 9, 73 (2012). 345. Lee, H.M., Kang, J., Lee, S.J. & Jo, E.K. Microglial activation of the NLRP3 inflammasome by the priming signals derived from macrophages infected with mycobacteria. Glia 61, 441-452 (2013). 346. Liang, Y. et al. Rifampicin attenuates rotenone-induced inflammation via suppressing NLRP3 inflammasome activation in microglia. Brain Res 1622, 43-50 (2015). 347. Hafner-Bratkovic, I., Bencina, M., Fitzgerald, K.A., Golenbock, D. & Jerala, R. NLRP3 inflammasome activation in macrophage cell lines by prion protein fibrils as the source of IL-1beta and neuronal toxicity.Cell Mol Life Sci 69, 4215-4228 (2012). 348. Hanamsagar, R., Torres, V. & Kielian, T. Inflammasome activation and IL-1beta/IL-18 processing are influenced by distinct pathways in microglia. Journal of neurochemistry 119, 736-748 (2011). 349. Terada, K. et al. Involvement of cathepsin B in the processing and secretion of interleukin-1beta in chromogranin A-stimulated microglia. Glia 58, 114-124 (2010). 350. Wu, Z. et al. Differential pathways for interleukin-1beta production activated by chromogranin A and amyloid beta in microglia. Neurobiol Aging 34, 2715-2725 (2013). 351. Kaushik, D.K., Gupta, M., Kumawat, K.L. & Basu, A. NLRP3 inflammasome: key mediator of neuroinflammation in murine Japanese encephalitis.PloS one 7, e32270 (2012). 352. Meissner, F., Molawi, K. & Zychlinsky, A. Mutant superoxide dismutase 1-induced IL-1beta accelerates ALS pathogenesis. Proceedings of the National Academy of Sciences of the United States of America 107, 13046-13050 (2010). 353. Kersse, K., Vanden Berghe, T., Lamkanfi, M. & Vandenabeele, P. A phylogenetic and functional overview of inflammatory caspases and caspase-1-related CARD-only proteins. Biochem Soc Trans 35, 1508-1511 (2007).

354. Mitchell, A.J. et al. Inflammasome-dependent IFN-gamma drives pathogenesis in Streptococcus pneumoniae meningitis.Journal of immunology 189, 4970-4980 (2012). 355. Hoegen, T. et al. The NLRP3 inflammasome contributes to brain injury in pneumococcal meningitis and is activated through ATP- dependent lysosomal cathepsin B release. Journal of immunology 187, 5440-5451 (2011). 356. Kumar, M. et al. Inflammasome adaptor protein Apoptosis-associated speck-like protein containing CARD (ASC) is critical for the immune response and survival in west Nile virus encephalitis.J Virol 87, 3655-3667 (2013). 357. Mori, I. et al. Impaired microglial activation in the brain of IL-18-gene-disrupted mice after neurovirulent influenza A virus infection. Virology 287, 163-170 (2001). 358. Sergerie, Y., Rivest, S. & Boivin, G. Tumor necrosis factor-alpha and interleukin-1 beta play a critical role in the resistance against lethal herpes simplex virus encephalitis.J Infect Dis 196, 853-860 (2007).

359. Codolo, G. et al. Triggering of inflammasome by aggregated alpha-synuclein, an inflammatory response in synucleinopathies.PloS one 8, e55375 (2013). 360. Freeman, D. et al. Alpha-synuclein induces lysosomal rupture and cathepsin dependent reactive oxygen species following endocytosis. PloS one 8, e62143 (2013). 361. Parajuli, B. et al. Oligomeric amyloid beta induces IL-1beta processing via production of ROS: implication in Alzheimer’s disease. Cell Death Dis 4, e975 (2013). 362. Sheedy, F.J. et al. CD36 coordinates NLRP3 inflammasome activation by facilitating intracellular nucleation of soluble ligands into particulate ligands in sterile inflammation.Nature immunology 14, 812-820 (2013).

363. Prusiner, S.B. Prions. Proceedings of the National Academy of Sciences of the United States of America 95, 13363-13383 (1998).

364. Masters, S.L. & O’Neill, L.A. Disease-associated amyloid and misfolded protein aggregates activate the inflammasome.Trends Mol Med 17, 276-282 (2011).

365. Schultz, J. et al. Role of interleukin-1 in prion disease-associated astrocyte activation.Am J Pathol 165, 671-678 (2004).

366. Tamguney, G. et al. Genes contributing to prion pathogenesis.J Gen Virol 89, 1777-1788 (2008).

50 General introduction 1

367. Woodruff, T.M. et al. Pathophysiology, treatment, and animal and cellular models of human ischemic stroke.Mol Neurodegener 6, 11 (2011).

368. Boutin, H. et al. Role of IL-1alpha and IL-1beta in ischemic brain damage.The Journal of neuroscience : the official journal of the Society for Neuroscience 21, 5528-5534 (2001). 369. Schielke, G.P., Yang, G.Y., Shivers, B.D. & Betz, A.L. Reduced ischemic brain injury in interleukin-1 beta converting enzyme-deficient mice. J Cereb Blood Flow Metab 18, 180-185 (1998).

370. Huang, Y. & Mucke, L. Alzheimer mechanisms and therapeutic strategies.Cell 148, 1204-1222 (2012). 371. Blum-Degen, D. et al. Interleukin-1 beta and interleukin-6 are elevated in the cerebrospinal fluid of Alzheimer’s and de novo Parkinson’s disease patients.Neurosci Lett 202, 17-20 (1995).

372. Cacabelos, R. et al. Brain interleukin-1 beta in Alzheimer’s disease and vascular dementia.Methods Find Exp Clin Pharmacol 16, 141-151 (1994).

373. Licastro, F. et al. Increased plasma levels of interleukin-1, interleukin-6 and alpha-1-antichymotrypsin in patients with Alzheimer’s disease: peripheral inflammation or signals from the brain?Journal of neuroimmunology 103, 97-102 (2000).

374. Griffin, W.S., Liu, L., Li, Y., Mrak, R.E. & Barger, S.W. Interleukin-1 mediates Alzheimer and Lewy body pathologies.Journal of neuroinflammation 3, 5 (2006). 375. Hickman, S.E., Allison, E.K. & El Khoury, J. Microglial dysfunction and defective beta-amyloid clearance pathways in aging Alzheimer’s disease mice. The Journal of neuroscience : the official journal of the Society for Neuroscience 28, 8354-8360 (2008). 376. Meraz-Rios, M.A., Toral-Rios, D., Franco-Bocanegra, D., Villeda-Hernandez, J. & Campos-Pena, V. Inflammatory process in Alzheimer’s Disease. Front Integr Neurosci 7, 59 (2013).

377. Dauer, W. & Przedborski, S. Parkinson’s disease: mechanisms and models. Neuron 39, 889-909 (2003).

378. Long-Smith, C.M., Sullivan, A.M. & Nolan, Y.M. The influence of microglia on the pathogenesis of Parkinson’s disease.Progress in neurobiology 89, 277-287 (2009). 379. Mogi, M. et al. Interleukin-1 beta, interleukin-6, epidermal growth factor and transforming growth factor-alpha are elevated in the brain from parkinsonian patients.Neurosci Lett 180, 147-150 (1994). 380. Wang, L. et al. Metabolic inflammation exacerbates dopaminergic neuronal degeneration in response to acute MPTP challenge in type 2 diabetes mice. Exp Neurol 251, 22-29 (2014). 381. Gayle, D.A. et al. Lipopolysaccharide (LPS)-induced dopamine cell loss in culture: roles of tumor necrosis factor-alpha, interleukin- 1beta, and nitric oxide. Brain Res Dev Brain Res 133, 27-35 (2002). 382. de Jong, B.A. et al. Production of IL-1beta and IL-1Ra as risk factors for susceptibility and progression of relapse-onset multiple sclerosis. Journal of neuroimmunology 126, 172-179 (2002). 383. Dujmovic, I. et al. The analysis of IL-1 beta and its naturally occurring inhibitors in multiple sclerosis: The elevation of IL-1 receptor antagonist and IL-1 receptor type II after steroid therapy.Journal of neuroimmunology 207, 101-106 (2009). 384. Reale, M. et al. Relation between pro-inflammatory cytokines and acetylcholine levels in relapsing-remitting multiple sclerosis patients.International journal of molecular sciences 13, 12656-12664 (2012).

385. Romme Christensen, J. et al. Cellular sources of dysregulated cytokines in relapsing-remitting multiple sclerosis.Journal of neuroinflammation 9, 215 (2012). 386. Rossi, S. et al. Cerebrospinal fluid detection of interleukin-1beta in phase of remission predicts disease progression in multiple sclerosis. Journal of neuroinflammation 11, 32 (2014).

387. Seppi, D. et al. Cerebrospinal fluid IL-1beta correlates with cortical pathology load in multiple sclerosis at clinical onset.Journal of neuroimmunology 270, 56-60 (2014).

388. Rossi, S. et al. Interleukin-1beta causes synaptic hyperexcitability in multiple sclerosis.Annals of neurology 71, 76-83 (2012).

389. Argaw, A.T. et al. IL-1beta regulates blood-brain barrier permeability via reactivation of the hypoxia-angiogenesis program.Journal of immunology 177, 5574-5584 (2006). 390. Kawana, N. et al. Reactive astrocytes and perivascular macrophages express NLRP3 inflammasome in active demyelinating lesions of multiple sclerosis and necrotic lesions of neuromyelitis optica and cerebral infarction.Clinical and Experimental Neuroimmunology 4, 296-304 (2013). 391. Kitic, M. et al. Intrastriatal injection of interleukin-1 beta triggers the formation of neuromyelitis optica-like lesions in NMO-IgG seropositive rats.Acta Neuropathol Commun 1, 5 (2013). 392. Gris, D. et al. NLRP3 plays a critical role in the development of experimental autoimmune encephalomyelitis by mediating Th1 and Th17 responses. Journal of immunology 185, 974-981 (2010).

393. Soulika, A.M. et al. Initiation and progression of axonopathy in experimental autoimmune encephalomyelitis.The Journal of neuroscience : the official journal of the Society for Neuroscience 29, 14965-14979 (2009).

51 Chapter 1

394. Inoue, M., Williams, K.L., Gunn, M.D. & Shinohara, M.L. NLRP3 inflammasome induces chemotactic immune cell migration to the CNS in experimental autoimmune encephalomyelitis.Proceedings of the National Academy of Sciences of the United States of America 109, 10480-10485 (2012). 395. Jha, S. et al. The inflammasome sensor, NLRP3, regulates CNS inflammation and demyelination via caspase-1 and interleukin-18. The Journal of neuroscience : the official journal of the Society for Neuroscience 30, 15811-15820 (2010). 396. Shaw, P.J. et al. Cutting edge: critical role for PYCARD/ASC in the development of experimental autoimmune encephalomyelitis. Journal of immunology 184, 4610-4614 (2010). 397. Lalor, S.J. et al. Caspase-1-processed cytokines IL-1beta and IL-18 promote IL-17 production by gammadelta and CD4 T cells that mediate autoimmunity. Journal of immunology 186, 5738-5748 (2011). 398. Burger, D. et al. Glatiramer acetate increases IL-1 receptor antagonist but decreases T cell-induced IL-1beta in human monocytes and multiple sclerosis.Proceedings of the National Academy of Sciences of the United States of America 106, 4355-4359 (2009). 399. Comabella, M. et al. Induction of serum soluble tumor necrosis factor receptor II (sTNF-RII) and interleukin-1 receptor antagonist (IL-1ra) by interferon beta-1b in patients with progressive multiple sclerosis.Journal of neurology 255, 1136-1141 (2008). 400. Inoue, M. et al. Interferon-beta Therapy Against EAE Is Effective Only When Development of the Disease Depends on the NLRP3 Inflammasome.Sci Signal 5, ra38 (2012).

401. Rathinam, V.A., Vanaja, S.K. & Fitzgerald, K.A. Regulation of inflammasome signaling.Nature immunology 13, 333-332 (2012). 402. Arthur, J.C., Lich, J.D., Aziz, R.K., Kotb, M. & Ting, J.P. Heat shock protein 90 associates with monarch-1 and regulates its ability to promote degradation of NF-kappaB-inducing kinase.Journal of immunology 179, 6291-6296 (2007).

403. Cui, J. et al. NLRC5 negatively regulates the NF-kappaB and type I interferon signaling pathways.Cell 141, 483-496 (2010). 404. Lich, J.D. et al. Monarch-1 suppresses non-canonical NF-kappaB activation and p52-dependent chemokine expression in monocytes. Journal of immunology 178, 1256-1260 (2007). 405. Williams, K.L. et al. The CATERPILLER protein monarch-1 is an antagonist of toll-like receptor-, tumor necrosis factor alpha-, and Mycobacterium tuberculosis-induced pro-inflammatory signals.The Journal of biological chemistry 280, 39914-39924 (2005).

406. Dorfleutner, A., Chu, L. & Stehlik, C. Inhibiting the inflammasome: one domain at a time.Immunol Rev 265, 205-216 (2015).

407. Stehlik, C. & Dorfleutner, A. COPs and POPs: modulators of inflammasome activity.Journal of immunology 179, 7993-7998 (2007). 408. Druilhe, A., Srinivasula, S.M., Razmara, M., Ahmad, M. & Alnemri, E.S. Regulation of IL-1beta generation by Pseudo-ICE and ICEBERG, two dominant negative caspase recruitment domain proteins.Cell death and differentiation 8, 649-657 (2001). 409. Humke, E.W., Shriver, S.K., Starovasnik, M.A., Fairbrother, W.J. & Dixit, V.M. ICEBERG: a novel inhibitor of interleukin-1beta generation.Cell 103, 99-111 (2000).

410. Lamkanfi, M. et al. INCA, a novel human caspase recruitment domain protein that inhibits interleukin-1beta generation.The Journal of biological chemistry 279, 51729-51738 (2004). 411. Lee, S.H., Stehlik, C. & Reed, J.C. Cop, a caspase recruitment domain-containing protein and inhibitor of caspase-1 activation processing. The Journal of biological chemistry 276, 34495-34500 (2001). 412. Porter, K.A. et al. The CLRX.1/NOD24 (NLRP2P) pseudogene codes a functional negative regulator of NF-kappaB, pyrin-only protein 4. Genes Immun 15, 392-403 (2014).

413. Dorfleutner, A. et al. Cellular pyrin domain-only protein 2 is a candidate regulator of inflammasome activation.Infect Immun 75, 1484-1492 (2007).

414. Khare, S. et al. The PYRIN domain-only protein POP3 inhibits ALR inflammasomes and regulates responses to infection with DNA viruses. Nature immunology 15, 343-353 (2014). 415. Stehlik, C. et al. The PAAD/PYRIN-only protein POP1/ASC2 is a modulator of ASC-mediated nuclear-factor-kappa B and procaspase-1 regulation.Biochem J 373, 101-113 (2003). 416. Veeranki, S. & Choubey, D. Interferon-inducible p200-family protein IFI16, an innate immune sensor for cytosolic and nuclear double-stranded DNA: regulation of subcellular localization.Mol Immunol 49, 567-571 (2012).

417. Roberts, T.L. et al. HIN-200 proteins regulate caspase activation in response to foreign cytoplasmic DNA.Science 323, 1057-1060 (2009).

418. Atianand, M.K., Fuchs, T. & Harton, J.A. Recent evolution of the NF-kappaB and inflammasome regulating protein POP2 in primates. BMC evolutionary biology 11, 56 (2011). 419. Rosenstiel, P. et al. A short isoform of NOD2/CARD15, NOD2-S, is an endogenous inhibitor of NOD2/receptor-interacting protein kinase 2-induced signaling pathways. Proceedings of the National Academy of Sciences of the United States of America 103, 3280- 3285 (2006).

420. Levine, B., Mizushima, N. & Virgin, H.W. Autophagy in immunity and inflammation.Nature 469, 323-335 (2011).

421. Harris, J. et al. Autophagy controls IL-1beta secretion by targeting pro-IL-1beta for degradation.The Journal of biological chemistry 286, 9587-9597 (2011).

52 General introduction 1

422. Shi, C.S. et al. Activation of autophagy by inflammatory signals limits IL-1beta production by targeting ubiquitinated inflammasomes for destruction.Nature immunology 13, 255-263 (2012). 423. Cho, M.H. et al. Autophagy in microglia degrades extracellular beta-amyloid fibrils and regulates the NLRP3 inflammasome. Autophagy 10, 1761-1775 (2014). 424. Nakahira, K. et al. Autophagy proteins regulate innate immune responses by inhibiting the release of mitochondrial DNA mediated by the NALP3 inflammasome.Nature immunology 12, 222-230 (2011).

425. Guarda, G. et al. Type I interferon inhibits interleukin-1 production and inflammasome activation.Immunity 34, 213-223 (2011).

426. Hernandez-Cuellar, E. et al. Cutting edge: nitric oxide inhibits the NLRP3 inflammasome.Journal of immunology 189, 5113-5117 (2012).

427. Kawano, A. et al. Regulation of P2X7-dependent inflammatory functions by P2X4 receptor in mouse macrophages.Biochemical and biophysical research communications 420, 102-107 (2012).

428. Kawano, A. et al. Involvement of P2X4 receptor in P2X7 receptor-dependent cell death of mouse macrophages. Biochemical and biophysical research communications 419, 374-380 (2012).

429. Mariathasan, S. et al. Cryopyrin activates the inflammasome in response to toxins and ATP.Nature 440, 228-232 (2006).

430. Burnstock, G. Physiopathological roles of P2X receptors in the central nervous system. Curr Med Chem 22, 819-844 (2015).

431. Sperlagh, B. & Illes, P. P2X7 receptor: an emerging target in central nervous system diseases. Trends Pharmacol Sci 35, 537-547 (2014).

432. Abbracchio, M.P. et al. International Union of Pharmacology LVIII: update on the P2Y G protein-coupled nucleotide receptors: from molecular mechanisms and pathophysiology to therapy. Pharmacol Rev 58, 281-341 (2006). 433. Khakh, B.S. et al. International union of pharmacology. XXIV. Current status of the nomenclature and properties of P2X receptors and their subunits. Pharmacol Rev 53, 107-118 (2001).

434. North, R.A. Molecular physiology of P2X receptors. Physiol Rev 82, 1013-1067 (2002). 435. Jacobson, K.A., Balasubramanian, R., Deflorian, F. & Gao, Z.G. G protein-coupled adenosine (P1) and P2Y receptors: ligand design and receptor interactions.Purinergic Signal 8, 419-436 (2012). 436. McLarnon, J.G. Purinergic mediated changes in Ca2+ mobilization and functional responses in microglia: effects of low levels of ATP. J Neurosci Res 81, 349-356 (2005).

437. Burnstock, G. Physiology and pathophysiology of purinergic neurotransmission. Physiol Rev 87, 659-797 (2007).

438. Burnstock, G. & Knight, G.E. Cellular distribution and functions of P2 receptor subtypes in different systems.Int Rev Cytol 240, 31- 304 (2004).

439. Moore, D.J. et al. Expression pattern of human P2Y receptor subtypes: a quantitative reverse transcription-polymerase chain reaction study.Biochim Biophys Acta 1521, 107-119 (2001).

440. Agresti, C. et al. Metabotropic P2 receptor activation regulates oligodendrocyte progenitor migration and development.Glia 50, 132-144 (2005).

441. Fields, R.D. & Burnstock, G. Purinergic signalling in neuron-glia interactions.Nat Rev Neurosci 7, 423-436 (2006).

442. Lalo, U. et al. P2X1 and P2X5 subunits form the functional P2X receptor in mouse cortical astrocytes.The Journal of neuroscience : the official journal of the Society for Neuroscience 28, 5473-5480 (2008). 443. Nagasawa, K., Escartin, C. & Swanson, R.A. Astrocyte cultures exhibit P2X7 receptor channel opening in the absence of exogenous ligands. Glia 57, 622-633 (2009). 444. Cavaliere, F., Dinkel, K. & Reymann, K. Microglia response and P2 receptor participation in oxygen/glucose deprivation-induced cortical damage.Neuroscience 136, 615-623 (2005). 445. Crain, J.M., Nikodemova, M. & Watters, J.J. Expression of P2 nucleotide receptors varies with age and sex in murine brain microglia. Journal of neuroinflammation 6, 24 (2009).

446. Inoue, K. Microglial activation by purines and pyrimidines.Glia 40, 156-163 (2002). 447. Morioka, N. et al. The activation of P2Y6 receptor in cultured spinal microglia induces the production of CCL2 through the MAP kinases-NF-kappaB pathway. Neuropharmacology 75, 116-125 (2013).

448. Franke, H., Krugel, U. & Illes, P. P2 receptors and neuronal injury. Pflugers Arch 452, 622-644 (2006).

449. Idzko, M., Ferrari, D. & Eltzschig, H.K. Nucleotide signalling during inflammation.Nature 509, 310-317 (2014).

450. Zimmermann, H., Zebisch, M. & Strater, N. Cellular function and molecular structure of ecto-nucleotidases.Purinergic Signal 8, 437-502 (2012).

451. Elias, L.A. & Kriegstein, A.R. Gap junctions: multifaceted regulators of embryonic cortical development.Trends in neurosciences 31, 243-250 (2008).

53 Chapter 1

452. Fields, R.D. & Stevens, B. ATP: an extracellular signaling molecule between neurons and glia. Trends in neurosciences 23, 625-633 (2000).

453. Weissman, T.A., Riquelme, P.A., Ivic, L., Flint, A.C. & Kriegstein, A.R. Calcium waves propagate through radial glial cells and modulate proliferation in the developing neocortex.Neuron 43, 647-661 (2004). 454. Liu, X., Hashimoto-Torii, K., Torii, M., Haydar, T.F. & Rakic, P. The role of ATP signaling in the migration of intermediate neuronal progenitors to the neocortical subventricular zone.Proceedings of the National Academy of Sciences of the United States of America 105, 11802-11807 (2008). 455. del Puerto, A. et al. Adenylate cyclase 5 coordinates the action of ADP, P2Y1, P2Y13 and ATP-gated P2X7 receptors on axonal elongation.J Cell Sci 125, 176-188 (2012). 456. Del Puerto, A., Wandosell, F. & Garrido, J.J. Neuronal and glial purinergic receptors functions in neuron development and brain disease. Front Cell Neurosci 7, 197 (2013). 457. Diaz-Hernandez, M. et al. Inhibition of the ATP-gated P2X7 receptor promotes axonal growth and branching in cultured hippocampal neurons. J Cell Sci 121, 3717-3728 (2008).

458. Stevens, B. & Fields, R.D. Response of Schwann cells to action potentials in development.Science 287, 2267-2271 (2000).

459. Sperlagh, B. & Sylvester Vizi, E. Neuronal synthesis, storage and release of ATP. Seminars in the neurosciences 8, 175-186 (1996).

460. Zimmermann, H. Signalling via ATP in the nervous system. Trends in neurosciences 17, 420-426 (1994). 461. Richler, E., Chaumont, S., Shigetomi, E., Sagasti, A. & Khakh, B.S. Tracking transmitter-gated P2X cation channel activation in vitro and in vivo. Nat Methods 5, 87-93 (2008).

462. Coco, S. et al. Storage and release of ATP from astrocytes in culture. The Journal of biological chemistry 278, 1354-1362 (2003).

463. Montana, V., Malarkey, E.B., Verderio, C., Matteoli, M. & Parpura, V. Vesicular transmitter release from astrocytes.Glia 54, 700-715 (2006).

464. Stout, C.E., Costantin, J.L., Naus, C.C. & Charles, A.C. Intercellular calcium signaling in astrocytes via ATP release through connexin hemichannels. The Journal of biological chemistry 277, 10482-10488 (2002).

465. Fields, R.D. & Stevens-Graham, B. New insights into neuron-glia communication.Science 298, 556-562 (2002). 466. Grimm, I., Ullsperger, S.N. & Zimmermann, H. Nucleotides and epidermal growth factor induce parallel cytoskeletal rearrangements and migration in cultured adult murine neural stem cells.Acta Physiol (Oxf) 199, 181-189 (2010).

467. Hogg, R.C. et al. Functional maturation of isolated neural progenitor cells from the adult rat hippocampus.Eur J Neurosci 19, 2410- 2420 (2004).

468. Ferrari, D., Chiozzi, P., Falzoni, S., Hanau, S. & Di Virgilio, F. Purinergic modulation of interleukin-1 beta release from microglial cells stimulated with bacterial endotoxin.J Exp Med 185, 579-582 (1997). 469. Fiebich, B.L., Akter, S. & Akundi, R.S. The two-hit hypothesis for neuroinflammation: role of exogenous ATP in modulating inflammation in the brain.Front Cell Neurosci 8, 260 (2014).

470. Filippini, A., Taffs, R.E. & Sitkovsky, M.V. Extracellular ATP in T-lymphocyte activation: possible role in effector functions.Proceedings of the National Academy of Sciences of the United States of America 87, 8267-8271 (1990).

471. Sanz, J.M. & Di Virgilio, F. Kinetics and mechanism of ATP-dependent IL-1 beta release from microglial cells.Journal of immunology 164, 4893-4898 (2000). 472. Matute, C. et al. P2X(7) receptor blockade prevents ATP excitotoxicity in oligodendrocytes and ameliorates experimental autoimmune encephalomyelitis.The Journal of neuroscience : the official journal of the Society for Neuroscience 27, 9525-9533 (2007).

473. Sharp, A.J. et al. P2x7 deficiency suppresses development of experimental autoimmune encephalomyelitis.Journal of neuroinflammation 5, 33 (2008). 474. Yiangou, Y. et al. COX-2, CB2 and P2X7-immunoreactivities are increased in activated microglial cells/macrophages of multiple sclerosis and amyotrophic lateral sclerosis spinal cord. BMC Neurol 6, 12 (2006). 475. Narcisse, L., Scemes, E., Zhao, Y., Lee, S.C. & Brosnan, C.F. The cytokine IL-1beta transiently enhances P2X7 receptor expression and function in human astrocytes.Glia 49, 245-258 (2005). 476. Hung, S.C. et al. P2X4 assembles with P2X7 and pannexin-1 in gingival epithelial cells and modulates ATP-induced reactive oxygen species production and inflammasome activation.PloS one 8, e70210 (2013). 477. Sakaki, H. et al. P2X4 receptor regulates P2X7 receptor-dependent IL-1beta and IL-18 release in mouse bone marrow-derived dendritic cells.Biochemical and biophysical research communications 432, 406-411 (2013).

CHAPTER 2

Expression of IL-1β in rhesus EAE and MS lesions is mainly induced in the CNS itself

Saskia M. Burm1, Laura A.N. Peferoen2, Ella A. Zuiderwijk-Sick1, Krista G. Haanstra3, Bert A. ‘t Hart3, Paul van der Valk2, Sandra Amor2, Jan Bauer4, Jeffrey J. Bajramovic1

1Alternatives Unit, Biomedical Primate Research Centre, Rijswijk, the Netherlands 2Department of Pathology, VU Medical Center, Amsterdam, the Netherlands 3Department of Immunobiology, Biomedical Primate Research Centre, Rijswijk, the Netherlands 4Department of Neuroimmunology, Medical University of Vienna, Vienna, Austria

ManuscriptJ Neurosci. submitted 2015. for35(2):678-87. publication Chapter 2

Abstract

Interleukin (IL)-1β is a pro-inflammatory cytokine that plays a role in the pathogenesis of multiple sclerosis (MS) and experimental autoimmune encephalomyelitis (EAE), the animal model for MS. Yet, detailed studies on IL-1β expression in different stages of MS lesion development and a comparison of IL-1β expression in MS and EAE are lacking. Here, we performed an extensive characterization of IL-1β expression in brain tissue of MS patients, which included different MS lesion types, and in brain tissue of rhesus macaques with EAE. In rhesus EAE brain tissue we observed prominent IL-1β staining in MHC class II+ cells within perivascular infiltrates and at the edges of large demyelinating lesions. Surprisingly, staining was localized to resident microglia or differentiated macrophages rather than to infiltrating monocytes, suggesting that IL-1β expression is induced within the central nervous system (CNS). By contrast, IL-1β staining in MS brain tissue was much less pronounced. Staining was found in the parenchyma of active and chronic active MS lesions, and in nodules of MHC classII+ microglia in otherwise normal appearing white matter. IL-1β expression was detected in a minority of the nodules only, which could not be distinguished by the expression of pro- and anti-inflammatory markers. These nodules were exclusively found in MS and it remains to be determined whether IL-1β+ nodules are destined to progress into active lesions or whether they merely reflect a transient response to cellular stress. Although the exact localization and relative intensity of IL-1β expression in EAE and MS is different, the staining pattern in both neuroinflammatory disorders is most consistent with the idea that the expression of IL-1β during lesion development is induced in the tissue rather than in the periphery.

58 IL-1β expression in MS lesions and rhesus EAE

Introduction

IL-1β is a cytokine with potent pro-inflammatory characteristics. High levels of systemic IL-1β lead to a rise in body temperature by affecting the activity of the hypothalamus, to vasodilation and to increased expression of adhesion factors on endothelial cells enabling transmigration of leukocytes1,2. Furthermore, IL-1β orchestrates the innate immune response3 and can induce skewing of T cells towards Th17 cells4-7, thereby linking innate immune responses to activation of the adaptive immune system. The synthesis of IL-1β precursor protein is induced by IL-1α or by activation of receptors of the innate immune system such as Toll-like receptors (TLR) and NOD- like receptors (NLR)8,9. Secretion of bioactive IL-1β requires additional cleavage of the precursor protein by a cysteine protease, which in turn requires activation10. Caspase 1 is the best-described cysteine protease that is activated by a protein complex called the inflammasome10,11. Inflammasomes play a role in several neurodegenerative and neuroinflammatory diseases as well as in animal models for such diseases12-18. NLR-mediated activation is critically involved in inflammasome formation and is evoked by disturbances in cellular homeostasis, as caused by e.g. pathogens, large protein aggregates and neighboring cell death. Subsequently, NLR associate with inflammatory caspases, mostly via the adaptor protein ASC, leading to processing and secretion of pro-inflammatory cytokines as IL-1β and IL-1819,20. The involvement of IL-1β and the inflammasome in experimental autoimmune encephalomyelitis (EAE), a commonly used animal model for MS, has been confirmed in different studies21. Inhibition of IL-1-induced signaling ameliorates the development of EAE in both rats and mice22-25, and mice that are deficient in NLRP3, ASC or caspase 1 expression are characterized by delayed onset of disease and less severe clinical symptoms26-28. Furthermore, expression levels of IL-1β29,30, specific NLRs (e.g. NLRP1 and NLRP3) and caspase 1 are increased in the brain and spinal cord during disease26,31. In addition, treatment with a caspase 1 inhibitor attenuates clinical signs of mouse EAE32. Treatment with interferon (IFN)β, a registered therapeutic biological for MS33, decreases brain pathology by reducing serum IL-1β and caspase 1 activation levels34. In human macrophages, IFNβ inhibits inflammasome-mediated activation by inhibition of pro-IL-1β transcription, by decreasing the availability of NLRP3-activating ligands, and by directly inhibiting NLRP3 and caspase-1 activation via post-translational modifications34-36. In line with this, monocytes derived from IFNβ-treated MS patients are characterized by decreased IL-1β production in response to inflammasome-activating stimuli35. More evidence for the involvement of IL-1β in MS pathogenesis comes from studies demonstrating that elevated IL-1β levels in cerebrospinal fluid (CSF) and blood of MS patients correlate with disease susceptibility, severity and progression37-41. In addition, therapeutic approaches used for treatment of MS i.e. IFNβ, Copaxone or steroid treatment lead to increased levels of IL-1 receptor antagonist (IL-1RA), the natural inhibitor of the IL-1 receptor, in the blood38,42,43. Although these data suggest a role for IL-1β in both EAE and MS and provide a rationale for clinical trials that target the IL-1 axis8, there are discordant results relating to the expression of IL-1β during the course of both diseases. While there is consensus on the abundant expression of IL-1β in the brain during EAE induced in rats and mice29,30,44, reports on IL-1β expression in MS lesions45-47 are by no means unequivocal48,49. Furthermore, it is unclear during which stages of pathogenesis IL-1β is produced and by which cells. We therefore characterized IL-1β expression

59 Chapter 2

in brain tissue of MS patients, which included different types of MS lesions, side-by-side with brain tissue derived from rhesus macaques in which EAE was induced. We performed in depth analyses of the cellular sources of IL-1β expression and phenotyped these cells based on the expression of pro- and anti-inflammatory markers. Our results reveal distinct characteristics of either EAE or MS that might well reflect differences in pathogenesis. However, in both neuroinflammatory disorders the expression of IL-1β during disease progression is mainly induced in the brain itself.

Materials and methods

Brain tissue We selected paraffin-embedded tissue blocks from three rhesus macaques without neurological disease, from eight rhesus macaques with EAE and from four immunized rhesus macaques that did not develop clinical disease (Table 1) from earlier studies50-52 that were performed at the Biomedical Primate Research Centre (BPRC, Rijswijk, the Netherlands), and of which the tissue blocks were archived at the Department of Neuroimmunology from the Center of Brain Research (Vienna, Austria). As such no animals were sacrificed for the exclusive purpose of this study, thereby complying with the priority 3Rs program of the BPRC. EAE was induced by immunization with recombinant human (rh)MOG protein either in incomplete or complete

Rhesus Gender Age Weight Immunizations (d) EAE score Euthanasia EAE score Ref EAE (y) (kg) ≥2 (d) (d) at animal ID euthanasia R05045 M 8 10.7 rhMOG/CFA (0) 12 12 5 52 R06052 M 7 7.7 rhMOG/CFA (0) 13 13 5 52 R07035 M 6 10.0 rhMOG/CFA (0) 16 16 5 52 R06088 M 7 11.4 rhMOG/CFA (0) 17 18 5 52 R08043 M 5 8.1 rhMOG/CFA (0) 21 21 5 52 R06030 M 7 12.2 rhMOG/CFA (0) 26 27 5 52 Ri0106111 M 9 12.5 rhMOG/IFA (0, 28) 40 41 5 51 Ri970621 M 9 8.3 rhMOG/IFA (0, 28) 46 48 2.5 51

Control animal ID R8765 F 11 9.5 - - - - R02095 M 5 11.3 - - - - R9222 F 17 9.3 - - - - R97058 M 12 11.5 rhMOG/CFA (0) - 22 0 50 R01097 M 9 13.9 rhMOG/CFA (0) - 18 0 50 rhMOG/IFA Ri9604157 M 14 8.2 - 111 0 51 (0, 28, 56, 84) Ri9805013 M 12 9.3 rhMOG/IFA (0, 28) - 28 0 51

Table 1. Characteristics of the rhesus macaques

60 IL-1β expression in MS lesions and rhesus EAE

Freund’s adjuvant (resp. IFA or CFA)50-52. All procedures were performed in compliance with guidelines of the Institutional Animal Care and Use Committee (IACUC) in accordance with Dutch law. Human brain tissue samples were obtained from the Netherlands Brain Bank (NBB; coordinator Dr. Huitinga, Amsterdam, the Netherlands). NBB received permission to perform autopsies for the use of tissue and to access medical records for research purposes from the Medical Ethical Committee of the VU Medical Centre (Amsterdam, the Netherlands). All patients and controls, or their next of kin, had given informed consent for autopsy and the use of brain tissue for research purposes. Relevant clinical information was retrieved from the medical records and is summarized in Table 2. We selected a total of 45 tissue blocks (paraffin-embedded: 22 blocks; frozen: 23 blocks) from 28 MS patients (female-to-male ratio 4:3; average age 60.9 years; average post-mortem delay 8 h) and five tissue blocks from five donors without neurological disease (female-to-male ratio 2:3; average age: 70.8 years; average post-mortem delay: 6 h). This panel represented different types of MS, including relapsing remitting (RR), secondary progressive (SP) and primary progressive (PP) MS.

Immunohistochemistry An overview of the used antibodies and their dilutions is given inTable 3. Isotype controls and omission of the primary antibodies were used to confirm specificity of the primary antibodies. Five μm-thick paraffin sections were collected on Superfrost Plus glass slides (VWR international, Leuven, Belgium) and dried at 37°C. Tissue sections were characterized for the presence of demyelination by staining for PLP and for inflammation by staining for MHC class II. PLP and MHC class II were stained according to a previously described protocol53 using mouse anti-human PLP or mouse anti-human HLA-DR antibodies (these are also cross reactive to the rhesus macaque equivalent Mamu-DR), EnVision horse radish peroxidase (HRP) and 3,3’-diaminobenzidine (DAB; both DAKO, Heverlee, Belgium). Consecutive sections were stained for IL-1β as described previously54 using goat anti-human IL-1β antibodies, biotinylated anti- sheep/-goat antibodies, avidin-HRP and DAB. Five μm-thick cryosections were collected on Superfrost Plus glass slides and airdried. For IL- 1β stainings, sections were formalin-fixed for 10 min, endogenous peroxidase was quenched in

0.3% H2O2 in phosphate-buffered saline (PBS) and sections were incubated with 10% fetal calf serum (FCS) in wash buffer (DAKO) for 20 min at RT. Thereafter sections were incubated with goat anti-human IL-1β antibodies overnight at 4°C. After rinsing, the primary antibody was reapplied for 1h at RT, followed by incubation with donkey anti-goat HRP and they were developed with DAB. Immunohistochemical double staining for IL-1β with MHC class II, CD74, CD40, CD200R, CCL22 or MR were performed on cryosections. Slides were stained for IL-1β as described above and developed with DAB. Thereafter, slides were rinsed thoroughly and incubated with anti- human HLA-DR, CD74, CD40, CD200R, CCL22 or MR antibodies overnight at 4°C. Then slides were incubated with either goat anti-mouse IgG alkaline phosphatase or goat anti-rabbit IgG alkaline phosphatase and further developed with Liquid Permanent Red solution (Dako) for 10 min at RT. Sections were imaged using the Olympus BX50 microscope and Canvas X Pro (Canvas X software Inc, 2015, version 16, build 2115) was used for graphical representations.

61 Chapter 2

Age (y) Gender PM delay (h) MS type Cause of death MS cases 1 44 F 10 PP Decompensation 2 47 F 4 Unknown Metastasis in the lung 3 57 F 8 RR Sepsis 4 77 M 8 RR Possible urosepsis 5 77 F 10 SP Euthanasia 6 86 M 10 RR Heart failure and pneumonia 7 43 M 8 Unknown Pneumonia 8 66 F 6 Unknown Unknown 9 48 F 11 Unknown Hepatic encephalitis 10 48 F 5 PP Euthanasia 11 54 M 8 PP Euthanasia 12 56 M 10 PP Cachexia and exhaustion by end stage MS 13 63 M 7 PP Cardiac arrest 14 69 F 7 Unknown Respiratory failure and heart failure 15 66 M 7 Unknown Unknown Increasing pain control and halting food 16 44 M 10 PP administration; possible infection 17 51 M 11 SP Unknown 18 66 F 10 PP Euthanasia 19 50 F 7 SP Euthanasia 20 48 F 6 RR Cardiac failure 21 49 M 8 SP Pneumonia 22 60 F 10 SP Euthanasia 23 61 M 9 SP Euthanasia 24 76 F 9 Unknown Unknown 25 84 F <0.5 PP Euthanasia 26 81 M 9 Unknown General deterioration 27 66 F 6 SP Metastasis in the liver 28 67 F 9 SP Palliative sedation

Controls Dehydration by advanced multi-infarct 1 79 M 4 - dementia 2 56 M 9 - Myocardial infarction 3 62 M 7 - Unknown 4 84 F 6 - Pneumonia 5 73 F 4 - Renal insufficiency

Table 2. Characteristics of the MS patients and controls

62 IL-1β expression in MS lesions and rhesus EAE

Source Species Dilution Primary antibodies IL-1β (clone C-20) Santa Cruz Biotechnology Goat Frozen: 1:100 Parafin: 1:250 PLP (clone plpc1) AbD Serotec Mouse Frozen: 1:500 Parafin: 1:300 HLA-DR (clone LN3) eBioscience Mouse Frozen: 1:750 Parafin: 1:500 Iba-1 Wako Rabbit 1:250 MRP14 (clone S36.48) BMA Biomedicals Mouse 1:100 CCL22 Abcam Rabbit 1:100 CD200R (clone OX108) AbD Serotec Mouse 1:50 CD40 (clone LOB7/6) AbD Serotec Mouse 1:50 CD74 (clone By2) Santa Cruz Biotechnology Mouse 1:1600 MR (clone 19.2) BD Pharmingen Mouse 1:150 Isotype control Southern Biotech Goat 1:2500

Secondary antibodies EnVision HRP-labeled anti-mouse/ DAKO - undiluted rabbit polymer Biotinylated anti-sheep/goat Amersham Donkey 1:200 Avidin-HRP Sigma Aldrich - 1:100 Anti-goat HRP Jackson ImmunoResearch Donkey 1:100 Anti-mouse IgG alkaline phosphatase DAKO Goat 1:250 Anti-rabbit IgG alkaline phosphatase Southern Biotech Goat 1:250 Avidin-CY2 Jackson ImmunoResearch - 1:150 Anti-rabbit TRITC Jackson ImmunoResearch Donkey 1:100 Anti-mouse TRITC Jackson ImmunoResearch Donkey 1:50

Table 3. Overview of the used antibodies

Immunofluorescence Immunofluorescent double staining for IL-1β with Iba-1 or MRP14 were performed on paraffin-embedded tissue sections. Antigen retrieval was performed by heating the slides in Tris- EDTA (pH 8.5). Thereafter sections were incubated with anti-human IL-1β overnight at 4°C. After rinsing the slides, the primary antibody was reapplied for 1h at RT, followed by incubation with biotinylated anti-sheep/-goat antibodies and avidin-CY2 in the dark. Next, slides were incubated with anti-human Iba-1 or MRP14 antibodies for 1h at RT. Then slides were incubated with either donkey anti-rabbit TRITC or donkey anti-mouse TRITC and embedded in vectashield mounting medium containing DAPI (Brunswig chemie). Sections were imaged using the Nikon Microphot-FXA microscope and Canvas X Pro (Canvas X software Inc, 2015, version 16, build 2115) was used for graphical representations.

63 Chapter 2

Results

Rhesus EAE We studied brain tissue from three rhesus macaques without neurological disease and from 12 rhesus macaques that were immunized with rhMOG in either IFA or CFA, of which eight animals developed clinical EAE (Table 1). Brain tissue from control animals and from animals that did not develop clinical EAE, did not contain detectable demyelination, inflammatory activity or IL-1β. Tissue from animals that developed clinical EAE was characterized by perivascular infiltrates. We observed considerable inter-donor variability concerning the number and extent of the observed EAE lesions, probably attributable to the outbred nature of the model52. In animals immunized with rhMOG in IFA, we studied 30 perivascular lesions and three large areas with infiltrating cells and demyelinationTable ( 4). IL-1β staining was observed in 50% of the perivascular infiltrates closely surrounding blood vessels Figure( 1A-B) and in all large areas with extensive MHC class II expression and demyelination Figure( 1C). Double immunofluorescent staining identified all IL-1β+ cells as Iba-1+ (Figure 1D) and as MRP14- or MRP14low (Figure 1E). As MRP14 is a marker that is strongly expressed on monocytes and neutrophils55-57, this staining pattern is most consistent with microglia or differentiated macrophages as main sources of IL-1β. As IFA does not contain mycobacteria that were previously shown to be involved in IL-1β production58, we also studied the expression of IL1β in brain tissue of animals immunized with rhMOG in CFA. We studied 432 perivascular lesions and 10 large areas with strong MHC class II expression and demyelination. IL-1β staining was observed in 36% of the perivascular infiltrates (Figure 2A) and in 70% of the large areas with strong MHC class II expression and demyelination (Figure 2B). Although IL-1β+ cells and MRP14high cells were observed in close vicinity in the same lesions, all IL-1β+ cells were Iba-1+ (Figure 2C) and MRP14- or MRP14low (Figure 2D), similar to what was observed in animals immunized with rhMOG in IFA. In conclusion, IL-1β expression was associated mainly with MHC class II expressing cells present in perivascular infiltrates or at the edges of actively demyelinating lesions and not with infiltrating monocytes. Despite the fact that animals immunized with rhMOG in CFA were characterized by a much more rapid onset of clinical disease than those immunized with rhMOG in IFA, the IL-1β staining patterns were similar.

MS We started our characterization of IL-1β in MS by examining well characterized paraffin- embedded tissue blocks of five donors without neurological disease and of 17 MS patients. MS lesions were characterized for the presence of demyelination by staining for PLP and for inflammation by staining for MHC class II and categorized as active, chronic active and inactive53,59,60. Most tissue blocks contained multiple lesions of different categoriesTable ( 5). We did not observe IL-1β staining in healthy controls. In contrast to our expectation, we also did not detect IL-1β expression in active, chronic active or in inactive MS lesionsTable ( 5, Figure 3A-C). Surprisingly, examination of normal appearing white matter (NAWM) from MS patients, revealed IL-1β expression in nodules of MHC class II+ microglia (Figure 3D). These microglia nodules occurred without evident signs of demyelination or infiltration and were previously described by different research groups53,59-61. Although their role in MS pathogenesis is unclear at present, some authors suggested that these nodules are preactive lesions53,59,60.

64 IL-1β expression in MS lesions and rhesus EAE

In total, we studied 38 of such microglia nodules in nine patients. IL-1β staining was observed in eight of the 38 microglia nodules (21%; Table 5, Figure 3D). The number of IL-1β+ microglia nodules varied between patients. In one patient, we observed exclusively IL-1β+ microglia nodules. In two patients we observed both IL-1β+ and IL-1β- microglia nodules, and in six patients we observed exclusively IL-1β- microglia nodules. Formal confirmation of the identity of the IL-1β+

Figure 1. IL-1β expression in brain tissue of rhesus macaques with EAE induced by rhMOG in IFA. Brain lesions were characterized based on the extent of myelin (PLP in brown, left panels) damage and activation of innate immune cells (MHC class II in brown, middle panels). In small perivascular lesions without signs of demyelination (A) IL-1β staining (in brown, right panels) was mainly localized in MHC class II+ cells at the edge of the lesion. In mid-sized MHC class II+ lesions with clear signs of demyelination (B), IL-1β staining was more pronounced. In large fulminating lesions with extensive demyelination and infiltration of MHC class+ II cells (C), IL-1β staining was less pronounced compared to the mid-sized lesions and observed at the edge of the demyelinated area. Original magnifications: 10x, scale bar represents 200 μm, inserts 100x. Nuclei were counterstained with hematoxilin (blue). Double labeling of perivascular lesions for IL-1β (in green) and Iba-1 or MRP14 (in red) demonstrated that all IL-1β+ cells were Iba-1+ (D), whereas all IL-1β+ cells were MRP14- or MRP14low (E) .

65 Chapter 2

Figure 2. IL-1β expression in brain tissue of rhesus macaques with EAE induced by rhMOG in CFA. Brain lesions were characterized based on the extent of myelin (PLP in brown, left panels) damage and activation of innate immune cells (MHC class II in brown, middle panels). In small perivascular lesions without signs of demyelination (A) IL-1β staining (in brown, right panels) was mainly localized in MHC class II+ cells at the edge of the lesion. In large fulminating lesions with extensive demyelination and infiltration of MHC class II+ cells (B), IL-1β staining was more pronounced and mainly observed at the edges of the demyelinated area. Original magnifications: 10x, scale bar represents 200 μm, inserts 100x. Double labeling of perivascular lesions for IL-1β (in green) and Iba-1 or MRP14 (in red) demonstrated that all IL-1β+ cells were Iba-1+ (C), whereas all IL-1β+ cells were MRP14- or MRP14low (D).

Animal ID Perivascular lesions Large demyelinated areas with MHC class II+ cells Total IL-1β+ Total IL-1β+ R05045 0 0 0 0 R06052 169 83 7 6 R07035 4 4 0 0 R06088 154 26 0 0 R08043 22 10 3 1 R06030 83 31 0 0 Total 432 154 10 7

Ri0106111 13 6 2 2 Ri970621 17 9 1 1 Total 30 15 3 3

Table 4. IL-1β expression in rhesus macaques with EAE

66 IL-1β expression in MS lesions and rhesus EAE

Figure 3. IL-1β expression in different types of MS lesions. MS lesions in paraffin-embedded brain tissue sections were characterized based on the extent of myelin (PLP in brown, left panels) damage and activation of innate immune cells (MHC class II in brown, middle panels). Active MS lesions were classified as areas with ongoing demyelination and activation of MHC class II+ innate immune cells (A). Chronic active lesions were classified by the presence ofa completely demyelinated (PLP-) center surrounded by a rim of MHC class II+ cells (B). Inactive lesions were classified by the presence of demyelinated areas where the immune response has resided (C). We did not detect IL-1β (in brown, right panels) in active, chronic active and inactive MS lesions in paraffin-embedded tissue sections (A-C). In addition, we observed MHC class II+ microglia nodules in otherwise NAWM (D) in which IL-1β was expressed. Double labeling of these microglia nodules for IL-1β (in red) and Iba-1 (in green) implicated that all IL-1β+ cells were Iba-1+ (E). Original magnifications: 4x, inserts 100x (A-D), scale bar represents 500 μm (A-D) or 10 μm (E). Nuclei were counterstained with hematoxilin (blue; A-D).

67 Chapter 2

Total # Microglia nodules Active Chronic active Inactive lesions lesions lesions lesions MS patients Total # IL-1β+ 1 10 5 - 2 1 2 2 1 0 - 1 0 0 3 6 3 - 1 2 0 4 4 3 - 1 0 0 5 19 10 4 4 5 0 6 1 0 - 1 0 0 7 14 0 - 6 8 0 8 3 0 - 2 1 0 9 11 0 - 11 0 0 10 2 0 - 1 1 0 11 6 3 3 1 2 0 12 9 1 - 1 3 4 13 7 6 - 0 0 1 14 8 5 - 3 0 0 15 4 0 - 1 2 1 16 2 2 1 0 0 0 17 6 0 - 3 3 0 Total 113 38 8 39 28 8

Table 5. IL-1β expression in paraffin-embedded sections of MS patients

cells as microglia was obtained by colocalization with Iba-1Figure ( 3E). Irrespective of the immunization protocol, no equivalent of these microglia nodules was found in rhesus macaques with clinical EAE. The existing literature on IL-1β expression in MS lesions contains contradicting observations. Whereas some studies reported a paucity of staining as we do48,49, others reported more extensive staining45-47. Differences in fixation procedures, tissue treatment and staining protocols may all have influenced the results. We therefore also characterized IL-1β staining in snap-frozen tissue blocks. For validation purposes, we included patients of which paraffin-embedded tissue sections had already been characterized by us. In total, we studied 25 active lesions in 15 patients and six chronic active lesions intwo patients. IL-1β staining in cryosections was more extensive than in paraffin-embedded sections, now also revealing expression in active and chronic active lesions. IL-1β staining was observed in 52% of active lesions Table( 6, Figure 4A). In nine patients, we observed IL-1β staining in ramified MHC class II+ cells in the parenchyma, whereas in six patients we could not detect IL-1β in any of the active lesions. Similarly, IL-1β staining was observed in ramified MHC class +II cells in the rim of all chronic active lesions Table( 6, Figure 4B). In line with our earlier results, we also observed IL-1β staining in MHC class II+ microglia nodules in otherwise NAWM. In total, we studied 106 microglia nodules in seven patients. IL-1β staining was observed in 52 of these microglia nodules (49%; Table 6, Figure 4C). The number of IL-1β+ microglia nodules varied between patients. In

68 IL-1β expression in MS lesions and rhesus EAE

Figure 4. IL-1β expression in different types of MS lesions. MS lesions in frozen brain tissue sections were characterized based on the extent of myelin (PLP in brown, left panels) damage and activation of innate immune cells (MHC class II in brown, middle panels). Active MS lesions were classified as areas with ongoing demyelination and activation of MHC class II+ innate immune cells (A). IL-1β expression (in brown, right panels) was mainly observed in ramified MHC class II+ cells in the parenchyma, that were mainly localized at the edges of active lesions. Chronic active lesions were classified by the presence of a completely demyelinated (PLP-) center surrounded by a rim of MHC class II+ cells (B). IL-1β expression was observed in MHC class II+ cells in the rim of the lesion. Again, we observed MHC class II+ microglia nodules in otherwise NAWM (C) in which IL-1β was expressed. Original magnifications: 10x, inserts 40x (A-C), scale bar represents 200 μm.

one patient all microglia nodules were IL-1β+, in three patients we observed both IL-1β+ and IL- 1β- microglia nodules, and in three patients we observed only IL-1β- microglia nodules. To further characterize the IL-1β+ cells, microglia nodules were stained for molecules associated with pro- and anti-inflammatory phenotypes62. IL-1β staining in MHC class II+ microglia nodules (Figure 5A) colocalized with the pro-inflammatory markers CD74 Figure( 5B) and CD40 (Figure 5C) as well as with the anti-inflammatory marker CD200RFigure ( 5D). In most microglia nodules IL-1β staining also colocalized with the anti-inflammatory marker CCL22, although some microglia nodules contained IL-1β+/CCL22- cells (Figure 5E). By contrast, IL-1β+ microglia did not stain for mannose receptor (MR; Figure 5F). As previously described62,63, MR staining was predominantly observed in perivascular spaces and not in microglia nodules. IL-1β+ and IL-1β- microglia nodules could not be distinguished based on the expression of these markers. In conclusion, IL-1β+ nodular microglia expressed a mix of pro-inflammatory and anti-inflammatory markers, in line with other reports62.

69 Chapter 2

Total # Microglia nodules Active lesions Chronic active Inactive lesions lesions lesions MS patient Total # IL-1β+ Total # IL-1β+ Total # IL-1β+ Total # IL-1β+ 3 2 0 - 2 2 0 - 0 - 5 7 2 2 3 3 2 2 0 - 8 6 4 1 1 1 0 - 1 - 11 3 2 - 1 1 0 - 0 - 16 80 75 41 1 1 4 4 0 - 18 22 20 8 2 2 0 - 0 - 19 3 1 - 2 1 0 - 0 - 20 1 0 - 0 - 0 - 1 - 21 1 0 - 1 - 0 - 0 - 22 1 0 - 1 1 0 - 0 - 23 6 0 - 6 1 0 - 0 - 24 3 2 - 1 - 0 - 0 - 25 1 0 - 1 - 0 - 0 - 26 1 0 - 1 - 0 - 0 - 27 1 0 - 1 - 0 - 0 - 28 2 0 - 1 - 0 - 1 - Total 140 106 52 25 13 6 6 3 0

Table 6. IL-1β expression in frozen sections of MS patients

Microglia in the rim of chronic active lesions expressed a similar mix of pro- andanti- inflammatory markers as the microglia in the nodules Figure( 6A-F), except that not all IL-1β+ cells in the rim of chronic active lesions were CD74+ and that more colocalization was found with CCL22, which may be indicative of a slightly less pro-inflammatory profile. Since IL-1β expression in EAE was mainly localized to perivascular infiltrates, we screened our available patient material for such lesions. In two patients, very active lesions were found that were associated with large perivascular infiltrates. Here, we also observed IL-1β staining in cells associated with the perivascular infiltrates Figure( 7A-C), mainly at the edges of the infiltrates. These cells were MHC class II+ (Figure 7D) and again expressed a mix of pro- and anti-inflammatory markers (Figure 7E-H). Although IL-1β and MR staining were observed in the same perivascular infiltrates, IL-1β staining never colocalized with MR staining Figure( 7I), nor with MHC class II+ cells with a foamy appearance (Figure 7J). Although this may suggest that myelin ingestion inhibits the production of IL-1β, as was shown previously for other pro-inflammatory cytokines48, we could not confirm this in vitro (data not shown). We did also observe some IL-1β immunoreactivity in reactive astrocytesFigure ( 7K), as reported by other authors45. In both patients that showed these +IL-1β perivascular lesions, microglia nodules and ramified cells within the rim of chronic active lesions were also IL-1β+.

70 IL-1β expression in MS lesions and rhesus EAE

Figure 5. Activation status of IL-1β+ cells in microglia nodules. Microglia nodules were classified as clusters of MHC class II+ cells in otherwise NAWM. These clusters of activated microglia were double stained for IL-1β (in brown) and cell surface markers associated with pro-inflammatory or anti-inflammatory cellular phenotypes (in red). IL-1β staining colocalized with MHC class II (A) and cell surface markers CD74 (B) and CD40 (C) as well as with CD200R (D). In most microglia nodules, IL-1β staining also colocalized with CCL22 (E), although some microglia nodules contained IL-1β+/CCL22- cells. IL-1β+ microglia did not express MR (F). Original magnifications: 40x, scale bar represents 50 μm. Nuclei were counterstained with hematoxilin (blue).

Discussion

Different lines of evidence suggest that IL-1β has a pathogenic role in MS and in the animal model for MS, EAE26,28,31,34. Here we characterized the expression of IL-1β in brain tissue from rhesus macaques with EAE and in different MS lesion types. Contrary to our expectations, we observed that IL-1β expression was mainly restricted to glia cells, most importantly microglia, both in EAE as well as in MS. In rhesus EAE, IL-1β expression was most abundant in perivascular lesions and in active demyelinating lesions with large infiltrates, whereas in MS IL-1β expression was much less abundant and mainly observed in parenchymal nodules of activated microglia. Although the perivascular localization of IL-1β in rhesus EAE was in line with previous studies in rodents29,30,44 and in accordance with the peripheral induction of disease, we did not detect IL-1β in MRP14high monocytes that had recently infiltrated the CNS. Especially in animals immunized with rhMOG in CFA, the enhanced immunogenicity caused by the presence of mycobacteria in the adjuvant has been linked to their ability to directly cause IL-1β expression, inflammasome activation and IL-1β secretion in monocytes and macrophages58,64-66. The induced expression of pro-IL-1β by immunization is however local and most likely of a transient nature. Recently, we described that in vitro pro-IL-1β expression can be potently induced in rhesus macaque primary microglia and peripheral macrophages, but that expression is subject to strong and rapid negative regulation67. As the last immunization was performed at least 12 days before

71 Chapter 2

Figure 6. Activation status of IL-1β+ cells in the rim of chronic active lesions. IL-1β+ cells in the rim of chronic active lesions were double stained for IL-1β (in brown) and cell surface markers associated with pro-inflammatory and anti- inflammatory cellular phenotypes (in red). IL-1β staining colocalized with MHC class II(A) and with CD74 (B), although we also observed some IL-1β+/CD74- cells. Furthermore, IL-1β staining colocalized with CD40 (C), CD200R (D), and CCL22 (E), although we also observed some IL-1β+/CCL22- cells. IL-1β and MR staining were both observed in rim of chronic active lesions (F), but all IL-1β+ cells were all MR-. Original magnifications: 40x, scale bar represents 50 μm. Nuclei were counterstained with hematoxilin (blue). euthanasia it is unlikely that the immunization-induced expression of IL-1β is responsible for the staining pattern observed in the CNS. Our results suggest that IL-1β expression is induced within the CNS and reflects a tissue response to stress that is associated with infiltration of peripheral immune cells. This would also be in line with the IL-1β+ microglia in brain tissue of animals immunized with rhMOG in IFA. We are not the first to report on this phenomenon, as previous studies demonstrated that IL-1β expression in microglia-like cells is increased by infiltration of immune cells into the CNS68 and that NLRP3 inflammasome activation is induced in rodents where EAE was passively induced34. IL-1β expression in MS was much less prominent as in rhesus EAE and the staining pattern was markedly different. In MS, IL-1β expression was mainly localized in the parenchyma, especially in parenchymal nodules of activated microglia. We observed that only a portion of these nodules was IL-1β+. Characterization of the IL-1β+ microglia in these nodules using markers for anti- and pro-inflammatory phenotypes showed that these cells express a mix of both markers, which is in line with other studies62,63. It has been proposed that most of these nodules might resolve spontaneously while other might progress into an active lesion59, and previous studies have demonstrated that IL-1β can initiate the demyelination process69,70. Whether the expression of IL-1β is a discriminating factor regarding the fate of the nodules remains to be determined as it is also well possible that the microglial expression of IL-1β merely reflects a transient response to cellular stress. Various molecules associated with acute cellular stress induce IL-1β expression,

72 IL-1β expression in MS lesions and rhesus EAE

Figure 7. IL-1β expression in perivascular infiltrates in active MS lesions. Within the active lesions of two patients, we observed perivascular infiltrates in areas with ongoing demyelination (PLP, in brown; A). These perivascular cells were strongly MHC class II+ (in brown; B). We observed IL-1β expression (in brown) in cells associated with these perivascular infiltrates, mainly at the edges of the infiltrate and the parenchyma (C). These cells were double stained for IL-1β (in brown) and cell surface markers associated with pro-inflammatory or anti-inflammatory cellular phenotypes (in red). IL-1β staining colocalized with MHC class II (D) and CD74, although we also observed multiple IL-1β+/CD74- cells (E). Furthermore, IL-1β staining colocalized with CD40 (F), CD200R (G) and CCL22, although we also observed some IL-1β+/CCL22- cells (H). IL-1β and MR staining were both observed in the same perivascular infiltrates, but all IL-1β+ cells were MR- (I). In addition, within one active lesion we observed MHC class +II cells (in red) with a foamy appearance (J). These MHC class II+ foamy cells did not express detectable levels of IL-1β. In addition, we observed some IL-1β staining (in brown) in reactive astrocytes in the same active lesion (K). Original magnifications: 40x, scale bar represents 50 μm. Nuclei were counterstained with hematoxilin (blue).

73 Chapter 2

including IL-1α, TNFα, the small stress protein alphaB-crystallin (HspB5) and high mobility group box 1 (HMGB1)9,71,72. Interestingly, HspB5 and TNFα are expressed in microglia nodules in MS53,71 and may contribute to the IL-1β expression as described here. However, whether these factors are specifically associated with the IL-1β+ microglia nodules remains to be investigated. The etiology of MS is still debated, and both infectious and non-infectious factors have been proposed as inducers or precipitators of the disease73-75. NLR activation has been reported in response to infectious and sterile inflammation, and inflammasome-induced IL-1β might represent an a-specific hallmark of disrupted brain homeostasis, both in EAE and in MS. However, in contrast to MS we did not observe IL-1β+ microglia nodules in rhesus EAE, which is most probably due to the acute nature of the model. MS typically develops over the course of many years, whereas rhesus macaques are sacrificed within 48h after the first clinical symptoms due to the rapid progression of disease51,52. Whether IL-1β expression as observed in MS can also be observed in more chronic EAE models requires further study. In conclusion, the expression pattern of IL-1β in EAE and MS is consistent with a response that is initiated in the tissue rather than with the infiltration of IL-1β-producing monocytes. Whether this response plays a role in the exacerbation of the disease remains to be demonstrated. Most importantly, we here describe that a subpopulation of parenchymal IL-1β+ microglial nodules can be distinguished exclusively in MS with an as yet unknown role in lesion initiation or progression.

Acknowledgements

This work was financially supported by the Dutch MS Research Foundation (MS12-805). The authors thank U. Köck, I. Kondova, W. Collignon, W. Gerritsen, R. Peferoen, M. Breur and K. Ummenthum for expert technical assistance.

74 IL-1β expression in MS lesions and rhesus EAE

References

1 Dinarello, C. A. Immunological and inflammatory functions of the interleukin-1 family.Annu Rev Immunol 27, 519-550, doi:10.1146/annurev.immunol.021908.132612 (2009).

2 Garlanda, C., Dinarello, C. A. & Mantovani, A. The interleukin-1 family: back to the future. Immunity 39, 1003-1018, doi:10.1016/j.immuni.2013.11.010 (2013).

3 Sims, J. E. & Smith, D. E. The IL-1 family: regulators of immunity. Nat Rev Immunol 10, 89-102, doi:10.1038/nri2691 (2010). 4 Acosta-Rodriguez, E. V., Napolitani, G., Lanzavecchia, A. & Sallusto, F. Interleukins 1beta and 6 but not transforming growth factor-beta are essential for the differentiation of interleukin 17-producing human T helper cells.Nature immunology 8, 942-949, doi:10.1038/ni1496 (2007).

5 Duan, J., Chung, H., Troy, E. & Kasper, D. L. Microbial colonization drives expansion of IL-1 receptor 1-expressing and IL-17- producing gamma/delta T cells. Cell Host Microbe 7, 140-150, doi:10.1016/j.chom.2010.01.005 (2010). 6 Sutton, C., Brereton, C., Keogh, B., Mills, K. H. & Lavelle, E. C. A crucial role for interleukin (IL)-1 in the induction of IL-17-producing T cells that mediate autoimmune encephalomyelitis.J Exp Med 203, 1685-1691, doi:10.1084/jem.20060285 (2006).

7 Sutton, C. E. et al. Interleukin-1 and IL-23 induce innate IL-17 production from gammadelta T cells, amplifying Th17 responses and autoimmunity. Immunity 31, 331-341, doi:10.1016/j.immuni.2009.08.001 (2009). 8 Dinarello, C. A., Simon, A. & van der Meer, J. W. Treating inflammation by blocking interleukin-1 in a broad spectrum of diseases. Nat Rev Drug Discov 11, 633-652, doi:10.1038/nrd3800 (2012). 9 Hanamsagar, R., Hanke, M. L. & Kielian, T. Toll-like receptor (TLR) and inflammasome actions in the central nervous system. Trends Immunol 33, 333-342, doi:10.1016/j.it.2012.03.001 (2012).

10 Dinarello, C. A. Interleukin-1 beta, interleukin-18, and the interleukin-1 beta converting enzyme.Ann N Y Acad Sci 856, 1-11 (1998). 11 Martinon, F., Burns, K. & Tschopp, J. The inflammasome: a molecular platform triggering activation of inflammatory caspases and processing of proIL-beta. Mol Cell 10, 417-426 (2002).

12 Halle, A. et al. The NALP3 inflammasome is involved in the innate immune response to amyloid-beta.Nature immunology 9, 857-865, doi:10.1038/ni.1636 (2008).

13 Heneka, M. T. et al. NLRP3 is activated in Alzheimer’s disease and contributes to pathology in APP/PS1 mice.Nature 493, 674-678, doi:10.1038/nature11729 (2013).

14 Salminen, A., Ojala, J., Suuronen, T., Kaarniranta, K. & Kauppinen, A. Amyloid-beta oligomers set fire to inflammasomes and induce Alzheimer’s pathology. J Cell Mol Med 12, 2255-2262, doi:10.1111/j.1582-4934.2008.00496.x (2008). 15 Hafner-Bratkovic, I., Bencina, M., Fitzgerald, K. A., Golenbock, D. & Jerala, R. NLRP3 inflammasome activation in macrophage cell lines by prion protein fibrils as the source of IL-1beta and neuronal toxicity.Cell Mol Life Sci 69, 4215-4228, doi:10.1007/s00018- 012-1140-0 (2012).

16 Hanamsagar, R., Torres, V. & Kielian, T. Inflammasome activation and IL-1beta/IL-18 processing are influenced by distinct pathways in microglia. Journal of neurochemistry 119, 736-748, doi:10.1111/j.1471-4159.2011.07481.x (2011).

17 Jamilloux, Y. et al. Inflammasome activation restricts Legionella pneumophila replication in primary microglial cells through flagellin detection.Glia 61, 539-549, doi:10.1002/glia.22454 (2013).

18 Shi, F. et al. The NALP3 inflammasome is involved in neurotoxic prion peptide-induced microglial activation.Journal of neuroinflammation 9, 73, doi:10.1186/1742-2094-9-73 (2012).

19 Latz, E. The inflammasomes: mechanisms of activation and function.Curr Opin Immunol 22, 28-33, doi:10.1016/j.coi.2009.12.004 (2010).

20 Martinon, F., Mayor, A. & Tschopp, J. The inflammasomes: guardians of the body.Annu Rev Immunol 27, 229-265, doi:10.1146/ annurev.immunol.021908.132715 (2009).

21 Inoue, M. & Shinohara, M. L. The role of interferon-beta in the treatment of multiple sclerosis and experimental autoimmune encephalomyelitis - in the perspective of inflammasomes.Immunology 139, 11-18, doi:10.1111/imm.12081 (2013).

22 Furlan, R. et al. HSV-1-mediated IL-1 receptor antagonist gene therapy ameliorates MOG(35-55)-induced experimental autoimmune encephalomyelitis in C57BL/6 mice.Gene Ther 14, 93-98, doi:10.1038/sj.gt.3302805 (2007). 23 Martin, D. & Near, S. L. Protective effect of the interleukin-1 receptor antagonist (IL-1ra) on experimental allergic encephalomyelitis in rats. Journal of neuroimmunology 61, 241-245 (1995). 24 Matsuki, T., Nakae, S., Sudo, K., Horai, R. & Iwakura, Y. Abnormal T cell activation caused by the imbalance of the IL-1/IL-1R antagonist system is responsible for the development of experimental autoimmune encephalomyelitis.Int Immunol 18, 399-407, doi:10.1093/intimm/dxh379 (2006).

25 Wiemann, B. et al. Combined treatment of acute EAE in Lewis rats with TNF-binding protein and interleukin-1 receptor antagonist. Exp Neurol 149, 455-463, doi:10.1006/exnr.1997.6723 (1998).

75 Chapter 2

26 Gris, D. et al. NLRP3 plays a critical role in the development of experimental autoimmune encephalomyelitis by mediating Th1 and Th17 responses. Journal of immunology 185, 974-981, doi:10.4049/jimmunol.0904145 (2010). 27 Inoue, M., Williams, K. L., Gunn, M. D. & Shinohara, M. L. NLRP3 inflammasome induces chemotactic immune cell migration to the CNS in experimental autoimmune encephalomyelitis.Proceedings of the National Academy of Sciences of the United States of America 109, 10480-10485, doi:10.1073/pnas.1201836109 (2012).

28 Shaw, P. J. et al. Cutting edge: critical role for PYCARD/ASC in the development of experimental autoimmune encephalomyelitis. Journal of immunology 184, 4610-4614, doi:10.4049/jimmunol.1000217 (2010).

29 Prins, M. et al. Interleukin-1beta and interleukin-1 receptor antagonist appear in grey matter additionally to white matter lesions during experimental multiple sclerosis.PloS one 8, e83835, doi:10.1371/journal.pone.0083835 (2013).

30 Vainchtein, I. D. et al. In acute experimental autoimmune encephalomyelitis, infiltrating macrophages are immune activated, whereas microglia remain immune suppressed. Glia 62, 1724-1735, doi:10.1002/glia.22711 (2014).

31 Soulika, A. M. et al. Initiation and progression of axonopathy in experimental autoimmune encephalomyelitis.The Journal of neuroscience : the official journal of the Society for Neuroscience 29, 14965-14979, doi:10.1523/JNEUROSCI.3794-09.2009 (2009).

32 Lalor, S. J. et al. Caspase-1-processed cytokines IL-1beta and IL-18 promote IL-17 production by gammadelta and CD4 T cells that mediate autoimmunity. Journal of immunology 186, 5738-5748, doi:10.4049/jimmunol.1003597 (2011). 33 Gajofatto, A. & Benedetti, M. D. Treatment strategies for multiple sclerosis: When to start, when to change, when to stop? World J Clin Cases 3, 545-555, doi:10.12998/wjcc.v3.i7.545 (2015).

34 Inoue, M. et al. Interferon-beta Therapy Against EAE Is Effective Only When Development of the Disease Depends on the NLRP3 Inflammasome.Sci Signal 5, ra38, doi:10.1126/scisignal.2002767 (2012).

35 Guarda, G. et al. Type I interferon inhibits interleukin-1 production and inflammasome activation.Immunity 34, 213-223, doi:10.1016/j.immuni.2011.02.006 (2011).

36 Hernandez-Cuellar, E. et al. Cutting edge: nitric oxide inhibits the NLRP3 inflammasome.Journal of immunology 189, 5113-5117, doi:10.4049/jimmunol.1202479 (2012).

37 de Jong, B. A. et al. Production of IL-1beta and IL-1Ra as risk factors for susceptibility and progression of relapse-onset multiple sclerosis. Journal of neuroimmunology 126, 172-179 (2002).

38 Dujmovic, I. et al. The analysis of IL-1 beta and its naturally occurring inhibitors in multiple sclerosis: The elevation of IL-1 receptor antagonist and IL-1 receptor type II after steroid therapy.Journal of neuroimmunology 207, 101-106, doi:10.1016/ j.jneuroim.2008.11.004 (2009).

39 Reale, M. et al. Relation between pro-inflammatory cytokines and acetylcholine levels in relapsing-remitting multiple sclerosis patients.International journal of molecular sciences 13, 12656-12664, doi:10.3390/ijms131012656 (2012).

40 Rossi, S. et al. Cerebrospinal fluid detection of interleukin-1beta in phase of remission predicts disease progression in multiple sclerosis. Journal of neuroinflammation 11, 32, doi:10.1186/1742-2094-11-32 (2014).

41 Seppi, D. et al. Cerebrospinal fluid IL-1beta correlates with cortical pathology load in multiple sclerosis at clinical onset.Journal of neuroimmunology 270, 56-60, doi:10.1016/j.jneuroim.2014.02.014 (2014).

42 Burger, D. et al. Glatiramer acetate increases IL-1 receptor antagonist but decreases T cell-induced IL-1beta in human monocytes and multiple sclerosis.Proceedings of the National Academy of Sciences of the United States of America 106, 4355-4359, doi:10.1073/pnas.0812183106 (2009).

43 Comabella, M. et al. Induction of serum soluble tumor necrosis factor receptor II (sTNF-RII) and interleukin-1 receptor antagonist (IL-1ra) by interferon beta-1b in patients with progressive multiple sclerosis.Journal of neurology 255, 1136-1141, doi:10.1007/ s00415-008-0855-1 (2008).

44 Bauer, J., Berkenbosch, F., Van Dam, A. M. & Dijkstra, C. D. Demonstration of interleukin-1 beta in Lewis rat brain during experimental allergic encephalomyelitis by immunocytochemistry at the light and ultrastructural level.Journal of neuroimmunology 48, 13-21 (1993).

45 Kawana, N. et al. Reactive astrocytes and perivascular macrophages express NLRP3 inflammasome in active demyelinating lesions of multiple sclerosis and necrotic lesions of neuromyelitis optica and cerebral infarction.Clinical and Experimental Neuroimmunology 4, 296-304 (2013). 46 Brosnan, C. F., Cannella, B., Battistini, L. & Raine, C. S. Cytokine localization in multiple sclerosis lesions: correlation with adhesion molecule expression and reactive nitrogen species.Neurology 45, S16-21 (1995).

47 Cannella, B. & Raine, C. S. The adhesion molecule and cytokine profile of multiple sclerosis lesions.Annals of neurology 37, 424-435, doi:10.1002/ana.410370404 (1995).

48 Boven, L. A. et al. Myelin-laden macrophages are anti-inflammatory, consistent with foam cells in multiple sclerosis. Brain : a journal of neurology 129, 517-526, doi:10.1093/brain/awh707 (2006).

49 Kitic, M. et al. Intrastriatal injection of interleukin-1 beta triggers the formation of neuromyelitis optica-like lesions in NMO-IgG seropositive rats.Acta Neuropathol Commun 1, 5, doi:10.1186/2051-5960-1-5 (2013).

76 IL-1β expression in MS lesions and rhesus EAE

50 Haanstra, K. G. et al. Antagonizing the alpha4beta1 integrin, but not alpha4beta7, inhibits leukocytic infiltration of the central nervous system in rhesus monkey experimental autoimmune encephalomyelitis.Journal of immunology 190, 1961-1973, doi:10.4049/jimmunol.1202490 (2013).

51 Haanstra, K. G. et al. Induction of experimental autoimmune encephalomyelitis with recombinant human myelin oligodendrocyte glycoprotein in incomplete Freund’s adjuvant in three non-human primate species. Journal of neuroimmune pharmacology : the official journal of the Society on NeuroImmune Pharmacology 8, 1251-1264, doi:10.1007/s11481-013-9487-z (2013).

52 Haanstra, K. G. et al. Selective Blockade of CD28-Mediated T Cell Costimulation Protects Rhesus Monkeys against Acute Fatal Experimental Autoimmune Encephalomyelitis.Journal of immunology 194, 1454-1466, doi:10.4049/jimmunol.1402563 (2015).

53 van Horssen, J. et al. Clusters of activated microglia in normal-appearing white matter show signs of innate immune activation. Journal of neuroinflammation 9, 156, doi:10.1186/1742-2094-9-156 (2012). 54 Bauer, J. & Lassmann, H. Neuropathological Techniques to Investigate Central Nervous System Sections in Multiple Sclerosis. Methods Mol Biol 1304, 211-229, doi:10.1007/7651_2014_151 (2016). 55 Lagasse, E. & Clerc, R. G. Cloning and expression of two human genes encoding calcium-binding proteins that are regulated during myeloid differentiation.Mol Cell Biol 8, 2402-2410 (1988).

56 Lominadze, G. et al. Myeloid-related protein-14 is a p38 MAPK substrate in human neutrophils. Journal of immunology 174, 7257-7267 (2005).

57 Odink, K. et al. Two calcium-binding proteins in infiltrate macrophages of rheumatoid arthritis.Nature 330, 80-82, doi:10.1038/330080a0 (1987).

58 Kleinnijenhuis, J. et al. Transcriptional and inflammasome-mediated pathways for the induction of IL-1beta production by Mycobacterium tuberculosis. European journal of immunology 39, 1914-1922, doi:10.1002/eji.200839115 (2009).

59 van der Valk, P. & Amor, S. Preactive lesions in multiple sclerosis.Current opinion in neurology 22, 207-213, doi:10.1097/ WCO.0b013e32832b4c76 (2009).

60 van der Valk, P. & De Groot, C. J. Staging of multiple sclerosis (MS) lesions: pathology of the time frame of MS.Neuropathology and applied neurobiology 26, 2-10 (2000).

61 De Groot, C. J. et al. Post-mortem MRI-guided sampling of multiple sclerosis brain lesions: increased yield of active demyelinating and (p)reactive lesions.Brain : a journal of neurology 124, 1635-1645 (2001).

62 Peferoen, L. A. et al. Activation status of human microglia is dependent on lesion formation stage and remyelination in multiple sclerosis. Journal of neuropathology and experimental neurology 74, 48-63, doi:10.1097/NEN.0000000000000149 (2015).

63 Vogel, D. Y. et al. Macrophages in inflammatory multiple sclerosis lesions have an intermediate activation status.Journal of neuroinflammation 10, 35, doi:10.1186/1742-2094-10-35 (2013).

64 Mishra, B. B. et al. Mycobacterium tuberculosis protein ESAT-6 is a potent activator of the NLRP3/ASC inflammasome. Cellular microbiology 12, 1046-1063, doi:10.1111/j.1462-5822.2010.01450.x (2010). 65 Welin, A., Eklund, D., Stendahl, O. & Lerm, M. Human macrophages infected with a high burden of ESAT-6-expressing M. tuberculosis undergo caspase-1- and cathepsin B-independent necrosis. PloS one 6, e20302, doi:10.1371/journal.pone.0020302 (2011).

66 Lee, H. M., Kang, J., Lee, S. J. & Jo, E. K. Microglial activation of the NLRP3 inflammasome by the priming signals derived from macrophages infected with mycobacteria. Glia 61, 441-452, doi:10.1002/glia.22448 (2013).

67 Burm, S. M. et al. Inflammasome-Induced IL-1beta Secretion in Microglia Is Characterized by Delayed Kinetics and Is Only Partially Dependent on Inflammatory Caspases.The Journal of neuroscience : the official journal of the Society for Neuroscience 35, 678-687, doi:10.1523/JNEUROSCI.2510-14.2015 (2015).

68 Grebing, M. et al. Myelin-specific T cells induce interleukin-1beta expression in lesion-reactive microglial-like cells in zones of axonal degeneration.Glia 64, 407-424, doi:10.1002/glia.22937 (2016).

69 Ferrari, C. C. et al. Reversible demyelination, blood-brain barrier breakdown, and pronounced neutrophil recruitment induced by chronic IL-1 expression in the brain. Am J Pathol 165, 1827-1837, doi:10.1016/S0002-9440(10)63438-4 (2004). 70 Jana, M. & Pahan, K. Redox regulation of cytokine-mediated inhibition of myelin gene expression in human primary oligodendrocytes. Free Radic Biol Med 39, 823-831, doi:10.1016/j.freeradbiomed.2005.05.014 (2005).

71 Bsibsi, M. et al. Alpha-B-crystallin induces an immune-regulatory and antiviral microglial response in preactive multiple sclerosis lesions. Journal of neuropathology and experimental neurology 72, 970-979, doi:10.1097/NEN.0b013e3182a776bf (2013). 72 Yang, H., Wang, H., Chavan, S. S. & Andersson, U. High Mobility Group Box Protein 1 (HMGB1): The Prototypical Endogenous Danger Molecule. Mol Med 21 Suppl 1, S6-S12, doi:10.2119/molmed.2015.00087 (2015).

73 Ascherio, A. & Munger, K. L. Environmental risk factors for multiple sclerosis. Part I: the role of infection.Annals of neurology 61, 288-299, doi:10.1002/ana.21117 (2007).

74 Ascherio, A. & Munger, K. L. Environmental risk factors for multiple sclerosis. Part II: Noninfectious factors.Annals of neurology 61, 504-513, doi:10.1002/ana.21141 (2007).

75 Gilden, D. H. Infectious causes of multiple sclerosis.The Lancet. Neurology 4, 195-202, doi:10.1016/S1474-4422(05)01017-3 (2005).

CHAPTER 3

Inflammasome-induced IL- 1β secretion in microglia is characterized by delayed kinetics and is only partially dependent on inflammatory caspases

Saskia M. Burm1, Ella A. Zuiderwijk-Sick1, Anke E.J. ‘t Jong1, Celine van der Putten1, Jennifer Veth1, Ivanela Kondova2, Jeffrey J. Bajramovic1

1Alternatives Unit, Biomedical Primate Research Centre, Rijswijk, the Netherlands 2Animal Science Department, Biomedical Primate Research Centre, Rijswijk, the Netherlands

J Neurosci. 2015. 35(2):678-87. Chapter 3

Abstract

Inflammasomes are multiprotein complexes that link pathogen recognition and cellular stress to the processing of the pro-inflammatory cytokine interleukin (IL)-1β. Whereas inflammasome- mediated activation is heavily studied in hematopoietic macrophages and dendritic cells, much less is known about microglia, resident tissue macrophages of the brain that originate from a distinct progenitor. To directly compare inflammasome-mediated activation in different types of macrophages, we isolated primary microglia and hematopoietic macrophages from adult, healthy rhesus macaques. We analyzed the expression profile of NOD-like receptors, adaptor proteins and caspases and characterized inflammasome activation and regulation in detail. We here demonstrate that primary microglia can respond to the same innate stimuli as hematopoietic macrophages. However, microglial responses are more persistent due to lack of negative regulation on pro-IL-1β expression. In addition, we show that while caspase 1, 4 and 5 activation is pivotal for inflammasome-induced IL-1β secretion by hematopoietic macrophages, microglial secretion of IL-1β is only partially dependent on these inflammatory caspases. These results identify key cell type-specific differences that may aid the development of strategies to modulate innate immune responses in the brain.

80 Microglia-specific inflammasome-induced processing

Introduction 3

Microglia are the resident tissue macrophages of the CNS. Like other macrophages, they express multiple receptors of the innate immune system, including Toll-like receptors (TLR), NOD- like receptors (NLR), C-type lectin receptors and retinoic acid-inducible gene-I like receptors1-5. Recent studies have implicated NLR-mediated activation of microglia in several neurodegenerative6,7 and infectious brain diseases8,9 providing an impetus for more detailed studies of this receptor family. NLR can sense disturbances in cellular homeostasis caused by amongst others pathogens, large protein aggregates and neighboring cell death. To date, 23 NLR have been described for humans10. Ligand recognition by NOD1 and NOD2 can directly induce transcription ofpro- inflammatory cytokines and chemokines via NFκB and IRF3-signalling11. Other NLR such as NALP1, -3, -7, AIM2 and IPAF can form multiprotein complexes called inflammasomes. These receptors can either directly or indirectly via the adaptor proteins ASC or CARDINAL interact with inflammatory caspases and activate them. In turn, activated caspases can process precursor proteins, such as pro-interleukin (IL)-1β, to their bioactive and secreted forms. Thereby NLR link perturbances in cellular homeostasis to the production of pro-inflammatory cytokines10,12,13. Inflammasome-mediated activation of microglia is involved in both infectious14-16 and non- infectious17-19 neurological diseases. Microglia express various components of the inflammasome, including NALP1, NALP3, ASC and caspase 18,19,20. In addition, microglia can be induced to express pro-IL-1β, which can be processed to bioactive and secreted IL-1β in response to pathogens, protein aggregates and more general cellular stressors, such as ATP and reactive oxygen species18,19,21-24. Although microglia resemble hematopoietic macrophages both in phenotype and function, it has recently been uncovered that they originate from a different progenitor25. Furthermore, there are indications that regulation of signaling by innate immune receptors is different in microglia26, and microglia have been reported to specifically employ caspases 3/7 and 8 during inflammatory conditions27. To directly compare inflammasome-mediated activation in different types of macrophages in an outbred system with close resemblance to humans, we isolated primary microglia and hematopoietic macrophages from adult, healthy rhesus macaques. We analyzed the expression profile of NLR, adaptor proteins and caspases and characterized inflammasome activation and regulation in detail. Our data reveal important cell type-specific differences pertaining to the negative regulation of pro-IL-1β expression as well astothe inflammasome-induced enzymatic processing of pro-IL-1β.

Materials and methods

Animals and cell culture Brain, bone marrow and blood were obtained from adult rhesus monkeys (Macaca mulatta) of either sex without neurological disease that became available from the outbred breeding colony. No animals were sacrificed for the exclusive purpose of the initiation of primary cell cultures. Better use of experimental animals contributes to the priority 3Rs program ofthe

81 Chapter 3

Biomedical Primate Research Centre. Individual identification data of the animals are listed in Table 1. Primary microglia and bone marrow-derived macrophages were isolated and cultured as described previously1,28. In short, microglia isolations were initiated from cubes of ~3g prefrontal subcortical white matter tissue that were manually depleted of blood vessels and meninges. These were chopped into cubes of less than 2 mm2 by using gentleMACSTM C tubes (Miltenyi Biotec, Bergisch Gladbach, Germany) and incubated for 20 min at 37 °C in PBS (Gibco Life Technologies, Bleiswijk, the Netherlands) containing 0.25% (w/v) trypsin (Gibco, Invitrogen, Paisely, UK) and 0.2 mg/ml bovine pancreatic DNAse I (Roche Diagnostics GmbH, Mannheim, Germany). The pellet (no centrifugation) was washed, passed over a 100 μm nylon cell strainer (Corning Inc., Corning, NY) and spun for 7 min at 524 x g. After resuspending, this was followed by Percoll (GE Healthcare Bio-Sciences AB, Uppsala, Sweden) gradient centrifugation for 30 min (1561 x g; slow brake). The pellet was washed and residual erythrocytes were depleted by hypotonic shock for 7 min on ice in milli-Q supplemented with 155 mM NH4Cl (Calbiochem, La

Jolla, CA), 1 mM KHCO3 (Merck KGaA, Darmstadt, Germany) and 0.2% (w/v) bovine serum albumin (Sigma-Aldrich, Saint Louis, MO). After a final wash, cells were plated in tissue-culture treated 6- or 24-well plates (Corning Costar Europe, Badhoevedorp, the Netherlands) in 1:1 v/v DMEM (high glucose)/HAM F10 Nutrient Mixture supplemented with 10% v/v heat-inactivated FCS, 0.5 mM glutamax, 50 units/ml penicillin and 50 μg/ml streptomycin (all Gibco Life Technologies). After overnight incubation, unattached cells and myelin debris were removed by washing with PBS and attached cells were cultured in fresh medium supplemented with 20 ng/ml macrophage- colony stimulating factor (M-CSF; PeproTech, London, UK). Primary bone marrow-derived macrophages were isolated by flushing the bone marrow from the femur (~4 cm) with PBS, followed by passing the suspension over a 100 μm nylon cell strainer (Corning Inc.) and gradient centrifugation using Lymphoprep (Axis Shield PoC AS, Oslo, Norway) according to manufacturer’s protocol. Cells were plated in tissue-culture treated 6- or 24-well plates (Corning Costar Europe) in RPMI (Roswell Park Memorial Institute) 1640 supplemented with 10% v/v heat-inactivated FCS, 2 mM glutamax, 50 units/ml penicillin, 50 μg/ml streptomycin (all Gibco Life Technologies) and 20 ng/ml M-CSF (Peprotech). Primary blood CD14+-macrophages were isolated from heparinized blood using Lymphoprep (Axis Shield PoC) and leucosep separation tubes. Interphases were collected and + CD14 monocytes were isolated using CD14+ microbeads (Miltenyi Biotec, Bergisch Gladbach, Germany) and a magnetic activated cell sorting (MACS) separation system.+ CD14 cells were plated in tissue-culture treated 6- or 24-well plates (Corning Costar Europe) in RPMI medium 1640 supplemented with 10% v/v heat-inactivated FCS, 2 mM glutamax, 50 units/ml penicillin, 50 μg/ ml streptomycin (all Gibco Life Technologies), and 20 ng/ml M-CSF (PeproTech). After isolation, cell populations were kept in culture for 7 or 8 days -without passaging- and received 1:1 fresh medium every 3-4 days supplemented with 20 ng/ml M-CSF (Peprotech). Cell cultures were synchronized for medium changes as well as for exposure to experimental stimuli. Different cell populations were analyzed (data not shown) for purity (there were no significant differences in % CD11b+ cells), morphological criteria indicative of activation (absent), and proliferation rate by Ki-67 immunostainings (there were no significant differences in % proliferating cells at time of stimulation). All cell culture media were analyzed for possible LPS contamination using a TLR4 bioassay: none of the media contained >10 fg LPS/ml (data not shown).

82 Microglia-specific inflammasome-induced processing

Monkey ID nr. Age (years) Gender Weight (kg) origin 3 1XR 28 Female 4.3 India 2CL 24 Female 9.0 India 2CP 21 Female 5.2 India 9017 23 Female 7.7 India 94045 6 Female 5.0 Myanmar 94056 16 Female 9.0 India 96024 17 Male 13.1 India 9606117 9 Male 12.8 China R00049 11 Male 9.6 India R00063 11 Male 8.4 Myanmar R011141 11 Male 10.1 Unknown R02032 10 Male 8.9 Myanmar R02052 11 Female 7.3 India R02093 11 Female 9.8 Mix R03042 9 Female 5.1 Myanmar R04027 9 Female 4.3 Myanmar R04053 10 Female 6.6 Mix R04055 7 Male 9.2 Mix R04058 7 Male 8.6 Mix R04067 9 Female 10.6 Mix R04080 6 Female 5.0 India R04108 9 Female 8.1 Mix R05074 9 Female 5.2 Myanmar R05098 6 Male 13.3 Mix R06026 8 Male 11.8 India R06043 8 Male 11.0 India R06084 4 Male 4.5 Myanmar R06106 6 Male 10.4 Mix R07097 6 Male 5.2 Myanmar R07108 7 Male 6.7 India R08045 4 Female 3.6 Myanmar R11088 2 Female 2.7 India R99007 14 Female 5.7 Mix Ri0511002 5 Female 3.7 China Ri201108 9 Female 5.4 China Ri202062 4 Female 5.8 China Ri202224 10 Female 6.0 China Ri204252 10 Female 5.1 China Ri303103 9 Male 8.9 China Ri306029 6 Male 10.7 China

Table 1. Individual identification data of rhesus macaques.

83 Chapter 3

Gene Universal Forward primer (5’ → 3’) Reverse primer (5’ → 3’) Amplicon name probe # length (nt) AIM2 3 agcctgagcagaaacagagg ccataactggcaaacagtctttc 78 ASC 65 gaactggacctgcaaggact tcctccaccaggtaggactg 66 β-Actin 63 gcccagcacgatgaagat cgccgatccacacagagta 65 CARDINAL 81 tgacgattgggtttggttc agccactgttcatggtgct 67 CASP1 4 ccaggacattaaaataaggaaattgt ccaaaaacctttacagaaggatctc 77 CASP3 68 tggaattgatgcgtaatgtt tggctcagaagcacacaaac 73 CASP4 26 ttccgggcaattgaaaatgg tgcaagctgtactaatgaaggtg 85 CASP5 80 ttgctttctgttcttcaacacc tgaagatggagccctttg 66 CASP7 25 gctgacttcctcttcgccta caaaccaggagcctcttcct 76 CASP8 55 catggaccacagtaacaagga gccatagatgatgcccttgt 73 CD14 74 gcatcctgcttgttgctg tcgtccagctcacaaggtt 77 EBP1 62 gacgaggcagctgagttga ttccgaagtagaaatccctctct 88 IL-1α 6 aataacctggaggccatcg gctaaaaggtgccgacctg 69 IL-1Rα 16 tgcctgtcctgtgtcaagtc cgcttgtcctgttttctgttc 95 IL-6 40 acaaaagtcctgatccagttcc gtcatgtcctgcagccact 131 IL-8 4 tctgtgtaaacatgacttccaagc cactccttggcaaaactgc 96 IPAF 18 aagtgaaccctgtgaccttga accaaattgtgaagattctgagc 96 MALT 4 ccagactcagttcactgcaaaa gcaatgagaggtttcccaac 130 MYD88 80 gcaaggaatgtgacttccaga gatggggatcagtcgcttc 77 NAIP 6 gacagcgtggtggaaattg gttgtccagtgctcgaaagaaa 129 NALP1 45 catcctgcctgccaactca cctcagctcctgcctcatct 75 NALP2 11 caccctccagacactccg cagtatcaataatcagttgtgggttg 104 NALP3 74 cacctgttgtgcaatctgaag gcaagatcctgacaacacgc 74 NALP4 87 cggtcctggtatacctgatgct tcagagatgtattcacagcac 67 NALP5 14 gcctctcagtgatgccttg tgatgccacagtcctcca 71 NALP6 75 tctcgaggcaccacaaaaca gactttgcagtgggacagc 111 NALP7 30 gctggactggacagactgc tccttgcagctgaggtagaac 66 NALP8 1 ccctgaagaaccctgactgt agcagatagaggtgaacagg 69 NALP9 7 ctggacgaaggctcaggaag cagggacgggaagacaggtt 110 NALP10 40 gaggggtttgagtcccaag cgtggggagtgtatgtctcc 64 NALP11 1 ccttaatgatatttcggaaaggattc gcagtcgagatataggacaactt 93 NALP12 83 gcctaggggaatgtgtcaac gggtttgagtgctccttcac 70 NALP13 80 tcagcttgtaacctcaagtatc caaggccaggtcctgacagc 75 NALP14 82 ttgagatatccaaactgtaacattca catttttatcagtctttggttgcag 117 NOD1 24 acaacaatctcaacgactacgg cagtgatctggtttacgctgag 90 NOD2 74 gactacaactctgtgggtgacatt tgagatattgttatcgcgcaaat 93 NOD3 34 aggtcggcaaggacttctc acacagcttctcgtgggtgt 71 NOD4 38 catcagagctgtgggtcctc caggtacttcttggccaactcta 75 PKR 13 aaaacacagaattgacggaaaga tcaagttttgccaatgctttt 96 pro-IL-1β 10 aaagcttggtgatgtctggtc ggacatggagaacaccacttg 89 pro-IL-18 87 gccaactctggctgctaaa cagcagccatctttattcctg 135 TGFβ 31 actactacgccaaggaggtcac tgcttgaacttgtcatagatttcg 73 TLR2 1 cggcctgtggtacatgaaa atgtccctgttgggagctt 78 TLR4 69 aatcccctgaggcatttagg tcaattgtctggatttcacacc 92 TNFα 79 aagcctgtagcccatgttgt gctggttatctgtcagctcca 112

84 Microglia-specific inflammasome-induced processing

Antibodies and reagents 3 Monoclonal antibodies against human caspase 1 (IMG5028: Novus Biologicals, Cambridge, UK) and polyclonal antibodies against human caspase 4 and caspase 5 (4450S and 4429S: Cell Signaling Technology, Danvers, MA) and human IL-1β (H-153; Santa Cruz Biotechnology, Inc., Dallas, TX) were used. Secondary mouse anti-rabbit-IgG-HRP and goat anti-mouse-IgG-HRP were obtained from Jackson ImmunoResearch Laboratories (West Grove, PA).

TLR ligands used were TLR1/2 agonist Pam3CSK4 (500 ng/ml), TLR3 agonist polyiosinic- polycytidylic acid (poly(I:C); 20 μg/ml), TLR8 agonist CL075 (1 μg/ml; all Invivogen, San Diego, CA) and TLR4 agonist lipopolysaccharide (LPS; 100 ng/ml, unless indicated otherwise; from E. Coli serotype O26:B6; Sigma-Aldrich). Inflammasome-activating agents used were monosodium urate (MSU) crystals (150 μg/ml; Invivogen), adenosine triphosphate (ATP; 5 mM) and silica (500 μg/ml; Sigma-Aldrich). Fluorchrome inhibitor of caspase assays (FLICA; AbD Serotec, Kidlington, UK) to determine specific caspase 1 activity were performed according to manufacturer’s instructions. Caspase inhibitors specific for caspase 1 (Z-YVAD-FMK; 10-40 μM), caspase 4 (Z-LEVD-FMK; 10-40 μM) and caspase 5 (Z-WEHD-FMK; 10-40 μM) were from BioVision (Milpitas, CA). Concentrations of inflammasome-activating agents and caspase inhibitors were based on earlier studies1,18,29.

RNA isolation, cDNA synthesis and real-time Polymerase Chain Reactions (rtPCR) Total cellular RNA was isolated using TriReagent (Sigma-Aldrich) or the RNeasy minikit (Qiagen GmbH, Hilden, Germany) according to manufacturer’s protocol. Subsequently, 1 μg template mRNA was reverse transcribed into cDNA with the RevertAid First Strand cDNA synthesis kit (Thermo Fisher Scientific Inc, Waltham, MA) according to manufacturer’s protocol. Probes for rtPCRs were designed using the Universal Probe Library design center (Roche Applied Science). rtPCRs were performed on the CFX96™ Real-time PCR detection system (Bio-rad Laboratories, Hercules, CA) using primer (Invitrogen; Life technologies) and probe (human Exiqon probe library, Roche, Woerden, the Netherlands) combinations listed in Table 2, and iTaq Universal Probes Supermix (Biorad). Relative gene expression was standardized to β-Actin using the Pfafll method30.

Cytokine analysis Sandwich ELISA kits for human IL-1β (R&D systems, Minneapolis, MN) were used for quantification of IL-1β in cell culture supernatants according to manufacturer’s instructions.

Table 2. Overview of primer/probe combinations used for real-time qPCR. Overview of primer/probe combinations used for real-time qPCR, including sequences (5’ --> 3’) of forward and reverse primer, human Universal Probe Library number of corresponding probe, and amplicon length (nt). Abbreviations: AIM2: Absent in melanoma 2, ASC: Apoptosis associated speck-like protein containing a caspase recruitment domain, CARDINAL (CARD8): CARD inhibitor of NF-kappaB-activating ligands, CASP: Caspase, CD14: Cluster of Differentiation antigen 14, EBP: End binding protein, IL: Interleukin, IL-1Rα: Interleukin-1 receptor antagonist, IPAF: ICE-protease activating factor, MALT: Mucosa- associated lymphoid tissue lymphoma-translocation gene, MyD88: Myeloid differentiation primary response 88, NAIP: Neuronal apoptosis inhibitor protein, NALP: NACHT-, LRR-, and PYD-containing protein, NOD: Nucleotide- binding oligomerization domain, PKR: double stranded RNA-activated protein kinase, TGF: Transforming growth factor, TLR: Toll-like receptor, TNF: Tumor-necrosis factor.

85 Chapter 3

Western Blot analysis Culture supernatants were collected and residual crystals or cellular debris was removed by short centrifugation at 12.000x g. To remove large proteins, 1:1 v/v acentonitrile (ICN biomedical Inc., Aurora, OH) was added, followed by 30 min incubation at room temperature and short centrifugation at 12.000 x g. Thereafter, supernatants were concentrated using 10 kD microcentrifuge tubes (Merck KGaA). Concentrates were collected and standardized to volume. Cell lysates were prepared in mammalian protein extraction reagent supplemented with HALT protease and phosphatase inhibitor cocktail (Thermo Fisher Scientific Inc.) according to manufacturer’s instructions. Cell lysates were standardized to protein concentrations that were determined using Bradford assays (Thermo Fisher Scientific Inc.). Culture supernatants and cell lysates were separated on 12% Bis/Tris gel in NuPage MOPS buffer (Invitrogen; Life technologies). Proteins were transferred to nitrocellulose membranes (GE Healthcare Bio-Sciences AB, Uppsala, Sweden) by semidry blotting. Membranes were probed with indicated primary and secondary antibodies, and developed with chemiluminescence (Thermo Fisher Scientific Inc.).

Statistics All data are depicted as means ± SD. Graphpad Prism 6 (Graphpad software, 2014, version 6.0e) for Macintosch was used for graphical representations. Statistical analyses were performed using Microsoft Excel for Mac (Microsoft Coorporation, 2011, version 14.4.1) and the R statistical package (R Development Core Team, 2009, version 3.02).

Results

We first assessed mRNA expression levels of different inflammasome components in primary microglia, bone marrow- and blood CD14+-derived macrophages (BMDMs and CD14Ms resp., Figure 1A). mRNA transcripts for NLR family members NALP1-NALP3, AIM2, IPAF, NAIP, MALT and NOD1-NOD4 were detectable in all cell types, while transcripts for NALP4-NALP14 were below detection levels. In addition, all cell types expressed transcripts for the adaptor proteins ASC, CARDINAL, EBP1 and PKR as well as transcripts for caspase 1, 3-5, 7, and 8. Expression levels of adaptor protein- and caspase-encoding transcripts were relatively abundant when compared to levels of NLR-encoding transcripts.

Figure 1. mRNA expression profile of inflammasome components in primary rhesus microglia, BMDMs and CD14Ms. (A). mRNA expression levels of NLR, adaptor proteins and caspases in primary rhesus microglia, BMDMs and CD14Ms. mRNA expression levels of genes of interest (GOI) are expressed relative to reference gene (β-Actin) mRNA expression levels. Data are represented as means ± SD. NALP4-NALP11, NALP13, and NALP14 mRNA expression levels were below detection limits and low expression levels of NALP12 prohibited reliable quantification of all samples. (B). Relative mRNA expression levels compared between microglia and BMDMs, between microglia and CD14Ms, and between CD14Ms and BMDMs. (C). Fold increases in relative mRNA expression levels of NLR, adaptor proteins and caspases after 16h exposure to LPS (100 ng/ml) in microglia, BMDMs and CD14Ms. Data are represented as mean values (D). Relative mRNA expression levels after 16h exposure to LPS (100 ng/ml) compared between microglia and BMDMs, microglia and CD14Ms, and CD14Ms and BMDMs. * p < 0.05, ** p < 0.01; ANOVA with Tukey HSD correction.

86 Microglia-specific inflammasome-induced processing

87 Chapter 3

The expression profiles are consistent with the notion that all these cell types canform functional inflammasomes. Yet, comparison of relative mRNA expression levels of microglia, BMDMs and CD14Ms (Figure 1B) revealed interesting differences. Where mRNA expression levels in BMDMs and CD14Ms were comparable, microglia expressed significantly lower levels of AIM2, NOD1, NOD3, caspase 1, 3, 4, and 5-encoding mRNA transcripts compared to BMDMs. In addition, levels of caspase 4- and 5-encoding mRNA transcripts were lower in microglia when compared to CD14Ms, although this was not significant. As in vitro inflammasome activation is most often monitored in cells that have been primed with a TLR agonist29,31,32, we also analyzed mRNA expression levels after overnight exposure to the TLR4 agonist LPS. Comparison to non-stimulated cells revealed LPS-induced changes in mRNA expression levels of many inflammasome components in all cell types Figure( 1C). Priming of microglia significantly enhanced expression levels of PKR and of caspase 1, 4, and 5 transcripts. Comparison of relative expression levels between cell types after LPS priming revealed that the mRNA expression profile of microglia now more closely resembled that of hematopoietic macrophages (Figure 1D). The expression levels of transcripts encoding caspase 1, 3, 4, and 5 were now similar in all macrophages, but LPS-primed microglia still expressed markedly lower levels of NOD3-encoding transcripts compared to BMDMs and CD14Ms.

For functional analysis of inflammasome-mediated activation in microglia and BMDMs, cells were primed with different TLR agonists before triggering the inflammasome with silica, monosodium urate crystals (MSU) or ATP29,33. Priming of microglia and BMDMs by exposure to TLR1/2, 4 or TLR8 agonists strongly induced pro-IL-1β-encoding mRNA expression levels, whereas exposure to a TLR3 agonist was much less effectiveFigure ( 2A). Consistent with literature18,32, secretion of IL-1β protein in response to TLR priming alone was lower than 500 pg/ml or below detection levels both in microglia as well as in BMDMs Figure( 2B). Exposure of microglia and BMDMs that were primed with the TLR4 agonist LPS to inflammasome activators strongly induced processing and secretion of IL-1β Figure( 2C-D). Whereas the physiological relevance of MSU and ATP for microglia is clear21,34-39, it is less likely that they will encounter silica. However, as silica and MSU were more potent in triggering inflammasome-mediated activation in microglia than ATP, we chose to continue our studies with these stimuli.

We first characterized the influence of priming on inflammasome-mediated activation by varying the length of the priming period before inflammasome activation. In microglia, silica- induced IL-1β secretion was detectable from 2h after LPS priming onwards and increased gradually for ≤12h after LPS priming Figure( 3A). Priming for >16h led to lower levels of secreted IL-1β. In BMDMs, silica-induced IL-1β secretion was detected as early as 1h after LPS priming. Much higher levels of secreted IL-1β were obtained if BMDMs were primed with LPS for 6-8h, whereas priming for >8h led to lower levels of secreted IL-1β (Figure 3A). Similar differences in kinetics were found between microglia and CD14Ms and also applied to MSU-induced inflammasome activation. Analysis of the ratio of inflammasome-induced secretion of IL-1β after 16h to inflammasome-induced secretion of IL-1β after 4h of LPS priming confirmed that these kinetics differ significantly between microglia and hematopoietic macrophagesFigure ( 3B).

88 Microglia-specific inflammasome-induced processing

Figure 2. TLR-mediated priming of microglia and BMDMs induces the expression of pro-IL-1β-encoding mRNA, but processing and secretion of IL-1β is measured only after inflammasome activation. (A). Relative pro-IL-1β-encoding mRNA expression levels in primary rhesus microglia and BMDMs. Cells were exposed for 16h to TLR1/2 (PAM3CSK4; 500 ng/ml), TLR3 (poly(I:C); 20 μg/ml), TLR4 (LPS; 100 ng/ml) and TLR8 (CL075; 1 μg/ml) agonists. (B). Levels of secreted IL-1β by TLR-primed microglia and BMDMs (C). Levels of secreted IL-1β by LPS-primed (100 ng/ml; 4h) microglia and BMDMs exposed to inflammasome inducers silica (500 μg/ml; 6h), MSU (150 μg/ml; 6h) or ATP (5 mM; 6h). * p < 0.05, ** p < 0.01; paired T tests with Bonferroni correction compared to unstimulated cells (-).(D). Western blot analysis of pro-IL-1β and cleaved IL-1β protein in cell lysates (lys) and supernatant (sup) of LPS-primed (100 ng/ ml; 4h) microglia and BMDMs that were exposed to silica (500 μg/ml; 6h), MSU (150 μg/ml; 6h) or ATP (5 mM; 6h). Arrows indicate molecular weight (MW) in kilodaltons.

89 Chapter 3

Figure 3. Kinetics of IL-1β secretion by LPS-primed microglia differ from that by LPS-primed hematopoietic macrophages. (A). Silica-induced (500 μg/ml; 6h) IL-1β secretion in LPS-primed (100 ng/ml; indicated timepoints) microglia and BMDMs. Data of one representative donor of at least 3 independent experiments are shown and are represented as mean ± SD. (B). Analysis of the ratio of inflammasome-induced IL-1β secretion after 16h compared to 4h. Open symbols: silica-induced IL-1β secretion; closed symbols: MSU-induced IL-1β secretion; * p < 0.05, ** p < 0.01; paired T tests with Bonferroni correction compared to microglia.

We examined whether the different kinetics of IL-1β secretion in microglia could be attributed to differences in sensitivity to LPS-induced signaling. However, basal expression levels of TLR2-, TLR4-, CD14- and MyD88-encoding transcripts were similar for microglia and other macrophages (Figure 4A). In addition, priming of microglia and BMDMs with different concentrations of LPS resulted in similar differences in IL-1β secretion profiles between microglia and BMDMs (Figure 4B). Finally, we assessed pro-IL-1β-encoding mRNA levels in more detail after LPS priming (Figure 4C). Pro-IL-1β mRNA transcripts were strongly induced already after 1h of LPS priming in both microglia as well as in BMDMs. However, while pro-IL-1β mRNA transcript levels were downregulated already 4h after LPS priming in BMDMs, they remained high in microglia. Analysis of other cytokine-encoding mRNA transcripts after priming with LPS demonstrates that the lack of negative regulation on pro-IL-1β transcripts also applied to IL-1α and IL-8Figure ( 4C). Other LPS-inducible transcripts like those of IL-1 receptor antagonist (IL-1Rα), IL-6 and TNF-a were subject to regulation in both microglia as well as in BMDMs.

Figure 4. Negative regulation of pro-IL-1β transcription is impaired in microglia. (A). Relative mRNA expression levels of TLR2, TLR4, CD14 and MyD88 in unprimed microglia, BMDMs and CD14Ms. (B). Silica-induced (500 μg/ml; 6h) IL-1β secretion of microglia and BMDMs primed with different concentrations of LPS (4-500 ng/ml; 4h or 16h). (C). Relative pro-IL-1β, IL-1α, pro-IL-18, IL-1Rα, IL-8, IL-6, TNFα, TGFβ mRNA expression levels in LPS-primed (100 ng/ ml; indicated timepoints) microglia (n=3) and BMDMs (n=3). Data are represented as mean ±SD.

90 Microglia-specific inflammasome-induced processing

91 Chapter 3

Figure 5. Silica-induced IL-1β secretion in microglia is only partially dependent of caspase 1, 4 and 5 (A). Silica- induced (500 μg/ml; 30 min) caspase 1 activation in LPS-primed (100 ng/ml; indicated timepoints) microglia and BMDMs. Caspase 1 activation was assessed using fluorochrome inhibitor of caspase (FLICA) assays and results in a green fluorescent signal. Nuclei are counterstained with DAPI. Original magnifications 400x.(B). Western blot analysis of caspase 1, 4 and 5 expression in cell lysates of unprimed and LPS-primed (100 ng/ml; indicated timepoints) microglia and BMDMs. Arrows indicate molecular weight in kD. (C). Analysis of silica-induced (500 μg/ml; 6h) IL-1β secretion by LPS-primed (100 ng/ml; indicated timepoints) microglia and BMDMs in the presence of 10-40μM specific caspase inhibitors or a combination of caspase 1, 4 and 5 inhibitors (10-20 μM each; all applied 15 min prior to silica activation). Data of one representative donor of at least 3 independent experiments are shown forthe separate caspase inhibitors, while data of multiple donors are shown for the combination of the caspase inhibitors. IL-1β secretion is represented relative to DMSO controls (dotted line = 100%). DMSO or caspase inhibitors alone did not induce IL-1β secretion in unprimed or LPS-primed microglia and BMDMs. * p < 0.05, ** p < 0.01, *** p < 0.001; paired T tests with Bonferroni correction compared to DMSO controls.

92 Microglia-specific inflammasome-induced processing

To examine the processing and secretion of IL-1β in more detail, we first monitored the 3 activation of caspase 1, the principal inflammasome-activated caspase40 described . To our surprise, silica-induced caspase 1 activation could not be detected in microglia that were primed with LPS for 4h. Only after 16h of LPS priming some caspase 1 activation could be observed (Figure 5A). This was in marked contrast to BMDMs, where robust silica-induced caspase 1 activation was detectable 4h after LPS priming, while longer priming resulted in decreased caspase 1 activation. Western blot analysis of caspase 1 expression revealed that although both microglia and BMDMs expressed caspase 1, BMDMs expressed an additional isoform at 30 kD and an additional high molecular weight band at 55 kD indicative of a protein complexFigure ( 5B). In addition, Western blot analysis revealed that both microglia and BMDMs expressed roughly similar amounts of the inflammatory caspases 4 and 5 under basal conditions and after LPS priming. Similar to caspase 1, BMDMs expressed an additional isoform of caspase 4 at 40 kD. To assess their functional involvement in the secretion of IL-1β, we specifically inhibited caspase 1, caspase 4 and caspase 5 before activating the inflammasomeFigure ( 5C). In LPS-primed microglia and BMDMs, inhibition of caspase 1 inhibited silica-induced IL-1β secretion by ≤46% and 59% respectively. Inhibition of caspase 4 and 5 inhibited silica-induced IL-1β secretion in microglia by ≤41% and 53% respectively, compared to ≤84% and 86% inhibition in BMDMs respectively. Whereas inhibition of caspase 4 and 5 in BMDMs was clearly dose dependent, this was not the case for microglia suggesting that exposure to even higher concentrations of caspase inhibitors would not lead to a further reduction in silica-induced IL-1β secretion in microglia. This could not be directly tested, as the necessary dissolvent controls affected cellular homeostasis (data not shown). However, simultaneous inhibition of caspase 1, 4 and 5 inhibited silica-induced IL-1β secretion in microglia by ≤38%, whereas this inhibited silica-induced IL-1β secretion in BMDMs by ≤84%. Together these data indicate that microglia are less dependent on inflammatory caspases than BMDMs for the secretion of silica-induced IL-1β.

Discussion

Although microglia have long been considered similar to other myeloid macrophages, it is becoming more and more apparent that they differ in many respects, as illustrated by the distinct roles that resident microglia and peripheral macrophages play in CNS injury41,42. Differences in regulation of innate immune responses26 and alternative use of caspases were described for microglia in earlier studies27. Our data now identify new and important cell type-specific differences in inflammasome-mediated responses. Results from this study demonstrate that microglia and hematopoietic macrophages are in principal endowed with similar inflammasome machinery. Published or online available datasets on gene expression profiles of rodent microglia and macrophages43-45 did not reveal differences in expression levels of inflammasome components between microglia and hematopoietic macrophages and are thus in line with most of our results. However, we report here that there are relatively large differences for two transcripts in particular. Resting microglia express less

93 Chapter 3

caspase 4 and caspase 5 than resting BMDMs and CD14Ms Figure( 1A). As caspase 4 and caspase 5 are not encoded for in rodents, which express the ortologue caspase 1140, this is a new finding that underlines the added value of studies using primate material. Furthermore, we show that although microglia and hematopoietic macrophages respond to the same innate stimuli, microglial IL-1β secretion is optimal when longer priming periods are used and is more persistent when compared to hematopoietic macrophages. Together our data demonstrate that the latter is due to a lack of negative regulation at the transcriptional level. This not only applies to LPS-induced pro-IL-1β mRNA expression levels, but also to IL-1α and IL-8 mRNA expression levels. Transcription factor analysis (Champion ChiP Transcription Factor Search Portal, SABiosciences46-48) revealed that the promoter regions of these cytokines share binding sites for the transcription factors NFκB, AP-1, C/EBPβ and glucocorticoid receptor. Many proteins have been described that regulate the activation of these transcription factors, including regulatory proteins A20, SOCS1, TRIAD3A, SHP1, TOLLIP, IRAKM, PELI1, FLN29 and MAPK phosphatases49. In microglia specifically, PELI1 can positively regulate NFκB signaling26. However, mRNA expression levels of PELI1 in microglia and hematopoietic macrophages were similar (data not shown) rendering it unlikely that this can directly explain the observed lack of negative regulation in microglia. Interestingly, NOD3 (also called NLRC3) has been found to negatively regulate NFκB activation50. As our mRNA expression analysis revealed that microglia constitutively express much lower levels of NOD3-encoding transcripts than hematopoietic macrophages, NOD3 is an interesting candidate for future studies. Various studies using primary microglia describe that inflammasome-induced IL-1β secretion in response to protein aggregates and pathogens is caspase 1-dependent8,9,16-18,21-23. Our results confirm that microglial secretion of IL-1β is dependent on caspase 1, but also demonstrate that this dependence is only partial. In addition, we demonstrate that although caspase 4 and 5 are involved in both microglia and hematopoietic macrophages, their relative contribution to inflammasome-induced IL-1β secretion appears to be less important in microglia. Our data on the simultaneous inhibition of caspase 1, 4 and 5 are in line with this notion. It has been reported that activation of caspase 4 and 5 can potentiate the activity of caspase 131,51 and this process might well be less efficient in microglia. Overall our data show that microglia are less dependent than BMDMs on inflammatory caspases for the processing and secretion of IL-1β and suggest that they also employ other mechanisms. Alternative mechanisms that have been described for IL-1β processing and secretion include activation of a non-canonical caspase 8 inflammasome52,53 and inflammasome- independent mechanisms such as matrix metalloproteinases54, cathepsins55 and serine proteases56-59. Preliminary results from our lab indicate that inhibition of caspase 8 does not affect silica-induced IL-1β secretion in either microglia or BMDMs (data not shown). The relative contribution of other pathways in microglial IL-1β secretion remains to be investigated. This study, describing cell type-specific differences in the negative regulation of pro-IL-1β expression and in the enzymatic processing of pro-IL-1β, concurs with recently described fundamental differences in inflammasome-mediated activation of monocytes and macrophages32. Whether such differences are cell-inherent25 or induced by prolonged exposure to the neuronal microenvironment is currently unknown. It also remains to be demonstrated how the here described differences translate to tissue-specific responses to chronic or acute cellular stress in

94 Microglia-specific inflammasome-induced processing

vivo. Currently, inhibition of caspase 1 activation is considered as therapeutic strategy to reduce 3 inflammation in neuroinflammatory diseases60. Our results suggest that this strategy might only be partially effective on microglia. To develop therapeutic strategies that target IL-1β processing and secretion in microglia specifically, it is important to delineate the additional mechanisms employed by microglia for the secretion of IL-1β.

Acknowledgements

This work was financially supported by the Dutch MS Research Foundation (MS12-805). The authors thank T. Haaksma for expert technical assistance. We thank E. Remarque for expert assistance with the statistical analyses and R. Bontrop, L.A. ‘t Hart, M.G. Netea and J.M. van Noort for critically reading the manuscript.

References

1 Zuiderwijk-Sick, E. A. et al. Differentiation of primary adult microglia alters their response to TLR8-mediated activation but not their capacity as APC. Glia 55, 1589-1600, doi:10.1002/glia.20572 (2007). 2 Olson, J. K. & Miller, S. D. Microglia initiate central nervous system innate and adaptive immune responses through multiple TLRs. Journal of immunology 173, 3916-3924 (2004). 3 Furr, S. R., Chauhan, V. S., Sterka, D., Jr., Grdzelishvili, V. & Marriott, I. Characterization of retinoic acid-inducible gene-I expression in primary murine glia following exposure to vesicular stomatitis virus.Journal of neurovirology 14, 503-513, doi:10.1080/13550280802337217 (2008).

4 Shah, V. B. et al. Beta-glucan activates microglia without inducing cytokine production in Dectin-1-dependent manner.Journal of immunology 180, 2777-2785 (2008).

5 Shi, F. et al. The NALP3 inflammasome is involved in neurotoxic prion peptide-induced microglial activation.Journal of neuroinflammation 9, 73, doi:10.1186/1742-2094-9-73 (2012). 6 Salminen, A., Ojala, J., Suuronen, T., Kaarniranta, K. & Kauppinen, A. Amyloid-beta oligomers set fire to inflammasomes and induce Alzheimer’s pathology. J Cell Mol Med 12, 2255-2262, doi:10.1111/j.1582-4934.2008.00496.x (2008).

7 Heneka, M. T. et al. NLRP3 is activated in Alzheimer’s disease and contributes to pathology in APP/PS1 mice.Nature 493, 674-678, doi:10.1038/nature11729 (2013).

8 Jamilloux, Y. et al. Inflammasome activation restricts Legionella pneumophila replication in primary microglial cells through flagellin detection.Glia 61, 539-549, doi:10.1002/glia.22454 (2013). 9 Hafner-Bratkovic, I., Bencina, M., Fitzgerald, K. A., Golenbock, D. & Jerala, R. NLRP3 inflammasome activation in macrophage cell lines by prion protein fibrils as the source of IL-1beta and neuronal toxicity.Cell Mol Life Sci 69, 4215-4228, doi:10.1007/s00018- 012-1140-0 (2012).

10 Martinon, F., Mayor, A. & Tschopp, J. The inflammasomes: guardians of the body.Annu Rev Immunol 27, 229-265, doi:10.1146/ annurev.immunol.021908.132715 (2009).

11 Ting, J. P., Duncan, J. A. & Lei, Y. How the noninflammasome NLRs function in the innate immune system.Science 327, 286-290, doi:10.1126/science.1184004 (2010).

12 Latz, E. The inflammasomes: mechanisms of activation and function.Curr Opin Immunol 22, 28-33, doi:10.1016/j.coi.2009.12.004 (2010).

13 Khare, S. et al. An NLRP7-containing inflammasome mediates recognition of microbial lipopeptides in human macrophages. Immunity 36, 464-476, doi:10.1016/j.immuni.2012.02.001 (2012).

14 Chang, J. et al. Antibody-mediated inhibition of integrin alpha5beta1 blocks neurotoxic prion peptide PrP106-126-induced activation of BV2 microglia.J Mol Neurosci 48, 248-252, doi:10.1007/s12031-012-9821-6 (2012). 15 Kaushik, D. K., Gupta, M., Kumawat, K. L. & Basu, A. NLRP3 inflammasome: key mediator of neuroinflammation in murine Japanese encephalitis.PloS one 7, e32270, doi:10.1371/journal.pone.0032270 (2012).

95 Chapter 3

16 Lee, H. M., Kang, J., Lee, S. J. & Jo, E. K. Microglial activation of the NLRP3 inflammasome by the priming signals derived from macrophages infected with mycobacteria. Glia 61, 441-452, doi:10.1002/glia.22448 (2013). 17 Meissner, F., Molawi, K. & Zychlinsky, A. Mutant superoxide dismutase 1-induced IL-1beta accelerates ALS pathogenesis. Proceedings of the National Academy of Sciences of the United States of America 107, 13046-13050, doi:10.1073/ pnas.1002396107 (2010).

18 Halle, A. et al. The NALP3 inflammasome is involved in the innate immune response to amyloid-beta.Nature immunology 9, 857- 865, doi:10.1038/ni.1636 (2008).

19 Abulafia, D. P. et al. Inhibition of the inflammasome complex reduces the inflammatory response after thromboembolic stroke in mice. J Cereb Blood Flow Metab 29, 534-544, doi:10.1038/jcbfm.2008.143 (2009).

20 Shi, F. et al. Prion protein participates in the regulation of classical and alternative activation of BV2 microglia.Journal of neurochemistry 124, 168-174, doi:10.1111/jnc.12053 (2013). 21 Hanamsagar, R., Torres, V. & Kielian, T. Inflammasome activation and IL-1beta/IL-18 processing are influenced by distinct pathways in microglia. Journal of neurochemistry 119, 736-748, doi:10.1111/j.1471-4159.2011.07481.x (2011).

22 Terada, K. et al. Involvement of cathepsin B in the processing and secretion of interleukin-1beta in chromogranin A-stimulated microglia. Glia 58, 114-124, doi:10.1002/glia.20906 (2010).

23 Walsh, J. G. et al. Rapid inflammasome activation in microglia contributes to brain disease in HIV/AIDS.Retrovirology 11, 35, doi:10.1186/1742-4690-11-35 (2014).

24 Wu, Z. et al. Differential pathways for interleukin-1beta production activated by chromogranin A and amyloid beta in microglia. Neurobiol Aging 34, 2715-2725, doi:10.1016/j.neurobiolaging.2013.05.018 (2013).

25 Ginhoux, F. et al. Fate mapping analysis reveals that adult microglia derive from primitive macrophages.Science 330, 841-845, doi:10.1126/science.1194637 (2010).

26 Xiao, Y. et al. Peli1 promotes microglia-mediated CNS inflammation by regulating Traf3 degradation.Nat Med 19, 595-602, doi:10.1038/nm.3111 (2013).

27 Burguillos, M. A. et al. Caspase signalling controls microglia activation and neurotoxicity.Nature 472, 319-324, doi:10.1038/ nature09788 (2011).

28 van der Putten, C. et al. Differential expression of adenosine A3 receptors controls adenosine A2A receptor-mediated inhibition of TLR responses in microglia. Journal of immunology 182, 7603-7612, doi:10.4049/jimmunol.0803383 (2009).

29 Zhou, R., Yazdi, A. S., Menu, P. & Tschopp, J. A role for mitochondria in NLRP3 inflammasome activation.Nature 469, 221-225, doi:10.1038/nature09663 (2011).

30 Pfaffl, M. W. A new mathematical model for relative quantification in real-time NucleicRT-PCR. Acids Res 29, e45 (2001). 31 Martinon, F., Burns, K. & Tschopp, J. The inflammasome: a molecular platform triggering activation of inflammatory caspases and processing of proIL-beta. Mol Cell 10, 417-426 (2002).

32 Netea, M. G. et al. Differential requirement for the activation of the inflammasome for processing and release of IL-1beta in monocytes and macrophages. Blood 113, 2324-2335, doi:10.1182/blood-2008-03-146720 (2009). 33 Martinon, F., Petrilli, V., Mayor, A., Tardivel, A. & Tschopp, J. Gout-associated uric acid crystals activate the NALP3 inflammasome. Nature 440, 237-241, doi:10.1038/nature04516 (2006).

34 Martins, I. et al. Molecular mechanisms of ATP secretion during immunogenic cell death.Cell death and differentiation 21, 79-91, doi:10.1038/cdd.2013.75 (2014).

35 Euser, S. M., Hofman, A., Westendorp, R. G. & Breteler, M. M. Serum uric acid and cognitive function and dementia.Brain : a journal of neurology 132, 377-382, doi:10.1093/brain/awn316 (2009).

36 Maetzler, W. et al. Serum and cerebrospinal fluid uric acid levels in lewy body disorders: associations with disease occurrence and amyloid-beta pathway. Journal of Alzheimer’s disease : JAD 27, 119-126, doi:10.3233/JAD-2011-110587 (2011). 37 McFarland, N. R., Burdett, T., Desjardins, C. A., Frosch, M. P. & Schwarzschild, M. A. Postmortem brain levels of urate and precursors in Parkinson’s disease and related disorders. Neuro-degenerative diseases 12, 189-198, doi:10.1159/000346370 (2013).

38 Rock, K. L. & Kono, H. The inflammatory response to cell death.Annual review of pathology 3, 99-126, doi:10.1146/annurev. pathmechdis.3.121806.151456 (2008).

39 Shi, Y., Evans, J. E. & Rock, K. L. Molecular identification of a danger signal that alerts the immune system to dying cells.Nature 425, 516-521, doi:10.1038/nature01991 (2003).

40 Martinon, F. & Tschopp, J. Inflammatory caspases: linking an intracellular innate immune system to autoinflammatory diseases.Cell 117, 561-574, doi:10.1016/j.cell.2004.05.004 (2004). 41 Greenhalgh, A. D. & David, S. Differences in the phagocytic response of microglia and peripheral macrophages after spinal cord injury and its effects on cell death.The Journal of neuroscience : the official journal of the Society for Neuroscience 34, 6316-6322, doi:10.1523/JNEUROSCI.4912-13.2014 (2014).

96 Microglia-specific inflammasome-induced processing

42 Raivich, G. & Banati, R. Brain microglia and blood-derived macrophages: molecular profiles and functional roles in multiple sclerosis and animal models of autoimmune demyelinating disease.Brain Res Brain Res Rev 46, 261-281, doi:10.1016/j. 3 brainresrev.2004.06.006 (2004).

43 Butovsky, O. et al. Identification of a unique TGF-beta-dependent molecular and functional signature in microglia.Nature neuroscience 17, 131-143, doi:10.1038/nn.3599 (2014).

44 Chiu, I. M. et al. A neurodegeneration-specific gene-expression signature of acutely isolated microglia from an amyotrophic lateral sclerosis mouse model. Cell reports 4, 385-401, doi:10.1016/j.celrep.2013.06.018 (2013).

45 Hickman, S. E. et al. The microglial sensome revealed by direct RNA sequencing. Nature neuroscience 16, 1896-1905, doi:10.1038/ nn.3554 (2013).

46 Cogswell, J. P. et al. NF-kappa B regulates IL-1 beta transcription through a consensus NF-kappa B binding site and a nonconsensus CRE-like site. Journal of immunology 153, 712-723 (1994).

47 Lee, W., Mitchell, P. & Tjian, R. Purified transcription factor AP-1 interacts with TPA-inducible enhancer elements.Cell 49, 741-752 (1987).

48 De Bosscher, K., Vanden Berghe, W. & Haegeman, G. The interplay between the glucocorticoid receptor and nuclear factor-kappaB or activator protein-1: molecular mechanisms for gene repression.Endocrine reviews 24, 488-522, doi:10.1210/er.2002-0006 (2003).

49 Bajramovic, J. J. Regulation of innate immune responses in the central nervous system.CNS Neurol Disord Drug Targets 10, 4-24 (2011).

50 Schneider, M. et al. The innate immune sensor NLRC3 attenuates Toll-like receptor signaling via modification of the signaling adaptor TRAF6 and transcription factor NF-kappaB.Nature immunology 13, 823-831, doi:10.1038/ni.2378 (2012). 51 Sollberger, G., Strittmatter, G. E., Kistowska, M., French, L. E. & Beer, H. D. Caspase-4 is required for activation of inflammasomes. Journal of immunology 188, 1992-2000, doi:10.4049/jimmunol.1101620 (2012). 52 Antonopoulos, C., El Sanadi, C., Kaiser, W. J., Mocarski, E. S. & Dubyak, G. R. Proapoptotic chemotherapeutic drugs induce noncanonical processing and release of IL-1beta via caspase-8 in dendritic cells.Journal of immunology 191, 4789-4803, doi:10.4049/jimmunol.1300645 (2013).

53 Gringhuis, S. I. et al. Dectin-1 is an extracellular pathogen sensor for the induction and processing of IL-1beta via a noncanonical caspase-8 inflammasome.Nature immunology 13, 246-254, doi:10.1038/ni.2222 (2012). 54 Schonbeck, U., Mach, F. & Libby, P. Generation of biologically active IL-1 beta by matrix metalloproteinases: a novel caspase-1- independent pathway of IL-1 beta processing. Journal of immunology 161, 3340-3346 (1998). 55 Edye, M. E., Lopez-Castejon, G., Allan, S. M. & Brough, D. Acidosis drives damage-associated molecular pattern (DAMP)-induced interleukin-1 secretion via a caspase-1-independent pathway.The Journal of biological chemistry 288, 30485-30494, doi:10.1074/ jbc.M113.478941 (2013).

56 Cassel, S. L. et al. Inflammasome-independent IL-1beta mediates autoinflammatory disease in Pstpip2-deficient mice.Proceedings of the National Academy of Sciences of the United States of America 111, 1072-1077, doi:10.1073/pnas.1318685111 (2014).

57 Joosten, L. A. et al. Inflammatory arthritis in caspase 1 gene-deficient mice: contribution of proteinase 3 to caspase 1-independent production of bioactive interleukin-1beta.Arthritis and rheumatism 60, 3651-3662, doi:10.1002/art.25006 (2009). 58 Karmakar, M., Sun, Y., Hise, A. G., Rietsch, A. & Pearlman, E. Cutting edge: IL-1beta processing during Pseudomonas aeruginosa infection is mediated by neutrophil serine proteases and is independent of NLRC4 and caspase-1.Journal of immunology 189, 4231-4235, doi:10.4049/jimmunol.1201447 (2012).

59 Stehlik, C. Multiple interleukin-1beta-converting enzymes contribute to inflammatory arthritis.Arthritis and rheumatism 60, 3524- 3530, doi:10.1002/art.24961 (2009).

60 Rabuffetti, M. et al. Inhibition of caspase-1-like activity by Ac-Tyr-Val-Ala-Asp-chloromethyl ketone induces long-lasting neuroprotection in cerebral ischemia through apoptosis reduction and decrease of proinflammatory cytokines.The Journal of neuroscience : the official journal of the Society for Neuroscience 20, 4398-4404 (2000).

CHAPTER 4

ATP-induced IL-1β secretion is selectively impaired in microglia

Saskia M. Burm1, Ella A. Zuiderwijk-Sick1, Paola M. Weert1, Jeffrey J. Bajramovic1

1Alternatives Unit, Biomedical Primate Research Centre, Rijswijk, the Netherlands

Manuscript submitted for publication Chapter 4

Abstract

Under stressful conditions, nucleotides are released from dying cells into the extracellular space, where they can bind to purinergic P2X and P2Y receptors. High concentrations of extracellular ATP in particular induce P2X7-mediated signaling, which leads to inflammasome activation. This in turn leads to the processing and secretion of pro-inflammatory cytokines, like interleukin (IL)-1β. During neurodegenerative diseases, innate immune responses are shaped by microglia and we have previously identified microglia-specific features of inflammasome- mediated responses. Here we compared ATP-induced IL-1β secretion in primary rhesus macaque microglia and bone marrow-derived macrophages (BMDM). We assessed the full expression profile of purinergic receptors and characterized the induction and modulation of IL-1β secretion by extracellular nucleotides. Microglia secreted significantly lower levels of IL-1β in response to ATP when compared to BMDM. We demonstrate that this is not due to differences in sensitivity, kinetics or expression of ATP-processing enzymes, but rather to differences in purinergic receptor expression levels and usage. Using a combined approach of purinergic receptor agonists and antagonists, we demonstrate that ATP-induced IL-1β secretion in BMDM was fully dependent on P2X7 signaling, whereas in microglia multiple purinergic receptors were involved, including P2X7 and P2X4. These cell type-specific features of conserved innate immune responses may reflect adaptations to the vulnerable CNS microenvironment.

100 ATP-induced IL-1β secretion is selectively impaired in microglia

Introduction

Intracellular nucleotides are released into the extracellular space under a variety of 4 homeostatic and pathological conditions. Here they can induce paracrine and autocrine signaling via purinergic P2X and P2Y receptors1-3. P2X receptors are adenosine triphosphate (ATP)-selective ionotropic receptors, while P2Y receptors are G protein-coupled receptors that recognize ATP, uridine triphosphate (UTP) or their metabolites. To date, seven P2X receptors and eight P2Y receptors have been characterized (Table 1)4,5. In the central nervous system (CNS), P2X and P2Y receptors are abundantly expressed by neurons, astrocytes, oligodendrocyte precursors and microglia6-10. In the healthy adult CNS, nucleotides can be secreted by neurons and astrocytes11 and purinergic receptor-mediated signaling is involved in neurogenesis, synaptic transmission and maintenance of the blood-brain barrier12-16. Under pathophysiological conditions, nucleotides can be released into the extracellular space either actively by apoptotic or inflammatory cells via secretory exocytosis or plasma membrane transporters, or passively by damaged and necrotic cells17-19. Subsequent purinergic receptor-mediated signaling in microglia induces migration to the injured site, phagocytosis of cellular debris and secretion of pro-inflammatory cytokines1,9,20-22. In addition, high extracellular concentrations of ATP can induce P2X7-mediated activation ofthe inflammasome1,23-25. Inflammasomes are multiprotein complexes that link perturbances in cellular homeostasis to caspase-dependent processing and secretion of pro-inflammatory cytokines, such as interleukin (IL)-1β26,27. P2X7-mediated signaling leads to efflux of intracellular K+ ions, which is required for inflammasome activation28,29. In hematopoietic macrophages, other purinergic receptors have been described to modulate P2X7-induced inflammasome activation. P2X4-mediated signaling for example enhances activation by increasing Ca2+ influx and by suppressing autophagy30-32, and signaling via P2Y receptors can also modulate inflammasome activation33,34. Although it has been long thought that microglia resemble hematopoietic macrophages both in phenotype and function, it has recently been uncovered that they originate from a different progenitor35 and that they express a unique transcriptome36-38. Microglia express various P2X and P2Y receptors39-42, but little is known about the interplay of these receptors with P2X7-induced inflammasome activation. As we have previously uncovered differences in inflammasome- mediated responses between microglia and hematopoietic macrophages43, the aim of this study was to characterize purinergic receptor-mediated signaling in inflammasome activation in microglia, and to compare that to hematopoietic macrophages. To do so, we isolated primary microglia and hematopoietic macrophages from adult, healthy rhesus macaques, outbred animals with a close genetic resemblance to humans. We analyzed the expression profiles of P2X and P2Y receptors and characterized inflammasome activation and regulation by ATP, UTP and their metabolites in detail using a combined approach of purinergic receptor agonists and antagonists.

101 Chapter 4

Materials and methods

Animals and cell culture Brain tissue, bone marrow and blood were obtained from adult rhesus monkeys Macaca( mulatta) of either sex without neurological disease that became available from the outbred breeding colony. Primary microglia, bone marrow-derived macrophages and blood-derived macrophages were isolated and cultured as described previously43-45. In short, microglia isolations were initiated from cubes of ~3g prefrontal subcortical white matter tissue that were manually depleted of blood vessels and meninges. These were chopped into cubes of less than 2 mm2 by using gentleMACSTM C tubes (Miltenyi Biotec, Bergisch Gladbach, Germany) and incubated for 20 min at 37 °C in PBS (Gibco Life Technologies, Bleiswijk, the Netherlands) containing 0.25% (w/v) trypsin (Gibco, Invitrogen, Paisely, UK) and 0.2 mg/ml bovine pancreatic DNAse I (Roche Diagnostics GmbH, Mannheim, Germany). The pellet (no centrifugation) was washed, passed over a 100 μm nylon cell strainer (Corning Inc., Corning, NY) and centrifuged for 7 min at 524 x g. After resuspending, this was followed by Percoll (GE Healthcare Bio-Sciences AB, Uppsala, Sweden) gradient centrifugation for 30 min (1561 x g; slow brake). The pellet was washed and residual erythrocytes were depleted by hypotonic shock for 7 min on ice in milli-Q supplemented with 155 mM NH4Cl (Calbiochem, La Jolla, CA), 1 mM KHCO3 (Merck KGaA, Darmstadt, Germany) and 0.2% (w/v) bovine serum albumin (Sigma-Aldrich, Saint Louis, MO). After a final wash, cells were plated in tissue-culture treated 6- or 24-well plates (Corning Costar Europe, Badhoevedorp, the Netherlands) in 1:1 v/v DMEM (high glucose)/HAM F10 Nutrient Mixture supplemented with

P2 receptor Ligand Antagonist Concentration Based on P2X family P2X1 ATP NF449 2.8 nM 10x IC50 P2X2 ATP - - - P2X3 ATP - - - P2X4 ATP 5-BDBD 50 μM 46 P2X5 ATP NF449 2.8 nM 10x IC50 P2X6 ATP - - - P2X7 ATP. BzATP A740003 50 μM 33

P2Y familiy P2Y1 ADP, ATP MRS2279 0.5 μM 10x IC50 P2Y2 UTP, ATP, UDP AR-C 118925XX 1 μM 10x IC50 P2Y4 UTP - - - P2Y6 UTP, UDP MRS2578 370 nM 10x IC50 P2Y11 ATP NF340 724 nM 10x IC50 P2Y12 ADP AR-C 66096 81 nM 10x IC50 P2Y13 ADP MRS2211 11.8 nM 10x IC50 P2Y14 UDP/ UDP-sugars - - -

Table 1. Overview P2X and P2Y receptors, their ligands and used antagonists

102 ATP-induced IL-1β secretion is selectively impaired in microglia

10% v/v heat-inactivated FCS, 0.5 mM glutamax, 50 units/ml penicillin and 50 μg/ml streptomycin (all Gibco Life Technologies). After overnight incubation, unattached cells and myelin debris were removed by washing with PBS and attached cells were cultured in fresh medium supplemented 4 with 20 ng/ml (≥ 4 units/ml) macrophage-colony stimulating factor (M-CSF; PeproTech, London, UK). Primary bone marrow-derived macrophages were isolated by flushing the bone marrow from the femur (~4 cm) with PBS. The suspension was passed over a 100 μm nylon cell strainer (Corning Inc.) and subjected to gradient centrifugation using Lymphoprep (Axis Shield PoC AS, Oslo, Norway) according to manufacturer’s protocol. Cells were plated in tissue-culture treated 6- or 24-well plates (Corning Costar Europe) in RPMI (Roswell Park Memorial Institute) 1640 supplemented with 10% v/v heat-inactivated FCS, 2 mM glutamax, 50 units/ml penicillin, 50 μg/ ml streptomycin (all Gibco Life Technologies) and 20 ng/ml M-CSF (Peprotech). Primary blood CD14+-macrophages were isolated from heparinized blood using Lymphoprep (Axis Shield PoC) according to manufacturer’s protocol and leucosep separation tubes. Interphases were collected and CD14+ monocytes were isolated using CD14+ microbeads (Miltenyi Biotec, Bergisch Gladbach, Germany) and a magnetic activated cell sorting (MACS) separation system. CD14+ cells were plated in tissue-culture treated 6- or 24-well plates (Corning Costar Europe) in RPMI medium 1640 supplemented with 10% v/v heat-inactivated FCS, 2 mM glutamax, 50 units/ml penicillin, 50 μg/ml streptomycin (all Gibco Life Technologies), and 20 ng/ ml M-CSF (PeproTech). After isolation, all cells were kept in culture for 7-8 days without passaging and received fresh medium containing 20 ng/ml M-CSF (Peprotech) every 3-4 days. Cell cultures were synchronized for medium changes as well as for exposure to experimental stimuli. Different cell populations were analyzed (data not shown) for purity (there were no significant differences in % CD11b+ cells), morphological criteria indicative of activation and proliferation rate by Ki-67 immunostainings (there were no significant differences in % proliferating cells at timeof stimulation). No animals were sacrificed for the exclusive purpose of the initiation of primary cell cultures. Better use of experimental animals contributes to the priority 3Rs program of the Biomedical Primate Research Centre (Rijswijk, the Netherlands). Individual identification data of the animals are listed in Table 2.

Antibodies and reagents Monoclonal mouse-anti human CD39 antibodies (clone BU61: Ancell, Bayport, MN) were used in conjunction with anti-mouse-IgG-FITC antibodies (Jackson ImmunoResearch Laboratories, West Grove, PA). TLR4 agonist lipopolysaccharide (LPS; 100 ng/ml, unless indicated otherwise; from E. coli serotype O26:B6), adenosine triphosphate (ATP), adenosine diphosphate (ADP), uridine triphosphate (UTP), uridine diphosphate (UDP) and benzoyl-benzoyl-ATP (BzATP; all 5 mM unless indicated otherwise) were obtained from Sigma-Aldrich (Saint Louis, MO). Purinergic receptor antagonists (Table 1) used were NF449 (P2X1/5; 2.8 nM), MRS2279 (P2Y1; 0.5 μM), AR-C 118925XX (P2Y2; 1 μM), MRS2578 (P2Y6; 370 nM), NF340 (P2Y11; 724 nM), AR-C 66096 (P2Y12; 81 nM), MRS2211 (P2Y13; 11.8 nM; all from Tocris, Bristol, UK), 5-BDBD (P2X4; 50 μM) and

103 Chapter 4

A740003 (P2X7; 50 μM) and ectonucleotidase inhibitor ARL67156 (1 μM; all from Sigma Aldrich). All purinergic receptor antagonists were applied 15 min prior to addition of nucleotides. Concentrations used were based on previous studies (P2X4 and P2X7)34,46 or, if not used previously in studies on inflammasome activation, based on 10x50 IC values indicated by the manufacturer.

RNA isolation, cDNA synthesis, real-time Polymerase Chain Reactions (rtPCR), PCR and gelelectroforesis Total cellular RNA was isolated using the RNeasy minikit (Qiagen GmbH, Hilden, Germany) according to manufacturer’s protocol. Subsequently, 1 μg template mRNA was reverse transcribed into cDNA with the RevertAid First Strand cDNA synthesis kit (Thermo Fisher Scientific Inc, Waltham, MA) according to manufacturer’s protocol. Primer/probe combinations for rtPCRs were designed using the Universal Probe Library assay design center (Roche, Woerden, the Netherlands). rtPCRs were performed on the CFX96™ Real-time PCR detection system (Bio-rad Laboratories, Hercules, CA) using primer (ThermoFisher Scientific Inc) and probe (human Exiqon

Monkey ID Age Sex Weight origin Monkey ID Age Sex Weight origin nr. (y) (kg) nr. (y) (kg) 1DL 34 F 5.3 India R04070 10 F 7.1 Mix 2CL 24 F 9.0 India R05028 9 F 11.2 Mix 9056 24 F 9.8 India R05039 9 M 10.2 India 94036 18 F 6.1 India R05070 10 F 8.9 India 95026 9 F 11.5 India R05079 9 F 6.8 Mix 95060 19 F 6.8 India R06026 8 M 11.8 India 96024 17 M 13.1 India R06041 9 F 4.8 Mix 97013 17 F 10.5 India R06101 8 F 6.0 Mix 98007 17 F 9.7 India R06106 6 M 10.4 Mix 98024 17 F 10.7 India R07052 7 M 7.1 Mix 98036 17 F 13.6 India R07055 8 F 4.5 India 98039 16 F 7.5 India R07074 7 M 11.8 Mix R00035 15 F 8.6 Mix R07102 7 M 11.1 Mix R00065 14 F 9.3 Mix R08041 6 F 7.8 India R01079 14 F 8.3 Mix R08065 3 M 3.3 India R02052 11 F 7.3 India R08077 6 F 4.8 Myanmar R02091 9 M 11.6 India R09012 4 M 4.1 Myanmar R03022 12 F 11.8 Mix R09154 5 M 6.5 India R03057 9 M 12.5 India R98058 15 F 11.8 Mix R03061 8 F 4.5 India R99007 14 F 5.8 Mix R04027 9 F 4.3 Myanmar R11018 4 F 5.8 India R04052 10 M 14.2 Mix Ri202224 10 F 6.0 China R04053 10 F 6.8 Mix Ri204252 10 F 5.1 China R04067 9 F 10.6 Mix Ri303103 9 M 8.9 China

Table 2. Individual identification data of rhesus macaques, including age (y), gender (M: male, F: female), weight (kg) and origin.

104 ATP-induced IL-1β secretion is selectively impaired in microglia

probe library, Roche) combinations listed in Table 3, and iTaq Universal Probes Supermix (Bio- rad). Relative mRNA expression levels were determined by standardization to β-actin mRNA 47 levels using the Pfafll method . Fold changes in expression after stimulation with LPS were 4 calculated by dividing relative mRNA expression levels after stimulation by relative mRNA expression levels of unstimulated controls. PCR of the P2X7 splice variants on cDNA samples was performed using the Phusion Hot Start II DNA Polymerase kit and specific primers (both ThermoFisher Scientific Inc) previously described to detect both normal and truncated P2X7 splice variants (Table 3)48. PCR products were separated by gelelectroforesis on a 1.5% agarose gel and visualized by Midorigreen staining (Nippon Genetics Europe GmbH, Dueren, Germany) using a Chemidoc™ MP imaging system (Bio- rad Laboratories).

Cytokine analysis Sandwich ELISA kits for human IL-1β (R&D systems, Minneapolis, MN) and IL-6 (U-CyTech, Utrecht, the Netherlands) were used for quantification of IL-1β in cell culture supernatants according to manufacturer’s instructions.

Gene name UPL Forward primer (5’ --> 3’) Reverse primer (5’ --> 3’) amplicon length (nt) Probe # AP 27 acgaggcggtagagatgga ccacggtcagagtgtcttcc 75 β-actin 63 gcccagcacgatgaagat cgccgatccacacagagta 65 CD39 22 cagcaccaagagacacctgtt caaaggggtagttgctgagg 127 CD73 48 gaacgccctacgctacgat tggctcaatcagtccttctaca 76 PANX1 2 gcgcaggagatctcgatt cagcaatatgaatccacaaagg 92 P2X1 62 tctggaattggcatctttgg agtgtctcttgggcaggatg 76 P2X2 77 gcctcgtcaggctacaactt atcccgtaggccttgatga 86 P2X3 15 ggcctttacttctgtgggagt ttcttggccttgtattgatcg 90 P2X4 9 tggttaagaacaacatctggtatcc aaatgcacgacttgaggtagg 93 P2X5 1 tgtgagatctttgcctggtg tgacgtccatcacattgctc 148 P2X6 65 tgtggatagagaagcccatttc ccagctcactccacacagag 92 P2X7 21 gggtttatctcctccccttga cacttccacttttggataaaaca 61 P2X7 splice Normal: 581 - cggccacaactacaccacgag cagggctgacagcacttgcac variants Non-functional: 634 P2Y1 21 gagcggcatctccgtgta gcagagtcagcacgtacaaga 65 P2Y2 27 ccgcttcaacgaggacttc agacacagcccaagcacac 75 P2Y4 87 tccttttcctcacctgcatt gctacgaccaaccaaactgc 124 P2Y6 42 agctgtctttgctgccaca gggctgaggtcatagcaaac 60 P2Y11 87 agaggctgccttctgtcg gccgtccaccaactaagc 71 P2Y12 48 tccattcaaaattcttagtgatgc cggaggtaacttgacacacaaa 74 P2Y13 23 actgagtatcctcccaaaggtg cggtcaagaaaaccactgtgt 143 P2Y14 75 caacttcactgaaaagagacctca ggaggttcttagagcaagattca 128

Table 3. Overview of primer/probe combinations used for real-time qPCR and PCR. Overview of primer/probe combinations used for real-time qPCR, including sequences (5’ --> 3’) of forward and reverse primer, human Universal Probe Library number of corresponding probe, and amplicon length (nt). Abbreviations: AP: alkaline phosphatase, CD39: Cluster of Differentiation antigen 39, CD73: Cluster of Differentiation antigen 73, PANX1: pannexin-1.

105 Chapter 4

Statistics All data are depicted as means ± SD. Graphpad Prism 6 for Macintosch (Graphpad software, 2014, version 6.0e) and Canvas X Pro (Canvas X software Inc, 2015, version 16, build 2115) were used for graphical representations. Statistical analyses were performed using Microsoft Excel for Mac (Microsoft Coorporation, 2011, version 14.4.1) and the R statistical package (R Development Core Team, 2009, version 3.02).

Results

First, we characterized purinergic receptor mRNA expression profiles in primary microglia, bone marrow-derived macrophages (BMDM) and blood-derived CD14+ macrophages of different donors (CD14M, Figure 1A). All cell types expressed detectable levels of P2X1, P2X4, P2X5 and P2X7-encoding mRNA, whereas mRNA levels for P2X2, P2X3 and P2X6 were absent or below detection levels. Importantly, P2X7 expression levels were significantly lower in microglia than in both types of hematopoietic macrophages. In addition, all cell types expressed mRNA encoding P2Y1, P2Y2, P2Y6 and P2Y11-13, whereas P2Y4-encoding mRNA was absent or below detection levels. Furthermore, P2Y2 expression levels were significantly higher in CD14M than in microglia and BMDM, and P2Y13 mRNA expression levels were significantly lower in microglia than in BMDM. Interestingly, detectable levels of P2Y14-encoding mRNA were exclusively found in BMDM. As in vitro inflammasome activation is most often monitored in cells that have been primed with a Toll-like receptor (TLR) agonist26,49,50, we also analyzed mRNA expression levels after exposure to the TLR4 agonist LPS for 4 h and 16 h (Figure 1B and Table 4). Expression levels of P2X1, P2X5, P2X7, P2Y6, P2Y11, P2Y13 and P2Y14 were not significantly affected by LPS stimulation. Expression levels of P2Y1, P2Y2 and P2Y12 were decreased in all cell types after 4 h. Whereas P2Y1 and P2Y2 levels returned to baseline levels after 16 h of exposure to LPS, P2Y12 expression levels decreased even further. By contrast, expression levels of P2X4 and PANX1 were increased in all cell types after 4 h and increased even further after 16 h of exposure to LPS.

Next, we exposed LPS-primed cells to ATP, ADP, UTP or UDP and determined IL-1β secretion levels as a read-out for inflammasome activation. Whereas ATP induced IL-1β secretion in LPS- primed microglia and BMDM, none of the other nucleotides did Figure( 2A). Interestingly, levels of ATP-induced IL-1β were significantly lower in microglia than in BMDM of the same animals (Figure 2B). As other LPS-induced cytokines, e.g. IL-6, were secreted in comparable amounts (Figure 2C), it is unlikely that the observed differences were caused by differences in cell numbers.

Figure 1. mRNA expression profiles of purinergic receptors in primary rhesus microglia, BMDM and CD14M. (A). Basal mRNA expression levels of P2X and P2Y receptors in primary rhesus microglia, BMDM and CD14M. mRNA expression levels of genes of interest (GOI) are expressed relative to reference gene (β-actin) mRNA expression levels. * p < 0.05, ** p < 0.01; ANOVA with Tukey HSD correction.(B) . Fold change in relative mRNA expression levels of P2X and P2Y receptors after 4 h and 16 h exposure to LPS (100 ng/ml) in microglia, BMDM and CD14M relative to their unstimulated controls. Data are represented as mean fold change ± SD (n=5). # p < 0.05 in microglia, * p < 0.05 in BMDM, + p < 0.05 in CD14M; ANOVA with Tukey HSD correction.

106 ATP-induced IL-1β secretion is selectively impaired in microglia

107 Chapter 4 Direct comparison of LPS-induced LPS-induced of comparison Direct (C). Levels of secreted IL-1β by LPS-primed Direct comparison of (5 ATP-induced mM; 4 h) IL-1β secretion in LPS- (B). Levels of ATP-induced (5 mM; 4 h) IL-1β secretion by LPS-primed (100 ng/ml; (100 LPS-primed by secretion IL-1β h) 4 mM; (5 ATP-induced of Levels (D). Figure Figure 2. Inflammasome 0.001; < activationp *** extracellular 0.01, by < nucleotides p ** h). microglia in 4 mM; 5 (all and BMDM UDP and (A). UTP ADP, ATP, nucleotides extracellular to exposed BMDM and microglia h) ng/ml;4 (100 paired T tests with Bonferroni correctioncompared to LPS. primed (100 ng/ml; 4 h) microglia and BMDM. ** p < 0.01; paired T test with Bonferroni correction correction Bonferroni with test T paired 0.01; < p ** BMDM. and microglia h) ng/ml;4 (100 primed mM each). (5 nucleotides three all of combination a or mM) 5 (all UDP UTP, ADP, to exposure simultaneous after BMDM and microglia h) 4 ATP. to LPS + compared correction with Bonferroni T tests ** p < 0.01; paired (100 ng/ml; 4 h) IL-6 secretion in microglia and BMDM. and microglia in secretion IL-6 ng/ml;h) (100 4

108 ATP-induced IL-1β secretion is selectively impaired in microglia

As we reported recently that LPS-primed microglia secrete similar levels of IL-1β as BMDM in response to silica or MSU43, this suggests that ATP-induced IL-1β secretion was selectively impaired in microglia. 4 As ADP, UTP and UDP have been reported to modulate inflammasome activation induced by crystal particles33,34, we determined the effects of these extracellular nucleotides on ATP-induced IL-1β secretion Figure( 2D). In LPS-primed microglia none of these nucleotides, either alone or in combination, affected levels of ATP-induced IL-1β secretion. By contrast, in LPS-primed BMDM, the addition of ADP, UTP and UDP did reduce ATP-induced IL-1β secretion, an effect that was significant when they were added in combination. Whereas P2Y-mediated signaling canthus affect ATP-induced inflammasome activation in BMDM, this appears absent in microglia.

To determine whether the observed differences in IL-1β secretion levels between LPS-primed microglia and BMDM were due to differences in sensitivity to ATP, we exposed cells to increasing concentrations of extracellular ATP Figure( 3A). Both in LPS-primed microglia and BMDM, 2.5 mM ATP was sufficient to trigger detectable levels of IL-1β. Exposure to higher concentrations of ATP did not further increase IL-1β secretion levels in BMDM, while in microglia a maximum level of IL-1β secretion was induced by exposure to 5 mM ATP. Irrespective of the concentration used, levels of ATP-induced IL-1β were significantly lower in microglia than in BMDM. As we have previously demonstrated differences in the kinetics of LPS priming on the efficacy of NLRP3-triggered inflammasome activation between microglia and 43 BMDM , we further investigated the effects of different exposure times to LPS and to ATP on IL-1β secretion in microglia and BMDM. In line with previous studies on the N13 microglial cell line51, ATP-induced IL-1β secretion in both microglia and BMDM peaked after 6 h of exposure to LPSFigure ( 3B). Hereafter IL-1β secretion was lower, most probably due to negative regulation at the transcription level43. Varying exposure times to ATP revealed that in all tested cell types, IL-1β secretion increased with increasing exposure times for up to 2 h and then reached a plateau Figure( 3C). Again, levels of secreted IL-1β were consistently lower in microglia than in CD14M and BMDM. As differences in expression levels of ATP-converting enzymes can affect the availability of extracellular ATP52, this might underlie the observed differences between microglia and BMDM. We therefore assessed the expression levels of tissue non-specific alkaline phosphatase, CD39 and CD73-encoding mRNAs in microglia and BMDM (Figure 3D). Tissue non-specific alkaline phosphatase mRNA expression levels were absent or below detection levels in either cell type, whereas CD39 and CD73-encoding mRNAs were expressed in both microglia and BMDM. However, mRNA expression levels of both CD39 and CD73 were higher in BMDM than in microglia, a difference that was significant after 4 h of LPS priming. In line with these results, we observed lower expression levels of membrane-bound CD39 protein on microglia than on BMDM (Figure 3E). Furthermore, addition of an ectonucleotidase inhibitor did not affect ATP-induced IL-1β levels in LPS-primed microglia or BMDM (Figure 3F). Together, these results suggest that the impaired ATP-induced IL-1β secretion in microglia cannot be ascribed to differences in sensitivity, kinetics or to increased ATP processing as compared to BMDM.

109 Chapter 4

A. Microglia BMDM *** *** * 15000 *** ** 15000

10000 10000 1β (pg/ml)

- 5000 5000 L I

0 0 blank 0 mM 0.2 mM 1 mM 2.5 mM 5 mM 10 mM blank 0 mM 0.2 mM 1 mM 2.5 mM 5 mM 10 mM

LPS + [ATP] LPS + [ATP] B. C. 15000 8000 Microglia Microglia 10000 BMDM BMDM 6000 CD14M 5000 4000 1000 1β (pg/ml) - L I 500 2000

0 0 0 4 8 12 16 20 40 0 2 4 6 LPS priming (h) ATP stimulus (h)

D. CD39 CD73 1 1 Microglia 0.1 * 0.1 *** BMDM 0.01 0.01 0.001 0.001

GOI/ β-ACT 0.0001 0.0001 0.00001 0.00001 0.000001 0.000001 (-) 4h LPS (-) 4h LPS E.

F. Microglia BMDM 25000 20000 R07074 20000 R07052 15000 R06101 15000 R04070 10000 10000 1β (pg/ml) - L I 5000 5000

0 0 (-) ARL67156 (-) ARL67156

4h LPS + ATP 4h LPS + ATP

Figure 3. Impaired microglial ATP-induced IL-1β secretion cannot be attributed to differences in sensitivity, kinetics or enzymatic processing. (A). ATP-induced (indicated concentrations; 4 h) IL-1β secretion in LPS-primed (100 ng/ml; 4 h) microglia and BMDM. * p < 0.05, ** p < 0.01, *** p < 0.001; paired T tests with Bonferroni correction compared to LPS. (B). ATP-induced (5 mM; 4 h) IL-1β secretion in LPS-primed (100 ng/ml; indicated timepoints) microglia and BMDM. Data of one representative donor of at least 3 independent experiments are shown.(C) . ATP-induced (5 mM; indicated timepoints) IL-1β secretion in LPS-primed (100 ng/ml; 4 h) microglia and BMDM (n=3). (D). mRNA expression levels of CD39 and CD73 in unstimulated microglia and BMDM and after exposure to LPS (100 ng/ml; 4 h). mRNA expression levels of genes of interest (GOI) are expressed relative to reference gene (β-actin) mRNA expression levels. Data are represented as mean values. * p < 0.05, *** p < 0.001; paired T tests with Bonferroni correction compared to microglia. (E). CD39 staining (green fluorescent signal) in unstimulated and LPS-primed (100 ng/ml; 4 h) microglia and BMDM. Nuclei are counterstained with DAPI. Original magnifications 40x. Pictures of one representative donor of at least 3 independent experiments are shown. (F). ATP-induced (5 mM; 6 h) IL-1β secretion by LPS-primed (100 ng/ ml; 4 h) microglia and BMDM in the presence of ectonucleotidase inhibitor ARL67156 (1 μM; applied 15 min prior to ATP activation).

110 ATP-induced IL-1β secretion is selectively impaired in microglia

As ATP can bind various P2X and P2Y receptors (Table 1), we investigated the contribution of different P2X and P2Y receptors to ATP-induced IL-1β secretion by using antagonists. Exposure to P2X1/5 antagonist did not affect ATP-induced IL-1β secretion in LPS-primed microglia or BMDM 4 (Figure 4A). By contrast, in LPS-primed microglia P2X4 and P2X7 antagonists significantly reduced ATP-induced IL-1β secretion by 45% and 80%, respectively. In LPS-primed BMDM, the contribution of P2X7-mediated signaling was more important. Exposure to P2X4 and P2X7 antagonists significantly reduced ATP-induced IL-1β secretion by 27% and 98%, respectively. P2Y receptor- mediated signaling did not contribute to ATP-induced IL-1β secretion, neither in LPS-primed microglia nor in BMDM, as exposure to P2Y1, -2, -6, and -11-13 antagonists had no effect (Figure 4B).

Figure 4. Involvement of P2X and P2Y receptors in ATP-induced IL-1β secretion in microglia and BMDM. (A). Effect of P2X1/5 (NF-449; 2.8 nM), P2X4 (5-BDBD; 50 μM) and P2X7 (A740003; 50 μM; all applied 15 min prior to ATP activation) receptor antagonists on ATP-induced (5 mM; 4 h) IL-1β secretion in LPS-primed (100 ng/ml; 4 h) microglia and BMDM. IL-1β secretion is represented relative to corresponding DMSO or H2O controls (dotted line = 100%). DMSO, H2O or P2X antagonists alone did not induce IL-1β secretion in unprimed or LPS-primed microglia and BMDM. * p < 0.05, *** p < 0.001; paired T tests with Bonferroni correction compared to solvent controls. (B). Effect of exposure to P2Y1 (MRS2279; 0.5 μM), P2Y2 (AR-C 118925XX; 1 μM), P2Y6 (MRS2578; 370 nM), P2Y11 (NF340; 724 nM), P2Y12 (AR-C 66096; 81 nM) and P2Y13 receptor antagonists (MRS2211; 11.8 nM; all applied 15 min prior to ATP activation) on ATP-induced (5 mM; 4 h) IL-1β secretion in LPS-primed (100 ng/ml; 4 h) microglia and BMDM. IL-1β secretion is represented relative to corresponding DMSO or H2O controls (dotted line = 100%). DMSO, H2O or P2Y antagonists alone did not induce IL-1β secretion in unprimed or LPS-primed microglia and BMDM.

111 Chapter 4

Different splice variants of P2X7 have been described for humans, including a splice variant encoding a non-functional receptor48. Differential expression of such splice variants by microglia and BMDM could affect the outcome of P2X7-induced signaling. We therefore determined the mRNA expression pattern of full length P2X7 and its splice variant in microglia and BMDM by PCR (Figure 5A). Although we were able to detect both variants in human THP-1 macrophages and in rhesus macaque brain homogenate (BH), we exclusively detected mRNA encoding full length P2X7 in microglia and BMDM. To further analyze the involvement of P2X7 in IL-1β secretion, we exposed LPS-primed microglia and BMDM to the specific P2X7 agonist BzATP. In microglia, exposure to 2.5 and 5 mM BzATP induced significantly higher IL-1β secretion levels compared to exposure to equimolar amounts of ATP (Figure 5B). By contrast, in LPS-primed BMDM, exposure to 2.5 and 5 mM of either BzATP or ATP induced similar IL-1β secretion levels. The only difference found for BMDM was that exposure to 1 mM BzATP triggered detectable IL-1β secretion levels, whereas exposure to 1 mM ATP did not. These results demonstrate that ATP-induced IL-1β secretion is selectively impaired in microglia, as IL-1β secretion levels induced by exposure to 5 mM BzATP were comparable to those of BMDM. We confirmed the selectivity of BzATP for P2X7 by demonstrating that BzATP-induced IL-1β secretion was completely inhibited by antagonizing P2X7 in both LPS-primed microglia and BMDM, whereas antagonizing P2X4 had no effect Figure( 5C). To address the relative contributions of ATP and BzATP to P2X7-induced IL-1β secretion, we exposed LPS-primed microglia and BMDM to different concentrations of ATP and BzATP, either alone or in combinationFigure ( 5D). In LPS- primed BMDM, the levels of secreted IL-1β were comparable in response to different concentrations of ATP (2.5-5 mM), BzATP (1.25-5 mM) or combinations of both. By contrast, in LPS-primed microglia we observed increasing levels of IL-1β secretion in response to increasing levels of ATP or BzATP. Furthermore, we observed a significant synergistic effect when LPS-primed microglia were exposed to 1.25 mM BzATP in combination with 1.25-5 mM ATP or exposed to 2.5 mM BzATP in combination with 2.5 mM ATP Table( 5).

Discussion

Here we report that ATP-induced IL-1β secretion in microglia is selectively impaired when compared to hematopoietic macrophages. In BMDM, ATP-induced IL-1β secretion was solely dependent on P2X7 signaling. Antagonizing P2X7 completely abrogated ATP-induced IL-1β secretion and similar levels of secreted IL-1β were observed when BMDM were stimulated with equimolar amounts of ATP or the selective P2X7 agonist BzATP. Furthermore, simultaneous exposure to ATP and BzATP did not yield synergistic effects, implicating that both compounds signaled via the same receptor. In microglia, the ATP-induced response was only partially dependent on P2X7 signaling. Although P2X7 was clearly involved in ATP-induced IL-1β secretion, antagonizing P2X7 did not completely inhibit IL-1β secretion. Furthermore, exposure of microglia to BzATP triggered the secretion of much higher amounts of IL-1β than equimolar amounts of ATP did. Finally, exposure of microglia to suboptimal concentrations of both ATP and BzATP had a synergistic effect on IL-1β secretion.

112 ATP-induced IL-1β secretion is selectively impaired in microglia

R03061 R08065 A. THP-1 BH Microglia BMDM Microglia BMDM 618 nt 534 nt 4

B. Microglia BMDM * ** * 25000 25000 20000 20000 15000 15000

10000 10000 1β (pg/ml) - L I 5000 5000

0 0 P P P P P P P P AT P AT P AT P AT P AT P AT P AT P AT P BzA T BzA T BzA T BzA T BzA T BzA T BzA T BzA T 0.2 mM 1 mM 2.5 mM 5 mM 0.2 mM 1 mM 2.5 mM 5 mM

C. ol r 150 *** *** 150 *** *** on t on i e t en t c r

v 100 100 e c o l s 1β s 50 50 ed t o I L - % pa r o m

c 0 0 P2X4 P2X7 P2X4+7 P2X4 P2X7 P2X4+7

4h LPS + BzATP 4h LPS + BzATP

Figure 5. Different involvement of P2X4 and P2X7 in ATP-induced IL-1β secretion in microglia andBMDM. (A). mRNA expression of normal (581 nt) and non-functional (634 nt) P2X7 splice variants in PMA-primed (100 μM; 3 h) human THP-1 cells, rhesus macaque brain homogenate (BH), and unstimulated or LPS-primed (100 ng/ml; 4 h) microglia and BMDM of two different rhesus macaques (R03061 and R08065).(B) . ATP- and BzATP-induced (indicated concentrations; 4 h) IL-1β secretion in LPS-primed (100 ng/ml; 4 h) microglia and BMDM. * p < 0.05, *** p < 0.001; paired T tests with Bonferroni correction compared to LPS + ATP. (C). Effect of P2X4 (5-BDBD; 50 μM) and P2X7 antagonists (A740003; 50 μM; applied 15 min prior to ATP activation) on BzATP-induced (5 mM; 4 h) IL-1β secretion in LPS-primed (100 ng/ml; 4 h) microglia and BMDM. IL-1β secretion is represented relative to corresponding DMSO controls (dotted line = 100%). DMSO or P2X antagonists alone did not induce IL-1β secretion in unprimed or LPS- primed microglia and BMDM. *** p < 0.001; paired T tests with Bonferroni correction compared to solvent controls. (D). IL-1β secretion in LPS-primed (100 ng/ml; 4 h) microglia and BMDM exposed to various combinations of ATP and BzATP (indicated concentrations; 4 h).

113 Chapter 4

Stimulus Mean SD Statistic difference synergy ATP 1.25 mM 317.6 307.6 n/a ATP 2.5 mM 478.9 381.6 n/a ATP 5 mM 2254.6 1115.7 n/a BzATP 1.25 mM 1375.1 1319.6 n/a BzATP 1.25 mM + ATP 1.25 mM 5196.5 3107.5 * BzATP 1.25 mM + ATP 2.5 mM 6379.6 2963.5 ** BzATP 1.25 mM + ATP 5 mM 5809.1 2065.0 ** BzATP 2.5 mM 5319.3 1313.5 n/a BzATP 2.5 mM + ATP 1.25 mM 7961.0 4453.5 p>0.05 BzATP 2.5 mM + ATP 2.5 mM 10070.2 3746.6 * BzATP 2.5 mM + ATP 5 mM 7244.6 2768.2 p>0.05 BzATP 5 mM 8445.4 7252.8 n/a BzATP 5 mM + ATP 1.25 mM 9507.0 7132.6 p>0.05 BzATP 5 mM + ATP 2.5 mM 8161.4 2731.5 p>0.05 BzATP 5 mM +ATP 5 mM 8399.2 3395.7 p>0.05

Tabel 5. Overview of IL-1β secretion by LPS-primed microglia exposed to different concentrations of ATP and BzATP, either alone or in combination. Statistical analysis of synergistic effect was performed by comparison of IL-1β secretion by microglia exposed to the different concentrations ATP and BzATP simultaneously with cumulative IL-1β secretion of microglia exposed to corresponding concentrations of ATP and BzATP separately. n/a: not applicable * p < 0.05, ** p < 0.01; paired T tests with Bonferroni correction.

We propose that our results are at least in part attributable to low P2X7 expression levels on microglia. P2X7-encoding mRNA levels were significantly lower in microglia than in hematopoietic macrophages. P2X7 expression is extensively regulated by amongst others transcription factors, epigenetic mechanisms and several miRNAs53. Which of these regulatory mechanisms underlies the observed differences in microglia and hematopoietic macrophages remains to be investigated. Previous studies demonstrated that a 10-fold reduction of rat P2X7 expression levels resulted in about 50% reduction in maximum currents evoked by ATP or BzATP54. As BzATP is a more potent agonist for P2X7 compared to the partial natural agonist ATP54-58, this can explain the higher levels of secreted IL-1β by microglia in response to BzATP when compared to ATP. In line with this idea are our data showing that exposure of BMDM to 1 mM of BzATP triggered IL-1β secretion, while exposure to 1 mM of ATP was not sufficient to do so. When P2X7 expression levels are too low, ATP-induced P2X7-mediated signaling might be insufficiently strong to trigger IL-1β secretion. This may be overcome by enhancing the signal with a stronger agonist such as BzATP, or by signaling via other receptors. Recent studies demonstrate that P2X4-mediated signaling can enhance P2X7-induced inflammasome activation in macrophages by increasingCa 2+ influx andthe production of reactive oxygen species and by suppression of autophagy30-32. Interestingly, antagonizing P2X4 reduced IL-1β secretion more effectively in microglia than in BMDM, corroborating a more prominent role for P2X4 in microglia. However, even antagonizing both P2X4 and P2X7 did not completely inhibit ATP-induced IL-1β secretion in microglia, indicating that yet other ATP receptors may play a role. As our experiments using other P2X or P2Y antagonists were ineffective in inhibiting IL-1β secretion, such a receptor

114 ATP-induced IL-1β secretion is selectively impaired in microglia

would be novel. Alternatively, ATP may modulate IL-1β secretion by directly affecting intracellular processes. At the used concentrations, extracellular ATP (MW ~507) might enter the intracellular 59 compartment via the 900 Da pore that is created by P2X7 . Whether this indeed happens in 4 microglia remains to be determined. In line with other studies19,22,29,51,60, we detected IL-1β secretion in microglia and macrophages in response to extracellular ATP at millimolar concentrations only. Although this is high, such concentrations are physiologically relevant. During inflammation, purines are released into the extracellular space either actively by apoptotic and inflammatory cells or passively by damaged or necrotic cells17-19. ATP is present at a concentration of 3-10 mM in the cytosol of most cells and can be released in large amounts following plasma membrane damage or acute cell death19,61-63. In addition, up to 15% of total cellular ATP can be released by inflammatory cells via non-lytic pathways51,64. Indeed, studies on extracellular ATP levels demonstrate low to high micromolar concentrations at sites of inflammation, tissue trauma or intensive cell stimulation65. As these levels refer to the average concentration in extracellular space, much higher levels of ATP can be reached in the vicinity of the plasma membrane or at sites of close cell-to-cell contact66-68. Microglia are derived from a distinct progenitor than hematopoietic macrophages i.e. primordial progenitors that seed the CNS during embryonic development35,69,70. Throughout life microglia are maintained by local self-renewal without replenishment from hematopoietic progenitors, and they form a distinct population from circulating blood monocytes and hematopoietic macrophages35,71,72. The differences between microglia and hematopoietic macrophages we report here may be a reflection of adaptations to the CNS microenvironment. As ATP is an important modulator of neuronal activity, microglia are likely transiently exposed to bursts of extracellular ATP in the CNS microenvironment73. ATP is stored at high concentrations (up to 200 mM) in neuronal synaptic vesicles3,61,63, which can be released into the synaptic cleft by exocytosis15. In addition, astrocytes can release ATP via connexin channels and vesicular release to modulate synaptic transmission7,74-76. Whether frequent exposure to ATP or to other environmental cues, such as TGFβ or cell-cell interactions with neurons36,77, underlie the here- described reduced expression levels of P2X7 warrants further investigation. Together, our results show that ATP-induced IL-1β secretion is selectively impaired in microglia. As recent studies demonstrate that microglia and infiltrating macrophages play different roles during neuroinflammation78, these cell-type specific differences may in the future be exploitable to develop therapeutic strategies that more specifically target either microglia or hematopoietic macrophages.

Acknowledgements

This work was financially supported by the Dutch MS Research Foundation (MS12-805). The authors thank I. Kondova, T. Haaksma and A. ‘t Jong for technical assistance. We thank E. Remarque for assistance with the statistical analyses, H. van Westbroek and F. van Hassel for assistance with graphical representations, and R. Bontrop, J. van Noort and R. Huizinga for critically reading the manuscript.

115 Chapter 4

References

1 Hanamsagar, R., Torres, V. & Kielian, T. Inflammasome activation and IL-1beta/IL-18 processing are influenced by distinct pathways in microglia. J Neurochem 119, 736-748, doi:10.1111/j.1471-4159.2011.07481.x (2011). 2 Lazarowski, E. R., Boucher, R. C. & Harden, T. K. Mechanisms of release of nucleotides and integration of their action as P2X- and P2Y-receptor activating molecules.Mol Pharmacol 64, 785-795, doi:10.1124/mol.64.4.785 (2003).

3 Zimmermann, H. Signalling via ATP in the nervous system. Trends in neurosciences 17, 420-426 (1994).

4 Abbracchio, M. P. et al. International Union of Pharmacology LVIII: update on the P2Y G protein-coupled nucleotide receptors: from molecular mechanisms and pathophysiology to therapy. Pharmacol Rev 58, 281-341, doi:10.1124/pr.58.3.3 (2006).

5 Khakh, B. S. et al. International union of pharmacology. XXIV. Current status of the nomenclature and properties of P2X receptors and their subunits. Pharmacol Rev 53, 107-118 (2001).

6 Agresti, C. et al. Metabotropic P2 receptor activation regulates oligodendrocyte progenitor migration and development.Glia 50, 132-144, doi:10.1002/glia.20160 (2005).

7 Fields, R. D. & Burnstock, G. Purinergic signalling in neuron-glia interactions.Nat Rev Neurosci 7, 423-436, doi:10.1038/nrn1928 (2006).

8 Franke, H., Verkhratsky, A., Burnstock, G. & Illes, P. Pathophysiology of astroglial purinergic signalling. Purinergic Signal 8, 629-657, doi:10.1007/s11302-012-9300-0 (2012).

9 Koizumi, S., Ohsawa, K., Inoue, K. & Kohsaka, S. Purinergic receptors in microglia: Functional modal shifts of microglia mediated by P2 and P1 receptors. Glia 61, 47-54, doi:10.1002/glia.22358 (2013).

10 Weisman, G. A. et al. Neuroprotective roles of the P2Y(2) receptor.Purinergic signalling 8, 559-578, doi:10.1007/s11302-012-9307- 6 (2012).

11 Fields, R. D. & Stevens, B. ATP: an extracellular signaling molecule between neurons and glia. Trends in neurosciences 23, 625-633 (2000).

12 Fields, R. D. & Stevens-Graham, B. New insights into neuron-glia communication.Science 298, 556-562, doi:10.1126/ science.298.5593.556 (2002).

13 Grimm, I., Ullsperger, S. N. & Zimmermann, H. Nucleotides and epidermal growth factor induce parallel cytoskeletal rearrangements and migration in cultured adult murine neural stem cells.Acta Physiol (Oxf) 199, 181-189, doi:10.1111/j.1748- 1716.2010.02092.x (2010).

14 Hogg, R. C. et al. Functional maturation of isolated neural progenitor cells from the adult rat hippocampus.Eur J Neurosci 19, 2410-2420, doi:10.1111/j.0953-816X.2004.03346.x (2004).

15 Richler, E., Chaumont, S., Shigetomi, E., Sagasti, A. & Khakh, B. S. Tracking transmitter-gated P2X cation channel activation in vitro and in vivo. Nat Methods 5, 87-93, doi:10.1038/nmeth1144 (2008).

16 Simard, M., Arcuino, G., Takano, T., Liu, Q. S. & Nedergaard, M. Signaling at the gliovascular interface. The Journal of neuroscience : the official journal of the Society for Neuroscience 23, 9254-9262 (2003).

17 Franke, H., Krugel, U. & Illes, P. P2 receptors and neuronal injury. Pflugers Arch 452, 622-644, doi:10.1007/s00424-006-0071-8 (2006).

18 Idzko, M., Ferrari, D. & Eltzschig, H. K. Nucleotide signalling during inflammation.Nature 509, 310-317, doi:10.1038/nature13085 (2014).

19 Ferrari, D., Chiozzi, P., Falzoni, S., Hanau, S. & Di Virgilio, F. Purinergic modulation of interleukin-1 beta release from microglial cells stimulated with bacterial endotoxin.J Exp Med 185, 579-582 (1997).

20 Davalos, D. et al. ATP mediates rapid microglial response to local brain injury in vivo. Nature neuroscience 8, 752-758, doi:10.1038/ nn1472 (2005).

21 Nimmerjahn, A., Kirchhoff, F. & Helmchen, F. Resting microglial cells are highly dynamic surveillants of brain parenchyma in vivo. Science 308, 1314-1318, doi:10.1126/science.1110647 (2005).

22 Halle, A. et al. The NALP3 inflammasome is involved in the innate immune response to amyloid-beta.Nat Immunol 9, 857-865, doi:ni.1636 [pii]10.1038/ni.1636 (2008).

23 Takenouchi, T., Sugama, S., Iwamaru, Y., Hashimoto, M. & Kitani, H. Modulation of the ATP-lnduced release and processing of IL-1beta in microglial cells. Crit Rev Immunol 29, 335-345 (2009).

24 Iyer, S. S. et al. Necrotic cells trigger a sterile inflammatory response through the Nlrp3 inflammasome.Proceedings of the National Academy of Sciences of the United States of America 106, 20388-20393, doi:10.1073/pnas.0908698106 (2009).

25 Sanz, J. M. et al. Activation of microglia by amyloid {beta} requires P2X7 receptor expression.Journal of immunology 182, 4378-4385, doi:10.4049/jimmunol.0803612 (2009).

116 ATP-induced IL-1β secretion is selectively impaired in microglia

26 Martinon, F., Burns, K. & Tschopp, J. The inflammasome: a molecular platform triggering activation of inflammatory caspases and processing of proIL-beta. Mol Cell 10, 417-426, doi:S1097276502005993 [pii] (2002).

27 Martinon, F., Mayor, A. & Tschopp, J. The inflammasomes: guardians of the body.Annu Rev Immunol 27, 229-265, doi:10.1146/ annurev.immunol.021908.132715 (2009).

28 Mariathasan, S. et al. Cryopyrin activates the inflammasome in response to toxins and ATP.Nature 440, 228-232, doi:nature04515 4 [pii]10.1038/nature04515 (2006).

29 Munoz-Planillo, R. et al. K(+) efflux is the common trigger of NLRP3 inflammasome activation by bacterial toxins and particulate matter.Immunity 38, 1142-1153, doi:10.1016/j.immuni.2013.05.016 (2013).

30 Kawano, A. et al. Regulation of P2X7-dependent inflammatory functions by P2X4 receptor in mouse macrophages.Biochemical and biophysical research communications 420, 102-107, doi:10.1016/j.bbrc.2012.02.122 (2012).

31 Kawano, A. et al. Involvement of P2X4 receptor in P2X7 receptor-dependent cell death of mouse macrophages. Biochemical and biophysical research communications 419, 374-380, doi:10.1016/j.bbrc.2012.01.156 (2012).

32 Sakaki, H. et al. P2X4 receptor regulates P2X7 receptor-dependent IL-1beta and IL-18 release in mouse bone marrow-derived dendritic cells.Biochemical and biophysical research communications 432, 406-411, doi:10.1016/j.bbrc.2013.01.135 (2013).

33 Baron, L. et al. The NLRP3 inflammasome is activated by nanoparticles through ATP, ADP and adenosine.Cell Death Dis 6, e1629, doi:10.1038/cddis.2014.576 (2015).

34 Riteau, N. et al. ATP release and purinergic signaling: a common pathway for particle-mediated inflammasome activation.Cell Death Dis 3, e403, doi:10.1038/cddis.2012.144 (2012).

35 Ginhoux, F. et al. Fate mapping analysis reveals that adult microglia derive from primitive macrophages.Science 330, 841-845, doi:10.1126/science.1194637 (2010).

36 Butovsky, O. et al. Identification of a unique TGF-beta-dependent molecular and functional signature in microglia.Nat Neurosci 17, 131-143, doi:10.1038/nn.3599 (2014).

37 Lavin, Y. et al. Tissue-resident macrophage enhancer landscapes are shaped by the local microenvironment. Cell 159, 1312-1326, doi:10.1016/j.cell.2014.11.018 (2014).

38 Gosselin, D. et al. Environment drives selection and function of enhancers controlling tissue-specific macrophage identities.Cell 159, 1327-1340, doi:10.1016/j.cell.2014.11.023 (2014). 39 Cavaliere, F., Dinkel, K. & Reymann, K. Microglia response and P2 receptor participation in oxygen/glucose deprivation-induced cortical damage.Neuroscience 136, 615-623, doi:10.1016/j.neuroscience.2005.04.038 (2005). 40 Crain, J. M., Nikodemova, M. & Watters, J. J. Expression of P2 nucleotide receptors varies with age and sex in murine brain microglia. Journal of neuroinflammation 6, 24, doi:10.1186/1742-2094-6-24 (2009).

41 Inoue, K. Microglial activation by purines and pyrimidines.Glia 40, 156-163, doi:10.1002/glia.10150 (2002).

42 Morioka, N. et al. The activation of P2Y6 receptor in cultured spinal microglia induces the production of CCL2 through the MAP kinases-NF-kappaB pathway. Neuropharmacology 75, 116-125, doi:10.1016/j.neuropharm.2013.07.017 (2013).

43 Burm, S. M. et al. Inflammasome-Induced IL-1beta Secretion in Microglia Is Characterized by Delayed Kinetics and Is Only Partially Dependent on Inflammatory Caspases.The Journal of neuroscience : the official journal of the Society for Neuroscience 35, 678- 687, doi:10.1523/JNEUROSCI.2510-14.2015 (2015).

44 van der Putten, C. et al. Differential expression of adenosine A3 receptors controls adenosine A2A receptor-mediated inhibition of TLR responses in microglia. Journal of immunology 182, 7603-7612, doi:10.4049/jimmunol.0803383 (2009).

45 Zuiderwijk-Sick, E. A. et al. Differentiation of primary adult microglia alters their response to TLR8-mediated activation but not their capacity as APC. Glia 55, 1589-1600, doi:10.1002/glia.20572 (2007).

46 Hung, S. C. et al. P2X4 assembles with P2X7 and pannexin-1 in gingival epithelial cells and modulates ATP-induced reactive oxygen species production and inflammasome activation.PloS one 8, e70210, doi:10.1371/journal.pone.0070210 (2013).

47 Pfaffl, M. W. A new mathematical model for relative quantification in real-time NucleicRT-PCR. acids research 29, e45 (2001). 48 Cheewatrakoolpong, B., Gilchrest, H., Anthes, J. C. & Greenfeder, S. Identification and characterization of splice variants of the human P2X7 ATP channel. Biochemical and biophysical research communications 332, 17-27, doi:10.1016/j.bbrc.2005.04.087 (2005).

49 Zhou, R., Yazdi, A. S., Menu, P. & Tschopp, J. A role for mitochondria in NLRP3 inflammasome activation.Nature 469, 221-225, doi:10.1038/nature09663 (2011).

50 Netea, M. G. et al. Differential requirement for the activation of the inflammasome for processing and release of IL-1beta in monocytes and macrophages. Blood 113, 2324-2335, doi:10.1182/blood-2008-03-146720 (2009).

51 Sanz, J. M. & Di Virgilio, F. Kinetics and mechanism of ATP-dependent IL-1 beta release from microglial cells.Journal of immunology 164, 4893-4898 (2000).

52 Zimmermann, H., Zebisch, M. & Strater, N. Cellular function and molecular structure of ecto-nucleotidases.Purinergic Signal 8, 437-502, doi:10.1007/s11302-012-9309-4 (2012).

117 Chapter 4

53 Gorodeski, G. I. P2X7-mediated chemoprevention of epithelial cancers.Expert Opin Ther Targets 13, 1313-1332, doi:10.1517/14728220903277249 (2009).

54 Young, M. T., Pelegrin, P. & Surprenant, A. Amino acid residues in the P2X7 receptor that mediate differential sensitivity to ATP and BzATP. Mol Pharmacol 71, 92-100, doi:10.1124/mol.106.030163 (2007). 55 Hibell, A. D., Kidd, E. J., Chessell, I. P., Humphrey, P. P. & Michel, A. D. Apparent species differences in the kinetic properties of P2X(7) receptors. Br J Pharmacol 130, 167-173, doi:10.1038/sj.bjp.0703302 (2000).

56 North, R. A. Molecular physiology of P2X receptors. Physiol Rev 82, 1013-1067, doi:10.1152/physrev.00015.2002 (2002). 57 Visentin, S., Renzi, M., Frank, C., Greco, A. & Levi, G. Two different ionotropic receptors are activated by ATP in rat microglia. J Physiol 519 Pt 3, 723-736 (1999). 58 Wiley, J. S., Gargett, C. E., Zhang, W., Snook, M. B. & Jamieson, G. P. Partial agonists and antagonists reveal a second permeability state of human lymphocyte P2Z/P2X7 channel. Am J Physiol 275, C1224-1231 (1998). 59 Browne, L. E., Compan, V., Bragg, L. & North, R. A. P2X7 receptor channels allow direct permeation of nanometer-sized dyes. The Journal of neuroscience : the official journal of the Society for Neuroscience 33, 3557-3566, doi:10.1523/ JNEUROSCI.2235-12.2013 (2013).

60 Ferrari, D. et al. Mouse microglial cells express a plasma membrane pore gated by extracellular ATP. Journal of immunology 156, 1531-1539 (1996).

61 Burnstock, G. Physiology and pathophysiology of purinergic neurotransmission. Physiol Rev 87, 659-797, doi:10.1152/ physrev.00043.2006 (2007).

62 Fiebich, B. L., Akter, S. & Akundi, R. S. The two-hit hypothesis for neuroinflammation: role of exogenous ATP in modulating inflammation in the brain.Front Cell Neurosci 8, 260, doi:10.3389/fncel.2014.00260 (2014).

63 Sperlagh, B. & Sylvester Vizi, E. Neuronal synthesis, storage and release of ATP. Seminars in the neurosciences 8, 175-186 (1996). 64 Filippini, A., Taffs, R. E. & Sitkovsky, M. V. Extracellular ATP in T-lymphocyte activation: possible role in effector functions. Proceedings of the National Academy of Sciences of the United States of America 87, 8267-8271 (1990).

65 Wang, X. et al. P2X7 receptor inhibition improves recovery after spinal cord injury.Nat Med 10, 821-827, doi:10.1038/nm1082 (2004).

66 Beigi, R., Kobatake, E., Aizawa, M. & Dubyak, G. R. Detection of local ATP release from activated platelets using cell surface-attached firefly luciferase.Am J Physiol 276, C267-278 (1999). 67 Pellegatti, P., Falzoni, S., Pinton, P., Rizzuto, R. & Di Virgilio, F. A novel recombinant plasma membrane-targeted luciferase reveals a new pathway for ATP secretion.Mol Biol Cell 16, 3659-3665, doi:10.1091/mbc.E05-03-0222 (2005).

68 Pellegatti, P. et al. Increased level of extracellular ATP at tumor sites: in vivo imaging with plasma membrane luciferase. PloS one 3, e2599, doi:10.1371/journal.pone.0002599 (2008).

69 Kierdorf, K. et al. Microglia emerge from erythromyeloid precursors via Pu.1- and Irf8-dependent pathways. Nature neuroscience 16, 273-280, doi:10.1038/nn.3318 (2013).

70 Schulz, C. et al. A lineage of myeloid cells independent of Myb and hematopoietic stem cells.Science 336, 86-90, doi:10.1126/ science.1219179 (2012).

71 Ajami, B., Bennett, J. L., Krieger, C., Tetzlaff, W. & Rossi, F. M. Local self-renewal can sustain CNS microglia maintenance and function throughout adult life. Nature neuroscience 10, 1538-1543, doi:10.1038/nn2014 (2007).

72 Gomez Perdiguero, E. et al. Tissue-resident macrophages originate from yolk-sac-derived erythro-myeloid progenitors. Nature 518, 547-551, doi:10.1038/nature13989 http://www.nature.com/nature/journal/v518/n7540/abs/nature13989.html - supplementary-information (2015).

73 Del Puerto, A., Wandosell, F. & Garrido, J. J. Neuronal and glial purinergic receptors functions in neuron development and brain disease. Front Cell Neurosci 7, 197, doi:10.3389/fncel.2013.00197 (2013).

74 Coco, S. et al. Storage and release of ATP from astrocytes in culture. The Journal of biological chemistry 278, 1354-1362, doi:10.1074/jbc.M209454200 (2003).

75 Montana, V., Malarkey, E. B., Verderio, C., Matteoli, M. & Parpura, V. Vesicular transmitter release from astrocytes.Glia 54, 700-715, doi:10.1002/glia.20367 (2006).

76 Stout, C. E., Costantin, J. L., Naus, C. C. & Charles, A. C. Intercellular calcium signaling in astrocytes via ATP release through connexin hemichannels. The Journal of biological chemistry 277, 10482-10488, doi:10.1074/jbc.M109902200 (2002).

77 Ransohoff, R. M. & Cardona, A. E. The myeloid cells of the central nervous system parenchyma.Nature 468, 253-262, doi:10.1038/ nature09615 (2010).

78 Yamasaki, R. et al. Differential roles of microglia and monocytes in the inflamed central nervous system.J Exp Med 211, 1533-1549, doi:10.1084/jem.20132477 (2014).

118

CHAPTER 5

Alternative methods for the use of non-human primates in biomedical research

Saskia M. Burm1, Jan-Bas Prins2, Jan Langermans3 and Jeffrey J. Bajramovic1

1Alternatives Unit, Biomedical Primate Research Centre, Rijswijk, the Netherlands 2Central Animal Facility, Leiden University Medical Centre, Leiden, the Netherlands 3Animal Science Department, Biomedical Primate Research Centre, Rijswijk, the Netherlands

ALTEX. 2014. 31(4):520-9. Chapter 5

Summary

The experimental use of non-human primates (NHP) in Europe is tightly regulated and is only permitted when there are no alternatives available. As a result, NHP are most often used in late, pre-clinical phases of biomedical research. Although the impetus for scientists, politicians and the general public to replace, reduce and refine NHP in biomedical research is strong, the development of 3Rs technology for NHP poses specific challenges. In February 2014 a workshop on “Alternative methods for the use of NHP in biomedical research” was organized within the international exchange program of EUPRIM-Net II, a European infrastructure initiative that links biomedical primate research centers. The workshop included lectures by key scientists in the field of alternatives as well asby experts from governmental and non-governmental organizations. Furthermore, parallel sessions were organized to stimulate discussion on the challenges of advancing the use of alternative methods for NHP. Subgroups voted on four statements and together composed a list with opportunities and priorities. This report summarizes the presentations that were held, the content of the discussion sessions and concludes with recommendations on 3Rs development for NHP specifically. These include technical, conceptual as well as political topics.

Figure 1. Monument for the monkey by Arie Teeuwisse (1994). This statue, placed at the campus of the Dutch National Institute of Public Health and the Environment, commemorates the contribution of monkeys tothe production of polio vaccines in the past.

122 Alternative methods for the use of non-human primates in biomedical research

Introduction

Because of their close resemblance to humans, non-human primates (NHP) are employed in biomedical research to study particular aspects of human biology and disease. Like humans, NHP are complex social species and their welfare, housing and care taking is demanding and requires specific expertise and facilities. Both society and biomedical researchers wish to limit the 5 numbers of NHP used for experimental purposes to an absolute minimum, with a maximum effort to ensure animal welfare and good science. Important guidelines for that quest are the three Rs of Replacement, Reduction and Refinement. In spring 2014 a workshop on “Alternative methods for the use of NHP in biomedical research” was held at the Biomedical Primate Research Centre (BPRC) in Rijswijk, the Netherlands. It was organized under the umbrella of the international exchange program of EUPRIM-Net II (www.euprim-net.eu) and served four main purposes: i) sharing information in order to accommodate, validate and spread the use of alternative methods in NHP research; ii) discussing the potential and the challenges for advancing the use of alternative methods; iii) identifying obstacles hampering the development of alternatives in NHP research; iv) providing transparency to the general public and other stakeholders on the status of alternative methodology in primate research. The workshop included lectures by key researchers in the field of alternatives discussing progress made on development and implementation of the 3Rs in NHP research. Furthermore, experts from the European Commission and the Dutch government presented the most recent advances on the legislation surrounding NHP research and the 3Rs. Representatives from non- governmental organizations, including animal welfare organizations, legislators, regulators and scientists discussed how the 3Rs in NHP research should be advanced.

The workshop opened with a lecture by Coenraad Hendriksen (Utrecht University and Intravacc) highlighting 3R successes in the past as well as stressing the long and winding road ahead for 3Rs development for NHP. After introducing the concept of the 3Rs with practical examples, Hendriksen specified that the development of alternatives for NHPs should be considered in the context of the research goals for which NHP are being used. In Europe, 67% of NHP are used in safety and efficacy regulatory testing, about 15% in R&D for medical products and devices and another 15% in fundamental research. Each of these purposes comes with different opportunities and obstacles for the development of 3Rs methodology, which were discussed. This was illustrated by a success story of NHP replacement for the production of inactivated polio vaccines. In 1960 about 4500 NHP were used annually in the Netherlands for this purpose (Figure 1). By 1984 this number was brought down to not more than 30 per year as the result of the sequential development of new technology and methodology. Although illustrative for the potential of 3Rs methodology, it took another 23 years to replace these last 30 monkeys illustrating that the ‘easier’ replacement and reduction targets were fulfilled and that in particular the last steps required considerable efforts. Hendriksen continued by listing several important dilemmas that pertain in particular to development of 3Rs methodology for NHP. Is replacement by a ‘lower’ animal species really 3Rs methodology? If European restrictions on NHP research become too tight, do we not stimulate outsourcing of NHP research to countries with less historical concern for animal welfare? He stated that the ultimate objective to replace

123 Chapter 5

all NHP in biomedical research will not be easy to achieve. As long as society as a whole is risk- aversive and not willing to accept the potential negative consequences of denouncing all animal experiments, replacement of NHP research might be the most arduous task to achieve. The focus should therefore be on reduction where possible, and on refinement. Refinement should not be considered as the Cinderella of the 3Rs and full attention should be given to the diversity in refinement opportunities, as they might be easiest achievable with a relatively high impact on animal welfare. Friedhelm Vogel (European Federation of Pharmaceutical Industries and Associations (EFPIA); Covance R&D Laboratories) focused on the role of the 3Rs and NHP in drug development and translational research. He stressed the important role that animal research has had in the process of medicine development, highlighting the role of NHP in particular with a list of examples. There is still an urgent need for new therapies as currently only 10.000 of the known 30.000 diseases can be treated and there is good potential for e.g. monoclonal antibody-based therapies. Although the use of animals forms a major part of much scientific and medical research, success seen in animal studies has not always translated to the clinic. Many potential drugs fail due to lack of efficacy in humans or concerns about their safety. The likelihood of approval, as assessed after clinical phase 1 development, has declined over the past years1 and needs to be improved by designing more predictive in– vivo– screening methods including identification and application of appropriate biomarkers. Results from another survey2 support the value of using two species for in vivo toxicology studies to predict human toxicity, as the predictive value is significantly higher in combination. Vogel continued by demonstrating that NHP numbers in toxicity studies can be significantly reduced by different study design. The “enhanced PPND” study design as referenced in the ICH S6 (R1) guideline published in June 2011 was used as an example. He cautioned however that group sizes should be kept large enough to have biological significance and statistical power. Thereafter he summarized refinement methodology that hasbeen developed for NHP research including social housing, enrichment, positive reinforcement training, jacketed telemetry, automated activity monitoring and use of only purpose-bred animals. He also offered a glimpse into the future, in which Europe is ageing. He predicted that more research efforts will be dedicated to age-related diseases as well as to personalized medicine, and both will require appropriate and reliable animal models. As the EU is now stimulating the translation of basic research into therapies, this transition will often require the testing of experimental therapies in NHP. On the other hand the EU wishes to restrict NHP experiments and European researchers are now taking their NHP research outside of Europe, sparking a controversy that is dividing the scientific community. He expressed similar concerns as Hendriksen that the standards of ethical oversight and animal welfare could be lower in those countries compared to those in Europe.

124 Alternative methods for the use of non-human primates in biomedical research

The legal framework and public policy

Susanna Louhimies (policy officer at the European Commission at the DG for the Environment) discussed EU policy (http://ec.europa.eu/environment/chemicals/lab_animals/home_en.htm) on NHP and the 3Rs in the context of Directive 2010/63/EU3, which entered into force in 2010 (http://eur-lex.europa.eu/legal-content/EN/TXT/PDF/?uri=CELEX:32010L0063&rid=1). 5 Transposition of the Directive into national legislation of EU Member States should have been completed by November 2012 and the Directive was effective as of 1 January 2013. Not all Member States managed to meet these requirements in time, including Italy, the Netherlands, Poland and Romania (see also below). Although there was the possibility for the maintenance of existing stricter measures, new more stringent measures can no longer be adopted by Member States. EU legislation explicitly states that the use of NHP is still necessary in biomedical research, but raises ethical concern and practical problems in terms of meeting their behavioral, environmental and social needs in a laboratory environment. The EU acknowledges that the use of NHP is of great concern to the public. The Directive spells out the 3Rs and makes their application a legal requirement at all times. In addition, the application of refinement is not limited to scientific procedures but also relevant in relation to care, accommodation and breeding of animals. Finally, the Directive requires that more resources should be made available for the development, validation and promotion of the 3Rs. The Directive restricts the use of NHP in relation to species used, areas of use andwho benefits from the research. The use of great apes is prohibited in the EU. Under exceptional circumstances a temporary exemption can be granted to the purposes of research aimed at the preservation of those species and where action is needed in case of an unexpected outbreak of a life threatening, debilitating condition endangering human beings. Furthermore, such a temporary measure will be put to vote by a Member State committee to either authorize or revoke it. The use of other species of NHP is restricted to basic research, preservation of the species and applied research for human health and diseases. The 3Rs and NHP are specifically addressed with regard to the source, use, care and accommodation of NHPs, follow-up, reporting and controls. As capturing of NHP from the wild is stressful and elevates the risk of injury and suffering, it is the ambition of the EU to use only second-generation (F2) purpose-bred NHP, ultimately from self-sustaining colonies. A feasibility study on the use of F2 animals will be initiated and results should be published by November 2017. Furthermore, results from a feasibility study on sourcing from self-sustained colonies should become available by November 2022. NHP should be socially housed, taking into account the need for environmental complexity and enrichment (e.g. foraging), and training of the animals. Each NHP must have an individual history file from birth onward to be able to assess and provide the care, accommodation and treatment adjusted to its individual needs and characteristics. A severity assessment framework is put in place to ensure that the 3Rs are considered and implemented during all phases of a project. All project using animals will undergo a systematic project evaluation. To improve transparency and to follow up on NHP research and implementation of the 3Rs, the EU requires non-technical project summaries and systematic retrospective

125 Chapter 5

assessments of all projects using NHP. Animal welfare bodies and national committees will play an important role in the dissemination of information on the 3Rs. Member States are required to publish annual statistics. The statistical reports will also include information on sourcing of NHP. Finally, the national authorities perform annual inspections of establishments breeding, supplying or using NHPs. The frequency of inspections should be adapted on the basis of risk assessment. The EC will review the Directive by 2017, taking into account the progress made towards replacing the use of animals and in particular NHP. Where appropriate, thematic reviews will be conducted on the replacement, reduction and refinement of animal use paying specific attention to NHP, technological developments and advances in science and animal-welfare knowledge. The scientific community will be fully involved in these reviews. Louhimies concluded by stating the importance of all forms of communication, from scientist to scientist, but also with the public. Angelique Nielen (policy officer at the Dutch Ministry of Economic Affairs) presented how the Netherlands is implementing the new EU Directive. Although the EU Directive 2010/63/EU implied changes in national law and secondary legislation, it allowed maintenance of existing stricter measures as was the case in the Netherlands. The Dutch Act on animal experimentation was and is based on a “Not allowed, unless there is no alternative” principle, whereas the EU Directive is based on a “Permitted, provided that special requirements are met” principle. In addition, in the Netherlands a total ban on the use of great apes for animal testing exists since 2003. It was decided to keep this ban in place. She next presented data demonstrating that only a small proportion of experiments in the Netherlands involve new world (<0.1%) or old world monkeys (0.1%). Those were mainly obtained from registered breeding or supplying establishments within the Netherlands, and some were re-used from other experiments. The national government aspires to replace the use of animals in experimental procedures by other methods, but acknowledges that the use of animals is still necessary to protect human and animal health and the environment. The ambition of the Dutch government is to obtain joint responsibility of public and private parties, to increase transparency on animal testing and to establish international collaborations. Key issues for the Dutch government are the central authorization of procedures, the issue of purpose-bred animals and how to minimize pain, suffering and distress of the animals used. Marianne Kuil (senior policy advisor on animal experiments and biotechnology at the Dutch Society for the Protection of Animals (DSPA)) started her presentation by presenting animal experimentation in the context of a chain of stakeholders rather than approaching it is a single event. That chain consists of biomedical research organizations, industry, government and authorities, patients and patient organizations, fundraising organizations, medical and veterinary students, doctors and healthcare workers, the general public and animal protection/welfare organizations. All these stakeholder groups should be consulted, have an informed opinion, be transparent and share responsibility for animal experiments, including the general public and fundraising organizations. She emphasized that the use of animals for scientific purposes, and especially the use of NHP, is of major concern to the general public. She made clear that different animal welfare organizations differ in their viewpoints. The DSPA recognizes the intrinsic value of all animals (it does not distinguish between species) and states that all use of animals for scientific purposes should be forbidden. However, DSPA is realistic in recognizing dilemmas that are raised

126 Alternative methods for the use of non-human primates in biomedical research

by this viewpoint and is seeking the way forward through dialogue based on respect, trust, involvement and hope and by the realization that partners in the chain have common goals. Furthermore, Kuil emphasized the importance of communication to the public at large about the use of NHP and the development of the 3Rs and encouraged the audience to think about how communication with the public can be improved. 5

Advances in 3Rs methods for housing, colony management and training

Jan Langermans (BPRC, the Netherlands) and Karolina Westlund (Karolinska Institute, Sweden) discussed advances in refinement of housing, colony management and training of NHP. To refine NHP housing and breeding the specific biological needs of each species should be taken into consideration, including their social system. Natural grouping patterns of macaques include large multi-male and multi-female groups with dominance hierarchy, from which the males migrate to other groups when they become sexually mature. Natural grouping patterns of marmosets include monogamous pairs with their offspring. To obtain stable, self-sustaining breeding groups, natural grouping patterns and behavior must be accommodated as much as possible to enhance welfare and to reduce stress thereby possibly also leading to better science. However, for scientists this provides challenges, including difficulties when introducing new males into established rhesus macaque groups, rank-associated fighting between group-housed animals and exposure to the environment, including potential pathogens. Social housing of NHP should also consider natural environment and behaviors, including floor bedding that enables foraging, availability of an outside compartment, sufficient height of the facilities to allow climbing and jumping, and mimic a tropical climate for marmosets. Social housing of NHP in laboratory settings has positive effects on the behavior and well-being of4 theanimals . Langermans presented data that periods of stress and stereotypic behavior are significantly lower in animals that were housed socially and in the presence of enrichment (bedding), strongly suggesting that these factors also contribute to ‘better science’ (Louwerse et al. in preparation). He also advocated the use of the enrichment manual5 written and edited during EUPRIM-Net (info via www.bprc.nl) and introduced the concept of positive reinforcement training (PRT). The basic principle of PRT is rewarding and reinforcing specific trained behavior, to encourage the animal to perform a specific task in response to a trained stimulus. Karolina Westlund was involved in the development of the EUPRIM-Net Seminar Group Lectures that were developed to give seminars on behavior management techniques. As she demonstrated, clicker training –an example of PRT- strongly reduces the stress level of animals used during experimental procedures. Training is thus not only important from an ethical perspective but also improves the quality of science. Specific PRT features were demonstrated by showing the DVD that was recorded under the umbrella of EUPRIM-Net: “Training laboratory animals” (info via www.euprim-net.eu). Training includes different phases from habituating naive animals to the trainer, teaching some basic operant behaviors, to full compliance in difficult procedures. Challenges of positive reinforcement training are amongst others the requirement

127 Chapter 5

of a serious time investment of the trainers and that not all animals are good trainees. Westlund showed that progress has been made in delineating which personality dimensions are correlated to trainability of the animals and what other factors influence training time investment.

Advances in 3Rs methods for neuroscience and neuroimmunology

Michael Niessing (German Primate Centre, Germany) presented data on the development of a novel model that allows setting up cognitive tasks and recordings of behavioral data in NHP without movement restrictions. This is a major improvement of the conventional setupof experiments in cognitive neuroscience where animals are usually restricted in several ways. The model comprises of a cage-based system (eXperimental Behavioral Instrument, XBI) and utilizes a computer controlled touch screen and rewarding system that NHP can interact with in an unrestrained and self-paced manner. It can be combined with miniaturized wireless devices for neuronal recordings to perform cognitive neuroscientific experiments. Data and video clips demonstrated that this system stimulates the natural curiosity of NHPs. In that respect the system itself may be regarded as part of environmental enrichment. Challenges remain such as the addition of an automatic identification system, which is of particular importance if the freely moving monkeys are to be group-housed. Finally, Niessing showed data on efforts to predict which animals are most likely to enjoy participation and learning, as not all animals have similar potential.

Figure 2. Alternatives for in vivo central nervous system research. Rhesus macaque brain tissue is acquired with minimal post mortem times and processed for different in vitro purposes. Motor cortex is used to initiate organotypic brain slice cultures, prefrontal subcortical white matter is used to initiate dissociated brain cell cultures. Brain tissue is always derived from animals that were sacrificed for other purposes than initiating in vitro cultures.

128 Alternative methods for the use of non-human primates in biomedical research

Saskia Burm (BPRC, the Netherlands) presented novel in vitro NHP models that have been established to study neurodegenerative diseases. These can be initiated from surplus brain material (Figure 2) that becomes available from animals that have been sacrificed for other reasons6. These in vitro NHP models include organotypic brain slice cultures, mixed glial cell cultures, dissociated primary cell cultures and co-cultures of glial cells with cells of the adaptive immune system. Data were presented on how these in vitro models can aid in the refinement, 5 reduction and replacement of in vivo models for neurodegenerative diseases. They can be used as pre-screening tool of drugs and/or they can complement in vivo models by dissecting complex biological mechanisms that are difficult to study in vivo, which may lead to the discovery of new therapeutic targets7,8. She also discussed the advantages and disadvantages of these NHP primary in vitro models compared to those that exist for humans and rodents9.

Advances in 3Rs methods for toxicology

Bas Blaauboer (Institute for Risk Assessment Sciences, the Netherlands) explained the paradigm shift that is now taking place in risk assessment that will hopefully lead to a reduction of NHP use in safety studies. The classical way to assess safety was by exposing animals to compounds and to measure acute toxicity, repeated dose toxicity and a number of more specialized toxic endpoints such as reproductive and genotoxic effects. An important quantification parameter is the No Observed Effect Level (NOEL) as the most sensitive endpoint, which then needs to be extrapolated to establish safety standards for human exposure. Extrapolation takes into account safety factors for uncertainty. However, as long as the mechanism of action of the compounds is unknown, extrapolation remains estimated guesswork. Toxicity is characterized by the critical concentration and time of exposure (dose metric) to the critical compound at the site of action. The new paradigm in toxicology takes these factors into account. An important catalyzer of this paradigm shift is the 2007 report of the US National Research Council10. If exposure levels to compounds are predictably low, exposure-based waiving of risk assessment can be considered. For certain categories of chemicals this is now done making use of the Threshold of Toxicological Concern concept. Furthermore, the potential of compounds to activate stress response pathways, toxicity pathways and adverse outcome pathways can be evaluated in vitro by assessments that are mechanism-based. In silico methods (QSARs, systems biology, pathway modeling, PBPK and PKPD modeling) and in vitro methods (testing battery for both toxicological endpoints and kinetic parameters) can be used in an integrated scheme. Integration of all available data in a stepwise (hierarchical) approach improves the transparency and efficacy of the risk assessment process and will reduce the number of animals needed in safety testing. Challenges remain such as the selection of the most important parameters to assess risk and the assessment of what can be called no effect, adaptive effects or adverse effects of a compound11. Kathryn Chapman (NC3Rs, UK) introduced the National Centre for 3Rs, an independent scientific organization that was established by the UK government to support the science base through the application of the 3Rs. They do so by funding relevant research, by creating new industry/academic partnerships, by creating forums for pre-competitive data sharing and by

129 Chapter 5

influencing regulators and politicians. Over the last years, NC3Rs have organized workshops, brought together working groups and published on their findings. Regarding NHP, NC3Rs have focused on the role of NHPs in the development of monoclonal antibody (mAb)-based therapies, and on study design of chronic toxicity and reproductive toxicity studies that use NHP12-15. For mAb-studies, it should be noted that NHP are not necessarily the primary species of choice. There are circumstances where pre-clinical studies can be performed in rodents. The revision of the European guideline for preclinical safety evaluation of biotechnology-derived pharmaceuticals (ICH S6: http://www.ich.org/fileadmin/Public_Web_Site/ICH_Products/Guidelines/Safety/S6_ R1/Step4/S6_R1_Guideline.pdf) leaves open the possibility to use one species if the toxicity profile is similar to that of humans. Chapman next summarized recommendations for study design of toxicity studies using NHP. Often the number of dose groups as well as the number of recovery animals can be reduced without affecting the outcome. She calculated that for a total toxicity program NHP numbers can be reduced from 144 to 52 by redesigning the study following NC3Rs guidelines. NC3Rs will continue funding and collaborating to advance the development and application of non-animal methods. She also commented on a recently published letter that questioned the added value of NHP in the development of mAb therapies16. The letter was based on a study for which data were used of EMA-registered drugs only, rather than those drugs which had been terminated from development prior to regulatory submission. This may have biased the outcome. NC3Rs is currently collecting data from unpublished compounds that may have been dropped because of adverse effects observed in NHP. She concluded by stating that there are further opportunities to reduce NHP use, but that these have to be science-driven to ensure human safety. NC3Rs will continue their role in cross-company collaborations as these give bigger –anonymized- datasets and a stronger voice. NC3Rs provides an honest-broker role between companies and regulators and wish to advocate the 3Rs as a catalyst for change.

Advances in 3Rs methods for vaccines/immunology

William Warren (Sanofi Pasteur, US) introduced the MIMIC® system. This in vitro model mimics the human immune system and can be used to study immunophysiology of neonates, adults, elderly and those with allergies, but also to assess immunogenicity and functionality of drugs and new vaccines. Human immune cells are placed into engineered tissue constructs that seek to emulate the physiological environment of the human immune system in modular microtiter wells. The MIMIC® system is modular and consists of a peripheral tissue equivalent (to mimic local innate immune responses), a lymph node tissue equivalent (to mimic and study adaptive immune responses) and functional assays (to e.g. assess neutralization). All modules have been developed and characterized in in terms of cell types, cell numbers, kinetics, etc. and provide the possibility to study immune responses in vitro in an outbred system. The MIMIC® system can be used as high throughput screening tool to study functionality of various compounds, thereby possibly reducing the number of animals needed to assess drugs, vaccines and biosimilars. Warren demonstrated that data from the MIMIC® system correlate well with clinical data for several vaccines and biologicals. Ultimately the system would be akin to running

130 Alternative methods for the use of non-human primates in biomedical research

“clinical trials in test tubes” to better downselect candidates before entering into the clinic. At this moment there are no plans to develop similar ex vivo technology for NHP. Ingo Spreitzer (Paul Ehrlich Institute, Germany) discussed the monocyte activation test (MAT) that has been developed to replace classical in vivo pyrogenicity tests in rabbits. Pyrogenicity testing is required for many biologicals, and is also an adverse effect frequently encountered during adjuvant development. The MAT is based on the principle that well-characterized 5 pyrogens (such as WHO reference lipopolysaccharide (LPS)) induce the secretion of interleukin (IL)-1β, IL-6 and tumor necrosis factor (TNF)α from human as well as from NHP-derived monocytes. Spreitzer presented data showing that pooling individual blood samples (and cryopreservation if desired) is a good method to standardize and to minimize variability due to the outbred nature of humans and NHP. Cryopreservation procedures of different NHP species require different methodology and it remains to be established which NHP mimics human fever responses the best. Besides replacement and reduction, species-specific MATs might help to refine foreseen in vivo experiments (e.g. evaluation of new antigen/adjuvant compositions). NHP MATs in combination within vivo experiments can serve to carefully correlate in vitro and in vivo data, thereby contributing to the acceptance and application of the MAT. Ulrike Sauermann (German Primate Centre, Germany) presented on the development of an in vitro NHP model to assess AIDS vaccine efficacy. This is currently done in vivo by repeated exposure of vaccinated NHP to low doses of SIV/SHIV with the aim to finally infect all animals. A simple, reproducible and standardized in vitro test would not only ultimately lead to a reduction of NHP used, but also refine animal experiments since conventional assessments of immune parameters are not informative about AIDS vaccine efficacy. Sauermann presented data showing that the ratio of MX1/CXCL10 RNA levels in lymphocytes as well as plasma IP-10 levels correlated with numbers of exposures required for infection. The markers for interferon (IFN)-γ- and IFN-α- mediated immune stimulation also correlated with SIV-specific CD4 T cell responses. These putative correlates of protection can be used to determine AIDS vaccine efficacy ex vivo within 48h post vaccination. However, the protocol for in vitro SIV-infection of lymphoyctes to predict AIDS vaccine efficacy requires further optimization, with a special focus on inthe vitro activation procedure of lymphocytes as this appears to be critical. Jeffrey Bajramovic (BPRC, the Netherlands) presented integrated in vitro test systems that were developed to aid adjuvant development. Adjuvants are formulations, which upon administration lead to non-specific immune stimulation. They are used to induce immune responses directed against pathogens (as for vaccination purposes) or to generate immune responses against components of the body itself (as in experimental animal models of human auto-immune diseases like e.g. multiple sclerosis, diabetes or rheumatoid arthritis). However, some of the more potent adjuvants are notorious for their adverse effects. Most notable is the development of granulomatous skin lesions, causing varying degrees of discomfort to animals in biomedical experiments. There is therefore an urgent need for new improved adjuvants. The integrated in vitro testing strategy for the development of new adjuvants is comprised of luminescent bioassays for Toll-like receptor-mediated responses to assess adjuvanticity17-20, and 2D/3D in vitro granuloma models to assess adverse effects. Data were shown demonstrating that the sequential use of multiple bioassays as a robust integrated test system can rapidly generate

131 Chapter 5

detailed information and can aid the development of new potent adjuvants with minimal adverse effects. Preliminary data on new adjuvant candidates for NHP with less adverse effects showed that in vitro results correlated well to in vivo findings. Although this project contributes mainly to the R of Refinement, adjuvants with serious adverse effects are used for biomedical research in many different animal species. The development of improved adjuvants might therefore also positively affect the welfare of those species.

Advances in 3Rs methods: stem cells and biobanking

Robert Passier (Leiden University Medical Centre, the Netherlands) described the use of stem cells as a 3Rs alternative for animal experiments. Stem cells can be derived from human and NHP origin. They are classically divided into adult stem cells (found in many organs), embryonic stem cells and induced pluripotent stem cells (iPSC). Adult human stem cells have limited differentiation and proliferative capacity. Embryonic stem cells are derived from blastocyst stage embryos, are pluripotent and have high proliferative capacity. However, obtaining these stem cells remains an ethically sensitive topic. iPSC are obtained by reprogramming somatic cells (by the addition of genetic material to e.g. skin fibroblasts or by culturing them in special culture media). Because of their origin they are free from ethical concerns. iPSC can form all tissues of the body and can be expanded and maintained in culture. These cells can be used in regenerative medicine, but also in toxicological studies, disease models and drug screening. Passier gave an overview of differentiation regimes (leading to e.g. beating cardiomyocytes) and the possibilities of using different types of stem cells (e.g. for transplantation purposes). He argued that iPSC protocols should also be further developed for NHP as evaluation is necessary for critical assessment of iPSC clinical feasibility and safety, specifically mentioning the potential to test and validate autologous stem cell-based therapies. NHP-derived iPSC also provide researchers with 3R opportunities of great potential forin vivo NHP models. Nadège Devaux (Rousset Station de Primatology, France) presented on the development and management of a new NHP biobank. The purpose is to collect, characterize and distribute high- quality tissues, cells and biological samples (DNA, RNA, proteins) of accredited primate centers and laboratories with accompanying behavioral and veterinary information. They have collected samples from macaques, African green monkeys and marmosets of many organs and of specific CNS areas. Further developments included preparation and storage of sperm, oocytes and cells from reproductive organs for several applications (genetic studies, in vitro fertilization, cryopreservation of gametes from endangered NHP species). Devaux explained the quality control checks that are important for proper biobanking as well as the necessity of good registration systems. She also summarized the public and private laboratories that have made use of the biobank thus far and stressed the importance of networks like EUPRIM-Net in supporting biobanks.

132 Alternative methods for the use of non-human primates in biomedical research

Opportunities and challenges

An important goal of the workshop was to discuss the opportunities and priorities for 3Rs development in biomedical research with NHP. To facilitate discussion, subgroups were formed. Every group was presented with four statements and each member of the group was asked to rank the four statements. In addition, subgroups were asked to compose a list of opportunities 5 and priorities. Results were discussed in a plenary session. The results are summarized below.

1. Recent advances in technology (CRISPR/CAS9) render it now possible to generate transgenic animals with much higher efficacy. This opens the route towards generating and using transgenic NHP, and recently a first paper was published on transgenic NHP21 demonstrating the potential – Is this a 3Rs opportunity?

None of the groups considered the generation of transgenic NHP a 3Rs opportunity. First, concerns were raised whether the public at large would accept the development of transgenic NHP models. Secondly, based on experience with transgenic mouse studies, it was estimated that the availability of transgenic NHP would not contribute directly to replacement, reduction or refinement. Third, because of the outbred nature of NHP results from studies that use transgenic NHP should always be interpreted very carefully as genotypic differences will also contribute importantly to study outcome. Although groups agreed that in the long run better control and a reductionist approach to correlations between gene function and pathology could lead to better science, this indirect 3Rs effect was considered of minor importance. In the general discussion it was suggested that it might be interesting to have the practicality and the ethics of this technology assessed in detail to generate a more informed opinion regarding the subject.

2. Stem cell technology – Do we need NHP stem cells and is this a 3Rs opportunity?

All groups considered stem cells as an opportunity to reduce and replace the number of NHP. Not only can these cells supplement in vivo studies with in vitro opportunities in the form of integrated testing schemes, but they can also be used in backwards validation studies within vivo models. This would teach us about the validity of human stem cells as predictive models. Especially induced pluripotent stem cells provide 3Rs opportunities, since these can be generated from e.g. fibroblasts that can be obtained with minimal discomfort. Furthermore, it was put forward that there are still many basic scientific questions regarding stem cells for which the comparison of NHP with human stem cells would be informative. Finally, it was discussed that the development of personalized –regenerative- medicine will probably require preclinical testing in NHP, adding an additional argument in favor of further development of NHP stem cell technology22-24.

133 Chapter 5

3. Biobanking - Do we need biobanking for NHP and is this a 3Rs opportunity?

All groups considered biobanking as a true 3Rs opportunity. Biobanks could directly lead to a reduction in NHP numbers necessary for in vivo experiments, but also lead to better science by providing researchers with additional opportunities to test e.g. biologicals on tissue or in vitro first. Some concerns were raised regarding how biobanking should be financed as most funding is project-related and biobanking is an infrastructural issue. Secondly, the question was raised if there was a finite number of individuals per species of which biological materials should be banked and whether active biobanking could be turned into passive biobanking when frozen and stored collections are of sufficient size. The general opinion was that we have not reached that point yet, but the point is –as it is for humans- valid. Collaboration of various existing biobanks and communication on the availability of NHP materials also provides further opportunities on implementation of the 3Rs.

4. Should all 3Rs be considered equal for NHP?

Groups were unanimously positive. Equal attention, focus and budget should be allocated to work on the development and implementation of all 3Rs alternatives including refinement initiatives which are often aimed at realistic goals. Different opinions were expressed on whether the replacement of NHP by other species was desirable and whether this is a 3Rs opportunity. The DSPA stated that they consider and value every animal, species-independent, as equal. When replacement and reduction options are exhausted or out of reach, refinement options should be developed as much as possible. In particular for NHP, refinement might often be the most achievable R and should not be regarded as less than the other two Rs.

3Rs opportunities listed by the different groups could be divided into different categories. First, groups focused on recent technological advances and the possibility to translate such technologies to NHP. 3D printing and 3D cell culture, NHP biomimetic systems (such asthe abovementioned MIMIC® system) and stem cells were discussed in some depth and were high on the lists. However, as for the possibilities of transgenic NHP, thorough technological assessments are needed to assess practicality. Second, most groups recognized 3Rs potential in the further development and validation of NHP in vivo models. Especially additional studies of compounds/vaccines with discrepant results between pre-clinical studies in NHP models and clinical assessment in men would be desirable. If certain NHP models turn out to have limited predictability, these models should be optimized, changed or abandoned. Although there was consensus on the importance of this topic, there was also consensus on the difficulties to get such –expensive- efforts funded. Maybe there could be a role for pre-competitive platforms financed by pharmaceutical companies here. Along the same line, the compilation of a registry of failed compounds was discussed. Such compounds are not tested in men, and the development pipeline stops after pre-clinical assessment in NHP. Not only is this information valuable for other NHP researchers and could it reduce NHP numbers by preventing unnecessary studies, such a registry could also aid the development and validation of better NHP models. Research on why compounds fail should be stimulated in order to gain understanding and to learn from these

134 Alternative methods for the use of non-human primates in biomedical research

failures. A data collection and registration system was proposed and NC3Rs mentioned that they are already working on this topic. NC3Rs and other groups saw additional 3Rs possibilities in the improvement of NHP safety study design13,14. Although much of this work has been published, not all companies have adapted their study designs accordingly. Extra and continuous efforts are necessary to push this topic further. Finally, most groups recognized 3Rs possibilities in communication, education and outreach. For refinement of NHP research, seminar group 5 lectures have been developed on topics regarding animal behavior management, ranging from breeding laboratory primates to enrichment and problem solving. The development of specific e-learning platforms and expert technical workshops may provide further opportunities for disseminating 3Rs technology. It was stressed that communication should not be restricted to scientists, but that there should be active efforts to get the general public, regulators and fundraising charities informed and involved. As long as animal experiments are still necessary, the responsibility should be shared and not be left to the researchers alone. Communication, outreach and dissemination of the 3Rs should aim for Europe and beyond. A dilemma that was brought up several times is that the progress that is made in implementing the 3Rs for NHP research in industrialized countries leads to higher costs as compared to emerging countries with lesser standards on animal welfare. However, it should be stressed that physically and mentally fitter animals make better science. Despite this, researchers and companies can escape EU legislation on NHP research and benefit economically by outsourcing NHP experiments to emerging countries, which is indeed happening more and more often. This tendency might ultimately lead to decreased implementation of the 3Rs in NHP research worldwide, and measures that are taken in Europe might in that respect be counterproductive. Efforts must therefore also be made to effectively communicate the implementation of the 3Rs inNHP research from industrial countries to emerging countries.

Evaluation of the workshop learned that attendees appreciated the mix of presentations on legal, scientific and public opinion topics and that there is a necessity for joint efforts to secure resources to advance 3Rs development. Although the public at large and governments agree on the desirability of 3Rs research, dedicated budget is limited. Workshops like this might not only advance sharing of knowledge but the informed discussions might also aid decision makers in their process of prioritizing limited research budgets.

Recommendations

The use of NHP in biomedical research is much debated and there is a strong impetus to develop 3Rs technology for NHP. Initiatives such as EUPRIM-Net remain essential for continuing education and improvements in the development of the 3Rs in NHP research. This report reflects the opportunities and challenges as experienced by those involved. Although by no means meant to discourage other initiatives, we would recommend that the following topics should receive full attention.

135 Chapter 5

• Refinement Refinement initiatives for NHP are often aiming for realistic goals. Equal attention, focus and budget should be allocated to work on the development and implementation of all 3Rs alternatives.

• Induced pluripotent stem cell technology for NHP Induced pluripotent stem cells can provide researchers with valuable 3Rs opportunities. They can be generated from cells that can be obtained with minimal discomfort for the animal and without ethical concerns. They can be used to generate all cell types of the body for in vitro studies. Such studies can supplement NHP in vivo studies, and they can also teach us about the validity of human stem cells as predictive models.

• Further development, optimization and validation of NHPin vivo models NHP in vivo models should be critically evaluated for their predictive value. Performingin vivo studies of compounds/vaccines with discrepant results between pre-clinical studies in NHP models and clinical assessment in men should be stimulated in backwards validation studies as a means to improve NHP models.

• Registry of failed compounds Compounds that fail during pre-clinical testing are not tested in men. This information is valuable for other NHP researchers and could reduce NHP numbers by preventing unnecessary studies.

• Communication, education and outreach Communication about the 3Rs and NHP research should not be restricted to scientists, but there should be active efforts to get the public at large, regulators and fund-raising charities informed and involved. Responsibility for performing and communicating about NHP research should be shared. Communication, outreach and dissemination of the 3Rs should be global as increasing restrictions on NHP research in e.g. Europe might be counterproductive by stimulating outsourcing of NHP research to countries with less concern for animal welfare.

Acknowledgements

Part of this work has been supported by EUPRIM-Net under the EU grant agreement 262443 of the 7th Framework Programme.

136 Alternative methods for the use of non-human primates in biomedical research

References

1 Hay, M., Thomas, D. W., Craighead, J. L., Economides, C. & Rosenthal, J. Clinical development success rates for investigational drugs. Nature biotechnology 32, 40-51, doi:10.1038/nbt.2786 (2014).

2 Olson, H. et al. Concordance of the toxicity of pharmaceuticals in humans and in animals.Regul Toxicol Pharmacol 32, 56-67, doi:10.1006/rtph.2000.1399 (2000). 3 The_European_Parliament_and_the_Council_of_the_European_Union. (Official Journal of the European Union, 2010). 5 4 DiVincenti, L., Jr. & Wyatt, J. D. Pair housing of macaques in research facilities: a science-based review of benefits and risks.Journal of the American Association for Laboratory Animal Science : JAALAS 50, 856-863 (2011).

5 Vernes, M. K. & Louwerse, A. L. BPRC’s Enrichment Manual for Macaques and Marmosets., (2010).

6 Zuiderwijk-Sick, E. A. et al. Differentiation of primary adult microglia alters their response to TLR8-mediated activation but not their capacity as APC. Glia 55, 1589-1600, doi:10.1002/glia.20572 (2007).

7 Van Der Putten, C. et al. Statins amplify TLR-induced responses in microglia via inhibition of cholesterol biosynthesis.Glia 60, 43- 52, doi:10.1002/glia.21245 (2012).

8 van der Putten, C. et al. Differential expression of adenosine A3 receptors controls adenosine A2A receptor-mediated inhibition of TLR responses in microglia. J Immunol 182, 7603-7612, doi:182/12/7603 [pii]10.4049/jimmunol.0803383 (2009).

9 Smith, A. M. & Dragunow, M. The human side of microglia. Trends Neurosci 37, 125-135, doi:10.1016/j.tins.2013.12.001 (2014).

10 National_Research_Council.Toxicity Testing in the 21st Century: A Vision and a Strategy., (The National Academies Press, 2007).

11 Blaauboer, B. J. et al. The use of biomarkers of toxicity for integrating in vitro hazard estimates into risk assessment for humans. Altex 29, 411-425 (2012).

12 Chapman, K. et al. Preclinical development of monoclonal antibodies: considerations for the use of non-human primates. MAbs 1, 505-516, doi:9676 [pii] (2009).

13 Chapman, K. L. et al. The design of chronic toxicology studies of monoclonal antibodies: implications for the reduction in use of non-human primates. Regul Toxicol Pharmacol 62, 347-354, doi:10.1016/j.yrtph.2011.10.016 (2012).

14 Chapman, K. L. et al. Pharmaceutical toxicology: designing studies to reduce animal use, while maximizing human translation.Regul Toxicol Pharmacol 66, 88-103, doi:10.1016/j.yrtph.2013.03.001 (2013).

15 Chapman, K. L., Pullen, N., Andrews, L. & Ragan, I. The future of non-human primate use in mAb development. Drug Discov Today 15, 235-242, doi:10.1016/j.drudis.2010.01.002 (2010). 16 van Meer, P. J., Kooijman, M., van der Laan, J. W., Moors, E. H. & Schellekens, H. The value of non-human primates in the development of monoclonal antibodies.Nature biotechnology 31, 882-883, doi:10.1038/nbt.2709 (2013).

17 Bsibsi, M. et al. The microtubule regulator stathmin is an endogenous protein agonist for TLR3. J Immunol 184, 6929-6937, doi:jimmunol.0902419 [pii]10.4049/jimmunol.0902419 (2010).

18 Boele, L. C. et al. Activation of Toll-like receptors and dendritic cells by a broad range of bacterial molecules.Cell Immunol 255, 17-25 (2009).

19 Jagessar, S. A. et al. Induction of progressive demyelinating autoimmune encephalomyelitis in common marmoset monkeys using MOG34-56 peptide in incomplete freund adjuvant.J Neuropathol Exp Neurol 69, 372-385, doi:10.1097/NEN.0b013e3181d 5d05300005072-201004000-00005 [pii] (2010).

20 Koopman, G. et al. Whole blood stimulation with Toll-like receptor (TLR)-7/8 and TLR-9 agonists induces interleukin-12p40 expression in plasmacytoid dendritic cells in rhesus macaques but not in humans.Clinical and experimental immunology 174, 161- 171, doi:10.1111/cei.12155 (2013).

21 Niu, Y. et al. Generation of gene-modified cynomolgus monkey via Cas9/RNA-mediated gene targeting in one-cell embryos.Cell 156, 836-843, doi:10.1016/j.cell.2014.01.027 (2014).

22 Hong, So G. et al. Path to the Clinic: Assessment of iPSC-Based Cell Therapies In Vivo in a Nonhuman Primate Model. Cell Reports 7, 1298-1309, doi:http://dx.doi.org/10.1016/j.celrep.2014.04.019 (2014).

23 Kamao, H. et al. Characterization of Human Induced Pluripotent Stem Cell-Derived Retinal Pigment Epithelium Cell Sheets Aiming for Clinical Application.Stem Cell Reports 2, 205-218, doi:http://dx.doi.org/10.1016/j.stemcr.2013.12.007 (2014).

24 Morizane, A. et al. Direct Comparison of Autologous and Allogeneic Transplantation of iPSC-Derived Neural Cells in the Brain of a Nonhuman Primate. Stem Cell Reports 1, 283-292, doi:http://dx.doi.org/10.1016/j.stemcr.2013.08.007 (2013).

137

CHAPTER 6

General discussion

Parts of this discussion will be integrated in a review on CNS-specific features of innate immune responses. Chapter 6

Multiple sclerosis (MS) is a chronic debilitating disease that mainly affects 1young adults . Symptoms of MS are caused by focal demyelinating lesions within the central nervous system (CNS). Activation of innate immune cells, including CNS-resident microglia and infiltrating macrophages, is a hallmark of MS lesions2,3 and is likely involved in the development of neuropathology. However, what activates these innate immune cells is currently unknown, as the cause of MS still remains to be elucidated. Inflammasomes are multiprotein complexes that are involved in the secretion ofpro- inflammatory cytokines, such as interleukin (IL)-1β4. Inflammasome assembly and activation can be induced by pathogens as well as by endogenous ligands that are associated with cellular stress4-13. The pathological potential of inflammasome activation in the CNS is highlighted by the recent identification of the inflammasome as a key player in microglia activation during Alzheimer’s disease (AD) and Parkinson’s disease (PD)9,14-17. This, together with the notion that defects in the regulation of inflammasome activation are associated with several autoinflammatory conditions18 provides a strong impetus to study the role of inflammasomes in microglia activation in MS lesions. In this thesis, we studied the expression of IL-1β in brain tissue of humans with MS and of rhesus macaques with experimental autoimmune encephalomyelitis (EAE), an animal model for MS. In addition, we studied inflammasome-mediated activationin vitro cell cultures using non-human primate (NHP)-derived microglia and hematopoietic macrophages.

IL-1β in EAE and MS

Inflammasome activation leads to the processing and secretion of IL-1β. IL-1β is a potent pro- inflammatory cytokine that affects essentially all cells and tissues and it has widespread effects in neurodegenerative diseases19,20. IL-1β acts on the hypothalamus and induces an increase of the body temperature and vasodilation, which allows increased migration of leukocytes19-21. Infiltration is further facilitated by the fact that IL-1β also induces the expression of adhesion molecules, promoting extravasation of leukocytes from the bloodstream into the tissue19,22. In addition, IL-1β orchestrates the innate immune response by increasing cytokine production in macrophages and dendritic cells (DCs), by inducing the expression of major histocompatibility complex (MHC) and co-stimulatory molecules on DCs, and by increasing survival, oxidative burst and protease release from neutrophils21. IL-1β induces skewing of T cells towards Th17 cells and initiates the production of IL-17 by γδT cells23-26, thereby linking innate immune responses to activation of the adaptive immune system. IL-1β also has tissue-specific effects. In the CNS, IL-1β can contribute to dopaminergic neuronal cell death27-29, induce demyelination, amyloid β production and neuronal tau phosphorylation, and it can inhibit microglial amyloid β clearance9,30-33. Thereby, IL-1β may contribute to both the initiation and/or progression of neurodegenerative diseases. Indeed, expression of IL-1β is observed in brain tissue of AD and PD patients9,15,29,34 and increased levels of IL-1β are detected in cerebrospinal fluid (CSF) and serum of AD patients15,35-37. In MS patients, IL-1β levels are elevated in CSF and serum and correlate with disease susceptibility, severity and progression38-42. However, while there is consensus on the abundant expression of IL-1β in the brain during EAE induced in rats and mice43-45, reports on IL-1β expression in MS lesions 46-48 are by no means unequivocal49,50.

140 General discussion

In chapter 2, we directly compared IL-1β expression in brain tissue of MS patients side-by-side with brain tissue derived from rhesus macaques with EAE. In line with previous studies in rodents43-45, IL-1β was prominently expressed in the CNS of rhesus macaques with EAE and its expression was mainly localized to perivascular lesions. To our surprise, IL-1β expression was predominantly detected in Iba-1+/MRP14- cells, and hardly in MRP14high infiltrating monocytes and neutrophils. Although this staining pattern strongly suggests that microglia are the main producers of IL-1β, we cannot formally exclude the possibility that IL-1β-expressing cells in rhesus EAE represent infiltrated monocytes that have lost their MRP14 expression upon differentiation 6 to macrophages within the CNS51,52. The fact that IL-1β was mainly expressed in MRP14- or MRP14low cells is most consistent with the notion that the expression of IL-1β is not induced in the periphery, but rather in the CNS, possibly reflecting a tissue response to stress that is associated with peripheral infiltration. Interestingly, IL-1β+/MRP14- and IL-1β-/MRP14+ cells were found in close proximity, exposed to the same inflammatory stimuli. Disparate responses within the same inflammatory microenvironment have been described previously in rodent EAE and were ascribed to differential responses of microglia and monocyte-derived macrophages53. In MS, we describe that IL-1β expression in the CNS is much less pronounced as compared to that in rhesus EAE. IL-1β expression was mainly localized in parenchymal nodules of activated microglia. These microglia nodules were not accompanied by signs of demyelination or infiltration and were previously described by different research groups2,3,54,55. It has been proposed that most of these nodules resolve spontaneously while other might progress into an active lesion2, hence the alternative name ‘preactive lesions’. Consistent with previous studies56,57, we could not distinguish specific pro- or anti-inflammatory microglia nodules based on the expression of classical pro- or anti-inflammatory markers. However, we observed that only a portion of the parenchymal nodules of activated microglia was IL-1β+. Whether these microglia also secrete IL- 1β remains to be determined by e.g staining for activated inflammasome complexes (implied from colocalisation of NOD-like receptors (NLR), adaptor proteins and inflammatory caspases), ASC speckles or active inflammatory caspases15,58-60. In addition, it is still unclear whether the expression of IL-1β is a discriminating factor regarding the fate of the nodules, as it is also very well possible that the microglial expression of IL-1β reflects a transient response to cellular stress. The IL-1β expression in microglial nodules in MS brain tissue is most consistent with an inside- out etiology of disease in which the initial trigger for MS leads to activation of CNS innate immune cells followed by infiltration of the CNS by cells of the peripheral immune system61. Endogenous molecules that are associated with damaged cells or tissue injury (e.g. reactive oxygen species, high extracellular adenosine triphosphate (ATP), ion imbalances) and neurodegenerative disease- associated molecules (e.g. amyloid β, α-synuclein or SOD1 aggregates) were previously linked to inflammasome activation within the CNS and to contribute to neurodegenerative diseases8,11,13,62-66. In line with these studies, microglia nodules are associated with stimuli that are known to activate the inflammasome, e.g. oxidative stress, axonal damage and elevated levels of heat shock proteins54,67-70, implicating that all stimuli required for production of active IL-1β are present in these nodules. Relevant signals for induction of IL-1β expression include small stress protein alpha-B-crystallin (HspB5), ApoE, HMGB, IL-1α and TNFα67,71,72. Especially HspB5 is an interesting candidate for future studies on inflammasome-mediated activation of microglia in the context of

141 Chapter 6

MS. HspB5 has classical features of a priming signal, as exposure to HspB5 induces pro-IL-1β expression in in vitro cultured microglia without inducing IL-1β secretion67. Previous studies showed that HspB5 is expressed in microglia nodules and in active MS lesions67,73. As inhibition of IL-1 signaling effectively ameliorates EAE pathogenesis74-78, targeting IL-1β production or IL-1-induced signaling has been proposed as a therapeutic strategy79 inMS . Interestingly, therapeutic approaches that are already in use for the treatment of MS,i.e. interferon (IFN)β, Copaxone or steroid treatment, have all been reported to induce the endogenous production of IL-1RA38,80,81 or to limit the production of IL-1β82-84, suggesting that these treatments interfere with IL-1 signaling. Alternatively, these changes may reflect general skewing of immune responses by these treatments. Interference with IL-1β production or signaling might be effective at multiple levels. It is well accepted that this may affect both the strength and the phenotype of potential autoreactive T cell responses. Our data suggest that local production of IL-1β also contributes to pathological processes within the CNS, and efforts to limit IL-1β production might also be targeted to the CNS.

Microglia and hematopoietic macrophages

Our data demonstrate that both in EAE and MS IL-1β expression was mainly restricted to microglia, and much less to infiltrating monocytes/macrophages. Such disparate responses may reflect differences in innate immune responses between these cell types53. To further study this, we performed an in-depth analysis of inflammasome activation in microglia and hematopoietic macrophages using in vitro models. Until a few years ago, it was believed that tissue-resident macrophages, including microglia, derived from circulating blood monocytes85. Recent evidence dramatically changed our view on microglia. Fate-mapping experiments showed that microglia, arise independently of monocyte input, originating prenatally from yolk sac or fetal liver progenitors prior to the establishment of definitive hematopoiesis86-89. Some tissue-resident macrophages, e.g. alveolar macrophages and intestinal macrophages, can be replaced by hematopoietic stem cells90,91. However, most tissue-resident macrophages, including microglia, maintain themselves throughout adult life by virtue of longevity and self-renewal without input from definitive hematopoiesis86,91,92. Thereby, microglia form a distinct population from circulating blood monocytes and hematopoietic macrophages86,91,92. Although inflammasome-mediated activation of macrophages has been extensively studied, much less is known about microglia14. In chapter 3 and 4 we describe that microglia are in principle endowed with similar inflammasome machinery and respond to the same innate stimuli with the production of pro-IL-1β and the release of mature IL-1β. However, we also describe key cell-type specific differences between microglia and hematopoietic macrophages pertaining to i) the kinetics of pro-IL-1β expression and the inflammasome-mediated response, ii) their dependence on inflammatory caspases and iii) the regulation of IL-1β secretion by purinergic receptors (graphically summarized in Figure 1).

142 General discussion

Figure 1: Overview of differences in inflammasome-mediated activation of microglia and hematopoietic macrophages. TLR-mediated signaling strongly induces pro-IL-1β mRNA expression in both microglia and hematopoietic macrophages. However, the kinetics of this response differs between cell types. Whereas pro-IL-1β expression is negatively regulated in hematopoietic macrophages already after two hours of exposure to LPS, microglia are characterized by persistent expression of pro-IL-1β transcripts and by delayed negative regulation. In both microglia and hematopoietic macrophages, inflammasome activation by e.g. silica, monosodium urate crystals or ATP, leads to activation of caspase 1, 4 and 5, which subsequently induces cleavage of pro-IL-1β to bioactive and secreted IL-1β. Again, the kinetics of this response differs between cell types. In comparison to hematopoietic macrophages, microglial IL-1β secretion is slower and has a more chronic character. Furthermore, while caspase 1, 4, and 5 are pivotal for inflammasome-induced IL-1β secretion by hematopoietic macrophages, microglial secretion of IL-1β is only partially dependent on these inflammatory caspases. This suggests that an additional mechanism is involved in the processing of IL-1β in microglia specifically. Alternative mechanisms for IL-1β processing and secretion include inflammasome-independent mechanisms, such as matrix metalloproteinases93, cathepsins94 and serine proteases95-98 and warrant further investigation. Finally, one of our key findings is that ATP-induced IL-1β secretion in microglia is restricted when compared to hematopoietic macrophages. We hypothesize that this may be due to significant lower expression levels of P2X7 on microglia. When P2X7 expression levels are too low, ATP-induced P2X7-mediated signaling might be insufficient to trigger IL-1β secretion and the contribution of other receptors may become more important. Whereas in hematopoietic macrophages ATP-induced IL-1β secretion appeared to be fully dependent on P2X7-induced signaling, microglial ATP-induced IL-1β secretion was the result of combined activation of the P2X4, P2X7 and possibly other –yet unknown– ATP receptors.

143 Chapter 6

These results are in line with recent in vivo studies in which the function of microglia and monocyte-derived macrophages were directly compared during neuroinflammation and in which these cell types showed differences in their inflammatory responses53,99. In general, microglia were characterized by a phenotype aiding a return to tissue homeostasis by clearance of cell and myelin debris53,99. Although microglia may also have detrimental effects during neuroinflammation, monocyte-derived macrophages are usually characterized as more inflammatory and thought to play an important role in the cascade that leadsto demyelination45,53,99-103. Accordingly, gene expression profiles confirm that monocyte-derived macrophages in EAE lesions are highly phagocytic and inflammatory, whereas those arising from microglia demonstrate a signature of globally suppressed cellular metabolism at disease onset53. However, we here demonstrate that microglia are the main source of IL-1β in MS and EAE lesions, implicating that microglial responses may be pathogenic or neurotoxic as well. It is well feasible that this is also dependent on the nature and the duration of the activating stimulus. Still, ourin vitro studies suggest that hematopoietic macrophages are characterized as more pro- inflammatory when compared to microglia. It is tempting to speculate that these tissue-specific traits of innate immune responses represent adaptations to the vulnerable CNS microenvironment.

The CNS microenvironment

The importance of the local environment in shaping the function and phenotype of microglia and other tissue-resident macrophages has gained interest over the past few years104-107. Local homeostasis in individual organs can vary considerably, because tissues differ in metabolic and mechanical activities, environmental exposure to nutrients or microbiota, and seclusion behind physical barriers107. Microglia are chronically exposed to the highly metabolic active CNS microenvironment, protected by the blood-brain-barrier. Recently, high-throughput technologies for studying the transcriptome, epigenome and proteome have been used to study the effect of the local environment on responses of various tissue-resident macrophages, including microglia, Kupfer cells (liver) and alveolar, splenic, intestinal and peritoneal macrophages104-106. These studies show that tissue-resident macrophages acquire features and activities that are tailored for assisting local tissue homeostasis. For example, microglia play an important rolein neurogenesis, clearance of superfluous neurons and synaptic pruning108-110, which is reflected by enriched expression of genes that are involved in sensing CNS endogenous ligands, development and function of the CNS and maintenance of tissue homeostasis104,111,112. The differentiation and tissue-specific activation of macrophages require precise regulation of gene expression, a process governed by the use of specific transcription factors and epigenetic mechanisms such as DNA methylation, histone modification and chromatin structure106. Multiple studies show that changes in the identity and global expression profiles of tissue-resident macrophages are dependent on tissue-specific transcription factors106,113-115. For example, microglia are characterized by the expression of transforming growth factor (TGF)β-regulated transcription factors Sall1 and Mef2c104,106,116. Accordingly, microglia have a specific epigenetic profile that differs from other tissue-resident macrophages and monocytes and that corresponds to their gene expression

144 General discussion

profile105,106. Tissue-resident macrophages that share a similar microenvironment, e.g. macrophages from small and large intestines or different types of peritoneal macrophages, are highly similar in their gene expression and epigenetic landscape105,106. Despite their differences, microglia cluster together with tissue-resident macrophages rather than with monocytes and DCs in both gene expression and epigenetic studies104,106,112. In addition to the tailored functions for assisting local tissue homeostasis, tissue macrophages need to fine-tune their innate immune responses in a tissue-specific manner to prevent insufficient or excessive activation. This is reflected by distinct expression profiles of immune 6 sensors, such as TLR, C-type lectin receptors and cytokine receptors, as well as of unique silencing modules, such as molecules from the IL-10 and the CD200 axis104,106,111. These last probably critically define the sensitivity, activation threshold and extent of the responses of distinct tissue macrophages. For example, microglia receive many inhibitory signals by exposure to TGFβ and via cell-cell interactions with neurons, e.g. CD200R-CD200 interactions104,117,118. Loss or disruption of these constitutive inhibitory signals leads to a more activated microglia phenotype104,119. Our results describe some tissue-specific traits of innate immunity, possibly as adaptations to the vulnerable CNS microenvironment. The differences in the innate immune response to ATP between microglia and hematopoietic macrophages are of particular interest in this context. During inflammation, ATP can be released into the extracellular space either actively by apoptotic or inflammatory cells or passively by membrane-rupture of necrotic cells120-122 and serves as an endogenous danger signal to activate innate immune cells via purinergic receptors120,123-125. We observed that ATP-induced IL-1β secretion in microglia was limited compared to hematopoietic macrophages, due to differences in regulation by purinergic receptorschapter ( 4). ATP is an important modulator of neuronal activity in the healthy CNS, as it can be released from neurons and astrocytes during synaptic transmission126-133. Thereby microglia are regularly exposed to high extracellular levels of ATP under homeostatic conditions. Whereas in hematopoietic macrophages ATP-induced IL-1β secretion appeared to be fully dependent on P2X7-induced signaling, microglial ATP-induced IL-1β secretion was the result of combined activation of the P2X4, P2X7 and possibly other –yet unknown– ATP receptors. Interestingly, the expression of P2X7 is significantly lower in microglia compared to hematopoietic macrophages. Previous studies demonstrated that a 10-fold reduction of rat P2X7 expression levels resulted in about 50% reduction in maximum currents evoked by ATP or BzATP134. When P2X7 expression levels are too low, ATP-induced P2X7-mediated signaling might be insufficient to trigger IL-1β secretion and the contribution of other receptors, e.g. P2X4, may become more important. P2X7 expression is modulated by factors that regulate transcription (e.g. activation of transcription factors and epigenetic modifications of the P2X7 gene), translation (e.g. miRNAs), post-translational modifications (e.g. glycosylation) and oligomerization of the receptorBox ( 1)135. Interestingly, microglia, other tissue-resident macrophages and monocytes show extensive differences in their transcription factor repertoire104,106,116, in their epigenetic landscape105,106 and in their expression of miRNAs104. Whether these factors contribute to the lower expression of P2X7 and how this is regulated by regular exposure to ATP warrants further investigation. The importance of the microenvironment in developing ATP-induced responses is underlined by a study showing that even microglia derived from different brain regions respond differently to ATP exposure136.

145 Chapter 6

Box 1: Regulation of P2X7 expression P2X7 expression is modulated by factors that regulate transcription (e.g. activation of transcription factors and epigenetic modificators of the P2X7 gene), translation (e.g. miRNAs), post-translational modifications (e.g. glycosylation) and oligomerization ofthe receptor135. As we observed significantly lower P2X7 mRNA levels in microglia compared to hematopoietic macrophages, differences in transcription or degradation of theP2X7 transcript are likely at the basis of the lower P2X7 expression levels on microglia. Transcription factor analysis revealed that the promoter regions of most differentially expressed genes described in chapter 3 and 4, e.g. CASP4, P2X4, P2X7 and pro-IL-1β, share binding sites for the transcription factor NFκB (Champion ChiP Transcription Factor Search Portal, Qiagen)156. Although this points towards differences in NFkB-mediated signaling, other NFκB-sensitive gene transcripts, e.g. IL-6 and TNFα, are characterized by similar expression levels in microglia and hematopoietic macrophages. Thereby, differential regulation of NFκB-mediated signaling provides at least an incomplete explanation for the lower P2X7 expression levels observed in microglia. The P2X7 promoter region also contains multiple binding sites for AP1, STAT, YY1F, TCF/LEF1 and SP1, of which SP1 is crucial for P2X7 transcription156. SP1 is expressed and functional in microglia and hematopoietic macrophages157,158. Whether the expression or functional activity of SP1 is differentially regulated between microglia and hematopoietic macrophages warrants further investigation. In addition, epigenetic modifications, such as DNA methylation, histone modifications and chromatin remodeling are also involved in the regulation ofP2X7 transcription levels. DNA methylation can modulate the spatial conformation of transcription factor binding sites159 or interfere with the recruitment of proteins that function as adaptors between DNA and chromatin-modifying enzymes160. P2X7 expression is regulated by hypermethylation of multiple CpG sites downstream of the active promoter161 region . Demethylation of this region by using the demethylation agent 5-aza-2’-deoxycitidine has been reported to increase P2X7 expression levels161. Although it is reported that the epigenetic landscape of microglia extensively differs from other tissue-macrophages and monocytes106, it remains to be investigated whether methylation of CpG sites in the P2X7 gene differs between microglia and hematopoietic macrophages. Furthermore, the human P2X7 gene also contains target sites for micro-RNAs (miRNAs). miRNAs are small single stranded, non-coding RNAs of 18-25 nt. miRNAs can downregulate gene expression by mRNA cleavage or translational repression162,163. The P2X7 gene contains binding sites for miR22, miR150, miR186, miR216b164-168. These miRNAs negatively regulate P2X7 receptor expression in various epithelial and cancer cells164-168. Although microglia express a specific miRNA profile, which differs from other tissue macrophages and monocytes104, miR150, miR186 and miR216b were not specifically identified as microglia- enriched miRNAs. miR22 was even specifically enriched in Ly6Clow and Ly6Chigh monocytes compared to microglia104. Thus, whether these specific miRNAs are involved in regulation of P2X7 receptor expression in microglia remains to be investigated, for example by using miR22, miR150, miR186 and miR216b-specific inhibitors (e.g. antagomers)165.

146 General discussion

Interestingly, ATP-dependent chromatin-remodeling enzymes utilize the energy of ATP hydrolysis to mobilize nucleosomes along DNA, evict histones off DNA or promote the exchange of histone variants, which in turn modulate DNA accessibility and alter nucleosome structures169. These chromatin-remodeling enzymes may provide a mechanistic link between regular exposure to ATP and epigenetic changes. Whether the activity of these enzymes is indeed altered by the regular exposure to high extracellular levels of ATP, whether these enzymes are expressed in microglia and whether epigenetic changes underlie lower P2X7 expression levels all remain to be investigated. 6

Although IL-1β production and inflammasome activation has been described for other tissue- resident macrophages, e.g. alveolar, adipose tissue and intestinal macrophages137-140, there is limited knowledge on how these responses compare to other tissue-resident macrophages or monocytes. Gene expression studies revealed no apparent differences between microglia and other tissue-resident macrophages in the basal expression of IL-1β or inflammasome components, including NLRP3 and inflammatory caspases104-106,112,141. To our knowledge, functional assays comparing inflammasome activation in different tissue macrophages and monocytes have not yet been performed. More extensive functional comparison of microglia with other tissue-resident macrophages may elucidate whether the differences described in this thesis are CNS-specific or apply to tissue-resident macrophages in general.

Future perspectives

For much research described in this thesis, primary dissociated cell cultures, derived from healthy, adult rhesus macaques142, were used to study functional differences in inflammasome activation between microglia and hematopoietic macrophages. Although these in vitro models have been instrumental in delineating differences in innate immune responses between microglia and hematopoietic macrophages, they also have important limitations especially when studying tissue-specific responses. Dissociated 2D mono cell cultures loose their natural 3D tissue architecture and thereby the environmental cues that are normally provided by other CNS cell types or extracellular proteins. This may affect the activation state of the 117,119microglia and recent studies demonstrate that isolated and cultured mouse microglia loose their CNS-specific signature104,105. 3D cell culture models in which different CNS cells are included may allow further characterization of tissue-specific innate immune responses of microglia. However, isolation and extended culturing of primary neurons and oligodendrocytes from humans and NHP has proven to be difficult. Promising novel research describes the generation of CNS cells, including neurons, oligodendrocytes, astrocytes and microglia, from inducible pluripotent stem cells143. By using specific scaffolds, 3D co-cultures of CNS cells can be initiated to mimic the CNStissue architecture143. An additional option of such a model would be the introduction of hematopoietic macrophages to compare their responses to their unexposed counterparts or to microglia.

147 Chapter 6

Another model with great promise for studying immune responses in an intact CNS microenvironment is the culture of organotypic brain slices. Such models have been developed from rodent and human brain tissue, which have been used to study neurotoxicity, in situ differentiation and activation of innate immune cells, effects of therapeutic interventions and various disease-associated pathways144-152. Interestingly, microglia can be specifically depleted from these slice cultures by using chlodronate-liposomes152. Replenishing of such microglia- depleted slice cultures with exogenous macrophages145,147 provides the opportunity to study innate immune responses of hematopoietic macrophages within a CNS microenvironment as well. NHP organotypic brain slice cultures can complement the existing rodent and human models, as they provide the opportunity to initiate these cultures from adult, outbred animals without any post mortem delay. Furthermore, CNS tissue and hematopoietic macrophages can be derived from the same donor. However, such a model remains to be established and warrants further investigation. As stated above, our results suggest that microglia and infiltrating macrophages play different roles in the pathogenesis of CNS diseases. Distinguishing tissue-resident microglia from infiltrating macrophages within CNS tissue, characterizing their responses in different stages of disease and changing the physiology of neurotoxic subsets holds promise for future therapeutics for CNS pathologies153. The description of microglia-specific markers would greatly facilitate discrimination of microglia and infiltrating macrophages in post-mortem CNS tissue. Ideally, a microglia-specific marker would meet the following requirements: i) the marker is prominently expressed in microglia, but absent in other CNS cells or immune cells that infiltrate the CNS, ii) the expression of the marker is maintained upon microglia activation, iii) infiltrating macrophages do not acquire expression of the marker, iv) the marker is conserved across species, so results of animal experiments can be compared with results obtained from human post-mortem tissue, v) appropriate tools for detection of the marker are widely available. Recent advances ingene expression profiling, e.g. RNA sequencing, allow for extensive and unbiased comparison of primary microglia and microglia cell lines with other CNS cells and different sources of macrophages104,111,141,154,155. Interestingly, various independent gene expression analyses have put forward P2Y12 as a microglia-specific marker Box( 2)104,111,155. However, our results (Figure 2) are more consistent with the notion that P2Y12 is a marker for resting innate immune cells rather than being specific for microglia. This might still enable researchers to distinguish infiltrating macrophages from resident resting microglia, but might limit its use to unequivocally determine cellular origin in inflammatory lesions. Other proposed microglia-specific markers include Tmem119, Olfm3, Hexb, Siglec H, and Fcrls104,111,141,155. Unfortunately, no human (or NHP) ortologues of Siglec H and Fcrls exist (BLAST)104, limiting their use as microglia-specific marker across species. However, Tmem119, Olfm3 and Hexb hold promise as microglia-specific markers and warrant more extensive characterization. Monocytes, infiltrating macrophages and tissue-resident macrophages, including microglia are dynamic populations. Changes in their microenvironment can induce polarization, differentiation and even complete reprogramming56,105,106,111. The research presented in this thesis may help to identify traits that are cell-type specific and that are conserved, even when different cells are exposed to the same microenvironment. Our results suggest that there are possibilities to develop therapeutic strategies allowing differential manipulation of microglia and

148 General discussion

infiltrating monocytes/macrophages. For example, the use of adenosine diphosphate (ADP), uridine triphosphate (UTP) and uridine diphosphate (UDP) exclusively inhibited inflammasome activation in hematopoietic macrophages. Identification of the receptors involved in this response may lead to selective targets on hematopoietic macrophages to limit inflammasome-induced (neuro)inflammation, while leaving microglial responses unaffected. By contrast, microglia are only partially dependent on inflammatory caspases for the processing of pro-IL-1β. Delineating the alternative mechanisms that microglia employ for IL-1β secretion, could lead tonovel therapeutic strategies that specifically target microglia while leaving inflammasome-mediated 6 responses in hematopoietic macrophages intact.

Box 2: P2Y12 expression The description of microglia-specific markers would greatly facilitate research into neuroinflammatory disorders. Various independent gene expression analyses have put forward P2Y12 as microglia-specific marker, as P2Y12 expression was enriched in mouse and human microglia compared to other CNS cells and to other monocyte/macrophage subsets, including tissue-specific macrophages104,111,155. Immunohistochemical staining of mouse and human brain tissue with an anti-P2Y12 antibody identified cells with a ramified, microglia- like, morphology104. Studies using chimeric mice that express GFP exclusively in peripheral immune cells showed that recruited GFP+ monocytes in the brain of EAE mice do not express P2Y12, whereas resident GFP- microglia were positive for P2Y12 in both naïve and EAE mice104. By contrast, we describe in chapter 4 that expression of P2Y12 mRNA transcripts is not limited to or enriched in primary rhesus macaque microglia, as we observed similar expression levels in hematopoietic macrophages derived from the blood and bone marrow. These contrasting results may have been the consequence of culturing both microglia and macrophages for one week with macrophage colony-stimulating factor (M-CSF), whereas most gene expression analyses were performed directly ex vivo104,111,155. To study this in more detail, we compared P2Y12 mRNA expression levels of ex vivo microglia to those in primary microglia exposed to M-CSF (Figure 1A). We observed significantly lower P2Y12 expression levels in cultured primary microglia when compared to ex vivo microglia from the same donors. One of the published gene expression studies also included cultured microglia and showed that exposure of primary murine microglia cultures to TGFβ was sufficient to induce P2Y12 expression104. However, we did not observe differences in P2Y12 expression levels (Figure 1B) or differences in Toll-like receptor (TLR)- and inflammasome-induced activation of microglia after exposure to TGFβFigure ( 1C). In chapter 3 we show that both microglia and hematopoietic macrophages constitutively express TGFβ themselves. We also characterized the expression of TGFβ and of its receptors, TGFBR1 and TGFBR2 in ex vivo microglia and cultured microglia of the same donors. Interestingly, the expression of TGFβ as well as that of TGFBR1 and -2 was decreased upon cell culture and correlated to P2Y12 expression levels. How the expression of endogenous TGFβ in NHP microglia relates to the endogenous expression in rodent microglia remains to be investigated. Different effects of

149 Chapter 6

150 General discussion

TGFβ in mouse and human microglia have been described on e.g. IFNγ-induced MHC class II expression. Whereas TGFβ modulates IFNγ-induced MHC class II expression in rodent microglia, it does not affect IFNγ-induced MHC class II expression in human microglia170. In vitro and in situ studies have demonstrated that P2Y12 expression levels are decreased in microglia under pro-inflammatory conditions104,171,172. In line with our results in chapter 4, exposure to LPS rapidly lowers P2Y12 expression levels in rodent and human microglia171,172 and P2Y12 expression levels are upregulated in human M2-polarized microglia172. Furthermore, P2Y12 expression is absent in microglia/macrophages within MS lesions, 6 but is expressed in cells surrounding the lesion173. Together these studies imply that P2Y12 expression is a good marker for resting microglia, whereas P2Y12 may not be the most optimal marker to distinguish microglia and infiltrating macrophages during neuroinflammatory disorders.

Figure 2. P2Y12 expression in ex vivo and in 7 day cultures of dissociated primary rhesus macaque microglia. Primary microglia were isolated from brain tissue of rhesus macaques as described previously142,174 and mRNA was isolated as described in chapter 4 either directly (ex vivo) or after exposure to M-CSF (20 ng/ ml; 7 days). (A). P2Y12 mRNA expression levels in ex vivo microglia and microglia exposed to M-CSF. P2Y12 mRNA expression was determined by quantitative rt-PCR as described in chapter 4, and standardized to the reference gene β-actin175. (B). P2Y12 mRNA expression levels in primary microglia exposed to either M-CSF alone or in combination with TGFβ (50 ng/ml; 7 days) (C). LPS-induced (100 ng/ml; 4h) secretion of IL-12, TNFα and IL-6, and ATP- (5 mM; 4h) or MSU-induced (150 μg/ml; 4h) IL-1β secretion in primary microglia exposed to either M-CSF alone or in combination with TGFβ.( D). TGFβ, TGFBR1 and TGFBR2 mRNA expression in ex vivo microglia and microglia exposed to M-CSF. mRNA expression levels were determined by quantitative rt-PCR by using specific primers (TGFβ: F 5’-actactacgccaaggaggtcac-3’, R 5’-tgcttgaacttgtcatagatttcg-3’; TGFBR1: F 5’-aaattgctcgacgatgttcc-3’, R 5’-tcataataaggcagctggtaatctt-3’; TGFBR2: F 5’-gctctgggaaatgacatcg-3’, R 5’-caccttggaaccaaatggag-3’) and standardized to the reference gene β-actin.

151 Chapter 6

References

1 Compston, A. & Coles, A. Multiple sclerosis. Lancet 372, 1502-1517, doi:10.1016/S0140-6736(08)61620-7 (2008).

2 van der Valk, P. & Amor, S. Preactive lesions in multiple sclerosis.Current opinion in neurology 22, 207-213, doi:10.1097/ WCO.0b013e32832b4c76 (2009).

3 van der Valk, P. & De Groot, C. J. Staging of multiple sclerosis (MS) lesions: pathology of the time frame of MS.Neuropathology and applied neurobiology 26, 2-10 (2000).

4 Martinon, F., Mayor, A. & Tschopp, J. The inflammasomes: guardians of the body.Annu Rev Immunol 27, 229-265, doi:10.1146/ annurev.immunol.021908.132715 (2009).

5 Chakrabarti, A. et al. RNase L activates the NLRP3 inflammasome during viral infections.Cell Host Microbe 17, 466-477, doi:10.1016/j.chom.2015.02.010 (2015).

6 Petrilli, V. et al. Activation of the NALP3 inflammasome is triggered by low intracellular potassium concentration.Cell death and differentiation 14, 1583-1589, doi:10.1038/sj.cdd.4402195 (2007).

7 Wang, X. et al. RNA viruses promote activation of the NLRP3 inflammasome through a RIP1-RIP3-DRP1 signaling pathway.Nature immunology 15, 1126-1133, doi:10.1038/ni.3015 (2014).

8 Halle, A. et al. The NALP3 inflammasome is involved in the innate immune response to amyloid-beta.Nature immunology 9, 857- 865, doi:10.1038/ni.1636 (2008).

9 Liu, L. & Chan, C. IPAF inflammasome is involved in interleukin-1beta production from astrocytes, induced by palmitate; implications for Alzheimer’s Disease.Neurobiol Aging 35, 309-321, doi:10.1016/j.neurobiolaging.2013.08.016 (2014).

10 Lupfer, C. & Kanneganti, T. D. The expanding role of NLRs in antiviral immunity.Immunol Rev 255, 13-24, doi:10.1111/imr.12089 (2013).

11 Munoz-Planillo, R. et al. K(+) efflux is the common trigger of NLRP3 inflammasome activation by bacterial toxins and particulate matter.Immunity 38, 1142-1153, doi:10.1016/j.immuni.2013.05.016 (2013).

12 Zhang, W. et al. AIM2 facilitates the apoptotic DNA-induced systemic lupus erythematosus via arbitrating macrophage functional maturation.J Clin Immunol 33, 925-937, doi:10.1007/s10875-013-9881-6 (2013).

13 Zhou, R., Yazdi, A. S., Menu, P. & Tschopp, J. A role for mitochondria in NLRP3 inflammasome activation.Nature 469, 221-225, doi:10.1038/nature09663 (2011).

14 Walsh, J. G., Muruve, D. A. & Power, C. Inflammasomes in the CNS.Nat Rev Neurosci 15, 84-97, doi:10.1038/nrn3638 (2014).

15 Heneka, M. T. et al. NLRP3 is activated in Alzheimer’s disease and contributes to pathology in APP/PS1 mice.Nature 493, 674-678, doi:10.1038/nature11729 (2013).

16 Lu, M. et al. Uncoupling protein 2 deficiency aggravates astrocytic endoplasmic reticulum stress and nod-like receptor protein 3 inflammasome activation.Neurobiol Aging 35, 421-430, doi:10.1016/j.neurobiolaging.2013.08.015 (2014).

17 Wang, L. et al. Metabolic inflammation exacerbates dopaminergic neuronal degeneration in response to acute MPTP challenge in type 2 diabetes mice. Exp Neurol 251, 22-29, doi:10.1016/j.expneurol.2013.11.001 (2014). 18 McGonagle, D., Savic, S. & McDermott, M. F. The NLR network and the immunological disease continuum of adaptive and innate immune-mediated inflammation against self.Semin Immunopathol 29, 303-313, doi:10.1007/s00281-007-0084-1 (2007).

19 Dinarello, C. A. Immunological and inflammatory functions of the interleukin-1 family.Annu Rev Immunol 27, 519-550, doi:10.1146/annurev.immunol.021908.132612 (2009).

20 Garlanda, C., Dinarello, C. A. & Mantovani, A. The interleukin-1 family: back to the future. Immunity 39, 1003-1018, doi:10.1016/j. immuni.2013.11.010 (2013).

21 Sims, J. E. & Smith, D. E. The IL-1 family: regulators of immunity. Nat Rev Immunol 10, 89-102, doi:10.1038/nri2691 (2010).

22 Tamaru, M. et al. Interleukin-1beta induces tissue- and cell type-specific expression of adhesion molecules in vivo.Arterioscler Thromb Vasc Biol 18, 1292-1303 (1998). 23 Acosta-Rodriguez, E. V., Napolitani, G., Lanzavecchia, A. & Sallusto, F. Interleukins 1beta and 6 but not transforming growth factor-beta are essential for the differentiation of interleukin 17-producing human T helper cells.Nature immunology 8, 942-949, doi:10.1038/ni1496 (2007).

24 Duan, J., Chung, H., Troy, E. & Kasper, D. L. Microbial colonization drives expansion of IL-1 receptor 1-expressing and IL-17- producing gamma/delta T cells. Cell Host Microbe 7, 140-150, doi:10.1016/j.chom.2010.01.005 (2010). 25 Sutton, C., Brereton, C., Keogh, B., Mills, K. H. & Lavelle, E. C. A crucial role for interleukin (IL)-1 in the induction of IL-17-producing T cells that mediate autoimmune encephalomyelitis.J Exp Med 203, 1685-1691, doi:10.1084/jem.20060285 (2006).

26 Sutton, C. E. et al. Interleukin-1 and IL-23 induce innate IL-17 production from gammadelta T cells, amplifying Th17 responses and autoimmunity. Immunity 31, 331-341, doi:10.1016/j.immuni.2009.08.001 (2009).

152 General discussion

27 Block, M. L. & Hong, J. S. Microglia and inflammation-mediated neurodegeneration: multiple triggers with a common mechanism. Progress in neurobiology 76, 77-98, doi:10.1016/j.pneurobio.2005.06.004 (2005).

28 Gayle, D. A. et al. Lipopolysaccharide (LPS)-induced dopamine cell loss in culture: roles of tumor necrosis factor-alpha, interleukin- 1beta, and nitric oxide. Brain Res Dev Brain Res 133, 27-35 (2002).

29 Long-Smith, C. M., Sullivan, A. M. & Nolan, Y. M. The influence of microglia on the pathogenesis of Parkinson’s disease.Progress in neurobiology 89, 277-287, doi:10.1016/j.pneurobio.2009.08.001 (2009).

30 Ferrari, C. C. et al. Reversible demyelination, blood-brain barrier breakdown, and pronounced neutrophil recruitment induced by chronic IL-1 expression in the brain. Am J Pathol 165, 1827-1837, doi:10.1016/S0002-9440(10)63438-4 (2004).

31 Griffin, W. S., Liu, L., Li, Y., Mrak, R. E. & Barger, S. W. Interleukin-1 mediates Alzheimer and Lewy body pathologies.Journal of neuroinflammation 3, 5, doi:10.1186/1742-2094-3-5 (2006). 6 32 Hickman, S. E., Allison, E. K. & El Khoury, J. Microglial dysfunction and defective beta-amyloid clearance pathways in aging Alzheimer’s disease mice. The Journal of neuroscience : the official journal of the Society for Neuroscience 28, 8354-8360, doi:10.1523/JNEUROSCI.0616-08.2008 (2008).

33 Jana, M. & Pahan, K. Redox regulation of cytokine-mediated inhibition of myelin gene expression in human primary oligodendrocytes. Free Radic Biol Med 39, 823-831, doi:10.1016/j.freeradbiomed.2005.05.014 (2005).

34 Mogi, M. et al. Interleukin-1 beta, interleukin-6, epidermal growth factor and transforming growth factor-alpha are elevated in the brain from parkinsonian patients.Neurosci Lett 180, 147-150 (1994).

35 Blum-Degen, D. et al. Interleukin-1 beta and interleukin-6 are elevated in the cerebrospinal fluid of Alzheimer’s and de novo Parkinson’s disease patients.Neurosci Lett 202, 17-20 (1995).

36 Cacabelos, R. et al. Brain interleukin-1 beta in Alzheimer’s disease and vascular dementia.Methods Find Exp Clin Pharmacol 16, 141-151 (1994).

37 Licastro, F. et al. Increased plasma levels of interleukin-1, interleukin-6 and alpha-1-antichymotrypsin in patients with Alzheimer’s disease: peripheral inflammation or signals from the brain?Journal of neuroimmunology 103, 97-102 (2000).

40 Romme Christensen, J. et al. Cellular sources of dysregulated cytokines in relapsing-remitting multiple sclerosis.Journal of neuroinflammation 9, 215, doi:10.1186/1742-2094-9-215 (2012).

41 Rossi, S. et al. Cerebrospinal fluid detection of interleukin-1beta in phase of remission predicts disease progression in multiple sclerosis. Journal of neuroinflammation 11, 32, doi:10.1186/1742-2094-11-32 (2014).

42 Seppi, D. et al. Cerebrospinal fluid IL-1beta correlates with cortical pathology load in multiple sclerosis at clinical onset.Journal of neuroimmunology 270, 56-60, doi:10.1016/j.jneuroim.2014.02.014 (2014).

43 Prins, M. et al. Interleukin-1beta and interleukin-1 receptor antagonist appear in grey matter additionally to white matter lesions during experimental multiple sclerosis.PloS one 8, e83835, doi:10.1371/journal.pone.0083835 (2013). 44 Bauer, J., Berkenbosch, F., Van Dam, A. M. & Dijkstra, C. D. Demonstration of interleukin-1 beta in Lewis rat brain during experimental allergic encephalomyelitis by immunocytochemistry at the light and ultrastructural level.Journal of neuroimmunology 48, 13-21 (1993).

45 Vainchtein, I. D. et al. In acute experimental autoimmune encephalomyelitis, infiltrating macrophages are immune activated, whereas microglia remain immune suppressed. Glia 62, 1724-1735, doi:10.1002/glia.22711 (2014).

46 Kawana, N. et al. Reactive astrocytes and perivascular macrophages express NLRP3 inflammasome in active demyelinating lesions of multiple sclerosis and necrotic lesions of neuromyelitis optica and cerebral infarction.Clinical and Experimental Neuroimmunology 4, 296-304 (2013). 47 Brosnan, C. F., Cannella, B., Battistini, L. & Raine, C. S. Cytokine localization in multiple sclerosis lesions: correlation with adhesion molecule expression and reactive nitrogen species.Neurology 45, S16-21 (1995).

48 Cannella, B. & Raine, C. S. The adhesion molecule and cytokine profile of multiple sclerosis lesions.Annals of neurology 37, 424- 435, doi:10.1002/ana.410370404 (1995).

49 Boven, L. A. et al. Myelin-laden macrophages are anti-inflammatory, consistent with foam cells in multiple sclerosis. Brain : a journal of neurology 129, 517-526, doi:10.1093/brain/awh707 (2006).

50 Kitic, M. et al. Intrastriatal injection of interleukin-1 beta triggers the formation of neuromyelitis optica-like lesions in NMO-IgG seropositive rats.Acta Neuropathol Commun 1, 5, doi:10.1186/2051-5960-1-5 (2013). 51 Goebeler, M., Roth, J., Henseleit, U., Sunderkotter, C. & Sorg, C. Expression and complex assembly of calcium-binding proteins MRP8 and MRP14 during differentiation of murine myelomonocytic cells.J Leukoc Biol 53, 11-18 (1993).

153 Chapter 6

52 Lagasse, E. & Clerc, R. G. Cloning and expression of two human genes encoding calcium-binding proteins that are regulated during myeloid differentiation.Mol Cell Biol 8, 2402-2410 (1988).

53 Yamasaki, R. et al. Differential roles of microglia and monocytes in the inflamed central nervous system.J Exp Med 211, 1533-1549, doi:10.1084/jem.20132477 (2014).

54 van Horssen, J. et al. Clusters of activated microglia in normal-appearing white matter show signs of innate immune activation. Journal of neuroinflammation 9, 156, doi:10.1186/1742-2094-9-156 (2012).

55 De Groot, C. J. et al. Post-mortem MRI-guided sampling of multiple sclerosis brain lesions: increased yield of active demyelinating and (p)reactive lesions.Brain : a journal of neurology 124, 1635-1645 (2001).

56 Peferoen, L. A. et al. Activation status of human microglia is dependent on lesion formation stage and remyelination in multiple sclerosis. Journal of neuropathology and experimental neurology 74, 48-63, doi:10.1097/NEN.0000000000000149 (2015).

57 Vogel, D. Y. et al. Macrophages in inflammatory multiple sclerosis lesions have an intermediate activation status.Journal of neuroinflammation 10, 35, doi:10.1186/1742-2094-10-35 (2013). 58 Martinon, F., Burns, K. & Tschopp, J. The inflammasome: a molecular platform triggering activation of inflammatory caspases and processing of proIL-beta. Mol Cell 10, 417-426 (2002).

59 Stutz, A., Horvath, G. L., Monks, B. G. & Latz, E. ASC speck formation as a readout for inflammasome activation.Methods Mol Biol 1040, 91-101, doi:10.1007/978-1-62703-523-1_8 (2013).

60 Man, S. M. et al. Inflammasome activation causes dual recruitment of NLRC4 and NLRP3 to the same macromolecular complex. Proceedings of the National Academy of Sciences of the United States of America 111, 7403-7408, doi:10.1073/pnas.1402911111 (2014).

61 Stys, P. K., Zamponi, G. W., van Minnen, J. & Geurts, J. J. Will the real multiple sclerosis please stand up?Nat Rev Neurosci 13, 507- 514, doi:10.1038/nrn3275 (2012).

62 Codolo, G. et al. Triggering of inflammasome by aggregated alpha-synuclein, an inflammatory response in synucleinopathies.PloS one 8, e55375, doi:10.1371/journal.pone.0055375 (2013).

63 Freeman, D. et al. Alpha-synuclein induces lysosomal rupture and cathepsin dependent reactive oxygen species following endocytosis. PloS one 8, e62143, doi:10.1371/journal.pone.0062143 (2013). 64 Meissner, F., Molawi, K. & Zychlinsky, A. Mutant superoxide dismutase 1-induced IL-1beta accelerates ALS pathogenesis. Proceedings of the National Academy of Sciences of the United States of America 107, 13046-13050, doi:10.1073/ pnas.1002396107 (2010).

65 Parajuli, B. et al. Oligomeric amyloid beta induces IL-1beta processing via production of ROS: implication in Alzheimer’s disease. Cell Death Dis 4, e975, doi:10.1038/cddis.2013.503 (2013).

66 Wu, Z. et al. Differential pathways for interleukin-1beta production activated by chromogranin A and amyloid beta in microglia. Neurobiol Aging 34, 2715-2725, doi:10.1016/j.neurobiolaging.2013.05.018 (2013).

67 Bsibsi, M. et al. Alpha-B-crystallin induces an immune-regulatory and antiviral microglial response in preactive multiple sclerosis lesions. Journal of neuropathology and experimental neurology 72, 970-979, doi:10.1097/NEN.0b013e3182a776bf (2013).

68 Singh, S. et al. Microglial nodules in early multiple sclerosis white matter are associated with degenerating axons.Acta neuropathologica 125, 595-608, doi:10.1007/s00401-013-1082-0 (2013).

69 Haider, L. et al. Oxidative damage in multiple sclerosis lesions.Brain : a journal of neurology 134, 1914-1924, doi:10.1093/brain/ awr128 (2011).

70 Mycko, M. P., Brosnan, C. F., Raine, C. S., Fendler, W. & Selmaj, K. W. Transcriptional profiling of microdissected areas of active multiple sclerosis lesions reveals activation of heat shock protein genes.J Neurosci Res 90, 1941-1948, doi:10.1002/jnr.23079 (2012).

71 Hanamsagar, R., Hanke, M. L. & Kielian, T. Toll-like receptor (TLR) and inflammasome actions in the central nervous system.Trends Immunol 33, 333-342, doi:10.1016/j.it.2012.03.001 (2012). 72 Yang, H., Wang, H., Chavan, S. S. & Andersson, U. High Mobility Group Box Protein 1 (HMGB1): The Prototypical Endogenous Danger Molecule. Mol Med 21 Suppl 1, S6-S12, doi:10.2119/molmed.2015.00087 (2015). 73 Bajramovic, J. J., Lassmann, H. & van Noort, J. M. Expression of alphaB-crystallin in glia cells during lesional development in multiple sclerosis.Journal of neuroimmunology 78, 143-151 (1997).

74 Coll, R. C. et al. A small-molecule inhibitor of the NLRP3 inflammasome for the treatment of inflammatory diseases.Nat Med 21, 248-255, doi:10.1038/nm.3806 (2015).

75 Furlan, R. et al. HSV-1-mediated IL-1 receptor antagonist gene therapy ameliorates MOG(35-55)-induced experimental autoimmune encephalomyelitis in C57BL/6 mice.Gene Ther 14, 93-98, doi:10.1038/sj.gt.3302805 (2007). 76 Martin, D. & Near, S. L. Protective effect of the interleukin-1 receptor antagonist (IL-1ra) on experimental allergic encephalomyelitis in rats. Journal of neuroimmunology 61, 241-245 (1995).

154 General discussion

77 Matsuki, T., Nakae, S., Sudo, K., Horai, R. & Iwakura, Y. Abnormal T cell activation caused by the imbalance of the IL-1/IL-1R antagonist system is responsible for the development of experimental autoimmune encephalomyelitis.Int Immunol 18, 399-407, doi:10.1093/intimm/dxh379 (2006).

78 Wiemann, B. et al. Combined treatment of acute EAE in Lewis rats with TNF-binding protein and interleukin-1 receptor antagonist. Exp Neurol 149, 455-463, doi:10.1006/exnr.1997.6723 (1998). 79 Dinarello, C. A., Simon, A. & van der Meer, J. W. Treating inflammation by blocking interleukin-1 in a broad spectrum of diseases. Nat Rev Drug Discov 11, 633-652, doi:10.1038/nrd3800 (2012).

80 Burger, D. et al. Glatiramer acetate increases IL-1 receptor antagonist but decreases T cell-induced IL-1beta in human monocytes and multiple sclerosis.Proceedings of the National Academy of Sciences of the United States of America 106, 4355-4359, doi:10.1073/pnas.0812183106 (2009).

81 Comabella, M. et al. Induction of serum soluble tumor necrosis factor receptor II (sTNF-RII) and interleukin-1 receptor antagonist 6 (IL-1ra) by interferon beta-1b in patients with progressive multiple sclerosis.Journal of neurology 255, 1136-1141, doi:10.1007/ s00415-008-0855-1 (2008).

82 Guarda, G. et al. Type I interferon inhibits interleukin-1 production and inflammasome activation.Immunity 34, 213-223, doi:10.1016/j.immuni.2011.02.006 (2011).

83 Hernandez-Cuellar, E. et al. Cutting edge: nitric oxide inhibits the NLRP3 inflammasome.Journal of immunology 189, 5113-5117, doi:10.4049/jimmunol.1202479 (2012).

84 Inoue, M. et al. Interferon-beta Therapy Against EAE Is Effective Only When Development of the Disease Depends on the NLRP3 Inflammasome.Sci Signal 5, ra38, doi:10.1126/scisignal.2002767 (2012).

85 Italiani, P. & Boraschi, D. New Insights Into Tissue Macrophages: From Their Origin to the Development of Memory. Immune Netw 15, 167-176, doi:10.4110/in.2015.15.4.167 (2015).

86 Ginhoux, F. et al. Fate mapping analysis reveals that adult microglia derive from primitive macrophages.Science 330, 841-845, doi:10.1126/science.1194637 (2010).

87 Schulz, C. et al. A lineage of myeloid cells independent of Myb and hematopoietic stem cells.Science 336, 86-90, doi:10.1126/ science.1219179 (2012).

88 Yona, S. et al. Fate mapping reveals origins and dynamics of monocytes and tissue macrophages under homeostasis.Immunity 38, 79-91, doi:10.1016/j.immuni.2012.12.001 (2013).

89 Kierdorf, K. et al. Microglia emerge from erythromyeloid precursors via Pu.1- and Irf8-dependent pathways. Nature neuroscience 16, 273-280, doi:10.1038/nn.3318 (2013).

90 Bain, C. C. et al. Constant replenishment from circulating monocytes maintains the macrophage pool in the intestine of adult mice. Nature immunology 15, 929-937, doi:10.1038/ni.2967 (2014).

91 Gomez Perdiguero, E. et al. Tissue-resident macrophages originate from yolk-sac-derived erythro-myeloid progenitors. Nature 518, 547-551, doi:10.1038/nature13989 http://www.nature.com/nature/journal/v518/n7540/abs/nature13989.html - supplementary-information (2015).

92 Ajami, B., Bennett, J. L., Krieger, C., Tetzlaff, W. & Rossi, F. M. Local self-renewal can sustain CNS microglia maintenance and function throughout adult life. Nature neuroscience 10, 1538-1543, doi:10.1038/nn2014 (2007). 93 Schonbeck, U., Mach, F. & Libby, P. Generation of biologically active IL-1 beta by matrix metalloproteinases: a novel caspase-1- independent pathway of IL-1 beta processing. Journal of immunology 161, 3340-3346 (1998). 94 Edye, M. E., Lopez-Castejon, G., Allan, S. M. & Brough, D. Acidosis drives damage-associated molecular pattern (DAMP)-induced interleukin-1 secretion via a caspase-1-independent pathway.The Journal of biological chemistry 288, 30485-30494, doi:10.1074/ jbc.M113.478941 (2013).

95 Cassel, S. L. et al. Inflammasome-independent IL-1beta mediates autoinflammatory disease in Pstpip2-deficient mice.Proceedings of the National Academy of Sciences of the United States of America 111, 1072-1077, doi:10.1073/pnas.1318685111 (2014).

96 Joosten, L. A. et al. Inflammatory arthritis in caspase 1 gene-deficient mice: contribution of proteinase 3 to caspase 1-independent production of bioactive interleukin-1beta.Arthritis and rheumatism 60, 3651-3662, doi:10.1002/art.25006 (2009). 97 Karmakar, M., Sun, Y., Hise, A. G., Rietsch, A. & Pearlman, E. Cutting edge: IL-1beta processing during Pseudomonas aeruginosa infection is mediated by neutrophil serine proteases and is independent of NLRC4 and caspase-1.Journal of immunology 189, 4231-4235, doi:10.4049/jimmunol.1201447 (2012).

98 Stehlik, C. Multiple interleukin-1beta-converting enzymes contribute to inflammatory arthritis.Arthritis and rheumatism 60, 3524- 3530, doi:10.1002/art.24961 (2009).

99 Greenhalgh, A. D. & David, S. Differences in the phagocytic response of microglia and peripheral macrophages after spinal cord injury and its effects on cell death.The Journal of neuroscience : the official journal of the Society for Neuroscience 34, 6316-6322, doi:10.1523/JNEUROSCI.4912-13.2014 (2014).

100 Ajami, B., Bennett, J. L., Krieger, C., McNagny, K. M. & Rossi, F. M. Infiltrating monocytes trigger EAE progression, but do not contribute to the resident microglia pool. Nature neuroscience 14, 1142-1149, doi:10.1038/nn.2887 (2011).

155 Chapter 6

101 Brendecke, S. M. & Prinz, M. Do not judge a cell by its cover-diversity of CNS resident, adjoining and infiltrating myeloid cells in inflammation.Semin Immunopathol 37, 591-605, doi:10.1007/s00281-015-0520-6 (2015). 102 Lewis, N. D., Hill, J. D., Juchem, K. W., Stefanopoulos, D. E. & Modis, L. K. RNA sequencing of microglia and monocyte-derived macrophages from mice with experimental autoimmune encephalomyelitis illustrates a changing phenotype with disease course. Journal of neuroimmunology 277, 26-38, doi:10.1016/j.jneuroim.2014.09.014 (2014).

103 Shemer, A. & Jung, S. Differential roles of resident microglia and infiltrating monocytes in murine CNS autoimmunity.Semin Immunopathol 37, 613-623, doi:10.1007/s00281-015-0519-z (2015).

104 Butovsky, O. et al. Identification of a unique TGF-beta-dependent molecular and functional signature in microglia.Nature neuroscience 17, 131-143, doi:10.1038/nn.3599 (2014).

105 Gosselin, D. et al. Environment drives selection and function of enhancers controlling tissue-specific macrophage identities.Cell 159, 1327-1340, doi:10.1016/j.cell.2014.11.023 (2014).

106 Lavin, Y. et al. Tissue-resident macrophage enhancer landscapes are shaped by the local microenvironment. Cell 159, 1312-1326, doi:10.1016/j.cell.2014.11.018 (2014).

107 Amit, I., Winter, D. R. & Jung, S. The role of the local environment and epigenetics in shaping macrophage identity and their effect on tissue homeostasis.Nature immunology 17, 18-25, doi:10.1038/ni.3325 (2015).

108 Marin-Teva, J. L. et al. Microglia promote the death of developing Purkinje cells. Neuron 41, 535-547 (2004).

109 Schafer, D. P. et al. Microglia sculpt postnatal neural circuits in an activity and complement-dependent manner.Neuron 74, 691- 705, doi:10.1016/j.neuron.2012.03.026 (2012).

110 Sierra, A. et al. Microglia shape adult hippocampal neurogenesis through apoptosis-coupled phagocytosis. Cell Stem Cell 7, 483- 495, doi:10.1016/j.stem.2010.08.014 (2010).

111 Hickman, S. E. et al. The microglial sensome revealed by direct RNA sequencing. Nature neuroscience 16, 1896-1905, doi:10.1038/ nn.3554 (2013).

112 Gautier, E. L. et al. Gene-expression profiles and transcriptional regulatory pathways that underlie the identity and diversity of mouse tissue macrophages.Nature immunology 13, 1118-1128, doi:10.1038/ni.2419 (2012).

113 Gautier, E. L. et al. Gata6 regulates aspartoacylase expression in resident peritoneal macrophages and controls their survival. J Exp Med 211, 1525-1531, doi:10.1084/jem.20140570 (2014).

114 Haldar, M. et al. Heme-mediated SPI-C induction promotes monocyte differentiation into iron-recycling macrophages. Cell 156, 1223-1234, doi:10.1016/j.cell.2014.01.069 (2014).

115 Okabe, Y. & Medzhitov, R. Tissue-specific signals control reversible program of localization and functional polarization of macrophages. Cell 157, 832-844, doi:10.1016/j.cell.2014.04.016 (2014).

116 Cohen, M. et al. Chronic exposure to TGFbeta1 regulates myeloid cell inflammatory response in an IRF7-dependent manner.EMBO J 33, 2906-2921, doi:10.15252/embj.201489293 (2014).

117 Ransohoff, R. M. & Cardona, A. E. The myeloid cells of the central nervous system parenchyma.Nature 468, 253-262, doi:10.1038/ nature09615 (2010).

118 Bajramovic, J. J. Regulation of innate immune responses in the central nervous system.CNS Neurol Disord Drug Targets 10, 4-24 (2011).

119 Hoek, R. M. et al. Down-regulation of the macrophage lineage through interaction with OX2 (CD200).Science 290, 1768-1771 (2000).

120 Ferrari, D., Chiozzi, P., Falzoni, S., Hanau, S. & Di Virgilio, F. Purinergic modulation of interleukin-1 beta release from microglial cells stimulated with bacterial endotoxin.J Exp Med 185, 579-582 (1997).

121 Franke, H., Krugel, U. & Illes, P. P2 receptors and neuronal injury. Pflugers Arch 452, 622-644, doi:10.1007/s00424-006-0071-8 (2006).

122 Idzko, M., Ferrari, D. & Eltzschig, H. K. Nucleotide signalling during inflammation.Nature 509, 310-317, doi:10.1038/nature13085 (2014).

123 Fiebich, B. L., Akter, S. & Akundi, R. S. The two-hit hypothesis for neuroinflammation: role of exogenous ATP in modulating inflammation in the brain.Front Cell Neurosci 8, 260, doi:10.3389/fncel.2014.00260 (2014). 124 Filippini, A., Taffs, R. E. & Sitkovsky, M. V. Extracellular ATP in T-lymphocyte activation: possible role in effector functions. Proceedings of the National Academy of Sciences of the United States of America 87, 8267-8271 (1990).

125 Sanz, J. M. & Di Virgilio, F. Kinetics and mechanism of ATP-dependent IL-1 beta release from microglial cells.Journal of immunology 164, 4893-4898 (2000).

126 Burnstock, G. Physiology and pathophysiology of purinergic neurotransmission. Physiol Rev 87, 659-797, doi:10.1152/ physrev.00043.2006 (2007).

127 Coco, S. et al. Storage and release of ATP from astrocytes in culture. The Journal of biological chemistry 278, 1354-1362, doi:10.1074/jbc.M209454200 (2003).

156 General discussion

128 Fields, R. D. & Burnstock, G. Purinergic signalling in neuron-glia interactions.Nat Rev Neurosci 7, 423-436, doi:10.1038/nrn1928 (2006).

129 Montana, V., Malarkey, E. B., Verderio, C., Matteoli, M. & Parpura, V. Vesicular transmitter release from astrocytes.Glia 54, 700- 715, doi:10.1002/glia.20367 (2006).

130 Richler, E., Chaumont, S., Shigetomi, E., Sagasti, A. & Khakh, B. S. Tracking transmitter-gated P2X cation channel activation in vitro and in vivo. Nat Methods 5, 87-93, doi:10.1038/nmeth1144 (2008).

131 Sperlagh, B. & Sylvester Vizi, E. Neuronal synthesis, storage and release of ATP. Seminars in the neurosciences 8, 175-186 (1996). 132 Stout, C. E., Costantin, J. L., Naus, C. C. & Charles, A. C. Intercellular calcium signaling in astrocytes via ATP release through connexin hemichannels. The Journal of biological chemistry 277, 10482-10488, doi:10.1074/jbc.M109902200 (2002). 133 Zimmermann, H. Signalling via ATP in the nervous system. Trends in neurosciences 17, 420-426 (1994). 6 134 Young, M. T., Pelegrin, P. & Surprenant, A. Amino acid residues in the P2X7 receptor that mediate differential sensitivity to ATP and BzATP. Mol Pharmacol 71, 92-100, doi:10.1124/mol.106.030163 (2007).

135 Gorodeski, G. I. P2X7-mediated chemoprevention of epithelial cancers.Expert Opin Ther Targets 13, 1313-1332, doi:10.1517/14728220903277249 (2009).

136 Lai, A. Y., Dhami, K. S., Dibal, C. D. & Todd, K. G. Neonatal rat microglia derived from different brain regions have distinct activation responses. Neuron Glia Biol 7, 5-16, doi:10.1017/S1740925X12000154 (2011).

137 Bi, J. et al. Porcine reproductive and respiratory syndrome virus induces IL-1beta production depending on TLR4/MyD88 pathway and NLRP3 inflammasome in primary porcine alveolar macrophages.Mediators Inflamm 2014, 403515, doi:10.1155/2014/403515 (2014).

138 Filardy, A. A., He, J., Bennink, J., Yewdell, J. & Kelsall, B. L. Posttranscriptional control of NLRP3 inflammasome activation in colonic macrophages. Mucosal Immunol, doi:10.1038/mi.2015.109 (2015).

139 Morris, D. L., Singer, K. & Lumeng, C. N. Adipose tissue macrophages: phenotypic plasticity and diversity in lean and obese states. Curr Opin Clin Nutr Metab Care 14, 341-346, doi:10.1097/MCO.0b013e328347970b (2011).

140 Wu, J. et al. Activation of NLRP3 inflammasome in alveolar macrophages contributes to mechanical stretch-induced lung inflammation and injury.Journal of immunology 190, 3590-3599, doi:10.4049/jimmunol.1200860 (2013).

141 Chiu, I. M. et al. A neurodegeneration-specific gene-expression signature of acutely isolated microglia from an amyotrophic lateral sclerosis mouse model. Cell reports 4, 385-401, doi:10.1016/j.celrep.2013.06.018 (2013).

142 Zuiderwijk-Sick, E. A. et al. Differentiation of primary adult microglia alters their response to TLR8-mediated activation but not their capacity as APC. Glia 55, 1589-1600, doi:10.1002/glia.20572 (2007).

143 Schwartz, M. P. et al. Human pluripotent stem cell-derived neural constructs for predicting neural toxicity.Proceedings of the National Academy of Sciences of the United States of America 112, 12516-12521, doi:10.1073/pnas.1516645112 (2015).

144 Chaichana, K. L. et al. Preservation of glial cytoarchitecture from ex vivo human tumor and non-tumor cerebral cortical explants: A human model to study neurological diseases. J Neurosci Methods 164, 261-270, doi:10.1016/j.jneumeth.2007.05.008 (2007).

145 Girard, S. et al. Microglia and macrophages differentially modulate cell death after brain injury caused by oxygen-glucose deprivation in organotypic brain slices.Glia 61, 813-824, doi:10.1002/glia.22478 (2013).

146 Immig, K. et al. CD11c-positive cells from brain, spleen, lung, and liver exhibit site-specific immune phenotypes and plastically adapt to new environments. Glia 63, 611-625, doi:10.1002/glia.22771 (2015). 147 Masuch, A., Shieh, C. H., van Rooijen, N., van Calker, D. & Biber, K. Mechanism of microglia neuroprotection: Involvement of P2X7, TNFalpha, and valproic acid. Glia, doi:10.1002/glia.22904 (2015).

148 Merz, F. et al. Tissue slice cultures from humans or rodents: a new tool to evaluate biological effects of heavy ions.Radiat Environ Biophys 49, 457-462, doi:10.1007/s00411-010-0293-1 (2010).

149 Miron, V. E. et al. Fingolimod (FTY720) enhances remyelination following demyelination of organotypic cerebellar slices.Am J Pathol 176, 2682-2694, doi:10.2353/ajpath.2010.091234 (2010).

150 Mitrasinovic, O. M. et al. Microglia overexpressing the macrophage colony-stimulating factor receptor are neuroprotective in a microglial-hippocampal organotypic coculture system. The Journal of neuroscience : the official journal of the Society for Neuroscience 25, 4442-4451, doi:10.1523/JNEUROSCI.0514-05.2005 (2005).

151 Verwer, R. W. et al. Cells in human postmortem brain tissue slices remain alive for several weeks in culture.FASEB J 16, 54-60, doi:10.1096/fj.01-0504com (2002).

152 Vinet, J. et al. Neuroprotective function for ramified microglia in hippocampal excitotoxicity.Journal of neuroinflammation 9, 27, doi:10.1186/1742-2094-9-27 (2012).

153 Bogie, J. F., Stinissen, P. & Hendriks, J. J. Macrophage subsets and microglia in multiple sclerosis.Acta neuropathologica 128, 191- 213, doi:10.1007/s00401-014-1310-2 (2014).

154 Holtman, I. R. et al. Induction of a common microglia gene expression signature by aging and neurodegenerative conditions: a co- expression meta-analysis. Acta Neuropathol Commun 3, 31, doi:10.1186/s40478-015-0203-5 (2015).

157 Chapter 6

155 Zhang, Y. et al. An RNA-sequencing transcriptome and splicing database of glia, neurons, and vascular cells of the cerebral cortex. The Journal of neuroscience : the official journal of the Society for Neuroscience 34, 11929-11947, doi:10.1523/ JNEUROSCI.1860-14.2014 (2014).

156 Garcia-Huerta, P. et al. The specificity protein factor Sp1 mediates transcriptional regulation of P2X7 receptors in the nervous system. The Journal of biological chemistry 287, 44628-44644, doi:10.1074/jbc.M112.390971 (2012).

157 Clarke, S. & Gordon, S. Myeloid-specific gene expression.J Leukoc Biol 63, 153-168 (1998).

158 Oh, Y. T. et al. Lipopolysaccharide induces hypoxia-inducible factor-1 alpha mRNA expression and activation via NADPH oxidase and Sp1-dependent pathway in BV2 murine microglial cells. Neurosci Lett 431, 155-160, doi:10.1016/j.neulet.2007.11.033 (2008). 159 Comb, M. & Goodman, H. M. CpG methylation inhibits proenkephalin gene expression and binding of the transcription factor AP-2. Nucleic Acids Res 18, 3975-3982 (1990).

160 Wade, P. A. Methyl CpG binding proteins: coupling chromatin architecture to gene regulation.Oncogene 20, 3166-3173, doi:10.1038/sj.onc.1204340 (2001).

161 Zhou, L., Luo, L., Qi, X., Li, X. & Gorodeski, G. I. Regulation of P2X(7) gene transcription.Purinergic Signal 5, 409-426, doi:10.1007/ s11302-009-9167-x (2009).

162 Ambros, V. The functions of animal microRNAs. Nature 431, 350-355, doi:10.1038/nature02871 (2004).

163 Bartel, D. P. MicroRNAs: genomics, biogenesis, mechanism, and function.Cell 116, 281-297 (2004).

164 Huang, S. et al. miR-150 promotes human breast cancer growth and malignant behavior by targeting the pro-apoptotic purinergic P2X7 receptor. PloS one 8, e80707, doi:10.1371/journal.pone.0080707 (2013).

165 Jimenez-Mateos, E. M. et al. microRNA targeting of the P2X7 purinoceptor opposes a contralateral epileptogenic focus in the hippocampus. Sci Rep 5, 17486, doi:10.1038/srep17486 (2015).

166 Weng, T. et al. Regulation of lung surfactant secretion by microRNA-150.Biochemical and biophysical research communications 422, 586-589, doi:10.1016/j.bbrc.2012.05.030 (2012).

167 Zheng, L. et al. Regulation of the P2X7R by microRNA-216b in human breast cancer.Biochemical and biophysical research communications 452, 197-204, doi:10.1016/j.bbrc.2014.07.101 (2014). 168 Zhou, L., Qi, X., Potashkin, J. A., Abdul-Karim, F. W. & Gorodeski, G. I. MicroRNAs miR-186 and miR-150 down-regulate expression of the pro-apoptotic purinergic P2X7 receptor by activation of instability sites at the 3’-untranslated region of the gene that decrease steady-state levels of the transcript. The Journal of biological chemistry 283, 28274-28286, doi:10.1074/jbc.M802663200 (2008).

169 Wang, G. G., Allis, C. D. & Chi, P. Chromatin remodeling and cancer, Part II: ATP-dependent chromatin remodeling.Trends Mol Med 13, 373-380, doi:10.1016/j.molmed.2007.07.004 (2007).

170 Smith, A. M. & Dragunow, M. The human side of microglia. Trends in neurosciences 37, 125-135, doi:10.1016/j.tins.2013.12.001 (2014).

171 Haynes, S. E. et al. The P2Y12 receptor regulates microglial activation by extracellular nucleotides.Nature neuroscience 9, 1512- 1519, doi:10.1038/nn1805 (2006).

172 Moore, C. S. et al. P2Y12 expression and function in alternatively activated human microglia.Neurol Neuroimmunol Neuroinflamm 2, e80, doi:10.1212/NXI.0000000000000080 (2015).

173 Amadio, S. et al. P2Y12 receptor protein in cortical gray matter lesions in multiple sclerosis.Cereb Cortex 20, 1263-1273, doi:10.1093/cercor/bhp193 (2010).

174 Olah, M. et al. An optimized protocol for the acute isolation of human microglia from autopsy brain samples.Glia 60, 96-111, doi:10.1002/glia.21251 (2012).

175 Pfaffl, M. W. A new mathematical model for relative quantification in real-time NucleicRT-PCR. Acids Res 29, e45 (2001).

158

Appendices 162 Abbreviations

Abbreviations

AD Alzheimer’s disease AIM2 absent in melanoma 2 AP1 activator protein 1 ASC apoptosis-associated speck-like protein containing a caspase recruitment domain ADP adenosine 5’-diphosphate ATP adenosine 5’-triphosphate BBB blood-brain barrier BDNF brain derived neurotrophic factor BIR baculoviral IAP repeat BzATP benzoyl adenosine 5’-triphosphate CARD caspase recruitment domain CARDINAL CARD inhibitor of NF-κB-activating ligands CASP caspase CCL C-C motif ligand CCR C-C motif receptor CD cluster of differentiation CD200R CD200 receptor CNS central nervous system COP CARD-only protein CR complement receptor CSF cerebrospinal fluid CXCL C-X-C motif ligand CXCR C-X-C motif receptor CX3CL C-X3-C motif ligand CX3CR C-X3-C motif receptor DAMP danger-associated molecular pattern DC dendritic cell DNA deoxyribonucleic acid EAE experimental autoimmune encephalomyelitis EBP end binding protein FcR Fc receptor FIIND function to find GFP green fluorescent protein HIV human immunodeficiency virus HLA human leukocyte antigen HMGB high mobility group box Hsp heat shock protein Iba ionized calcium binding adaptor molecule ICE IL-1β converting enzyme IFN interferon IGF insulin-like growth factor

163 Abbreviations

IL interleukin IL-1R IL-1 receptor IL-1RA IL-1 receptor antagonist INCA inhibitory CARD IPAF ICE-protease activating factor iPS inducible pluripotent stem cell IRF interferon regulatory factor JEV Japanese encephalitis virus LPS lipopolysaccharide LRR leucine rich repeat MALT mucosa-associated lymphoid tissue lymphoma-translocation gene M-CSF macrophage colony stimulating factor MCP monocyte chemotactic protein MFG-E8 milk fat globule-EGF-factor 8 MHC major histocompatibility complex MIP macrophages inflammatory protein MMP matrix metallopeptidase MOG myelin oligodendrocyte glycoprotein MPTP 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine MR mannose receptor MRI magnetic resonance imaging MRP myeloid-related protein MS multiple sclerosis MSU monosodium urate MyD88 myeloid differentiation primary response 88 NACHT NAIP, C2TA (MHC class 2 transcription activator), HET-E (incompatibility locus protein from Podospora arsina) and TP1 (telomerase-associated domain) NADPH nicotinamide adenine dinucleotide phosphate NAIP neuronal apoptosis inhibitor protein NALP NACHT-, LRR-, and PYD-containing protein NAWM normal appearing white matter NFκB nuclear factor κ B NGF nerve growth factor NHP non-human primate NLR NOD-like receptor NLRC NLR family, CARD-domain containing NLRP NLR family, pyrin domain containing NOD nucleotide- binding oligomerization domain PAMP pathogen-associated molecular pattern PD Parkinson’s disease PKR double stranded RNA-activated protein kinase PLP proteolipid protein POP pyrin-only protein

164 Abbreviations

PPMS primary progressive multiple sclerosis PRR pattern recognition receptor PtdSer phosphatidylserine PYD pyrin domain RLR retinoic acid-inducible gene I-like receptor ROS reactive oxygen species RRMS relapsing remitting multiple sclerosis SOD superoxide dismutase SPF specific pathogen free SPMS secondary progressive multiple sclerosis TIM-4 T cell immunoglobulin mucin 4 TGF transforming growth factor Th T helper TLR Toll-like receptor TNF tumor-necrosis factor TREM triggering receptor expressed on myeloid cells UDP uridine 5’-diphosphate UTP uridine 5’-triphosphate UTR untranslated region VLA very late activation antigen WNV West Nile virus

165 English summary

English summary

Multiple sclerosis (MS) is a chronic disease of the central nervous system (CNS) that affects approximately 2.3 million people worldwide. MS is usually diagnosed in young adults between 25 to 30 years old. Symptoms of MS are caused by scars in the CNS, so called lesions. In these lesions the protective layer (myelin sheaths) surrounding the axons of neurons is degenerated, leading to hampered neuronal signaling. This subsequently causes symptoms such as fatigue, pain and –partial– disability. The exact cause of MS is still unclear, as there is evidence that both genetic and environmental factors play a role the pathogenesis of MS and that specific viruses are involved. The lesions in the brain of MS patients are characterized by activation of immune cells, including microglia and macrophages that are derived from the blood. Microglia are the innate immune cells of the CNS and are an important part of the immune system of the brain. Microglia are located throughout the CNS, where they continuously scan their direct environment for the presence of infections or tissue injury. Microglia exert a plethora of functions and are important for maintaining a healthy CNS (homeostasis) as well as for the initiation and regulation of immune responses during pathological and degenerative conditions. Macrophages are normally not present in the CNS, but can be found within the CNS before of during pathological conditions. Although these cells differ in their origin, microglia and macrophages exert similar functions during an immune response. For example, both cells can clear pathogens (bacteria and viruses) and cellular debris from the CNS, but can also produce and secrete cytokines. Cytokines are small signaling molecules, similar to hormones, that can attract, activate or regulate other immune cells. Activated microglia are involved in almost all neurological diseases, although it is not always clear whether they play an protective or detrimental role in the pathogenesis of these diseases. In addition, it is often unclear whether microglia and macrophages play similar or distinct roles in the pathogenesis of CNS diseases. What activates microglia and macrophages in MS lesions is yet unknown. In general, microglia and macrophages are activated by detection of molecules present on bacteria or viruses or that derived from damaged tissue. These molecules can be detected by receptors, the sensors of the cell, which are present within the cell or at the cell surface. Microglia and macrophages express many different receptors, including NOD-like receptors (NLR). NLR recognize molecules derived from both pathogens and tissue damage, and play an important role in the production of the cytokine interleukin (IL)-1β. Activation of the NLR induces the formation of a protein complex called the inflammasome. Formation of the inflammasome complex leads to subsequent activation of specific enzymes, called inflammatory caspases. These inflammatory caspases are involved in the processing of the inactive pro-IL-1β to its active form. The active IL-1β is released by the microglia or macrophages and attracts and activates other immune cells. Recent studies show that inflammasome activation plays an important role in the development of neurodegenerative diseases, such as Alzheimer’s disease. Molecules that activate NLR, such as reactive oxygen species and molecules associated with cellular damage, are present in MS lesions. Furthermore, it is shown that the inflammasome plays an important role in the animal model that is used for MS studies, experimental autoimmune

166 English summary

encephalomyelitis (EAE). However, not much is known about the role of the inflammasome in MS. Therefore, the aim of this thesis was to investigate whether inflammasome-mediated activation of microglia and macrophages plays a role in the development of MS lesions.

In chapter 2, we determined IL-1β production in brain tissue of MS patients and of rhesus macaques (Macaca mulatta) with EAE by using antibody stainings and microscopic analyses. Although we observed differences in the localization and the extent of the IL-1β production, we observed that the IL-1β production was initiated within the CNS both in MS and in EAE. Furthermore, we observed that the microglia, and not the infiltrating macrophages, were the main source of the IL-1β. This is particularly remarkable, as previous studies showed that both cell types are able to produce IL-1β.

To investigate this in more detail, we used in vitro models for microglia and macrophages in chapter 3 and 4. Cells were isolated from brain tissue of healthy, adult rhesus macaques and subsequently cultured in culture plates in the laboratory. The brain tissue was derived from animals that were euthanized for other purposes (see below). To compare microglia with other macrophages, we cultured macrophages derived from the blood and bone marrow of the same animals. These macrophages are also called hematopoietic macrophages, as they originate from hematopoietic progenitor cells. These hematopoietic macrophages represent the infiltrating macrophages in MS lesions. Until few years ago, it was believed that microglia, like hematopoietic macrophages, originated from hematopoietic progenitor cells. However, recent evidence shows that microglia are derived from embryonic precursor cells without contribution of hematopoietic progenitor cells. This implicates that microglia and hematopoietic macrophages are distinct populations by origin. Furthermore, microglia and hematopoietic macrophages are continuously exposed to external stimuli from different environments. The CNS is a unique environment within the body, as it is highly metabolic active tissue that is secluded from the rest of the body by the blood-brain-barrier. Thereby, microglia are under normal conditions exposed to different stimuli compared to hematopoietic cells that circulate in the blood. Recent evidence shows that differences in origin and environment affect how microglia and macrophages respond. Although inflammasome-mediated activation of hematopoietic macrophages has been extensively studied previously, much less is known about microglia. We describe in chapter 3 and 4 that microglia and hematopoietic macrophages are in principle endowed with the same inflammasome proteins and that both cell types can respond to the same stimuli with production of pro-IL-1β and secretion of active IL-1β. However, we also describe important cell-specific differences between microglia and hematopoietic macrophages, including differences in i) the kinetics of inflammasome-mediated response, ii) their dependence on inflammatory caspases for the secretion of IL-1β, and iii) the regulation of IL-1β secretion by purinergic receptors. While hematopoietic macrophages are equipped to induce IL-1β secretion in a very acute and potent manner, microglial IL-1β production and secretion has a more slow and chronic character. Especially the differences in adenosine triphosphate (ATP)-induced inflammasome activation between microglia and hematopoietic macrophages are interesting in the context of the CNS. ATP is an endogenous molecule with many different functions. When a cell is damaged, ATP is

167 English summary

released in high concentrations into the extracellular space, where it functions as a ‘danger’ signal to neighboring (immune) cells. Microglia and macrophages detect a high concentration of ATP via purinergic receptors, such as the P2X7 receptor. Recent studies showed that this leads to activation of the inflammasome and secretion of IL-1β. Inchapter 4 we compared ATP-induced IL-1β secretion in microglia with hematopoietic macrophages. ATP-induced IL-1β secretion is significantly lower in microglia compared to hematopoietic macrophages, which may be due to lower expression of the P2X7 receptor in microglia. This is an interesting finding as microglia are also exposed to high concentrations of extracellular ATP under normal conditions. ATP is also an important molecule for signaling between different neurons. This suggests that the immune response in microglia is adapted to this specific environment to prevent undesirable immune activation in response to a signal that is present under healthy conditions.

For the research described in this thesis, we used tissue derived from monkeys (non-human primates). Non-human primates are used for biomedical research due to their strong resemblance to humans, especially regarding their immune system and the CNS. In chapter 5 we discuss how the use of non-human primates may be reduced by development of alternative methods for studying biomedical research questions. Inchapter 3 and 4 we used such alternative methods for studying microglia and macrophages. To initiate primary cell cultures, microglia were isolated from brain tissue derived from healthy, adult rhesus macaques that were euthanized for other scientific research. As this tissue would otherwise not be used, the initiation ofin vitro models contributes to optimal use of experimental animals. This method is an example ofthe implementation of the procedure to reduce, replace and refine animal experiments within the Biomedical Primate Research Centre (BPRC). Comparable in vitro models for studying microglia can be initiated from brain tissue of rodents and humans. Each of these models has their own advantages and limitations. Rodents form a homogeneous genetic population and their conditions are completely controllable, both throughout their lifespan and after death. Therefore, results obtained from rodent models contain limited variability. There are however important fundamental differences in the immune system of rodents and humans. Of course the use of models derived from human brain material are not limited by such differences between species. However, the availability of (healthy) brain tissue of human donors is limited, as specific permission is required for the use of brain tissue after death. Furthermore, human brain tissue becomes available after a relatively long period after death. This results in degenerative processes in the brain tissue, which may influence the activation of microglia. Furthermore, acquiring different tissues from the same donor is often difficult, implicating that comparisons of different cell types cannot be performed within the same donor. In this thesis we used primary microglia cultures derived from rhesus macaques. Rhesus macaques have many similarities to humans, such as their genetic background and age. Furthermore, their conditions both during their life and after death are controllable implicating that the brain tissue becomes available directly after death. Different tissues from thesame animal are available, which enables direct comparison between cell types, such as microglia and macrophages in this thesis. Despite the many advantages of this model, there is always room for improvement. One of the most important limitations is that microglia are isolated from their normal CNS environment

168 English summary

and are cultured in a two-dimensional (2D) model system. Since the environment plays an important role in regulating immune responses, three-dimensional (3D) models in which microglia are cultured together with other CNS cells might provide a more realistic model of the immune responses in the CNS. In chapter 5 and 6 we discuss some of these models, such as organotypic tissue cultures or co-cultures of different CNS cells derived from stem cells.

In conclusion, in this thesis we showed that inflammasome-mediated activation might indeed play a role in the development of MS lesions. Surprisingly, it appeared that IL-1β is mainly produced by cells within the CNS. Even in the animal model for MS, where the disease starts within the blood, we could only show IL-1β production within the CNS. Furthermore, our results suggest that it was predominantly the microglia, and not the hematopoietic macrophages, that produce the IL-1β. In the subsequent research we delineated important differences between microglia and hematopoietic macrophages in the regulation of the inflammasome-mediated response. These results are consistent with tissue-specific innate immune responses in the CNS and are further discussed in chapter 6. Furthermore, these results suggest possibilities for therapeutic interventions that are specifically directed to block activation of either microglia or macrophages. Microglia and macrophages may play both beneficial and detrimental roles in the development of MS. Furthermore, beneficial and detrimental roles of microglia and macrophages may occur simultaneously in the same lesion. Targeting a therapy towards a specific cell population would enable regulation of the detrimental effect of one population, while leaving the beneficial effect of the other population intact. Although the research in this thesis suggests that such cell-specific regulation of innate immune responses is possible, this warrants further investigation.

169 Nederlandse samenvatting

Nederlandse samenvatting

Multipele Sclerose (MS) is een chronische aandoening van het centraal zenuwstelsel (CZS), die bij ongeveer 2,3 miljoen mensen wereldwijd voorkomt. De diagnose wordt meestal gesteld in jongvolwassenen tussen de 25 en 30 jaar. Symptomen van MS worden veroorzaakt door littekens in het CZS. Deze littekens heten laesies. In deze laesies is de beschermlaag (myeline) rondom de uitlopers van zenuwcellen afgebroken, waardoor de zenuwcellen hun signalen niet goed meer kunnen doorgeven. Dit leidt uiteindelijk tot symptomen zoals vermoeidheid, pijn en –gedeeltelijke– invaliditeit. Er zijn aanwijzingen dat zowel genetische als omgevingsfactoren een rol kunnen spelen in de ontwikkeling van MS. Ook zijn er bepaalde virussen bij betrokken. Hierdoor is de precieze oorzaak van MS nog onduidelijk. De laesies worden gekarakteriseerd door de aanwezigheid van geactiveerde cellen van het immuunsysteem, waaronder microglia en macrofagen die afkomstig zijn uit het bloed. Microglia zijn de aangeboren immuuncellen van het CZS en vormen een belangrijk onderdeel van het afweersysteem van de hersenen. Microglia bevinden zich in het gehele CZS, waar ze continu hun directe omgeving controleren op de aanwezigheid van infecties en weefselschade. Microglia voeren een verscheidenheid aan functies uit en zijn zowel belangrijk voor het onderhouden van een gezond CZS (homeostase) als voor het starten en reguleren van een immuunreactie gedurende pathologische en degeneratieve omstandigheden. Macrofagen zijn onder gezonde omstandigheden niet aanwezig in het CZS, maar voor of tijdens ziekte worden ze wel in het CZS aangetroffen. Hoewel deze cellen een andere afkomst hebben, kunnen microglia en macrofagen dezelfde functies uitoefenen. Beide celtypes kunnen bijvoorbeeld ziekteverwekkers (bacteriën en virussen) en celresten opruimen, maar ook cytokines aanmaken en uitscheiden. Cytokines zijn kleine signaalmoleculen, te vergelijken met hormonen, die andere immuuncellen kunnen aantrekken, activeren of juist afremmen. Hoewel duidelijk is dat geactiveerde microglia betrokken zijn bij vrijwel alle aandoeningen en ziektes van de hersenen, is nog niet altijd duidelijk of ze een beschermende of schadelijke rol spelen in de ontwikkeling van de ziekte. Ook is vaak nog onduidelijk of microglia en macrofagen eenzelfde of verschillende rollen spelen bij de ontwikkeling van deze ziektes. Wat de activatie van microglia en macrofagen in de MS-laesies veroorzaakt is nog onbekend. In het algemeen kunnen microglia en macrofagen geactiveerd raken doordat ze moleculen kunnen detecteren die aanwezig zijn op bacteriën of virussen of die vrijkomen tijdens weefselschade. Deze moleculen worden gedetecteerd door middel van receptoren (de sensoren van de cel) die zich in de cel of aan het oppervlak van de cel bevinden. Microglia en macrofagen brengen veel verschillende soorten receptoren tot expressie, waaronder de NOD-like receptoren (NLR). NLR kunnen zowel moleculen van ziekteverwekkers als weefselschade herkennen en zijn belangrijk voor de productie van het cytokine interleukine (IL)-1β. Activatie van NLR leidt tot de vorming van een eiwitcomplex, genaamd het inflammasoom. Vorming van het inflammasoom lijdt vervolgens weer tot activatie van specifieke enzymen, genaamd inflammatoire caspases. Deze inflammatoire caspases zijn betrokken bij de omzetting van het inactieve pro-IL-1β tot zijn actieve vorm. Het actieve IL-1β wordt uitgescheiden door microglia of macrofagen enkan vervolgens weer andere immuuncellen aantrekken en activeren. Recent onderzoek wijst uit

170 Nederlandse samenvatting

dat inflammasoom activatie een belangrijke rol speelt in de ontwikkeling van verschillende neurodegeneratieve ziekten, waaronder de ziekte van Alzheimer. Het is bekend dat moleculen die NLR activeren, zoals bijvoorbeeld zuurstofradicalen en andere weefselschade moleculen, aanwezig zijn in MS-laesies. Daarnaast is aangetoond dat het inflammasoom een belangrijke rol speelt in het proefdiermodel dat gebruikt wordt voor studies naar MS (experimentele autoimmune encephalomyelitis (EAE)). Over de mogelijke rol van het inflammasoom in MS was echter nog weinig bekend. Het doel van dit proefschrift was dan ook om te onderzoeken of inflammasoom-gemedieerde activatie van microglia en macrofagen een rol speelt in de ontwikkeling van MS-laesies.

In hoofdstuk 2 hebben wij de IL-1β productie in hersenweefsel van MS-patiënten en van rhesus makaken (Macaca mulatta) met EAE bepaald met behulp van antilichaam kleuringen en microscopische analyses. Hoewel we verschillen zagen in de lokalisatie en sterkte van de IL-1β productie, werd in zowel MS als in EAE de IL-1β productie vooral geïnitieerd in het CZS. Bovendien waren het voornamelijk de microglia, en niet de binnendringende macrofagen, die IL-1β produceerden. Dit was opmerkelijk, omdat eerdere studies hebben uitgewezen dat beide celtypes wel de mogelijkheid hebben om IL-1β te produceren.

Om dit in meer detail te onderzoeken, hebben wij in hoofdstuk 3 en 4 gebruik gemaakt van in vitro modellen voor microglia en macrofagen. Hierbij worden cellen geïsoleerd uit hersenweefsel van volwassen rhesus makaken en vervolgens gekweekt in kweekplaten in het lab. Het hersenweefsel was afkomstig van dieren die om andere redenen geëuthanaseerd werden (zie ook beneden). Om microglia te vergelijken met andere macrofagen werden uit dezelfde dieren macrofagen gekweekt uit bloed en beenmerg. Deze macrofagen worden ook wel hematopoietische macrofagen genoemd, omdat ze afkomstig zijn uit zogenaamde hematopoietische voorlopercellen. Deze hematopoietische macrofagen representeren de infiltrerende macrofagen in MS-laesies. Lang is gedacht dat microglia, net als hematopoietische macrofagen, afkomstig zijn uit hematopoietische voorlopercellen. Recent onderzoek wijst echter uit dat microglia uit embryonale voorloper cellen ontstaan zonder de tussenkomst van hematopoietische voorloper cellen. Dit impliceert dat microglia en hematopoietische macrofagen al van origine verschillende populaties zijn. Bovendien staan microglia en hematopoietische macrofagen continue bloot aan externe stimuli uit verschillende omgevingen. Het CZS is een unieke omgeving in het lichaam, aangezien het sterk metabool actief weefsel is dat wordt afgeschermd van de rest van het lichaam door middel van de bloed-brein-barrière. Hierdoor staan microglia onder normale omstandigheden bloot aan andere stimuli dan hematopoietische cellen die circuleren in het bloed. Hoewel inflammasoom-gemedieerde activatie van hematopoietische macrofagen uitgebreid bestudeerd is in eerdere studies, was er slechts weinig bekend over microglia. We beschrijven in hoofdstuk 3 en 4 dat microglia en hematopoietische macrofagen in principe uitgerust zijn met dezelfde inflammasoom eiwitten en dat beide celtypes kunnen reageren op dezelfde stimuli met de productie van pro-IL-1β en de uitscheiding van actief IL-1β. We beschrijven echter ook belangrijke cel-specifieke verschillen tussen microglia en hematopoietische macrofagen, waaronder verschillen in i) de kinetiek van de inflammasoom-

171 Nederlandse samenvatting

gemedieerde respons, ii) de afhankelijkheid van inflammatoire caspases voor de uitscheiding van IL-1β, en iii) de regulatie van IL-1β uitscheiding door middel van purinerge receptoren. Terwijl hematopoietische macrofagen uitgerust lijken te zijn om IL-1β uitscheiding te induceren op een acute en potente manier, heeft de uitscheiding van IL-1β in microglia een trager en chronischer karakter. Met name de verschillen in adenosine triphosphate (ATP)-geïnduceerde inflammasoom activatie tussen microglia en hematopoietische macrofagen zijn interessant in de context van het CZS. ATP is een lichaamseigen molecuul met verschillende functies. Hoge concentraties ATP komen vrij in de extracellulaire ruimte als een cel beschadigd raakt, wat een signaal voor ‘gevaar’ is voor de omliggende (immuun)cellen. Microglia en macrofagen kunnen een hoge concentratie ATP detecteren met behulp van purinerge receptoren, zoals bijvoorbeeld de P2X7 receptor. Recentelijk is aangetoond dat dit ook kan leiden tot activatie van het inflammasoom en uitscheiding van IL-1β. In hoofdstuk 4 hebben we ATP-geïnduceerde IL-1β uitscheiding in microglia vergeleken met hematopoietische macrofagen. ATP-geïnduceerde uitscheiding van IL- 1β is significant lager in microglia in vergelijking met hematopoietische macrofagen, wat mogelijk veroorzaakt wordt door lagere expressie van de purinerge P2X7 receptor in microglia. Dit is een interessante bevinding, aangezien microglia ook onder normale omstandigheden blootgesteld worden aan hoge concentraties extracellulair ATP. ATP is namelijk ook een belangrijk molecuul voor de signalering tussen verschillende zenuwcellen. Dit suggereert dat de immuunrespons in microglia is aangepast aan hun specifieke omgeving, zodat er geen onnodige immuunactivatie plaatsvindt in reactie op een signaal dat ook onder gezonde condities wordt gedetecteerd.

Voor het onderzoek beschreven in dit proefschrift is gebruik gemaakt van weefsel afkomstig van apen (non-humane primaten). Vanwege hun sterke gelijkenis met mensen, onder andere met betrekking tot het immuunsysteem en het CZS, worden non-humane primaten gebruikt in biomedisch onderzoek. In hoofdstuk 5 wordt bediscussieerd hoe het gebruik van non-humane primaten tot een minimum beperkt kan worden door het ontwikkelen van alternatieve methoden voor het bestuderen van biomedische vraagstukken. In hoofdstuk 3 en 4 wordt gebruik gemaakt van zulke alternatieve methoden voor het bestuderen van microglia en macrofagen. Om primaire celkweken te starten werden microglia geïsoleerd uit hersenweefsel van gezonde, volwassen rhesus makaken, die werden geëuthanaseerd voor ander wetenschappelijk onderzoek. Aangezien dit weefsel anders niet gebruikt zouden worden, dragen deze in vitro modellen bij aan optimaal gebruik van dieren voor experimentele doeleinden. Deze methodiek is een voorbeeld van implementatie van de principes tot vermindering, verfijning en vervanging van dierproeven binnen het Biomedical Primate Research Centre (BPRC). Vergelijkbare in vitro modellen voor het bestuderen van microglia kunnen ook worden gestart uit hersenweefsel van knaagdieren of mensen. Ieder van deze modellen kent voordelen en beperkingen. Knaagdieren vormen een homogene genetische populatie en de omstandigheden van deze dieren tijdens het leven en na overlijden zijn volledig controleerbaar. Daardoor bevatten resultaten verkregen met knaagdiermodellen weinig variatie. Er zijn echter belangrijke fundamentele verschillen in het immuunsysteem van knaagdieren en mensen. Van dergelijke verschillen in het immuunsysteem is bij het gebruik van modellen afkomstig uit menselijk hersenmateriaal uiteraard geen sprake. De beschikbaarheid van hersenmateriaal afkomstig van

172 Nederlandse samenvatting

(gezonde) mensen is echter beperkt, omdat specifiek toestemming moet worden verleend voor het gebruik van hersenmateriaal na overlijden. Bovendien komt dit materiaal pas beschikbaar na een relatief lange periode na het overlijden van een donor. Dit heeft tot gevolg dat er in het hersenweefsel degeneratieve processen plaatsvinden die van invloed kunnen zijn op de activatie van de microglia. Tevens is het lastig om verschillende weefsels van dezelfde donor te verkrijgen, waardoor vergelijkingen tussen celtypes niet binnen een individu kunnen worden uitgevoerd. In dit proefschrift is gewerkt met primaire microglia kweken afkomstig uit de rhesus makaak. Rhesus makaken hebben veel overeenkomsten met de mens, zoals genetische achtergrond en leeftijd. Bovendien zijn zowel de levensomstandigheden als de condities na het overlijden controleerbaar waardoor het hersenweefsel direct beschikbaar komt na overlijden. Daarnaast zijn verschillende weefseltypes uit hetzelfde dier beschikbaar. Hierdoor zijn effectieve vergelijkingen mogelijk tussen celtypes, zoals de in dit proefschrift beschreven microglia en hematopoietische macrofagen. Ondanks de vele voordelen die dit model biedt, is er nog altijd ruimte voor verbetering. Eén van de belangrijkste beperkingen is dat de microglia uit hun natuurlijke CZS omgeving worden gehaald en in een tweedimensionaal (2D) model systeem worden gekweekt. Aangezien de omgeving een belangrijke rol speelt in onder andere het reguleren van immuunreacties, zouden driedimensionale (3D) modellen waarbij microglia gekweekt worden samen met andere CZS cellen mogelijk een nog realistischer model zijn van immuunreacties in het CZS. In hoofdstuk 5 en 6 bediscussiëren we enkele van zulke modellen, zoals organotypische weefsel kweken of co-culturen van verschillende CZS cellen gekweekt uit stamcellen.

Concluderend, hebben wij in dit proefschrift laten zien dat inflammasoom-gemedieerde activatie van aangeboren immuuncellen inderdaad een rol lijkt te spelen in de ontwikkeling van MS-laesies. Verrassend genoeg lijken het met name de cellen in het CZS te zijn die IL-1β produceren. Zelfs in het diermodel voor MS, waar de ziekte in de bloedbaan begint, konden wij alleen IL-1β productie in het CZS aantonen. Tevens lijkt het er sterk op dat het met name de microglia zijn die IL-1β maken, en niet de hematopoietische macrofagen. Wij beschrijven hoe ons verdere onderzoek belangrijke verschillen tussen microglia en hematopoietische macrofagen in de regulatie van de inflammasoom-gemedieerde reacties heeft blootgelegd. Deze resultaten geven aanleiding om te denken dat de aangeboren immuunresponsen in het CZS specifieke kenmerken hebben en worden verder bediscussieerd in hoofdstuk 6. Deze resultaten suggereren ook mogelijkheden voor therapeutische interventies, die bijvoorbeeld specifiek gericht zijn op het blokkeren van activatie van microglia dan wel macrofagen. Microglia en macrofagen kunnen zowel voordelige als nadelige effecten hebben tijdens de ontwikkeling van MS. Sterker nog, de voordelige en de nadelige effecten van microglia en infiltrerende macrofagen kunnen tegelijkertijd en in dezelfde laesie plaatsvinden. Het richten van een therapie tegen een specifieke celpopulatie biedt de mogelijkheid om de ongewenste activatie van het ene celtype te reguleren, zonder het voordelige effect van het andere celtype te verminderen. Hoewel de resultaten in dit proefschrift suggereren dat zulke cel-specifieke regulatie van aangeboren immuunresponsen mogelijk is, behoeft dit verder onderzoek.

173 Dankwoord

Dankwoord

And now for something completely different… Eindelijk ben ik dan bij het dankwoord aangekomen, wellicht het meest gelezen stuk van het proefschrift. Hoewel ik niet iedereen persoonlijk kan bedanken, wil ik toch een paar mensen bij naam noemen.

Jeffrey; uiteraard zijn mijn eerste woorden van dank voor jou. Dankzij jouw begeleiding ben ik enorm gegroeid als wetenschapper en heb ik veel over mijzelf geleerd. Vanaf het begin heb je mij altijd mijn eigen weg laten zoeken en als ik dreigde te ontsporen een duwtje in de goede richting gegeven. Je deur stond altijd open als ik ergens niet meer uitkwam of als ik het even niet meer zag zitten. Bedankt voor de onuitputtelijke positiviteit en je niet aflatende geduld en vertrouwen in dat het wel goed zou komen. Ik heb genoten van het samen papers schrijven en discussiëren over hoe we de resultaten het beste konden weergeven. Ook toen dat tijdens de laatste fase in een stroomversnelling kwam, vanwege mijn nieuwe baan. Ik koester mooie herinneringen aan de congressen in Praag, Boston, Berlijn en Bilbao. Je gaf mij daar uitgebreid de mogelijkheid om mijn resultaten te presenteren en te netwerken. Maar het was toch vooral altijd erg gezellig.

Ronald; bedankt voor het kritisch lezen van het proefschrift en de snelle afhandeling van alle procedures rondom mijn promotie. Aan de leden van de beoordelingscommissie; prof. dr. R. de Boer, prof. dr. C. Hendriksen en prof. dr. E. Hol; dank dat jullie de tijd en moeite hebben genomen om mijn proefschrift te beoordelen en onderdeel wilden uitmaken van de ceremonie. Prof. dr. S. Amor and prof. dr. K. Biber; thank you for your time and effort to evaluate my thesis and for being part of the ceremony. Dr. O. Butovsky and dr. J. Bauer; thank you for taking the time to be part of the ceremony. Sandra; I additionally would like to thank you for the opportunity to perform the doublestainings for the IL-1 paper in your lab. I’ve learned a lot from working in a different environment and from your input on the paper. Jan; bedankt dat ik in Wenen welkom was voor de initiële experimenten voor het IL-1 paper en de verschillende dubbelkleuringen die je op het laatste moment nog even snel hebt uitgevoerd voor ons. Elly; ik ben ontzettend dankbaar voor de kans die jij mij biedt om mijn pad binnen de wetenschap verder te verkennen.

De afgelopen jaren heb ik met plezier op het BPRC onderzoek gedaan. Dit was niet mogelijk geweest zonder fijne collega’s. Ella; ik ben jou veel dank verschuldigd voor al het werk dat jij voor mij hebt gedaan; het woord inflammasoom komt jou inmiddels de neus uit. Hoewel jij altijd in de spagaat staat tussen werk en privé – ik heb enorme bewondering voor hoe je dat allemaal georganiseerd krijgt - heb je altijd je beste beentje voor gezet voor mijn project. Zonder de enorme hoeveelheid ELISA’s en qPCRs die jij voor dit proefschrift hebt uitgevoerd, zou ik niet de ruimte hebben gehad om in alle rust te kunnen schrijven. Daarnaast kon ik ook altijd bij jou terecht voor een luisterend oor als ik het even niet meer zag zitten. Wij waren een goed team en ik ga je erg missen als collega. Bedankt dat je me ook in de allerlaatste fase als paranimf wilde ondersteunen.

174 Dankwoord

Jennifer; hoewel we studiegenootjes waren, heb ik je pas goed leren kennen toen je bij de Alternatieven kwam werken. Ik bewonder jouw enorme werklust en drive om mooie resultaten te krijgen. Dit heeft mij ook geïnspireerd om een extra stapje harder te werken. En hoewel we het niet altijd eens waren over de temperatuur (verwarming hoger-lager-repeat), was je een hele fijne kamergenoot. Linda; ook jij bedankt voor je gezelligheid als kamergenoot. Karin; vanaf het moment dat jij bij het BPRC binnenstapte, had ik het gevoel dat ik er een soortgenoot bij had. Je bleek bovendien een goede discussiepartner, vraagbaak, eet- en stapmaatje, maar bovenal een hele fijne vriendin. Ik ben blij dat jij mij wilde steunen als mijn paranimf. Met jouw onvermoeibare doorzettingsvermogen weet ik zeker dat jij ook een heel mooi boekje gaat afleveren! Fellow BPRC-PhDs, Jordon, Astrid, Jesse; I really enjoyed our PhDinners. Good luck with finishing up the thesis. You can do it! Voorgaand BPRC-PhDs, Celine, Yolanda, Anwar en Jeroen; wat fijn dat jullie mij in de eerste jaren onder jullie hoede hebben genomen en dat ik met vragen altijd bij jullie terecht kon. Céline, in het bijzonder ben ik jou dankbaar voor het bewijzen dat met doorzettingsvermogen alles mogelijk is. Anke en Paola; ontzettend bedankt voor jullie bijdrage aan dit proefschrift. Ik heb dankzij jullie veel geleerd over mijzelf als begeleider. Tom and Ivanela; thank you for providing the tissues from the numerous necropies over the years, I really appreciate it! Jan, dank voor het faciliteren van het onderzoek en je input in de workshop. Krista en Bert; dank voor het beschikbaar stellen van de rhesus EAE samples en het meedenken over de verschillende papers. Willem; dank voor het snijden van de coupes. Ed; dank voor je hulp bij de statistiek voor de verschillende papers. Henk; dank voor het maken van de vele posters voor congressen en de illustraties in dit proefschrift. Francisca; dank voor al je hulp met het lay-outen van dit proefschrift. Dankzij jou ziet mijn boekje er keurig uit. Afdelingen Alternatives, Immunobiology en CG&R wil ik graag bedanken voor de gezellige labuitjes. Ik denk met veel plezier terug aan bijvoorbeeld het lasergamen, curling en natuurlijk de heerlijke kerstlunches. Tenslotte wil ik alle overige BPRC-ers bedanken; ieder van jullie heeft op de een of andere manier bijgedragen aan dit proefschrift. Ik heb er altijd met veel plezier gewerkt, mede dankzij jullie.

Tijdens mijn promotie heb ik ook de mogelijkheid gehad om kennis te maken en samen te werken met verschillende fijne collega’s van andere instituten. Dit heeft mijn onderzoek een enorme boost gegeven en de verschillende congressen nog plezieriger gemaakt, waarvoor mijn dank. Laura; het laatste jaar hebben wij veel samen gewerkt voor het IL-1 paper. Eindeloos nieuwe protocollen uitproberen, coupes inbedden afplakken en discussies over hoe het nu werkt met IL-1 in MS. Zonder jouw input was dit nooit zo mooi gelukt. Bovenal vond ik het heel gezellig om met je samen te werken en congressen te bezoeken. Binnenkort mag jij ook een prachtig boekje verdedigen! Prof. P. van der Valk; dank voor het beschikbaar stellen van de weefsels. Wouter, Marjolein, Kim en Regina; dank voor jullie hulp met het opzoeken van blokjes en snijden van coupes. Dankzij jullie voelde ik me altijd erg welkom op de VU.

175 Dankwoord

Hans; bedankt voor het kritisch lezen van de verschillende manuscripten. Dankzij jouw commentaar heb ik veel geleerd over nauwkeurig formuleren en kritisch kijken naar je eigen resultaten. Ruth; ook jij bedankt voor je input op het paper en het meedenken over mijn onderzoek. Jan-Bas; bedankt voor je input bij de workshop en het workshop report. Collega’s van andere instituten die ik heb ontmoet tijdens verschillende congressen en symposia, met in het bijzonder Baukje, Daphne, Philip, Mark, Jack, Anne-Marie, Miriam, Inge, Ilia en Bart; het was ontzettend leuk om jullie te leren kennen tijdens de verschillende congressen. Jullie hebben het een onvergetelijke tijd gemaakt, met lekker buitenlands eten en lokale drankjes, verkenningstochten door verschillende steden en wetenschappelijke discussies. Miriam; ik voel me vereerd dat je aan mij hebt gedacht om het project over neurale stamcellen in Parkinson van jou over te nemen. Ik ga mijn best doen het project zo succesvol mogelijk af te ronden. Nieuwe collega’s bij het UMC Utrecht; wat fijn om me zo welkom te voelen op mijn nieuwe werk. Ik kijk ernaar uit om met jullie allen samen te werken.

Tijdens de afgelopen jaren heb ik ontdekt dat je tijdens het promoveren gemakkelijk de wereld om je heen vergeet. Daarom gaat mijn grootste dank uit naar mijn vrienden en familie, die mij de afgelopen jaren hebben gesteund. Femke, Sophie, Arianne, Marlies en Rivkah; tijdens onze gezellige meidenavonden en lunches hebben jullie altijd mijn verhalen geduldig aangehoord. Jullie onophoudelijke stroom aan lieve woorden tijdens etentjes, via kaartjes en berichtjes hebben mij er doorheen gesleept. Bedankt dat jullie er altijd voor mij zijn. Walter; dank voor het ontwerpen van een prachtige cover. Dankzij jou ziet mijn ‘visitekaartje voor de toekomst’ er ontzettend stijlvol uit. Carolien, Simone en Ilse; het was fijn om met jullie de ups en downs van een promotie te kunnen delen. Omdat we ongeveer tegelijk begonnen zijn, voelde het fijn dat we met z’n allen in hetzelfde schuitje zaten. Als laatste van ons clubje heb ik enorm kunnen profiteren van jullie tips over het zoeken van sponsors, drukkers, etc., waarvoor mijn dank. Overige leden van de Vriendengroep, Jane, Vico, Niels, Anastasiya, Astrid, Rudie, Guido, en heren van FC Schubberkutterveen en lieve schoonfamilie; dank voor jullie interesse en voor de avonden waarin ik gewoon even met jullie kon ontspannen.

Helaas heeft mijn vader mijn promotietraject niet meer mogen meemaken. Toch heeft zijn enthousiasme voor en visie op de wetenschap het fundament gelegd voor dit proefschrift. Daarom is dit proefschrift opgedragen ter nagedachtenis aan hem. Mariëtte, lieve mama; dit betekent ook dat jij hebt moeten fungeren als dubbele steunpilaar. Fijn dat ik altijd bij je terecht kan voor een gezonde maaltijd, goed advies of gewoon een luisterend oor. Judith, liefste suz; wat is het fijn om een grote zus te hebben waar je altijd bij terecht kunt. Ik ben ontzettend trots dat jij ook nog ‘even’ een onderzoeksmaster bent begonnen. Ik hoop dat er voor jou een mooie combinatie tussen dans en wetenschap in het verschiet ligt.

176 Dankwoord

Jesse; mijn laatste woorden van dank zijn uiteraard voor jou. Bedankt voor jouw onuitputtelijke steun, begrip en vertrouwen in dat het allemaal wel goed zou komen met mijn proefschrift. Jij hebt mij uitgedaagd om meer uit mijzelf te halen dan ik vooraf had kunnen denken. Dank ook voor je begrip op de momenten dat ik niet zo gezellig - of ronduit chagrijnig - was, omdat mijn hoofd weer eens te vol zat met informatie. Het samen thuis werken, al dan niet op het terras van de Francobolli, maakte het werken in het weekend alsnog een feestje. Toch is het ook wel heel fijn dat we de komende tijd meer van elkaars gezelschap kunnen genieten zonder te hoeven werken – hopelijk binnenkort in ons nieuwe huis. Ik hou van je.

177 Curriculum vitae

Curriculum vitae

Saskia Maria Burm werd op 21 november 1986 geboren te Leiderdorp. In 2005 behaalde zij het VWO-diploma aan het Stedelijk Gymnasium te Leiden. In datzelfde jaar begon zij aan de bachelor Biomedische wetenschappen aan de Universiteit Leiden, die ze in 2008 met succes voltooide. Aansluitend startte zij met de onderzoeksmaster Biomedische wetenschappen aan de Universiteit Leiden. Als onderdeel hiervan liep Saskia stage bij de afdeling Longziekten in het Leiden Universitair Medisch Centrum (LUMC), waar zij onder begeleiding van dr. L. Kunz en prof. dr. P. Hiemstra onderzoek deed naar ‘Macrofaag heterogeniteit in COPD-patiënten en het effect van sigarettenrook en bronchiaal epitheelcellen op de in vitro differentiatie van macrofagen’. Tijdens haar afstudeeronderzoek bestudeerde ze onder begeleiding van dr. D. Champagne ‘De invloed van genetische achtergrond op het angstgedrag van zebravislarven’ bij de afdeling Integrative Zoology in het Institute of Biology te Leiden (IBL). Na het cum laude afronden van haar onderzoeksmaster, startte Saskia met haar promotieonderzoek onder begeleiding van dr. J. Bajramovic bij de Alternatives Unit van het Biomedical Primate Research Centre (BPRC) te Rijswijk. Gedurende deze periode bracht Saskia verschillende werkbezoeken aan het laboratorium van dr. J. Bauer in de Universiteit van Wenen, Department of Neuroimmunology en aan het laboratorium van prof. dr. S. Amor in het VU Medisch Centrum in Amsterdam, Afdeling Pathologie. De resultaten van haar promotieonderzoek staan beschreven in dit proefschrift, getiteld ‘Inflammasome-mediated activation of microglia: tissue-specific features of innate’, immunity wat verdedigt zal worden aan de Universiteit Utrecht met prof. dr. R. Bontrop als promotor. Vanaf februari 2016 is Saskia werkzaam als postdoctoraal onderzoeker binnen de afdeling Translational Neuroscience van het Universitair Medisch Centrum Utrecht (UMC Utrecht). Daar doet zij onder begeleiding van prof. dr. E. Hol en in samenwerking met dr. M. van Strien onderzoek naar neurale stamcellen in patiënten met de ziekte van Parkinson.

178 Curriculum vitae

Saskia Maria Burm was born on 21 November 1986 in Leiderdorp, the Netherlands. She graduated at the Stedelijk Gymnasium Leiden in 2005. In the same year, she started a bachelor biomedical sciences at the University of Leiden, which was successfully finished in 2008. Thereafter, Saskia started with the research master biomedical sciences at the University of Leiden. During this master, she performed an internship at the Department of Pulmonology at the Leiden University Medical Centre (LUMC), where she studied ‘Macrophage heterogeneity in COPD patients and the effect of cigarette smoke and bronchial epithelial cells onthein vitro differentiation of macrophages’under supervision of Dr. L. Kunz and Prof. Dr. P. Hiemstra. For her master thesis, Saskia studied ‘The influence of genetic background on anxiety behavior of larval zebrafish’ under supervision of Dr. D. Champagne at the Department of Integrative Zoology at the Institute of Biology Leiden (IBL). After graduating with honors, Saskia started her PhD research under supervision of Dr. J. Bajramovic at the Alternatives Unit of the Biomedical Primate Research Centre in Rijswijk, the Netherlands. During this research, Saskia paid several working visits to the University of Vienna, Department of Neuroimmunology in the laboratory of Dr. J. Bauer and to the VU Medical Centre in Amsterdam, Department of Pathology in the laboratory of Prof. Dr. S. Amor. The results of her PhD research are described in this thesis, entitled Inflammasome- ‘ mediated activation of microglia: tissue-specific features of innate’, immunity which will be defended at the Utrecht University with Prof. Dr. R. Bontrop as promotor. From February 2016, Saskia will be working at the Department of Translational Neuroscience at the UMC Utrecht where, under supervision of Prof. Dr. E. Hol and in collaboration with Dr. M. van Strien, she will study neural stem cells in patients with Parkinson’s disease.

179 List of publications

List of publications

Expression of IL-1β in rhesus EAE and MS lesions is mainly induced in the CNS itself. Burm S.M., Peferoen L.A.N., Zuiderwijk-Sick E.A., Haanstra K.G., ’t Hart B.A., van der Valk P., Amor S., Bauer J., Bajramovic J.J. Submitted for publication

Inflammasome-induced IL-1β secretion in microglia is characterized by delayed kinetics and is only partially dependent on inflammatory caspases. Burm S.M., Zuiderwijk-Sick E.A., ‘t Jong A.E., van der Putten C., Veth J., Kondova I., Bajramovic J.J. J Neurosci. 2015. 35(2):678-87.

ATP-induced IL-1β secretion is selectively impaired in microglia. Burm S.M., Zuiderwijk-Sick E.A., Weert P.M., Bajramovic J.J. Submitted for publication

Alternative methods for the use of non-human primates in biomedical research. Burm S.M., Prins J.B., Langermans J., Bajramovic J.J. ALTEX. 2014. 31(4):520-9.

Whole blood stimulation with Toll-like receptor (TLR)-7/8 and TLR-9 agonists induces interleukin-12p40 expression in plasmacytoid dendritic cells in rhesus macaques but not in humans. Koopman G., Beenhakker N., Burm S., Bouwhuis O., Bajramovic J., Sommandas V., Mudde G., Mooij P., ‘t Hart B.A., Bogers W.M. Clin Exp Immunol. 2013. 174(1):161-71.

Toll-like receptor-induced IL-12 production is dependent on adenosine receptor 3-mediated signaling. van der Putten C., Veth J., Zuiderwijk-Sick E.A., Diavatopoulos D., Koenen H., Sukurova L., Burm S.M., van Noort J.M., IJzerman A.P. and Bajramovic J.J. Manuscript in preparation

Soluble TLR2 and 4 play a role in HIV/SIV related neuroinflammation and subsequent neuropathology. Mothapo K.M., ten Oever J., Koopmans P., Stelma F.F., Burm S.M., Bajramovic J.J., Verbeek M.M., Olde Rikkert M.G., Netea M.G., Koopman G., van der Ven A. Submitted for publication

180