Cotargeting Stress-Activated Hsp27 and Autophagy As a Combinatorial Strategy to Amplify Endoplasmic Reticular Stress in Prostate Cancer

Total Page:16

File Type:pdf, Size:1020Kb

Load more

Published OnlineFirst June 6, 2012; DOI: 10.1158/1535-7163.MCT-12-0072 Molecular Cancer Therapeutic Discovery Therapeutics Cotargeting Stress-Activated Hsp27 and Autophagy as a Combinatorial Strategy to Amplify Endoplasmic Reticular Stress in Prostate Cancer Masafumi Kumano1, Junya Furukawa2, Masaki Shiota1, Anousheh Zardan1, Fan Zhang1, Eliana Beraldi1, Romina M. Wiedmann1, Ladan Fazli1, Amina Zoubeidi1, and Martin E. Gleave1 Abstract Hsp27 is a stress-activated multifunctional chaperone that inhibits treatment-induced apoptosis and causes treatment resistance in prostate and other cancers. We previously showed that targeted suppression of Hsp27 sensitizes cancer cells to hormone and chemotherapy. However, mechanisms by which Hsp27 confers cell treatment resistance are incompletely defined. Here, we report that Hsp27 protects human prostate cancer cells against proteotoxic stress induced by proteasome inhibition, and that Hsp27 silencing using siRNA or antisense (OGX-427) induced both apoptosis and autophagy through mechanisms involving reduced protea- some activity and induction of endoplasmic reticulum (ER) stress. We found that autophagy activation protected against ER stress-induced cell death, whereas inhibition of autophagy activation following Hsp27 silencing using either pharmacologic inhibitors or atg3 silencing enhanced cell death. Importantly, cotargeting Hsp27 and autophagy by combining OGX-427 with the autophagy inhibitor, chloroquine, significantly delayed PC-3 prostate tumor growth in vivo. These findings identify autophagy as a cytoprotective, stress-induced adaptive pathway, activated following disruption of protein homeostasis and ER stress induced by Hsp27 silencing. Combinatorial cotargeting cytoprotective Hsp27 and autophagy illustrates potential benefits of blocking activation of adaptive pathways to improve treatment outcomes in cancer. Mol Cancer Ther; 11(8); 1661–71. Ó2012 AACR. Introduction factor pathways (5), stress-induced survival genes (6), Many strategies used to kill cancer cells induce stress and cytoprotective chaperone networks (7). Molecular responses that promote the emergence of a treatment- chaperones such as Hsps help cells cope with stress- resistant phenotype. In prostate cancer, androgen ablation induced misfolded proteins and play prominent roles in induces remission in most patients but also progression cellular signaling and transcriptional regulatory net- to castration-resistant prostate cancer (CRPC; ref. 1). works. In particular, Hsp27 is a stress-activated chap- Although docetaxel chemotherapy (2) and, more recently, erone highly expressed in CRPC and other cancers that AR pathway inhibitors such as abiraterone (3) and MDV- inhibits treatment-induced apoptosis (8–10). Hsp27 is 3100 prolong survival by several months, treatment induced by anti-AR and chemotherapy, inhibiting apo- resistance frequently emerges, highlighting the need for ptosis by regulating components of both stress- and additional therapies targeting the molecular basis of receptor-induced apoptotic pathways (11–14). We pre- CRPC and treatment resistance. viously reported that Hsp27 silencing induces apoptosis Development of CRPC is attributed to reactivation of and enhances anticancer drug sensitivity in prostate the androgen receptor (AR) axis (4), alternative growth and bladder cancer cells (7, 15, 16). The Hsp27 inhibitor, OGX-427, delays progression and enhances activity of chemotherapy in CRPC and other cancers (7, 15, 16), Authors' Affiliations: 1The Vancouver Prostate Centre and Department of Urological Sciences, University of British Columbia, Vancouver, British and is currently in multicenter phase II studies of CRPC Columbia, Canada; and 2Division of Urology, Kobe University Graduate and metastatic bladder cancer (ClinicalTrials.gov iden- School of Medicine, Kobe, Japan tifier, NCT01454089 and NCT01120470). Note: Supplementary data for this article are available at Molecular Cancer Hsps are particularly important in regulating mis- Therapeutics Online (http://mct.aacrjournals.org/). folded protein and endoplasmic reticular (ER) stress M. Kumano and J. Furukawa contributed equally to this work. responses, an emerging area of interest in cancer progres- sion and treatment resistance (17). In cancer, ER stress Corresponding Author: Martin E. Gleave, Department of Urologic Sciences, University of British Columbia, 2775 Laurel Street, Level 6, and misfolded protein levels are elevated because of Vancouver, British Columbia, Canada V6H 3Z6. Phone: 604-875-4818; mutated genes and stressed microenvironments (18); Fax: 604-875-5654; E-mail: [email protected] moreover, many anticancer agents induce ER stress doi: 10.1158/1535-7163.MCT-12-0072 (19). ER stress activates a complex intracellular signaling Ó2012 American Association for Cancer Research. pathway, called the unfolded protein response (UPR), www.aacrjournals.org 1661 Downloaded from mct.aacrjournals.org on September 24, 2021. © 2012 American Association for Cancer Research. Published OnlineFirst June 6, 2012; DOI: 10.1158/1535-7163.MCT-12-0072 Kumano et al. tailored to reestablish protein homeostasis (proteostasis) cleotide (ASO), OGX-427 was kindly provided by Onco- by inhibiting protein translation and promoting ER- Genex Pharmaceuticals. The sequence of OGX-427 corre- associated protein degradation (ERAD) by stimulating sponds to the human Hsp27 translation initiation site (50- the ubiquitin–proteasome system (UPS) and autophagy GGGACGCGGCGCTCGGTCAT-30). A scrambled (ScrB) to reduce levels of misfolded proteins (20). Autophagy control oligonucleotide was generously provided by ISIS is an evolutionarily conserved bulk degradation system Pharmaceuticals. The sequence of Hsp27 siRNA corre- that facilitates clearance of stress-induced misfolded or sponds to the human Hsp27 site (50-GUCUCAUCG- aggregated proteins, as well as organelles (21). Classi- GAUUUUGCAGC-30; Dharmacon). The sequence of Atg3 cally, autophagy is activated in starvation or oxidative siRNA corresponds to the human Atg3 site (50-GGAAU- stress and generally considered an adaptive survival CAAAGUUUAAGGAAACAGGU-30; Invitrogen Life mechanism (22); however, when ER stress and unfolded Technologies). A scrambled siRNA (50-CAGCGCUGA- protein burden overwhelms the degradation capacity CAACAGUUUCAU-30; Dharmacon) was used as a con- of the proteasome or autophagy, then cell death can trol for RNA interference experiments. occur. Although many studies link UPS inhibition and ER Western blotting analysis stress to autophagy induction (23–26), whether treat- Total proteins were extracted using radioimmunopre- ment-induced autophagy is cytoprotective to facilitate cipitation assay buffer (50 mmol/L Tris, pH 7.2, 1% development of acquired treatment resistance, or alterna- NP-40, 0.1% deoxycholate, 0.1% SDS, 100 mmol/L tively mediates treatment-induced cell death, remain NaCl, Roche complete protease inhibitor cocktail) and controversial. Because Hsp27 has been identified as a submitted to Western blot as we described previously cytoprotective chaperone linked to treatment resistance (27). and cell survival (7, 11, 27, 28) as well as ER stress and UPS activity (12, 29), we set out to explore its role in treatment- Proteasome activity induced ER stress and protein homeostasis in prostate Peptidase activity of the proteasome was measured by cancer. mixing tissue homogenate with 20 mmol/L fluorogenic peptide Suc-LLVT-AMC (succinyl-Leu-Leu-Val-Tyr-7- amino-4-methylcoumarin; Calbiochem) as we previously Materials and Methods described (30). Prostate cancer cell lines and reagents LNCaP and C4-2 cells were kindly provided by Dr. Analysis of Xbp-1 splicing Leland W. K. Chung (Cedar Sinai, Los Angeles, CA) tested Total RNA was isolated using TRIzol reagent according and authenticated by whole-genome and whole-tran- to the manufacturer instructions (Life, Technology). scriptome sequencing on Illumina Genome Analyzer IIx cDNA was synthesized from 2 mg of RNA using the platform in July 2009. PC-3 cells were purchased from the Superscript II First–Strand Synthesis Kit (Invitrogen) and American Type Culture Collection (2008, ATCC authen- amplified with a pair of primers corresponding to nucleo- tication by isoenzymes analysis). LNCaP and C4-2 cells tides 285–308 (forward; 50- AAACAGAGTAGCAGCTC- were maintained in RPMI-1640 media (Invitrogen Life AGACTGC-30) and -735–758 (reverse; 50-TCCTTCTG- Technologies) containing 5% heat-inactivated FBS (Invi- GGTAGACCTCTGGGAG-30) of XBP-1 cDNA. b-Actin trogen Life Technologies). PC-3 cells were maintained in (forward: GGACTTCGAGCAAGAGATGG; reverse: AG- Dulbecco’s Modified Eagle’s Medium (DMEM; Invitro- CACTGTGTTGGCGGTACAG) was used as endogenous gen Life Technologies) containing 5% FBS. PC-3 cells control. PCR products were analyzed on 2.5% agarose stably transfected with Hsp27 (PC-3Hsp27) and empty gel. vector–transfected PC-3 cells (PC-3Empty) were generated as previously reported (13). MG132 was purchased In vitro cell growth assay from Calbiochem. Chloroquine, bafilomycin, and 3- Cells were plated in 12-well plate, allowed to attach for methyladenine (3-MA) were purchased from Sigma- 24 hours, and treated with indicated concentrations of Aldrich. Antibodies anti-GRP78, anti-CREB2 (ATF4), siRNA for 1 day or ASO for 2 days. Cell growth was then anti-GADD153 (CHOP), and anti-ubiquitin from Santa assessed using crystal violet assay as described previously Cruz Biotechnology; anti–phospho-eIF2a from Invitrogen (31). Absorbance was determined with a microculture Life Technologies;
Recommended publications
  • The Role of the Ubiquitin Ligase Nedd4-1 in Skeletal Muscle Atrophy

    The Role of the Ubiquitin Ligase Nedd4-1 in Skeletal Muscle Atrophy

    The Role of the Ubiquitin Ligase Nedd4-1 in Skeletal Muscle Atrophy by Preena Nagpal A thesis submitted in conformity with the requirements for the degree of Masters in Medical Science Institute of Medical Science University of Toronto © Copyright by Preena Nagpal 2012 The Role of the Ubiquitin Ligase Nedd4-1 in Skeletal Muscle Atrophy Preena Nagpal Masters in Medical Science Institute of Medical Science University of Toronto 2012 Abstract Skeletal muscle (SM) atrophy complicates many illnesses, diminishing quality of life and increasing disease morbidity, health resource utilization and health care costs. In animal models of muscle atrophy, loss of SM mass results predominantly from ubiquitin-mediated proteolysis and ubiquitin ligases are the key enzymes that catalyze protein ubiquitination. We have previously shown that ubiquitin ligase Nedd4-1 is up-regulated in a rodent model of denervation- induced SM atrophy and the constitutive expression of Nedd4-1 is sufficient to induce myotube atrophy in vitro, suggesting an important role for Nedd4-1 in the regulation of muscle mass. In this study we generate a Nedd4-1 SM specific-knockout mouse and demonstrate that the loss of Nedd4-1 partially protects SM from denervation-induced atrophy confirming a regulatory role for Nedd4-1 in the maintenance of muscle mass in vivo. Nedd4-1 did not signal downstream through its known substrates Notch-1, MTMR4 or FGFR1, suggesting a novel substrate mediates Nedd4-1’s induction of SM atrophy. ii Acknowledgments and Contributions I would like to thank my supervisor, Dr. Jane Batt, for her undying support throughout my time in the laboratory.
  • The HECT Domain Ubiquitin Ligase HUWE1 Targets Unassembled Soluble Proteins for Degradation

    The HECT Domain Ubiquitin Ligase HUWE1 Targets Unassembled Soluble Proteins for Degradation

    OPEN Citation: Cell Discovery (2016) 2, 16040; doi:10.1038/celldisc.2016.40 ARTICLE www.nature.com/celldisc The HECT domain ubiquitin ligase HUWE1 targets unassembled soluble proteins for degradation Yue Xu1, D Eric Anderson2, Yihong Ye1 1Laboratory of Molecular Biology, National Institute of Diabetes and Digestive and Kidney Diseases, National Institutes of Health, Bethesda, MD, USA; 2Advanced Mass Spectrometry Core Facility, National Institute of Diabetes and Digestive and Kidney Diseases, National Institutes of Health, Bethesda, MD, USA In eukaryotes, many proteins function in multi-subunit complexes that require proper assembly. To maintain complex stoichiometry, cells use the endoplasmic reticulum-associated degradation system to degrade unassembled membrane subunits, but how unassembled soluble proteins are eliminated is undefined. Here we show that degradation of unassembled soluble proteins (referred to as unassembled soluble protein degradation, USPD) requires the ubiquitin selective chaperone p97, its co-factor nuclear protein localization protein 4 (Npl4), and the proteasome. At the ubiquitin ligase level, the previously identified protein quality control ligase UBR1 (ubiquitin protein ligase E3 component n-recognin 1) and the related enzymes only process a subset of unassembled soluble proteins. We identify the homologous to the E6-AP carboxyl terminus (homologous to the E6-AP carboxyl terminus) domain-containing protein HUWE1 as a ubiquitin ligase for substrates bearing unshielded, hydrophobic segments. We used a stable isotope labeling with amino acids-based proteomic approach to identify endogenous HUWE1 substrates. Interestingly, many HUWE1 substrates form multi-protein com- plexes that function in the nucleus although HUWE1 itself is cytoplasmically localized. Inhibition of nuclear entry enhances HUWE1-mediated ubiquitination and degradation, suggesting that USPD occurs primarily in the cytoplasm.
  • Heat Shock Protein 27 Inhibits HMGB1 Translocation by Regulating CBP

    Heat Shock Protein 27 Inhibits HMGB1 Translocation by Regulating CBP

    Molecular Immunology 108 (2019) 45–55 Contents lists available at ScienceDirect Molecular Immunology journal homepage: www.elsevier.com/locate/molimm Heat shock protein 27 inhibits HMGB1 translocation by regulating CBP acetyltransferase activity and ubiquitination T ⁎⁎ Xiaowen Bia, Miao Xua, Jinfei Lia, Ting Huanga, Baolin Jianga, Lei Shena, Lan Luob, , ⁎⁎⁎ ⁎ Shixiang Liuc, , Zhimin Yina, a Jiangsu Province Key Laboratory for Molecular and Medical Biotechnology, College of Life Science, Nanjing Normal University, Nanjing, Jiangsu, PR China b State Key Laboratory of Pharmaceutical Biotechnology, School of Life Sciences, Nanjing University, Nanjing, Jiangsu, PR China c Jurong People’s Hospital, Zhenjiang, Jiangsu, PR China ARTICLE INFO ABSTRACT Keywords: Heat-shock protein 27 (Hsp27) is a member of the small heat shock protein family that has been reported to Hsp27 protect cells against pro-inflammatory stresses. High mobility group box 1 (HMGB1) is a proinflammatory cy- CBP tokine associated with death from sepsis and other inflammatory diseases. After being acetylated by CREB- HMGB1 binding protein (CBP), the transcriptional adaptor and acetyltransferase, HMGB1 translocates from the nucleus Phosphorylation to the cytoplasm. In the present study, we investigated the effects of Hsp27 on HMGB1 translocation from the Acetylation nucleus to the cytoplasm in THP-1 cells. We found that Hsp27 phosphorylation decreased LPS-induced HMGB1 acetylation and translocation from the nucleus to the cytoplasm, as well as its release from THP-1 cells. The study further showed that cytosolic non-phosphorylated Hsp27 enhanced CBP ubiquitination and degradation in LPS-unstimulated cells, which suggested that Hsp27 maintained suitable CBP levels under normal physiological conditions. After LPS stimulation, Hsp27 was phosphorylated at serine residues 15/78 and translocated from the cytoplasm into the nucleus.
  • Uncovering Ubiquitin and Ubiquitin-Like Signaling Networks Alfred C

    Uncovering Ubiquitin and Ubiquitin-Like Signaling Networks Alfred C

    REVIEW pubs.acs.org/CR Uncovering Ubiquitin and Ubiquitin-like Signaling Networks Alfred C. O. Vertegaal* Department of Molecular Cell Biology, Leiden University Medical Center, Albinusdreef 2, 2333 ZA Leiden, The Netherlands CONTENTS 8. Crosstalk between Post-Translational Modifications 7934 1. Introduction 7923 8.1. Crosstalk between Phosphorylation and 1.1. Ubiquitin and Ubiquitin-like Proteins 7924 Ubiquitylation 7934 1.2. Quantitative Proteomics 7924 8.2. Phosphorylation-Dependent SUMOylation 7935 8.3. Competition between Different Lysine 1.3. Setting the Scenery: Mass Spectrometry Modifications 7935 Based Investigation of Phosphorylation 8.4. Crosstalk between SUMOylation and the and Acetylation 7925 UbiquitinÀProteasome System 7935 2. Ubiquitin and Ubiquitin-like Protein Purification 9. Conclusions and Future Perspectives 7935 Approaches 7925 Author Information 7935 2.1. Epitope-Tagged Ubiquitin and Ubiquitin-like Biography 7935 Proteins 7925 Acknowledgment 7936 2.2. Traps Based on Ubiquitin- and Ubiquitin-like References 7936 Binding Domains 7926 2.3. Antibody-Based Purification of Ubiquitin and Ubiquitin-like Proteins 7926 1. INTRODUCTION 2.4. Challenges and Pitfalls 7926 Proteomes are significantly more complex than genomes 2.5. Summary 7926 and transcriptomes due to protein processing and extensive 3. Ubiquitin Proteomics 7927 post-translational modification (PTM) of proteins. Hundreds ff fi 3.1. Proteomic Studies Employing Tagged of di erent modi cations exist. Release 66 of the RESID database1 (http://www.ebi.ac.uk/RESID/) contains 559 dif- Ubiquitin 7927 ferent modifications, including small chemical modifications 3.2. Ubiquitin Binding Domains 7927 such as phosphorylation, acetylation, and methylation and mod- 3.3. Anti-Ubiquitin Antibodies 7927 ification by small proteins, including ubiquitin and ubiquitin- 3.4.
  • Genome-Wide Sirna Screen for Mediators of NF-Κb Activation

    Genome-Wide Sirna Screen for Mediators of NF-Κb Activation

    Genome-wide siRNA screen for mediators SEE COMMENTARY of NF-κB activation Benjamin E. Gewurza, Fadi Towficb,c,1, Jessica C. Marb,d,1, Nicholas P. Shinnersa,1, Kaoru Takasakia, Bo Zhaoa, Ellen D. Cahir-McFarlanda, John Quackenbushe, Ramnik J. Xavierb,c, and Elliott Kieffa,2 aDepartment of Medicine and Microbiology and Molecular Genetics, Channing Laboratory, Brigham and Women’s Hospital and Harvard Medical School, Boston, MA 02115; bCenter for Computational and Integrative Biology, Massachusetts General Hospital, Harvard Medical School, Boston, MA 02114; cProgram in Medical and Population Genetics, The Broad Institute of Massachusetts Institute of Technology and Harvard, Cambridge, MA 02142; dDepartment of Biostatistics, Harvard School of Public Health, Boston, MA 02115; and eDepartment of Biostatistics and Computational Biology and Department of Cancer Biology, Dana-Farber Cancer Institute, Boston, MA 02115 Contributed by Elliott Kieff, December 16, 2011 (sent for review October 2, 2011) Although canonical NFκB is frequently critical for cell proliferation, (RIPK1). TRADD engages TNFR-associated factor 2 (TRAF2), survival, or differentiation, NFκB hyperactivation can cause malig- which recruits the ubiquitin (Ub) E2 ligase UBC5 and the E3 nant, inflammatory, or autoimmune disorders. Despite intensive ligases cIAP1 and cIAP2. CIAP1/2 polyubiquitinate RIPK1 and study, mammalian NFκB pathway loss-of-function RNAi analyses TRAF2, which recruit and activate the K63-Ub binding proteins have been limited to specific protein classes. We therefore under- TAB1, TAB2, and TAB3, as well as their associated kinase took a human genome-wide siRNA screen for novel NFκB activa- MAP3K7 (TAK1). TAK1 in turn phosphorylates IKKβ activa- tion pathway components. Using an Epstein Barr virus latent tion loop serines to promote IKK activity (4).
  • At Elevated Temperatures, Heat Shock Protein Genes Show Altered Ratios Of

    At Elevated Temperatures, Heat Shock Protein Genes Show Altered Ratios Of

    EXPERIMENTAL AND THERAPEUTIC MEDICINE 22: 900, 2021 At elevated temperatures, heat shock protein genes show altered ratios of different RNAs and expression of new RNAs, including several novel HSPB1 mRNAs encoding HSP27 protein isoforms XIA GAO1,2, KEYIN ZHANG1,2, HAIYAN ZHOU3, LUCAS ZELLMER4, CHENGFU YUAN5, HAI HUANG6 and DEZHONG JOSHUA LIAO2,6 1Department of Pathology, Guizhou Medical University Hospital; 2Key Lab of Endemic and Ethnic Diseases of The Ministry of Education of China in Guizhou Medical University; 3Clinical Research Center, Guizhou Medical University Hospital, Guiyang, Guizhou 550004, P.R. China; 4Masonic Cancer Center, University of Minnesota, Minneapolis, MN 55455, USA; 5Department of Biochemistry, China Three Gorges University, Yichang, Hubei 443002; 6Center for Clinical Laboratories, Guizhou Medical University Hospital, Guiyang, Guizhou 550004, P.R. China Received December 16, 2020; Accepted May 10, 2021 DOI: 10.3892/etm.2021.10332 Abstract. Heat shock proteins (HSP) serve as chaperones genes may engender multiple protein isoforms. These results to maintain the physiological conformation and function of collectively suggested that, besides increasing their expres‑ numerous cellular proteins when the ambient temperature is sion, certain HSP and associated genes also use alternative increased. To determine how accurate the general assumption transcription start sites to produce multiple RNA transcripts that HSP gene expression is increased in febrile situations is, and use alternative splicing of a transcript to produce multiple the RNA levels of the HSF1 (heat shock transcription factor 1) mature RNAs, as important mechanisms for responding to an gene and certain HSP genes were determined in three cell increased ambient temperature in vitro. lines cultured at 37˚C or 39˚C for three days.
  • Could Small Heat Shock Protein HSP27 Be a First-Line Target for Preventing Protein Aggregation in Parkinson’S Disease?

    Could Small Heat Shock Protein HSP27 Be a First-Line Target for Preventing Protein Aggregation in Parkinson’S Disease?

    International Journal of Molecular Sciences Review Could Small Heat Shock Protein HSP27 Be a First-Line Target for Preventing Protein Aggregation in Parkinson’s Disease? Javier Navarro-Zaragoza 1,2 , Lorena Cuenca-Bermejo 2,3 , Pilar Almela 1,2,* , María-Luisa Laorden 1,2 and María-Trinidad Herrero 2,3,* 1 Department of Pharmacology, School of Medicine, University of Murcia, Campus Mare Nostrum, 30100 Murcia, Spain; [email protected] (J.N.-Z.); [email protected] (M.-L.L.) 2 Institute of Biomedical Research of Murcia (IMIB), Campus de Ciencias de la Salud, 30120 Murcia, Spain 3 Clinical & Experimental Neuroscience (NICE), Institute for Aging Research, School of Medicine, University of Murcia, Campus Mare Nostrum, 30100 Murcia, Spain; [email protected] * Correspondence: [email protected] (P.A.); [email protected] (M.-T.H.); Tel.: +34-868889358 (P.A.); +34-868883954 (M.-T.H.) Abstract: Small heat shock proteins (HSPs), such as HSP27, are ubiquitously expressed molecular chaperones and are essential for cellular homeostasis. The major functions of HSP27 include chaper- oning misfolded or unfolded polypeptides and protecting cells from toxic stress. Dysregulation of stress proteins is associated with many human diseases including neurodegenerative diseases, such as Parkinson’s disease (PD). PD is characterized by the presence of aggregates of α-synuclein in the central and peripheral nervous system, which induces the degeneration of dopaminergic neurons in the substantia nigra pars compacta (SNpc) and in the autonomic nervous system. Autonomic dys- function is an important non-motor phenotype of PD, which includes cardiovascular dysregulation, Citation: Navarro-Zaragoza, J.; among others. Nowadays, the therapies for PD focus on dopamine (DA) replacement.
  • Diet, Autophagy, and Cancer: a Review

    Diet, Autophagy, and Cancer: a Review

    1596 Review Diet, Autophagy, and Cancer: A Review Keith Singletary1 and John Milner2 1Department of Food Science and Human Nutrition, University of Illinois, Urbana, Illinois and 2Nutritional Science Research Group, Division of Cancer Prevention, National Cancer Institute, Bethesda, Maryland Abstract A host of dietary factors can influence various cellular standing of the interactions among bioactive food processes and thereby potentially influence overall constituents, autophagy, and cancer. Whereas a variety cancer risk and tumor behavior. In many cases, these of food components including vitamin D, selenium, factors suppress cancer by stimulating programmed curcumin, resveratrol, and genistein have been shown to cell death. However, death not only can follow the stimulate autophagy vacuolization, it is often difficult to well-characterized type I apoptotic pathway but also can determine if this is a protumorigenic or antitumorigenic proceed by nonapoptotic modes such as type II (macro- response. Additional studies are needed to examine autophagy-related) and type III (necrosis) or combina- dose and duration of exposures and tissue specificity tions thereof. In contrast to apoptosis, the induction of in response to bioactive food components in transgenic macroautophagy may contribute to either the survival or and knockout models to resolve the physiologic impli- death of cells in response to a stressor. This review cations of early changes in the autophagy process. highlights current knowledge and gaps in our under- (Cancer Epidemiol Biomarkers Prev 2008;17(7):1596–610) Introduction A wealth of evidence links diet habits and the accompa- degradation. Paradoxically, depending on the circum- nying nutritional status with cancer risk and tumor stances, this process of ‘‘self-consumption’’ may be behavior (1-3).
  • Reconstitution of Cargo-Induced LC3 Lipidation in Mammalian Selective Autophagy

    Reconstitution of Cargo-Induced LC3 Lipidation in Mammalian Selective Autophagy

    bioRxiv preprint doi: https://doi.org/10.1101/2021.01.08.425958; this version posted January 9, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Reconstitution of cargo-induced LC3 lipidation in mammalian selective autophagy Chunmei Chang1,3, Xiaoshan Shi1,3, Liv E. Jensen1,3, Adam L. Yokom1,3, Dorotea Fracchiolla2,3, Sascha Martens2,3 and James H. Hurley1,3,4 1 Department of Molecular and Cell Biology at California Institute for Quantitative Biosciences, University of California, Berkeley, Berkeley, CA 94720, USA 2 Department of Biochemistry and Cell Biology, Max Perutz Labs, University of Vienna, Vienna BioCenter, Dr. Bohr-Gasse 9, 1030 Vienna, Austria 3Aligning Science Across Parkinson’s Collaborative Research Network, Chevy Chase, MD, USA 4 Corresponding author: James H. Hurley, ORCID: 0000-0001-5054-5445, e-mail: [email protected] 1 bioRxiv preprint doi: https://doi.org/10.1101/2021.01.08.425958; this version posted January 9, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Abstract Selective autophagy of damaged mitochondria, intracellular pathogens, protein aggregates, endoplasmic reticulum, and other large cargoes is essential for health. The presence of cargo initiates phagophore biogenesis, which entails the conjugation of ATG8/LC3 family proteins to membrane phosphatidylethanolamine.
  • Omics Technologies: Insights Into the Transmission of Insect Vector-Borne Plant Viruses

    Omics Technologies: Insights Into the Transmission of Insect Vector-Borne Plant Viruses

    Looking Through the Lens of ‘Omics Technologies: Insights into the Transmission of Insect Vector-borne Plant Viruses Jennifer R. Wilson1,2, Stacy L. DeBlasio1,2,3, Mariko M. Alexander1,2 and Michelle Heck1,2,3* 1Plant Pathology and Plant Microbe Biology Section, School of Integrative Plant Sciences, Cornell University, Ithaca, NY, USA. 2Boyce Tompson Institute, Ithaca, NY, USA. 3Emerging Pests and Pathogens Research Unit, United States Department of Agriculture – Agricultural Research Service, Ithaca, NY, USA. *Correspondence: [email protected] htps://doi.org/10.21775/cimb.034.113 Abstract interactions, and the development of novel control Insects in the orders Hemiptera and Tysanoptera strategies. transmit viruses and other pathogens associated with the most serious diseases of plants. Plant viruses transmited by these insects target similar Advances in whole genome tissues, genes, and proteins within the insect to sequencing of insect vectors of facilitate plant-to-plant transmission with some plant viruses fuels discovery degree of specifcity at the molecular level. ‘Omics Major advances in next generation sequencing tech- experiments are becoming increasingly important nologies and their increased afordability has led to and practical for vector biologists to use towards an explosion in the availability of whole-genome beter understanding the molecular mechanisms sequence data for each biological player in the and biochemistry underlying transmission of virus–vector–host relationship: virus, vector and these insect-borne diseases.
  • Role of Autophagy in Histone Deacetylase Inhibitor-Induced Apoptotic and Nonapoptotic Cell Death

    Role of Autophagy in Histone Deacetylase Inhibitor-Induced Apoptotic and Nonapoptotic Cell Death

    Role of autophagy in histone deacetylase inhibitor-induced apoptotic and nonapoptotic cell death Noor Gammoha, Du Lama,1, Cindy Puentea, Ian Ganleyb, Paul A. Marksa,2, and Xuejun Jianga,2 aCell Biology Program, Memorial Sloan Kettering Cancer Center, New York, NY 10065; and bMedical Research Council Protein Phosphorylation Unit, University of Dundee, Dundee DD1 5EH, Scotland, United Kingdom Contributed by Paul A. Marks, March 16, 2012 (sent for review February 13, 2012) Autophagy is a cellular catabolic pathway by which long-lived membrane vesicle. Nutrient and energy sensing can directly proteins and damaged organelles are targeted for degradation. regulate autophagy by affecting the ULK1 complex, which is Activation of autophagy enhances cellular tolerance to various comprised of the protein kinase ULK1 and its regulators, stresses. Recent studies indicate that a class of anticancer agents, ATG13 and FIP200 (10–12). Under nutrient-rich conditions, histone deacetylase (HDAC) inhibitors, can induce autophagy. One mammalian target of rapamycin (mTOR) directly phosphor- of the HDAC inhibitors, suberoylanilide hydroxamic acid (SAHA), is ylates ULK1 and ATG13 to inhibit the autophagy function of the currently being used for treating cutaneous T-cell lymphoma and ULK1 complex. However, amino acid deprivation inactivates under clinical trials for multiple other cancer types, including mTOR and therefore releases ULK1 from its inhibition. glioblastoma. Here, we show that SAHA increases the expression Downstream of the ULK1 complex, in the heart of the auto- of the autophagic factor LC3, and inhibits the nutrient-sensing phagosome nucleation and elongation, lie two ubiquitin-like kinase mammalian target of rapamycin (mTOR). The inactivation conjugation systems: the ATG12-ATG5 and the LC3-phospha- of mTOR results in the dephosphorylation, and thus activation, of tidylethanolamide (PE) conjugates (13).
  • Coordination Between Autophagy and the Heat Shock Response: Evidence from Exercise in Animals and Humans Nathan H

    Coordination Between Autophagy and the Heat Shock Response: Evidence from Exercise in Animals and Humans Nathan H

    University of New Mexico UNM Digital Repository Health, Exercise, and Sports Sciences ETDs Education ETDs 9-1-2015 Coordination Between Autophagy and the Heat Shock Response: Evidence From Exercise in Animals and Humans Nathan H. Cole Follow this and additional works at: https://digitalrepository.unm.edu/educ_hess_etds Part of the Health and Physical Education Commons Recommended Citation Cole, Nathan H.. "Coordination Between Autophagy and the Heat Shock Response: Evidence From Exercise in Animals and Humans." (2015). https://digitalrepository.unm.edu/educ_hess_etds/52 This Thesis is brought to you for free and open access by the Education ETDs at UNM Digital Repository. It has been accepted for inclusion in Health, Exercise, and Sports Sciences ETDs by an authorized administrator of UNM Digital Repository. For more information, please contact [email protected]. Nathan H. Cole Candidate Health, Exercise, & Sports Sciences Department This thesis is approved, and it is acceptable in quality and form for publication: Approved by the Thesis Committee: Christine M. Mermier, Chairperson Karol Dokladny Orrin B. Myers i COORDINATION BETWEEN AUTOPHAGY AND THE HEAT SHOCK RESPONSE: EVIDENCE FROM EXERCISE IN ANIMALS AND HUMANS by NATHAN H. COLE B.S. University Studies, University of New Mexico, 2013 THESIS Submitted in Partial Fulfillment of the Requirements for the Degree of MASTER OF SCIENCE PHYSICAL EDUCATION CONCENTRATION: EXERCISE SCIENCE The University of New Mexico Albuquerque, New Mexico July, 2015 ii Acknowledgments I would like to thank Dr. Christine Mermier for her unwavering guidance, support, generosity, and patience (throughout this project, and many that came before it); Dr. Orrin Myers for all his assistance in moving from the numbers to the meaning (not to mention putting up with my parabolic model); Dr.