Autoantibody-Mediated Pulmonary Alveolar Proteinosis in Rasgrp1-Deficient Mice Andrew Ferretti, Jarrod R

Home , Surfactant protein B

Autoantibody-Mediated Pulmonary Alveolar Proteinosis in Rasgrp1-Deficient Mice Andrew Ferretti, Jarrod R. Fortwendel, Sarah A. Gebb and Robert A. Barrington This information is current as of October 2, 2021. J Immunol published online 8 June 2016 http://www.jimmunol.org/content/early/2016/06/08/jimmun ol.1502248 Downloaded from

Why The JI? Submit online.

• Rapid Reviews! 30 days* from submission to initial decision

• No Triage! Every submission reviewed by practicing scientists http://www.jimmunol.org/

• Fast Publication! 4 weeks from acceptance to publication

*average

Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription by guest on October 2, 2021 Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts

The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2016 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. Published June 8, 2016, doi:10.4049/jimmunol.1502248 The Journal of Immunology

Autoantibody-Mediated Pulmonary Alveolar Proteinosis in Rasgrp1-Deﬁcient Mice

Andrew Ferretti,*,† Jarrod R. Fortwendel,*,† Sarah A. Gebb,†,‡ and Robert A. Barrington*,†

Pulmonary alveolar proteinosis (PAP) is a rare lung syndrome caused by the accumulation of surfactants in the alveoli. The most prevalent clinical form of PAP is autoimmune PAP (aPAP) whereby IgG autoantibodies neutralize GM-CSF. GM-CSF is a pleiotropic cytokine that promotes the differentiation, survival, and activation of alveolar macrophages, the cells responsible for surfactant degradation. IgG-mediated neutralization of GM-CSF thereby inhibits alveolar macrophage homeostasis and function, leading to surfactant accumulation and innate immunodeficiency. Importantly, there are no rodent models for this disease; therefore, underlying immune mechanisms regulating GM-CSF–specific IgG in aPAP are not well understood. In this article, we identify that autoimmune- prone Rasgrp1-deficient mice develop aPAP: 1) Rasgrp1-deficient mice exhibit reduced pulmonary compliance and lung histopathology characteristic of PAP; 2) alveolar macrophages from Rasgrp1-deficient mice are enlarged and exhibit reduced surfactant

degradation; 3) the concentration of GM-CSF–specific IgG is elevated in both serum and bronchoalveolar lavage fluid from Downloaded from Rasgrp1-deficient mice; 4) GM-CSF–specific IgG is capable of neutralizing GM-CSF bioactivity; and 5) Rasgrp1-deficient mice also lacking CD275/ICOSL, a molecule necessary for conventional T cell–dependent Ab production, have reduced GM-CSF–specific autoantibody and do not develop PAP. Collectively, these studies reveal that Rasgrp1-deficient mice, to our knowledge, represent the first rodent model for aPAP. The Journal of Immunology, 2016, 197: 000–000.

ulmonary alveolar proteinosis (PAP) is a rare pulmonary serum and bronchoalveolar lavage fluid (BALF) (10, 11). More- http://www.jimmunol.org/ syndrome defined by the accumulation of pulmonary sur- over, transfer of GM-CSF–specific autoantibodies from human P factant in the alveoli leading to respiratory insufficiency. aPAP patients to healthy nonhuman primates recapitulates the Pulmonary surfactant levels are maintained in part by GM-CSF (also disease, establishing a causal relationship (12). aPAP patients called CSF-2) (1–5). GM-CSF is a pleotropic cytokine that is re- treated with rituximab, a B cell–depleting anti-CD20 mAb, exhibit quired for the differentiation, maintenance, and function of alveolar improvement in lipid homeostasis and overall outcome, illustrat- macrophages (6, 7). In the absence of GM-CSF, degradation of ing that B cells and Ab are necessary for the pathology (13–15). pulmonary surfactants by alveolar macrophages is impaired, leading GM-CSF–specific autoantibodies in aPAP patients are polyclonal to an accumulation in the alveoli. GM-CSF–deprived alveolar and somatically hypermutated IgG Abs (16, 17). Interestingly, macrophages also are less adherent, and they exhibit impaired GM-CSF–specific IgG autoantibodies are also detectable in by guest on October 2, 2021 phagocytosis and pathogen killing (6). Defective phagocytosis and healthy individuals, although titers are significantly lower com- pathogen killing by alveolar macrophages likely contributes to in- pared with aPAP patients (18). GM-CSF–specific autoantibodies creased susceptibility to infections with opportunistic pathogens from both healthy individuals and aPAP patients are comparable such as Nocardia spp., Cryptococcus spp., and Aspergillus spp. in in regard to IgG subclass distribution (18), raising a key question PAP patients (8). of how immunological tolerance is regulated in healthy and PAP is classified into three clinical forms including congenital, pathologic settings. However, identifying underlying immune secondary, and autoimmune, with the latter representing the pre- mechanism(s) resulting in the production of pathological GM- dominant form comprising 90% of patients (9). In autoimmune CSF–specific autoantibodies is problematic due to a lack of ap- PAP (aPAP), GM-CSF–specific autoantibodies are elevated in the propriate animal models. RasGRP1 is a guanine exchange factor expressed by B and T cells that activates Ras downstream of B cell and T cell Ag receptor *Department of Microbiology & Immunology, University of South Alabama, Mobile, stimulation (19). Mice deficient in RasGRP1 are lymphopenic early AL 36688; †Center for Lung Biology, University of South Alabama, Mobile, AL in life with a block at the double-positive stage in T cell devel- 36688; and ‡Department of Physiology & Cell Biology, University of South Alabama, Mobile, AL 36688 opment (20). Later in life, Rasgrp1-deficient mice develop a lym- ORCIDs: 0000-0002-5426-5536 (A.F.); 0000-0001-5713-5369 (R.A.B.). phoproliferative disorder with multiple autoimmune features including enlarged secondary lymphoid tissues, spontaneous formation of ger- Received for publication October 19, 2015. Accepted for publication May 13, 2016. minal centers, and autoantibody production including anti-nuclear au- This work was supported by an American Lung Society Biomedical Research grant (to R.A.B.), start-up funds from the University of South Alabama College of Med- toantibodies (21). The autoimmune features in Rasgrp1-deficient mice icine (to R.A.B.), and National Institutes of Health Training Grant T32-HL076125 (to are T cell–dependent because Rasgrp1-deficient mice crossed to A.F.). athymicnudemicehaveattenuatedsplenomegaly and lack anti-nuclear Address correspondence and reprint requests to Dr. Robert A. Barrington, Department Abs (22). In addition, studies using Rasgrp1-deficient mice harboring of Microbiology & Immunology, University of South Alabama, MSB 2114, 5851 USA Drive North, Mobile, AL 36604. E-mail address: [email protected] an autoreactive BCR transgene revealed that B cells in Rasgrp1- Abbreviations used in this article: aPAP, autoimmune PAP; BAL, bronchoalveolar deficient mice also breach tolerance at multiple checkpoints, impli- lavage; BALF, bronchoalveolar lavage fluid; MFI, median fluorescent intensity; PAP, cating both T cell–independent and –dependent mechanisms (23). pulmonary alveolar proteinosis; PAS, periodic acid–Schiff; SP, surfactant protein; In this study, we show that autoimmune-prone, Rasgrp1-deficient Tfh, T follicular helper cell. mice develop PAP. The disease in Rasgrp1-deficient mice features Copyright Ó 2016 by The American Association of Immunologists, Inc. 0022-1767/16/$30.00 characteristic accumulation of pulmonary surfactants in alveolar

www.jimmunol.org/cgi/doi/10.4049/jimmunol.1502248 2 AUTOIMMUNE PULMONARY ALVEOLAR PROTEINOSIS IN MICE spaces, reduced pulmonary compliance, impaired alveolar macro- Corporation, Temecula, CA), SP-C (Santa Cruz Biotechnology, Dallas, phage function, and age-dependent increases in GM-CSF–neutralizing TX), SP-D (Bioss, Woburn, MA), or a rabbit IgG isotope control (Cell autoantibodies in serum and BALF that correspond with disease Signaling Technology, Danvers, MA). Biotinylated horse anti-rabbit IgG (Vector Laboratories, Burlingame, CA) was used as a secondary Ab, which onset. Lastly, aged mice lacking both RasGRP1 and CD275/ was detected using HRP-conjugated streptavidin (BD Biosciences, San ICOSL, a molecule necessary for conventional T follicular helper Jose, CA) and using 3-amino-9-ethylcarbazole (Thermo Fisher Scientific, cell (Tfh) development and the production of T cell–dependent Ab, Waltham, MA) as substrate. do not develop PAP. Therefore, from these data, we suggest that Bronchoalveolar lavage, alveolar macrophage diameter, and Rasgrp1-deficient mice represent, to our knowledge, the first rodent surfactant degradation assay model for aPAP. Bronchoalveolar lavage (BAL) was collected in situ by washing three times with 0.8 ml PBS (pH 7.4) intratracheally at a pressure of 15 cm H2O. To Materials and Methods determine alveolar macrophage diameter, we cytocentrifuged and stained Mice BAL cells with PAS. Alveolar macrophage diameter was determined using ImageJ. To determine light scatter of alveolar macrophages, we stained Mice were housed in an American Association for the Accreditation of BAL cells for flow cytometry using the following Abs: BV510-conjugated Laboratory Animal Care–certified pathogen-free facility at the Uni- anti-CD11c (N418; BioLegend, San Diego, CA), PE-conjugated anti–Siglec versity of South Alabama College of Medicine. Mice were .10 gen- F (E50-2440; BD Biosciences, Franklin Lakes, NJ). For the surfactant erations backcrossed on a C57BL/6 background. Both C57BL/6 mice degradation assay, BAL cells were evenly divided into three samples and and mice heterozygous for Rasgrp1 were used as controls as indicated. incubated at 37˚C 5% CO2 for 30 min and washed to remove nonadherent Importantly, PAP was not observed in either control group. Mice re- cells. A 1:1 mixture of rhodamine-labeled 1,2-dipalmitoyl-sn-glycero-3- ferred to as “young” herein ranged from 2 to 3 mo of age, whereas phosphoethanolamine (Avanti Polar Lipids, Alabaster, AL) and bovine sur- those referred to as “aged” ranged from 7 to 12 mo of age. All pro- factant (Infasurf; Forest Pharmaceuticals, St. Louis, MO), or surfactant Downloaded from cedures involving mice were performed according to approved proto- mixed with a vehicle control was added to the cells and incubated for 30 min cols by the University of South Alabama Institutional Animal Care and at 37˚C 5% CO . Surfactant uptake was determined after 30 min by washing Use Committee. 2 cells three times to remove excess surfactant, trypsinizing, and measuring Pulmonary compliance rhodamine fluorescence by flow cytometry. After an additional 4 h, a sep- arate sample was measured to detect degradation. The degradation of labeled Pulmonary compliance was determined by removing the chest wall and surfactant was quantified using the following equation: (30 min MFI 2 4h injecting 2–20 ml/kg air at 50-ml increments and recording pressure at MFI)/(30 min MFI 2 control MFI), where MFI represents median fluores- each increment after a 2- to 3-s pause for the pressure to plateau. cent intensity. http://www.jimmunol.org/ Compliance was calculated from the slope of the linear portion of the inflation curve. Real-time quantitative PCR Histology and immunohistochemistry mRNA was prepared from lungs or alveolar macrophages using the RNeasy mini kit (Qiagen, Valencia, CA) and reverse transcribed to cDNA using an Lungs of mice were inflation fixed in situ with 10% phosphate-buffered iScript cDNA preparation kit (Bio-Rad Laboratories, Hercules, CA). formalin at a pressure of 15 cm H2O, embedded in paraffin, sectioned, Quantitative PCR was performed by SYBR Green incorporation using a and stained with H&E or periodic acid–Schiff (PAS). For quantification of CFX96 (Bio-Rad) thermocycler with the following primers: b2-micro- proteinaceous material, nonoverlapping lung sections imaged at low power globulin (59-CCCGCCTCACATTGAAATCC/GCGTATGTATCAGTCT- (403 total) encompassing the entire lung section were analyzed using CAGTGG-39)SP-A(59-GTGCACCTGGAGAACATGGA/TGGATCC- ImageJ software. Percent proteinaceous accumulation was defined as TTGCAAGCTGAGG-39), SP-B (59-CCTCACAAAGATGACCAAGGA/ by guest on October 2, 2021 binary area of proteinaceous material dividedbybinaryareaofthetotal CTGGCTCTGGAAGTAGTCAATAA-39), SP-C (59-AGAGGTCCTGA- lung section analyzed. Total percent proteinaceous accumulation for TGGAGAGTCC/CATGAGCAGAGCCCCTACAA-39), SP-D (59-GGG- each mouse was calculated using the mean of three lung sections in- CCAACAAGGAAGCAATC/GGCCATTCTCTGTTGGGCTA-39), PU.1 cluding an upper, middle, and lower portion of the left lung lobe for each (59-CCATCGGATGACTTGGTTACTT/GTTCTCAAACTCGTTGTTGTG- mouse. G-39), PPARg (59-GCCCTTTACCACAGTTGATTTC/GTGGAGATGCA- To identify surfactant proteins (SP), we deparaffinized and immuno- GGTTCTACTT-39), ABCG1 (59CAGACGAGAGATGGTCAAAGAG/ stained sections with rabbit anti-mouse SP-A, SP-B (EMD Millipore CTGGTGGGCTCATCAAAGAA-39).

FIGURE 1. Morbidity and mortality of aged Rasgrp1-deficient mice. (A) Kaplan– Meier survival curves of control (n = 12) and Rasgrp1-deficient (n = 18) mice (p = 0.005, Mantel–Cox log-rank test). (B) Body mass of aged (7–12 mo) female and male control and Rasgrp1-deficient mice. Each symbol represents the value of an individual mouse (***p = 0.0002, two-way ANOVA with Sidak’s multiple comparisons test). (C) Mean pulmonary pressure-volume curve from aged control (n =12) and Rasgrp1-deficient (n = 11) mice. (D) Pulmonary compliance of aged control and Rasgrp1-deficient mice. Pulmonary compliance was calculated from linear portion of the inflation pressure-volume curve. Error bars represent SD (*p = 0.031, unpaired Student t test with Welch’s correction). The Journal of Immunology 3

GM-CSF–specific autoantibody ELISA and Welch’s correction was applied when variances were unequal as determined by an F test. One-way ANOVA was used to compare more than ELISA plates were coated with 1 mg/ml mouse rGM-CSF (Shenandoah two means with the exception of body mass data that were compared using Biotechnology, Warwick, PA) overnight and then blocked with StabilGuard a two-way ANOVA. (SurModics, Eden Prairie, MN) for 1 h at room temperature. Biotinylated goat anti-mouse IgG Fc (Southern Biotechnology, Birmingham, AL) was used to detect GM-CSF autoantibodies in serial dilutions of serum followed Results by HRP-conjugated streptavidin (BD Biosciences, San Jose, CA). Absor- Morbidity and mortality of aged Rasgrp1-deficient mice bance of serial dilutions was compared with a standard curve generated from nonspecific IgG captured with a goat anti-mouse Ig Ab (Southern Mice deficient in RasGRP1 are autoimmune prone, with breaks Biotechnology). in lymphocyte tolerance in both B and T cell compartments (23, 24). Mice were aged to understand the effects of autoimmunity. As GM-CSF neutralization assay controls, Rasgrp1-sufficient littermate mice achieved an average Neutralization of GM-CSF was determined using the GM-CSF–dependent body mass of 35.5 and 42.0 g for females and males, respectively, FDC-P1 cell line (American Type Culture Collection, Manassas, VA). IgG and .90% of the mice survived past 1 y of age (Fig. 1A, 1B). By was isolated from pooled serum from 15 mice using protein G–coupled comparison, aged Rasgrp1-deficient mice exhibited significantly magnetic beads following manufacturer’s instructions (Promega, Madison, WI). Serially diluted serum IgG from mice was added to FDC-P1 cell reduced body mass (25.1 and 30.5 g for females and males, cultures grown in the presence of 0.01 ng/ml GM-CSF, and proliferation respectively), and survival decreased beginning at 21 wk of age, was measured after 3 d by addition of 10 ml 5 mg/ml MTT (Amresco, with only 38% of the mice surviving beyond 1 y of age. Aged Solon, OH). Rat GM-CSF–specific IgG mAb (MP1-31G6; BioLegend) Rasgrp1-deficient mice also exhibited labored breathing, was used a positive control. Absorbance was measured at 540 nm after prompting us to evaluate lung function. Pulmonary compliance of

addition of DMSO. Downloaded from aged control and Rasgrp1-deﬁcient mice was assessed by gener- Statistics ating pressure volume curves. Although aged control mice dis- played pressure-volume curves with typical hysteresis within the Statistics were determined using GraphPad Prism 6 software. Kaplan–Meier survival curves were compared using a Mantel–Cox log-rank test. Un- normal volume range for mice, aged Rasgrp1-deﬁcient mice had paired Student t test was used to compare two means with equal variances, comparatively right-shifted pressure-volume curves characteristic http://www.jimmunol.org/ by guest on October 2, 2021

FIGURE 2. Rasgrp1-deficient mice exhibit PAP-like pathology. (A) Formalin-fixed, paraffin-embedded lung sections of control and Rasgrp1-deficient lungs stained with H&E. Upper panels represent young (2–3 mo) mice and lower panels represent aged (7–12 mo) mice. Scale bars, 50 mm. (B) Quantification of the accumulating proteinaceous material as a percent of total lung section area. Each symbol represents the mean percent accumulation of an individual mouse calculated from three lung sections including the upper, middle, and lower portion of the left lung (***p = 0.0006, one-way ANOVA with Tukey’s multiple comparison test). 4 AUTOIMMUNE PULMONARY ALVEOLAR PROTEINOSIS IN MICE of restrictive lung disease (Fig. 1C). Calculation of pulmonary characteristic of PAP (Fig. 2A). Perivascular and peribronchial compliance showed that, relative to aged control mice, aged mononuclear cell infiltration was also apparent in the lungs of Rasgrp1-deficient mice had reduced compliance (Fig. 1D; control aged Rasgrp1-deficient mice (data not shown). To assess the ex- versus Rasgrp1-deficient: 0.032 6 0.011 versus 0.025 6 0.004). tent of pathology, we quantified the amount of proteinaceous ac- Therefore, lung function was impaired in aged Rasgrp1-deficient cumulation in the lungs (described in Materials and Methods). mice. Although lung sections from control and young Rasgrp1-deficient mice had no measurable accumulation, analysis of lung sections Rasgrp1-deficient mice exhibit PAP-like pathology from aged Rasgrp1-deficient mice with pathology showed variable To identify the nature of restrictive lung disease in aged Rasgrp1- accumulation ranging from 5.6 to 38.5% of the lung section deficient mice, we performed histological examination of lungs. (Fig.2B).Notably,8of11agedRasgrp1-deficient mice showed Formalin-fixed, paraffin-embedded sections of lungs from young measureable protein accumulation by histology (Fig. 2B), sug- (2–3 mo) and aged (7–12 mo) control mice (both wild-type and gesting that ∼70% of aged Rasgrp1-deficient mice develop PAP- Rasgrp1 heterozygous) demonstrated normal histology, with open like disease. Moreover, because no pathology was observed in alveolar spaces and thin septal walls (Fig. 2A). Lungs from young young Rasgrp1-deficient mice, development of PAP-like disease is Rasgrp1-deficient mice also appeared normal. In contrast, analysis age dependent. of lung sections from aged Rasgrp1-deficient mice indicated an PAS-positive staining of the accumulated material in the alveoli eosinophilic proteinaceous accumulation in the alveolar space is a key feature in PAP. Consistent with PAP, the accumulated Downloaded from http://www.jimmunol.org/ by guest on October 2, 2021

FIGURE 3. Impaired surfactant homeostasis in lungs of mice with PAP. (A) Formalin-fixed, paraffin-embedded lung sections of aged control and Rasgrp1-deficient mice stained with PAS. (B) Immunohistochemical examination of lung sections from aged control and Rasgrp1-deficient mice using Abs to SP-A, -B, -C, and -D and counterstained with hematoxylin. Scale bars, 50 mm. (C) mRNA expression of SP genes from aged control and Rasgrp1- deficient mouse lungs was measured by quantitative RT-PCR. Values represent mean of duplicate wells expressed relative to b2-microglobulin (n =9 control and n =8Rasgrp1-deficient; error bars represent SD, unpaired Student t test). ns, not significant. The Journal of Immunology 5 material in lung sections from aged Rasgrp1-deficient mice were Surfactant degradation by alveolar macrophages in PAS-positive (Fig. 3A). Further, because impaired surfactant ho- Rasgrp1-deficient mice is impaired meostasis in PAP patients leads to buildup of surfactants in the An important function of alveolar macrophages is to maintain alveoli, lung sections were stained for SP-A, -B, -C, and -D by surfactant homeostasis. During PAP, alveolar macrophage function immunohistochemistry. Consistent with impaired surfactant ho- is impaired, rendering them unable to degrade pulmonary sur- meostasis, the accumulated material in lung sections from aged factants (6). Consistent with impaired function, histological Rasgrp1-deficient mice stained positively for all SPs (Fig. 3B). analysis of lung sections from aged Rasgrp1-deficient mice Accumulation of pulmonary surfactants in PAP is reportedly revealed enlarged PAS-positive alveolar macrophages in the caused by impaired degradation rather than increased SP expres- alveoli of Rasgrp1-deficient mice in comparison with control mice sion (5, 25). To investigate whether increased SP expression con- (Fig. 3A). To quantify alveolar macrophage size, we isolated BAL tributes to accumulation of surfactants in aged Rasgrp1-deficient cells from aged control and Rasgrp1-deficient mice and measured lungs, we measured SP gene expression using quantitative RT-PCR. cell diameters. Whereas the mean diameter of alveolar macro- No measurable differences in control and Rasgrp1-deficient mice in phages from littermate control mice was ∼14 mm, those from SP-A, -B, -C, or -D mRNA were observed, suggesting that the Rasgrp1-deficient mice had a significantly larger mean diameter accumulation of pulmonary surfactants is not due to increased gene (control versus Rasgrp1-deficient: 13.9 6 0.94 versus 17.2 6 2.25 expression (Fig. 3C). Taken together with histological analysis of mm; Fig. 4A, 4B). Moreover, alveolar macrophages from lung sections, these data support that Rasgrp1-deficient mice de- Rasgrp1-deficient mice were larger and more granular than those velop PAP in an age-dependent manner. from control mice using light scatter by flow cytometry (Fig. 4C). Downloaded from http://www.jimmunol.org/ by guest on October 2, 2021

FIGURE 4. Impaired surfactant degradation by alveolar macrophages from Rasgrp1-deficient mice. (A) Representative image of cytocentrifuged BAL cells stained with H&E from aged control and Rasgrp1-deficient mice (scale bars, 50 mm). (B) Diameter of alveolar macrophages quantified from aged control and Rasgrp1-deficient mice. Each symbol represents the mean diameter for alveolar macrophages from an individual mouse (**p = 0.004, unpaired Student t test with Welch’s correction). (C) Representative forward scatter (FSC) versus side scatter (SSC) flow cytometry plots of alveolar macrophages from aged control (top panel) and Rasgrp1-deficient (bottom panel) mice. Alveolar macrophages were identified as CD11c and Siglec F double-positive cells. (D) Representative flow cytometry histograms of surfactant degradation by alveolar macrophages from control and Rasgrp1-deficient mice. Open histogram (dashed line) indicates unstained control; open histogram (solid line) indicates labeled surfactant uptake at 30 min; filled histogram represents labeled surfactant at 4 h postuptake. (E) Rhodamine-labeled 1,2-dipalmitoyl-sn-glycero-3-phosphoethanolamine–labeled surfactant degradation for individual mice was quantified as an index of degradation where 1 is complete degradation of labeled surfactant and 0 is no degradation of labeled surfactant (****p , 0.0001, one-way ANOVA with Tukey’s multiple comparison test). ns, not significant. 6 AUTOIMMUNE PULMONARY ALVEOLAR PROTEINOSIS IN MICE

Therefore, alveolar macrophages from aged Rasgrp1-deficient to development of PAP in Rasgrp1-deficient mice, we measured mice are enlarged, consistent with an inability to degrade sur- the concentration of GM-CSF–specific IgG in serum and BALF factants. using ELISA. Aged control mice had a mean serum GM-CSF– To measure directly whether alveolar macrophages from mice specific IgG concentration of ∼10 ng/ml (10.4 6 4.9; Fig. 5A). In with PAP have impaired surfactant degradation, we incubated BAL contrast, aged-matched Rasgrp1-deficient mice had a mean serum cells with rhodamine-labeled surfactant. At indicated times, the GM-CSF–specific IgG concentration of 32.5 ng/ml, representing amount of rhodamine label in alveolar macrophages was measured a 3-fold increase relative to control mice. Consistent with the lack by flow cytometry (Fig. 4D). Surfactant degradation was quantified of disease in younger Rasgrp1-deficient mice, 2- to 3-mo-old as the percent reduction in rhodamine signal intensity after nor- Rasgrp1-deficient mice exhibited GM-CSF–specific IgG con- malizing to unstained cells (Fig. 4E). As expected, alveolar centration comparable with control mice (3.5 6 2.6; Fig. 5C). The macrophages from all mice showed maximal uptake of surfactant concentration of GM-CSF–specific IgG in BALF from aged after incubating for 30 min, consistent with previous reports (26). Rasgrp1-deficient mice was also increased in comparison with At 4-h incubation, alveolar macrophages from all control mice had levels measured from control mice (Fig. 5B). Therefore, GM- reduced rhodamine fluorescence, indicating that they had de- CSF–specific IgG autoantibodies are elevated in Rasgrp1-deficient graded the labeled surfactants. By comparison, alveolar mac- mice in an age-dependent manner. rophages from aged Rasgrp1-deficient mice, although showing To test whether GM-CSF–specific autoantibodies from Rasgrp1- surfactant uptake comparable with control cells, were less able to deficient mice have the capacity to neutralize GM-CSF, we degrade surfactant. Importantly, alveolar macrophages from young tested isolated serum IgG for the ability to block proliferation of Rasgrp1-deficient mice were able to both take up and degrade GM-CSF–dependent FDC-P1 cells (Fig. 5D). As a positive con- surfactants similar to alveolar macrophages from control mice. trol, a monoclonal rat anti-mouse GM-CSF IgG prevented growth Downloaded from These data demonstrate that alveolar macrophage function is of FDC-P1 cells. Importantly, IgG from wild-type mice failed to impaired in Rasgrp1-deficient mice with PAP. Moreover, surfac- inhibit GM-CSF–dependent growth. By comparison, serum IgG tant degradation by alveolar macrophages from young Rasgrp1- isolated from aged Rasgrp1-deficient mice completely inhibited deficient mice is not impaired, indicating alveolar macrophage GM-CSF–dependent growth. Therefore, aged Rasgrp1-deficient dysfunction is progressive in Rasgrp1-deficient mice. mice have elevated GM-CSF–neutralizing serum IgG, suggesting that progressive development of PAP in Rasgrp1-deficient mice http://www.jimmunol.org/ Rasgrp1-deficient mice have an increase in is autoimmune. GM-CSF–neutralizing IgG autoantibodies Rasgrp1-deficient mice develop germinal centers that contain Alveolar macrophages from Rasgrp1-deficient mice show autoreactive B cells and have increased levels of serum anti- characteristic GM-CSF depletion nuclear autoantibodies beginning at 2–3 mo of age (23). In aPAP In the absence of GM-CSF, alveolar macrophages have reduced patients, GM-CSF–specific IgG autoantibodies are elevated in expression of transcription factors PU.1 (6, 27) and PPARg 28), as serum and in BALF, and these Abs neutralize GM-CSF (10). To well as the ABCG1 transporter (29). Accordingly, if GM-CSF is determine whether GM-CSF–specific autoantibodies were linked neutralized by autoantibody in Rasgrp1-deficient mice, then PU.1, by guest on October 2, 2021

FIGURE 5. Elevated GM-CSF–neutralizing autoantibodies in aged Rasgrp1-deficient mice. Concentration of GM-CSF–specific IgG in the serum (A) and BALF (B) of aged control and Rasgrp1-deficient mice measured by ELISA. Symbols represent the mean concentration for individual mice (*p =0.02, ***p = 0.001, unpaired Student t test with Welch’s correction). (C) Concentration of GM-CSF–specific IgG in serum from young Rasgrp1-deficient mice compared with the concentration from aged Rasgrp1-deficient mice in (A)(****p , 0.0001, unpaired Student t test with Welch’s correction). (D)

Inhibition of FDC-P1 cell growth by pooled IgG from aged Rasgrp1-deﬁcient mice. Lines represent the OD450 of FDC-P1 cells grown in the absence of Csf-2 (dashed) or IgG (dotted) in the cell media. Symbols represent the mean values from duplicate wells (representative of three independent ex- periments; error bars represent SEM). The Journal of Immunology 7

PPARg, and ABCG1 mRNA levels would be reduced. To test the from aged Rasgrp1-deficient mice (n = 4) revealed lesions char- bioactivity of GM-CSF in Rasgrp1-deficient mice, we measured acteristic of PAP, whereas those from aged control mice (n =3) using quantitative RT-PCR the expression of PU.1, PPARg, and showed normal airways. Interestingly, 9 of 11 aged mice lacking ABCG1 in alveolar macrophages (GR12,CD11c+ Siglec F+) both RasGRP1 and CD275 (Rasgrp12/2 CD2752/2) had normal sorted from the lungs of aged control and Rasgrp1-deficient mice lung histology and, therefore, showed no signs of PAP (Fig. 7A). (Fig. 6). Consistent with aPAP patients, the relative expression of Although lung sections from two aged Rasgrp12/2 CD2752/2 PU.1, PPARg, and ABCG1 was reduced in alveolar macrophages mice exhibited enlarged alveolar macrophages, there was little from aged Rasgrp1-deficient mice compared with aged control evidence of surfactant accumulation compared with the pathology mice. Collectively, these data suggest that bioactivity of GM-CSF observed in aged Rasgrp12/2 mice (data not shown). To deter- is neutralized in Rasgrp1-deficient mice. mine whether the absence of PAP in Rasgrp12/2 CD2752/2 mice was due to a reduced autoimmunity, the concentration of serum Rasgrp1-deficient mice also deficient in CD275 have reduced GM-CSF–specific autoantibodies were measured. Similar to ear- GM-CSF–specific autoantibody and do not develop PAP lier data (Fig. 5), the concentration of serum GM-CSF–specific CD278/ICOS–CD275/ICOSL interactions are necessary for con- autoantibodies from Rasgrp1-deficient mice was ∼40 ng/ml. In ventional T cell–dependent humoral responses (30–32). GM-CSF contrast, the concentration of serum GM-CSF–specific autoanti- autoantibodies are IgG, and therefore likely to be dependent on bodies from Rasgrp12/2 CD2752/2 mice was reduced and com- T cell help. To test whether disrupting B cell–T cell interactions parable with those observed in control mice (Fig. 7B). Therefore, via CD278-CD275 is required for the development of aPAP and disruption of CD278–CD275 interactions abrogated the develop- GM-CSF autoantibodies, we crossed Rasgrp1-deficient mice to ment of aPAP. mice deficient in CD275. As before, histological lung sections Downloaded from

Discussion aPAP is a rare autoimmune disorder caused by neutralizing autoantibodies to GM-CSF. Currently, there are no identified animal models for aPAP that spontaneously produce GM-CSF–specific autoantibodies. In this article, we show that aged Rasgrp1-deficient http://www.jimmunol.org/ mice have an increase in morbidity and mortality associated with reduced pulmonary compliance. The histopathology in lungs of aged Rasgrp1-deficient mice is indistinguishable from human PAP with eosinophilic, PAS-positive, and SP-positive material within the alveoli of the lungs. Rasgrp1-deficient mice also have enlarged, foam-like alveolar macrophages that are impaired at degrading surfactants. Lastly, Rasgrp1-deficient mice exhibit an age- and CD275-dependent increase in GM- by guest on October 2, 2021 CSF–specific autoantibodies that are capable of neutralizing GM-CSF bioactivity. Collectively, the present studies strongly support that Rasgpr1-deficient mice develop autoantibody- mediated PAP. GM-CSF–specific autoantibody is elevated concomitant with disease onset, and IgG from aged Rasgrp1-deficient mice neu- tralizes GM-CSF, suggesting that Ab-mediated neutralization of GM-CSF is the mechanism of PAP in Rasgrp1-deficient mice. Moreover, the onset of pathology in Rasgrp1-deficient mice presents at 6–8 mo of age, which compares with aPAP patients who typically present from 30 to 46 y of age (8). This contrasts with GM-CSF– and GM-CSFR–deficient mice (1, 2, 4) that develop disease as early as 2 mo of age. Similarly, congenital disease in humans resulting from GM-CSFR mutations also presents early in life (33–35). Importantly, Rasgrp1-deficient mice do not show signs of disease early in life; therefore, we consider it highly unlikely that PAP in aged Rasgrp1-deficient mice is caused by congenital deficiency. Thus, the kinetics of disease in Rasgrp1- deficient mice is most consistent with aPAP rather than congenital disease. It should be noted that the concentration of GM-CSF–specific autoantibodies observed in Rasgrp1-deficient mice is lower than those established in human aPAP patients (18, 36, 37). This dif- ference may be caused by assay conditions used to quantify GM- FIGURE 6. Decreased levels of PU.1, PPARg,andABCG1mRNAinal- CSF–specific Abs in mouse. In our study, the concentration of veolar macrophages from Rasgrp1-deficient mice. mRNA expression of (A) PU.1, (B)PPARg,and(C) ABCG1 in alveolar macrophages from aged control GM-CSF–specific Abs was determined by comparison with a and Rasgrp1-deficient mice was measured by quantitative RT-PCR. Values standard curve generated using total Ig capture Ab (i.e., not GM- represent mean of duplicate wells expressed relative to b2-microglobulin CSF–specific capture). Therefore, the concentrations reported in (n = 6 control and n =4Rasgrp1-deficient; error bars represent SD; *p = this study are relative to detection of total, nonspecific IgG rather 0.01, **p = 0.004, unpaired Student t test with Welch’s correction). than GM-CSF–specific IgG. 8 AUTOIMMUNE PULMONARY ALVEOLAR PROTEINOSIS IN MICE

FIGURE 7. Rasgrp1-deficient mice also lacking CD275/ICOSL do not develop PAP and have normal GM-CSF–specific autoantibody levels. (A) Representative formalin- fixed, paraffin-embedded lung sections from control (upper right panel, n = 3), Rasgrp1-deficient (upper left panel, n = 4), CD275-deficient (lower left panel, n = 3), 2/2 2/2

and Rasgrp1 CD275 (lower right Downloaded from panel, n = 11) mice stained with H&E. Scale bars, 50 mm. (B) Concentrations of GM-CSF–specific IgG in the serum of aged control, Rasgrp1-deficient, CD275- deficient, and Rasgrp12/2 CD2752/2 mice measured by ELISA. Symbols represent the

mean concentration for individual mice http://www.jimmunol.org/ (**p # 0.005, one-way ANOVA with Tukey’s multiple comparison test). by guest on October 2, 2021

Reduced mRNA levels of GM-CSF–dependent genes are con- alveolar macrophage function. Notably, alveolar macrophages from sistent with GM-CSF neutralization as the cause of PAP in aged Rasgrp1-deficient mice have reduced PU.1 mRNA, again Rasgrp1-deficient mice. Alveolar macrophages from aPAP pa- implicating GM-CSF neutralization as a cause of pathology in aged tients and GM-CSF–deficient mice have markedly reduced levels Rasgrp1-deficient mice. of ABC transporter ABCG1 (29), a molecule involved in lipid GM-CSF deficiency or neutralization results in an increased transport (38–40). The reduction of ABCG1 is attributed to lower susceptibility to pulmonary pathogens (8) including many fungal levels of PPARg as a consequence of GM-CSF deficiency (28, 41). pathogens such as Cryptococcus neoformans (45), Pneumocystis Interestingly, mice deficient in ABCG1 display increased surfac- carinii (46), and Histoplasma capsulatum (47). Consistent with tants in the alveoli later in life; however, these mice also have autoantibody-mediated neutralization of GM-CSF, lung sections elevated SP-D and reduced SP-B and SP-C mRNA expression from aged Rasgrp1-deficient mice display positive staining for consistent with disorders of surfactant production (42, 43). Dis- Grocott’s methenamine silver (data not shown). Although PAP can orders of surfactant production are considered distinct from PAP, develop secondary to infection, particularly Pneumocystis spp. which is defined by an inability to degrade surfactants (44). No- infection, secondary PAP remains unlikely because: 1) aged tably, although alveolar macrophages from aged Rasgrp1-deficient Rasgrp1-deficient mice with PAP and littermate controls tested mice have a reduction in ABCG1 expression, they also have a negative in a serological test for Pneumocystis spp. (data not reduction in PPARg mRNA. Further, expression of SPs in the lung shown); 2) aged Rasgrp1-deficient mice that do not develop PAP is normal. Therefore, gene expression in alveolar macrophages from pathology are frequently caged with aged Rasgrp1-deficient mice aged Rasgrp1-deficient mice is most consistent with GM-CSF that develop PAP pathology; and 3) SP-B levels are decreased in a neutralization and aPAP rather than with disorders of surfactant mouse model of secondary PAP (48), whereas SP-B expression is production. Neutralization of GM-CSF in aPAP also causes reduced unchanged in aged Rasgrp1-deficient mice in comparison with con- levels of PU.1, a transcription factor regulated by GM-CSF (6, 12, trol mice. It is more likely that autoantibody neutralization of GM- 27). Enforced expression of PU.1 in alveolar macrophages from CSF contributes to impaired clearance by alveolar macrophages GM-CSF–deficient mice restores cell size, adherence, and surfac- (6) and/or inhibition of pulmonary macrophage and dendritic cell tant degradation (6), demonstrating that PU.1 is sufficient to recoup maturation (7, 49). Future studies can elucidate whether fungal The Journal of Immunology 9 infections in aged Rasgrp1-deficient mice contribute to mortality 2. Stanley, E., G. J. Lieschke, D. Grail, D. Metcalf, G. Hodgson, J. A. Gall, D. W. Maher, J. Cebon, V. Sinickas, and A. R. Dunn. 1994. Granulocyte/ because GM-CSF–deficient mice exhibit a normal life span (1). macrophage colony-stimulating factor-deficient mice show no major perturba- CD278/ICOS–CD275/ICOSL interactions are required for hu- tion of hematopoiesis but develop a characteristic pulmonary pathology. Proc. moral responses to T cell–dependent Ags (30). This study dem- Natl. Acad. Sci. USA 91: 5592–5596. 3. Robb, L., C. C. Drinkwater, D. Metcalf, R. Li, F. Ko¨ntgen, N. A. Nicola, and onstrates that aged Rasgrp1-deficient mice also lacking CD275 C. G. Begley. 1995. Hematopoietic and lung abnormalities in mice with a null produce normal amounts of GM-CSF–specific IgG Abs and do not mutation of the common beta subunit of the receptors for granulocyte- develop PAP. Thus, these data support that PAP in Rasgrp1-deficient macrophage colony-stimulating factor and interleukins 3 and 5. Proc. Natl. Acad. Sci. USA 92: 9565–9569. mice is autoantibody dependent. In MRL/lpr (50), collagen-induced 4. Nishinakamura, R., N. Nakayama, Y. Hirabayashi, T. Inoue, D. Aud, T. McNeil, arthritis (51), and diabetes/NOD mouse models (52), disruption of S. Azuma, S. Yoshida, Y. Toyoda, K. Arai, et al. 1995. Mice deficient for the CD278–CD275 interactions mitigates severity of disease. CD278– IL-3/GM-CSF/IL-5 beta c receptor exhibit lung pathology and impaired immune response, while beta IL3 receptor-deficient mice are normal. Immunity 2: CD275 interactions are considered key for the generation of Tfhs 211–222. (53, 54). In recent work, we demonstrated that Rasgrp1-deficient 5. Huffman, J. A., W. M. Hull, G. Dranoff, R. C. Mulligan, and J. A. Whitsett. mice have increased frequency and number of IL-17A–producing 1996. Pulmonary epithelial cell expression of GM-CSF corrects the alveolar proteinosis in GM-CSF-deficient mice. J. Clin. Invest. 97: 649–655. Tfh cells (55). Interestingly, Rasgrp1-deficient mice also lacking 6. Shibata, Y., P. Y. Berclaz, Z. C. Chroneos, M. Yoshida, J. A. Whitsett, and CD275 still produced Tfh17 cells, formed germinal centers, and B. C. Trapnell. 2001. GM-CSF regulates alveolar macrophage differentiation and innate immunity in the lung through PU.1. Immunity 15: 557–567. produced similar titers of anti-nuclear autoantibodies compared with 7. Hashimoto, D., A. Chow, C. Noizat, P. Teo, M. B. Beasley, M. Leboeuf, mice lacking only RasGRP1. However, whereas Tfh17 cells from C. D. Becker, P. See, J. Price, D. Lucas, et al. 2013. Tissue-resident macrophages Rasgrp1-deficient mice also produced IL-21, Tfh17 cells from self-maintain locally throughout adult life with minimal contribution from cir- 2/2 2/2 culating monocytes. Immunity 38: 792–804. Rasgrp1 CD275 mice did not. Because GM-CSF–specific 8. Seymour, J. F., and J. J. Presneill. 2002. Pulmonary alveolar proteinosis: progress Downloaded from autoantibodies in mice lacking both RasGRP1 and CD275 are re- in the first 44 years. Am. J. Respir. Crit. Care Med. 166: 215–235. duced to levels comparable with control mice, we speculate that 9. Trapnell, B. C., J. A. Whitsett, and K. Nakata. 2003. Pulmonary alveolar proteinosis. N. Engl. J. Med. 349: 2527–2539. IL-21 production by Tfh17 cells is critical for GM-CSF–specific but 10. Kitamura, T., N. Tanaka, J. Watanabe, S. Uchida, S. Kanegasaki, Y. Yamada, and not anti-nuclear autoantibodies. Formal testing of this hypothesis K. Nakata. 1999. Idiopathic pulmonary alveolar proteinosis as an autoimmune may be significant for human disease as well. To date, no studies disease with neutralizing antibody against granulocyte/macrophage colony- stimulating factor. J. Exp. Med. 190: 875–880. have examined the importance of Tfhs, CD275–CD278 interactions, 11. Uchida, K., K. Nakata, B. C. Trapnell, T. Terakawa, E. Hamano, A. Mikami, and/or IL-21 in human disease, although GM-CSF–specific auto- I. Matsushita, J. F. Seymour, M. Oh-Eda, I. Ishige, et al. 2004. High-affinity http://www.jimmunol.org/ autoantibodies specifically eliminate granulocyte-macrophage colony- antibodies from aPAP patients are heavily somatically hypermutated stimulating factor activity in the lungs of patients with idiopathic pulmonary (16), suggesting a role for Tfh cells. alveolar proteinosis. Blood 103: 1089–1098. Mutations in BCR and TCR signaling pathways can facilitate 12. Sakagami, T., D. Beck, K. Uchida, T. Suzuki, B. C. Carey, K. Nakata, G. Keller, R. E. Wood, S. E. Wert, M. Ikegami, et al. 2010. Patient-derived granulocyte/ breaks in B and T cell tolerance. For example, Rasgrp1 deficiency macrophage colony-stimulating factor autoantibodies reproduce pulmonary al- in mice leads to a break in tolerance in B cells early in develop- veolar proteinosis in nonhuman primates. Am. J. Respir. Crit. Care Med. 182: ment, at the transitional stage, and in the germinal center (23). 49–61. 13. Malur, A., M. S. Kavuru, I. Marshall, B. P. Barna, I. Huizar, R. Karnekar, and These studies used an Ig knock-in transgene with broad specificity M. J. Thomassen. 2012. Rituximab therapy in pulmonary alveolar proteinosis to ssRNA and nuclear Ags. It is unknown whether GM-CSF– improves alveolar macrophage lipid homeostasis. Respir. Res. 13: 46. by guest on October 2, 2021 specific B cells are regulated similarly. Notably, anti-nuclear and 14. Kavuru, M. S., A. Malur, I. Marshall, B. P. Barna, M. Meziane, I. Huizar, H. Dalrymple, R. Karnekar, and M. J. Thomassen. 2011. An open-label trial transgene-derived autoantibodies are elevated at 2–3 mo of age in of rituximab therapy in pulmonary alveolar proteinosis. Eur. Respir. J. 38: Rasgrp1-deficient mice, an age at which the concentration of GM- 1361–1367. 15. Amital, A., S. Dux, D. Shitrit, O. Shpilberg, and M. R. Kramer. 2010. Thera- CSF–specific autoantibodies is similar to those observed in control peutic effectiveness of rituximab in a patient with unresponsive autoimmune mice. As discussed earlier, elevation of GM-CSF–specific auto- pulmonary alveolar proteinosis. Thorax 65: 1025–1026. antibodies is not evident until 6–8 mo of age. Whether these age- 16. Wang, Y., C. A. Thomson, L. L. Allan, L. M. Jackson, M. Olson, T. R. Hercus, T. L. Nero, A. Turner, M. W. Parker, A. L. Lopez, et al. 2013. Characterization of dependent changes in anti–GM-CSF Ab levels are due to escape pathogenic human monoclonal autoantibodies against GM-CSF. Proc. Natl. from discrete tolerance checkpoints is unknown. To our knowledge, Acad. Sci. USA 110: 7832–7837. no studies are examining whether BCR and TCR signaling mutations 17.Piccoli,L.,I.Campo,C.S.Fregni,B.M.Rodriguez,A.Minola,F.Sallusto, M. Luisetti, D. Corti, and A. Lanzavecchia. 2015. Neutralization and clearance of or specific tolerance checkpoints associate with aPAP in humans. GM-CSF by autoantibodies in pulmonary alveolar proteinosis. Nat. Commun. 6: 7375. In conclusion, our data strongly suggest, to our knowledge, that 18. Uchida, K., K. Nakata, T. Suzuki, M. Luisetti, M. Watanabe, D. E. Koch, Rasgrp1-deficient mice are the first rodent model for aPAP. Thus, C. A. Stevens, D. C. Beck, L. A. Denson, B. C. Carey, et al. 2009. Granulocyte/ macrophage-colony-stimulating factor autoantibodies and myeloid cell immune Rasgrp1-deficient mice develop age-dependent PAP-like pathol- functions in healthy subjects. Blood 113: 2547–2556. ogy in the lung that corresponds with an age-dependent increase in 19. Ebinu, J. O., S. L. Stang, C. Teixeira, D. A. Bottorff, J. Hooton, P. M. Blumberg, M. Barry, R. C. Bleakley, H. L. Ostergaard, and J. C. Stone. 2000. RasGRP links GM-CSF–specific neutralizing autoantibodies. This novel aPAP T-cell receptor signaling to Ras. Blood 95: 3199–3203. model may reveal important underlying immune mechanisms and 20. Dower, N. A., S. L. Stang, D. A. Bottorff, J. O. Ebinu, P. Dickie, identify new therapeutic targets for human aPAP. H. L. Ostergaard, and J. C. Stone. 2000. RasGRP is essential for mouse thy- mocyte differentiation and TCR signaling. Nat. Immunol. 1: 317–321. 21. Coughlin, J. J., S. L. Stang, N. A. Dower, and J. C. Stone. 2005. RasGRP1 and Acknowledgments RasGRP3 regulate B cell proliferation by facilitating B cell receptor-Ras signaling. J. Immunol. 175: 7179–7184. We thank Kristin O’Donnell for assistance with measuring pulmonary 22. Coughlin, J. J., S. L. Stang, N. A. Dower, and J. C. Stone. 2006. The role of compliance and Audrey Vasauskas for assistance with surfactant staining. RasGRPs in regulation of lymphocyte proliferation. Immunol. Lett. 105: 77–82. 23. Bartlett, A., J. E. Buhlmann, J. Stone, B. Lim, and R. A. Barrington. 2013. Multiple checkpoint breach of B cell tolerance in Rasgrp1-deficient mice. Disclosures J. Immunol. 191: 3605–3613. The authors have no financial conflicts of interest. 24. Priatel, J. J., S. J. Teh, N. A. Dower, J. C. Stone, and H. S. Teh. 2002. RasGRP1 transduces low-grade TCR signals which are critical for T cell development, homeostasis, and differentiation. Immunity 17: 617–627. 25. Brasch, F., J. Birzele, M. Ochs, S. H. Guttentag, O. D. Schoch, A. Boehler, References M. F. Beers, K. M. Muller,€ S. Hawgood, and G. Johnen. 2004. Surfactant pro- 1. Dranoff, G., A. D. Crawford, M. Sadelain, B. Ream, A. Rashid, R. T. Bronson, teins in pulmonary alveolar proteinosis in adults. Eur. Respir. J. 24: 426–435. G. R. Dickersin, C. J. Bachurski, E. L. Mark, J. A. Whitsett, and R. C. Mulligan. 26. Yoshida, M., M. Ikegami, J. A. Reed, Z. C. Chroneos, and J. A. Whitsett. 2001. 1994. Involvement of granulocyte-macrophage colony-stimulating factor in GM-CSF regulates protein and lipid catabolism by alveolar macrophages. Am. pulmonary homeostasis. Science 264: 713–716. J. Physiol. Lung Cell. Mol. Physiol. 280: L379–L386. 10 AUTOIMMUNE PULMONARY ALVEOLAR PROTEINOSIS IN MICE

27. Bonfield, T. L., B. Raychaudhuri, A. Malur, S. Abraham, B. C. Trapnell, accumulation in alveolar macrophages of GM-CSF knockout mice. Am. M. S. Kavuru, and M. J. Thomassen. 2003. PU.1 regulation of human alveolar J. Physiol. Lung Cell. Mol. Physiol. 300: L73–L80. macrophage differentiation requires granulocyte-macrophage colony-stimulating 42. Out, R., M. Hoekstra, R. B. Hildebrand, J. K. Kruit, I. Meurs, Z. Li, F. Kuipers, factor. Am. J. Physiol. Lung Cell. Mol. Physiol. 285: L1132–L1136. T. J. Van Berkel, and M. Van Eck. 2006. Macrophage ABCG1 deletion disrupts 28. Bonfield, T. L., C. F. Farver, B. P. Barna, A. Malur, S. Abraham, lipid homeostasis in alveolar macrophages and moderately influences athero- B. Raychaudhuri, M. S. Kavuru, and M. J. Thomassen. 2003. Peroxisome sclerotic lesion development in LDL receptor-deficient mice. Arterioscler. proliferator-activated receptor-gamma is deficient in alveolar macrophages from Thromb. Vasc. Biol. 26: 2295–2300. patients with alveolar proteinosis. Am. J. Respir. Cell Mol. Biol. 29: 677–682. 43. Baldań, A., P. Tarr, C. S. Vales, J. Frank, T. K. Shimotake, S. Hawgood, and 29. Thomassen, M. J., B. P. Barna, A. G. Malur, T. L. Bonfield, C. F. Farver, P. A. Edwards. 2006. Deletion of the transmembrane transporter ABCG1 results A. Malur, H. Dalrymple, M. S. Kavuru, and M. Febbraio. 2007. ABCG1 is in progressive pulmonary lipidosis. J. Biol. Chem. 281: 29401–29410. deficient in alveolar macrophages of GM-CSF knockout mice and patients with 44. Carey, B., and B. C. Trapnell. 2010. The molecular basis of pulmonary alveolar pulmonary alveolar proteinosis. J. Lipid Res. 48: 2762–2768. proteinosis. Clin. Immunol. 135: 223–235. 30. Tafuri, A., A. Shahinian, F. Bladt, S. K. Yoshinaga, M. Jordana, A. Wakeham, 45. Chen, G. H., M. A. Olszewski, R. A. McDonald, J. C. Wells, R. Paine, III, L. M. Boucher, D. Bouchard, V. S. Chan, G. Duncan, et al. 2001. ICOS is es- G. B. Huffnagle, and G. B. Toews. 2007. Role of granulocyte macrophage sential for effective T-helper-cell responses. Nature 409: 105–109. colony-stimulating factor in host defense against pulmonary Cryptococcus 31. Warnatz, K., L. Bossaller, U. Salzer, A. Skrabl-Baumgartner, W. Schwinger, M. van neoformans infection during murine allergic bronchopulmonary mycosis. Am. der Burg, J. J. van Dongen, M. Orlowska-Volk, R. Knoth, A. Durandy, et al. 2006. J. Pathol. 170: 1028–1040. Human ICOS deficiency abrogates the germinal center reaction and provides a 46. Paine, R., III, A. M. Preston, S. Wilcoxen, H. Jin, B. B. Siu, S. B. Morris monogenic model for common variable immunodeficiency. Blood 107: 3045–3052. J. A. Reed, G. Ross, J. A. Whitsett, and J. M. Beck. 2000. Granulocyte-macrophage 32. Choi, Y. S., R. Kageyama, D. Eto, T. C. Escobar, R. J. Johnston, L. Monticelli, colony-stimulating factor in the innate immune response to Pneumocystis carinii C. Lao, and S. Crotty. 2011. ICOS receptor instructs T follicular helper cell pneumonia in mice. J. Immunol. 164: 2602–2609. versus effector cell differentiation via induction of the transcriptional repressor 47. Deepe, G. S., Jr., R. Gibbons, and E. Woodward. 1999. Neutralization of en- Bcl6. Immunity 34: 932–946. dogenous granulocyte-macrophage colony-stimulating factor subverts the 33. Suzuki, T., T. Sakagami, B. K. Rubin, L. M. Nogee, R. E. Wood, protective immune response to Histoplasma capsulatum. J. Immunol. 163: S. L. Zimmerman, T. Smolarek, M. K. Dishop, S. E. Wert, J. A. Whitsett, et al. 4985–4993. 2008. Familial pulmonary alveolar proteinosis caused by mutations in CSF2RA. 48. Beers, M. F., E. N. Atochina, A. M. Preston, and J. M. Beck. 1999. Inhibition of J. Exp. Med. 205: 2703–2710. lung surfactant protein B expression during Pneumocystis carinii pneumonia in Downloaded from 34. Martinez-Moczygemba, M., M. L. Doan, O. Elidemir, L. L. Fan, S. W. Cheung, mice. J. Lab. Clin. Med. 133: 423–433. J. T. Lei, J. P. Moore, G. Tavana, L. R. Lewis, Y. Zhu, et al. 2008. Pulmonary 49. Chen, G. H., S. Teitz-Tennenbaum, L. M. Neal, B. J. Murdock, alveolar proteinosis caused by deletion of the GM-CSFRalpha gene in the X A. N. Malachowski, A. J. Dils, M. A. Olszewski, and J. J. Osterholzer. 2016. chromosome pseudoautosomal region 1. J. Exp. Med. 205: 2711–2716. Local GM-CSF-dependent differentiation and activation of pulmonary dendritic 35. Dirksen, U., R. Nishinakamura, P. Groneck, U. Hattenhorst, L. Nogee, cells and macrophages protect against progressive cryptococcal lung infection in R. Murray, and S. Burdach. 1997. Human pulmonary alveolar proteinosis as- mice. J. Immunol. 196: 1810–1821. sociated with a defect in GM-CSF/IL-3/IL-5 receptor common beta chain ex- 50. Odegard, J. M., B. R. Marks, L. D. DiPlacido, A. C. Poholek, D. H. Kono,

pression. J. Clin. Invest. 100: 2211–2217. C. Dong, R. A. Flavell, and J. Craft. 2008. ICOS-dependent extrafollicular helper http://www.jimmunol.org/ 36. Nei, T., S. Urano, N. Motoi, J. Takizawa, C. Kaneko, H. Kanazawa, R. Tazawa, T cells elicit IgG production via IL-21 in systemic autoimmunity. J. Exp. Med. K. Nakagaki, K. S. Akagawa, K. Akasaka, et al. 2012. IgM-type GM-CSF au- 205: 2873–2886. toantibody is etiologically a bystander but associated with IgG-type autoanti- 51. Frey, O., J. Meisel, A. Hutloff, K. Bonhagen, L. Bruns, R. A. Kroczek, body production in autoimmune pulmonary alveolar proteinosis. Am. J. Physiol. L. Morawietz, and T. Kamradt. 2010. Inducible costimulator (ICOS) blockade Lung Cell. Mol. Physiol. 302: L959–L964. inhibits accumulation of polyfunctional T helper 1/T helper 17 cells and miti- 37. Seymour, J. F., I. R. Doyle, K. Nakata, J. J. Presneill, O. D. Schoch, E. Hamano, gates autoimmune arthritis. Ann. Rheum. Dis. 69: 1495–1501. K. Uchida, R. Fisher, and A. R. Dunn. 2003. Relationship of anti-GM-CSF 52. Ansari, M. J., P. Fiorina, S. Dada, I. Guleria, T. Ueno, X. Yuan, antibody concentration, surfactant protein A and B levels, and serum LDH to S. Trikudanathan, R. N. Smith, G. Freeman, and M. H. Sayegh. 2008. Role of pulmonary parameters and response to GM-CSF therapy in patients with idio- ICOS pathway in autoimmune and alloimmune responses in NOD mice. Clin. pathic alveolar proteinosis. Thorax 58: 252–257. Immunol. 126: 140–147. 38. Kobayashi, A., Y. Takanezawa, T. Hirata, Y. Shimizu, K. Misasa, N. Kioka, 53. Johnston, R. J., A. C. Poholek, D. DiToro, I. Yusuf, D. Eto, B. Barnett,

H. Arai, K. Ueda, and M. Matsuo. 2006. Efﬂux of sphingomyelin, cholesterol, A. L. Dent, J. Craft, and S. Crotty. 2009. Bcl6 and Blimp-1 are reciprocal and by guest on October 2, 2021 and phosphatidylcholine by ABCG1. J. Lipid Res. 47: 1791–1802. antagonistic regulators of T follicular helper cell differentiation. Science 325: 39. Malur, A., I. Huizar, G. Wells, B. P. Barna, A. G. Malur, and M. J. Thomassen. 2011. 1006–1010. Lentivirus-ABCG1 instillation reduces lipid accumulation and improves lung com- 54. Nurieva, R. I., Y. Chung, G. J. Martinez, X. O. Yang, S. Tanaka, pliance in GM-CSF knock-out mice. Biochem. Biophys. Res. Commun. 415: 288–293. T. D. Matskevitch, Y. H. Wang, and C. Dong. 2009. Bcl6 mediates the devel- 40. Balda´n, A., P. Tarr, R. Lee, and P. A. Edwards. 2006. ATP-binding cassette opment of T follicular helper cells. Science 325: 1001–1005. transporter G1 and lipid homeostasis. Curr. Opin. Lipidol. 17: 227–232. 55. Smith, C., J. E. Buhlmann, X. Wang, A. Bartlett, B. Lim, and R. A. Barrington. 41. Malur, A., A. D. Baker, A. J. McCoy, G. Wells, B. P. Barna, M. S. Kavuru, 2016. CD275-independent IL-17 producing T follicular helper-like cells in A. G. Malur, and M. J. Thomassen. 2011. Restoration of PPARg reverses lipid lymphopenic autoimmune-prone mice. J. Immunol. 196: 4935–4946.