Functional Genomics of Rhipicephalus Bursa – Babesia Ovis Interactions Towards Disease Control

Fábio David Ferreira Rodrigues Licenciado em Biologia Celular e Molecular

Functional genomics of Rhipicephalus bursa – Babesia ovis interactions towards disease control

Dissertação para obtenção do Grau de Mestre em Genética Molecular e Biomedicina

Orientador: Ana Isabel Amaro Gonçalves Domingos, Investigadora Doutora, IHMT-UNL Co-orientador: Sandra Isabel da Conceição Antunes, Investigadora Pós-Doc, IHMT-UNL

Júri:

Presidente: Doutora Ilda Maria Barros dos Santos Gomes Sanches Arguente: Doutor Jacinto José Carneiro Gomes Vogal: Doutora Sandra Isabel da Conceição Antunes

Novembro, 2016

Functional genomics of Rhipicephalus bursa – Babesia ovis interactions towards disease control

A Faculdade de Ciências e Tecnologia e a Universidade Nova de Lisboa têm o direito, perpétuo e sem limites geográficos, de arquivar e publicar esta dissertação através de exemplares impressos reproduzidos em papel ou de forma digital, ou por qualquer outro meio conhecido ou que venha a ser inventado, e de a divulgar através de repositórios científicos e de admitir a sua cópia e distribuição com objectivos educacionais ou de investigação, não comerciais, desde que seja dado crédito ao autor e editor.

Acknowlegments

A realização desta tese não teria sido possível sem o apoio e colaboração que, de alguma forma, muitas pessoas manifestaram durante o último ano. Nomear todos os que contribuíram não seria viável, porém, não posso deixar de demonstrar o meu profundo agradecimento para com algumas pessoas que fazem e fizeram parte da minha vida e, portanto, gostaria de aproveitar esta oportunidade para fazê-lo. Às minhas orientadoras, Doutora Sandra Antunes e Investigadora Doutora Ana Domingos, por poder sempre contar com o seu entusiasmo e alegria, bem como com a sua paciência e a sua palavra amiga, de incentivo e tranquilidade, nos momentos em que as coisas corriam menos bem. O apoio e a disponibilidade manifestados contribuíram de uma forma decisiva para que a conclusão deste trabalho tenha sido possível. Agradeço, ainda, pela revisão científica deste manuscrito e pela enorme disponibilidade com que sempre o fizeram. Às minhas colegas e amigas Joana Couto, Joana Ferrolho, Samira d’Almeida, Catarina Rosa e Sara Pardal, por proporcionarem bons momentos, por me terem recebido tão bem no grupo, pelos conselhos e pelos debates, e pela forma como sempre mostrou disponibilidade para ajudar em tarefas no laboratório, o meu sincero obrigado Joana Couto. Aos professores que me acompanharam ao longo deste percurso académico, sendo que alguns deles vão ficar na minha memória pela forma como conseguiam transmitir o seu conhecimento. O meu reconhecimento sincero aos funcionários do Instituto de Higiene e Medicina Tropical e do Instituto Nacional de Investigação Agrária e Veterinária de Santarém, que colaboraram de forma exemplar e com grande disponibilidade, tornando possível este estudo. Aos colegas da Licenciatura em Biologia Celular e Molecular 2011/2014 e do Mestrado em Genética Molecular e Biomedicina 20014/2016, com quem vivi um ambiente de aprendizagem colaborativa e que com alguns dos quais partilhei momentos inesquecíveis e fiz boas amizades. Aos meus amigos, alguns deles ouvintes de algumas dúvidas, inquietações, desânimos e sucessos, pelo apoio e conforto, dando‐me, desta forma, coragem para ultrapassar os momentos “menos bons” desta jornada. À minha família em geral, uma palavra de agradecimento pela confiança que sempre depositaram em mim, transmitindo-me sempre energias positivas e motivação para alcançar os meus objetivos, sempre com um sorriso. Uma chamada de reconhecimento muito especial para os meus pais, David e Luísa, por me possibilitarem financeiramente este percurso académico e sempre me incentivarem perante os desafios que a vida proporciona, a fazer mais e melhor. Portanto, quero partilhar convosco a alegria de conseguir vencê-los continuamente!

Obrigada por tudo!

Resumo

Estudo funcional de genes envolvidos nas interações Rhipicephalus bursa - Babesia ovis para o controlo da doença.

Fábio David Ferreira Rodrigues

Palavras-chave: Babesia, Carraça, Vacina, RNA de interferência, Lachesina, Vitelogenina.

As carraças são ectoparasitas hematófagos obrigatórios de animais selvagens e domésticos, sendo o Homem um hospedeiro acidental. Enquanto em saúde humana são consideradas o segundo vetor mais importante de doenças, a seguir aos mosquitos, em saúde animal são os principais vetores. Os protozoários do género Babesia, responsáveis pela doença denominada babesiose, são agentes patogénicos que afetam uma ampla variedade de animais, incluindo o Homem. Apesar de a babesiose humana ser uma zoonose emergente, é na área animal que a babesiose se destaca, pois tem um grande impacto na produção animal. Nomeadamente a espécie Babesia ovis, transmitida principalmente por Rhipicephalus bursa, é altamente patogénica, particularmente em ovinos, podendo provocar febre, anemia, aborto, hemoglubinúria e até levar à morte. Atualmente, o principal método de controlo de carraças e agentes a estas associados baseia-se no uso de acaricidas, mas a vacinação é um método alternativo. O desenvolvimento de vacinas inicia-se com a identificação e caracterização de antigénios com papel essencial no desenvolvimento da carraça. Assim, o objetivo do presente estudo foi clarificar a função de genes de carraças diferenciadamente expressos em resposta à alimentação e infeção por B. ovis, visando o desenvolvimento de vacinas anti-carraças. Com base em estudos prévios foram identificados genes potencialmente envolvidos no processo de alimentação e infeção. Quatro destes foram selecionados para caracterização funcional utilizando a metodologia de RNA de interferência. A redução dos níveis de mRNA alvo nas carraças mostrou que a lachesina poderá estar envolvida no processo de infeção, uma vez que reduziu significativamente os níveis de infeção de B. ovis. Além disso, foi observado um efeito na fixação da carraça ao hospedeiro e aumento da mortalidade. O silenciamento de vitelogenina-3 e do gene codificante para uma proteína de cimento demonstrou que ambos poderão estar associados ao processo de alimentação. Vários estudos têm caracterizado a interface carraça-patogénio a nível molecular. Porém, este é o primeiro estudo de genómica funcional em R. bursa em resposta à infeção por B. ovis. Os resultados obtidos permitem avaliar o interesse destes genes como potenciais candidatos a vacinas.

Abstract

Functional genomics of Rhipicephalus bursa - Babesia ovis towards disease control.

Fábio David Ferreira Rodrigues

Keywords: Babesia, Tick, Vaccine, RNA interference, Lachesin, Vitellogenin.

Ticks are obligate hematophagous ectoparasites of wild and domestic animals, whereas is Man an accidental host. While in human health are considered the second most important vector of diseases, after mosquitoes, in animal health are the main vectors. Protozoans of the genus Babesia, responsible for the disease called babesiosis, are pathogens that affect a wide variety of animals, including Man. Although human babesiosis is an emerging zoonosis, this disease has its greatest impact on animal production. Namely Babesia ovis, mainly transmitted by Rhipicephalus bursa, is highly pathogenic, particularly in sheep, and can cause fever, anemia, abortion, hemoglobinuria and even lead to death. Currently, the principal TTBD control method is based on the use of acaricides, nevertheless vaccination is an alternative method. Vaccine development begins with the identification and characterization of antigens that have an essential role in tick development. Therefore, the goal of this study was to clarify the function of genes differentially expressed in response to blood-feeding and infection by B. ovis, aiming the development of anti-tick vaccines. Based on previous studies, genes potentially involved in tick feeding and infection processes were identified. Four of these were selected for functional characterization using the RNA interference methodology. Reduction of target mRNA levels showed that lachesin may be involved in the infection process, since it significantly reduced the infection levels of B. ovis. Furthermore, it was observed an effect on tick attachment to the host and increased mortality. Silencing of vitellogenin-3 and the gene coding for a cement protein demonstrated that both may be associated to tick feeding. Several studies have characterized the tick- pathogen interface at the molecular level. However, this is the first functional genomics study in R. bursa in response to infection by B. ovis. The results obtained allow assessing the interest of these genes as potential vaccine candidates.

Abbreviations

μL Microliter

μM Micro molar

ºC Degree Celsius

64TRP 64 tick recombinant protein

AGE Agarose Gel Electrophoresis

AN Avogadro’s number

ATP Adenosine triphosphate

Ave Average bp Base pair cDNA Complementary DNA

Cq Quantification cycle

CRT Calreticulin

DDT Dichlorodiphenyltrichloroethane

DNA Deoxyribonucleic acid dsRNA Double-stranded ribonucleic acid

EDTA Ethylene diamine tetra acetic acid e.g. exempli gratia

ELF Elongation factor

ELI Expression library immunization

ELISA Enzyme-linked immunosorbent assay

EST Expressed sequence tag g gram g G-force gDNA Genomic DNA

GRP Glycine-rich protein

ICT Immunochromatographic test

IFAT Immunoflorescence antibody test kDa Kilo Dalton

Kg Kilo gram

viii

Lac Lachesin

Mg Milligram min Minute ml Millilitre mm Millimetre mM Millimolar mRNA Messenger RNA

Mw Molecular weight nl Nanolitre

LAMP Loop-Mediated Isothermal PCR

OTEs Off-target effects

OVs Ovaries

PBS Phosphate buffered saline

PCR Polymorphism chain reaction qPCR Quantitative PCR rCRT Recombinant calreticulin rDNA Ribosomal DNA

RISC RNA-induced silencing complex

RLB Reverse line blot

RNA Ribonucleic acid

RNAi RNA interference

RNA-Seq RNA sequencing

RT-PCR Reverse transcriptase polymerase chain reaction

RTT Replication-Transcription-Translation s Second

S.D. Standard deviation

SGs Salivary glands siRNAs Small interfering RNAs

SNPs Single nucleotide polymorphisms

spp. Species (Plural) s.s. sensu stricto

SSH Suppression-Subtractive Hybridization

TBD Tick borne diseases

TBE Tris/Borate/EDTA

TBEV Tick-borne encephalitis virus

TNF-α Tumor necrosis factor α

Tris-HCl Tris hydrochloride

TROSPA Tick receptor for outer surface protein A

TTBD Tick and tick borne diseases

UV Ultraviolet

V Volt

Vg Vitellogenin

VgR Vitellogenin receptor

Vn Vitellin w/v Weight per volume

Table of Contents

ACKNOWLEGMENTS ...... I RESUMO ...... III ABSTRACT ...... V ABBREVIATIONS ...... VII TABLE OF CONTENTS ...... XI INDEX OF FIGURES...... XIV INDEX OF TABLES ...... XVII INTRODUCTION ...... 1

OVINE BABESIOSIS ...... 2 1.1.1 BACKGROUND ...... 2 1.1.2 HISTORICAL OVERVIEW ...... 3 1.1.3 HOSTS ...... 3 1.1.4 VECTORS ...... 3 1.1.5 BABESIA SPP. LIFE CYCLE ...... 4 1.1.5.1 Babesia spp. development in the vertebrate host ...... 5 1.1.5.2 Babesia spp. development in the vector ...... 5 1.1.6 PATHOGENESIS AND CLINICAL SIGNS ...... 6 1.1.7 DIAGNOSIS ...... 7 1.1.8 BABESIOSIS TREATMENT ...... 8 1.1.9 ZOONOTIC RISK ...... 9 TICK VECTOR ...... 10 1.2.1 CLASSIFICATION ...... 10 1.2.2 LIFE CYCLE...... 11 1.2.3 TICK-HOST INTERACTIONS...... 11 1.2.4 TICK ANATOMY AND PHYSIOLOGY ...... 12 TICK CONTROL ...... 14 1.3.1 CHEMICAL TICK CONTROL – ACARICIDES ...... 14 1.3.2 ALTERNATIVE METHODS IN TICK CONTROL - VACCINES ...... 15 1.3.3 IMMUNOLOGICAL TICK CONTROL ...... 15 TICK AND TICK-BORNE DISEASES CONTROL ...... 16 1.4.1 TICK ANTIGENS ...... 16 1.4.2 FUNCTIONAL GENOMICS IN TICKS ...... 18 AIMS OF THIS MASTER PROJECT...... 19 2 MATERIALS AND METHODS ...... 20

LAMB INFECTION WITH BABESIA OVIS ...... 21 GENOMIC DNA EXTRACTION FROM LAMB BLOOD ...... 21 DETECTION OF BABESIA OVIS IN BLOOD BY PCR...... 21 AGAROSE GEL ELECTROPHORESIS ...... 21 IDENTIFICATION OF DIFFERENTIALLY EXPRESSED GENES IN R. BURSA TICKS IN RESPONSE TO B. OVIS INFECTION...... 22 2.5.1 SELECTION OF GENES ...... 22 IN VIVO GENE SILENCING IN TICKS BY RNA INTERFERENCE ...... 23 2.6.1 DSRNA SYNTHESIS ...... 23 2.6.2 RHIPICEPHALUS BURSA COLONY ...... 24 2.6.3 DSRNA INJECTION IN TICKS...... 24 2.6.4 ANALYSIS OF TICK SURVIVAL AFTER RNAI ...... 25

xii

TICK DISSECTION ...... 25 DNA AND TOTAL RNA EXTRACTION FROM TICK SGS AND OVS ...... 25 GENE KNOCKDOWN ASSESSMENT BY QPCR ...... 26 2.9.1 DETERMINATION OF TICK MRNA LEVELS BY QPCR ...... 26 2.9.2 DETERMINATION OF BABESIA OVIS INFECTION BY QPCR ...... 27 3 RESULTS ...... 28

MONITORIZATION OF LAMB INFECTION ...... 29 SEQUENCE ANALYSIS OF TICK GENES DIFFERENTIALLY EXPRESSED IN RESPONSE TO B. OVIS INFECTION 29 REFERENCE GENES SELECTION ...... 29 EFFICIENCY OF GENE SILENCING IN R. BURSA SGS AND OVS ...... 30 FUNCTIONAL ANALYSIS OF TICK GENES DIFFERENTIALLY EXPRESSED IN RESPONSE TO B. OVIS INFECTION...... 30 3.5.1 ANALYSIS OF TICK PHENOTYPE AFTER RNAI...... 30 3.5.2 ANALYSIS OF BABESIA OVIS INFECTION LEVELS AFTER RNAI ...... 31 4 DISCUSSION AND CONCLUSIONS ...... 33 5 REFERENCES ...... 39 6 APPENDIX ...... 61

APPENDIX I ...... 62 APPENDIX II ...... 64

xiii

Index of figures

Figure 1.1: The transmission cycle of Babesia spp. in cattle ...... 5 Figure 1.2: Tick examples...... 11 Figure 1.3: Characteristic Ixodid two-host life cycle...... 12 Figure 1.4: Dissected SGs from Rhipicephalus annulatus...... 13 Figure 1.5: Dissected ovaries from Rhipicephalus annulatus...... 13 Figure 2.1: Injection of Rhipicephalus bursa female tick in the trochanter articulation...... 25 Figure 3.1: Detection of B. ovis in the lamb blood by AGE of PCR products...... 29 Figure 3.2: Analysis of vitellogenin orthologue sequences...... 29 Figure 3.3: Silenced and control female ticks recovered after feeding in B. ovis infected lamb...... 31 Figure 6.1: Detection of B. ovis in the tick salivary glands by AGE of qPCR products in silenced groups st1 and mt5 ...... 64 Figure 6.2: Detection of B. ovis in the tick salivary glands by AGE of qPCR products in the group Control and in the silenced groups cf2 and cf1+cf2...... 64 Figure 6.3: Detection of B. ovis in the tick salivary glands by AGE of qPCR products in the group Control...... 65 Figure 6.4: Detection of B. ovis in the tick salivary glands by AGE of qPCR products in the group Control...... 65 Figure 6.5: Detection of B. ovis in the tick ovaries by AGE of qPCR products in the group Control and in the silenced groups cf1, cf2, st1, mt5 and cf1+cf2...... 66 Figure 6.6: Detection of 16S tick gene in the tick ovaries by AGE of qPCR products in the group Control and in the silenced groups cf1, st1, mt5, cf2 and cf1+cf2...... 66 Figure 6.7: Detection of 16S tick gene in the tick salivary glands by AGE of qPCR products in the group Control and in the silenced groups cf1, st1, cf2 and mt5...... 67 Figure 6.8: Detection of 16S tick gene in the tick salivary glands by AGE of qPCR products in the silenced group cf1+cf2...... 67 Figure 6.9: Detection of cf2 tick gene in the tick ovaries by AGE of qPCR products in the silenced group cf2...... 68 Figure 6.10: Detection of st1, cf1 and β-tubulin tick genes in the tick ovaries by AGE of qPCR products in the silenced groups st1, cf1 and cf1+cf2...... 68 Figure 6.11: Detection of st1, cf1 and β-tubulin tick genes in the tick ovaries by AGE of qPCR products in the silenced groups st1, cf1 and cf1+cf2...... 69 Figure 6.12: Detection of mt5 tick gene in the tick salivary glands and ovaries by AGE of qPCR products in the group Control and in the silenced group mt5...... 69 Figure 6.13: Detection of β-actin and cf2 tick genes in the tick ovaries by AGE of qPCR products in the silenced groups st1, cf1 and cf1+cf2...... 70 Figure 6.14: Detection of β-actin, β-tubulin, st1 and cf1 tick genes in the tick ovaries by AGE of qPCR products in the group Control and in the silenced groups mt5 and cf2...... 70

xvi

Index of tables

Table 2.1: Number of molecules per µL of each dsRNA used to knockdown R. bursa genes in the present study...... 24 Table 2.2: Sequences of primers used for dsRNA synthesis and amplification conditions...... 26 Table 2.3: Sequences of primers used for qPCR...... 27 Table 3.1: Female tick weight after gene knockdown by RNA interference in Rhipicephalus bursa ticks...... 31 Table 3.2: Babesia ovis infection levels after gene knockdown by RNA interference in Rhipicephalus bursa ticks SGs...... 32 Table 6.1: Sequence identity between different available vitellogenin nucleotide sequences and the obtained vitellogenin sequences...... 62 Table 6.2: Sequence identity between different available genes encoding for secreted glycine-rich cement proteins nucleotide sequences and the obtained sequence...... 63 Table 6.3: Sequence identity between different available lachesin nucleotide sequences and the obtained lachesin sequence...... 63

xviii

Introduction

Ovine babesiosis

1.1.1 Background

Tick-borne protozoan parasites of the phylum Apicomplexa such as Babesia spp. are important pathogenic agents with a major impact in animal health leading to substantial financial losses especially regarding livestock (Domingos et al., 2013; Guerrero et al., 2012a; Erster et al., 2015b). In addition, some of these organisms can infect humans increasing the risks posed by ticks and tick-borne diseases (TTBD). The first documented case of human babesiosis occurred in 1956 near Zagreb, Croatia, when a splenectomized farmer was diagnosed with a B. divergens infection (Skrabalo & Deanovic, 1957) ever since, babesiosis came into view as a potentially life threatening zoonotic infection in humans (Herwaldt et al., 2003; Homer et al., 2000; Hunfeld et al., 2008). Notably, Babesia spp. can infect three host groups: domestic animals, humans and, most recently acknowledged, some wildlife species make of this pathogen one of the most important protozoan transmitted by ticks (Schnittger et al., 2012). B. ovis is responsible for ovine babesiosis which as the name suggests is mainly associated with small ruminants. This protozoan species represents the principal ethiological agent of the disease, although other species like B. motasi, B. crassa, B. taylori, B. foliata, among others have been described (Guan et al., 2008; Erster et al., 2015a; Ranjbar-Bahadori et al., 2012). Ovine babesiosis is widespread in Eastern Asia, Iran, the Mediterranean basin and North Africa (Erster et al., 2015a; Ranjbar-Bahadori et al., 2012; Rjeibi et al., 2014; Sevinc et al., 2013; Uilenberg, 2006), being considered of great economic importance to the livestock industry, due to animal mortality, yield losses and costs of treatment (Sevinc et al., 2015; Ranjbar-Bahadori et al., 2012). The principal vector of B. ovis is the tick species Rhipicephalus bursa, whose distribution ranges from Asia to Africa, across the Mediterranean region (Erster et al., 2015a; Ranjbar-Bahadori et al., 2012). R. bursa is a two-host tick, feeding on a varied range of hosts, comprising hares, dogs and humans, as well as several species of ungulates (Erster et al., 2015; Yeruham et al., 1996). Like other pathogens, B. ovis displays transstadial and transovarial transmission, which means that the infection sustains tick moulting and is successfully passed to progeny (Razmi & Nouroozi, 2010). Outbreaks of ovine babesiosis were described mostly from April to July, corresponding with the seasonality of the adult R. bursa activity (Erster et al., 2015a; Yeruham et al., 2000, 2001).

Introduction

1.1.2 Historical overview

It was at the end of the 19th century that Babes discovered microorganisms in erythrocytes of cattle in Rumania and associated them with bovine hemoglobinuria or red water fever (Babes, 1888). Afterwards, the same author found similar organisms in sheep red blood cells. This seems to have been the first report of the transmission of a protozoan parasite by an arthropod. In 1893, Starcovici named these parasites as Babesia bovis, Babesia ovis and Babesia bigemina (Starcovici, 1893).

1.1.3 Hosts

As other protozoa pathogens, also Babesia spp. needs to interact with two different hosts to complete its life cycle: a vertebrate host and an arthropod, namely a tick. Initially, Babesia spp. was considered to be specific to a given vertebrate host but with the subsequent development of molecular tools, some Babesia species have been shown to have a wider vertebrate host range than thought before. B. bovis and B. bigemina, primarily described as pathogens of cattle in tropical and sub- tropical areas, were both identified by specific serology and PCR in white-tailed deer (Odocoileus virginianus) in northern Mexico (Cantu et al., 2007; Chauvin et al., 2009; Mosqueda et al., 2012). B. divergens represents another parasite of cattle in temperate climates. Yet, it is capable to infect humans with a special impact in immunocompromised individuals (Cantu et al., 2007), primates (chimpanzees and rhesus monkeys) (Garnham & Bray, 1959), ungulates (roe deer, fallow deer, red deer, mouflon and sheep) (Penzhorn, 2006), and rodents (rat) (Ben Musa & Phillips, 1991) as well as reindeer (Zintl et al., 2011), sheep (Malandrin et al., 2009) and gerbils (Lewis & Williams, 1979).

1.1.4 Vectors

The main experimental and biological vector of babesiosis in sheep is the tick Rhipicephalus bursa Canestrini and Fanzago, 1877 (Erster et al., 2015a; Erster et al., 2015b; Ferrolho et al., 2016). R. bursa is a common ectoparasite of sheep and goat, although has also been documented in equines, cattle, dogs, gazelles and hares (Yeruham et al., 2000) and is widespread in the north hemisphere, being particularly frequent in Mediterranean basin and central-western Asia (Erster et al., 2015a; Ferrolho et al., 2016; Rjeibi et al., 2014; Sevinc et al., 2013; Uilenberg, 2006). This tick is also known to act as vector of B. bigemina and B. bovis, the agents of bovine babesiosis, Theileria ovis, T. equi and T. annulata, etiological agents of theileriosis, Anaplasma marginale and A. ovis, agents of anaplasmosis, and Ehrlichia canis, responsible for canine monocytic ehrlichiosis (de la Fuente et al., 2008; Uilenberg, 2006; Dahmani et al., 2016; Ferrolho et al., 2016; Masala et al., 2012). Other diseases have been associated with this tick, for example, Crimean Congo haemorrhagic fever virus (Gargili et al., 2011; Papadopoulos & Koptopoulos, 1980). R. bursa is a two-host tick, though immature stages are commonly found in the same host as adults (Yeruham et al., 1996). As described previously, R. bursa can act as vector of many pathogens,

Introduction but is mostly associated to the transmission of B. ovis. Like in all Babesial infections, once infected with B. ovis, R. bursa ticks remain infected during the course of their life cycle and transmit the parasite to the progeny, resulting in the emergence of infected larvae, nymphs and adults capable of infect susceptible hosts during feeding. Besides this transstadial transmission, Babesia spp. also presents transovarial transmission (Erster et al., 2015a; Razmi & Nouroozi, 2010). Transovarial transmission is considered a Babesia spp. adaptation for long-lasting persistence by the fact that some ticks remain infected and infective for many generations without needing to feed on infected animals again, thus increasing transmission efficiency (Chauvin et al., 2009). Babesia spp. are usually divided into large and small forms such as B. ovis and B. microti, respectively. The large Babesia, also named as Babesia sensu stricto (s.s.), differ from small Babesia by their susceptibility to anti-Babesia drugs (Gray & Pudney, 1999) and by their life cycles, principally the occurrence of transovarial transmission (Hunfeld et al., 2008; Uilenberg, 2006). Using light microscopy, Weber and Friedhoff (1971) showed the development of B. ovis in R. bursa and could characterize the differentiated merozoites in the salivary glands (SGs) of female ticks (Weber & Friedhoff, 1971). Later, a study by Moltmann et al. (1982) using electron microscopy has determined the development of B. ovis in the SGs of R. bursa. R. sanguineus and R. turanicus were reported that they could act as a vector of B. ovis as well (Moltmann et al., 1982; Razmi et al., 2002; Shayan et al., 2007). A study in Iran demonstrates that B. ovis DNA was found not just in R. bursa ticks but also in R. sanguineus and R. turanicus (Shayan et al., 2007). Hyalomma marginatum is also known to act like a vector of B. ovis in cattle (Razmi & Nouroozi, 2010; Razmi et al., 2002; Taylor, 2015).

1.1.5 Babesia spp. life cycle

As referred previously, Babesia spp. life cycle takes place in two hosts, vector and mammalian host, and sexual and asexual reproduction proceeds through three stages, in which gamogony – sexual development with formation and fusion of gametes inside the tick gut, sporogony – asexual reproduction in tick SGs, and merogony – asexual reproduction in the vertebrate host (Mehlhorn & Piekarski, 2002).

Introduction

Figure 1.1: The transmission cycle of Babesia spp. in cattle (adapted from Hajdušek et al., 2013).

1.1.5.1 Babesia spp. development in the vertebrate host

Babesia spp. that belong to sensu stricto groups invade the host by injection of sporozoites with the saliva of the infected tick larvae, nymph or adult (Mehlhorn & Piekarski, 2002). Once in circulation sporozoite penetrate erythrocyte’s cell membranes with the aid of a specialized apical complex forming a parasitophorous vacuole (Moltmann et al., 1982; Suarez & Noh, 2011; Yokoyama et al., 2006). The parasite is left with the defining piroplasm feature of a single membrane by the gradual disintegration of the vacuole membrane, contrasting to Plasmodium species that invade by a similar mode but retain the host membrane in addition to its own (Homer et al., 2000). Sporozoite transforms into trophozoite by binary fission, from which two merozoites develop by merogony. These last structures lyse the cell and continue to infect more erythrocytes. Rapid reproduction destroys the host cell and results in hemoglobinuria in the host. Different divisional stages can be observed in the bloodstream at the same time due to the asynchronous multiplication of the parasite (Chauvin et al., 2009). Some trophozoites develop into a diploid ovoid type of merozoite, named gamont precursor, which do not develop further until they are taken up by the tick in the blood meal later on, when in the tick gut, even before to leaving the erythrocytes, these precursors develop into gametocytes (Chauvin et al., 2009; Hildebrandt et al., 2013; Homer et al., 2000; Hunfeld et al., 2008; Mackenstedt et al., 1995).

1.1.5.2 Babesia spp. development in the vector

Once in the arthropod vector, most of the parasites degenerate and are destroyed when Babesia-infected erythrocytes are ingested by ticks. Nevertheless, in the passage from host blood to the midgut of the tick there are environmental changes that stimulate the development of “pre- gametocytes” into elongated bodies, with arrowhead-shaped ray appearance, believed to be gamonts, the ray bodies (“strahlenkorper”) (Chauvin et al., 2009; Hildebrandt et al., 2013; Mackenstedt et al.,

Introduction

1995; Schnittger et al., 2012). The ray bodies go through further multiplication inside the infected erythrocyte, leading to the formation of large aggregations of multinucleated ray bodies. Once gametogenesis is accomplished and after digestion of the consumed erythrocyte, single-nucleated and haploid gametes emerge from the aggregates (Mackenstedt et al., 1995). The elongated zygote is formed by the fusion of gametes in the lumen of tick’s digestive tract. When the zygote reaches the midgut cell membrane invaginates at the point of contact, apparently due to the action of enzymes released by the invading parasite and no parasitophorous membrane is formed (Chauvin et al., 2009). At some moment, the zygote undergoes one-step meiosis to form a haploid zygote (Mackenstedt et al., 1995) and motile kinetes are formed (primary schizogony). These organisms escape the midgut epithelium into the haemolymph and infect a variety of cell types and tissues, including ovaries (OVs) where successive cycles of secondary schizogony occur (Chauvin et al., 2009; Homer et al., 2000; Mackenstedt et al., 1995). Hence, transovarial transmission succeeds with further development taking place in tick larvae. Sporogony occurs at each tick stage and the Babesia spp. infection acquired during one life stage is passed on to the next (transtadial transmission). Kinetes are transformed into multinucleated stages in the SGs and break up to form sporozoites (Mackenstedt et al., 1995). A recent study showed an inefficient transmission of the parasite by immature tick stages that indicates that the transmission of B. ovis by R. bursa occurs mainly by the adult stage (Erster et al., 2015a), which is in agreement with previous reports on the seasonality of ovine babesiosis, describing that the outbreak of the disease corresponds to the emergence of adult R. bursa (Erster et al., 2015a; Yeruham et al., 1998a).

1.1.6 Pathogenesis and clinical signs

After Babesia spp. transmission to the vertebrate host, the pathogenesis of babesiosis consists of an incubation period of between 1 week and 6 weeks followed sequentially by acute, subclinical, and in some cases chronic phases (Conrad et al., 1991; Figueroa et al., 1992; Homer et al., 2000). A few studies suggest that the pathogenesis is possibly related to an excessive immunological reaction of the vertebrate host to the Babesia agent (Hemmer et al., 2000; Hunfeld et al., 2008; Telford III & Maguire, 2006). Studies in a mouse model of B. microti infection demonstrated that T-cell receptor-deficient mice are easily infected in comparing with B-cell receptor-deficient mice (Hunfeld et al., 2008; Telford III & Maguire, 2006). Immunological studies on mice also reveal an important role of CD4+ T cells in controlling parasitemia (Hemmer et al., 2000; Hunfeld et al., 2008). These data are in agreement with the known difficulties of depressed cellular immunity individuals to control persistent parasitemia (Telford III & Maguire, 2006; Haselbarth et al., 2007; Hunfeld et al., 2008; Hildebrandt et al., 2008). In the same way, reduction of host macrophages and natural killer cells increases susceptibility to infection (Hunfeld et al., 2008). A devastating production of pro- inflammatory cytokines such as TNF-α and interferon-Ƴ in animal studies with B. duncani propose that the pathobiology principally results from the host response and not from the parasite itself. In

Introduction human cases, symptoms occur at parasitemias of less than 1% and experiments on several Babesia spp. suggest that an excessive host immune response is an important pathogenetic cofactor for severe babesiosis (Hunfeld et al., 2008; Gray & Weiss, 2008). The acute phase generally runs a course of one week, in which mild and non-specific signs are described, such as fever, loss of appetite, tachycardia, dyspnea, icterus, hemoglobinuria and hemolytic anemia, with lymphadenopathy, splenomegaly and hemorrhagic tendencies in worst cases, which eventually might lead to death (Conrad et al., 1991; Yeruham et al., 1998a; Yeruham et al., 1998b). Mortality rates in susceptible hosts range from 30% to 50% after field infections with B. ovis (Aktas et al., 2005; Hashemi-Fesharki, 1997). Whereas B. ovis infections of young animals are not usually followed by clinical signs, primary exposure of adult sheep and goats to this parasite may lead to clinical symptoms of the disease (Yeruham et al., 1998b; Carletti et al., 2015; Suarez & Noh, 2011). The pathogenicity of B. ovis strains are directly related to erythrocyte destruction. In the case of strains of B. bovis, the ethiological agent of bovine babesiosis, hemolysis involves the release of many pharmacologically active agents like proteolytic enzymes, which affect microcirculation by vasodilatation and increased permeability, leading to hypotension and edema, and affect blood viscosity, coagulation and cytoadherence, resulting in ischemia. Central nervous system complications due to adhesion of parasitized erythrocytes in brain capillaries can occur with B. bovis infections (Mosqueda et al., 2012; Seifert, 1996). Afterwards, babesial infections may continue after spontaneous clinical recovery or ineffective treatment, and such animals may enter the subclinical phase of babesiosis with no clinical signs. Consequently, clinically healthy sheep in the subclinical phase of babesiosis are carriers of the parasite for years without developing clinical disease, during which time tick vectors could still acquire and spread the pathogen to other hosts (Buling et al., 2007; Conrad et al., 1991; Homer et al., 2000). For an unknown reason, certain animals will progress to the chronic phase of babesiosis, which can be absent of clinical signs for years due to complete cure or more often associated with the persistence of small numbers of parasites, being consequently considered natural reservoirs of Babesia spp. (Homer et al., 2000). Chronically infected animals maintain elevated antibody titers, and some can develop signs of other chronic diseases, such as liver disease (Conrad et al., 1991; Homer et al., 2000). Babesiosis is a multisystemic disease and several factors may contribute to its severity, such as pathogenicity of different strains, host age, immunocompetence and co-infections with other pathogenic agents (Homer et al., 2000; Marathe et al., 2005).

1.1.7 Diagnosis

The diagnosis of babesiosis should begin with a descriptive history, which might include clinical manifestations, history of travel to an area where it is endemic, tick bite, or exposure to a tick- infested area, recent blood transfusion and splenectomy (Homer et al., 2000). Clinical cases of babesiosis can be detected by microscopy, immunological assays or using molecular detection methods (Mosqueda et al., 2012). Relatively to the first group, blood smears can

Introduction be dyed by staining with Giemsa or acridine orange. Thin blood films are prepared from capillary blood, since blood of general circulation may contain fewer parasites due to sequestration of infected erythrocytes in capillaries of brain or other organs (Böse et al., 1995). For low levels of parasitemia, diagnosis is carried on by thick smears of infected blood stained with Giemsa (Mosqueda et al., 2012). The advantage of the thick smear consists in a large amount of erythrocytes analyzed in a reduced space. Hence, the probability of finding infected cells is higher than in a thin smear. Such methods are inexpensive and portable, nevertheless, accuracy of diagnosis depend on the skills of the microscopist (Mosqueda et al., 2012). Some immunological tests have been described for Babesia spp. detection, as the indirect immunofluorescence antibody test (IFAT), the enzyme-linked immunosorbent assay (ELISA) and the immunochromatographic test (ICT), being all based on the recognition of parasite antigens by serum antibodies in the blood of the tested animal. ELISA includes the use of recombinant antigens and monoclonal antibodies, increasing specificity and decreasing unspecific binding and signal (Goff et al., 2008; Mosqueda et al., 2012). The ICT is a quick diagnostic device that detects antibodies against a specific antigen in a small amount of serum by means of specific antibody and a recombinant antigen both imbued on a nitrocellulose membrane-based test strip (Weigl et al., 2008). Since it is very easy to perform and read, does not require a trained technician, can be implemented in the field and is inexpensive (Mosqueda et al., 2012). The main disadvantage of the immunological tests consists in the relying on the presence of specific antibodies against parasites and that may take days or weeks to develop in an infected animal (Mosqueda et al., 2012). The molecular diagnosis methods can distinguish active infections by detection and amplification of pathogen DNA (PCR based assays). Since the improvement of the sensitivity of PCR based techniques, many methods for the detection and differentiation of babesiosis infections have been described, among them nested PCR (Figueroa et al., 1993), reverse line blot (RLB) hybridization (Schouls et al., 1999), LAMP (Loop-Mediated Isothermal PCR) (Iseki et al., 2007) and real time PCR (Buling et al., 2007; Criado-Fornelio et al., 2009). Due to factors like costs, contaminations and validation, none of these methods is globally used, in spite of the advantages of these techniques concerning to sensitivity. There are some studies that used PCR to diagnose B. ovis and this technique demonstrates to be specific and sensitive in detecting the pathogen (Aktaş et al., 2005; Shahzad et al., 2013).

1.1.8 Babesiosis treatment

Due to its implications in animal production and in public health, babesiosis control is crucial (Bock et al., 2004). Currently, due to the introduction of exotic breeds, which typically do not display natural immunity against Babesia spp., babesiosis control is even more important (Graf et al., 2004). Disease control can be assured either by tick management, immunization, anti-Babesia drugs administration or by a combination of these approaches (Suarez & Noh, 2011).

Introduction

Chemotherapy is usually effective against ovine babesiosis and several chemical compounds have been reported to be active against Babesia parasites (Vial & Gorenflot, 2006). An early diagnosis and the rapid administration of drugs are factors that contribute to a successful treatment. Present treatments afford protection from disease but normally permit an appropriate level of infection (low level parasitemias) in order to develop immunity which is important in babesiosis endemic areas. Only a few Babesiacides are available commercially, being diminazene aceturate and imidocarb dipropionate the most used: Diminazene aceturate – In Pakistan, chemotherapy against babesiosis was studied (Rashid et al., 2010). Diminazene® was administered to a group of sheep at the dose of 3.5 mg/kg body weight and showed 80% efficacy at day 10 post-medication. These results agree with the study of Baby and his colleagues, who treated simultaneous babesiosis and anaplasmosis in goat with diminazene (Baby et al., 2001). Equivalent results were also found by Cordoves & Polanco (1983), Simitch et al. (1956), Aliu & Odegaard (1985), Mohamed & Yagoub (1990) and Manget (1983), who obtained an acceptable effect of diminazene against babesiosis. Imidocarb dipropianate – used subcutaneously at a dose of 1.2 mg/kg for treatment or at a dose of 3 mg/kg for chemoprophylactic use will prevent babesiosis (Vial & Gorenflot, 2006). Several studies have presented that imidocarb is retained in comestible tissues of ruminants for long periods after treatment (McHardy et al., 1986; Mosqueda et al., 2012; Suarez & Noh, 2011). High doses of this drug completely eliminate parasites, leaving the animals susceptible to reinfection and for this motive reduced drug levels are sometimes designated (Bock et al., 2004; Vial & Gorenflot, 2006), particularly in endemic areas where the development of protective immunity is desired. In other hand, the use of reduced drug doses increases the risk of resistance acquisition against the drug by the extensive use (Rodriguez & Trees, 1996). Rashid et al. (2010) also studied the effect of imidocarb dipropianate in treatment of babesiosis in sheep. Imizol® was administered to a group of sheep at the dose rate of 2 mg/kg body weight. The efficacy was 60% at day 3, 90% at day 7 and 100% at day 10 post- medication. Ramin (2000) and McHardy et al. (1986) have found similar results, by recording 97.28% and 100% imidocarb efficacy.

1.1.9 Zoonotic risk

Although recognized as an animal disease, more attention is being given to babesiosis as a worldwide emerging zoonosis due to the increase of reports of human cases. The rodent parasite B. microti and the cattle parasite B. divergens are the most commonly implicated species in North America and Europe, respectively. Cases reported in splenectomized or otherwise immunocompromised individuals are often fatal (Herwaldt et al., 2003, 2004). The first human case of babesiosis was identified in 1957 near Zagreb, Croatia (Skrabalo & Deanovic, 1957). A young farmer had been grazing cattle on tick-infested pastures and presented with fever, anemia and hemoglobinuria. He was asplenic and died of renal insufficiency during the second

Introduction week of illness. Firstly, described as B. bovis, the agent most likely was B. divergens. In 1968, B. divergens was confirmed as the etiologic agent in a splenectomized person infected while vacationing in the Irish countryside (Fitzpatrick et al., 1968; Vannier et al., 2008). Primarily detected in Europe and North America, human babesiosis is now described worldwide. Over the past 50 years, the epidemiology of the human babesiosis has changed from a few isolated cases to the establishment of endemic areas in southern New England, New York, and the north central Midwest. Human babesiosis due to B. microti has been reported in Connecticut, Massachusetts, Minnesota, New Jersey, New York, Rhode Island, and Wisconsin (Esernio-Jenssen et al., 1987; Meldrum et al., 1992; Spielman, 1988; Spielman et al., 1981; Spielman et al., 1979; Steketee et al., 1985; Western et al., 1970; Spielman et al., 1985; Eskow et al., 1999; Herwaldt et al., 2002; Krause et al., 1991). Moderately severe illness caused by B. duncani occurred in Washington state and California (Conrad et al., 2006; Persing et al., 1995). Cases of B. divergens-like infection have been reported from Missouri (Herwaldt et al., 1996), Kentucky (Beattie et al., 2002), and Washington state (Herwaldt et al., 2004). In Europe, B. divergens, B. microti, and B. EU1, an etiological agent of babesiosis found in ticks from Slovenia (Duh et al., 2005), have been reported to cause babesiosis in humans and are thought to be transmitted by Ixodes ricinus (Herwaldt et al., 2003; Hildebrandt et al., 2007). In Asia, babesiosis has been reported in Japan (B. microti-like) (Wei et al., 2001), Korea (KO1) (Kim et al., 2007), Taiwan (TW1) (Shih et al., 1997), and India (Marathe et al., 2005). Human babesiosis also has been reported in Africa (Bush et al., 1990) and South America (Ríos et al., 2003). The disease manifestations are similar to the other types of babesiosis (Benach & Habicht, 1981; Persing et al., 1995). The cases due to B. divergens infections seen in Europe are usually more severe than those caused by B. microti. Onset of disease symptoms usually occurs within 1 to 3 weeks of the infecting tick bite (Homer et al., 2000; Hunfeld et al., 2008; Leiby, 2006). In splenectomized patients, illness appears suddenly, with hemoglobinuria followed by jaundice due to severe hemolysis. In the most severe cases, patients show renal failure and pulmonary edema (Homer et al., 2000; Vial & Gorenflot, 2006).

Tick vector

1.2.1 Classification

Ticks belong to phylum Arthropoda, subphylum Chelicerata, class Arachnida, subclass Acari, superorder Parasitiformes, order Ixodida and superfamily Ixodoidea. There are three families of ticks, in which Argasidae or soft ticks with 193 species, Ixodidae or hard ticks with 702 species and, with only one species, Nuttalliellidae (Brites-Neto et al., 2015). The most remarkable difference between the two most representative tick families is the presence of a hard sclerotized shield or scutum on the anterior dorsal surface of hard ticks, which is absent in soft ticks. There are other dissimilarities, like the aspect of the outer body wall or integument that is rough on soft ticks while smooth with fine

Introduction grooves in hard ticks, and the position of mouthparts, which are located ventrally in soft ticks and anterior in hard ticks, making them visible from a dorsal view. Nuttalliellidae family is considered the most ancestral lineage of ticks, sharing features characteristic of both Argasidae and Ixodidae (Klompen et al., 2007; Mans et al., 2011). The largest family of ticks can be divided in Prostriata, which is considered as the most basal line and can copulate either on or off the host, aggregating only the Ixodes genus, in contrast with Metastriata that can mate only on the host (Barker & Murrell, 2008).

A B

Figure 1.2: Tick examples. (A) dorsal (left) and ventral (right) view of an Rhipicephalus annulatus female, representative of a hard tick species (original and authorized from Sandra Antunes). (B) dorsal (left) and ventral (right) view of an Ornithodoros savignyi with eggs, representative of a soft tick species (original and authorized from Ard Nijhof).

1.2.2 Life cycle

Ticks go through four stages, specifically egg, larvae, nymph and adult (Oliver, 1989; Sonenshine & Roe, 2014). Hard ticks only have one nymph instar, differing to the several nymphal instars of soft ticks (Oliver, 1989). Ixodid ticks require some days to feed and after the female is engorged falls from the host to lay thousands of eggs and then dies. Argasid ticks may feed for several times and intermittently in their lifetime and lay few hundreds of eggs in batches on different hosts because these parasites don’t remain attached to the hosts. These last have a huge longevity living for many years and may tolerate long periods of starvation (Sonenshine & Roe, 2014). Relatively to Ixodid ticks, larval, nymphal and adult feeding normally requires 3-7, 4-8 and 7-9 days, respectively. Through this time, occurs the growth of gut and cuticle in order to accommodate the blood meal, mostly acquired in the last 24 hours of engorgement. Male hard ticks feed intermittently, since small quantities of blood are enough to mature reproductive organs. As soon as genus Ixodes male ticks moult from the nymphal stage, they have already active reproductive organs and do not need to feed. Resulting of many factors of nature such as photoperiods, temperature, humidity and availability of appropriate hosts, the length of life cycles is variable. In colder regions, ticks can take until three years to complete their life cycle, being one generation a year the usual pattern for most ticks in warmer regions (Oliver, 1989; Sonenshine & Roe, 2014).

1.2.3 Tick-host interactions

Ixodid ticks can be three-, two-, or one-host arthropods. Regarding the two-host ticks, larvae attach to the host and when full of blood they hatch and nymphs reattach feeding again until repletion. Nymphs drop from the host and, after some days, adults hatch and search for a new host to complete the life cycle. Under certain conditions, ticks can use one or two hosts or use two instead of three (Oliver, 1989), demonstrating some flexibility in feeding behavior. There are ticks that accept an

Introduction extensive variety of host species, other might be more selective and other attach to only one host species.

Figure 1.3: Characteristic Ixodid two-host life cycle. (Adapted from: http://www.cdc.gov/ accessed in 20 July 2016).

1.2.4 Tick anatomy and physiology

Ticks body is externally divided in two main parts: the anterior capitulum or gnathosoma containing the head and mouthparts and the posterior idiosoma that contains the legs, digestive tract and reproductive organs. Whole tick body is covered by cuticle that works as an exoskeleton, like in other arthropods. The exterior part of cuticle, termed procuticle, is sclerotized in certain parts and forms sclerites. The biggest sclerite, scutum, covers the anterior part of the body and protects the dorsal side of it. Cuticle major components are proteins and chitin, whereas lipids represent a minor part (Sonenshine & Roe, 2014). Within ticks body there are different organs surrounded by hemolymph, including the midgut, SGs and the ovary, which are organs that can be easily detected upon dissection of engorged female ticks. The midgut is the most notable organ in the tick body and is divided into an anterior and a post-ventricular region, lined by a simple pseudo-statified epithelium composed of cells with diverse classifications and functions (Coons & Alberti, 1999). Throughout feeding, almost all body cavity of the tick is occupied by it and his branches are for storage. Unlike in insects, the digestion in ticks is an intracellular process, except the intraluminal digestion of erythrocytes (Coons & Alberti, 1999; Sonenshine & Roe, 2014). At a structural level, midgut’s cells of Ixodidae ticks are complex by having different organelles and many cytoplasmic inclusions and that reflects the multifunctional activity of the midgut (Caperucci et al., 2010). SGs accomplish a range of complex functions that are essential to tick survival as well as for

Introduction the development and transmission of tick-borne pathogens, designed transstadial transmission (Sonenshine & Roe, 2014). The pair of SGs is located in the lateral regions of the body cavity in both Argasid and Ixodid ticks, and was described as grape-like (alveolar structures) clusters composed of the granular and agranular acini. The saliva is drained by a system of small secondary ducts to the main duct towards the opening in the mouthpart (Sonenshine & Roe, 2014). Previously to feeding, SGs are crucial in water balance regulation, during attachment and feeding are responsible for cement proteins secretion as well as other molecules transported by saliva (Sonenshine & Roe, 2014). During feeding SGs expand several times and once females fully engorge suffer degeneration and transformation processes that are under hormonal regulation (L’Amoreaux et al., 2003). Female reproductive system consists of a single U-shaped ovary, which is found in the posterior region of the body and is responsible for transovarial transmission in some pathogens. In the unfed females the ovary is thin and small otherwise in fed females it’s a big organ with a tube-like structure of luminal epithelium and developing oocytes connected with an epithelium by a short hollow stalk called funiculus (Sonenshine & Roe, 2014). The sequential life cycle stages of Babesia spp. occur in different sections of ixodid ticks. So, these pathogens have to cross barriers like midgut and salivary gland epithelium, and, in ticks that transmit these parasites transovarially, also need to cross ovary epithelium (Florin-Christensen & Schnittger, 2009).

Figure 1.4: Dissected SGs from Rhipicephalus annulatus. (original and authorized from Sandra Antunes).

Figure 1.5: Dissected ovaries from Rhipicephalus annulatus. (original and authorized from Sandra Antunes).

Introduction

Ticks represents one of the most important groups of arthropod vectors of pathogens worldwide and are considered obligate, bloodsucking, nonpermanent ectoparasitic arthropods that feed on all animals except fish (Schwan, 2011). Although ticks are considered zoophilic, several species can be related to the transmission of agents to humans, making these last accidental hosts (Silva et al., 2006). In order to qualify as a vector, a tick must feed on infectious vertebrates, acquire the pathogen during the blood meal, keep the pathogen through one or more stages of life-cycle and has to be able to transmit the pathogen to other unexposed hosts while feeding again (Estrada-Peña et al., 2013; Jongejan & Uilenberg, 2004).

Tick control

Tick control is fundamental to reduce impact on livestock productivity and also to contract tick-borne diseases occurrence, including control measures predominantly based on the application of acaricides, however, other methods such as vaccination has been applied (Willadsen, 2006).

1.3.1 Chemical tick control – acaricides

Up to now, the use of acaricides has been a main factor of an integrate tick control measures. There are several acaricides that can be used against ticks: pyrethroids as flumethrin and deltamethrin; organochlorines, as dichlorodiphenyltrichloroethane (DDT); organophosphates, as diazinon and coumaphos; carbamates, as carbaril; formamidines, as amitraz; cicloamidines as, clenpirin and macrocyclic lactones (avermectins and milbemycins), among others (George et al., 2004; Latif & Walker, 2004). Owing to limitations like contamination problems, ineffective issues or resistance arising, some acaricides were withdrawn from the market unless others are still accessible. Acaricides can lead to residual effects in milk and meat products, as well as in the environment. Acaricides application strategies are frequently hard to preserve and consequently, tend to be improperly used, being responsible for acaricide-resistant ticks increasing (George et al., 2004; Graf et al., 2004). This resistance is associated with mutations in genes related to drug susceptibility, like detoxificating enzymes, like esterases, glutathione-S-transferases and mono-oxidases, and due to genetic drift (Guerrero et al., 2012a). Combinations of acaricides have been used globally, which products combine active components, in order to exploit a diverse number of mechanisms of action, aiming the reduction of insecticide resistance (Veiga et al., 2012). The public awareness of the damaging effects of pesticides on the environment and increasing concerns about resistance of insecticides, demands the need of discovering new methodologies in tick control. Besides, the introduction in the market of a new acaricide is time-consuming and has a massive economic burden (Graf et al., 2004).

Introduction

1.3.2 Alternative methods in tick control - Vaccines

Ticks have relatively few natural enemies, although the use of predators, parasites and pathogens has been studied aiming tick control (Miranda-Miranda et al., 2011). Tick control strategies could be based on interference with tick bacteria endosymbionts, which are essential to arthropod survival (Ghosh et al., 2007). Other approach is the application of entomopathogenic fungi that have been reported to attack and kill ticks. These organisms have been applied in field trials with moderate success and commercial products have been developed (Samish et al., 2004; Stafford & Allan, 2010). Other measure in controlling the tick vector is the genetic control, in which consists in the release of sterilized ticks into the environment, identical to sterile insect techniques developed for the control of pests. Ticks can be sterilized through hybridization (Hilburn et al., 1991), treatment with chemicals (Hayes & Oliver, 1981) or by RNA interference (RNAi) (de la Fuente et al., 2006b; Merino et al., 2011a).

1.3.3 Immunological tick control

Alternatives to acaricide treatments have been developed and anti-tick vaccines are among the most significant developments. The identification of antigens capable of induce animal protection to ticks is critical and during the decade of 1980´s several midgut protein combinations were tested until an antigen termed Bm86, a membrane-bound glycoprotein in the cell surface, was discovered, which conferred significant protection of cattle against R. microplus infestations (Willadsen et al., 1989). This protein of unknown function in tick biology is localized on the microvilli of the midgut digest cells, and tick ingestion of antigen specific antibodies leads to lysis of these cells, resulting in mortality and a deleterious effect on the reproductive performance of tick (de la Fuente et al., 1998c; Willadsen, 2004). The discovery of this protective antigen was a revolutionary moment in the development of anti-tick vaccines. From this breakthrough, two commercial vaccines containing the Bm86 recombinant protein emerged in the early 1990’s, Gavac in Cuba and TickGARD in Australia (Willadsen, 2004; Ghosh et al., 2007). In spite of the effectiveness of these commercial Bm86-based vaccines for cattle tick infestations control, they show strain-to-strain variation in efficacy being predominantly effective against Rhipicephalus tick species (de la Fuente & Kocan, 2003; Guerrero et al., 2012b; Willadsen, 2006). Since the commercialization of these vaccines no other has become available but research focusing this alternative tick control method has ascended. In the last decade new molecular tools such as next generation sequencing, proteomics or RNA interference (RNAi) have brought to light some potential vaccine candidates allowing a rapid, systematic and comprehensive approach to tick vaccine discovery (de la Fuente & Kocan, 2006c; Domingos et al., 2013). Nevertheless, the availability of these techniques, the identification and characterization of effective antigens remains a noteworthy challenge.

Introduction

This approach is based on recombinant protein as antigens to immunize animals and demonstrate to be a good-looking alternative for the control of tick plagues, since they exhibit several advantages, such as prevention or reduction of pathogens transmission (Almazán et al., 2005; de la Fuente et al., 1998c; de la Fuente et al., 2007a, 2011; Merino et al., 2011b), environmental safety, low cost production (Kiss et al., 2012), avoidance of drug-resistant selection (Parizi et al., 2012) and inclusion of multiple antigens that are able to target many tick species (de la Fuente et al., 2000; de la Fuente & Kocan, 2006c; Parizi et al., 2012; Willadsen, 2008; Willadsen, 2004). A study from Rodriguez-Mallon focused on Rhipicephalus ribosomal proteins (Rodríguez- Mallon et al., 2012) identified a unique immunogenic region of protein P0. This protein seems to be important in the assembly of 60S ribosomal subunit (Rodríguez-Mallon et al., 2012). Silencing effects of tick protective antigens 4D8 and Rs86, homologues of Bm86, were evaluated in R. sanguineus (de la Fuente et al., 2006a). Silencing of 4D8 alone had effect on tick feeding, attachment and oviposition and silencing of Rs86 had an effect on tick weight and oviposition. Silencing of expression of both genes had substantial effect on R. sanguineus survival, attachment, feeding, weight and oviposition (de la Fuente et al., 2006a). The authors of this study suggested the development of multi-antigenic vaccines, in order to prevent infestation from R. sanguineus (de la Fuente et al., 2006a).

Tick and tick-borne diseases control

The aim of anti-arthropod vaccines is not only the control of vector infestations but also the agents harbored by them. The effect of such vaccines could be achieved by a) reducing vector populations and therefore the exposure of hosts to vector-borne pathogens, b) reducing the arthropod vector capacity for pathogen transmission, and, ideally, c) a combination of these factors (Merino et al., 2013). As it is more and more clear that disease transmission can implicate complex interactions between host, vector and disease organism, it is accepted that by disturbing the tick the vaccine will also have impact on the disease (Willadsen, 2004).

1.4.1 Tick antigens

Current molecular techniques are supporting in the identification of potencial tick-protective antigens. Bioinformatic tools and high throughput DNA sequencing technologies development enable undertake of provisional function to expressed sequence tags (ESTs). ESTs are fragments of mRNA sequences of approximately 200-800 base pairs (bp) derived from single sequencing reactions performed on randomly selected cDNA clones and show to be really useful for gene identification and verification of gene predictions, since they represent the expressed portion of a genome and offer a low-cost alternative to full genome sequencing, particularly for eukaryote organisms, whose genomes tend to be larger and less gene-dense than prokaryotes (Parkinson & Blaxter, 2009). The first study that reports the use of ESTs was in 1983 (Putney et al., 1983). An alternative approach for identification of potential vaccine antigens is expression library immunization (ELI), a high-

Introduction throughput technology that uses the immune system to screen the entire genome of a pathogen, in combination with sequence analysis of EST’s, resulting in the expressed genes without prior knowledge of the antigens encoded by the cDNAs (Almazán et al., 2003; Barry et al., 2004; Ghosh et al., 2007). Also, suppression subtractive hybridization (SSH) is a broadly used technique for separating DNA molecules that discriminate two closely related DNA samples of either cDNA or genomic DNA (Diatchenko et al., 1999). Both these methods assure antigen identification without introducing prior criteria to manage the selection of candidate genes and thereby may result in the finding of new and unexpected antigens. Several studies successfully identified antigens related to tick feeding and pathogen infection using SSH technique (Antunes et al., 2012; Heekin et al., 2012, 2013; McNally et al., 2012). A study performed by Antunes et al. (2012) applied this technique to identify R. microplus and R. annulatus genes induced by infection with B. bigemina (e.g. TROSPA, calreticulin, serum amyloid A, subolesin). Posterior studies perfomed in vitro and in vivo supported the inclusion of TROSPA in the development of new anti-TTBD vaccine (Antunes et al., 2014, 2015; Merino et al., 2013). Direct RNA sequencing (RNA-Seq) offers the possibility to obtain both sequence and frequency of RNA molecules that are present at any particular time in a particular cell type, tissue or organ. Briefly, a population of RNA is converted to a library of cDNA fragments with adaptors attached to one or both ends. After this, fragments are sequenced in a high-throughput manner to obtain short sequences, typically 30–400 bp. After sequencing, the resulting reads are either aligned to a reference genome or reference transcripts, or assembled de novo without the genomic sequence to produce a genome-scale transcription map that consists of both the transcriptional structure and/or level of expression for each gene (Wang et al., 2009). Although RNA-Seq is a technology under development, it presents several advantages over existing technologies. First, contrasting with hybridization-based approaches like microarrays, based on the use of probes to simultaneously analyze the expression of thousands of genes in a certain point in time, this method is not limited to detecting transcripts that correspond to existing genomic sequence (Nagalakshmi et al., 2008; Wang et al., 2009). For example, 454-based RNA-Seq has been used to sequence the transcriptome of the Glanville fritillary butterfly (Melitaea cinxia) (Vera et al., 2008). For non-model organisms, whose genomic sequences that are yet to be determined, this technique shows to be particularly attractive. RNA-Seq has very low, if any, background signal because DNA sequences can been unambiguously mapped to unique regions of the genome, unlike microarrays that have high background signal and cannot distinguish two closely related sequences due to cross-hybridization of probes (Nagalakshmi et al., 2008; Wang et al., 2009). This technique can also reveal sequence variations, as single nucleotide polymorphisms (SNPs), in the transcribed regions (Cloonan et al., 2008). The results of RNA-Seq also demonstrate high levels of reproducibility for both technical and biological replicates, as well as high accuracy in quantifying expression levels, as determined using quantitative PCR (qPCR) and spike-in RNA controls of known concentration

Introduction

(Cloonan et al., 2008; Mortazavi et al., 2008). Finally, because there are no cloning steps, RNA-Seq requires less RNA sample. These factors make RNA-Seq useful for studying complex transcriptomes. There are reports that use RNA-Seq in order to get new insights into the sialotranscriptome of A. americanum tick (Karim & Ribeiro, 2015), as well for A. parvum, A. cajennense and A. triste (Garcia et al., 2014), aiming the identification of antigens that might confer anti-tick immunity.

1.4.2 Functional genomics in ticks

RNAi or post transcriptional gene silencing is a conserved and natural process that cells use to turn down or silence specific genes (Fire, 1999; Montgomery et al., 1998). Though RNAi mechanism in ticks has not been fully elucidated, it has been well studied in the nematode Caenorhabditis elegans and the fruit fly Drosophila melanogaster (Hannon, 2002; Mello & Conte, 2004). RNAi begins with the uptake of dsRNA by the cell, followed by its cleavage, which is assessed by an RNAse III called Dicer, producing small interfering RNAs (siRNAs). The siRNAs are then incorporated into RNA- induced silencing complex (RISC), which results in a huge sequence-specific degradation of cytoplasmic mRNAs containing the same sequence as dsRNA trigger, leading to gene silencing (de la Fuente et al., 2007b; Mello & Conte, 2004). This silencing signal may spread among the cells and different tissues, generating a systemic gene silencing in the organism (Whangbo & Hunter, 2008). A study from Kurscheid et al. (Kurscheid et al., 2009) shown that some components of RNAi machinery in other invertebrates are also present in the ticks. The key challenge is to find easy and trustworthy methods for delivering dsRNA. There are three main strategies to delivery dsRNA, being microinjection the most commonly used method for dsRNA delivery to arthropods and insects (Antunes et al., 2012). Ingestion of dsRNA through oral feeding of diet mixed with dsRNA or transgenic plants expressing dsRNA could be performed (Baum et al., 2007). In some cases, dsRNA could be delivered by soak organisms in dsRNA solution (Galay et al., 2016; Whyard et al., 2009) but is mainly used for cell culture work. Prior experiments proposed that dsRNAs could be designed as specific pesticides due to its high specificity (Baum et al., 2007; Whyard et al., 2009). Since the first report of RNAi application in Amblyomma americanum (Aljamali et al., 2002), in which ticks injected with histamine binding protein (HBP) dsRNA presented a decrease in feeding compared to control ticks, several studies have been used RNAi in ticks to evaluate tick gene function in response to pathogen infections, aiming the development of vaccines against tick specific antigens (Antunes et al., 2012; Galay et al., 2013, 2016; Hajdušek et al., 2016; Lu et al., 2016). TROSPA and serum amyloid A knockdowns using RNAi reduced B. bigemina infection in R. annulatus whereas in R. microplus, knockdown of TROSPA, serum amyloid A and calreticulin reduced pathogen infection as well, comparing with controls (Antunes et al., 2012). Recently, knockdown of subolesin, a transcription factor that regulates gene expression (Naranjo et al., 2013), by RNAi decreased the engorgement, attachment, oviposition and body weight in R. microplus ticks (Lu et al., 2016). In other

Introduction recent study using RNAi, silencing of gene encoding for an intracellular ferritin-1, an iron-binding protein, in Haemaphysalis longicornis ticks led to lower weight after feeding when compared with control group, as well as high mortality and low oviposition (Galay et al., 2016). In the past years, RNAi revealed to be a valuable tool to carry gene functional studies in ticks, the characterization of the tick–pathogen interface and the screening and characterization of tick- protective antigens (de la Fuente & Kocan, 2006c; Merino et al., 2013).

Aims of this Master project

Due to its capacity of transmit a wide variety of infectious agents to different vertebrate hosts, ticks represent great medical and veterinary importance (de la Fuente et al., 2008). Particularly, babesiosis continues having a great economic impact in livestock industry due to the lack of effective control methods. Alternatively to acaricides, anti-tick vaccines have been developed to control tick infestations (de la Fuente et al., 1998; Willadsen et al., 1989; Willadsen, 2004). Still, identification and evaluation of new candidate antigens implicate laborious and often expensive work, since it is necessary to define the immunological mechanisms of these antigens and develop appropriate methods for their production, as well as optimization studies on the host immune system response, field trials to test the vaccine and product registration are needed (Willadsen, 2004). Presupposing that improved vaccine formulations and the discovery of new tick-protective antigens related to infection and feeding will improve control of TTBD, as well as increase our understanding on tick-pathogen interface, this Master project was designed with one main objective, that consists in validation of the influence of antigens, which were identified in previous studies as differentially expressed in response to tick feeding and B. ovis infection. Functional analyses using RNA interference was applied in order to assess about the role of specific gene expression disruption in pathogen transmission and tick feeding. Parameters such as tick weight, attachment to the host and mortality were evaluated as well as the B. ovis infection levels in tick´s SGs and OVs. These assays are expectable to contribute for the characterization of the tick-pathogen interface, as well as provide new targets for the development of alternative TTBD control methods, such as vaccination.

2 Materials and Methods

Materials and Methods

Lamb infection with Babesia ovis

A six month old lamb bred and maintained at the INIAV (Instituto Nacional de Investigação Agrária e Veterinária) animal facility was used in the gene silencing assays. To ensure infection establishment, the lamb was splenectomised and, 45 days after, intravenously inoculated with 1 ml of cryopreserved B. ovis culture with 9% parasitemia. The infection in the lamb was monitored daily by collecting and screening blood for B. ovis using the protocol described in the section below. Animal ethics approval was given for this work. The lamb used in the present work was cared for in accordance with standards specified in the Guide for Care and Use of Laboratory Animals.

Genomic DNA extraction from lamb blood

DNA from the lamb blood was extracted using the NZY Blood gDNA Isolation Kit (NZY Tech, Genes and Enzymes) according to the protocol provided by the manufacturer. The DNA samples were maintained at -20ºC. Following DNA extraction, quantity and purity was assessed in a Nanodrop 1000 Spectrophotometer (Thermo Fisher Scientific™) using the elution buffer as a blank.

Detection of Babesia ovis in blood by PCR

To amplify a 549 bp fragment of B. ovis 18S ribosomal DNA (18S rRNA), primers described by Aktaş et al. (2005) were used. Primers were synthetized by StabVida (Lisbon, Portugal) and reconstituted in nuclease free water (Sigma-Aldrich, St. Louis, MO, USA) to a 100 mM stock. PCR were performed in 25 μl reactions with Supreme NZYTaq 2× Green Master Mix (NZYTech, Lisbon, Portugal), 1 μM primers and 5 μl of template DNA. There was also prepared a negative control, without DNA, and a positive control, which contained DNA extracted from “in house” B. ovis (Israel strain) culture. The PCR was carried out with a thermal cycling profile of 95oC for 2 min, and 35 cycles of 95oC for 30 s, 62oC for 45 s and 72oC for 45 s, followed by a 72oC extension for 5 min and a 4oC hold (T-100® Thermal Cycler, Bio-Rad, Hercules, CA, USA). The PCR products were visualized by agarose gel electrophoresis.

Agarose gel electrophoresis

PCR products were visualized by AGE as follows. To prepare 1.2% agarose gel as required, 0.36 g of agarose (Sigma-Aldrich, St. Louis, MO, USA) was added to 30 ml of 0.5X Tris-Borate- EDTA (TBE) buffer (Sigma-Aldrich, St. Louis, MO, USA) and heated in a microwave oven for 1 min, in order to dissolve the agarose powder. 2 µl SYBR® Safe (Thermo Fisher Scientific™) was added. 10 µl of each sample was loaded directly into the wells. 5 µl NZY DNA Ladder I (NZY Tech, Genes and Enzymes) was loaded in the lane M. Gels were run at 90 V for 20 min. The products were visualized using a UV transilluminator.

Materials and Methods

Identification of differentially expressed genes in R. bursa ticks in response to B. ovis infection

This work is a continuation of a research project that started earlier entitled “Functional genomics of Rhipicephalus bursa and Babesia ovis interactions towards disease control” PTDC/CVT-EPI/4339/2012, thus part of the project plan was already concluded, which made ground for the selection of genes to be characterized under this MSc project. The identification of R. bursa genes potentially involved in response to Babesia infection was previously performed by the IHMT´s team based on RNA sequencing results. In summary, R. bursa differentially expressed genes in response to both infection and blood feeding were identified by sequencing RNA from SGs of tick populations’ correspondent to each of the conditions: B. ovis infected and fed females, non-infected and fed females and finally non-infected and unfed females. The annotation of each transcript was done based on the BLAST similarity results comparing the transcript to a database of reference proteins. Two comparisons were made (infected vs non-infected and fed vs non-fed) and, subsequently, two catalogues of genes differentially expressed were obtained. The obtained data was analyzed and the selection of genes to further characterize was made according to their potential role on each of the conditions (feeding and infection) studied and fold change of expression.

2.5.1 Selection of genes

The genes cf1 (Uniprot ID: A0A034WWF8), cf2 (Uniprot ID: L7M018), st1 (Uniprot ID: A0A034WWS7) and mt5 (Uniprot ID: L7M1K6_9ACAR) were selected for functional analysis. The cf1 and cf2 transcripts were found to be upregulated in fed ticks showing a fold change above 15 and belong to cell function class. The cf1 encodes for the vitellogenin-3 protein (Vg-3), a precursor of the major yolk protein vitellin (Vn), both considered heme-binding storage proteins (Horigane et al., 2010). Vg has already been identified in other tick suggesting that their role may be linked to lipid transport and its production is one of the most important events for egg development since, once synthesized by the fat body or less commonly by the midgut (Coons et al., 1982), Vg are secreted in the haemolymph and incorporated into oocytes by a specific Vg receptor on the surface (Boldbaatar et al., 2008, 2010; Horigane et al., 2010; Khalil et al., 2011; Smith & Kaufman, 2013, 2014; Taheri et al., 2014; Mitchell et al., 2007). The cf2 encodes for a putative lachesin which is a cell surface protein that is thought to be involved in the morphogenesis of the tracheal system of Drosophila and in other arthropods, known to be involved in neurogenesis (Karlstrom et al., 1993; Llimargas et al., 2004). Its role in ticks has not yet been described. Regarding the st1 and mt5 transcripts identified on the catalogue of differentially expressed genes in response to infection, both were found to be upregulated in infected ticks with again fold changes above 15. The st1 transcript encodes for a putative glycine-rich secreted cement protein with unknown function belonging to the

Materials and Methods

structural class while the mt5 transcript encodes for a protein that belongs to the metabolism class with unknown function on ticks. Performing functional analysis using RNA interference permits to unravel possible function of these proteins during infection.

in vivo gene silencing in ticks by RNA interference

2.6.1 dsRNA synthesis

Gene-specific double-stranded RNAs (dsRNA) were synthesized based on identified Rhipicephalus spp. sequences prior to the beginning of the present work and used to knockdown the expression of selected genes in R. bursa ticks, since the role of genes carried in this study were not previously described in R. bursa. Briefly, specific primers containing T7 promoter sequences (5´- TAATACGACTCACTATAGGGTACT-3´) at the 5´- end were manually designed and synthesized by StabVida (Lisbon, Portugal) (Table 2.2). R. bursa cDNA was synthetized using the iScript cDNA synthesis (Biorad, CA, USA) following the manufacturer instructions and further used as template to amplify fragments of interest by PCR. Amplification of target DNA was achieved using the iProof High Fidelity PCR kit (Biorad, CA, USA). 50 µl of final volume was used including 200mM each primer. Cycling conditions were for 40 cycles: 30 s at 94 ºC, 30 s at specific annealing temperature and 30 s at 72 ºC with a final extension step of 7 min at 72º C. All PCR assays were performed in a T100 thermal cycler (Biorad, CA, USA). Amplification results were analyzed on a 0.5X TBE, 1.2 % (w/v) agarose gel. Amplicons were purified using the NZYGelpure kit (NZYtech, Lisbon, Portugal) and sent for Sanger sequencing at StabVida (Lisbon, Portugal). The obtained sequences were aligned, compared to reference sequences and sequences deposited in the NCBI nucleotide database (http://blast.ncbi.nlm.nih.gov/Blast). After confirmation of the amplified sequences the MEGAscript RNAi Kit (Ambion, Austin, TX, USA) was used to synthesize dsRNA according to manufacturer’s instructions. The resulting dsRNA was purified, quantified by spectrometry and checked on a 0.5X TBE, 1.2 % (w/v) agarose gel. Table 2.1 shows the determination of the number of molecules per µl of each dsRNA used in silencing experiments.

Materials and Methods

Table 2.1: Number of molecules per µL of each dsRNA used to knockdown R. bursa genes in the present study. Molecules Group Mw (g/mol) [ ] (g/µL) n (moles) per µL Vitellogenin (cf1) 132311,4 1,11E-06 8,38E-12 5,05E+12 Lachesin (cf2) 141611 1,53E-06 1,08E-11 6,51E+12 Metabolism protein (mt5) 140110,2 1,32E-06 9,43E-12 5,68E+12 Glycine-rich secreted cement protein (st1) 132832,2 7,01E-07 5,28E-12 3,18E+12 Double-knockdown (cf1+cf2) 136969,2 8,20E-07 5,99E-12 3,61E+12 The number of molecules per µL of each dsRNA was calculated using the formula nº of molecules= n×AN, in which AN represents Avogadro’s number, AN=6.022×1023. Molecular weight (Mw) was calculated based in the number of each nitrogenous base (adenine, timine, cytosine and guanine) present in the dsRNA sequence, using the following formula Mw=(A*329.2)+(T*306.2)+(C*305.2)+(G*345.2)+159.

2.6.2 Rhipicephalus bursa colony

A laboratory R. bursa colony was established in Centro de Estudos de Vectores e Doenças Infecciosas (CEVDI) from Instituto Nacional de Saúde Dr. Ricardo Jorge. To establish a R. bursa colony, ticks were originally collected from the field in Sétubal, Portugal, region. Briefly, after oviposition, each female and a sample of eggs were tested by PCR for pathogens detection according to Aktas et al (Aktaş et al., 2005), during two generations. R. bursa life cycle was maintained in Hyla white rabbits under the appropriate conditions. The ticks that were used in the present study were at least the 10th generation of the laboratory colony.

2.6.3 dsRNA injection in ticks

R. bursa adult female ticks were detached from a Hyla white rabbit ear, using fine forceps, observed, cleaned and placed ventral side up on double sticky tape affixed to a plane wood table. The ticks were closely positioned together in groups of 10 ticks leaving the body exposed. After, ticks were injected with 69 nl of dsRNA (1×1011 to 1×1012 molecules) in the trochanter articulation. Thirty female ticks per group were injected using the nano-injector (Nanoject, Drummond Scientific, Broomall, PA, USA). Control ticks were injected with buffer (10 mM Tris-HCl, pH 7, 1 mM EDTA) alone (negative control). According to the described above, six groups were formed, cf1, cf2, cf1+cf2, st1, mt5 and control. The group cf1+cf2 corresponds to a double knockdown performed by injection of an equal mixture of both dsRNA. After dsRNA injection, female ticks were held in a humidity chamber for 4 hours after which they were allowed to feed on splenectomized sheep infected with B. ovis together with 30 male ticks per tick feeding cell. Tick-feeding cells (450mmX400mm) (cotton fabric) were glued to shaved skin using Pattex® contact glue (Henkel Nederland, Nieuwegein, The Netherlands) on the day before infestation. Ticks were allowed to feed in the infected lamb and 8 days after attached ticks were removed. Ticks were monitored daily and mortality was evaluated.

Materials and Methods

Figure 2.1: Injection of Rhipicephalus bursa female tick in the trochanter articulation. (original from the author).

2.6.4 Analysis of tick survival after RNAi

Tick survival after feeding was evaluated by determining the number of ticks that survived and tick weight. Tick mortality was evaluated as the ratio of dead ticks to the total number of fed ticks on the lamb. To analyze tick mortality, the Chi-square test (P=0.05) was used with the null hypothesis that tick mortality was not dependent on gene knockdown. The number of attached ticks and the number of ticks that started to feed, in each group, were as well analyzed using the Chi-square test (P=0.05). Tick weight was determined in individual female ticks collected after feeding and further compared between ticks injected with test genes dsRNA and control dsRNA by Student's t-test with unequal variance (P = 0.05). Ticks SGs and OVs were posteriorly dissected and used for DNA and total RNA extraction for further evaluation of silencing efficiency determination and influence on infection acquisition.

Tick dissection

Ticks were twice rinsed individually in distilled water. To carry out tick dissection, each tick was covered with a drop of PBS in a Petri dish, to prevent desiccation of the tissues. All tissues were washed in PBS giving special attention to guts samples from which the luminal contents were carefully removed, and remaining tissue was gently washed from the host blood excess in the same buffer. SGs and OVs were removed and stored in 100 µl of RNA later (Ambion®, Austin, TX, USA) at 4ºC for further total RNA and DNA extraction.

DNA and total RNA extraction from tick SGs and OVs

gDNA and RNA from tick tissues were extracted using a TRI Reagent® Protocol (Sigma- Aldrich, St. Louis, MO, USA). The manufacturer’s protocol was followed. Subsequently to DNA and RNA extraction from OVs and SGs, the concentration as well as

Materials and Methods

the optical density of each sample was measured spectrophotometrically with NanoDrop 1000 Spectrophotometer (Thermo Fisher Scientific™) using water as blank for RNA samples and 8 mM NaOH for DNA samples.

Table 2.2: Sequences of primers used for dsRNA synthesis and amplification conditions. PCR annealing Upstream/downstream primer sequence 5´-3´* Uniprot ID conditions

ACGTGTTCGGCCTATCTCAC L7M1K6_9ACAR (mt5) 64ºC/30s TGGCGATTCAAGTACACCAG

A0A034WWS7_RHIMP CGGTGGATATGGTGCTCTTT 55ºC/30s (st1) GGGAAACCTCCGTATGATCC

CCGCCAAGGTTCTGTTGTAT A0A034WWF8 (cf1) 65ºC/30s GCATCTTCGCTCCTCTGTTC

GCGCTGGTGTCTTTAGGTTC L7M018 (cf2) 65ºC/30s GTGGCATAGCACTCCAAGGT

*All primers contained T7 promoter sequences (5´-TAATACGACTCACTATAGGGTACT-3´) at the 5´end.

Gene knockdown assessment by qPCR

2.9.1 Determination of tick mRNA levels by qPCR

The efficiency of gene specific silencing in different tick tissues was evaluated by qPCR, using the minimum information for publication of qPCR experiments (Bustin et al., 2009). The efficiency of cf1, cf2, st1 and mt5 knockdown was assessed in the SGs and OVs. Several potential reference genes were tested and based on the geNorm algorithm included in the CFX Manager™ Software (Bio-Rad) and on the expression stability value M of each gene (Bustin et al., 2009); the ideal reference genes were then selected to normalize the silenced gene levels in tick SGs and OVs. For each gene used in qPCR, primer sets were designed and can be found in Table 2.3 as well as PCR conditions. RNA extracted from individual tick SGs was used to synthetize cDNA using the iScript™ cDNA Synthesis Kit (Biorad) and the iQ™ SYBR® Green Supermix (Biorad) was used for amplifications. The qPCR was carried out in the CFX96 Touch™ Real-Time PCR Detection System (Bio-Rad). Negative controls were prepared with water. Standard curves were constructed with 5-fold serial dilutions of cDNA from R. bursa. The CFX Manager™ Software was used to analyse the qPCR data. Gene expression was normalized to the total amount of RNA used to generate the cDNA, as previously described (Bustin et al., 2009). The absence of PCR product in control reactions has shown

Materials and Methods

the reaction specificity. A dissociation curve was run at the end of the reaction to ensure that only one amplicon was formed and that the amplicons denatured consistently in the same temperature range for every sample. The mRNA levels in ticks after feeding were compared between dsRNA and saline- injected control ticks by Student's t test (P=0.05).

Table 2.3: Sequences of primers used for qPCR. Upstream/downstream primer sequence PCR annealing Gene 5´-3´ conditions L7M1K6_9ACAR GTGCGCTTCAATGTGTTTGT 56ºC/45s (mt5) AAGAATGGCCTTTGTGTTGG A0A034WWS7_RHI CGGTGGATATGGTGCTCTTT 54.5ºC/45s MP (st1) ACGCCACCAAGTCCTGAGTA AGACCTTCGACAACGTCACC A0A034WWF8 (cf1) 54.5ºC/45s GCATCTTCGCTCCTCTGTTC GCGCTGGTGTCTTTAGGTTC L7M018 (cf2) 62ºC/45s GATCTGGTACGATGGCCTTG GACATCAAGGAGAAGCT(TC)TGC β-actin 62ºC/45s CGTTGCCGATGGTGAT(GC) GACAAGAAGACCCTA 16S rRNA 56ºC/45s ATCCAACATCGAGGT ELF (elongation CGTCTACAAGATTGGTGGCATT 62ºC/45s factor) CTCAGTGGTCAGGTTGGCAG AACATGGTGCCCTTCCCACG β-tubulin 62ºC/45s GCAGCCATCATGTTCTTTGC

2.9.2 Determination of Babesia ovis infection by qPCR

B. ovis DNA levels were evaluated by qPCR normalizing against tick 16S rDNA as described previously for B. bigemina (Antunes et al., 2012). The primers used for quantitative detection of B. ovis were the same used previously for traditional PCR firstly described by Aktas et al (Aktaş et al., 2005). Normalized Cq values were compared between ticks injected with test A and control dsRNA by Student's t-test with unequal variance (P = 0.05).

3 Results

Results

Monitorization of lamb infection

The infection in the lamb was monitored daily by collecting and screening blood for B. ovis. Fig 3.1 shows the evolution of parasitemia from day 0 to day 17. The lamb was considered infected on day 6.

Figure 3.1: Detection of B. ovis in the lamb blood by AGE of PCR products. The protocol followed is described in Aktas et al (2005). Samples were electrophoresed on a 1.2% Agarose/SYBR® Safe gel, 0,5X TBE. The first and last lane corresponds to the ladder (M), the second lane corresponds to the negative control (N) and the 13th lane corresponds to the positive control (P).

Sequence analysis of tick genes differentially expressed in response to B. ovis infection

Additional sequence analysis was conducted on different Rhipicephalus spp. ESTs differentially expressed in response to Babesia spp. infection and tick feeding, since sequences from genes analyzed in this study are not available in databases for R. bursa. R. microplus (UniProt Accession number A0A034WWF8) obtained sequence analysis showed that cf1 which encodes for vitellogenin-3 is a conserved gene in ticks, with 93.61% homology between R. appendiculatus (Figure 3.2, Table 6.1). Regarding cf2 which encodes for a putative lachesin, R. pulchellus (L7LSG7) showed a 94.91% identity to R. appendiculatus (A0A131YVX3) (Table 6.2). Relatively to st1 that encodes for a putative glycine-rich secreted cement protein, R. pulchellus (L7MBM8) showed the highest homology (45.85%) to A. americanum (A0A0C9SFJ8) and I. scapularis (A0A023FLK9) share with A. cajennense (A0A023GE61) 61.60% of identity with the obtained sequence (Table 6.3).

Figure 3.2: Analysis of vitellogenin orthologue sequences. Unrooted phylogram inferred using the Neighbor-Joining method. The tree is drawn to scale, with branch lengths in the same units as those of the evolutionary distances used to infer the phylogenetic tree.

Reference genes selection

In order to normalize gene mRNA and DNA levels in tick SGs and OVs, the best reference genes were selected for each tissue based on the geNorm algorithm included in the CFX Manager™ Software (Bio-Rad) and on the expression stability value M of each gene (Bustin et al., 2009). Relatively to OVs, after test several potential reference genes, β-actin

Results and β-tubulin were chosen and were used in data analysis with a mean M value of 0,5578 and a coefficient of variation (C.V.) of 0,1933. Regarding the SGs, ELF and β-tubulin were used with a mean M value 0,9585 and a C.V. of 0,3325. These values are within the recommended stability values for heterogeneous samples.

Efficiency of gene silencing in R. bursa SGs and OVs

Under the conditions undertaken in this study gene knockdown after dsRNA-mediated RNAi was demonstrated in R. bursa SGs for all genes, except for mt5, whose silencing values were approximately 92%, 51% and 65% for cf1, cf2 and st1, respectively. In the case of the double knockdown performed, only two ticks were recovered, thus, it was not possible to determine gene silencing efficiency. Concerning to OVs the silencing of the four genes was not demonstrated.

Functional analysis of tick genes differentially expressed in response to B. ovis infection

3.5.1 Analysis of tick phenotype after RNAi

The knockdown effect of selected genes on tick weight and mortality was determined and statistically analyzed. Gene silencing assays results showed first that tick mortality was significantly affected in dsRNA-injected ticks, particularly in cf1 and cf2 gene knockdown, when compared to controls (P=0.001), suggesting that Vg-3 and putative lachesin had a role in tick survival. After allowed to feed, it was possible to determine that not all the ticks engorged or even attached to the host: group cf1, 4/7 ticks attached, cf2 8/9 ticks, cf1+cf2 3/5 ticks, from the mt5 group 11/19, st1 group 13/24 ticks and finally from the control group 22 of the 25 ticks recovered were attached. By comparing injected test groups with control group using a Chi-square test (P=0.05) there is evidence that st1 (P=0.008774) knockdown reduced significantly tick attachment. Vitellogenin-3 (cf1) and gene encoding for a putative glycine-rich secreted cement protein (st1) knockdowns resulted in a reduction of female tick weight in R. bursa (Table 3.1). The low number of fed females in cf1 did not allow any statistical analysis but these results are indicative of impact of the silenced gene in the process of feeding. When comparing ticks injected with specific dsRNA to control group using the Student’s t- test (P= 0.05) results demonstrate that st1 knockdown significantly reduced female tick weight (P=0.02). Figure 3.3 shows the recovered ticks after gene silencing assays. Regarding mt5, since gene silencing was not demonstrated, no inferences can be assumed.

Results

Table 3.1: Female tick weight after gene knockdown by RNA interference in Rhipicephalus bursa ticks. R. bursa weight Group Ave ± S.D. (mg) Vitellogenin-3 (cf1) 40 ± 19b Lachesin (cf2) 149 ± 108 Metabolism protein (mt5) 73 ± 72b Glycine-rich secreted cement protein (st1) 52 ± 46 a Double-knockdown (cf1+cf2) 19 ± 1b

Control 136 ± 163 Thirty female ticks per group were injected with double stranded RNA or saline control. Ticks were allowed to feed in six separated patches on a lamb experimentally infected with B. ovis. All attached ticks were removed after 7 days of feeding, weighed and held in a humidity chamber for 4 days to allow ticks to digest the blood meal. Tick mortality was evaluated as the ratio of dead ticks to the total number of placed ticks on the lamb. Female tick weight after feeding was compared between dsRNA and saline-injected control ticks by a Student’s t-test (aP < 0.05; b no statistical study was made).

Figure 3.3: Silenced and control female ticks recovered after feeding in B. ovis infected lamb.

3.5.2 Analysis of Babesia ovis infection levels after RNAi

Knockdown of lachesin significantly reduced B. ovis infection levels by 70% in R. bursa SGs compared with control ticks (Table 3.2). The vitellogenin-3, gene encoding for a metabolism protein and gene encoding for a glycine-rich secreted cement protein knockdowns did not affect B. ovis infection levels in SGs of R. bursa ticks (Table 3.2). Considering the OVs, B. ovis infection levels were not analyzed since gene silencing was not confirmed in none of the four genes studied.

Results

Table 3.2: Babesia ovis infection levels after gene knockdown by RNA interference in Rhipicephalus bursa ticks SGs.

Gene silencing B. ovis infection levels Test/Control Group N (% Ave ± S.D.) (Ave ± S.D.) (Ave ± S.D.)

-04 04 a Vitellogenin-3 (cf1) 4 92 ± 2 4,67e ± 3,05e- 314 ± 255.17

-07 -07 a Lachesin (cf2) 8 51 ± 9 4,48e ± 1,20e 0.30 ± 0.09

Glycine-rich secreted cement 13 65 ± 11 2,97e-06 ± 2,68e-06 1.99 ± 2.18 protein (st1)

Metabolism protein (mt5) 11 ND ND ND

-06 -06 Control 22 --- 1,49e ± 1,09e ---

Thirty female ticks per group were injected with double stranded (ds)RNA or saline control. Ticks were allowed to feed in six separated patches on a lamb experimentally infected with B. ovis. All attached ticks (n = 4–22) were removed after 7 days of feeding and held in a humidity chamber for 4 days to allow ticks to digest the blood meal. Gene knockdown was analyzed by real-time reverse transcription (RT)-PCR by comparing mRNA levels between dsRNA-injected and control ticks. The B. ovis infection levels were determined by quantitative PCR of -CT -CT the 18S rRNA gene and normalized against tick 16S rRNA using the ddCT method (2 target β-actin). The mRNA levels and B. ovis infection in ticks were compared between dsRNA and saline-injected control ticks by a Student’s t-test (aP < 0.05). ND means not determined, since gene knockdown was not demonstrated.

4 Discussion and Conclusions

Discussion and Conclusions

Understanding the paradigm host-pathogen-tick remains a complex issue, mostly because, in fact, there´s three interactions present: Pathogen-Vector, Pathogen-Host and Host-Vector. In this way, basic research focusing on each one of these interplays is necessary that can be after integrated to realize a broader image of this triangle. One of the models that can be used is the Babesia ovis - Rhipicephalus bursa system. Focusing on the molecular alterations that Babesia induces on the tick vector offers insight on the possible molecular strategies that this pathogen uses to surpass mechanic and immune barriers. Moreover, these perceptions can be used in the discovery of tick key molecules with a role in vector infestation or vector capacity. Recent studies performed with different methodological approaches, have reported that the expression of Rhipicephalus tick factors can be modulated in response to tick feeding and Babesia infection (Domingos et al., 2015; de la Fuente et al., 2011; Merino et al., 2011a,b; Heekin et al., 2012; Lu et al., 2016; Taheri et al., 2014; Antunes et al., 2012, 2014, 2015; Erster et al., 2015a; Merino et al., 2013). In this work, we characterized R. bursa genes differentially expressed in response to feeding and B. ovis infection using a RNAi approach to analyze their role in tick biological parameters and also pathogen acquisition. Under the study conditions, babesiosis was detected 6 days post-inoculation in the lamb blood and clinical signs were observed 11 days after experimental infection, which is concomitant with a recent study related to transmission of B. ovis in R. bursa (Erster et al., 2015a). Gene knockdown was carried out by inoculation of dsRNA on the trochanter of R. bursa females. This technique allowed to diminish the damage provoked to the specimens in comparison to the traditional inoculation site, the abdominal region. Ticks were placed in the lamb at day 12 post-inoculation, when the lamb presented high parasitemia and were allowed to feed until drop-off or until day 8 post-infestation. After these assays, gene knockdown evaluation was performed.

Silencing efficiency: In R. bursa SGs but not in OVs, gene knockdown was assessed for all of the genes tested, except for the unknown metabolism related protein (mt5). These results suggest that for some genes and for different tissues, the amount of injected dsRNA necessary to knockdown a gene is different. Moreover, as referred, these genes were selected based on transcriptomic data relative to SGs, thus we are not able to determine the basal expressions levels of such genes in OVs. The cement related protein, denominated here as st1, probably does not exist in OVs, since these type of proteins are exclusive to SGs. Vitellogenins are commonly found and highly expressed in OVs, thus the amount of dsRNA necessary for an efficient knockdown should be higher in comparison to other tissues. Regarding the gene, denominated here as mt5, not much is known about its function in either tissue, so, we might suggest that further studies should be performed to confirm that the gene is also found on OVs and, if so, the expression profile should be assessed in order to determine the amount of dsRNA needed to silence this gene. Finally, the lachesin gene, here cf2, is not described as present in OVs of invertebrate organisms, consequently, as in mt5, more analyses should be carried to explain the result obtained in the present work. A noteworthy element, that cannot be excluded in our gene

Discussion and Conclusions knockdown assays, is the RNAi off-target effects (OTEs) (Scacheri et al., 2004) previously described in R. microplus (Lew-Tabor et al., 2011). The absence of full tick genomic data and the lack of a confirmed tick RNAi pathway can under estimate the OTEs in current tick RNAi experiments (Lew- Tabor et al., 2011). Notwithstanding, the use of long dsRNAs in RNAi treatments in ticks has been accepted as a routine method for validation of tick gene function (Galay et al., 2016; Lu et al., 2016; de la Fuente et al., 2007c; Merino et al., 2011b). The following part of the discussion will be centered in each of the genes studied.

Vitellogenin (Vg), a large phosphoglycolipoprotein (200-700 kDa), is a lipid transfer protein (Avarre et al., 2007) that constitutes the precursor of major yolk protein, such as vitellin (Vn). The two major storage proteins found in ticks are the hemelipoglyco-carrier protein (CP), which seems to be expressed throughout most of tick development, and the female-specific yolk proteins, denominated vitellogenin (Vg), only found in female ticks at the point of egg development. Curiously, both these proteins also demonstrate to have a common evolutionary origin (Donohue et al., 2008, 2009; Sonenshine & Roe, 2014) and, due to its similarities, differentiation between these proteins can be difficult. In ticks, vitellogenesis takes place in midgut, fat body and ovary (Coons et al., 1989; Thompson et al., 2007; Boldbaatar et al., 2010; Horigane et al., 2010; Khalil et al., 2011), being induced by a blood meal and regulated by ecdysteroids (Seixas et al., 2008; Thompson et al., 2005), while tissues where CP is more abundant is in SGs and fat body, being suggested to be a component of saliva and cement cone (Donohue et al., 2008; Guddera et al., 2002). The first complete tick Vg cDNA sequence was reported from Dermacentor variabilis (Thompson et al., 2007). Since then, complete Vg sequences have been described from Ornithodoros moubata (Horigane et al., 2010) and H. longicornis (Boldbaatar et al., 2010) with multiple Vg genes described from both D. variabilis (Khalil et al., 2011) and H. longicornis (Boldbaatar et al., 2010). In H. longicornis, there were identified three different Vg mRNA sequences, described as HlVg-1, HlVg-2 and HlVg-3, and further molecular structure studies aiming these proteins revealed a great similarity of these to CPs (Sonenshine & Roe, 2014). Vitellogenin uptake by growing oocytes in oviparous animals is carried by a receptor-mediated endocytosis pathway, including in invertebrates, such as the nematode Caenorhabditis elegans (Grant & Hirsh, 1999), arthropods, like, Drosophila melanogaster (Meigen, 1830) (Schonbaum et al., 1995) and Aedes aegypti (L., 1762) (Sappington et al., 1995), D. variabilis (Mitchell et al., 2007) and vertebrates, such as chicken (Bujo et al., 1994) and fish (Prat et al., 1998). A study reports that knockdown of Vg in H. longicornis led to lower tick body weight and egg weight in Vg dsRNA- injected ticks owing to insufficient uptake of Vg for oocyte development (Boldbaatar et al., 2010). In other study, Vg receptor (VgR) knockdown using RNAi in H. longicornis resulted in decreased tick ability for oviposition due to failure of Vg uptake by developing oocytes (Boldbaatar et al., 2008). In A. hebraeum, VgR knockdown resulted in decreased oocyte length, delayed ovarian development, and a longer latency to oviposition (Smith & Kaufman, 2013). These results suggest that VgR is crucial for

Discussion and Conclusions binding and transporting Vg via receptor-mediated endocytosis into oocytes in the tick ovary (Boldbaatar et al., 2008; Smith & Kaufman, 2013). Vg-3 (cf1) was found to be upregulated in SGs of fed ticks when comparing with non-fed ticks (Antunes et al., in prep.). Vg-3 knockdown was successfully assessed in SGs, presenting 92% of gene silencing. Under the conditions of this study, Vg-3 knockdown did not affect pathogen infection, thus suggesting that this molecule is not essential to control B. ovis infection in R. bursa ticks. However, Vg-3 knockdown resulted in increased tick mortality. Based on the principal functions associated to this type of molecule, we can suggest that a decrease of the expression of Vg-3 reduces the transport of lipids and normal production of energy (ATP) provided by the disruption of lipids, leading to death. Whereas Vgs are mainly present in midgut and OVs, Vg-3 was found in SGs of fed ticks. As referred, CPs and Vgs share some molecular features, being CPs mostly present in SGs, composing the cement cone, and were suggested to have a role in tick attachment and feeding (Donohue et al., 2008; Gudderra et al., 2002). This result stimulates future research with this molecule in tick life cycle to further develop vaccines against tick infestations.

Lachesin (Lac), a cell surface protein of the immunoglobulin superfamily (Karlstrom et al., 1993; Llimargas et al., 2004), was found to regulate organ size by influencing cell length and cell detachments, suggesting a role for Lac in cell adhesion (Llimargas et al., 2004). Lac was first identified in a grasshopper embryo as a membrane protein specifically expressed in neural cells (Karlstrom et al., 1993). Further, a Lac homologue in D. melanogaster was identified (Karlstrom et al., 1993) and is expressed in a dynamic pattern including in the trachea development (Llimargas et al., 2004). Strong expression of this protein is detected in specific tissues such as the trachea, hindgut, foregut and nervous system (Llimargas et al., 2004). Using bead aggregation assays, it was shown that Lac works as a homophilic cell adhesion molecule necessary to afford epithelial integrity to the tracheal tubes and to control tubular epithelium length (Llimargas et al., 2004). Also, it was reported that Lac accumulates at the Septate Junctions (SJs), specific invertebrate cell junctions located in the apical part of the lateral membrane of ectoderm-derived cells, whose role is the formation of a trans- epithelial diffusion barrier, establishing and/or maintaining cell polarity, cell adhesion and cell-cell interactions (Tepass & Hartenstein, 1994; Tepass et al., 2001). Recently, lachesin has been identified in the R. appendiculatus sialotranscriptome upon blood feeding (de Castro et al., 2016). Also, this gene has firstly been identified in the genome of Ixodes scapularis (Caler et al., 2008), but until date there is no studies focusing this molecule in ticks. Lac (cf2) was found to be upregulated in fed ticks when comparing with non-fed ticks (Antunes et al., in prep.). Lac knockdown was demonstrated in SGs, presenting 51% of gene silencing. Gene knockdown under the conditions undertaken here led to a significantly lower pathogen infection of about 70% in SGs. In addition, Lac dsRNA-injected ticks presented increased tick mortality when compared to PBS-injected ticks, as well as it was observed for Vg-3 (cf1). No effect was evidenced in tick weight after feeding. These results suggested the

Discussion and Conclusions possibility that Lac may play a role in tick survival, as in B. ovis infection, in R. bursa ticks. Based on the putative role of this molecule in the cell adhesion and cell-cell interactions might influence pathogen invasion. Plus, as mentioned, it has been described as a molecule necessary to confer epithelial integrity and consequently involved in the development of specific organs therefore manipulating the expression of such gene can induce abnormal cell growth.

Putative secreted glycine-rich cement protein, st1, is a component of the cement cone, which consists of several glycine-rich proteins (GRPs) (Bishop et al., 2002; Trimnell et al., 2005), found to be expressed in SGs of several hard tick species (Bishop et al., 2002; Mulenga et al., 1999a,b; Trimnell et al., 2005; Untalan et al., 2005). For feeding, ticks attach to their hosts with the help of specialized mouthparts and remain attached by the secretion of adhesive (cement) GRPs that glue the mouthparts into the host’s skin, enabling ixodid ticks to remain attached to the host during the prolonged feeding period and prevent host immune response molecules from coming into contact with the tick proboscis (Sonenshine & Roe, 2014; Bishop et al., 2002; Trimnell et al., 2005). SGs are not only responsible for the attachment cement secretion that allows the parasite to remain attached to the host for several days, but also enable pathogen transmission from the vector to the host. When on-host, tick avoids the host’s immune system through SGs secretions (L’Amoreaux et al., 2003). Therefore, these structures are of great interest for on-host activities. GRP was isolated from H. longicornis, and was proposed to be a component of cement to help anchor the tick’s mouthparts to the host during tick feeding (Mulenga et al., 1999a,b). Few years later, a study has identified genes encoding cement-like antigens in H. longicornis, which were upregulated upon feeding (Harnnoi et al., 2006). Cement cone proteins are similar to those of epidermis/dermis, which reflects their flexibility and need to avoid host rejection, representing good-looking candidates for inclusion in vaccines against ticks and pathogen transmission, since formation of the cone is essential for the tick to attach and feed (Bishop et al., 2002). 64P, a 15 kDa protein, was identified as a putative cement protein involved in attachment and feeding of R. appendiculatus ticks (Trimnell et al., 2002), found to be expressed in SGs (Havlíková et al., 2009). In vaccination experiments with recombinant versions from R. appendiculatus 64P protein (64TRPs), a dual-action vaccine was proposed, since it was demonstrated that it could act both as “exposed” and “concealed” antigen (Almazán et al., 2005a,b; Havlíková et al., 2009; Trimnell et al., 2002, 2005). Moreover, a posterior study showed that immunization with 64TPR protected mice from tick-borne encephalitis virus (TBEV) transmission by Ixodes ricinus (Labuda et al., 2006). Gene encoding for a putative secreted glycine-rich cement protein (st1) was found to be upregulated in SGs infected ticks when comparing with non-infected ticks (Antunes et al., in prep.). Subsequent gene knockdown was successfully assessed in SGs, showing 65% of gene silencing. Under the conditions of this study, st1 knockdown did not affect pathogen infection, thus suggesting that this molecule is not essential to control B. ovis infection in R. bursa ticks. Though, st1 knockdown resulted in decreased tick weight after feeding and tick attachment to the host. Previous studies concerning cement cone

Discussion and Conclusions proteins showed that immunization with these proteins affected significantly ixodid tick attachment to the host (Trimnell et al., 2005), as well as reducing pathogen transmission (Labuda et al., 2006). As in the 64P case, using a cement cone protein, such as st1, for the development of new anti-tick vaccines, represent a promising approach for the control of tick infestations since these molecules are considered “exposed” antigens by targeting the tick-feeding site, which results in impaired feeding and attachment. “Exposed” antigens have the advantage of not needing further vaccination boosts, since tick feeding promote continuous exposition of such molecules to the immune system of the vertebrate host (Ghosh et al., 2007; Trimnell et al., 2005, 2002).

Mt5, an unknown metabolism related protein, was found to be upregulated in SGs infected ticks when comparing with non-infected ticks (Antunes et al., in prep.). Until date, there is no study that focuses on this protein, consequently, not much is known about its function in either tissue, and so, we might suggest that further studies should be performed. Since mt5 gene knockdown was not assessed in SGs or OVs, functional analysis after RNAi were not carried.

The main objective of the present Master project consisted in the validation of the influence of selected genes in tick development and infection acquisition towards TTBD. New genes involved in the tick feeding and in B. ovis infection were identified using RNA-Seq. Using this technique, catalogues of genes upregulated in an infected tick population and in a fed tick population were obtained, improving our understanding of the molecular mechanisms involved in tick–pathogen and tick-host interactions (Antunes et al., in prep.). Vitellogenin-3 (cf1) and putative lachesin (cf2) were selected from the catalogue of fed tick population, and gene encoding for a putative secreted glycine- rich cement protein (st1) and gene encoding for an unknown metabolism protein (mt5) were selected from the catalogue of infected tick population, based on fold change expression. RNA interference assays were employed, allowing functional analysis of genes by disrupting their expression. Our results showed that gene disruption was achieved in cf1, cf2 and st1 groups, in SGs. The gene Lac presented a significant influence on B. ovis infection in R. bursa ticks. Additionally, Vg-3 (cf1) knockdown resulted in increased tick mortality. Finally, st1 gene disruption resulted in decreased tick attachment and decreased tick weight after feeding. The results reported here increased our understanding of the role of tick genes in Babesia infection/multiplication and tick feeding, which is fundamental for the development of novel tick control measures. Some of the R. bursa genes discovered in the present study such as Vg-3, Lac and the gene encoding for a putative secreted glycine-rich cement protein could contribute to the development of novel vaccines designed to reduce tick infestations and prevent or minimize pathogen infection in ticks and transmission to vertebrate hosts.

5 References

References

Aktaş, M., Altay, K., & Dumanli, N. (2005). Development of a polymerase chain reaction method for diagnosis of Babesia ovis infection in sheep and goats. Veterinary Parasitology, 133(4), 277– 281.

Aliu, Y. O., & Odegaard, S. (1985). Pharmacokinetics of Dirninazene in Sheep. Journal of Pharmacokicetics and Biopharmaceutics, 13(2).

Aljamali, M., Sauer, J., & Essenberg, R. (2002). RNA interference: applicability in tick research. Experimental & Applied Acarology, 28(1–4), 89–96.

Almazán, C., Blas-Machado, U., Kocan, K. M., Yoshioka, J. H., Blouin, E. F., Mangold, A. J., & De La Fuente, J. (2005). Characterization of three Ixodes scapularis cDNAs protective against tick infestations. Vaccine, 23(35), 4403–4416.

Almazán, C., Kocan, K., Bergman, D., Garcia-Garcia, J., Blouin, E., & de la Fuente, J. (2003). Identification of protective antigens for the control of Ixodes scapularis infestations using cDNA expression library immunization. Vaccine, 21(13–14), 1492–1501.

Almazán, C., Kocan, K., Blouin, E., & De La Fuente, J. (2005). Vaccination with recombinant tick antigens for the control of Ixodes scapularis adult infestations. Vaccine, 23(46–47), 5294–5298.

Antunes, S., Ferrolho, J., Couto, J., Rodrigues, F., Santos, A. S., Santos-Silva, M. M., … Domingos, A. (2016) Rhipicephalus bursa sialotranscriptomic responses to blood feeding and Babesia ovis infection: evaluation of antigens towards tick and tick borne pathogens control. in preparation

Antunes, S., Galindo, R. C., Almazán, C., Rudenko, N., Golovchenko, M., Grubhoffer, L., … Domingos, A. (2012). Functional genomics studies of Rhipicephalus (Boophilus) annulatus ticks in response to infection with the cattle protozoan parasite, Babesia bigemina. International Journal for Parasitology, 42(2), 187–95.

Antunes, S., Merino, O., Lérias, J., Domingues, N., Mosqueda, J., de la Fuente, J., & Domingos, A. (2015). Artificial feeding of Rhipicephalus microplus female ticks with anti calreticulin serum do not influence tick and Babesia bigemina acquisition. Ticks and Tick-Borne Diseases, 6(1), 47– 55.

Antunes, S., Merino, O., Mosqueda, J., Moreno-Cid, J. a, Bell-Sakyi, L., Fragkoudis, R., … de la Fuente, J. (2014). Tick capillary feeding for the study of proteins involved in tick-pathogen interactions as potential antigens for the control of tick infestation and pathogen infection. Parasites & Vectors, 7(42).

Avarre, J.-C., Lubzens, E., & Babin, P. J. (2007). Apolipocrustacein, formerly vitellogenin, is the

References

major egg yolk precursor protein in decapod crustaceans and is homologous to insect apolipophorin II/I and vertebrate apolipoprotein B. BMC Evolutionary Biology, 7(3).

Babes, V. (1888). Sur l’hémoglobinurie bactérienne du boeuf (on the bacterian hemoglobinuria of cattle). C. R. Hebd. Acad. Sci., 107, 692–694.

Baby, P., David, P., Ravindran, P., & Ravindran, R. (2001). A subacute case of concurrent babesiosis and anaplasmosis in a she-goat. Indian Veterinary Journal, 78(5), 424–5.

Barker, S., & Murrell, A. (2008). Systematics and evolution of ticks with a list of valid genus and species names. Ticks: Biology, Disease and Control, l.

Barry, M. A., Howell, D. P. G., Andersson, H. A., Chen, J. L., & Singh, R. A. K. (2004). Expression library immunization to discover and improve vaccine antigens. Immunological Reviews, 199, 68–83.

Baum, J., Bogaert, T., Clinton, W., Heck, G. R., Feldmann, P., Ilagan, O., … Roberts, J. (2007). Control of coleopteran insect pests through RNA interference. Nature Biotechnology, 25(11), 1322–6.

Beattie, J., Michelson, M., & Holman, P. (2002). Acute babesiosis caused by Babesia divergens in a resident of Kentucky. N Engl J Med, 347(9), 697–8.

Benach, J., & Habicht, G. (1981). Clinical characteristics of human babesiosis. Journal of Infect Dis., 144(5), 481.

Ben Musa, N., & Phillips, R. (1991). The adaptation of three isolates of Babesia divergens to continuous culture in rat erythrocytes. Parasitology, 103(2), 165–170.

Bishop, R., Lambson, B., Wells, C., Pandit, P., Osaso, J., Nkonge, C., … Nene, V. (2002). A cement protein of the tick Rhipicephalus appendiculatus , located in the secretory e cell granules of the type III salivary gland acini , induces strong antibody responses in cattle. International Journal for Parasitology, 32, 833–842.

Bock, R., Jackson, L., de Vos, A., & Jorgensen, W. (2004). Babesiosis of cattle. Parasitology, 129, 247–69.

Boldbaatar, D., Battsetseg, B., Matsuo, T., Hatta, T., Umemiya-Shirafuji, R., Xuan, X., & Fujisaki, K. (2008). Tick vitellogenin receptor reveals critical role in oocyte development and transovarial transmission of Babesia parasite. Biochemistry and Cell Biology, 86, 331–344.

Boldbaatar, D., Umemiya-Shirafuji, R., Liao, M., Tanaka, T., Xuan, X., & Fujisaki, K. (2010).

References

Multiple vitellogenins from the Haemaphysalis longicornis tick are crucial for ovarian development. Journal of Insect Physiology, 56(11), 1587–1598. http://doi.org/10.1016/j.jinsphys.2010.05.019

Böse, R., Jorgensen, W., Dalgliesh, R., Friedhoff, K., & de Vos, A. (1995). Current state and future trends in the diagnosis of babesiosis. Veterinary Parasitology, 57(1–3), 61–74.

Brites-Neto, J., Maria Duarte Roncato, K., & Martins, T. F. (2015). Tick-borne infections in human and animal population worldwide. Veterinary World, 8(3), 301–315.

Bujo, H., Hermann, M., Kaderli, M. O., Jacobsen, L., Sugawara, S., Nimpf, J., … Schneider, W. J. (1994). Chicken oocyte growth is mediated by an eight ligand binding repeat member of the LDL receptor family. The EMBO Journal, 13(21), 5165–75.

Buling, A., Criado-Fornelio, A., Asenzo, G., Benitez, D., Barba-Carretero, J. C., & Florin-Christensen, M. (2007). A quantitative PCR assay for the detection and quantification of Babesia bovis and B. bigemina. Veterinary Parasitology, 147(1–2), 16–25.

Bush, J., Isaäcson, M., Mohamed, A., Potgieter, F., & de Waal, D. (1990). Human babesiosis--a preliminary report of 2 suspected cases in South Africa. South Africa Med Journal, 78(11), 699.

Bustin, S., Benes, V., Garson, J., Hellemans, J., Huggett, J., Kubista, M., … Wittwer, C. (2009). The MIQE Guidelines: Minimum Information for Publication of Quantitative Real-Time PCR Experiments. Clinical Chemistry, 55(4), 611–622.

Caler, E., Hannick, L. I., Bidwell, S., Joardar, V., Thiagarajan, M., Amedeo, P., … Strausberg, R. (2008). Annotation of Ixodes scapularis.

Cantu, A., Ortega-S, J. A., Mosqueda, J., Garcia-Vazquez, Z., Henke, S. E., & George, J. E. (2007). Immunologic and molecular identification of Babesia bovis and Babesia bigemina in free- ranging white-tailed deer in northern Mexico. Journal of Wildlife Diseases, 43(3), 504–507.

Caperucci, D., Bechara, G. H., & Camargo Mathias, M. I. (2010). Ultrastructure features of the midgut of the female adult Almblyomma cajennense ticks Fabricius, 1787 (Acari: Ixodidae) in several feeding stages and subjected to three infestations. Micron, 41(7), 710–721.

Carletti, T., Barreto, C., Mesplet, M. et al. (2015). Characterization of a papain-like cysteine protease essential for the survival of Babesia ovis merozoites. Ticks and Tick-Borne Diseases.

Chauvin, A., Moreau, E., Bonnet, S., Plantard, O., & Malandrin, L. (2009). Babesia and its hosts: Adaptation to long-lasting interactions as a way to achieve efficient transmission. Veterinary Research, 40(2).

References

Cloonan, N., Forrest, A. R. R., Kolle, G., Gardiner, B. B. a, Faulkner, G. J., Brown, M. K., … Grimmond, S. M. (2008). Stem cell transcriptome profiling via massive-scale mRNA sequencing. Nature Methods, 5(7), 613–9.

Conrad, P. A., Kjemtrup, A. M., Carreno, R. A., Thomford, J., Wainwright, K., Eberhard, M., … Herwaldt, B. L. (2006). Description of Babesia duncani n.sp. (Apicomplexa: Babesiidae) from humans and its differentiation from other piroplasms. International Journal for Parasitology, 36(7), 779–789.

Conrad, P., Thomford, J., Yamane, I., Whiting, J., Bosma, L., Uno, T., … Shelly, S. (1991). Hemolytic anemia caused by Babesia gibsoni infection in dogs. Journal of the American Veterinary Medical Association, 199(5), 601–5.

Coons, L., & Alberti, G. (1999). The acari-ticks. In F. Harrison & R. Foelix (Eds.), Microscopic anatomy of invertebrates. New York, USA: Wiley.

Coons, L. B., Lamoreaux, W. J., Rosell-Davis, R., & Tarnowski, B. I. (1989). Onset of vitellogenin production and vitellogenesis, and their relationship to changes in the midgut epithelium and oocytes in the tick Dermacentor variabilis. Experimental and Applied Acarology, 6(4), 291–305.

Coons, L., Tarnowski, B., & Ourth, D. (1982). Rhipicephalus sanguinius: localization of vitellogenin synthesis by immunological methods and electron microscopy. Experimental Parasitology, 54(3), 331–339.

Cordoves, C., & Polanco, R. (1983). Efficacy of Ganasegur (diminazene) in the control of trypanosomiasis and babesiosis. Veterinaria, 5, 133–8.

Criado-Fornelio, A., Buling, A., Asenzo, G., Benitez, D., Florin-Christensen, M., Gonzalez-Oliva, A., … Madruga, C. R. (2009). Development of fluorogenic probe-based PCR assays for the detection and quantification of bovine piroplasmids. Veterinary Parasitology, 162(3–4), 200– 206.

Dahmani, M., Davoust, B., Rousseau, F., Raoult, D., Fenollar, F., & Mediannikov, O. (2016). Natural Anaplasmataceae infection in Rhipicephalus bursa ticks collected from sheep in the French Basque Country. Ticks and Tick-Borne Diseases. de Castro, M. H., de Klerk, D., Pienaar, R., Latif, A. A., Rees, D. J. G., & Mans, B. J. (2016). De novo assembly and annotation of the salivary gland transcriptome of Rhipicephalus appendiculatus male and female ticks during blood feeding. Ticks and Tick-Borne Diseases, 7(4), 536–548. de la Fuente, J., Almazán, C., Canales, M., Pérez de la Lastra, J. M., Kocan, K. M., & Willadsen, P.

References

(2007). A ten-year review of commercial vaccine performance for control of tick infestations on cattle. Animal Health Research Reviews / Conference of Research Workers in Animal Diseases, 8(1), 23–28. de la Fuente, J., Almazán, C., Naranjo, V., Blouin, E. F., & Kocan, K. M. (2006). Synergistic effect of silencing the expression of tick protective antigens 4D8 and Rs86 in Rhipicephalus sanguineus by RNA interference. Parasitology Research, 99(2), 108–113. de la Fuente, J., Almazán, C., Naranjo, V., Blouin, E. F., Meyer, J. M., & Kocan, K. M. (2006). Autocidal control of ticks by silencing of a single gene by RNA interference. Biochemical and Biophysical Research Communications, 344(1), 332–338. http://doi.org/10.1016/j.bbrc.2006.03.109 de la Fuente, J., Blouin, E. F., Manzano-Roman, R., Naranjo, V., Almazán, C., Pérez de la Lastra, J. M., … Kocan, K. M. (2007). Functional genomic studies of tick cells in response to infection with the cattle pathogen, Anaplasma marginale. Genomics, 90(6), 712–722. de la Fuente, J., Estrada-Pena, A., Venzal, J. M., Kocan, K. M., & Sonenshine, D. E. (2008). Overview: Ticks as vectors of pathogens that cause disease in humans and animals. Frontiers in Bioscience, 13, 6938–6946. de la Fuente, J., & Kocan, K. M. (2003). Advances in the identification and characterization of protective antigens for recombinant vaccines against tick infestations. Expert Rev Vaccines, 2(4), 583–593. de la Fuente, J., & Kocan, K. M. (2006). Strategies for development of vaccines for control of ixodid tick species. Parasite Immunology, 28(7), 275–283. de la Fuente, J., Kocan, K. M., Almazán, C., & Blouin, E. F. (2007). RNA interference for the study and genetic manipulation of ticks. Trends in Parasitology, 23(9), 427–433. de la Fuente, J., Moreno-Cid, J. A., Canales, M., Villar, M., de la Lastra, J. M. P., Kocan, K. M., … Blouin, E. F. (2011). Targeting arthropod subolesin/akirin for the development of a universal vaccine for control of vector infestations and pathogen transmission. Veterinary Parasitology, 181(1), 17–22. de la Fuente, J., Rodríguez, M., & García-García, J. C. (2000). Immunological control of ticks through vaccination with Boophilus microplus gut antigens. Annals of the New York Academy of Sciences, 916, 617–621. de la Fuente, J., Rodríguez, M., Redondo, M., Montero, C., García-García, J. C., Méndez, L., …

References

García, L. (1998). Field studies and cost-effectiveness analysis of vaccination with Gavac against the cattle tick Boophilus microplus. Vaccine, 16(4), 366–373.

Diatchenko, L., Lukyanov, S., Lau, Y.-F. C., & Siebert, P. D. (1999). Suppression Subtractive Hybridization: A Versatile Method for Identifying Differentially Expressed Genes. Methods in Enzymology, 303(1991), 349–380.

Domingos, A., Antunes, S., Borges, L., & Do Rosário, V. E. (2013). Approaches towards tick and tick-borne diseases control. Revista Da Sociedade Brasileira de Medicina Tropical, 46(3), 265– 269.

Domingos, A., Antunes, S., Villar, M., & de la Fuente, J. (2015). Functional Genomics of Tick Vectors Challenged with the Cattle Parasite Babesia bigemina. Veterinary Infection Biology: Molecular Diagnostics and High-Throughput Strategies, 475–489.

Donohue, K. V., Khalil, S. M. S., Sonenshine, D. E., & Roe, R. M. (2009). Heme-binding storage proteins in the Chelicerata. Journal of Insect Physiology, 55(4), 287–296.

Donohue, K. V, Khalil, S. M. S., Mitchell, R. D., Sonenshine, D. E., & Roe, R. M. (2008). Molecular characterization of the major hemelipoglycoprotein in ixodid ticks. Insect Mol Biol, 17(3), 197– 208.

Duh, D., Petrovec, M., & Avsic-Zupanc, T. (2005). Molecular characterization of human pathogen Babesia EU1 in Ixodes ricinus ticks from Slovenia. Journal of Parasitology, 91(2), 463–5.

Erster, O., Roth, A., Wolkomirsky, R., Leibovich, B., Savitzky, I., & Shkap, V. (2015). Transmission of Babesia ovis by different Rhipicephalus bursa developmental stages and infected blood injection. Ticks and Tick-Borne Diseases, 7(1), 13–19.

Erster, O., Roth, A., Wolkomirsky, R., Leibovich, B., Savitzky, I., Zamir, S., … Shkap, V. (2015). Molecular detection of Babesia ovis in sheep and ticks using the gene encoding B. ovis surface protein D (BoSPD). Veterinary Parasitology.

Esernio-Jenssen, D., Scimeca, P., Benach, J., & Tenenbaum, M. (1987). Transplacental/perinatal babesiosis. J Pediatr, 110(4), 570–2.

Estrada-Peña, A., Gray, J. S., Kahl, O., Lane, R. S., & Nijhof, A. M. (2013). Research on the ecology of ticks and tick-borne pathogens--methodological principles and caveats. Frontiers in Cellular and Infection Microbiology, 3(August), 29.

Ferrolho, J., Antunes, S., Santos, A., Velez, R., Padre, L., Cabezas-Cruz, A., & Santos-Silva, M. D. A. (2016). Detection and phylogenetic characterization of Theileria spp. and Anaplasma marginale

References

in Rhipicephalus bursa in Portugal. Ticks and Tick-Borne Diseases, 7(3), 443–448.

Figueroa, J., Chieves, L., Johnson, G., & Buening, G. (1993). Multiplex polymerase chain reaction based assay for the detection of Babesia bigemina, Babesia bovis and Anaplasma marginale DNA in bovine blood. Veterinary Parasitology, 50(1–2), 69–81.

Figueroa, J., LP, C., Johnson, G., & Buening, G. (1992). Detection of Babesia microti by polymerase chain reaction. J. Clin. Microbiol., 30(10), 2576–82.

Fire, A. (1999). RNA-triggered gene silencing. Trends in Genetics, 15(9), 358–363.

Fitzpatrick, J., Kennedy, C., McGeown, M., Oreopoulos, D., Robertson, J., & Soyannwo, M. (1968). Human case of piroplasmosis (babesiosis). Nature, 217(5131), 861–2.

Florin-Christensen, M., & Schnittger, L. (2009). Piroplasmids and ticks: a long-lasting intimate relationship. Frontiers in Biosciences, 14(6), 3064–73.

Galay, R. L., Aung, K. M., Umemiya-Shirafuji, R., Maeda, H., Matsuo, T., Kawaguchi, H., … Tanaka, T. (2013). Multiple ferritins are vital to successful blood feeding and reproduction of the hard tick Haemaphysalis longicornis. The Journal of Experimental Biology, 216(Pt 10), 1905–1915.

Galay, R. L., Hernandez, E. P., Talactac, M. R., Maeda, H., Kusakisako, K., Umemiya-Shirafuji, R., … Tanaka, T. (2016). Induction of gene silencing in Haemaphysalis longicornis ticks through immersion in double-stranded RNA. Ticks and Tick-Borne Diseases.

Garcia, G. R., Gardinassi, L. G., Ribeiro, J. M., Anatriello, E., Ferreira, B. R., Moreira, H. N. S., … Maruyama, S. R. (2014). The sialotranscriptome of Almblyomma triste, Almblyomma parvum and Almblyomma cajennense ticks, uncovered by 454-based RNA-seq. Parasites & Vectors, 7(430).

Gargili, A., Midilli, K., Ergonul, O., Ergin, S., Alp, H., Vatansever, Z., … Estrada-Peña, A. (2011). Crimean-Congo hemorrhagic fever in European part of Turkey: genetic analysis of the virus strains from ticks and a seroepidemiological study in humans. Vector Borne Zoonotic Diseases, 11(6), 747–52.

Garnham, P., & Bray, R. (1959). The Susceptibility of the Higher Primates to Piroplasms. The Journal of Eukaryotic Microbiology, 6(4), 352–355.

George, J. E., Pound, J. M., & Davey, R. B. (2004). Chemical control of ticks on cattle and the resistance of these parasites to acaricides. Parasitology, 129 Suppl(May), S353–S366.

Ghosh, S., Azhahianambi, P., & Yadav, M. P. (2007). Upcoming and future strategies of tick control:

References

A review. Journal of Vector Borne Diseases, 44(2), 79–89.

Goff, W. L., Johnson, W. C., Molloy, J. B., Jorgensen, W. K., Waldron, S. J., Figueroa, J. V., … McElwain, T. F. (2008). Validation of a competitive enzyme-linked immunosorbent assay for detection of Babesia bigemina antibodies in cattle. Clinical and Vaccine Immunology, 15(9), 1316–1321.

Graf, J. F., Gogolewski, R., Leach-Bing, N., Sabatini, G. a, Molento, M. B., Bordin, E. L., & Arantes, G. J. (2004). Tick control: an industry point of view. Parasitology, 129 Suppl(2), S427–S442.

Grant, B. D., & Hirsh, D. (1999). Receptor-mediated endocytosis in the Caenorhabditis elegans oocyte. Molecular Biology of the Cell, 10(12), 4311–4326.

Gray, J., & Pudney, M. (1999). Activity of atovaquone against Babesia microti in the Mongolian gerbil, Meriones unguiculatus. Journal of Parasitology, 85(4), 723–8.

Gray, J., & Weiss, L. (2008). Babesia microti. In N. Khan (Ed.), Emerging Protozoan Pathogens (pp. 303–349). Abingdon, UK: Taylor and Francis.

Guan, G., Chauvin, A., Luo, J., Inoue, N., Moreau, E., Liu, Z., … Yin, H. (2008). The development and evaluation of a loop-mediated isothermal amplification (LAMP) method for detection of Babesia spp. infective to sheep and goats in China. Experimental Parasitology, 120(1), 39–44.

Guan, G., Ma, M., Moreau, E., Liu, J., Lu, B., Bai, Q., … Yin, H. (2009). A new ovine Babesia species transmitted by Hyalomma anatolicum anatolicum. Experimental Parasitology, 122(4), 261–267.

Gudderra, N. P., Sonenshine, D. E., Apperson, C. S., & Roe, R. M. (2002). Tissue distribution and characterization of predominant hemolymph carrier proteins from Dermacentor variabilis and Ornithodoros parkeri. J. Insect. Physiol., 48, 161–170.

Guerrero, F. D., Lovis, L., & Martins, J. R. (2012). Acaricide resistance mechanisms in Rhipicephalus (Boophilus) microplus. Brazilian Journal of Veterinary Parasitology, 21(1), 1–6.

Guerrero, F. D., Miller, R. J., & Pérez de León, A. A. (2012). Cattle tick vaccines: Many candidate antigens, but will a commercially viable product emerge? International Journal for Parasitology, 42(5), 421–427.

Hajdušek, O., Šíma, R., Ayllón, N., Jalovecká, M., Perner, J., de la Fuente, J., & Kopáček, P. (2013). Interaction of the tick immune system with transmitted pathogens. Frontiers in Cellular and Infection Microbiology, 3(July), 1–15.

References

Hajdušek, O., Sima, R., Perner, J., Loosova, G., Harcubova, A., & Kopacek, P. (2016). Tick iron and heme metabolism - New target for an anti-tick intervention. Ticks and Tick-Borne Diseases, 7(4), 565–572.

Hannon, G. J. (2002). RNA interference. Nature, 418.

Harnnoi, T., Sakaguchi, T., Xuan, X., & Fujisaki, K. (2006). Identification of Genes Encoding Cement-Like Antigens Expressed in the Salivary Glands of Haemaphysalis longicornis. Journal of Veterinary Medical Science, 68(11), 1155–1160.

Haselbarth, K., Tenter, A. M., Brade, V., Krieger, G., & Hunfeld, K. P. (2007). First case of human babesiosis in Germany - Clinical presentation and molecular characterisation of the pathogen. International Journal of Medical Microbiology, 297(3), 197–204.

Hashemi-Fesharki, R. (1997). Tick-borne diseases of sheep and goats and their related vectors in Iran. Parassitologia, 39(2), 115–7.

Havlíková, S., Roller, L., Koči, J., Trimnell, A. R., Kazimírová, M., Klempa, B., & Nuttall, P. A. (2009). Functional role of 64P, the candidate transmission-blocking vaccine antigen from the tick, Rhipicephalus appendiculatus. International Journal for Parasitology, 39(13), 1485–1494.

Hayes, M., & Oliver, J. J. (1981). Immediate and latent effects induced by the antiallatotropin precocene 2(P2) on embryonic Dermacentor variabilis (Say) (Acari: Ixodidae). Journal of Parasitology, 67(6), 923–927.

Heekin, A. M., Guerrero, F. D., Bendele, K. G., Saldivar, L., Scoles, G. A., Dowd, S. E., … Brayton, K. A. (2013). Gut transcriptome of replete adult female cattle ticks, Rhipicephalus (Boophilus) microplus, feeding upon a Babesia bovis-infected bovine host. Parasitology Research, 112(9), 3075–3090.

Heekin, A. M., Guerrero, F. D., Bendele, K. G., Saldivar, L., Scoles, G. a, Gondro, C., … Brayton, K. a. (2012). Analysis of Babesia bovis infection-induced gene expression changes in larvae from the cattle tick, Rhipicephalus (Boophilus) microplus. Parasites & Vectors, 5(162).

Hemmer, R., Ferrick, D., & Conrad, P. (2000). Role of T cells and cytokines in fatal and resolving experimental babesiosis: protection in TNFRp55-/- mice infected with the human Babesia WA1 parasite. Journal of Parasitology, 86(4), 736–42.

Herwaldt, B. L., Bruyn, G. De, Pieniazek, N. J., Homer, M., Lofy, K. H., Slemenda, S. B., … Limaye, A. P. (2004). Babesia divergens – like Infection , Washington State. Emerging Infectious Diseases, 10(4).

References

Herwaldt, B. L., Cacciò, S., Gherlinzoni, F., Aspöck, H., Slemenda, S. B., Piccaluga, P. P., … Pieniazek, N. J. (2003). Molecular characterization of a non-Babesia divergens organism causing zoonotic babesiosis in Europe. Emerging Infectious Diseases, 9(8), 942–948.

Herwaldt, B., Persing, D., Précigout, E., Goff, W., Mathiesen, D., Taylor, P., … Gorenflot, A. (1996). A fatal case of babesiosis in Missouri: identification of another piroplasm that infects humans. Ann Intern Med., 124(7), 643–50.

Hilburn, L. R., Davey, R. B., George, J. E., Pound, J. M., & Mathews, J. P. (1991). Non-random mating between Boophilus microplus and hybrids of B. microplus females and B. annulatus males, and its possible effect on sterile male hybrid control releases. Experimental & Applied Acarology, 11(1), 23–36.

Hildebrandt, A., Gray, J. S., & Hunfeld, K.-P. (2013). Human Babesiosis in Europe: what clinicians need to know. Infection, 41(6), 1057–1072.

Hildebrandt, A., Hunfeld, K. P., Baier, M., Krumbholz, A., Sachse, S., Lorenzen, T., … Straube, E. (2007). First confirmed autochthonous case of human Babesia microti infection in Europe. European Journal of Clinical Microbiology and Infectious Diseases, 26(8), 595–601.

Hildebrandt, A., Tenter, A. M., Straube, E., & Hunfeld, K. P. (2008). Human babesiosis in Germany: Just overlooked or truly new? International Journal of Medical Microbiology, 298(1), 336–346.

Homer, M. J., Aguilar-delfin, I., Iii, S. A. M. R. T., Krause, P. J., Persing, D. H., & Ev, C. L. I. N. M. I. R. (2000). Babesiosis. Clin.Microbiol.Rev., 13(3), 451–469.

Horigane, M., Shinoda, T., Honda, H., & Taylor, D. (2010). Characterization of a vitellogenin gene reveals two phase regulation of vitellogenesis by engorgement and mating in the soft tick Ornithodoros moubata (Acari: Argasidae). Insect Molecular Biology, 19(4), 501–515.

Hunfeld, K., Hildebrandt, A., & Gray, J. (2008). Babesiosis: Recent insights into an ancient disease. International Journal for Parasitology, 38(11), 1219–1237.

Iseki, H., Alhassan, A., Ohta, N., Thekisoe, O. M. M., Yokoyama, N., Inoue, N., … Igarashi, I. (2007). Development of a multiplex loop-mediated isothermal amplification (mLAMP) method for the simultaneous detection of bovine Babesia parasites. Journal of Microbiological Methods, 71(3), 281–287.

Karim, S., & Ribeiro, J. M. C. (2015). An insight into the sialome of the lone star tick, Almblyomma americanum, with a glimpse on its time dependent gene expression. PLoS ONE, 10(7).

Karlstrom, R. O., Wilder, L. P., & Bastiani, M. J. (1993). Lachesin: an immunoglobulin superfamily

References

protein whose expression correlates with neurogenesis in grasshopper embryos. Development (Cambridge, England), 118(2), 509–522.

Khalil, S. M. S., Donohue, K. V., Thompson, D. M., Jeffers, L. A., Ananthapadmanaban, U., Sonenshine, D. E., … Roe, R. M. (2011). Full-length sequence, regulation and developmental studies of a second vitellogenin gene from the American dog tick, Dermacentor variabilis. Journal of Insect Physiology, 57(3), 400–408.

Kim, J. Y., Cho, S. H., Joo, H. N., Tsuji, M., Cho, S. R., Park, I. J., … Kim, T. S. (2007). First case of human babesiosis in Korea: Detection and characterization of a novel type of Babesia sp. (KO1) similar to ovine Babesia. Journal of Clinical Microbiology, 45(6), 2084–2087.

Kiss, T., Cadar, D., & Spînu, M. (2012). Tick prevention at a crossroad: New and renewed solutions. Veterinary Parasitology, 187(3–4), 357–366.

Klompen, H., Lekveishvili, M., & Black IV, W. C. (2007). Phylogeny of parasitiform mites (Acari) based on rRNA. Molecular Phylogenetics and Evolution, 43(3), 936–951.

Krause, P., Telford, S. R., Ryan, R., Hurta, A. B., Kwasnik, I., Luger, S., … Spielman, A. (1991). Geographical and temporal distribution of Babesial infection in Connecticut. Journal of Clinical Microbiology, 29(1), 1–4.

Kurscheid, S., Lew-Tabor, A. E., Rodriguez Valle, M., Bruyeres, A. G., Doogan, V. J., Munderloh, U. G., … Bellgard, M. I. (2009). Evidence of a tick RNAi pathway by comparative genomics and reverse genetics screen of targets with known loss-of-function phenotypes in Drosophila. BMC Mol Biol, 10, 26.

L’Amoreaux, W. J., Junaid, L., & Trevidi, S. (2003). Morphological evidence that salivary gland degeneration in the American dog tick, Dermacentor variabilis (Say), involves programmed cell death. Tissue and Cell, 35(2), 95–99.

Labuda, M., Trimnell, A. R., Ličková, M., Kazimírová, M., Davies, G. M., Lissina, O., … Nuttall, P. A. (2006). An antivector vaccine protects against a lethal vector-borne pathogen. PLoS Pathogens, 2(4), 251–259.

Latif, A., & Walker, A. . (2004). An introduction to the biology and control of ticks in Africa. International Consortium on Ticks and Tick-borne Diseases-2 Project.

Leiby, D. A. (2006). Babesiosis and blood transfusion: Flying under the radar. Vox Sanguinis, 90(3), 157–165.

Lewis, D., & Williams, H. (1979). Infection of the Mongolian gerbil with the cattle piroplasm Babesia

References

divergens. Nature, 278(5700), 170–1.

Lew-Tabor, A. E., Kurscheid, S., Barrero, R., Gondro, C., Moolhuijzen, P. M., Rodriguez Valle, M., … Bellgard, M. I. (2011). Gene expression evidence for off-target effects caused by RNA interference-mediated gene silencing of Ubiquitin-63E in the cattle tick Rhipicephalus microplus. International Journal for Parasitology, 41(9), 1001–1014.

Llimargas, M., Strigini, M., Katidou, M., Karagogeos, D., & Casanova, J. (2004). Lachesin is a component of a septate junction-based mechanism that controls tube size and epithelial integrity in the Drosophila tracheal system. Development (Cambridge, England), 131(1), 181–90.

Lu, P., Zhou, Y., Yu, Y., Cao, J., Zhang, H., Gong, H., … Zhou, J. (2016). RNA interference and the vaccine effect of a subolesin homolog from the tick Rhipicephalus haemaphysaloides. Experimental and Applied Acarology, 68(1), 113–126.

Mackenstedt, U., Gauer, M., Fuchs, P., Zapf, F., Schein, E., & Mehlhorn, H. (1995). DNA measurements reveal differences in the life cycles of Babesia bigemina and B . canis , two typical members of the genus Babesia. Parasitology Research, 81, 595–604.

Malandrin, L., Jouglin, M., Moreau, E., & Chauvin, A. (2009). Individual heterogeneity in erythrocyte susceptibility to Babesia divergens is a critical factor for the outcome of experimental spleen- intact sheep infections. Veterinary Research, 40(4).

Manget, I. (1983). Package of practices in veterinary and animal husbandry for livestock and poultry. Ludhiana: Punjab Agriculture University.

Mans, B. J., de Klerk, D., Pienaar, R., & Latif, A. A. (2011). Nuttalliella namaqua: A living fossil and closest relative to the ancestral tick lineage: Implications for the evolution of blood-feeding in ticks. PLoS ONE, 6(8).

Marathe, A., Tripathi, J., Handa, V., & Date, V. (2005). Human babesiosis - a case report. Indian J Med Microbiol, 23(4), 267–269.

Masala, G., Chisu, V., Foxi, C., Socolovschi, C., Raoult, D., & Parola, P. (2012). First detection of Ehrlichia canis in Rhipicephalus bursa ticks in Sardinia, Italy. Ticks and Tick-Borne Diseases, 3(5–6), 396–7.

McHardy, N., Woollon, R., Clampitt, R., James, J., & Crawley, R. (1986). Efficacy, toxicity and metabolism of imidocarb dipropionate in the treatment of Babesia ovis infection in sheep. Res Vet Sci., 41(1), 14–20.

McNally, K., Mitzel, D., Anderson, J., Ribeiro, J., Valenzuela, J., Myers, T., … Bloom, M. (2012).

References

Differential salivary gland transcript expression profile in Ixodes scapularis nymphs upon feeding or flavivirus infection. Ticks and Tick-Borne Diseases, 3(1), 18–26.

Mehlhorn, H., & Piekarski, G. (2002). Grundriß der Parasitenkunde (6th ed.). Heidelberg, Berlin, Germany: Spektrum Akademischer Verlag GmbH.

Meldrum, S., Birkhead, G., White, D., Benach, J., & Morse, D. (1992). Human babesiosis in New York State: an epidemiological description of 136 cases. Clin Infect Dis, 15(6), 1019–23.

Mello, C. C., & Conte, D. (2004). Revealing the world of RNA interference. Nature, 431(7006), 338– 342.

Merino, O., Alberdi, P., Perez de la Lastra, J. M., & de la Fuente, J. (2013). Tick vaccines and the control of tick-borne pathogens. Front Cell Infect Microbiol, 3(July), 30.

Merino, O., Almazán, C., Canales, M., Villar, M., Moreno-Cid, J. A., Estrada-Peña, A., … de la Fuente, J. (2011). Control of Rhipicephalus (Boophilus) microplus infestations by the combination of subolesin vaccination and tick autocidal control after subolesin gene knockdown in ticks fed on cattle. Vaccine, 29(12), 2248–2254.

Merino, O., Almazán, C., Canales, M., Villar, M., Moreno-Cid, J. A., Galindo, R. C., & De la Fuente, J. (2011). Targeting the tick protective antigen subolesin reduces vector infestations and pathogen infection by Anaplasma marginale and Babesia bigemina. Vaccine, 29(47), 8575– 8579.

Merino, O., Antunes, S., Mosqueda, J., Moreno-Cid, J. A., Pérez de la Lastra, J. M., Rosario-Cruz, R., … De la Fuente, J. (2013). Vaccination with proteins involved in tick-pathogen interactions reduces vector infestations and pathogen infection. Vaccine, 31(49), 5889–5896.

Miranda-Miranda, E., Cossio-Bayugar, R., Martinez-Ibañez, F., & Bautista-Garfias, C. R. (2011). Megaselia scalaris reared on Rhipicephalus (Boophilus) microplus laboratory cultures. Medical and Veterinary Entomology, 25(3), 344–347.

Mitchell, R. D., Ross, E., Osgood, C., Sonenshine, D. E., Donohue, K. V., Khalil, S. M., … Michael Roe, R. (2007). Molecular characterization, tissue-specific expression and RNAi knockdown of the first vitellogenin receptor from a tick. Insect Biochemistry and Molecular Biology, 37(4), 375–388.

Mohamed, A., & Yagoub, I. (1990). Outbreaks of babesiosis in domestic livestock in the Eastern region of the Sudan. Tropical Animal Health and Production, 22, 123–125.

Moltmann, U. G., Mehlhorn, H., & Friedhoff, K. T. (1982). Electron microscopic study on the

References

development of Babesia ovis (Piroplasmia) in the salivary glands of the vector tick Rhipicephalus bursa. Acta Trop, 39(1), 29–40.

Montgomery, M. K., Xu, S., & Fire, a. (1998). RNA as a target of double-stranded RNA-mediated genetic interference in Caenorhabditis elegans. Proceedings of the National Academy of Sciences of the United States of America, 95(26), 15502–7.

Mortazavi, A., Williams, B. A., McCue, K., Schaeffer, L., & Wold, B. (2008). Mapping and quantifying mammalian transcriptomes by RNA-Seq. Nature Methods, 5(7), 621–628.

Mosqueda, J., Olvera-Ramirez, a, Aguilar-Tipacamu, G., & Canto, G. J. (2012). Current advances in detection and treatment of babesiosis. Current Medicinal Chemistry, 19(10), 1504–1518.

Mulenga, A., Sugimoto, C., Ingram, G., Ohashi, K., & Onuma, M. (1999). Molecular cloning of two Haemaphysalis longicornis cathepsin L-like cysteine proteinase genes. The Journal of Veterinary Medical Science / the Japanese Society of Veterinary Science, 61(5), 497–502.

Mulenga, A., Sugimoto, C., Sako, Y., Ohashi, K., Mozaria, S., Musoke, A., & Onuma, M. (1999). Molecular characterization of a Haemaphysalis longicornis tick salivary gland associated 29 kilodalton protein and its vaccine effect against tick infestation in rabbits. Infection and Immunity, 67(4), 1652–1658.

Nagalakshmi, U., Wang, Z., Waern, K., Shou, C., Raha, D., Gerstein, M., & Snyder, M. (2008). The Transcriptional Landscape of the Yeast Genome Defined by RNA Sequencing. Science, 320(5881), 1344–1349.

Naranjo, V., Ayllón, N., Pérez de la Lastra, J. M., Galindo, R. C., Kocan, K. M., Blouin, E. F., … de la Fuente, J. (2013). Reciprocal Regulation of NF-kB (Relish) and Subolesin in the Tick Vector, Ixodes scapularis. PLoS ONE, 8(6).

Oliver, J. H. (1989). Biology and systematics of ticks (Acari:Ixodida). Annual Review of Ecology and Systematics, 20(1), 397–430.

Papadopoulos, O Koptopoulos, G. (1980). Crimean-Congo hemorrhagic fever (CCHFV) in Greece: isolation of the virus from Rhipicephalus bursa ticks and a preliminary serological survey. In J. Vesenjak-Hirjan (Ed.), Arboviruses in the Mediterranean countries (pp. 117–121). Stuttgart, Germany: Gustav Fisher Verlag.

Parizi, L. F., Githaka, N. W., Logullo, C., Konnai, S., Masuda, A., Ohashi, K., & da Silva Vaz, I. (2012). The quest for a universal vaccine against ticks: Cross-immunity insights. Veterinary Journal, 194(2), 158–165.

References

Parkinson, J., & Blaxter, M. (2009). Expressed sequence tags: an overview. Statewide Agricultural Land Use Baseline 2015 (Vol. 1).

Penzhorn, B. L. (2006). Babesiosis of wild carnivores and ungulates. Veterinary Parasitology, 138(1– 2), 11–21.

Persing, D. H., Herwaldt, B. L., Glaser, C., Lane, R. S., Thomford, J. W., Mathiesen, D., … Conrad, P. A. (1995). Infection with a Babesia-like organism in northern California. The New England Journal of Medicine, 332(5), 298–303.

Prat, F., Coward, K., Sumpter, J. P., & Tyler, C. R. (1998). Molecular characterization and expression of two ovarian lipoprotein receptors in the rainbow trout, Oncorhynchus mykiss. Biology of Reproduction, 58(5), 1146–1153.

Ramin, A. (2000). The chemotherapeutic effect of “Imidocarb” against ovine babesiosis in Iran. Indian Veterinary Journal, 77(12), 1078–80.

Ranjbar-Bahadori, S., Eckert, B., Omidian, Z., Shirazi, N. S., & Shayan, P. (2012). Babesia ovis as the main causative agent of sheep babesiosis in Iran. Parasitology Research, 110(4), 1531–1536.

Rashid, A., Khan, J., Khan, M., Rasheed, K., Maqbool, A., & Iqbal, J. (2010). Prevalence and chemotherapy of babesiosis among Lohi sheep in the Livestock Experiment Station, Qadirabad, Pakistan, and environs. Journal of Venomous Animals and Toxins Including Tropical Diseases, 16(4), 587–591.

Razmi, G., & Nouroozi, E. (2010). Transovarial Transmission of Babesia ovis by Rhipicephalus sanguineus and Hyalomma marginatum. Iran J Parasitol, 5(3), 35–39.

Razmi, G. R., Naghibi, A., Aslani, M. R., Dastjerdi, K., & Hossieni, H. (2002). An epidemiological study on Babesia infection in small ruminants in Mashhad suburb, Khorasan province, Iran. Small Ruminant Research, 50(1–2), 39–44.

Ríos, L., Alvarez, G., & Blair, S. (2003). Serological and parasitological study and report of the first case of human babesiosis in Colombia. Revista Da Sociedade Brasileira de Medicina Tropical, 36(4), 493–498.

Rjeibi, M. R., Gharbi, M., Mhadhbi, M., Mabrouk, W., Ayari, B., Nasfi, I., … Darghouth, M. A. (2014). Prevalence of piroplasms in small ruminants in North-West Tunisia and the first genetic characterisation of Babesia ovis in Africa. Parasite (Paris, France), 21.

Rodriguez, R. I., & Trees, A. J. (1996). In vitro responsiveness of Babesia bovis to imidocarb dipropionate and the selection of a drug-adapted line. Veterinary Parasitology, 62(1–2), 35–41.

References

Rodríguez-Mallon, A., Fernández, E., Encinosa, P. E., Bello, Y., Méndez-Pérez, L., Ruiz, L. C., … Estrada, M. P. (2012). A novel tick antigen shows high vaccine efficacy against the dog tick, Rhipicephalus sanguineus. Vaccine, 30(10), 1782–1789.

Samish, M., Ginsberg, H., & Glazer, I. (2004). Biological control of ticks. Parasitology, 129 Suppl(February), S389–S403.

Sappington, T. W., Hays, A. R., & Raikhel, A. S. (1995). Mosquito vitellogenin receptor: Purification, developmental and biochemical characterization. Insect Biochemistry and Molecular Biology, 25(7), 807–817.

Scacheri, P. C., Rozenblatt-Rosen, O., Caplen, N. J., Wolfsberg, T. G., Umayam, L., Lee, J. C., … Collins, F. S. (2004). Short interfering RNAs can induce unexpected and divergent changes in the levels of untargeted proteins in mammalian cells. Proceedings of the National Academy of Sciences of the United States of America, 101(7), 1892–1897.

Schnittger, L., Rodriguez, A. E., Florin-Christensen, M., & Morrison, D. A. (2012). Babesia: A world emerging. Infection, Genetics and Evolution, 12(8), 1788–1809.

Schonbaum, C. P., Lee, S., & Mahowald, A. P. (1995). The Drosophila yolkless gene encodes a vitellogenin receptor belonging to the low density lipoprotein receptor superfamily. Proceedings of the National Academy of Sciences, 92(5), 1485–1489.

Schouls, M., Gubbels, J. M., De Vos, P., Van Der Weide, M., Viseras, J., De Vries, E., & Jongejan, F. (1999). Simultaneous Detection of Bovine Theileria and Babesia Species by Reverse Line Blot Hybridization. Journal of Clinical Microbiology, 37(6), 1782–1789.

Schwan, T. (2011). Natural History of Ticks: Evolution, Adaptation and Biology. (T. Press, Ed.)Critical Needs and Gaps in Understanding Prevention, Amelioration, and Resolution of Lyme and Other Tick-Borne Diseases. Washington, D.C.: The National Academies Press.

Seifert, H. (1996). Tropical Animal Health (2nd ed.). Berlin, Germany: Kluwer Academic Publishers.

Seixas, A., Friesen, K. J., & Kaufman, W. R. (2008). Effect of 20-hydroxyecdysone and haemolymph on oogenesis in the ixodid tick Almblyomma hebraeum. Journal of Insect Physiology, 54(7), 1175–1183.

Sevinc, F., Cao, S., Zhou, M., Sevinc, M., Ceylan, O., & Xuan, X. (2015). A new immunoreactive recombinant protein designated as rBoSA2 from Babesia ovis: Its molecular characterization, subcellular localization and antibody recognition by infected sheep. Veterinary Parasitology, 214(1–2), 213–218.

References

Sevinc, F., Guler, L., Sevinc, M., Ekici, O. D., & Isik, N. (2013). Determination of immunoreactive proteins of Babesia ovis. Veterinary Parasitology, 198(3–4), 391–395.

Shahzad, W., Noor, H., Ahmad, M., & Munir, R. (2013). Prevalence and Molecular Diagnosis of Babesia ovis and Theileria ovis in Lohi Sheep at Livestock Experiment Station (LES), Bahadurnagar, Okara, Pakistan. Iranian Journal of Parasitology, 8(4), 570–578.

Shayan, P., Hooshmand, E., Rahbari, S., & Nabian, S. (2007). Determination of Rhipicephalus spp. as vectors for Babesia ovis in Iran. Parasitology Research, 101(4), 1029–1033.

Shih, C. M., Liu, L. P., Chung, W. C., Ong, S. J., & Wang, C. C. (1997). Human babesiosis in Taiwan: Asymptomatic infection with a Babesia microti-like organism in a Taiwanese woman. Journal of Clinical Microbiology, 35(2), 450–454.

Silva, M. M., Santos, A. S., Formosinho, P., & Bacellar, F. (2006). Carraças associadas a patologias infecciosas em Portugal. Acta Medica Portuguesa, 19(1), 39–48.

Simitch, C., Nevenic, V., & Sibalic, S. (1956). Le traitment de la piroplamose ovine et la piroplasmose bovine par berenil. Acta Vet Belgrad., 6, 3–13.

Skrabalo, Z., & Deanovic, Z. (1957). Piroplasmosis in man; report of a case. Doc Med Geogr Trop., 9(1), 11–6.

Smith, A. D., & Kaufman, W. R. (2013). Molecular characterization of the vitellogenin receptor from the tick, Almblyomma hebraeum (Acari: Ixodidae). Insect Biochemistry and Molecular Biology, 43(12), 1133–1141.

Smith, A. D., & Kaufman, W. R. (2014). Molecular characterization of two vitellogenin genes from the tick, Almblyomma hebraeum (Acari: Ixodidae). Ticks and Tick-Borne Diseases, 5(6), 821– 833.

Sonenshine, D., & Roe, R. (2014). Biology of Ticks Volume 1 (2nd ed.). New York, USA: Oxford University Press.

Spielman, A. (1988). Prospects for suppressing transmission of Lyme disease. Annual New York Acad Science, 539, 212–20.

Spielman, A., Clifford, C., Piesman, J., & Corwin, M. (1979). Human babesiosis on Nantucket Island, USA: description of the vector, Ixodes (Ixodes) dammini, n. sp. (Acarina: Ixodidae). J Med Entomol., 15(3), 218–34.

Spielman, A., Etkind, P., Piesman, J., Ruebush, T. 2nd, Juranek, D., & Jacobs, M. (1981). Reservoir

References

hosts of human babesiosis on Nantucket Island. American Journal of Tropical Medicine Hygiene, 30(3), 560–5.

Spielman, A., Wilson, M. L., Levine, J. F., & Piesman, J. (1985). Ecology of Ixodes Dammini-borne Human babesiosis and Lyme Disease. Annual Reviews of Entomology, 30.

Stafford, K. C., & Allan, S. a. (2010). Field applications of entomopathogenic fungi Beauveria bassiana and Metarhizium anisopliae F52 (Hypocreales: Clavicipitaceae) for the control of Ixodes scapularis (Acari: Ixodidae). Journal of Medical Entomology, 47(6), 1107–1115.

Starcovici, C. (1893). Bemerkungen über den durch Babes entdeckten Blutparasiten und die durch denselben hervorgebrachten Krankheiten, die seuchenhafte Hämoglobinurie des Rindes (Babes), des Texasfieber (Th. Smith) und der Carceag der Schafe (Babes). Zbl. Bakt. I. Abt., 14, 1–8.

Steketee, R., Eckman, M., Burgess, E., Kuritsky, J., Dickerson, J., Schell, W., … Davis, J. (1985). Babesiosis in Wisconsin. A new focus of disease transmission. JAMA, 253(18), 2675–8.

Suarez, C. E., & Noh, S. (2011). Emerging perspectives in the research of bovine babesiosis and anaplasmosis. Veterinary Parasitology, 180(1–2), 109–125.

Taheri, M., Nabian, S., Ranjbar, M., Mazaheri Nezhad Fard, R., Gerami Sadeghian, A., & Sazmand, A. (2014). Study of vitellogenin in Boophilus annulatus tick larvae and its immunological aspects. Tropical Biomedicine, 31(3), 398–405.

Taylor, M., Coop, R., & Wall, R. (2015). Veterinary Parasitology (4th ed.). Oxford, UK: Wiley- Blackwell.

Telford III, S., & Maguire, J. (2006). Babesiosis. In R. Guerrant, D. Walker, & P. Weller (Eds.), Tropical Infectious Diseases: Principles, Pathogens and Practice (2th ed., pp. 1063–1071). New York, USA: Churchill Livingstone.

Tepass, U., & Hartenstein, V. (1994). The Development of Cellular Junctions in the Drosophila embryo. Developmental Biology, 161, 563–596.

Tepass, U., Tanentzapf, G., Ward, R., & Fehon, R. (2001). Epithelial cell polarity and cell junctions in Drosophila. Annual Reviews of Genetics, 35, 747–784.

Thompson, D. M., Khalil, S. M. S., Jeffers, L. A., Ananthapadmanaban, U., Sonenshine, D. E., Mitchell, R. D., … Roe, R. M. (2005). In vivo role of 20-hydroxyecdysone in the regulation of the vitellogenin mRNA and egg development in the American dog tick, Dermacentor variabilis (Say). Journal of Insect Physiology, 51(10), 1105–1116.

References

Thompson, D. M., Khalil, S. M. S., Jeffers, L. A., Sonenshine, D. E., Mitchell, R. D., Osgood, C. J., & Michael Roe, R. (2007). Sequence and the developmental and tissue-specific regulation of the first complete vitellogenin messenger RNA from ticks responsible for heme sequestration. Insect Biochemistry and Molecular Biology, 37(4), 363–374.

Trimnell, A. R., Davies, G. M., Lissina, O., Hails, R. S., & Nuttall, P. A. (2005). A cross-reactive tick cement antigen is a candidate broad-spectrum tick vaccine. Vaccine, 23(34), 4329–4341.

Trimnell, A. R., Hails, R. S., & Nuttall, P. A. (2002). Dual action ectoparasite vaccine targeting “exposed” and “concealed” antigens. Vaccine, 20(29–30), 3560–3568.

Uilenberg, G. (2006). Babesia—A historical overview. Veterinary Parasitology, 138(1–2), 3–10.

Untalan, P. M., Guerrero, F. D., Haines, L. R., & Pearson, T. W. (2005). Proteome analysis of abundantly expressed proteins from unfed larvae of the cattle tick, Boophilus microplus. Insect Biochemistry and Molecular Biology, 35(2), 141–151.

Vannier, E., Gewurz, B. E., & Krause, P. J. (2008). Human babesiosis. Infectious Disease Clinics of North America, 22(3), 469–88, viii–ix.

Veiga, L. P. H. N., Souza, A. P. de, Bellato, V., Sartor, A. A., Nunes, A. P. de O., & Cardoso, H. M. (2012). Resistance to cypermethrin and amitraz in Rhipicephalus (Boophilus) microplus on the Santa Catarina Plateau, Brazil. Revista Brasileira de Parasitologia Veterinária, 21(2), 133–136.

Vera, J. C., Wheat, C. W., Fescemyer, H. W., Frilander, M. J., Crawford, D. L., Hanski, I., & Marden, J. H. (2008). Rapid transcriptome characterization for a nonmodel organism using 454 pyrosequencing. Molecular Ecology, 17(7), 1636–1647.

Vial, H. J., & Gorenflot, a. (2006). Chemotherapy against babesiosis. Veterinary Parasitology, 138(1– 2), 147–160.

Wang, Z., Gerstein, M., & Snyder, M. (2009). RNA-Seq: a revolutionary tool for transcriptomics. Nat Rev Genet., 10(1), 57–63.

Weber, G., & Friedhoff, K. (1971). Light microscopy studies on the development of Babesia ovis (Piroplasmidea) in Rhipicephalus bursa (Ixodoidea). II. Cytochemical studies of differentiated merozoites in the salivrry glands of female ticks. Z Parasitenkd, 35(3), 218–33.

Wei, Q., Tsuji, M., Zamoto, A., Kohsaki, M., Matsui, T., Shiota, T., … Ishihara, C. (2001). Human babesiosis in Japan: Isolation of Babesia microti-like parasites from an asymptomatic transfusion donor and from a rodent from an area where babesiosis is endemic. Journal of Clinical Microbiology, 39(6), 2178–2183.

References

Weigl, B., Domingo, G., Labarre, P., & Gerlach, J. (2008). Towards non- and minimally instrumented, microfluidics-based diagnostic devices. Lab. Chip., 8(12), 1999–2014.

Western, K., Benson, G., Gleason, N., Healy, G., & Schultz, M. (1970). Babesiosis in a Massachusetts resident. N Engl J Med, 283(16), 854–6.

Whangbo, J. S., & Hunter, C. P. (2008). Environmental RNA interference. Trends in Genetics, 24(6), 297–305.

Whyard, S., Singh, A. D., & Wong, S. (2009). Ingested double-stranded RNAs can act as species- specific insecticides. Insect Biochemistry and Molecular Biology, 39(11), 824–832.

Willadsen, P. (2004). Anti-tick vaccines. Parasitology, 129(367–387).

Willadsen, P. (2006). Tick control: further thoughts on a research agenda. Trends in Parasitology, 22(12), 550–551.

Willadsen, P. (2008). Antigen cocktails: valid hypothesis or unsubstantiated hope? Trends in Parasitology, 24(4), 164–167.

Willadsen, P., Riding, G. a, McKenna, R. V, Kemp, D. H., Tellam, R. L., Nielsen, J. N., … Gough, J. M. (1989). Immunologic control of a parasitic arthropod. Identification of a protective antigen from Boophilus microplus. Journal of Immunology (Baltimore, Md. : 1950), 143(4), 1346–1351.

Yeruham, I., Hadani, A., & Galker, F. (1996). Effect of passage of Babesia ovis in the gerbil (Acomys cahirinus) on the course of infection in splenectomized lambs. Veterinary Parasitology, 65, 157– 161.

Yeruham, I., Hadani, A., & Galker, F. (1998). Some epizootiological and clinical aspects of ovine babesiosis caused by Babesia ovis - A review. Veterinary Parasitology, 74(2–4), 153–163.

Yeruham, I., Hadani, A., & Galker, F. (2000). The life cycle of Rhipicephalus bursa Canestrini and Fanzago, 1877 (Acarina: Ixodidae) under laboratory conditions. Veterinary Parasitology, 89, 109–116.

Yeruham, I., Hadani, A., Galker, F., Avidar, Y., & Bogin, E. (1998). Clinical, clinico-pathological and serological studies of Babesia ovis in experimentally infected sheep. Journal of Veterinary Medicine Series B, 45(7), 385–394.

Yeruham, I., Hadani, a, & Galker, F. (2001). The effect of the ovine host parasitaemia on the development of Babesia ovis (Babes, 1892) in the tick Rhipicephalus bursa (Canestrini and Fanzago, 1877). Veterinary Parasitology, 96(3), 195–202.

References

Yokoyama, N., Okamura, M., & Igarashi, I. (2006). Erythrocyte invasion by Babesia parasites: Current advances in the elucidation of the molecular interactions between the protozoan ligands and host receptors in the invasion stage. Veterinary Parasitology, 138(1–2), 22–32.

Zintl, A., Finnerty, E. J., Murphy, T. M., de Waal, T., & Gray, J. S. (2011). Babesias of red deer (Cervus elaphus) in Ireland. Veterinary Research, 42(protocol I), 1–6.

6 Appendix

Appendix

Appendix I

Table 6.1: Sequence identity between different available vitellogenin nucleotide sequences and the obtained vitellogenin sequences.

R. microplus Vg-3 H. longicornis Vg-3 R. microplus Vg-1 R. microplus Vg-2 R. appendiculatus Vg-3 A0A034WTS6 E1CAY0 A0A034WTV5 A0A034WWF8 A0A131YWP6 R. microplus Vg-3 100 39.06 41.02 42.67 41.75 A0A034WTS6

H. longicornis Vg-3 100 42.67 43.48 42.84 E1CAY0

R. microplus Vg-1 100 49.06 48.49 A0A034WTV5

R. microplus Vg-2 100 93.61 A0A034WWF8

R. appendiculatus Vg-3 100 A0A131YWP6

Appendix

Table 6.2: Sequence identity between different available genes encoding for secreted glycine-rich cement proteins nucleotide sequences and the obtained sequence.

A. triste A. parvum I. scapularis A. cajennense R. pulchellus A. americanum R. microplus EEC183 A0A023F A0A023FLK9 A0A023GE61 L7MBM8 A0A0C9SFJ8 A0A034WZ12 66 YT7 I. scapularis A0A023FLK9 100 61.60 37.99 35.92 41.51 39.65 36.33 A. cajennense A0A023GE61 100 36.00 35.92 40.97 37.80 36.13 A. triste EEC18366 100 41.71 43.26 35.79 34.46 A. parvum A0A023 FYT7 100 45.34 37.71 37.24

R. pulchellus L7MBM8 100 45.85 44.04 A. americanum A0A0C9SFJ8 100 49.45

R. microplus A0A034WZ1 100 2

Table 6.3: Sequence identity between different available lachesin nucleotide sequences and the obtained lachesin sequence. Ixodes scapularis R. pulchellus R. appendiculatus B7QM16 L7LSG7 A0A131YVX3 Ixodes scapularis B7QM16 100 46.01 46.43 R. pulchellus L7LSG7 100 94.91

R. appendiculatus A0A131YVX3 100

Appendix

Appendix II

Figure 6.1: Detection of B. ovis in the tick salivary glands by AGE of qPCR products in silenced groups st1 and mt5. The protocol followed is described in Aktas et al (2005). Samples were electrophoresed on a 1.2% Agarose/SYBR® Safe gel, 0,5X TBE. The lanes M correspond to the ladder. The last lane corresponds to a standard of B. ovis (positive control).

Figure 6.2: Detection of B. ovis in the tick salivary glands by AGE of qPCR products in the group Control and in the silenced groups cf2 and cf1+cf2. The protocol followed is described in Aktas et al (2005). Samples were electrophoresed on a 1.2% Agarose/SYBR® Safe gel, 0,5X TBE. The lanes M correspond to the ladder and a 1:10 standard sample of B. ovis was run (positive control).

Appendix

Figure 6.3: Detection of B. ovis in the tick salivary glands by AGE of qPCR products in the group Control. The protocol followed is described in Aktas et al (2005). Samples were electrophoresed on a 1.2% Agarose/SYBR® Safe gel, 0,5X TBE. The lanes M correspond to the ladder.

Figure 6.4: Detection of B. ovis in the tick salivary glands by AGE of qPCR products in the group Control. The protocol followed is described in Aktas et al (2005). Samples were electrophoresed on a 1.2% Agarose/SYBR® Safe gel, 0,5X TBE. The first lane (M) corresponds to the ladder and the last lane corresponds to a 1:10 standard sample of B. ovis (positive control).

Appendix

Figure 6.5: Detection of B. ovis in the tick ovaries by AGE of qPCR products in the group Control and in the silenced groups cf1, cf2, st1, mt5 and cf1+cf2. The protocol followed is described in (Aktas et al 2005). Samples were electrophoresed on a 1.2% Agarose/SYBR® Safe gel, 0,5X TBE. The lanes M correspond to the ladder.

Figure 6.6: Detection of 16S tick gene in the tick ovaries by AGE of qPCR products in the group Control and in the silenced groups cf1, st1, mt5, cf2 and cf1+cf2. The protocol followed is described in Aktas et al (2005). Samples were electrophoresed on a 1.2% Agarose/SYBR® Safe gel, 0,5X TBE. The lanes M correspond to the ladder. Two B. ovis standard samples with different dilutions (1:10 and 1:100) were run.

Appendix

Figure 6.7: Detection of 16S tick gene in the tick salivary glands by AGE of qPCR products in the group Control and in the silenced groups cf1, st1, cf2 and mt5. The protocol followed is described in Aktas et al (2005). Samples were electrophoresed on a 1.2% Agarose/SYBR® Safe gel, 0,5X TBE. The lanes M correspond to the ladder.

Figure 6.8: Detection of 16S tick gene in the tick salivary glands by AGE of qPCR products in the silenced group cf1+cf2. The protocol followed is described in Aktas et al (2005). Samples were electrophoresed on a 1.2% Agarose/SYBR® Safe gel, 0,5X TBE. The first lane (M) corresponds to the ladder and the last lane corresponds to a 1:5 standard sample of 16S (positive control).

Appendix

Figure 6.9: Detection of cf2 tick gene in the tick ovaries by AGE of qPCR products in the silenced group cf2. The protocol followed is described in Aktas et al (2005). Samples were electrophoresed on a 1.2% Agarose/SYBR® Safe gel, 0,5X TBE. The first lane corresponds to the ladder (M).

Figure 6.10: Detection of st1, cf1 and β-tubulin tick genes in the tick ovaries by AGE of qPCR products in the silenced groups st1, cf1 and cf1+cf2. The protocol followed is described in Aktas et al (2005). Samples were electrophoresed on a 1.2% Agarose/SYBR® Safe gel, 0,5X TBE. The lanes M correspond to the ladder.

Appendix

Figure 6.11: Detection of st1, cf1 and β-tubulin tick genes in the tick ovaries by AGE of qPCR products in the silenced groups st1, cf1 and cf1+cf2. The protocol followed is described in Aktas et al (2005). Samples were electrophoresed on a 1.2% Agarose/SYBR® Safe gel, 0,5X TBE. The lanes M correspond to the ladder.

Figure 6.12: Detection of mt5 tick gene in the tick salivary glands and ovaries by AGE of qPCR products in the group Control and in the silenced group mt5. The protocol followed is described in Aktas et al (2005). The lanes M correspond to the ladder and standard samples (1:5 and 1:125) were run (positive controls).

Appendix

Figure 6.13: Detection of β-actin and cf2 tick genes in the tick ovaries by AGE of qPCR products in the silenced groups st1, cf1 and cf1+cf2. The protocol followed is described in Aktas et al (2005). Samples were electrophoresed on a 1.2% Agarose/SYBR® Safe gel, 0,5X TBE. The lanes M correspond to the ladder.

Figure 6.14: Detection of β-actin, β-tubulin, st1 and cf1 tick genes in the tick ovaries by AGE of qPCR products in the group Control and in the silenced groups mt5 and cf2. The protocol followed is described in Aktas et al (2005). Samples were electrophoresed on a 1.2% Agarose/SYBR® Safe gel, 0,5X TBE. The lanes M correspond to the ladder.

Appendix

Figure 6.15: Detection of β-tubulin, cf2 and β-actin tick genes in the tick ovaries by AGE of qPCR products in the silenced group mt5, group Control and in the silenced group cf2, respectively. The protocol followed is described in Aktas et al (2005). Samples were electrophoresed on a 1.2% Agarose/SYBR® Safe gel, 0,5X TBE. The first lane (M) corresponds to the ladder.