Published OnlineFirst June 6, 2012; DOI: 10.1158/1535-7163.MCT-12-0072 Molecular Cancer Therapeutic Discovery Therapeutics Cotargeting Stress-Activated Hsp27 and Autophagy as a Combinatorial Strategy to Amplify Endoplasmic Reticular Stress in Prostate Cancer Masafumi Kumano1, Junya Furukawa2, Masaki Shiota1, Anousheh Zardan1, Fan Zhang1, Eliana Beraldi1, Romina M. Wiedmann1, Ladan Fazli1, Amina Zoubeidi1, and Martin E. Gleave1 Abstract Hsp27 is a stress-activated multifunctional chaperone that inhibits treatment-induced apoptosis and causes treatment resistance in prostate and other cancers. We previously showed that targeted suppression of Hsp27 sensitizes cancer cells to hormone and chemotherapy. However, mechanisms by which Hsp27 confers cell treatment resistance are incompletely defined. Here, we report that Hsp27 protects human prostate cancer cells against proteotoxic stress induced by proteasome inhibition, and that Hsp27 silencing using siRNA or antisense (OGX-427) induced both apoptosis and autophagy through mechanisms involving reduced protea- some activity and induction of endoplasmic reticulum (ER) stress. We found that autophagy activation protected against ER stress-induced cell death, whereas inhibition of autophagy activation following Hsp27 silencing using either pharmacologic inhibitors or atg3 silencing enhanced cell death. Importantly, cotargeting Hsp27 and autophagy by combining OGX-427 with the autophagy inhibitor, chloroquine, significantly delayed PC-3 prostate tumor growth in vivo. These findings identify autophagy as a cytoprotective, stress-induced adaptive pathway, activated following disruption of protein homeostasis and ER stress induced by Hsp27 silencing. Combinatorial cotargeting cytoprotective Hsp27 and autophagy illustrates potential benefits of blocking activation of adaptive pathways to improve treatment outcomes in cancer. Mol Cancer Ther; 11(8); 1661–71. Ó2012 AACR. Introduction factor pathways (5), stress-induced survival genes (6), Many strategies used to kill cancer cells induce stress and cytoprotective chaperone networks (7). Molecular responses that promote the emergence of a treatment- chaperones such as Hsps help cells cope with stress- resistant phenotype. In prostate cancer, androgen ablation induced misfolded proteins and play prominent roles in induces remission in most patients but also progression cellular signaling and transcriptional regulatory net- to castration-resistant prostate cancer (CRPC; ref. 1). works. In particular, Hsp27 is a stress-activated chap- Although docetaxel chemotherapy (2) and, more recently, erone highly expressed in CRPC and other cancers that AR pathway inhibitors such as abiraterone (3) and MDV- inhibits treatment-induced apoptosis (8–10). Hsp27 is 3100 prolong survival by several months, treatment induced by anti-AR and chemotherapy, inhibiting apo- resistance frequently emerges, highlighting the need for ptosis by regulating components of both stress- and additional therapies targeting the molecular basis of receptor-induced apoptotic pathways (11–14). We pre- CRPC and treatment resistance. viously reported that Hsp27 silencing induces apoptosis Development of CRPC is attributed to reactivation of and enhances anticancer drug sensitivity in prostate the androgen receptor (AR) axis (4), alternative growth and bladder cancer cells (7, 15, 16). The Hsp27 inhibitor, OGX-427, delays progression and enhances activity of chemotherapy in CRPC and other cancers (7, 15, 16), Authors' Affiliations: 1The Vancouver Prostate Centre and Department of Urological Sciences, University of British Columbia, Vancouver, British and is currently in multicenter phase II studies of CRPC Columbia, Canada; and 2Division of Urology, Kobe University Graduate and metastatic bladder cancer (ClinicalTrials.gov iden- School of Medicine, Kobe, Japan tifier, NCT01454089 and NCT01120470). Note: Supplementary data for this article are available at Molecular Cancer Hsps are particularly important in regulating mis- Therapeutics Online (http://mct.aacrjournals.org/). folded protein and endoplasmic reticular (ER) stress M. Kumano and J. Furukawa contributed equally to this work. responses, an emerging area of interest in cancer progres- sion and treatment resistance (17). In cancer, ER stress Corresponding Author: Martin E. Gleave, Department of Urologic Sciences, University of British Columbia, 2775 Laurel Street, Level 6, and misfolded protein levels are elevated because of Vancouver, British Columbia, Canada V6H 3Z6. Phone: 604-875-4818; mutated genes and stressed microenvironments (18); Fax: 604-875-5654; E-mail: [email protected] moreover, many anticancer agents induce ER stress doi: 10.1158/1535-7163.MCT-12-0072 (19). ER stress activates a complex intracellular signaling Ó2012 American Association for Cancer Research. pathway, called the unfolded protein response (UPR), www.aacrjournals.org 1661 Downloaded from mct.aacrjournals.org on September 24, 2021. © 2012 American Association for Cancer Research. Published OnlineFirst June 6, 2012; DOI: 10.1158/1535-7163.MCT-12-0072 Kumano et al. tailored to reestablish protein homeostasis (proteostasis) cleotide (ASO), OGX-427 was kindly provided by Onco- by inhibiting protein translation and promoting ER- Genex Pharmaceuticals. The sequence of OGX-427 corre- associated protein degradation (ERAD) by stimulating sponds to the human Hsp27 translation initiation site (50- the ubiquitin–proteasome system (UPS) and autophagy GGGACGCGGCGCTCGGTCAT-30). A scrambled (ScrB) to reduce levels of misfolded proteins (20). Autophagy control oligonucleotide was generously provided by ISIS is an evolutionarily conserved bulk degradation system Pharmaceuticals. The sequence of Hsp27 siRNA corre- that facilitates clearance of stress-induced misfolded or sponds to the human Hsp27 site (50-GUCUCAUCG- aggregated proteins, as well as organelles (21). Classi- GAUUUUGCAGC-30; Dharmacon). The sequence of Atg3 cally, autophagy is activated in starvation or oxidative siRNA corresponds to the human Atg3 site (50-GGAAU- stress and generally considered an adaptive survival CAAAGUUUAAGGAAACAGGU-30; Invitrogen Life mechanism (22); however, when ER stress and unfolded Technologies). A scrambled siRNA (50-CAGCGCUGA- protein burden overwhelms the degradation capacity CAACAGUUUCAU-30; Dharmacon) was used as a con- of the proteasome or autophagy, then cell death can trol for RNA interference experiments. occur. Although many studies link UPS inhibition and ER Western blotting analysis stress to autophagy induction (23–26), whether treat- Total proteins were extracted using radioimmunopre- ment-induced autophagy is cytoprotective to facilitate cipitation assay buffer (50 mmol/L Tris, pH 7.2, 1% development of acquired treatment resistance, or alterna- NP-40, 0.1% deoxycholate, 0.1% SDS, 100 mmol/L tively mediates treatment-induced cell death, remain NaCl, Roche complete protease inhibitor cocktail) and controversial. Because Hsp27 has been identified as a submitted to Western blot as we described previously cytoprotective chaperone linked to treatment resistance (27). and cell survival (7, 11, 27, 28) as well as ER stress and UPS activity (12, 29), we set out to explore its role in treatment- Proteasome activity induced ER stress and protein homeostasis in prostate Peptidase activity of the proteasome was measured by cancer. mixing tissue homogenate with 20 mmol/L fluorogenic peptide Suc-LLVT-AMC (succinyl-Leu-Leu-Val-Tyr-7- amino-4-methylcoumarin; Calbiochem) as we previously Materials and Methods described (30). Prostate cancer cell lines and reagents LNCaP and C4-2 cells were kindly provided by Dr. Analysis of Xbp-1 splicing Leland W. K. Chung (Cedar Sinai, Los Angeles, CA) tested Total RNA was isolated using TRIzol reagent according and authenticated by whole-genome and whole-tran- to the manufacturer instructions (Life, Technology). scriptome sequencing on Illumina Genome Analyzer IIx cDNA was synthesized from 2 mg of RNA using the platform in July 2009. PC-3 cells were purchased from the Superscript II First–Strand Synthesis Kit (Invitrogen) and American Type Culture Collection (2008, ATCC authen- amplified with a pair of primers corresponding to nucleo- tication by isoenzymes analysis). LNCaP and C4-2 cells tides 285–308 (forward; 50- AAACAGAGTAGCAGCTC- were maintained in RPMI-1640 media (Invitrogen Life AGACTGC-30) and -735–758 (reverse; 50-TCCTTCTG- Technologies) containing 5% heat-inactivated FBS (Invi- GGTAGACCTCTGGGAG-30) of XBP-1 cDNA. b-Actin trogen Life Technologies). PC-3 cells were maintained in (forward: GGACTTCGAGCAAGAGATGG; reverse: AG- Dulbecco’s Modified Eagle’s Medium (DMEM; Invitro- CACTGTGTTGGCGGTACAG) was used as endogenous gen Life Technologies) containing 5% FBS. PC-3 cells control. PCR products were analyzed on 2.5% agarose stably transfected with Hsp27 (PC-3Hsp27) and empty gel. vector–transfected PC-3 cells (PC-3Empty) were generated as previously reported (13). MG132 was purchased In vitro cell growth assay from Calbiochem. Chloroquine, bafilomycin, and 3- Cells were plated in 12-well plate, allowed to attach for methyladenine (3-MA) were purchased from Sigma- 24 hours, and treated with indicated concentrations of Aldrich. Antibodies anti-GRP78, anti-CREB2 (ATF4), siRNA for 1 day or ASO for 2 days. Cell growth was then anti-GADD153 (CHOP), and anti-ubiquitin from Santa assessed using crystal violet assay as described previously Cruz Biotechnology; anti–phospho-eIF2a from Invitrogen (31). Absorbance was determined with a microculture Life Technologies;