BMP15 regulates the inhibin/activin system independently of ovulation rate control in sheep Anthony Estienne, Belén Lahoz, Peggy Jarrier-Gaillard, Loys Bodin, José Folch, José Luis Alabart, Stéphane Fabre, Danielle Monniaux
To cite this version:
Anthony Estienne, Belén Lahoz, Peggy Jarrier-Gaillard, Loys Bodin, José Folch, et al.. BMP15 regulates the inhibin/activin system independently of ovulation rate control in sheep. Reproduction, BioScientifica, 2017, 153 (4), pp.395-404. 10.1530/REP-16-0507. hal-01595250
HAL Id: hal-01595250 https://hal.archives-ouvertes.fr/hal-01595250 Submitted on 25 May 2020
HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. Version postprint Page 1of39 Monniaux, D.(2017).BMP15 regulates theinhibin/activin systemindependently of ovulationrate control Reproduction AdvancePublicationfirstpostedon9January2017asManuscriptREP-16-0507 10 10 12 12 13 13 14 14 17 17 16 4 4 1 1 3 3 6 6 7 7 9 9 8 Estienne, A.,Lahoz,B., Jarrier,P.,Bodin, L.,Folch, J.,Alabart,J. L., Fabre,S., BMP15 regulates the inhibin/activin system independently of ovulation rate control insheep ratecontrol ovulation independently of system theinhibin/activin regulates BMP15 5 Anthony Estienne Anthony 2 Alabart 11 Agroalimentaria de Aragón (CITA). Instituto Agroalimentario de Aragón – IA2 (CITA IA2 – Aragón de Agroalimentario Instituto (CITA). Aragón de Agroalimentaria Comportements, Centre INRA Val de Loire, F 37380 Nouzilly, FranceF 37380 Nouzilly, deLoire, Val INRA Centre Comportements, ( Universidad de Zaragoza), 50059 Zaragoza, España. España. Zaragoza, deZaragoza),50059 Universidad 1 * 3 2 Short title : Inhibin/activin system regulation by BMP15 BMP15 byregulation system Inhibin/activin : title Short 15
UMR85 PRC, INRA, CNRS, IFCE, Université de Tours, 37380 Nouzilly, France 37380Nouzilly, deTours, IFCE, Université INRA,CNRS, PRC, UMR85 [email protected] GenPhySE, Université de Toulouse, INRA, INPT, ENVT, 31326 Castanet Tolosan, France Tolosan, 31326Castanet INPT, ENVT, INRA, deToulouse, Université GenPhySE, Tecnología y Investigación Centro Animal, de Sanidad y deProducción Unidad Corresponding author : Danielle Monniaux, Physiologie de la Reproduction et des et delaReproduction Physiologie Monniaux, : Danielle author Corresponding in sheep. Reproduction, 153 (4), 395-404. DOI: 10.1530/REP-16-0507 2 , Stéphane Fabre Stéphane , Copyright ©2017 bythe Society for Reproduction and Fertility. 1 , Belén Lahoz Belén , Comment citer cedocument: 3 and DanielleMonniaux and )
2
, PeggyJarrier , 1 1 1 , Loys Bodin Loys, 1*
3 , JoséFolch , 2 , José Luis José Luis ,
Version postprint Monniaux, D.(2017).BMP15 regulates theinhibin/activin systemindependently of ovulationrate control 22 22 21 23 23 24 24 18 18 25 25 36 36 19 19 26 26 27 27 20 20 38 38 37 28 28 32 32 31 29 29 30 30 33 33 34 34 35 35 Estienne, A.,Lahoz,B., Jarrier,P.,Bodin, L.,Folch, J.,Alabart,J. L., Fabre,S., BMP15 INHBA ACVR2A have studied the effects of two natural loss of function mutations of mutations loss of function naturalof twostudied the effects have of components ofThethissystem. components of respectively in Rasa Aragonesa ewes at the heterozygous state and in Grivette ewes at theatGrivette in ewes and state theheterozygous ewes at Aragonesa Rasain respectively Polymorphisms in the gene encoding bone morphogenetic protein 15 (BMP15) have been 15have (BMP15) protein morphogenetic bone encoding thegene in Polymorphisms Abstract homozygous state, were associated with a two fold increase in ovulation rate. There were onlywere Thererate. increaseovulation in two fold witha associated were state, homozygous ovulation rate associated with with rateassociated ovulation associated with multiple ovulations in sheep. As BMP15 regulates inhibin expression in in inhibin expression regulates As sheep. BMP15 in multipleovulations with associated small differences between mutant and wild type ewes for mRNA expression of mRNAexpression ewes for wild type mutant and between differences small rodents, we assumed that the ovarian inhibin/activin system could mediate part of the effect of the of mediateeffect part systemcould inhibin/activin theovarian that we assumed rodents,
concentrations in follicular fluid. Moreover, the effects of mutations differed betweenbreeds. differed mutations of theeffects Moreover, fluid. infollicular concentrations TGFBR3 In cultures of granulosa cells from wild type ewes, BMP15, acting alone orsynergy with alone in acting BMP15, wild type ewes, offrom granulosa cells cultures In GDF9, stimulated stimulated GDF9, elements, and the differential regulation of these elements by BMP15 and activin can explain can and BMP15activin by these thedifferentialof elements regulation and elements, that theeffectsof that conclusion, the ovarian inhibin/activin system is unlikely to participate in the increase of increaseparticipate in tothe is systemunlikely inhibin/activin theovarian conclusion, in sheep. Reproduction, 153 (4), 395-404. DOI: 10.1530/REP-16-0507 , mutations in the regulation of ovulation rate in sheep. To answer this question, wequestion, thisTo answer rateinsheep. ovulation of intheregulation mutations ACVR1B . Activin A did affect A Activin not . . The complexity of the inhibin/activin system, including positive and antagonistic positiveantagonistic andincluding system, theinhibin/activin ofThe complexity. , , BMP15 INHA ACVR2A, FST ACVR2A, Comment citer cedocument: , INHBA mutations differ when present in different genetic backgrounds. In differentmutationswhen in differ backgrounds. genetic present BMP15 and or
INHBA FecX TGFBR3 FST mutations insheep. mutations R and theand expression, but inhibited the expression of theexpression but inhibited expression, expression, but inhibited also the expression of theexpression but inhibited also expression, in granulosa cells, and Inhibin A or Activin AActivinor AInhibin and cells, granulosa in 2 2 FecX Gr mutations, when present mutations, BMP15 on theexpression on INHA , , Page 2of39 Version postprint Page 3of39 Monniaux, D.(2017).BMP15 regulates theinhibin/activin systemindependently of ovulationrate control 44 44 45 45 43 43 46 46 48 48 49 49 50 50 40 40 47 47 39 39 41 41 42 42 51 51 52 52 53 53 54 54 55 55 62 62 61 61 63 63 57 57 56 56 58 58 59 59 60 60 Estienne, A.,Lahoz,B., Jarrier,P.,Bodin, L.,Folch, J.,Alabart,J. L., Fabre,S., BMPR1B propensity for dizygotic twins (Palmer twins dizygotic for propensity biological activity of the proteins in poly ovulating mammals (Monestier poly ovulatingmammals in the of proteins activity biological a key role in this process. In sheep, heterozygous carriers of various missense mutations mutations missense various of carriers heterozygoussheep, process.In this role in akey affecting to be specifically expressed in the oocyte (McGrath theoocyte in expressed specifically be to Persani BMP15/GDF9 signaling factor) have also been shown to occur among human cohorts witha cohorts humanamong occur toshown been also have factor) signaling BMP15/GDF9 transforming growth factor beta (TGFß) family in the control of ovulation number at each ateach numberovulation controlofin (TGFß)family the beta growthfactor transforming (Montgomery Introduction Introduction sexual cycle (ovulation rate) in adult females. In particular, the bone morphogenetic proteins morphogenetic Inthebone particular, in adult females. rate) (ovulation cyclesexual BMP15 (bone morphogenetic protein 15) and GDF9 (growth differentiation factor 9), known 9),known factor differentiation GDF9(growth15) and protein morphogenetic (bone BMP15 Mbarek genes has been recently associated with twinning in callitrichine primates (Harrisprimates in callitrichine withtwinning recently been associated has genes From a phylogenetic analysis comparing mono and poly ovulating mammalian species, high species, poly ovulatingmammalian and mono comparing analysisphylogenetic aFrom variations have been observed in specific areas of BMP15 and GDF9, able to modify GDF9,the able and to BMP15 of in specific areas observed been have variations Themmen 2005; Knight & Glister 2006; Visser & Themmen 2014), has also been proposed to been hasalso Themmen2014), Visser & 2006; Glister Knight 2005;& Themmen TGFß family known to importantly modulate FSH sensitivity (DurlingersensitivityFSHmodulate importantly toknown family TGFß understood. BMP15, acting alone or in synergy with GDF9, can modulate follicle growth and growth follicle GDF9, orsynergymodulate can in with alone actingBMP15, understood. maturation by controlling granulosa cell proliferation and their responsiveness to FSHresponsiveness to their proliferation and granulosacell controlling by maturation (Otsuka Shimasaki 2005). Recently, the anti Müllerian hormone (AMH), another member of theof member another hormone(AMH), the anti Müllerian Recently, 2005). Shimasaki in sheep. Reproduction, 153 (4), 395-404. DOI: 10.1530/REP-16-0507 et al. et Increasing evidence support the involvement of cytokines belonging to belongingthe to of cytokines theinvolvement support evidence Increasing The mechanism by which BMP15 and GDF9 control the ovulation rate is not fully rateisfully theovulation not GDF9control BMP15whichand by mechanism The et al. et et al. et , BMP15
exhibit systematically increased ovulation rates and litter sizes (reviews:sizeslitterrates and ovulation increased systematically exhibit 2014). Polymorphisms inPolymorphisms 2014). 2016) and the presence of non synonymous substitutions in substitutions of non synonymous 2016) theand presence 2000;Otsuka et al.et or 2001; Galloway 2001; Comment citer cedocument: GDF9 , or carriers of a partial loss of function mutation in their receptor theirreceptor in mutation loss of function apartial of carriers or , et al. et 2001; Moore 2001;
et al. et et al. et GDF9 2002;McNatty 2006; Hoekstra 2006; , , 3 3 etal. BMPR1B et al. et 2003; McNatty 2003; and 1995; Dube1995; et al. et et al.et SMAD3 2003; Fabre 2003; 2008; Luong2008; et al. et (encoding a(encoding et al. et et al. et et al.et 2005b; Moore & 2005b; BMP15 1998), could play could 1998), et al. et 2001; Visser & 2001; 2014). et al.et et al. et 2006; or 2011; 2011; GDF9 2014).
Version postprint Monniaux, D.(2017).BMP15 regulates theinhibin/activin systemindependently of ovulationrate control 74 74 75 75 84 84 76 76 85 85 72 72 78 78 77 86 86 73 73 79 79 80 80 81 81 83 83 82 82 64 64 65 65 87 87 70 70 88 88 66 66 71 71 67 67 68 68 69 69 Estienne, A.,Lahoz,B., Jarrier,P.,Bodin, L.,Folch, J.,Alabart,J. L., Fabre,S., promoting granulosa cell proliferation, enhancing FSHR (follicle stimulating hormone stimulatinghormone FSHR(follicle enhancing proliferation, cell granulosa promoting participate in this mechanism. Indeed, BMP15 enhances the expression of AMH and its and of AMH theexpression enhances Indeed, BMP15 thisinmechanism. participate receptor) and CYP19A1 (cytochrome P450 family 19 subfamily A member 1, also known asknown 1, alsoA member 19subfamily P450 family (cytochrome CYP19A1 and receptor) always accompanied by the expected rise in plasma FSH, and intra ovarian effects of effects intra ovarian plasma FSH, and inrise theexpected by accompanied always aromatase) expression, and inhibiting follicle atresia and luteinization, whereas inhibins whereas atresialuteinization, inhibiting and follicle and expression, aromatase) neutralizing endogenous inhibin bioactivity might also be involved in the stimulation of thestimulation might in involvedbe bioactivityalso inhibin endogenous neutralizing granulosa cells of growing follicles and known to act in an opposite waytheirtargetcells.on anopposite in to known act and growingfollicles of cells granulosa are secreted by the largest follicles during terminal follicular development and are important important development are and terminal during follicular folliclesby largest secretedthe are (Knightthese modulatingprocesses thussignaling, the activin oppose follicular development (Tannetta development follicular Activins are importantly implicated in follicular growth, acting in an intra ovarian way byway anintra ovarian ingrowth,actingin follicular importantly implicated are Activins inhibitors of FSH secretion by pituitary gonadotrophs. In various animal species, species, Ingonadotrophs.animal various by pituitary FSH secretion of inhibitors immunization against inhibin induces multiple ovulations and an increase in pituitary pituitary in increase anandmultipleovulations induces inhibin against immunization secretion of FSH appears to be the main mechanism by which the growth of additional growthwhichof by the mechanism to thebemain FSH of appears secretion Drummond follicles is stimulated (Henderson isstimulated follicles specific receptor AMHR2 in the granulosa cells of sheep antral follicles, and hyperprolific hyperprolific follicles, and sheepantral ofthe granulosa cells in AMHR2 receptor specific ewes carrying a loss of function mutationin aloss of function ewes carrying glycosylation of the inhibin alpha and beta A subunits is associated with multiple ovulations ovulations withmultiple associatedAsubunits betais and alphaof theinhibin glycosylation Inhibins and activins, other members of the TGFß family, could also be involved ininvolved bealso could TGFß of family, the other members activins,and Inhibins respectively impaired expression of AMHR2 or AMH(Estienne orAMHR2 of expression impaired respectively the mechanisms leading to multiple ovulations. Inhibins and activins are produced bythe produced Inhibins andare ovulations.activins multiple to leading mechanisms the
2016). It is suggested that low BMP15 and low AMH signaling in follicles of these mutant mutant of these in follicles signaling AMH BMP15lowandlow that suggested Itis2016). ewes contribute to sensitizing granulosa cells to FSH, thereby promoting the selection andselection promotingthe thereby to FSH, cells granulosa sensitizing to ewes contribute maintenance of follicles during the follicular phase, and thus enhancing the ovulation rate. ovulation the enhancingthusphase, and follicular the of during follicles maintenance in sheep. Reproduction, 153 (4), 395-404. DOI: 10.1530/REP-16-0507 et al.et 2004;Yan Comment citer cedocument: et al. et et al. et
et al. et 2015). However, immunization against inhibin isnot against inhibin immunization However,2015). 1998). Interestingly, the specific intra ovarian specific intra ovarian Interestingly,the 1998). 1984; Forage1984; BMP15 4 4 or its receptoror its et al. et 1987; Hillard 1987; et al. et BMPR1B et al.et 2015; Pierre 2015; et al. et 2012). Inhibins Inhibins 2012). show 1995; et al. et
Page 4of39 Version postprint Page 5of39 Monniaux, D.(2017).BMP15 regulates theinhibin/activin systemindependently of ovulationrate control 113 113 112 112 108 108 106 110 110 109 105 105 104 104 111 111 103 103 102 102 101 101 100 100 91 91 90 90 89 89 94 94 95 95 96 96 93 93 92 98 98 99 99 97 97 Estienne, A.,Lahoz,B., Jarrier,P.,Bodin, L.,Folch, J.,Alabart,J. L., Fabre,S., breed. The The breed. by the findings that BMP15 can activate BMP15activate that can bythe findings BMP15 phenotype of mutant ewes. We took into consideration various components of thissystem, various of components consideration took into mutant ofWe ewes. phenotype and high prolificacy in ewes carrying the ewes carrying in prolificacy high and Materials and Methods and Materials A. 107 comparison with those of other factors of the TGFß family such as BMP4, GDF9 and Activin GDF9and as suchBMP4, of theTGFß family otherfactors of with those comparison BMP15 on the mRNA expression of these components in ovine granulosa cells, in in granulosa ovinecells, in components theseof expression themRNA on BMP15 (Drouilhet of theof carrying mutations in thein carryingmutations activin signaling) (Walton signaling) activin type 3 receptor (TGFBR3, also known as betaglycan, a co receptor of inhibin, able to blockinhibin, to able of co receptor betaglycan, asa known (TGFBR3, also 3 receptor type ACVR2A and the known antagonists of activin, which are follistatin (FST) and the TGFß the and(FST) follistatin are whichof activin, known antagonists the and ACVR2A subunits and follistatin (the specific activin binding protein) in mouse granulosa cells (Li granulosa cells binding mouse in protein) specificactivin (the follistatin and subunits including the INHA and INHBA subunits, the activin signaling receptors ACVR1B andACVR1B receptors signaling activinthe INHAsubunits, INHBAthe and including 2009) and cooperates with GDF9 in enhancing immunoreactive inhibin production in rat in production immunoreactive inhibin GDF9 inenhancing with cooperatesand 2009) granulosa cells (McNatty cells granulosa expression of components of the inhibin/activin system in relationship with the hyperprolific hyperprolific with the relationship system in theinhibin/activin of of components expression effects of two natural loss of function mutations of mutations twoloss of function natural of effects in sheep. Reproduction, 153 (4), 395-404. DOI: 10.1530/REP-16-0507 B4GALNT2 Animals Animals
For We assumed that the ovarian inhibin/activin system could mediate part of the effect oftheeffectpart of mediate system could inhibin/activin ovarian thatthe assumed We mutations in the regulation of ovulation rate in sheep. This assumption is Thissupported assumption rateinsheep. ovulation of intheregulation mutations et al. et BMP15 in vivo in 2013). ( expression studies, granulosa cells were recovered from hyperprolific ewes hyperprolific recoveredfrom were granulosa cells studies, expression W154NFsX55 beta-1,4-N-acetyl-galactosaminyl transferase 2 transferase beta-1,4-N-acetyl-galactosaminyl Comment citer cedocument: et al. et BMP15 et al. et /FecX 2005a). To answer this question, we have analyzed thehave analyzed we thisquestion, To 2005a). answer 2012). In addition, we studied the acute studied the acute weIn 2012). addition, gene and their corresponding non carrier ewes of the same of ewes non carrier corresponding their and gene
R mutation is a 17 bp deletion creating a premature stop a premature creating deletion isbp mutationa17 in vitro in FecL 5 5 L mutation which induces an ectopic expression inducesectopic whichan mutation the transcription of genes encoding inhibin inhibin of genes encoding transcription the BMP15 in two ovine breeds onbreedsovine in the two ) gene within the ovary the gene) within in in vitro effects of effects in in vivo et al. et
Version postprint Monniaux, D.(2017).BMP15 regulates theinhibin/activin systemindependently of ovulationrate control 118 118 138 138 117 117 120 120 116 116 119 119 137 137 136 136 114 114 133 133 135 135 134 132 132 115 115 121 121 131 131 130 130 129 129 128 128 127 127 126 126 122 122 125 125 124 124 123 123 Estienne, A.,Lahoz,B., Jarrier,P.,Bodin, L.,Folch, J.,Alabart,J. L., Fabre,S., breed when the mutation is present at the heterozygous state and even more at the more at evenand heterozygous thestate present at mutationis when the breed breed when the mutation is present in ewes at the heterozygous state and sterility whensterility and state atthe heterozygous ewes present in mutationis when the breed present at the homozygous state(Martinez Royo thehomozygous at present progestagen sponges (fluogestone acetate, 20 mg; Intervet, Angers, France) for 14 days to 14France) for Angers, mg;Intervet, 20 acetate, (fluogestone sponges progestagen carriers of theof carriers Grivette Frenchin the hyperprolificacy itits causes activity; signaling impairs proteinand the mutation is a substitution of a threonine for an isoleucine which affects the hydrophobicity of thehydrophobicity affects which isoleucine for of an a substitutionthreonine is a mutation homozygous state (Demars state homozygous codon in the in codon genotype. Forof theevaluation genotype. mm in diameter. For each animal, the follicles were then classified according to their size andtheir size to according were classified then thefollicles each For diameter.animal, in mm Teaching. Teaching. the guidelines for Care and Use of Agricultural Animals in Agricultural Research and Research AnimalsAgricultural in Agriculturalof Use Care for and guidelines the carrier ewes ( carrier ewes 2 in Nouzilly, C31 429 01 in Toulouse and CITA 2011 08 in Zaragoza) in accordance with inZaragoza)accordance in 2011 08 CITA Toulouse in and Nouzilly,C31 429 01 in 2 Research Government Committees and local ethical committees (Approval numbers C37 175 numbers(Approval ethical localcommittees and Committees Government Research Grivette breeds, respectively. All procedures were approved by the Agricultural and Scientific Scientific andAgricultural bythe approvedwere procedures Allrespectively. breeds, Grivette slaughterhouse at Zaragoza (Spain) and Toulouse (France), for the Rasa Aragonesa Rasa and thefor Toulouse (France), and (Spain) Zaragoza at slaughterhouse to the follicular phase of the cycle. Ovaries from all genotypes were recovered in a locala in recovered weregenotypes all Ovariescycle.from phaseof the thefollicular to synchronize estrus, before slaughtering of the ewes 36 h after sponge removal, corresponding sponge removal, h theewes36 after of slaughtering before estrus, synchronize mutation ( mutation ovulation rate = 2.29 ± 0.20) were used after genotyping. genotyping. used after were 0.20)=±2.29 rate ovulation in sheep. Reproduction, 153 (4), 395-404. DOI: 10.1530/REP-16-0507 Collected ovaries were finely dissected to isolate all the antral follicles larger than 1 1 larger than follicles the antral to all isolate weredissected finely ovaries Collected cells granulosa of andculture Collection All animals were treated during their seasonal period of reproduction with intravaginal withintravaginal reproduction of period seasonal their wereduringtreated animals All Gr/Gr BMP15 +/+ FecX ; ovulation rate = 4.88 ± 0.55) and 5 Grivette non carrier ewes ( non carrier Grivetteewes 5 and 0.55) =±ovulation4.88 ; rate ;
ovulation rate = 1.00), 5 Grivette ewes homozygous carriers of theof homozygouscarriers ewes 5rate=Grivette 1.00), ovulation R Comment citer cedocument: pro region; it causes hyperprolificacy in the Spanish Rasa Aragonesa Aragonesa RasaSpanish in the hyperprolificacy pro region;it causes mutation ( mutation etal. R/+ invivo 2013). In this study, 6 Rasa Aragonesa ewes heterozygous ewes 6Aragonesa Rasa thisstudy, In 2013).
; ovulation rate = 1.89 ± 0.16), 6 Rasa Aragonesa non 6Aragonesa Rasa rate0.16), =±1.89 ovulation ; gene expression in Rasa Aragonesa and Grivette ewes,Grivette Aragonesa and Rasa in expression gene 6 6 et al. et 2008). The The 2008). BMP15 T317I /FecX +/+; Gr
FecX Gr Gr Page 6of39 Version postprint Page 7of39 Monniaux, D.(2017).BMP15 regulates theinhibin/activin systemindependently of ovulationrate control 157 157 156 155 154 154 153 153 146 146 152 152 139 139 151 151 158 158 163 163 150 150 162 162 147 147 145 144 144 143 143 159 159 142 142 161 161 141 141 160 160 140 140 149 149 148 148 Estienne, A.,Lahoz,B., Jarrier,P.,Bodin, L.,Folch, J.,Alabart,J. L., Fabre,S., performed. ACVR1B at 80°C for further RNA extraction. In total, 15 independent culture experiments were experiments independentculture 15total, In RNA extraction. 80°C further for at accutase (Sigma), then pooled according to treatment, centrifuged, and cell pellets were storedwerepellets cell and centrifuged, totreatment, accordingpooled (Sigma),then accutase type at the atthe two type treatment being tested in 12 replicate wells. After 48 h of culture, cells were recovered using recovered were culture, Afterh cells of 48 wells. replicate testedin 12 being treatment corresponding to follicle growth and dominance stages, respectively. Follicular fluid and and Follicularfluid respectively.stages, dominance and to follicle growth corresponding otn o gns noig opnns f h ihbnatvn ytm ( system inhibin/activin the of components encoding genes of content France), each Lille, Europe, R&D ng/ml System A each; (50 Activin human/mouse/rat two follicular classes were defined, small (1–3 mm) and large (> or equal to 5 mm) follicles, 5mm) to follicles, or (>equal (1–3large mm) smalland defined, wereclasses two follicular 96 well plates with and without recombinant human BMP4, human BMP15, mouse GDF9 ormouseGDF9 BMP4,BMP15, humanhuman recombinant with without and plates 96 well 2002). Total RNA was extracted with a Nucleospin RNA II kit (Macherey Nagel, Hoerdt, Hoerdt, (Macherey Nagel, kit II RNA Nucleospin a with extracted was RNA Total 2002). Granulosa cells from 1 3 mm follicles were cultured in serum free conditions in McCoy’s 5aMcCoy’s in conditions wereserum free cultured in 1 3 follicles frommm Granulosa cells granulosa cells were stored at 80°C for further analysis. analysis. 80°Cfurther for at stored were cells granulosa µl for individual large follicles and 5 µl for pooled small follicles. Follicular fluids and Follicularfluidsand small follicles. pooled µl for5 and follicles large individual for µl volumes of follicular fluid recovered by follicular puncture from each animal were at least 50at least were animal each from puncture by recovered follicular fluidof follicular volumes ( 2015). For small follicles, follicular fluid and granulosa cells were pooled within animal. The animal. pooled within were cells granulosa and fluid follicular smallFor follicles, 2015). olclr auain n hat ws sesd sn casc akr o differentiation of markers classic using assessed was health and maturation follicular granulosa cells were recovered from small and large follicles as described (Estienne describedas follicles largeand small recovered fromwere cells granulosa a previously described method (Campbell 1996). Cells were seeded at 10 seededwere at Cells 1996). (Campbell method described apreviously medium (Sigma, L’Isle d’Abeau Chesnes, France) containing insulin (100 ng/ml) according to to according (100 ng/ml) insulinFrance) containing Chesnes, L’Isled’Abeau (Sigma, medium CYP19A1 in sheep. Reproduction, 153 (4), 395-404. DOI: 10.1530/REP-16-0507 RNA extraction and quantitative real-timePCR quantitative and extraction RNA Samples of granulosa cell recovered cell recovered granulosa of Samples For culture experiments, ovaries were recovered from ewes of various breeds wild of breeds various recoveredfrom wereewes ovaries experiments, culture For , , ) and atresia ( atresia and ) ACVR2A BMP15 , , Comment citer cedocument: FST loci after slaughtering in a local slaughterhouse at Nouzilly (France). at(France). Nouzilly slaughterhouse local in a slaughteringlociafter IGFBP5 , , TGFBR3 et al. et (Besnard cells granulosa ovine in )
. For ). and after culture were analyzed for mRNA mRNA for were analyzed culture and after vivo in ee xrsin tde, h sae of stage the studies, expression gene vivo in 7 7 5 viable cells/well in cells/well viable et al. et Logan 1996; INHA et al.et , , INHBA
, ,
Version postprint Monniaux, D.(2017).BMP15 regulates theinhibin/activin systemindependently of ovulationrate control 166 166 169 169 165 165 164 164 170 170 168 167 167 172 172 173 173 185 185 184 184 183 183 188 188 182 182 174 174 181 181 180 180 179 179 171 171 178 178 177 177 187 187 176 176 175 175 186 186 Estienne, A.,Lahoz,B., Jarrier,P.,Bodin, L.,Folch, J.,Alabart,J. L., Fabre,S., t al. et (Monniaux described previously rti, n te RA eaie ee ws siae b te ai R 10 [E x 100 = R ratio the by estimated was level relative mRNA the and protein, protocol. The use of the Human/Mouse/Rat usetheHuman/Mouse/Rat ofThe protocol. Activin AELISA Quantikine hasbeen sheep in kit oprd ih ht f the of that with compared n n Cce i mlioo dtcin ytm BoRd Mre l Cqet, rne as France) Coquette, la Marnes (Bio Rad, system detection multicolor iQ iCycler an on transcribed, and quantitative real time PCR reactions were run using SYBR Green Supermix Supermix Green SYBR using run were reactions PCR real time quantitative and transcribed, rne acrig o h mnfcue’ pooo. hn 1 g f N ws reverse was RNA of µg 1 Then, protocol. manufacturer’s the to according France) et et al.(Monniaux described as measured amplification are listed in Table 1. For each primer pair, amplification efficiency (E) was was (E) efficiency amplification pair, primer each For 1. Table in listed are amplification follicular growth (Bonnet growth follicular in the granulosa cells of sheep follicles in previous studies (Drouilhet studies previous in follicles sheep of cells granulosa the in Activin Activin AtheHuman/Mouse/Rat measuredusing was fluid infollicular concentration inter assays coefficients of variation were lower than 5%. than 5%. lowerwereinter assays variation coefficientsof conditions, the limit of detection of the assay was found to be 0.5 pg/well and theintra and andpg/well0.5be towas of theassay found of limit detection the conditions, fluid diluted at 1/100 and 1/1000 for small and largerespectively.small and follicles, 1/1001/1000 forand dilutedat fluid working our In al. the present study,present the Inhibin A of follicular 30µl in aliquots determined were concentrations (RPL19) dilution curves were linear and parallel to the standard curve (Supplementary Figure 1A). In1A). (Supplementary Figure curve standard to parallelthe linear andwere curves dilution different ovine plasma and follicular fluid samples in steer plasma. Results showed that that the Results plasma.showed steer in samplesfluid plasma different ovinefollicular and Active Inhibin Active AELISA of dilutions by studying serial has validated been sheep in kit ELISA kit (Beckman Coulter France) according to the manufacturer’s protocol. of usethe protocol. ELISAthe The manufacturer’s to according France) Coulter (Beckman kit Inhibin Inhibin Atheusing measured was fluid infollicular concentration Inhibin Active A Activin Activin AELISA Quantikine LTD)Europe (R&DSystems kit manufacturer’s to the according in sheep. Reproduction, 153 (4), 395-404. DOI: 10.1530/REP-16-0507 2015; Pierre2015; /E Inhibin and activin assaysactivin and Inhibin target
Ct (target) Ct et al. et ]. ]. Comment citer cedocument: 2016). 2016). RPL19 et al. et RPL19 is known to be easily detectable and not regulated during ovine during regulated not and detectable easily be to known is 2011) and it has been used and validated as a reference gene reference a as validated and used been has it and 2011)
nenl eeec gn ecdn a bqios ribosomal ubiquitous a encoding gene reference internal 2008). The cycle threshold (Ct) of the target gene (Ct) was targetgene the of cycle threshold The 2008). 08. h seii pie sqecs sd for used sequences primer specific The 2008). 8 8 et al. et 2013; Estienne 2013; RPL19
et et Ct Page 8of39 Version postprint Page 9of39 Monniaux, D.(2017).BMP15 regulates theinhibin/activin systemindependently of ovulationrate control 197 197 196 196 194 195 195 193 193 192 192 207 207 210 210 208 191 191 206 206 190 190 205 205 189 189 199 199 204 204 198 198 203 203 202 202 201 201 200 200 212 212 211 Estienne, A.,Lahoz,B., Jarrier,P.,Bodin, L.,Folch, J.,Alabart,J. L., Fabre,S., breeds were made using Mann Whitney test, and comparisons of gene expression and geneofexpression test, comparisons and Whitney using Mann made were breeds BMP15 mutations BMP15 6 Software (GraphPad Software Inc., La Jolla, CA, USA). In the wild type ( Inthewild typeUSA). CA, La Jolla, Inc., Software (GraphPad Software 6 respectively.7%, 5%and than found to be 1.5 pg/well and the intra and inter assayslowerandwerethe intra coefficients pg/well 1.5 variation and of be to found largerespectively. was theassay of detection follicles, of thelimit conditions,our working In Results Results significance. required for 209 determined in 100 µl aliquots of follicular fluid diluted at 1/1000 and 1/10000 for small andsmall1/10000 for 1/1000and diluted at fluidof follicular 100µl in aliquots determined correction of the degrees of freedom. For all analyses, a probability of at least 0.05 was0.05 least at probabilityof a analyses, allFor freedom. ofdegrees of the correction curve (Supplementary Figure 1B). In the present study,In thepresent Figure 1B). (Supplementary curve Activin A were concentrations were analyzed using repeated measures one way ANOVA with the Greenhouse Geisser theGreenhouse Geisser with one way ANOVA using repeated measures analyzed were steer plasma. Results showed that the dilution curves were linear and parallel to the standard thestandard to parallel and linearwere dilution curves showedthat the Results plasma. steer Difference (LSD) test for multiple comparisons. For granulosa cell culture experiments, data experiments, culture granulosaForcell comparisons. multiple for test (LSD)Difference validated by studying serial dilutions of different ovine plasma and follicular fluid samples in in samples fluid anddifferent ofdilutionsplasmafollicular ovine by studying serial validated comparisons of follicle numbers and sizes between the Rasa Aragonesa and the Grivette theandAragonesa the Rasa betweensizesand numbers of follicle comparisons ANOVA. The ANOVA analyses were followed by Fisher’s protected Least Significant Significant Least protected Fisher’sby followed were ANOVA analyses The ANOVA. concentrations were compared between follicular classes and genotypes using two way genotypes and classes follicular between compared were concentrations made using two way ANOVA. Within each ovine breed, gene expression and hormonaland geneexpression breed,ovine each Within ANOVA. two wayusing made hormonal concentrations in follicular fluid between breeds and follicular size classes were size classes breeds follicular andbetween fluid follicular in concentrations hormonal in sheep. Reproduction, 153 (4), 395-404. DOI: 10.1530/REP-16-0507 All data are presented as mean ± SEM. Data were analyzed using the GraphPad PrismGraphPad theusingwere Dataanalyzed SEM.± as data mean arepresented All Statistics Statistics Follicular development in the Rasa Aragonesa and Grivette breedsGrivette theRasaand in development ofAragonesa andeffects Follicular Comment citer cedocument:
9 9 +/+ ) ewes, ) Version postprint Monniaux, D.(2017).BMP15 regulates theinhibin/activin systemindependently of ovulationrate control 226 226 224 223 223 225 225 230 230 229 229 228 228 221 221 222 222 219 219 220 220 232 232 218 218 231 231 227 217 217 237 237 214 214 236 236 235 235 234 233 233 216 216 215 215 213 213 Estienne, A.,Lahoz,B., Jarrier,P.,Bodin, L.,Folch, J.,Alabart,J. L., Fabre,S., p<0.05 for p<0.05 both breeds and all genotypes,all breeds and both phase of the estrous cycle) was higher in the prolificinthe higher was cycle) theestrous of phase the small ones (p<0.001 for all comparisons, Figuregranulosacell 1).in allThiscomparisons, increase (p<0.001 onesforsmall the granulosacells. in expression all genotypes, both breeds in and expected, As mRNA levels were strongly increased in the granulosa cells of the large follicles, compared tomRNAlargeof the compared the granulosa cells follicles, in wereincreased strongly levels for genotypes, except a 1.9 fold lower 1.9 foldlower a except genotypes, large (Rasa follicles both p<0.001 for breed:Aragonesa similar between genotypes. between similar +/+ ewes (p<0.001, ewes +/+Table was mm) (1 3small follicles of thenumber breeds,In both2). smallerlargesizetheofprolific was in the themean follicles although Grivette breed, the number of large follicles was not statistically different between genotypes, differentstatisticallygenotypes, betweennotlarge of was the number folliclesbreed, Grivette follicles, in the Rasa theRasa in follicles, Figure 1). (p<0.05, breed Aragonesa marker theatresiaoflower withaexpression differentiationwas associated (p<0.05) and the mean size of these large follicles was smaller (p<0.01, (p<0.01, largeTableof these sizesmaller was follicles the mean and (p<0.05) the2).In development was affected by the presence ofwas by thepresence affected development granulosa cells from large follicles of the Grivette, compared to theRasa to Grivette,of compared largethe cells follicles from granulosa breed.In Aragonesa breeds and effects of BMP15mutations ofandeffects breeds Aragonesa breed, the number of large dominant follicles (> or equal to 5 mm in the 5 the follicular orto(> in largemm equaldominant thenumber of follicles breed, Aragonesa numbers and sizes of follicles present in the ovaries of the wild type ( thewild type oftheovaries in present follicles of sizes and numbers in sheep. Reproduction, 153 (4), 395-404. DOI: 10.1530/REP-16-0507 CYP19A1 In Ovarian expression of Inhibin A and Activin A in the Rasa theRasa andGrivette inActivinA Aragonesa and A Inhibin of expression Ovarian The mRNA The levelsof There was nodifference theRasa was There between breedsthefor Grivette andAragonesa +/+ +/+ (a marker of follicle maturation) and follicle maturation) markerof (a ewes, there was no difference between the Rasa wasnodifference there the between Rasa ewes, breedsGrivette and Aragonesa follicles and p<0.01 for p<0.01 and follicles Comment citer cedocument: INHA INHA
and CYP19A1 and
INHBA Gr/Gr Gr/Gr INHBA expression in expression BMP15 10 10 were higher (p<0.001 for both genes)inboth (p<0.001 forhigher were follicles). nodifferenceTherewas betweenfollicles). mRNAthe in wereincreased strongly levels IGFBP5 R/+ mutations in both breeds. In theRasaIn breeds. both in mutations +/+ than in the non prolific +/+ ewes +/+ewes thenon prolific inthan R/+ (a marker of follicle atresia) of (afollicle marker and , compared compared to , R/+ follicles; Grivette breed: Grivettefollicles; +/+ Gr/Gr ) ewes, but follicular ) ewes, IGFBP5 CYP19A1 ewes than in the in ewesthan +/+ large in in the
+/+
Page 10of39 Version postprint Page 11of39 Monniaux, D.(2017).BMP15 regulates theinhibin/activin systemindependently of ovulationrate control 254 254 252 252 250 250 251 251 255 255 253 260 260 259 259 262 262 247 247 261 261 243 243 246 246 256 256 258 258 242 242 249 249 248 248 245 257 257 244 244 241 241 240 240 239 238 238 Estienne, A.,Lahoz,B., Jarrier,P.,Bodin, L.,Folch, J.,Alabart,J. L., Fabre,S., Rasa Aragonesa and Grivette breeds and effects of BMP15 mutations BMP15mutations of andeffects andbreedsGrivette Rasa Aragonesa ACVR2A breeds and all genotypes, the the genotypes, all breeds and Activin AInhibin / Alargelower in the was ratio concentration breeds. In both breeds and all genotypes, the intra follicular concentrations of Inhibin of concentrations the intra follicular genotypes, Aall and breeds In both breeds. were p<0.001 for p<0.001 INHA large follicles (p<0.001 for both genes) and small follicles (p<0.05 and p<0.001 for for p<0.001 (p<0.05 and folliclessmalland both genes) largefor(p<0.001 follicles compared to to compared and significant difference between follicular sizes in theRasain sizesdifference follicular between significant higherbreed, except Aragonesa genotype (p<0.01). In the Grivette breed, theGrivetteIn (p<0.01). genotype also significantly higher in the large follicles (p<0.05 for all comparisons, Figure 3). In both 3). Figure comparisons, thelarge higher all in (p<0.05for follicles significantly also Grivette breed, breed, Grivette Rasa Rasa thebreed, but Aragonesa Activin AInhibin / Abetween similar ratio was concentration were found between genotypes, except a 2.3 fold higher concentration of Inhibinof concentration 2.3 fold higher a genotypes, between except A found were in follicles, compared to the small ones (p<0.001 for all comparisons). No significant differencessignificantNo onesforcomparisons). (p<0.001 all thesmall to compared follicles, the Rasa except for Aragonesa large follicles, compared to the small ones for both genotypes ( bothgenotypes onesthesmall for largecompared to follicles, higher in the large follicles, compared to the small ones (p<0.001 for all comparisons) and, and, comparisons) all for (p<0.001 thesmalltheoneslargeto in compared higher follicles, (p<0.001 and p<0.01, respectively) in in respectively) p<0.01, and (p<0.001 all comparisons, Figure 2). 2). FigureWithin forgenotypes noall comparisons, difference there was eachbetween breed, granulosa cells of the large follicles, compared to the small ones (p<0.001 for both genesand both onesfor(p<0.001 smallto the largethe of cells follicles, compared granulosa in sheep. Reproduction, 153 (4), 395-404. DOI: 10.1530/REP-16-0507 ACVR2A and Ovarian expression of activin receptors and activin/inhibin binding proteins in the proteins binding activin/inhibin andreceptorsactivin of expression Ovarian The mRNA The levelsof The intra follicular concentrations of Inhibin of concentrations intra follicular The Aand Activin Ahigherbothwere mRNA thelarge in levels INHBA +/+ +/+ , respectively) , ACVR1B large follicles, in the Rasa large Rasa in the follicles, Figure 3). (p<0.05, breed Aragonesa follicles and p<0.05 for p<0.05 and follicles mRNA levels. Comment citer cedocument: and
of the Grivette, compared to the Rasa the Rasa toGrivette,compared the theIn of breed.Aragonesa ACVR1B ACVR2A +/+
ewes, the intra follicular concentrations of concentrations the intra follicular ewes, Activin Awere R/+ and and +/+ mRNAof the granulosa cells inthehigher were levels follicles, compared to the small ones of the sameof onesthe small to the compared follicles, Gr/Gr Gr/Gr ACVR1B ACVR2A large follicles of the Grivette, compared tothe theGrivette, compared oflarge follicles 11 11 follicles, Figure 4), but there was no was 4),butthereFigure follicles, mRNA were higher in were
levels were 1.9 foldlower were levels ACVR1B ACVR1B +/+ granulosa cells from from granulosa cells and and ACVR2A ACVR1B : R/+ , ,
Version postprint Monniaux, D.(2017).BMP15 regulates theinhibin/activin systemindependently of ovulationrate control 275 275 274 274 279 279 276 276 277 277 278 278 269 269 268 268 272 272 273 273 270 271 271 280 280 267 267 282 282 281 281 266 266 284 284 264 264 265 265 263 283 283 286 286 285 285 287 287 Estienne, A.,Lahoz,B., Jarrier,P.,Bodin, L.,Folch, J.,Alabart,J. L., Fabre,S., between genotypes was observed in the Rasa theRasa in was observed genotypes between breed. Aragonesa breeds and all genotypes, genotypes, all breeds and p<0.001 for p<0.001 between breeds led us to investigate whether the components of the inhibin/activin system theinhibin/activin of thecomponents whether to ledusinvestigate breeds between breed. In both breeds and all genotypes, breedsall and both In breed. Gr/Gr and the inconsistency of the changes found associated with the presence ofpresence with the associated found thechanges of inconsistency the and ovine granulosa cells invitrocellsgranulosa ovine granulosa cells of the large follicles, compared to the small ones( smallto the largethe of cells follicles, compared granulosa Aragonesa breed (Figure 5), but no difference(Figureno 5),but in breed Aragonesa genotypes in the Grivette breed. theGrivette in genotypes levels were 1.6 fold lower (p<0.05) in1.6 fold lower(p<0.05) were levels with GDF9, and thus activate different SMAD signaling pathways involved in BMP or/and or/and BMP in involved pathways signaling differentSMAD activate thus GDF9, and with could be direct target genes of BMP15. As BMP15 is known to act alone or in interaction inorinteraction alone to isknownact BMP15 As BMP15. directgenesof target be could (p<0.01) and and (p<0.01) in in in combination, were compared with those of BMP4 (a canonical inducer of theBMP of inducer canonicalof (a BMP4 with those were compared in combination, Aragonesa breed. breed. Aragonesa large activin signaling (Mottershead signaling activin conditions, BMP4 and BMP15 enhanced BMP15 BMP4 and conditions, signaling pathway) and Activin A (Figure 6). In 48h culture experiments in serum free in In experiments 6).A (Figure 48h culture Activin and pathway) signaling in sheep. Reproduction, 153 (4), 395-404. DOI: 10.1530/REP-16-0507 +/+
follicles (Figure 4), but no difference between genotypes was observed in the Rasa intheobserved nowas difference genotypes between 4), but (Figure follicles , compared to to compared , granulosa cells from large follicles of the Grivette, compared to the Rasa theRasa large to compared fromthe granulosaof cells Grivette, follicles Aragonesa Regulation of the components of the inhibin/activin system by BMP15 and byBMP15 Activin theinhibin/activinsystem of Aof the components in Regulation The small (< 3 fold changes), or non existent differences observed between genotypes between observed differences non existentor 3 fold ( et al.et follicles in the Grivette breed (Figure 5), but no differencebut no 5),(Figurebreed theGrivette in follicles levels were 1.6 fold lower (p<0.01) in in (p<0.01) lower 1.6 foldwere levels Gr/Gr TGFBR3 and : p<0.001 for both genotypes in Rasa ingenotypesboth p<0.001for : breed,Aragonesa 2015), the effects of BMP15 and GDF9, acting alone or alone acting GDF9, BMP15 ofand the effects 2015), TGFBR3 R/+ genotypes in Grivette breed, Figure Figure 5). breed, Grivettegenotypes in FST INHBA mRNA in (p<0.05) 1.4 foldlower levelswere , compared tocompared , and 12 12 were lower (p<0.05 and p<0.01, respectively) p<0.01, lower and(p<0.05 were TGFBR3 (p<0.001 and p<0.01, respectively) andrespectively) p<0.01, and (p<0.001 FST expression was observed between observedbetween was expression +/+ mRNAthe in increased were levels small FST follicles in the Rasa theRasa in follicles : p<0.001 for both p<0.001for : Gr/Gr BMP15 , compared to compared , FST mutations mRNA FST +/+ Page 12of39 Version postprint Page 13of39 Monniaux, D.(2017).BMP15 regulates theinhibin/activin systemindependently of ovulationrate control 308 308 306 306 307 307 305 305 310 310 304 304 309 309 303 303 302 302 301 301 300 300 311 311 299 299 312 312 298 298 297 297 295 294 294 293 293 292 292 290 290 288 288 289 289 291 291 Estienne, A.,Lahoz,B., Jarrier,P.,Bodin, L.,Folch, J.,Alabart,J. L., Fabre,S., ACVR1B BMP15 and BMP4, whereas BMP4, and BMP15 the expression of expression the A Activinall enhanced and BMP4 recovered from small antral follicles, BMP15 (acting alone or in combination with GDF9), with inorcombination (actingalone antralfollicles, BMP15 smallfrom recovered SMAD1/5/8 signaling pathway (Moore pathway signaling SMAD1/5/8 expression of the different components of the inhibin/activin system. In ovine granulosa cellsgranulosa In system.ovine the inhibin/activin of components the different of expression similar effects of BMP4 and BMP15 can be explained by their common activation of theof activation theircommon by explained be can BMP15 ofand BMP4 similar effects expression in two different genetic models of hyperprolific sheep. hyperprolific of geneticmodels different in two expression the consequence of the presence of presenceof the consequence the We have identified the direct target genes of BMP15 among these components and evaluated evaluated theseand components BMP15 genesof among directtarget thehave identified We et al. (Mazerbourg et proteins throughSMAD2/3 signal to activin receptors and antagonists, based on complementary investigations on based complementary receptors antagonists, and activin ovarian expression of the whole inhibin/activin system, i.e. inhibin and activin subunits,activin and i.e.inhibinsystem, wholeofinhibin/activin the expression ovarian Discussion Discussion 296 expression, but enhanced BMP15 effects on BMP15 effects butenhanced expression, combination of BMP15 and GDF9 slightly reduced BMP15 effects on effects BMP15 reduced slightly GDF9 BMP15 ofand combination GDF9 alone had no effect on the mRNA levels of all studied genes. However,the genes. levelsofstudied all onthe mRNA had noeffect GDF9alone significant effect on effect significant enhanced enhanced (both p<0.001) expression, but inhibited but expression, p<0.001) (both BMPs, had no effect onno hadeffect BMPs, in sheep. Reproduction, 153 (4), 395-404. DOI: 10.1530/REP-16-0507 In vitro In To our knowledge, this is the first study dedicated to the regulation by BMP15 ofthe BMP15 by theregulation dedicated to studythis isthe ourfirst knowledge, To expression; in addition, Activin A enhanced A Activinenhanced in addition, expression; FST (p<0.01) and reducedand (p<0.01) , the effects of BMP15, BMP4 and Activin A itself were compared on theon Acompared itselfwere Activin BMP4 ofand BMP15, the effects , TGFBR3 Comment citer cedocument: INHA INHBA , , . In addition, addition, In . ACVR1B ACVR2A mRNA levels but inhibited butinhibited levels mRNA FST BMP15 and TGFBR3 expression was inhibited by Activin A only. The The only.Activin byA inhibited was expression and, in a lesser extent, lesserextent, a and, in et al.et INHBA TGFBR3 ACVR2A loss of function FST 2003), whereas GDF9 and Activin A are known Aare ActivinGDF9 and whereas2003), (p<0.01) expression and had no effect on no hadeffect and expression (p<0.01) 13 13 expression was specifically enhanced by enhanced specifically was expression (p<0.05) and (p<0.05) (both p<0.001) expression and had no had and expression p<0.001) (both mRNA levels. Similarly, Activin A Activin Similarly, levels.mRNA INHA 2004). From our results, no effect ofeffect noresults, our From2004). ACVR2A (p<0.01) expression and, unlike and, expression (p<0.01) mutations on theirovarian on mutations INHA INHA expression, butinhibited expression, (p<0.05) expression. (p<0.05) (p<0.01) expression. INHBA invitro (p<0.05) (p<0.05) and invivo . Version postprint Monniaux, D.(2017).BMP15 regulates theinhibin/activin systemindependently of ovulationrate control 317 317 319 319 316 316 318 318 315 315 322 322 314 314 321 321 320 320 336 336 335 335 334 334 329 329 313 313 333 333 331 331 330 330 332 332 328 328 327 327 326 326 325 325 324 324 323 323 Estienne, A.,Lahoz,B., Jarrier,P.,Bodin, L.,Folch, J.,Alabart,J. L., Fabre,S., pathways (Mottershead pathways FecX al. regulations by BMP15 and GDF9, when acting together. together. when GDF9,acting and BMP15 by regulations of GDF9 was found to enhance and decrease the stimulating effects of BMP15 on the expression ontheexpression BMP15 of effects the stimulating todecrease enhance and found GDF9was the ovulation rate of non carrier ewes of the same breed, whereas the recently discovered discovered recently the whereas same ofbreed, thenon carrier rate of ewes ovulation the Rasa Aragonesa breed, was associated with a 1.9 fold increase in ovulation rate, compared to to compared rate, ovulation inincrease 1.9 fold with a was associated breed, Aragonesa Rasa follicles was discarded from analysis, due to the high expression of thehighexpression todue discarded wasanalysis, from follicles stage of the granulosa cells between genotypes. However, the intermediary class of 3 5 mm of class theintermediary genotypes.However, between cells thegranulosa of stage strikingly for the Booroola ewes carrying the ewescarryingthe theBooroola strikinglyfor SMAD2/3 signaling pathway by GDF9 in ovine granulosa cells (Pierre granulosa cells ovine inbyGDF9 pathway signaling SMAD2/3 choice of these follicular classes did not allow detecting any fine difference in thematuration difference in fine anynotdetecting allow did classes these follicular of choice CYP19A1 1985). However, there was no clear effect of the the ofeffect clear wasthereno However, 1985). GDF9 alone was observed, in agreement with the presence of a low activation level the of activation of alow the presence with inwas observed,agreement GDF9alone classes, i.e. small (1–3 mm) and large (> or equal to 5 mm) follicles. It is possible that thethat ispossible It 5mm) to follicles. or(> equal large(1–3 mm) and small i.e. classes, the Inverdale ewes carrying the ewes carryingInverdale the suggesting an earlier final differentiation of their granulosa cells, as previously proposed for proposed previously their of granulosa as cells, differentiation final earlier an suggesting follicular phase of the estrous cycle, associated with a small decrease in their diameter,their in decrease small with a associated cycle, estrous phaseof the follicular ewes exhibited a higher number of large dominant (preovulatory) follicles during the follicles dominantlarge (preovulatory) numberof higher a ewes exhibited 2011; Demars 2011; 2.1 fold increase in ovulation rate, in agreement with previous observations (Lahozpreviouswithobservations agreement rate,ovulation in in increase 2.1 fold in sheep. Reproduction, 153 (4), 395-404. DOI: 10.1530/REP-16-0507 2003; McIntosh 2003; FST Gr and mutation, when present at the homozygous state in the French Grivette breed, led tobreed,led a Grivette statetheFrenchin homozygous whenthe present at mutation, In vivo In mRNA levels in the granulosa cells recovered from the two studied follicular size studied follicular two recoveredfromthe thegranulosa cells in levels mRNA INHBA et al. et , the , et al. et , respectively. GDF9 and BMP15 are known to form heterodimers (Liao heterodimers to knownform BMP15 GDF9are respectively.and , FecX 2013). From our results, compared to non carrierewes, to compared results, ourFrom2013). Comment citer cedocument: et al. et R 2008) and exhibit synergistic interactions by activating both SMAD both byactivating interactions synergistic exhibitand 2008) mutation, when present at the heterozygous state in the Spanish intheheterozygous state present whenat the mutation, 2015). These interactions might be involved in theobservedinbe involved might interactions These 2015). FecX I mutation in in mutation FecB 14 14 FecX BMP15 B mutation in mutation R and theand (McNatty FecX BMPR1B IGFBP5 IGFBP5 etal. Gr mutations on mutations etal. 2009) and moreand 2009) (Henderson et et al. (Henderson BMP15 2016). However, However, 2016). and other other and etal. mutant et Page 14of39 Version postprint Page 15of39 Monniaux, D.(2017).BMP15 regulates theinhibin/activin systemindependently of ovulationrate control 361 361 352 352 354 354 353 353 338 338 356 356 337 337 355 355 357 357 359 359 345 345 358 358 346 346 339 339 351 351 360 360 350 350 348 348 347 347 343 343 344 344 342 342 341 341 340 340 349 349 Estienne, A.,Lahoz,B., Jarrier,P.,Bodin, L.,Folch, J.,Alabart,J. L., Fabre,S., such differences were not observed between theheterozygous observedbetween not were differences such concentrations in large follicles andlarge infollicles concentrations Aragonesa ewes. Other examples of discrepancies could be cited, concerning Inhibin A Inhibin cited, bediscrepanciesconcerning could of Otherexamples ewes. Aragonesa The presence of loss of function of loss of function presence The state. The state. size class containing the subordinate follicles already engaged in the atresia process.theatresia in engaged already thefollicles subordinate containing class size These discrepancies might be related to the mutation itself or its homozygous or heterozygous or itshomozygous itselfor themutation to relatedbe might discrepancies These markers of atresia or apoptosis (Supplementary Figure 2 and Supplementary Table 1)this in Table Supplementary andFigure 2 (Supplementary apoptosisor of atresia markers 2008) and the and 2008) lower amounts of the mature protein (as hypothesized inhypothesized(as proteinof themature lower amounts such participate in balancing the expression level of these components thesecomponents of level balancingthe expression in participate such 2013). In both models, a lowering of the biological activity of BMP15 is expected, due todueis BMP15 expected, of activitythebiological of a bothmodels,lowering In 2013). hypothesis cannot explain whyexplain cannot hypothesis expression of the components of the inhibin/activin system and the differences found between differences found thesystemand of the inhibin/activin the componentsof expression levels were lower in theinhomozygouslower were levels interactions between BMP15 and GDF9 (as hypothesized in hypothesized (as GDF9 BMP15betweenand interactions example, in the granulosa cells of the largeof the follicles, granulosa cells in the example, in in vivo stimulating effect of BMP15 on the expression of genes these theexpression ofon BMP15 effect stimulating results, Activin A was able to enhance the expression of the expression was to ableenhance A Activin results, affected by the presence ofby thepresence affected vitro genotypes were not consistent with the effects of BMP15 observed on ovine granulosa cells ongranulosa ovine observed BMP15 of withthe effects not wereconsistent genotypes of function of function in sheep. Reproduction, 153 (4), 395-404. DOI: 10.1530/REP-16-0507 . For instance, the expression of theexpression instance,For . . . The components of the inhibin/activin system were affected by the presence of a loss of presencea bythe were affectedsystem oftheinhibin/activin components The FecX BMP15 FecX R et al. (Martinez Royoet BMP15 production preclude toknown is mutation Gr mutation differently in the Rasa Aragonesa and the Grivette breed. For breed.Grivette the and Aragonesa Rasa in the differently mutation Comment citer cedocument: mutation totally impairs BMP15 signaling in target cells (Demars in target cells signaling totally BMP15 impairs mutation BMP15 INHBA mutations FST INHA FecX was unaffected by the presence ofthepresence by was unaffected expression in the granulosa cells of small follicles. follicles. small of thegranulosa cells in expression BMP15 , , Gr INHBA , compared to non carrier Grivette ewes, butewes,Grivette non carrier to compared , 15 15 in in vivo mutations mutations and and ACVR1B in both breeds, despite the existence of a despitethe existence bothbreeds, in FST INHA R/+ in in vivo was not, or only slightly, ornot,onlyslightly, was Gr/Gr follicles) or lowerfunctionalor follicles) , , in in vitro FecX and ACVR2A had little effect on the on hadeffect little follicles), butthe follicles), FST R and non carrier Rasa non carrier and . From ourFrom . . However, this However, in vivo. expression and could could and expression and BMP15 TGFBR3 invitro mutations mRNA in Version postprint Monniaux, D.(2017).BMP15 regulates theinhibin/activin systemindependently of ovulationrate control 383 383 380 380 382 382 379 379 384 384 381 381 378 378 377 377 376 376 386 386 385 385 375 375 374 374 373 373 372 372 371 371 369 368 368 370 370 367 367 363 363 362 362 366 366 365 365 364 364 Estienne, A.,Lahoz,B., Jarrier,P.,Bodin, L.,Folch, J.,Alabart,J. L., Fabre,S., backgrounds. Therefore, the inhibin/activin system would not be implicated in the in implicated be wouldnot systeminhibin/activin backgrounds. Therefore, the betaglycan) are antagonistic elements. From our From elements. antagonistic are betaglycan) the recently evidenced AMH system(Pierre AMH evidenced recently the of the changes found associated with the presence ofpresence withthe associated found thechanges of mutation when present at the heterozygous state, or theor theheterozygousstate, when present at mutation mechanisms leading to multiple ovulations in ewes carrying to multiple leading mechanisms vivo inhibin/activin system. We inhibin/activin systemof this of the components thatre balancing a propose can acutely regulate the expression of both positive and negative components of theof negative components bothand positive of regulate the expression acutely can homozygous state, is associated with a clear increase in ovulation rate leading to a higher a to rateleading ovulation with increase in a clear isassociated state, homozygous signaling, whereas inhibin, follistatin and theinhibin called (orTGFBR3 and co receptor whereas follistatin inhibin, signaling, mutation differ betweenbreeds.mutation Activin Aofactivin positiveelements are its andreceptors molecular mechanisms affecting BMP15 are not yet fully understood. understood. yetaffecting not fully mechanisms are BMP15 molecular Alternatively, the when a loss of function loss of function awhen BMP15 on granulosa granulosa cells on BMP15 of absence the The complexity of the inhibin/activin system may explain that (1) theeffectsthatmay(1)of systemexplain theinhibin/activin of complexity The in systembetweenbreeds, inhibin/activin inthedifferences pre existing illustrating also ewes, the concentrations of Activin A and Inhibin A proteins were higher in the follicles of Grivette of Grivette in thefollicles higher wereproteins A InhibinActivin A and of concentrations the specific equilibrium of the different components existing within each breed. This hypothesis Thisbreed. each within existing different ofcomponents the specific equilibrium vivo TGFBR3 expressed higher levelsof higher expressed is supported by the observation that the granulosa cells of non mutant Grivette ewesGrivette non mutant ofthe granulosa cells that observation bythesupported is in sheep. Reproduction, 153 (4), 395-404. DOI: 10.1530/REP-16-0507 can explain the small effects of effects small the explain can expression level of each component of the inhibin/activin system could depend onthe depend could systemof the inhibin/activin of component level each expression In conclusion, the presence of a loss of function ofpresence aloss of function the conclusion, In mRNA than the granulosa cells of non mutant Rasa Aragonesa ewes. Consistently, ewes. AragonesaRasa of non mutant thethangranulosa cells mRNA BMP15 Comment citer cedocument: mutation. mutation. BMP15 INHA in vitro mutation is present present is mutation , INHBA are not consistent with the expressional changes observed changes with the expressional notconsistent are BMP15 , ACVR1B et al.et loss of function mutations and the inconsistency inconsistency the and mutations loss of function 16 16 in in vitro 2016). 2016). and invivo BMP15 FecX results, BMP15 and BMP15 results, Activin A itself ACVR2A BMP15 (2) the consequences ofa the consequences (2) BMP15 mutations in different genetic genetic in different mutations Gr mutation when present at the atthe present when mutation mutation, such as such themutation, , but lower levels of levels butlower , mutations, in contrast to in contrast mutations, BMP15 FST FecX in in and and R Page 16of39 Version postprint Page 17of39 Monniaux, D.(2017).BMP15 regulates theinhibin/activin systemindependently of ovulationrate control 392 392 407 407 391 391 406 406 390 390 394 394 405 405 393 393 389 389 404 404 403 403 399 399 402 402 400 398 398 396 395 387 387 411 411 409 408 388 388 Estienne, A.,Lahoz,B., Jarrier,P.,Bodin, L.,Folch, J.,Alabart,J. L., Fabre,S., prolificacy. In this study, we have challenged a potential role of the ovarian inhibin/activin theovarianof rolepotential achallenged havewe study, In this prolificacy. changes were dependent on either the the on dependentwereeither changes contained herein).Centre Régionfrom contained Fellowshipthe by wasa French supported Estienne A. expression of these components in granulosa cells. Moreover, the observed expressional observedexpressional the Moreover, cells.in granulosa these components of expression authors’ oftheinformation madebe thatmay usefor liable notany theEC is views and loss of function loss of function is not a key component of the mechanisms regulating the ovulation ratein ovulation regulatingthe themechanisms of component key nota is Small Ruminants (http://www.3srbreeding.eu/), Ruminants Small theonlyreflects (this publication WP4 mutation was present. Altogether, these results suggest that the ovarian inhibin/activin systeminhibin/activin theovarian suggestthat results Altogether,these waspresent. mutation granulosaHowever, ovine cells. ofin BMP15 targets potential are AMHAROC) and EC (FP7/2007–2013), grant 245140, ‘‘3SR’’,grant245140, (FP7/2007–2013), EC and AMHAROC) for Solutions Sustainable Recherche” (http://www.agence nationale recherche.fr/) Recherche” (ANR 12 BSV1 0034 02, This work was supported by grants from France via the “Agence Nationale pour la Nationale pour viathe “AgenceFrance frombygrants supported was work This Funding thereported. researchof impartiality the 401 The authors declare that there is no conflict of interest that could be perceived as prejudicing beperceivedas could thatinterestof isnoconflict declare that there authors The interestof Declaration ewes. 397 system in participating in this phenotype. From ourFrom thisphenotype. in participating in system Acknowledgements Acknowledgements INRA. and 410 different components of the inhibin/activin systemsuch as inhibin/activin ofthe components different in sheep. Reproduction, 153 (4), 395-404. DOI: 10.1530/REP-16-0507 BMP15 Comment citer cedocument: mutation in ewes was not found associated with strong changes in the in strong withchanges associatednot found eweswas in mutation BMP15 mutation itself or the ovine breed in whichinthebreed or theovine itself mutation 17 17 invitro INHA results, the genes the results,encoding , INHBA in in vivo , , , the presence of a thepresence , BMP15 FST and mutant TGFBR3 Version postprint Monniaux, D.(2017).BMP15 regulates theinhibin/activin systemindependently of ovulationrate control 412 412 415 415 416 416 414 414 413 413 Estienne, A.,Lahoz,B., Jarrier,P.,Bodin, L.,Folch, J.,Alabart,J. L., Fabre,S., recovery of sheep ovaries. sheepovaries. of recoveryWe INRA the ofthetechnicians to grateful of are unit experimental Wethefor (France) atNouzillyof platform theCIRE staff thethankof the slaughterhouse Spain. Spain. animal facilities of CITAfacilities animal de Rasa the providingandcaretaking Aragón for ewes in Aragonesa Langlade who took care of the Grivette animals in France, and the staff theexperimentalthe inof France, animalsand theGrivette ofwhotook care Langlade in sheep. Reproduction, 153 (4), 395-404. DOI: 10.1530/REP-16-0507 Comment citer cedocument: 18 18 Page 18of39 Version postprint Page 19of39 Monniaux, D.(2017).BMP15 regulates theinhibin/activin systemindependently of ovulationrate control 420 420 419 419 418 418 431 431 430 430 438 438 429 429 423 423 434 434 421 421 428 428 425 425 426 426 417 417 424 424 433 433 439 439 436 436 435 435 Estienne, A.,Lahoz,B., Jarrier,P.,Bodin, L.,Folch, J.,Alabart,J. L., Fabre,S., follicles. follicles. 2, 4, and 5 in the ovine ovary: localization and changes during growth and atresia of antral growthatresia andduring changes and theovinelocalization in 5ovary: 4,and 2, 1996 Expression of messenger ribonucleic acids of insulin like growth factor binding protein binding growth insulin likefactor of ribonucleic acids messenger of Expression 1996 Drouilhet L, Mansanet C, Sarry J, Sarry DrouilhetL,C, Mansanet Tabet P,Bardou K, WoloszynF, HarichauxLluchJ, 432 Genetics in Reproductive in Medicine BMP15 mutations responsible for an atypical hyperprolificacy phenotype insheep. phenotype hyperprolificacy anatypical responsible for mutations BMP15 J, TereninaP E,Martin associated with an ectopic expression of the B4GALNT2 gene within the within ovary.gene theB4GALNT2of expression ectopic with an associated Bonnet F,Benne C, Bevilacqua A, Sarry M, Sancristobal LiaubetL, C, Cotinot L, Bodin 422 P,DrobikZ, Nowak W Genomics Demars J, Fabre S, Sarry J, Rossetti R, Gilbert H, Persani L, Persani H, Gilbert R,Tosser-Klopp Rossetti J,FabreJ,Sarry Demars S, Mulsant G, 427 Besnard N, Pisselet C, Monniaux D, Locatelli Locatelli D, MonniauxN,C, Pisselet F,Besnard Benne A, Gasser F, FHatey P Monget& References oocytes during early follicular development obtained by laser capture microdissection. microdissection. capturelaser bydevelopmentobtained follicular early during oocytes G, ViguieMonniauxC,D 440 Drummond &FindlayIrelandJK JJ AE, 437 Genetics in sheep. Reproduction, 153 (4), 395-404. DOI: 10.1530/REP-16-0507 Biology of Reproduction of Biology 9 9 e1003482. e1003809. 12 417. Comment citer cedocument: , et al. et , , et al. et , 22 , etal., 243 52. 2013 Genome wide association studies identify two novelidentify two studies association 2013Genome wide 2011 and granulosa Transcriptomecellsof sheep profiling 2013 The highly prolific phenotype of Lacaune sheep is sheep Lacaune of2013 phenotype highly prolificThe 55 1356 67. 2004 2004 action. of modelsinhibin Animal 19 19 PLoS PLoS Seminars Seminars BMC BMC Version postprint Monniaux, D.(2017).BMP15 regulates theinhibin/activin systemindependently of ovulationrate control 453 453 451 451 454 454 449 449 447 447 446 446 450 450 442 442 457 457 445 445 455 455 443 443 463 463 462 462 459 459 460 460 441 458 458 Estienne, A.,Lahoz,B., Jarrier,P.,Bodin, L.,Folch, J.,Alabart,J. L., Fabre,S., ReproductiveEndocrinology and Biology Endocrinology Journal of Endocrinology of Journal D FabreS,Pierre A, MulsantP, PMonget L,Persani E, Pasquale Di Bodin L, & Monniaux 452 FabreS Estienne Estienne PierreA, JY,Picard diA,N, Clemente Jarrier P,& C,D Monniaux Mansanet 448 the effects of FSH on follicle development in the mouse ovary.inthemouse effectsdevelopment follicle theFSH of on sheep ovary: deciphering a direct regulatory pathway. directregulatory decipheringa ovary: sheep Bertram KC, KC, Bertram TolstoshevP, DMRobertson de Jong FH, UilenbroekJT,FH, Jong de GrootegoedJA Forage RG, BrownRG, RW,Forage Oliver KJ, BT,Atrache NH,Goss GC, HudsonPL,Devine 456 Durlinger KramerP,Gruijters MJ, AL, Karels B, Kumar Rose UM, Matzuk MM, TR, 444 8. 465 464 2002 Bmp15 mutations and ovarian function. ovarian function. and mutations Bmp15 2002 Galloway SM,Gregan Galloway SM, Wilson T,KP, McNatty GH Davis&JL, Ritvos Juengel O 461 inoocytes. expressed andisX linked15gene protein morphogenetic Dube JL, WangDubeJL, P, LyonsJ, Elvin Celeste KM, MatzukMM & AJ subunit produced by recombinant DNAsheep.by recombinant ratein produced ovulationincreased insubunit results techniques 2006 Regulation of ovulation rate in mammals: contribution of sheep genetic models. geneticofmodels. sheep contribution rate mammals: in ovulation of 2006Regulation in sheep. Reproduction, 153 (4), 395-404. DOI: 10.1530/REP-16-0507 2015 Anti Mullerian hormone regulation by the bone morphogenetic proteins in 2015 the proteins thebonemorphogenetic by regulation hormone Anti Mullerian 12 1809 17. Comment citer cedocument: 114 R1 4. 4 20. , et al.et, 20 20 Molecular and Cellular Endocrinology and Cellular Molecular , et,al. 1987 Immunization against an inhibin inhibin against anImmunization 1987 2001 attenuates hormone Anti Mullerian Endocrinology Endocrinology 1998bone The 156 Molecular 301 13. 142 4891 9. 191 15 Page 20of39 Version postprint Page 21of39 Monniaux, D.(2017).BMP15 regulates theinhibin/activin systemindependently of ovulationrate control 466 466 468 468 467 467 486 486 484 484 489 489 469 469 487 487 476 476 472 472 475 475 471 471 473 473 490 490 477 477 483 483 481 481 480 480 479 479 Estienne, A.,Lahoz,B., Jarrier,P.,Bodin, L.,Folch, J.,Alabart,J. L., Fabre,S., Molecular and Cellular andCellular Endocrinology Molecular bovine follicular fluid. follicular bovine ReproductionandSuppl Fertility Aagaard KM Aagaard Harris RA, RA, Harris TardifSD, Vinar T,J, Rogers Wildman JN, Worley DE, Rutherford & KC of of America callitrichine primates. callitrichine development. development. Knight PG & Glister&C KnightPG 485 Henderson KM, Franchimont P,FranchimontKM, Henderson Lecomte-Yerna Increase &1984 Ball K N Hudson MJ, 470 Knight PG, Satchell LSatchell KnightPG, Glister& C 488 without a fecundity gene. afecundity without stimulated cyclic cyclic stimulated and eweswith AMPx Romney Booroola from cells bygranulosa production in ovulation rate after active immunization of sheep with inhibin partially purified from purified from inhibinpartiallyofwith sheep immunization rateafter active ovulation in Henderson KM, Kieboom LE, McNatty KP,McNatty KieboomLE, KM, Henderson D Lun& S Heath 474 Hillard MA, MA, Wilkins Hillard JF, Bindon BM, TsonisLJ, Cummins &O'Shea JK FindlayCG,T 478 Montgomery GW Montgomery Hoekstra C, Zhao ZZ, Lambalk CB, Willemsen G, Martin NG, Boomsma DI & DI BoomsmaZhaoZZ,NG,CB, Willemsen Lambalk Martin C, G, Hoekstra 482 1995 Immunological manipulation of ovulation rate for twinning in cattle. cattle. ratetwinning in of for ovulation manipulation Immunological 1995 in sheep. Reproduction, 153 (4), 395-404. DOI: 10.1530/REP-16-0507 111 Reproduction 2014 Evolutionary genetics and implications of small size and twinning twinning in sizesmalland of implications genetics and 2014Evolutionary 1467 72. 2008 Dizygotic twinning. 2008 Dizygotic Comment citer cedocument: ProceedingsStatesofNational of Sciences United of the Academythe Jornal of Endocrinology of Jornal 2006 TGF beta superfamily members and ovarianand members follicle superfamily 2006 TGF beta Journal of Reproductionof andJournal Fertility 132 191 206. 49 351 64. 2012 Intra ovarian roles of activins and inhibins. and of rolesactivins Intra ovarian 2012 359 53 65. 53 65. HumanReproduction Update 21 21 102 305 9. 75 1985 Gonadotrophin 1985 111 20. Journal of Journal 14 37 47. Version postprint Monniaux, D.(2017).BMP15 regulates theinhibin/activin systemindependently of ovulationrate control 501 501 499 499 498 498 503 503 497 497 502 502 495 495 494 494 506 506 510 510 493 493 514 514 504 504 507 507 492 492 512 512 511 511 515 515 Estienne, A.,Lahoz,B., Jarrier,P.,Bodin, L.,Folch, J.,Alabart,J. L., Fabre,S., Molecular Human ReproductionHuman Molecular the processing and secretion of bone morphogenetic protein 15 (BMP 15) and growth and (BMP 15)growthand protein 15 morphogenetic bone of secretion and processing the Liao WX,Liao MooreRK,FOtsuka S Shimasaki & 500 sheep. characterization of N terminal tagged recombinant human bone morphogenetic protein 15. protein morphogenetic bonehuman recombinant tagged N terminal of characterization differentiation factor 9. Implication of the aberrant ovarian phenotype of BMP 15 mutant mutant BMP 15phenotypeof aberrantovarianof differentiationfactor 9. theImplication Li Q, Rajanahally S, Edson MAEdson S,Rajanahally LiQ, &MM Matzuk 496 and implications for on farm application. application. on farm for implications and expression during ovarian follicular development in sheep. developmentin follicular ovarian during expression Hoekstra C, Duffy DL, Martin NGDL,DuffyMartin C, Hoekstra equine chorionic gonadotropin induced ovulation rate and litter size in Rasasize inlitter rate and ovulation gonadotropin induced ewes chorionic equine Aragonesa Bodin L, Mulsant P,MulsantL, Bodin M Serrano Logan KA, Juengel JLJuengelKA, Logan KP McNatty & 505 LuongHT, McRae J, Chaplin AF,SE, Henders WillemsenDR,Medland Nyholt G, AK, 16. 509 508 Effect of the FecX(R) polymorphism in the bone morphogenetic protein 15 gene onornatural gene protein15 morphogenetic thebone in polymorphism EffecttheFecX(R) of Martinez-Royo Martinez-Royo SmuldersJP, JuradoJJ, A, JI, Marti Roche Alabart JL, E, FantovaA, 513 Lahoz B, B, Lahoz JH, Martinez-Royo Calvo JuradoJJ, J JL, Folch E&Alabart Fantova A, 491 BMPR2 and control of dizygotic twinning. oftwinning. dizygotic control BMPR2 and in sheep. Reproduction, 153 (4), 395-404. DOI: 10.1530/REP-16-0507 Journal of BiologicalChemistry of Journal Comment citer cedocument: 15 , et al. et , 779 88. , et al.et, 2008 A15protein morphogenetic thebone indeletion 278 2002 Onset of steroidogenic enzymegene of 2002steroidogenic Onset Journal Science of Animal Journal 2011 Variationin andBMPR1B, TGFRB1 TwinResearch Genetics Human and 3713 9. 3713 9. 22 22 2003 Effect of intracellular interactions onEffect interactions of2003 intracellular 2009 Stable expression andStable 2009expression Biology ofReproduction Biology 89 3522 30. 14 408 16. 66 906 2011 Page 22of39 Version postprint Page 23of39 Monniaux, D.(2017).BMP15 regulates theinhibin/activin systemindependently of ovulationrate control 528 528 526 526 525 525 524 524 523 523 520 520 519 521 521 529 529 516 516 517 517 531 531 532 532 533 533 535 535 536 536 539 539 537 537 540 540 Estienne, A.,Lahoz,B., Jarrier,P.,Bodin, L.,Folch, J.,Alabart,J. L., Fabre,S., Human Genetics Human proregion of mouse BMP15 regulates the cooperative interactions of BMP15GDF9.of interactions and thecooperative regulates BMP15 mouse of proregion Biology of Reproduction of Biology growth/differentiation factor 9.growth/differentiation McGrath SA, Esquela SA, Esquela McGrath AFLeeSJ& 527 Influencing Spontaneous Dizygotic Dizygotic Spontaneous Twinning Influencing Fertility.Femaleand Day FR, DayWillemsenEJ Geus de G, receptor,receptor like 5. activin kinase Hsueh & O AJ Mbarek H, Steinberg S, Nyholt DR, Gordon SD, Miller SD,DR, McRae S,Gordon MB, Nyholt Mbarek Steinberg H, AF,JJ,Hottenga 522 McIntosh CJ, Lun S, LawrenceS,S,Lun CJ, WesternMcIntosh KPAH, McNatty JL Juengel& 530 Mazerbourg S, Klein C, Roh J, Kaivo-Oja N, Mottershead DG, KorchynskyiDG,RitvosN, Kaivo-Oja J,Mottershead O, KleinRoh C, S, Mazerbourg 294 7. 518 gene causes sterility and increased prolificacy in Rasa Rasa in prolificacy sterilityincreased and sheep. causes Aragonesagene Gonadotrophin responsiveness of granulosa cells from bone morphogenetic protein 15 protein morphogenetic bone offrom granulosa cells Gonadotrophin responsiveness KP,McNatty JL S,Juengel Lun Hudson NL, DA, Heath Moore2009 & LG 534 heterozygous mutant sheep. mutant heterozygous Meerasahib MF,Meerasahib GroomeDG, NP Mottershead McNatty KP,McNatty S,Lawrence ReaderS, JL, Juengel Lun SB, Myllymaa KL, Western A, 538 in sheep. Reproduction, 153 (4), 395-404. DOI: 10.1530/REP-16-0507 2004 Growth differentiation factor 9 signaling is mediated by the type Itype differentiationfactor 9 by the 2004isGrowth mediated signaling 98 898 908. 898 908. Comment citer cedocument: 79 889 96. Reproduction Molecular Endocrinology Molecular , et al.et , 1995 Oocyte specific expression of expression Oocyte specific 1995 Molecular Endocrinology Molecular 138 2016 Identification of Common Genetic Variants of Common Identification 2016 23 23 545 51. , et al.et, 2005a Bone morphogenetic protein morphogenetic Bone2005a 9 131 6. 18 American Journal of American Journal 653 65. 653 65. Animal Genetics Animal 2008 2008 The 39 Version postprint Monniaux, D.(2017).BMP15 regulates theinhibin/activin systemindependently of ovulationrate control 544 544 542 542 541 541 546 546 545 545 549 549 547 547 554 554 553 553 551 551 550 550 562 562 558 558 560 560 555 555 563 563 556 556 559 559 Estienne, A.,Lahoz,B., Jarrier,P.,Bodin, L.,Folch, J.,Alabart,J. L., Fabre,S., Reproduction Reproduction Meerasahib MF,Meerasahib GroomeDG, NP Mottershead McNatty KP,McNatty S,Lawrence ReaderS, JL, Juengel Lun SB, Myllymaa KL, Western A, 543 15 and growth differentiation factor 9 co operate to regulate granulosa granulosa function. cellregulate to 9 co operate growth differentiationfactor 15 and ruminants. ruminants. 15 and growth differentiation factor 9 co operate to regulate granulosa cell function in in granulosa function cellregulate to 9 co operate growth differentiationfactor 15 and Cranfield M, ReaderMP KL, M, Laitinen Cranfield McNatty KP,McNatty JL, JuengelWilson T,NL,CL,Moeller Hudson GH, Davis SM,Galloway 548 and differential selective pressure between mono and polyovulating species. species. polyovulatingand mono between pressure differentialandselective Evolutionary origin of bone morphogenetic protein 15 and growth and differentiation factor 9differentiation growthfactor and 15 and protein morphogenetic bone of origin Evolutionary Monestier O, ServinB, Monestier O, BourquardAuclairS, T,Poupon &GFabreS Pascal A, 552 ovulation rate in sheep. ratein ovulation ovulation rate in sheep. ratein ovulation FabreS Montgomery GW,Montgomery KP & GH McNatty Davis SM,Galloway 561 564 Monniaux D, di Clemente N,Clemente diTouzé D, Monniaux JYM, Picard BontouxC, &Rico C, JL, Belville 557 ovarian follicular development in thein cow. development follicular ovarian in sheep. Reproduction, 153 (4), 395-404. DOI: 10.1530/REP-16-0507 2008 Intrafollicular steroids and anti mullerian hormone during normal and normalcystic and during hormone and steroids anti mullerian Intrafollicular2008 Reproduction 129 91 83. 473 80. Comment citer cedocument: ReproductionSuppl Reproduction 129 481 7. 121 , et al.et , 843 52. Biology of Reproduction of Biology 61 24 24 339 51. 2003 Oocyte derived growth factors and growth and Oocyte derivedfactors 2003 , et al.et, 2005b Bone morphogenetic protein morphogenetic 2005bBone 2001 Genes controlling controlling Genes 2001 79 387 96. Biology of of Biology 2014 Page 24of39 Version postprint Page 25of39 Monniaux, D.(2017).BMP15 regulates theinhibin/activin systemindependently of ovulationrate control 565 565 576 576 574 574 573 573 572 572 568 568 566 566 571 571 569 569 577 577 578 578 581 581 585 585 580 580 587 587 586 584 584 582 582 Estienne, A.,Lahoz,B., Jarrier,P.,Bodin, L.,Folch, J.,Alabart,J. L., Fabre,S., Journal of Biological Chemistry Biological of Journal Biological Chemistry Biological 15 signaling in granulosa cells.in granulosa signaling 15 MooreF Otsuka RK, Shimasaki&S inhibits follicle stimulating hormone (FSH) action by suppressing FSH receptor expression. FSHexpression. suppressingreceptor (FSH)by action hormone follicle stimulating inhibits OtsukaF, YamamotoGFErickson S, &S Shimasaki 575 oocyte quality. oocyte transforming growthfactor beta transforming family,improves and granulosa cells of is potentactivator a factor, BMP 15. Moore RK & Shimasaki S Shimasaki Moore& RK 567 Trotta AP,RitterJ Shi LJ, Mottershead DG, Sugimura S, Sugimura DG, D,Mottershead GA, Richani SL, White LiJJ, MA, Martin Al-Musawi 570 OtsukaF, YaoZ, Lee T, Yamamoto Erickson GF S, &S Shimasaki 579 factor 9 in mothers of dizygotic twins. twins. ofdizygotic in mothers9 factor morphogenetic protein 15. Identification of target cells and biological functions. targetfunctions. ofbiological Identification and protein 15. cells morphogenetic 4713 6. 588 Boomsma DI, Duffy DLDuffy DI, Boomsma GW Montgomery & Palmer JS, Zhao ZZ, Hoekstra C, Hayward NK, Hayward C, Webb PalmerZhaoJS,ZZ, Hoekstra NG,PM, WhitemanMartin DC, 583 in sheep. Reproduction, 153 (4), 395-404. DOI: 10.1530/REP-16-0507 Journal of Biological Chemistry of Biological Journal Molecular and Cellular Endocrinology andCellular Molecular Comment citer cedocument: 275 39523 8. 2005 Molecular biology and physiological role of the oocyte oftheroleoocyte physiological and Molecularbiology 2005 , et al. et , Journal of Biological Chemistry Biological Journal of 276 2015 Cumulin, an oocyte secreted heterodimer of the the of heterodimer oocyte secreted 2015an Cumulin, 11387 92. Journal of Clinical Endocrinology andMetabolism Endocrinology ofClinical Journal 2003 Molecular basis of bone morphogenetic protein morphogenetic bonebasis of 2003Molecular 25 25 2006 Novel variants in growthdifferentiationin variants 2006Novel 290 24007 24020. 24007 24020. 2001 Bone morphogenetic protein 15 morphogenetic Bone2001 234 67 73. 67 73. 278 304 10. 304 10. 2000 Bone 2000 Journal of Journal 91 Version postprint Monniaux, D.(2017).BMP15 regulates theinhibin/activin systemindependently of ovulationrate control 606 606 610 610 591 591 607 607 608 608 590 590 589 589 611 611 594 594 599 599 604 604 595 595 598 598 603 603 593 593 596 596 601 601 600 Estienne, A.,Lahoz,B., Jarrier,P.,Bodin, L.,Folch, J.,Alabart,J. L., Fabre,S., proteins in the regulation ofsensitivity.FSH the regulation in proteins Endocrinology and Metabolism and Endocrinology action and inhibition. and action Pierre A,Estienne JY,C,Racine Picard A, B, Fanchin Lahoz R, J,AlabartJL, Folch 592 WaltonMakanji KL, YCA Harrison & 465. 609 disorders. disorders. of bone morphogenetic protein 15 in ovarian function and its involvement in female fertility fertility in female itsinvolvement function ovarianand 15 in protein morphogenetic bone of 612 Mullerian Hormone Receptor Expression in Granulosa Cells. Granulosain Expression Receptor Hormone Mullerian on intrafollicular levels of activinlevels of intrafollicular on inhibin A, A and follistatin. VisserJA & Themmen AP 605 active immunization of sheep against an amino terminal peptide of the inhibin alpha C subunit Calpha peptide the inhibin of terminal amino anof immunization sheep against active and Cellular Endocrinology Cellular and JarrierP, FabreS TannettaGroome NP,EC, Feist SA, Bleach DS, LWEvans KnightPG & 597 VisserJA & Themmen AP 157 68. 602 Persani L, Rossetti R, Di Pasquale E, Cacciatore&E,FabreCDi PasqualeR, S Rossetti L, Persani in sheep. Reproduction, 153 (4), 395-404. DOI: 10.1530/REP-16-0507 HumanReproduction Update , et al.et, Comment citer cedocument: Molecular and Cellular Endocrinology Cellular Molecularand 2016 The Bone Morphogenetic Protein 15 Up Regulates the the 15Up RegulatesProtein Morphogenetic2016 TheBone Anti 2014 Role of anti Mullerian hormone and bone morphogenetic morphogenetic bone andhormone of anti Mullerian 2014Role 2005 2005 folliculogenesis. and Anti Mullerianhormone 234 101 81 6. 2602 11. 20 2012 New insights into the mechanisms of activinof into the mechanisms New insights 2012 869 83. Molecular and CellularEndocrinology and Molecular 26 26 Journal of Clinical ofClinical Journal 359 Journal of Endocrinology ofJournal 2 12. 2014 The fundamental role2014 The fundamental 1998 Effects1998 of Molecular Molecular 382 157 460 Page 26of39 Version postprint Page 27of39 Monniaux, D.(2017).BMP15 regulates theinhibin/activin systemindependently of ovulationrate control 613 613 614 614 Estienne, A.,Lahoz,B., Jarrier,P.,Bodin, L.,Folch, J.,Alabart,J. L., Fabre,S., embryo production. production. embryo Yan&Z HShi Li L, 617 616 615 in sheep. Reproduction, 153 (4), 395-404. DOI: 10.1530/REP-16-0507 Animal ReproductionAnimal Science Comment citer cedocument: 2015 Immunization against inhibin improves in vivo and in vitroinvivo and in improves inhibin against 2015Immunization 27 27 163 1 9. Version postprint Monniaux, D.(2017).BMP15 regulates theinhibin/activin systemindependently of ovulationrate control Estienne, A.,Lahoz,B., Jarrier,P.,Bodin, L.,Folch, J.,Alabart,J. L., Fabre,S., black bars) andbars) black bars) and and bars) by one-way ANOVA and different letters indicate significant differences (p < 0.05) between(p ***: p<0.001 vs. the corresponding follicle class in follicle class correspondingvs. thep<0.001 ***: RPL19 INHA as an internal reference. In each panel, data weredata analyzed panel, In each reference. an internal as (upper panels) and panels) and (upper INHBA CYP19A1 (lower panels) expression in panels) expression (lower and and +/+ IGFBP5 IGFBP5 Rasa Gr/Gr BMP15 BMP15 mRNA R/+ Page 28of39 Version postprint Page 29of39 Monniaux, D.(2017).BMP15 regulates theinhibin/activin systemindependently of ovulationrate control Estienne, A.,Lahoz,B., Jarrier,P.,Bodin, L.,Folch, J.,Alabart,J. L., Fabre,S., bars) and and bars) p<0.01, ***: p<0.001 vs. the corresponding follicle class in in class follicle thecorresponding vs. p<0.001 ***: p<0.01, by ELISA. In each panel, data were analyzed by one-way ANOVA and different lettersdifferent and ANOVAbyone-waywere panel, data analyzed each In byELISA. growing (1-3 mm) and large dominant (> or equal to 5 mm) follicles from +/+ (n=6, black(n=6, +/+ from5follicles mm) equal or to (> large dominant andmm) growing(1-3 Results represent Results ewes. of thegranulosa cells in receptors activin genesencoding of on the expression gene Figure 4: Figure and classes and genotypes. and classes follicular between0.05) <(p differences significant indicate letters different panel, each Figure 5: Figure ewes. Aragonesa Rasa follicular phase of a synchronized estrous cycle and hormonal concentrations were measuredwere hormonalconcentrations and cycle estrous synchronized phaseof a follicular the ewesin of theovaries recoveredwere on Follicularfluids panels).(right ewes Grivette cells of ewes. Results represent represent Results ewes.of cells thegranulosa in bindingproteins activin/inhibin genesencoding of on the expression gene Figure 3: Figure dominant (> or equal to 5 mm) follicles from +/+ (n=6, black bars) andbars)(n=6,black +/+ mm) tofrom 5follicles or (> equal dominant largeand mm) (1-3small ingrowingpanels) (lower ratio A Inhibin A/ concentration Activin thepanels)andA(middle Activin (upperpanels), ofA Inhibin the concentrations represent Results sheepovaries.A in Activin and of AInhibin concentration ontheintra-follicular gene Rasa Aragonesa ewes (left panels), and +/+ (n=5, black bars) andbars) black (n=5, +/+(left andpanels), ewes Aragonesa Rasa indicate significant differences (p < 0.05) between follicular classes and genotypes.and classesbetween0.05) < (pfollicular differences significant indicate in sheep. Reproduction, 153 (4), 395-404. DOI: 10.1530/REP-16-0507 Gr/Gr Consequences of the presence of natural loss-of-function mutations in the in mutations loss-of-function naturalof thepresence of Consequences Consequences of the presence of natural loss-of-function mutations in the in mutations loss-of-function naturalof thepresence of Consequences R/+ Consequences of the presence of natural loss-of-function mutations in the in mutations loss-of-function naturalof thepresence of Consequences (n=5, open bars) Grivette ewes (right panels), analyzed as described in Figure 1. In 1.Figure in described as analyzed panels), ewes(right Grivettebars)open (n=5, (n=6, open bars) Rasa Aragonesa ewes (left panels), and +/+ (n=5, blackbars)(n=5, +/+ panels),(left and ewes Aragonesa Rasa bars) open(n=6, ACVR1B Comment citer cedocument: *: p<0.05, ***: p<0.001 vs. the corresponding follicleinclass vs. thecorresponding p<0.001 ***: p<0.05, *: (upper panels)and(upper FST (encoding follistatin, the specific activin-binding protein, specificactivin-binding the follistatin,(encoding ACVR2A (lower panels) expression in small in expression panels) (lower +/+ Rasa Aragonesa ewes. Aragonesa Rasa Gr/Gr R/+ (n=5, open bars)(n=5, open (n=6, open bars)open(n=6, **: **: BMP15 BMP15 BMP15 +/+ Version postprint Monniaux, D.(2017).BMP15 regulates theinhibin/activin systemindependently of ovulationrate control Estienne, A.,Lahoz,B., Jarrier,P.,Bodin, L.,Folch, J.,Alabart,J. L., Fabre,S., between follicular classes and genotypes. *: p<0.05, **: p<0.01 vs. the corresponding thecorresponding follicle p<0.01 vs. p<0.05,**: *: genotypes. and classes follicular between p < 0.01, ***: p < 0.001, vs. Ctrl, or between BMP15 and BMP15+GDF9 conditions. conditions. BMP15+GDF9 BMP15orand between Ctrl, 0.001,vs. p < ***: < 0.01, p upper panels) and panels) upper +/+ (n=6, black bars) and black(n=6, +/+ from5follicles mm) to (> equal or dominant large andmm) growing (1-3 in small expression (n=5, black bars) and and bars)black (n=5, Figure 6: Figure in class 0.05)<(p differences significant indicate lettersdifferent panel,In1. Figure in each described < 0.05,**: p *: p<0.1,(*): comparisons. multiplefortest LSDby Fisher’s followed freedom, theofdegrees of correction theGreenhouse-Geisser ANOVA with one-way measures bytreatmentsrepeated made were different between means of Comparisons treatment. each performedfor independentofexperiments results15 the represent100%).Data at fixed (Ctrl, without ligand cells thatcultured oftorelatively expression of percentage in expressed accumulation of accumulation RNA Messenger preparation. mRNAfor of culture end at the treatment to according cellsthenpooled wells,12were replicate in tested was treatment Each factors. different theng/mlof 50 without withor 48 hours plates for 96-well incultured were cells granulosa Sheepcells. granulosaovine in system theinhibin/activin of members different encoding transcription and quantitative PCR relatively torelativelyPCR quantitative and transcription in sheep. Reproduction, 153 (4), 395-404. DOI: 10.1530/REP-16-0507 +/+ +/+ Effect of BMP4, BMP15, GDF9 and Activin A on the expression of genesonof Activin the expression A GDF9and EffectBMP15,BMP4,of Rasa Aragonesa ewes. Aragonesa Rasa INHA TGFBR3 Comment citer cedocument: Gr/Gr , , INHBA R/+ (encoding betaglycan, the co-receptor of inhibin, lowerpanels) of theco-receptor betaglycan, (encoding (n=5, open bars) Grivette ewes (right panels), analyzed as analyzedpanels),(right ewesGrivettebars)open(n=5, (n=6, open bars) Rasa Aragonesa ewes (left panels), and +/+ +/+ and(left panels), ewes Aragonesa Rasabars)open (n=6, , ACVR1B , ACVR2A RPL19 , , FST as internal reference. The results were The results internalreference. as and TGFBR3 was studied by reverse studied was Page 30of39 Version postprint Page 31of39 Monniaux, D.(2017).BMP15 regulates theinhibin/activin systemindependently of ovulationrate control Estienne, A.,Lahoz,B., Jarrier,P.,Bodin, L.,Folch, J.,Alabart,J. L., Fabre,S., RPL19 follicular phase of a synchronized estrous cycle. estrous synchronized phaseof a follicular ofthegranulosa ewes. cells in of the ewes ovaries in on the recovered were thefollicles All genotypes. and classes differences follicular between 0.05)(psignificant different and< indicate letters Supplementary in listed are Tableone-wayby panel,were data analyzed In1. each ANOVA mRNAusinglevel, relative as representedPCR and quantitative andreversetranscription by wasstudied accumulation mutations in the in mutations Supplementary FigureSupplementary 2: thesamples.in B) Inhibin of to the concentration proportional isdirectlytest theA (Panel A) or Activin A(Panel oftheend nm at450 at measured density) plasma. (optical absorbance inmadesteer The all Inhibin A and Activin A were samplesovine theandpoints the of standard Dilutions ELISA. of(SC)the standard curves thecorresponding and 020720) E982067 E (E950428, and ewes 3 plasmafrom andFF3)FF2 samples(FF1,and fluid of follicular ovine dilutions serial the Human/Mouse/Rat Activin AELISAQuantikine resultsof(Panel B).depict the panelskit The the in standard curves the with Inhibin Active AELISA (Panel kit thein A) and FigureSupplementary 1: in sheep. Reproduction, 153 (4), 395-404. DOI: 10.1530/REP-16-0507 are shown in the lower panels. The specific primer sequences used for amplification amplification usedfor sequencespanels.primer The thespecific lower shown in are BMP15 BMP15 Comment citer cedocument: gene onthemRNA gene follicular atresia markers geneof of 3 expression Consequences of the presence of natural loss-of-function naturalof presence theof Consequences fluidsplasmaandfollicular ovine of dilution curves of Parallelism RPL19 as an internal reference. The cycle thresholds (Ct) of(Ct) reference. thresholds Theaninternalcycle as IGFBP5 , , GADD45A and CLU CLU mRNA Version postprint Monniaux, D.(2017).BMP15 regulates theinhibin/activin systemindependently of ovulationrate control Estienne, A.,Lahoz,B., Jarrier,P.,Bodin, L.,Folch, J.,Alabart,J. L., Fabre,S., Table 1: Quantitative PCR primers sequences efficiency theirand primerssequences PCR 1: Quantitative Table CYP19A1 CYP19A1 ACVR1B ACVR2A TGFβR3 TGFβR3 IGFBP5 IGFBP5 in sheep. Reproduction, 153 (4), 395-404. DOI: 10.1530/REP-16-0507 INHBA INHBA RPL19 INHA Gene Accession number Forward 5’ sequence Forward number Accession Gene FST FST M012001 CTCGTACTCG CGCAACGGCG 1.95 CCAGACGAGACCAGCGACCG TCATCCTGGTCACCCTTCTG NM_001123000.1 M012731 TCAAAACGG ACTACCTCT 1.99 CAGCTTCATCCCATACTT CTACAAGAGAAAGCAGTG NM_001129733.1 M010481 AGGAAAGGA GATGTAGCG 2.08 GTAGTGGTTGATGACTGT GAAGAGGAAAGAAGAGGAA NM_001009458.1 M010591 ACAAGCCCG ATTGACCGT 2.00 CAGTATGGAACCACAGCT GACCAAGATGTCTCCCAG NM_001308579.1 M010231 ATGCTTGAC TTCAAAGAG 2.05 GTCTTCAAGAGAGGGATG GATTAGTCCTGTGGGAAC NM_001009293.1 M015031 GACGCATAG ACTAAGCTG 1.87 TATCTTCACAGGACTTTG TGGACCAGACTAATAATG NM_001257093.1 M027242 TTTCGGGTG CAGCTAAGCG 1.96 ACTAGGTCATAATATGGCAG TTGTGTACTGGGAGATTG XM_012174234.2 M027052 TTTTCGGGG ACTGGCTCG 1.98 GATCATTGAGGCATCCAG CTCTTTCTCCAGTGTGAG XM_012176015.2 M04187 AGCAGCAT CCTCCACAAC 1.95 CCCTTTCGCTACCTATACC AATGCCAATGCCAACTC XM_004012837 Comment citer cedocument: →3’ Reverse sequence 5’ Reverse →3’ Efficiency Efficiency Page 32of39 Version postprint Page 33of39 Monniaux, D.(2017).BMP15 regulates theinhibin/activin systemindependently of ovulationrate control N° of small follicles (1-3 mm) (1-3 small N°follicles of N° of large follicles (> or equal to 5 mm) 2.3 ± 0.3 3.7 ± 0.3* 2.2 ± 0.2 3.8 ± 0.9± 3.8 0.2± 2.2 0.3*± 3.7 0.3± 2.3 mm) to(> 5 or equal follicles large N°of Breed Mean diameter of the large follicles (mm) follicles largeof the diameter Mean (N° of ewes) ewes) (N° of Genotype 2 2 1 4 4 Estienne, A.,Lahoz,B., Jarrier,P.,Bodin, L.,Folch, J.,Alabart,J. L., Fabre,S., Table 2: Follicular populations in the ovaries of Rasa Aragonesa and Grivette ewes with with Grivette ewes and RasaAragonesa of ovaries in the populations 2: Follicular Table different genotypes genotypes different *: p<0.05, **: p<0.01; ***: p<0.001, vs. vs. p<0.001, ***: **:p<0.01; p<0.05, *: 3 6 5 in sheep. Reproduction, 153 (4), 395-404. DOI: 10.1530/REP-16-0507 Comment citer cedocument: 7.25 ± 0.33 5.88 ± 0.11** 7.06 ± 0.28 5.36 ± 0.09*** ± 5.36 0.28± 7.06 0.11**± 5.88 0.33± 7.25 43.0 ± 7.4 42.8 ± 6.5 48.2 ± 3.7 56.6 ± 6.8± 56.6 3.7± 48.2 6.5± 42.8 7.4± 43.0 +/+ (n=6) +/+ +/+ Rasa Aragonesa Aragonesa Rasa ewes of the same breed. thesame of ewes 1 1 (n=6) R/+ R/+ (n=5) (n=5) +/+ +/+ Grivette Grivette Gr/Gr Gr/Gr (n=5) Version postprint Monniaux, D.(2017).BMP15 regulates theinhibin/activin systemindependently of ovulationrate control iue1: Figure sa nenlrfrne nec ae,dt eeaaye yoewyAOAaddfeetltesindicate letters genotypes. different and and classes ANOVA follicular one-way using between by 0.05) level, analyzed < were relative (p data mRNA differences panel, significant as each represented In reference. and internal PCR an quantitative cycle. as and estrous transcription synchronized reverse a by of from studied phase follicles follicular mm) the 5 the in to in ewes equal mutations or loss-of-function (> natural dominant large and of and and presence bars) mm) black the (1-3 and (n=6, growing of +/+ panels) small onsequences represent in upper Results expression cells, ewes. panels) lower of granulosa cells differentiated granulosa fully the in of markers gene functional of expression Gr/Gr Estienne, A.,Lahoz,B., Jarrier,P.,Bodin, L.,Folch, J.,Alabart,J. L., Fabre,S., C in sheep. Reproduction, 153 (4), 395-404. DOI: 10.1530/REP-16-0507 n5 pnbr)Giet ws(ih aes.Alteflilswr eoee nteoaisof ovaries the on recovered were follicles the All panels). (right ewes Grivette bars) open (n=5, BMP15 0.0 0.2 0.4 0.6 0.8 1.0 20 40 60 80 40 20 40 60 80 0 Follicular diameter(mm) Follicular diameter (mm) a W154NFsX55 b R/+ +/+ 1-3 1-3 R/+ CYP19A1 IGFBP5 a b Comment citer cedocument: n6 pnbr)Rs rgns ws(etpnl) n / n5 lc bars) black (n=5, +/+ and panels), (left ewes Aragonesa Rasa bars) open (n=6, c a 5 5 /FecX b a R BMP15 IGFBP5 CYP19A1 0.0 0.2 0.4 0.6 0.8 1.0 40 20 40 60 80 20 40 60 80 0 Follicular diameter (mm) Follicular diameter (mm) amre faottcgauoacells, granulosa apoptotic of marker (a b b b a Gr/Gr +/+ 1-3 1-3 T317I and CYP19A1 IGFBP5 b a IGFBP5 /FecX a b 5 5 b a RAacmlto was accumulation mRNA Gr BMP15 CYP19A1 eeo the on gene amarker (a RPL19 Page 34of39 Version postprint Page 35of39 Monniaux, D.(2017).BMP15 regulates theinhibin/activin systemindependently of ovulationrate control rvteee rgtpnl) nlzda ecie nFgr .I ahpnl ifrn letters different panel, each vs. In p<0.001 ewes. ***: Aragonesa 1. genotypes. Rasa +/+ and Figure and in classes class in follicular bars) follicle between corresponding described black 0.05) the < as (n=5, (p analyzed +/+ differences significant panels), and indicate and bars) (right panels), black (n=6, (left ewes +/+ from ewes Grivette follicles Aragonesa mm) 5 Rasa to equal bars) or (> dominant large and mm) h xrsino ee noigIhbnAadAtvnAsbnt ntegauoaclso ewes. of cells granulosa the in subunits A Activin and A Inhibin represent encoding Results genes of expression the 2: Figure Estienne, A.,Lahoz,B., Jarrier,P.,Bodin, L.,Folch, J.,Alabart,J. L., Fabre,S., in sheep. Reproduction, 153 (4), 395-404. DOI: 10.1530/REP-16-0507 BMP15 osqecso h rsneo aua oso-ucinmttosi the in mutations loss-of-function natural of presence the of Consequences 1000 1500 100 150 200 500 0.0 0.5 1.0 1.5 2.0 50 10 20 30 40 50 0 Follicular diameter (mm) Follicular diameter(mm) a a a INHA 1-3 1-3 W154NFsX55 R/+ +/+ a a INHBA a INHA uprpnl)and panels) (upper Comment citer cedocument: b b 5 5 b b /FecX R INHBA lwrpnl)epeso nsalgoig(1-3 growing small in expression panels) (lower Relative mRNA levels 1000 1500 BMP15 500 100 150 200 0.0 0.5 1.0 1.5 2.0 10 20 30 40 50 50 0 Follicular diameter (mm) Follicular diameter (mm) a a 1-3 1-3 Gr/Gr +/+ a INHBA T317I a INHA *** *** b b /FecX 5 5 Gr/Gr b b Gr n5 pnbars) open (n=5, BMP15 R/+ n6 open (n=6, eeon gene Version postprint Monniaux, D.(2017).BMP15 regulates theinhibin/activin systemindependently of ovulationrate control iue3: Figure lse n eoye.*:p00,** <.0 s h orsodn olcecasi / aaAaoeaewes. Aragonesa follicular Rasa +/+ between in 0.05) class follicle < corresponding (p the vs. differences p<0.001 significant were ***: indicate data p<0.01, panel, letters **: phase each genotypes. follicular different In and the and classes ELISA. in by ANOVA ewes measured bars) one-way of were (lower black concentrations by ovaries hormonal (n=6, ratio the analyzed and +/+ on concentration cycle recovered from estrous A were follicles synchronized fluids a mm) Inhibin Follicular of 5 panels). / the to of (right in A equal ewes concentrations mutations or Grivette Activin loss-of-function the (> bars) natural the dominant represent of large and Results presence and panels) the ovaries. mm) and of (middle (1-3 sheep onsequences growing A in small Activin in A panels) panels), Activin (upper and A A Inhibin Inhibin of concentration follicular R/+ n6 pnbr)Rs rgns ws(etpnl) n / n5 lc as and bars) black (n=5, +/+ and panels), (left ewes Aragonesa Rasa bars) open (n=6, Estienne, A.,Lahoz,B., Jarrier,P.,Bodin, L.,Folch, J.,Alabart,J. L., Fabre,S., C in sheep. Reproduction, 153 (4), 395-404. DOI: 10.1530/REP-16-0507 Follicular fluid Follicular fluid BMP15 concentration (ng/ml) concentration (ng/ml) 10 20 30 0 Follicular diameter (mm) Concentration ratio Concentration b W154NFsX55 R/+ +/+ 1-3 b Comment citer cedocument: a 5 /FecX a R Follicular fluid concentration (ng/ml) 1000 1200 Activin A / Inhibin A BMP15 200 400 600 800 10 20 30 0 0 Follicular diameter (mm) Concentration ratio Concentration Follicular diameter(mm) b a 1-3 1-3 Gr/Gr +/+ Inhibin A T317I b a a *** /FecX b 5 5 a b BMP15 Gr eeo h intra- the on gene Gr/Gr n5 open (n=5, Page 36of39 Version postprint Page 37of39 Monniaux, D.(2017).BMP15 regulates theinhibin/activin systemindependently of ovulationrate control xrsino ee noigatvnrcposi h rnls el fee.Rslsrepresent Results ewes. of cells granulosa the in receptors activin encoding genes of expression 4: Figure :p00,** <.0 s h orsodn olcecasi / aaAaoeaewes. Aragonesa Rasa +/+ in genotypes. class and follicle classes corresponding follicular the between vs. 0.05) p<0.001 < ***: (p p<0.05, differences *: significant indicate letters different panel, each and and bars) bars) black black (n=5, (n=6, +/+ from follicles mm) and panels) Estienne, A.,Lahoz,B., Jarrier,P.,Bodin, L.,Folch, J.,Alabart,J. L., Fabre,S., osqecso h rsneo aua oso-ucinmttosi the in mutations loss-of-function natural of presence the of Consequences in sheep. Reproduction, 153 (4), 395-404. DOI: 10.1530/REP-16-0507 ACVR2A BMP15 Relative mRNA levels 0.0 0.2 0.4 0.6 0.0 0.5 1.0 1.5 lwrpnl)epeso nsalgoig(- m n ag oiat( reult 5 to equal or (> dominant large and mm) (1-3 growing small in expression panels) (lower Gr/Gr Follicular diameter(mm) Folliculardiameter (mm) a W154NFsX55 a R/+ +/+ 1-3 1-3 n5 pnbr)Giet ws(ih aes,aaye sdsrbdi iue1 In 1. Figure in described as analyzed panels), (right ewes Grivette bars) open (n=5, ACVR1B ACVR2A ab a Comment citer cedocument: ab ab 5 5 /FecX b b R/+ R n6 pnbr)Rs rgns ws(etpnl) n +/+ and panels), (left ewes Aragonesa Rasa bars) open (n=6, BMP15 0.0 0.5 1.0 1.5 0.0 0.2 0.4 0.6 Follicular diameter (mm) Follicular diameter (mm) *** b a a * Gr/Gr +/+ 1-3 T317I 1-3 ACVR2A ACVR1B a a /FecX *** *** c c 5 5 b b Gr BMP15 ACVR1B eeo the on gene (upper Version postprint Monniaux, D.(2017).BMP15 regulates theinhibin/activin systemindependently of ovulationrate control infcn ifrne p<00)btenfliua lse n eoye.* <.5 * <.1vs. p<0.01 **: p<0.05, *: ewes. genotypes. Aragonesa and Rasa +/+ indicate classes letters in follicular class different follicle between panel, corresponding each and and 0.05) the In bars) bars) < 1. black black Figure (p in (n=6, (n=5, differences described +/+ +/+ significant as from analyzed and follicles panels), panels), (right mm) (left ewes 5 Grivette ewes to Aragonesa equal Rasa ewes. or bars) (> of open dominant cells large and granulosa mm) the (1-3 in proteins binding TGFBR3 activin/inhibin encoding represent genes Results of expression the 5: Figure Estienne, A.,Lahoz,B., Jarrier,P.,Bodin, L.,Folch, J.,Alabart,J. L., Fabre,S., in sheep. Reproduction, 153 (4), 395-404. DOI: 10.1530/REP-16-0507 ecdn ealcn h orcpo fihbn oe aes xrsini ml growing small in expression panels) lower inhibin, of co-receptor the betaglycan, (encoding osqecso h rsneo aua oso-ucinmttosi the in mutations loss-of-function natural of presence the of Consequences BMP15 100 150 0.0 0.5 1.0 1.5 2.0 50 10 0 2 4 6 8 FST Follicular diameter (mm) Follicular diameter(mm) W154NFsX55 a a b R/+ +/+ 1-3 1-3 ecdn olsai,teseii cii-idn rti,uprpnl)and panels) upper protein, activin-binding specific the follistatin, (encoding TGFBR3 a Comment citer cedocument: a FST c b 5 5 /FecX c b R BMP15 100 150 0.0 0.5 1.0 1.5 2.0 50 10 0 2 4 6 8 Folliculardiameter (mm) Follicular diameter (mm) ab a Gr/Gr +/+ 1-3 1-3 T317I TGFBR3 a a FST /FecX b ** * c 5 5 Gr/Gr b b Gr n5 pnbars) open (n=5, BMP15 R/+ eeon gene (n=6, Page 38of39 Version postprint Page 39of Monniaux, D.(2017).BMP15 regulates theinhibin/activin systemindependently of ovulationrate control elct el,te el eepoe codn oteteta h n fcluefrmN preparation. mRNA 12 for in culture tested of was end treatment the Each at factors. treatment different of 96- to accumulation the in according of RNA cultured pooled ng/ml Messenger were were 50 cells cells without then granulosa or wells, Sheep with replicate hours cells. granulosa 48 for ovine plates in well system inhibin/activin the of members 6: Figure <.,* .5 * .1 *:p<001 s tl rbtenBP5adBP5GF conditions. BMP15+GDF9 and BMP15 between (*): or comparisons. Ctrl, vs. multiple 0.001, for < p test ***: LSD Greenhouse- Data 0.01, Fisher’s < the 100%). p by with **: followed at 0.05, ANOVA freedom, < fixed p one-way of *: measures degrees (Ctrl, p<0.1, repeated the ligand means of by of without correction made Comparisons Geisser treatment. cultured were each treatments cells for performed different of experiments independent between that 15 of to results the relatively represent expression of to percentage relatively PCR quantitative and transcription Percentage of control Percentage of control Percentage of control 1000 100 200 300 400 500 Estienne, A.,Lahoz,B., Jarrier,P.,Bodin, L.,Folch, J.,Alabart,J. L., Fabre,S., 200 400 600 800 0 0 in sheep. Reproduction, 153 (4), 395-404. DOI: 10.1530/REP-16-0507 feto M4 M1,GF n cii nteepeso fgnsecdn different encoding genes of expression the on A Activin and GDF9 BMP15, BMP4, of Effect tlBP M1 D9BMP15 GDF9 BMP15 BMP4 Ctrl tlBP M1 D9BMP15 GDF9 BMP15 BMP4 Ctrl *** (*) *** INHA FST Comment citer cedocument: * * INHA + + GDF9 *** GDF9 (*) , INHBA ACTA ACTA ** ** , , ACVR1B RPL19 sitra eeec.Terslswr xrse in expressed were results The reference. internal as ACVR2A Percentage of control Percentage of control Percentage of control 100 150 50 0 tlBP M1 D9BMP15 GDF9 BMP15 BMP4 Ctrl , FST and TGFBR3 ACVR2A a tde yreverse by studied was +GDF9 ACTA ***