Related Genes Using Crispr/Cas9

TARGETING ZEBRAFISH HAIR BUNDLE-

RELATED GENES USING CRISPR/CAS9

HAIMENG BAI

Submitted in partial fulfillment of the requirements for

the degree of Master of Science

Thesis Advisor:

Brian M. McDermott Jr., Ph.D.

Department of Biology

CASE WESTERN RESERVE UNIVERSITY

August, 2017

CASE WESTERN RESERVE UNIVERSITY

SCHOOL OF GRADUATE STUDIES

We hereby approve the thesis/dissertation of

Haimeng Bai

candidate for the Master of Science degree*.

Roy Ritzmann, Ph.D. Chair of Committee

Brian M. McDermott, Ph.D.

Ruben Stepanyan, Ph.D.

Audrey Lynn, Ph.D.

(date) 5/24/2017

*We also certify that written approval has been obtained for any proprietary material contained therein.

Table of Contents Abstract ...... 12

Chapter 1: Background Information ...... 13

Hearing in Vertebrates ...... 14

Hair Cell ...... 15

Hair Bundle ...... 19

Using Zebrafish as a Model Organism ...... 21

Chapter 2: Targeting Zebrafish Hair Bundle-Related Genes Using CRISPR/Cas9 ...... 23

Introduction ...... 24

MET Complex/Channel ...... 24

TMC Protein Family ...... 26

LHFPL5 (TMHS) ...... 30

MACF1 ...... 31

Materials and Methods ...... 36

Results ...... 44

CRISPR/Cas9 induced mutation of tmc5 in zebrafish ...... 44

CRISPR/Cas9 induced mutation of lhfpl5a in zebrafish ...... 49

CRISPR/Cas9 induced mutation of tmc6b in zebrafish ...... 52

CRISPR/Cas9 induced mutation of macf1a in zebrafish ...... 56

Discussion ...... 60

Chapter 3: Generation of transgenic zebrafish line expressing dendra2 tagged β-actin in hair cells ...... 63

Introduction ...... 64

β-actin in Hair Cell ...... 64

Dendra2 ...... 66

Materials and Methods ...... 67

Plasmid Preparation and Microinjection ...... 67

Screening for Positive Fish ...... 68

Photoconversion ...... 68

Results ...... 69

Discussion ...... 71

References ...... 74

Acknowledgements

First and for most, I would like to thank my Master's advisor, Dr. Brian M. McDermott for his education, continuous support, and caring during the past two years. He patiently encouraged me when I was low and fully supported me by giving me intellectual freedom in my projects. His guidance helped me at all times during research. From him, I experienced the biggest passion for science. Besides work, he is also a thoughtful friend to me who cares about me and is always ready to help.

I would like to thank the rest of my thesis committee: Dr. Roy Ritzmann, Dr. Audrey

Lynn, and Dr. Ruben Stepanyan for their support, guidance, and education. I am also very thankful to Dr. Jessica Fox and Ms. Julia Brown-Allen for all their help with my future career.

My thanks also go to all the members of McDermott lab, Carol Fernando, Hoa Nguyen,

Zongwei Chen, Shaoyuan Zhu, Robin Woods Davis, Shengxuan Wang, Shenyu Sun, Jun

Wang, Danyang Zhu, and Kayla Kindig, and former lab member Dr. Philsang Hwang and

Nilay Gupta, especially for all their valuable advice and training.

My particular thanks to my parents for their love and support, and to my girlfriend,

Zhuo Chen, for her unwavering companionship and love.

I would like to especially thank God, who saved me and provided me this chance to be trained as a Master of Science student out of his wonderful work. For his power, I can

finish this journey and overcome the difficulties in my projects, and for his love, I can walk in the light and rejoice.

Dedication

This thesis is dedicated to the God.

"For thine is the kingdom, and the power, and the glory, forever. Amen."

List of Tables

Table 1...... 39

Table 2...... 41

Table 3...... 42

Table 4...... 61

List of Figures

Figure 1.1...... 15

Figure 1.2...... 16

Figure 1.3...... 18

Figure 1.4...... 20

Figure 1.5...... 22

Figure 2.1...... 25

Figure 2.2 ...... 28

Figure 2.3 ...... 30

Figure 2.4 ...... 32

Figure 2.5 ...... 33

Figure 2.6 ...... 35

Figure 2.7...... 37

Figure 2.8...... 45

Figure 2.9...... 47

Figure 2.10...... 49

Figure 2.11 ...... 50

Figure 2.12 ...... 52

Figure 2.13...... 52

Figure 2.14 ...... 53

Figure 2.15 ...... 54

Figure 2.16 ...... 55

Figure 2.17 ...... 56

Figure 2.18 ...... 57

Figure 2.19 ...... 58

Figure 2.20 ...... 59

Figure 3.1...... 65

Figure 3.2...... 67

Figure 3.3...... 70

Figure 3.4...... 72

List of Abbreviations IHCs inner hair cells

OHCs outer hair cells

MET mechanoelectrical transduction

CDH23 cadherin 23

PCDH15 protocadherin 15

CP cuticular plate

TMC transmembrane channel-like

TMIE transmembrane inner ear

LHFPL5 lipoma HMGIC fusion partner- like 5

TMHS tetraspan membrane protein of hair cell stereocilia

MACF1 microtubule actin cross-linking factor 1

ACF7 actin crosslinking family protein 7

CRISPR clustered regularly interspaced short palindromic repeats

ZFNs zinc-finger nuclease

TALENs transcription activator-like effector nuclease sgRNA single-guide RNA

NHEJ nonhomologous end joining indel insertion/deletion

PAM protospacer adjacent motifs

WT wild-type dpf days post fertilization

PCR polymerase chain reaction bp base pair nt nucleotide pv3b parvalbumin 3b

FRAP fluorescence recovery after photo-bleaching

UV ultraviolet

HDR homologous direct repair

µl microliter ng nanogram nl nanoliter

µm micrometer

NCBI National Center for Biotechnology Information

BLAST Basic Local Alignment Search Tool

TMHMM transmembrane helix hidden Markov model

Targeting Zebrafish Hair Bundle-Related Genes Using

CRISPR/Cas9

Abstract

Hair cells are vital mechanosensory cells in the inner ear. At the apex of each hair cell, there are stereocilia with a staircase-like pattern with a mechanoelectrical transduction

(MET) complex located at the tip of each of the shorter protrusions. This complex is functionally critical to the hair cell, but its structure remains unknown. In addition, the morphology of the hair bundle is closely related to its function, and the mechanisms of its formation are mostly a mystery. For this thesis study, I aimed to investigate the involvement and function of genes that are potentially related to hair bundle structure and function by knocking them out using CRIPSR/Cas9 in zebrafish. The genetically altered fish that I generated should yield insights into the molecular basis of hearing.

Chapter 1: Background Information

Hearing in Vertebrates

Hearing is a vital way of receiving information from the world that complements other senses such as vision and touch. It is reported by the National Institute on Deafness and

Other Communication Disorders (NIDCD) that, in the United States of America, there are

30 million people who are affected by different levels of hearing loss. Deafness can cause much inconvenience in life. A better understanding of the process and mechanism of hearing will be very helpful for developing treatments for deafness.

A mammalian ear is composed of three main sections: the outer ear, the middle ear, and the inner ear. The cochlear and vestibular systems in the inner ear are where hair cells, the sensory cells of hearing, balance, and head movement detection, reside (Figure 1.1). A sound wave is first captured by the auricle. Then it goes through the ear canal and induces movement of the tympanum. The mechanical stimulus of sound is transferred into the cochlea by three bones: the malleus, incus, and stapes. The cochlea is filled with fluid. The vibration of the fluid leads to shearing movement of the tectorial membrane relative to basilar membrane in the cochlea. Hair cells that are embedded in the basilar membrane detect the shear-movement-induced stereocilia deflection and transduce it into electrical signals. The hair cells are innervated by afferent and efferent neurons (Figure 1.3). Then the afferent neurons in the spiral ganglia transfer the signals to the brain so that we can hear.

Figure 1.1. Human ear anatomy. Figure adapted from (Kandel et al., 2012).

Hair Cell

Hair cells are the mechanosensory cells of both the auditory and vestibular systems in vertebrates. They sense gravity, head movement and sound vibrations and convert them into neural signals (Vollrath et al., 2007). In mammals, there are two types of hair cells for both the cochlear and vestibular systems. In the vestibule system, type 1 and type 2 hair cells are distinguished by the shape of the soma. In the cochlea, there is one row of inner hair cells (IHCs), that are connected to afferent neurons and responsible for sensory

processing, and three rows of outer hair cells (OHCs), which are innervated by efferent neurons (Figure 1.2). The hair bundle, located on the apex of each hair cell, is the mechanical sensory organelle. It has a structure of actin-based stereocilia arranged in precise rows of increasing height (Vollrath et al., 2007). The kinocilium, which is a tall true cilium, is not essential for hearing, as it degenerates around the time of birth in mammalian cochlear hair cells, but is still important in development (Fettiplace and Kim,

2014; Kandel et al., 2012). Each hair cell has its best sensing direction which is toward the kinocilium.

Figure 1.2. Rat cochlea hair cells. One row of inner hair cells and three rows of outer hair cells are embedded in the basilar membrane. Hair bundles are covered by the tectorial

membrane. Figure adapted from (Fettiplace and Kim, 2014).

Due to vibration or acceleration, the stereocilia deflect towards the kinocilium and the mechanoelectrical transduction (MET) channels located at the tip of each stereocilium open, becoming permeable to potassium and calcium ions, and generating a depolarization potential. The potassium and calcium entry further triggers other ion channels to open, such as Ca2+-sensitive K+ channels and voltage-sensitive K+ channels, and the hair cell depolarizes (Kandel et al., 2012). The influx of calcium results in the release of synaptic vesicles at synaptic ribbons, organelles that specifically exist in sensory cells to permit an immediate response to stimuli by neurotransmitter release (Guillet et al., 2016). The signal is transferred to the central nervous system by the afferent spiral ganglion. The hair cell

MET process is highly sensitive. Thus the ear can detect an extremely wide range of intensity (Gillespie and Müller, 2009).

Figure 1.3. Lateral view of a cochlea hair cell. Figure adapted from (Kandel et al., 2012).

At rest, the hair cell MET channel has low-level permeability which results in a base firing rate in the axon. Positive deflection, deflection towards the tallest stereocilia, opens

the channel wider and further depolarizes the cell, while negative deflection hyperpolarizes it (Kandel et al., 2012).

Hair Bundle

The hair bundle is the mechanical sensory organelle of the hair cell composed of tens to hundreds of stereocilia supported by a cytoskeleton of actin filaments which are cross- linked with the proteins Plastin, Fascin, Xirp2, and Espin (Kandel et al., 2012; Scheffer et al., 2015; Vollrath et al., 2007). Positive deflection of fewer than 1 µm can generate a current of about 1 nA (Corey, 2006). Negative deflection closes the channels which are slightly open at rest. Hwang et al., (2015) have shown that the β-actin in stereocilia is dynamic over time. Old actin can be replaced by new protein not only on the plus end of the filament but at any position (Hwang et al., 2015). This discovery indicates that a damaged stereocilium could be repaired by replacement of the whole stereocilium.

Hair bundle stereocilia are not separate. They are connected by 4 types of connections: ankle links which connect stereocilia at the taper region, shaft connectors which connect stereocilia above the ankle links, horizontal top connectors which connect stereocilia at upper shaft and tip links which connect the tip of each stereocilium with its taller neighbor

(Vollrath et al., 2007). Horizontal top connectors cause the bundle to move as a unit during stimulation (Kandel et al., 2012). The tension in the tip links opens the MET channel during deflection. The tip link is composed of two parts: cadherin 23 (CDH23) at the upper end and protocadherin 15 (PCDH15) at the lower end. The two proteins are joined at their tips

in a Ca2+ sensitive manner (Kandel et al., 2012). A recent electron micrographic image has lead researchers to suggest 2 models of transmission of the force from tip link to the channel.

The tip link either connects to the membrane (Figure 1.4 B) activating channels by membrane tension, or connects to the cell cytoskeleton (Figure 1.4 C) acting as a force sensor (Fettiplace and Kim, 2014). High-speed calcium imaging showed that Ca2+ enters through the shorter stereocilia, indicating that MET channels are only located at the tips of shorter stereocilia (Beurg et al., 2009). Another recent electrophysiology study calculated that there are 2 MET channels per tip link (Fettiplace and Kim, 2014). Under the hair bundle, inside the cell body, there is a cuticular plate (CP) that is a matrix made of actin filaments which enmeshes stereocilia rootlets (Figure 1.3).

Figure 1.4. The tip link and connections. A: transmission electron micrograph of a guinea pig outer hair cell illustrating the tip link and the electron-dense regions at the upper and

lower ends. Scale bar = 0.2 µm. B: one theoretical model for the connections of the MT channel, where two channels float free in the plasma membrane. C: another model where each MT channel is attached to one strand of the tip link and is also anchored to the internal cytoskeleton by an “adaptation spring.” Figure adapted from (Fettiplace and Kim, 2014).

Using Zebrafish as a Model Organism

Zebrafish (Danio rerio) has become a model organism for studying hearing and other vertebrate gene functions. Not only because zebrafish are easy to maintain, and experiments are easy to operate, but also because a great percentage of human genes have orthologues in zebrafish (Howe et al., 2013). Additionally, one female zebrafish can lay

100 to 300 eggs per mating, and the fertilization process happens externally, so every developmental stage is possible for study ex utero (Whitfield, 2002). As to hearing, the hair cell morphology of zebrafish is very similar to human and mice (Nicolson, 2005). Zebrafish with balance and hearing defects lead to a swimming behavior in circular motions and can be easily tested by examining the startle response (Nicolson, 2005).

At early embryonic stages, zebrafish larvae are transparent, which makes the observation of fluorescent labeling very easy. Moreover, zebrafish have a lateral line system to sense peripheral water movement along the body's surface (Figure 1.5), consisting of neuromast organs, which also contain hair cells (Bleckmann and Zelick, 2009;

Ghysen and Dambly-Chaudière, 2004). This provides convenience for visualization

experiments of hair cells as compared with mice and other species, which is that dissections are not necessary, and visualization can be done in live animals.

Figure 1.5. Zebrafish ear and lateral line system. Fish ears (oval with pink background) are behind eyes. Neuromast organs in lateral line system are shown in red dots.

Zebrafish embryos are relatively big, which enable us to manipulate the expression of genes and generate transgenic animals via microinjection of certain RNA or DNA constructs. Nowadays, with the progress of the Sanger sequencing project, the map of the zebrafish genome is becoming more completed and clear; in other words, there is a whole database of zebrafish genomic information ready for us to use. All of these factors indicate that the zebrafish is a good model for genetics and developmental studies of hearing.

Chapter 2: Targeting Zebrafish Hair Bundle-Related Genes

Using CRISPR/Cas9

Introduction

MET Complex/Channel

Deflections of the hair bundle open or close the MET channel. Channel opening is very fast. In mammals, it takes less than 10 µs (Vollrath et al., 2007). Small cations up to

1.2 nm in diameter can cross the MET channel. The MET channels on stereocilia are immersed in a high K+ low Ca2+ endolymph and are particularly permeable to Ca2+ (Vollrath et al., 2007).

The molecular structure of the MET channel has been pursued for over 20 years

(Fettiplace, 2016). Hearing loss is the most common symptom resulting from the dysfunction of MET in humans, and mutations in over 80 genes have been associated with the disease (Wu and Müller, 2016). Apart from tip link proteins CDH23 and PCDH15, several classic mechanosensory related ion channels including the Piezo protein family, and some newly discovered hair cell proteins, such as transmembrane channel-like (TMC) protein family, transmembrane Inner Ear (TMIE) protein, lipoma HMGIC fusion partner- like 5 (LHFPL5), have been shown to be highly related to MET in hair cells (Figure 2.1).

TMC1 and TMC2 are suspected to be components that form the pore of the MET channel

(Pan et al., 2013). It has yet to be shown that TMC1 and TMC2 can actually form a pore.

Several experiments failed to demonstrate that heterologous expression of TMC1 and

TMC2 grant MET in cultured cells (Kawashima et al., 2011; Labay et al., 2010; Zhao et al., 2014). LHFPL5 was shown to be the connector that links PCDH15 and TMC1 (Beurg

et al., 2015). Gleason et al., (2009) found that the deficiency of TMIE in zebrafish leads to a lack of microphonic potential in response to stimulus and Zhao et al., (2014) revealed

TMIE to be a binding partner of PCDH15 and LHFPL5 in mice.

Figure 2.1. Schematic of a hair cell bundle, tip link, and the MET channel. Key proteins are labeled. Figure adapted from (Fettiplace, 2016).

Interestingly, hair cells without tip-links show robust reverse-polarity currents (Beurg et al., 2014; Marcotti et al., 2014). It was found recently that the reverse-polarity current might be carried by another ion channel located at the apical surface of the hair cell that its function is affected by mutation of Piezo2 protein (Beurg et al., 2016; Wu et al., 2016).

Some of the genes that are related to my thesis project are introduced below.

TMC Protein Family

Some of the members of the protein family transmembrane channel-like (TMC) are required for MET in mice (Kawashima et al., 2011). There are 8 members in the TMC protein family. They have multiple transmembrane domains and a TMC domain. TMC1 was shown to be essential for normal MET in the hair cell (Kim et al., 2013). Mutations in the TMC1 gene can cause hearing loss without vestibular dysfunction in both mice and humans, in both dominant and recessive forms. Mice with a targeted deletion of Tmc1 were deaf (Kawashima et al., 2011). It is also reported that expression of either TMC1 or TMC2 could rescue Tmc1 and Tmc2 double homozygous mutant mice (Kawashima et al., 2011).

TMC1 is also suspected to interact with PCDH15 (Maeda et al., 2014).

TMC2 was also found to be involved in the MET complex. RNA in situ hybridization analysis using Tmc2 mRNA confirmed the expression of TMC2 only in hair cells and expression of TMC2::AcGFP showed that TMC2 was localized to the tips of stereocilia in both vestibular and cochlear hair cells (Figure 2.2) (Kawashima et al., 2011; Kurima et al.,

2015). They also found that, in Tmc1 and Tmc2 double mutant mice, utricle hair cells had

no detectable FM1-43 uptake, which indicated disrupted MET (Kawashima et al., 2011;

Kurima et al., 2015). Interestingly, Kawashima et al., (2011)reported that mice with deletions of Tmc1 were deaf while those with Tmc2 deletions were phenotypically normal.

Tmc1 and Tmc2 double mutant mice have vestibular dysfunction, deafness, and structurally normal hair cells but are missing all mechanotransduction (Kawashima et al., 2011; Kurima et al., 2015). Thus, TMC2 was suspected to functionally compensate for TMC1

(Kawashima et al., 2011).

Figure 2.2. Localization of TMC2::AcGFP. F-actin was tagged by mCherry to create a red background. TMC2::AcGFP is mainly located on the tips of hair cell stereocilia. Figure adapted from (Kawashima et al., 2011).

It becomes even more interesting when TMC1 and TMC2 are disrupted together. Kim et al., (2013) found that calcium ionic permeability and whole-cell currents depend on

TMC genotype and that the properties varied according to whether the hair cell was TMC1- or TMC2- deficient. Mice with Tmc1 and Tmc2 double knock-out or Tmc1 or Tmc2 single knock-outs all display no normal MET current but have a reduced reverse-polarity current.

Hair cells in Tmc1 Beethoven mutation mice had smaller single-channel conductance and lower Ca2+ permeability (Pan et al., 2013). These results mean that TMC1 and TMC2 can affect the MET channel at the molecular level (Kawashima et al., 2014; Kim et al., 2013).

Studies of Caenorhabditis elegans tmc orthologs further demonstrated TMC proteins as ion channel subunits. Deletion of the homolog tmc-1 results in loss of salt-evoked neuronal activity and behavioral avoidance of high concentrations of NaCl (Chatzigeorgiou et al.,

2013). TMC-1 expressed in Chinese hamster ovary cells in C. elegans created a predominantly cationic conductance that is activated by high extracellular sodium

(Chatzigeorgiou et al., 2013). An electrophysiology study done by Kim and Fettiplace

(2013) states that the basal OHCs Ca2+ permeability increased by knocking out of Tmc1, whereas permeability in apical OHCs and in IHCs decreased by knocking out of Tmc2, indicating the TMC proteins are chaperones for MET ion trafficking. For my thesis study, we chose tmc5 and tmc6b from the Tmc family as our targets, since their protein structures are similar to Tmc1 and Tmc2. Fluorescent in situ experiment which was previously done by our lab also showed that the Tmc5 was expressed specifically in the ear in zebrafish

(Figure 2.3).

Figure 2.3. tmc5 fluorescent in situ hybridization pictures. (A and B) Antisense and sense probed 5 dpf zebrafish demonstrate expression of Tmc5 in otocyst (arrowhead).

LHFPL5 (TMHS)

LHFPL5, also known as tetraspan membrane protein of hair cell stereocilia (TMHS), is a member of the tetraspan superfamily, which encodes proteins with diverse functions such as tight junction proteins, gap junction proteins, ion channel subunits, and tetraspanins

(Xiong et al., 2012). LHFPL5 is a small protein with four putative transmembrane helices and two short cysteine-containing extracellular loops (Vollrath et al., 2007). Mutations of

LHFPL5 can cause an autosomal recessive nonsyndromic hearing loss in humans, and deafness in hurry-scurry mice (Kalay et al., 2006; Longo-Guess et al., 2005). In situ hybridization showed expression of Lhfpl5 in both IHCs and OHCs of the cochlea as well as in vestibular hair cells (Xiong et al., 2012). Interestingly, stereocilia in hair bundles from

Lhfpl5 mutant mice were rarely to be observed connected by tip links, PCDH15 expression level was also low, and the loss of PCDH15 connected to hair bundles happened progressively (Xiong et al., 2012). Beurg et al., (2015) claimed that LHFPL5 is required for normal MET current, perhaps via regulating TMC1 participation. LHFPL5 and TMC1 were both shown to interact with PCDH15 by immunolabeling and coimmunoprecipitation, and they may form a linker complex with the MET channel (Beurg et al., 2015; Fuchs,

2015). Zhao et al., (2014) stated that TMIE is also involved in the linker complex that interacts with LHFPL5 and PCDH15, while TMC1 might be the pore-forming component for MET.

MACF1

Microtubule Actin Cross-linking Factor 1 (MACF1) is a huge gene that spans over three hundred kilobases in zebrafish. One of its protein products in hair cells, also known as actin crosslinking family protein 7 (ACF7), is gigantic (>500 kDa) and capable of interacting with both actin and microtubules (Leung et al., 1999). With the help of alternative splicing, ACF7 has a large number of different isoforms (Gong et al., 2001).

Additionally, it was reported that a mutation of macf1a in the zebrafish results in animal-

vegetal polarity defects in the oocyte (Gupta et al., 2010). Previously, our lab demonstrated that ACF7 is located in between of hair cell stereocilia and cuticular plate using immunolabelling and quantitative analysis (Figure 2.4) (Antonellis et al., 2014). They then found ACF7 to be a potential linker in zebrafish hair cells by utilizing transmission electron microscopy (Figure 2.5) (Antonellis et al., 2014).

Figure 2.4. (A) Hair cell co-labeled with phalloidin (stains F-actin as red), ACF7 antibody

(green), and tubulin antibody (blue) showing that ACF7 signal (green) rests between phalloidin (red) and tubulin (blue) signals. (B) Fluorescence intensity profile from hair cell in A, using the yellow-line region of interest. Figure adapted from (Antonellis et al., 2014).

Figure 2.5. Linker proteins, which may be ACF7, are found to bridge microtubules that inserted into the CP with actin meshwork. (A) 2D transmission electron microscopy of an inner ear hair cell from a 6-dpf zebrafish. Arrowhead shows a microtubule terminating within the CP. Asterisk shows the apical surface of the cell. (B) A ~ 1-nm-thick slice through a tomographic 3D reconstruction corresponding to the 2D projection view shown in A. (C) An enlarged view of rectangle in B. (D and E) Manual segmentation and surface rendering of the densities of interest, with microtubule depicted in mint, actin meshwork in purple, and connecting filaments in red, revealing a ~ 15- to 20-nm-wide gap between the microtubule and the actin meshwork, which is bridged by the filamentous connections.

The boundary of the actin meshwork is indicated in blue. Mitochondria adjacent to the CP are shown in yellow and green. Figure adapted from (Antonellis et al., 2014).

CRISPR/Cas9

The most classic way to study a gene is to knock it out and see what the consequences are. Our lab has tried all of the gene knock-out methods: zinc-finger nuclease (ZFNs), transcription activator-like effector nuclease (TALENs), and clustered regularly interspaced short palindromic repeats (CRISPR) /Cas9. The RNA-mediated CRISPR/Cas9 is a novel gene knock-out and modification tool. Different from traditional protein/domain based ZFNs and TALENs, CRISPR/Cas9 uses a single-guide RNA (sgRNA) to lead a Cas9 nuclease to cleave the DNA molecule then accomplish gene knock-out and modification.

CRISPR was first found in bacteria as an immune response to exogenous DNA such as phages or plasmids. When a bacterium is undergoing invasion by a phage, a phage specific spacer RNA, which is completely or partially complimentary with phage DNA, guides Cas proteins to cut the phage DNA.

Cas9 is an RNA-guided DNA endonuclease that belongs to the Cas protein family

(Hwang et al., 2013) (Figure 2.6). First, with the mediation of the gene-specific sgRNA, a

20 nt long RNA that is complementary to the DNA target site, Cas9 creates a double-strand cleavage of the DNA molecule. Then, as the cell tries to repair double-stranded breakages by the nonhomologous end joining (NHEJ) pathway, a small indel (insertion/deletion) may be generated at the site of cleavage. In the case where a frame-shifting or in-frame mutation occurs, no protein product or a nonfunctional protein product is produced, and there is a very high possibility to have the gene knocked out. The target site must meet 2 criteria: 1.

It must be 20 bp long. 2. An NGG protospacer adjacent motifs (PAM) site must follow the

20- mer which is required by Cas9 (Gagnon et al., 2014; Varshney et al., 2015).

Figure 2.6. Schematic of the CRISPR/Cas9-mediated process. With the guidance of sgRNA, the Cas9 protein creates nicks on both strands of DNA. From homologous direct repair (HDR) pathway, the break will be repaired using the sister chromatin DNA as template, thus no mutations will be generated. Mutations will be generated from nonhomologous end joining pathway. Figure adapted from (Tu et al., 2015).

The reason why we use CRISPR/Cas9 instead of other techniques is because it has a higher efficiency. Varshney et al., (2015) reported the efficiency of CRISPR is greater than

ZFNs and TALENs in generating mutations. They targeted genes in zebrafish using all three techniques and found the germline transmission level mutation rate of CRISPR was

5 to 6 times higher than the other two techniques. (Varshney et al., 2015).

Materials and Methods

Zebrafish Husbandry

Zebrafish wild-type (WT) strain Tübingen were used throughout all the experiments.

Fish was raised and kept at 28 ℃ in fish system water according to a protocol approved by

Institutional Animal Care and Use Committee at Case Western Reserve University.

Zebrafish embryos were kept in standard Petri dishes with blue water (0.025 M Methylene

Blue Trihydrate solution) in a 28 ℃ incubator.

CRISPR/Cas9

Annealing of Template Oligonucleotides

The CRISPR/Cas9 protocol was developed by Gagnon et al., (2014), and modified by our lab. The 20 nt target site DNA sequences were selected by using the CHOPCHOP web tool, developed by Harvard University (Montague et al., 2014), then checked by using the

NCBI (National Center for Biotechnology Information) BLAST (Basic Local Alignment

Search Tool) program for potential non-specific target hits. A gene-specific oligonucleotide composed of a T7 promoter (5¢-TAATACGACTCACTATA-3¢), the 20-

nucleotide target site DNA sequence, and a region at the end that is complementary with the beginning of a constant oligonucleotide, which encodes the part of RNA that associates with the cas9 protein. The gene-specific oligonucleotides and constant oligonucleotide were synthesized by and purchased from Integrated DNA Technologies, lnc. A single- guide RNA (sgRNA) template was then made by annealing the gene-specific and constant oligonucleotides together (Figure 2.7). The single-strand DNA overhangs were filled in with T4 DNA polymerase. The template was then purified using a EZ-10 Spin Column

PCR Products Purification Kit (BIO BASIC CANADA LNC.) and electrophoresed on an agarose gel to confirm length (120bp).

Figure 2.7. Flowchart of template annealing. The 60 nt gene-specific oligo with a segment that is complementary with the 80 nt constant oligo are anneal together. The rest of the

double stranded DNA is synthesized with the help of T4 DNA polymerase. Figure adapted from (Gagnon et al., 2014).

RNA in vitro Transcription (sgRNA and Cas9 mRNA)

sgRNAs were made using annealed oligonucleotides as the templates by in vitro transcription using a mMESSAGE mMACHINE® T7 ULTRA Transcription Kit

(Thermofisher Scientific Company). A DNA plasmid encoding Cas9 was linearized with

NotI restriction enzyme (Gagnon et al., 2014). Then Cas9 mRNA was made by in vitro transcription using the mMESSAGE mMACHINE® SP6 Transcription Kit (Thermofisher

Scientific Company). RNA quality was verified using an Agilent Tape Station. In some cases, Cas9 protein (PNA BIO INC), not RNA, was used in the protocol.

Microinjection

For Cas9 mRNA, the microinjection construct was mixed with sgRNA, Cas9 mRNA, phenol red, and Danieau's buffer (58 mM NaCl, 0.7 mM KCl, 0.4 mM MgSO4, 0.6 mM

Ca(NO3)2, 5.0 mM HEPES pH7.6) and the concentration of Cas9 mRNA was 350 ng/µl

(Table 1.). For Cas9 protein, the microinjection construct was mixed with sgRNA, Cas9 protein, phenol red, and DEPC-treated water and the concentration of Cas9 protein was twice that of the sgRNA’s concentration (Table 1.). For all CRIPSR/Cas9 injections, 1 to

2 nl of the injection mixture was injected into one-cell stage zebrafish embryos.

Table 1. Components, volumes, and concentrations of CRISPR/Cas9 microinjection.

Component Volume Final Concentration Tmc5 CRISPR1 sgRNA (750 ng/µl) 1 µl 250 ng/µl

Cas9 mRNA (1300 ng/µl) 0.67 µl 350 ng/µl

0.5% Phenolred 1 µl 0.08%

1 × Danieu’s Buffer To 6 µl Lhfpl5a CRISPR4 sgRNA (512.2 ng/µl) 1.45 µl 300 ng/µl

Cas9 mRNA (1300 ng/µl) 0.67 µl 350 ng/µl

0.5% Phenolred 1 µl 0.08%

1 × Danieu’s Buffer To 6 µl Macf1a CRISPR4 sgRNA (1985.1 ng/µl) 0.76 µl 300 ng/µl

Cas9 protein (2000 ng/µl) 1 µl 600 ng/µl

0.5% Phenolred 1 µl 0.08%

DEPC-treated water To 6 µl Tmc6b CRISPR1 sgRNA (1404.2 ng/µl) 1.07 µl 500 ng/µl

Cas9 protein (2000 ng/µl) 1 µl 600 ng/µl

0.5% Phenolred 1 µl 0.08%

DEPC-treated water To 6 µl

Genomic DNA Extraction

DNA was extracted from 3 to 4 days post fertilization (dpf) zebrafish embryos. The

HotShot (Meeker et al., 2007) technique was used to extract DNA. First, 50 µl of base

solution (25 mM NaOH, 0.2 mM Na2EDTA, pH 12) was added into a tube with a collected embryo and incubated at 95 ℃ for 30 min. 50 µl of neutralization solution (40 mM Tris-

HCL, pH 5) was then added in and centrifuged at room temperature for 5 min. For somatic mutation detection, 16 injected wild-type embryos were collected from each injection construct for genomic DNA extraction. For founder screening, 8 embryos were collected from each potential founder for genomic DNA extraction.

Polymerase Chain Reaction, Sequencing, and Result Analysis

A segment of extracted DNA covering the target site was amplified by polymerase chain reaction (PCR). The PCR reaction was assembled by mixing 18.875 µl of DNAse free water, 2.5 µl of 10x standard buffer (NEW ENGLAND BioLabs lnc.), 0.5 µl of dNTPs,

0.5 µl of 10 µM forward primer, 0.5 µl of 10 µM reverse primer, 0.125 µl of Taq DNA polymerase (NEW ENGLAND BioLabs lnc.), and 2 µl of extracted DNA as template together. The program in Table 2 was used for amplification in a thermocycler (Applied

Biosystems). All the primers sequences used for experiments are shown in Table 3. After confirming the band size by agarose gel electrophoresis and purification using a EZ-10

Spin Column PCR Products Purification Kit, the purified PCR products were then

sequenced by Eurofins Genomics Company. Sequencing result was analyzed by the

MacVector software.

Table 2. Thermocycler program for PCR.

Temperature (℃) Time (s) 95 30

95 30

Tm 30 35×

72 30

72 300

4 forever

Table 3. Primers used in this study.

Primer name Primer sequence (5¢ - 3¢) Product Tm length ℃ (bp) ( ) tmc5 CRISPR1 seq F¢ CAGCCGGAGCCAGATTTCAAGCG 585 61 tmc5 CRISPR1 seq R¢ AATAACTCACCACGCCAGTGAGCAG lhfpl5a CRISPR4 seq F¢ AGTGTGGCTGAAGTTGCCTGG 400 62 lhfpl5a CRISPR4 seq R¢ GGCAGCAGTTTGTCCTGCCG macf1a CRISPR4 seq F¢ CCAACACAAAGCTACAAATGGTCCT 574 62 macf1a CRISPR4 seq R¢ TGAGGATTAGAACTGCTGGATGGA tmc6b CRISPR1 seq F¢ CCCATGTTCAGCAGGGTGTACTAA 1180 61 tmc6b CRISPR1 seq R¢ GAATCTGCACAGTGTTCAGGCAG tmc6b Exon5 seq F¢ CCTTATTAACCTATAGTGAAGCCTCT Only for sequencing

Subcloning and Transformation

PCR products that showed multiple peaks in the sequence, meaning sequence not consistent and mutations were generated, start from target site regions, were selected to be subcloned into a PCR4 TOPO vector (Thermofisher Scientific Company). The cloning reaction was assembled with 4.5 µl of purified PCR product, 1 µl of salt solution

(Thermofisher Scientific Company), and 0.5 µl of PCR4 TOPO vector, and incubated at room temperature for 20 min.

The vector was then transformed into One Shot TOP 10 chemically competent E. coli cells (Thermofisher Scientific Company). A total volume of 6 µl of cloning reaction was added into 25 µl of competent cells and incubated on ice for 30 min. The cells were then heat-shocked at 42 ℃ for exactly 30 sec. After adding in 150 µl of S.O.C medium, the cells were incubated in a shaker incubator at 37 ℃, 200 rpm for 1 hour. 50 µl and 100 µl of culture medium with cells were then spread on two selection LB broth agar (BIO BASIC

CANADA LNC.) plates with 60 ng/µl carbenicillin.

Picking up Colonies, Preparation of DNA, and Sequencing

After overnight incubation in a 37 ℃ incubator, 8 single colonies were picked from each plate and incubated in LB broth medium (BIO BASIC CANADA LNC.) in a shaker incubator at 37 ℃, 200 rpm overnight. The vectors amplified by E. coli were then extracted by performing DNA miniprep (EZ-10 Spin Column Plasmid DNA Miniprep Kit; BIO

BASIC CANADA LNC.) and sequenced (Eurofins Genomics Company with an M13

Forward primer (5¢GTAAAACGACGGCCAG3¢).

Results

CRISPR/Cas9 induced mutation of tmc5 in zebrafish

Design of tmc5 CRISPR for target sites was based on the sequence of tmc5

(ENSDARG00000013252) from the Ensembl database (GRCz10). This gene has only one known protein product. In order to completely knock out the gene or at least knock out most of the functional domains, for example, transmembrane domains, target sites were searched for on the most upstream exons. For this gene, exon 4 and exon 6 were selected since these two exons encode regions upstream of the transmembrane domains (predicted by transmembrane helix hidden Markov model, TMHMM) (Figure 2.8 A), and they show high amino acid sequence similarity between zebrafish, mouse (Mus musculus), and human

(Homo sapiens) (Figure 2.8 B). After confirming specificity using the BLAST web-tool from NCBI, a 20 bp target site with the sequence of 5¢-

GATACTCTGAAGGAGATCGGGGG-3¢ named tmc5 CRISPR1 on exon 4 was selected

(Figure 2.8 C).

Figure 2.8. Design of zebrafish tmc5 CRISPR. (A) Schematic shows positions of transmembrane domains relative to tmc5 exons. Transmembrane domains predicted by

TMHMM. (B) Alignment of TMC5 amino acid sequences of zebrafish, mouse, and human.

Yellow box shows exon 4 and green box shows exon 6 in zebrafish. Asterisks represent conserved sequence and dots represent semi-conservative mutations. (C) Schematic of zebrafish tmc5 (ENSDARG00000013252) exons and introns. The tmc5 CRISPR1 target site is located on the forward strand of early exon 4 with PAM site underlined. Scale bar equals to 200 bp.

After the target site sequence was confirmed by PCR and sequencing, tmc5 CRISPR1 sgRNA was made, and its quality was inspected by an Agilent Tape Station (Figure 2.9

A). The gel image (Figure 2.9 A) reveals that the quality of sgRNA is adequate, and the size is correct (120 nt). It was then microinjected into one-cell stage zebrafish embryos to determine the somatic mutation rate. The initial sequencing result of PCR using injected

WT fish embryo genomic DNA as template shows multiple mutations were created

(Figure 2.9 B). From the somatic mutation sequencing result (Figure 2.9 B), we can infer that the average peak heights remarkably decreased downstream the target site region, which means multiple frame-shifting mutations were generated.

Control

Mutant

Figure 2.9. tmc5 CRISPR1 sgRNA and somatic mutation detection. (A) Gel image of tmc5

CRISPR1 sgRNA from an Agilent tape station with the ladder in the left lane and tmc5

CRISPR1 sgRNA in the right lane. The majority of the RNA band is the right length (120 nt). (B) Sequencing result from PCR of WT embryo injected with tmc5 CRISPR1 sgRNA.

WT control is on the top and mutant is on the bottom. Targeted region is highlighted.

Downstream the target site region, there is a markedly decrease in average peak heights.

Since the CRISPR injected fish is mosaic, meaning that each cell may carry a different type of mutation, a subcloning and colony sequencing experiment was then performed to

figure out the exact mutation types. The PCR product was subcloned into a TOPO PCR4 vector, and transformed into and amplified by competent E. coli cells. Plasmids were then extracted using a DNA Miniprep Kit and sequenced (Figure 2.10 A). 12 different mutations were recognized from subcloning and sequencing, including deletions of 25 bp,

23 bp, 11bp, 10 bp, 9 bp, 7 bp, and 3 bp, respectively, and insertions of 10 bp, 9 bp, 8 bp,

5 bp, and 2 bp, respectively. The somatic mutation rate is 20/44. The injected fish embryos were then raised up into adult fish, which is the founder generation (F0). The adult founders were then individually bred with wild-types to obtain F1 embryos for founder screening.

Genomic DNA was then extracted from the embryos and genotyped by PCR direct sequencing (Figure 2.10 B).

Embryo 1:

Embryo 2:

Embryo 3:

Figure 2.10. tmc5 CRISPR1 subcloning and founder screening sequencing results. (A)

Alignment of tmc5 wild-type DNA sequence (reference) and sequence results from PCR product subcloned from zebrafish DNA that had been subjected to tmc5 CRISPR1 with target site labeled in red and PAM site in blue. (B) tmc5 CRISPR1 zebrafish founder screening sequencing result. Three embryos that are heterozygous with one mutant allele and one wild type allele are shown. The target site is highlighted. Clear double peaks can be observed starting from certain mutation positions (arrows).

F1 embryos acquired from founder screening were heterozygous composed of one chromosome with a mutation and one WT chromosome. Clear double peaks in sequencing result were distinguished from F1 embryos genotyping, which means inheritable and frame-shift mutations were created. Currently, five tmc5 CRISPR1 fish founders have been discovered and are undergoing breeding to generate F1 generations.

CRISPR/Cas9 induced mutation of lhfpl5a in zebrafish

The sequence of zebrafish lhfpl5a (ENSDARG00000045023) from the Ensembl database (GRCz10) was used as a reference for designing of lhfpl5a CRISPR target sites.

This gene has 2 coding exons and 2 transcripts, which greatly overlap with each other. The alignment of the whole coding region of zebrafish, mouse, and human Lhfpl5a amino acid sequence shows high similarity of exon 2 between species (Figure 2.11 A). The NCBI

BLAST web-tool was then used to confirm specificity of target sites. A target site named

lhfpl5a CRISPR4 on exon 2 with the sequence of 5¢-

GGGCAACTGTACGGTGCGCTGGG-3¢ was selected (Figure 2.11 B).

Figure 2.11. CRISPR design of lhfpl5a in zabrafish. (A) Alignment of amino acid sequences of zebrafish lhfpl5a, mouse Lhfpl5, and human LHFPL5. The green box demarcates exon 2 in zebrafish. Asterisks represent conserved sequence and dots represent semi-conservative mutations. (B) Schematic graph of zebrafish lhfpl5a

(ENSDARG00000045023) exons and introns. The lhfpl5a CRISPR4 target site is located on the forward strand of exon 2; the PAM site is underlined. Scale bar equals to 200 bp.

PCR and sequencing were performed to confirm the target site sequence of our WT fish is the same as the database. lhfpl5a CRISPR4 sgRNA was made and inspected (Agilent

Tape Station; Figure 2.12 A). Gel image shows excellent sgRNA quality and correct band size. lhfpl5a CRISPR4 sgRNA was then microinjected into one-cell stage zebrafish embryos to determine its effectiveness at making somatic mutations. Same as tmc5

CRISPR1, notably drop of average peak heights was identified from the sequencing result of PCR using injected WT fish embryo genomic DNA as template, indicating multiple mutations generated (Figure 2.12 B). The embryonic mutation rate is 9/12.

Control

Mutant

Figure 2.12. lhfpl5a CRISPR4 sgRNA and somatic mutation detection. (A) Gel image of lhfpl5a CRISPR4 sgRNA viewed from an Agilent tape station with the ladder in the left lane and lhfpl5a CRISPR4 sgRNA in the right lane. Most of the RNA is at the predicted length (120 nt). (B) Sequencing result from PCR of WT embryo injected with lhfpl5a

CRISPR4 sgRNA. WT control is on the top and mutant is on the bottom. Target site region is highlighted. Peak heights decrease markedly downstream of the target site region.

After subcloning and sequencing as described previously, a 16 bp insertion mutation was identified. (Figure 2.13). The injected fish embryos were then raised up into adult fish, which is the founder generation (F0). The adult founders were then individually bred with wild-types to obtain F1 embryos for founder screening, which is currently ongoing.

Figure 2.13. Alignment of lhfpl5a wild-type DNA sequence (reference) and part of subcloned lhfpl5a CRISPR4 PCR product sequencing results. WT reference shown on top with target site labeled in red and PAM site in blue. Mutation sequence is on the bottom.

CRISPR/Cas9 induced mutation of tmc6b in zebrafish

The sequence of zebrafish tmc6b (ENSDARG00000004875) from the Ensembl database (GRCz10) was used for the design of tmc6b CRISPR target site. This gene has 18 exons and four transcripts. The design was based on the longest transcript

(ENSDART00000037819.8), using a target site located on the upstream exons, aiming to knock out the whole gene. An alignment of the entire amino acid sequences of zebrafish, mouse, and human reveals good similarity on both exons 5 and 6 (Figure 2.14). Thus, those two exons are excellent locations for target sites. The NCBI BLAST web-tool was applied to verify the specificity, a target site with the sequence of 5¢-

AGACGGAGCTGGCTTCCAGGAGG-3¢ named tmc6b CRISPR1 on exon 5 was selected

(Figure 2.15).

Figure 2.14. Alignment of amino acid sequences of zebrafish Tmc6b, mouse TMC6, and

human TMC6. Red box shows exon 5 and green box shows exon 6 in zebrafish. Asterisks represent conserved sequences and dots signify semi-conservative sequences.

Figure 2.15. Schematic graph of zebrafish tmc6b (ENSDARG00000004875) exons and introns. The tmc6b CRISPR1 target site is located on the forward strand of early exon 5 with PAM site underlined. Scale bar equals to 200 bp.

After target site sequence was confirmed, tmc6b CRISPR1 sgRNA was made and inspected with an Agilent Tape Station (Figure 2.16 A). The sgRNA quality is high, and its size is appropriate according to the image. Microinjection of tmc6b CRISPR1 sgRNA was done for determination of somatic mutation rate. The sequencing result of the genomic

DNA PCR shows multiple frame-shift mutations created (Figure 2.16 B), as the average peak heights remarkably decreased after the target site region. The embryonic mutation rate is 4/16.

Control

Mutant

Figure 2.16. tmc6b CRISPR1 sgRNA and somatic mutation detection. (A) Gel image of tmc6b CRISPR1 sgRNA from the Agilent tape station with the ladder in the left lane and tmc6b CRISPR1 sgRNA in the right lane. The majority of the RNA band is at the right length (120 nt). (B) Sequencing result from PCR of WT embryo injected with tmc6b

CRISPR1 sgRNA. WT control is on the top and mutant is on the bottom. Target site region is highlighted. Peak heights decrease markedly after the target site region.

Subcloning and sequencing were done as described previously. Seven different mutation types were identified, including deletions of 14 bp, 13 bp, 5 bp, 4 bp, and 2 bp, respectively (Figure 2.17). The somatic mutation rate is 10/23. Over 50 injected fish embryos are currently being raised up into adulthood for further experiments.

Figure 2.17. Subcloned tmc6b CRISPR1 PCR product sequences are aligned tmc6b wild- type DNA sequence (reference). The target site is labeled in red and PAM site in blue. WT reference shows on top with different types of mutation found lists on the bottom.

CRISPR/Cas9 induced mutation of macf1a in zebrafish

macf1a is a huge gene that has over 90 exons and encodes for more than 20 protein products that functionally vary greatly. The knock-out of the Macf1 orthologue in mice is embryonically lethal (Kodama et al., 2003). Mutation in macf1a results in a weak epigenetically imposed developmentally defect in zebrafish (Gupta et al., 2010). We are aiming to completely knock out this gene in zebrafish. This may create a more substantial phenotype.

The sequence of zebrafish macf1a with Gene ID ENSDARG00000028533 from the

Ensembl database (GRCz10) was used to design macf1a CRISPR. This gene has 97 exons

and encodes for five transcripts. Exons 11-13 were chosen to search for potential target sites since they show a high similarity between species of zebrafish, mouse, and human from the amino acid sequence alignment (Figure 2.18 A), and they are shared by most of the transcripts, too. The specificity was then confirmed by the NCBI BLAST web-tool, a segment of with the sequence of 5¢-GGTAGTACTTCTCATCTCGGAGG-3¢ on exon 13 was selected as target site and named macf1a CRISPR4 (Figure 2.18 B).

Figure 2.18. Design of zebrafish macf1a CRISPR. (A) Alignment of amino acid sequences of zebrafish macf1a, mouse Macf1, and human MACF1. The yellow box shows exon 11, the green box shows exon 12, and the red box shows exon 13. Asterisks represent conserved sequence and dots symbolize semi-conservative mutations. (B) Schematic graph of zebrafish macf1a (ENSDARG00000028533) exons and introns. Some exons and introns

are omitted. The macf1a CRISPR4 target site is located on the reverse strand of exon 13 with PAM site (underlined). Scale bar equals to 200 bp.

PCR and sequencing were employed to confirm the target site. macf1a CRISPR4 sgRNA was synthesized with its quality inspected by an Agilent Tape Station (Figure 2.19).

From the gel, the quality of sgRNA is fine and are correct in length. Microinjection of macf1a CRISPR4 sgRNA along with somatic mutations determination PCR and sequencing were performed. From the lessening in peak heights downstream the target site in the sequencing result, we can infer multiple mutations are created (Figure 2.20 A).

Figure 2.19. Agilent tape station gel image shows ladder (left) and macf1a CRISPR4 sgRNA (right). The majority of RNA band is at the correct length (120 nt).

A subcloning experiment was then performed to verify the mutation. From subcloning sequencing results, three different mutation types were identified including deletions of 3 bp, and 2 bp, and a substitution of 4 bp (Figure 2.20 B). The somatic mutation rate is 3/9.

Over 50 of the injected fish embryos were raised up into adulthood (founder generation).

The potential founders were individually bred with wild-types to obtain F1 embryos for founder screening, which is currently ongoing.

Control

Mutant

Figure 2.20. macf1a CRISPR4 somatic mutation determination. (A) Somatic mutation determination sequencing result. WT control is on the top and mutant is on the bottom with target site region highlighted. Peak heights decrease remarkably after the target site region.

(B) Alignment of reverse complemented macf1a wild-type DNA sequence and subcloned macf1a CRISPR4 PCR product sequencing results. WT reference shows on top and mutations show on the bottom. Target sites are labeled in red and PAM sites in blue.

Discussion

To better investigate the MET of the hair cell, our lab has been knocking out potentially related genes for years using different techniques from ZFNs to CRISPR/Cas9.

With the help of development of novel gene-editing techniques and maturation of whole- genome sequencing of the zebrafish, making a knock-out of a fish gene has become much easier than before, though challenges exist. CRISPR/Cas9 provides us a simple, fast and efficient way of knocking genes out. In this thesis study, 4 genes, tmc5, lhfpl5a, macf1a, and tmc6b, were successfully knocked out in zebrafish using CRISPR/Cas9. Unlike older gene editing techniques, such as ZFN and TALENs, the RNA-guided CRISPR/Cas9 method is more rapid and less complex. Because it does not require transcription of protein products to work, mutations could be created very early, at the one cell stage. Thus, the efficiency increases very much. From this study, the mutation rate is 75% and highest somatic rate of mutation is 45.5%, with mean values of 37.5% and 35.9%, respectively

(Table 4.). All of the mutations are germline transferable. The CRISPR/Cas9 showed a great ability to generate numerous different mutation types as well as a high rate of frame- shift mutations, which agrees with previous work (Varshney et al., 2015). The power of

CRISPR/Cas9 allows us to compare phenotypes from different mutations of the same gene and give us a bigger chance of generating a frame-shift mutation to knock out a gene.

Table 4. Mutation rates of tmc5, lhfpl5a, macf1a, and tmc6b CRISPRs.

Embryonic rate of mutation Somatic rate of mutation tmc5 37.5% 45.5% lhfpl5a 75% 25% macf1a 12.5% 33.3% tmc6b 25% 43.5% Mean 37.5% 35.9%

With the knock-outs I generated, we can further investigate the effects of losing those genes to zebrafish hair cell development and function. Many future characterization experiments could be done. First, a startle response can be tested by tapping the Petri dish or touching with a hair loop, which gives us a clue of phenotypic defects, such as deafness and defects in touch sensation. Secondly, some dye loading experiments, such as 4-Di-2-

ASP (4- (4-diethylaminostyryl)- N- methylpyridinium iodide) and a styryl pyridinium dye

FM 1- 43 (N- (3-Triethylammoniumpropyl)- 4- (4- (Dibutylamino) Styryl)) pyridinium dibromide, which can enter and stain hair cells through MET channel, could be used to test or even quantify the function of MET channel (Kappler et al., 2004; Magrassi et al., 1987;

Meyers et al., 2003). Thirdly, electrophysiology tests, such as patch-clamping or microphonic potential recordings, can be used to examine hair cell function. Finally, cutting-edge microscopy techniques can help us study the development of hair cell morphology.

Tmc5 and Tmc6b both belong to the Tmc protein family, a family that is considered to contain candidates of the MET channel. Knocking them out individually could lead to a partial or a complete loss of function of the MET channel. But since the Tmc family members are highly related and structurally similar to one another, compensation may occur when any one member of the gene family is removed, as with TMC1 and TMC2 in mice (Kawashima et al., 2011). To further examine the compensatory mechanisms, single knock-outs should be crossed with each other to get double or multiple knock-outs. A study of LHFPL5 in mice revealed its role as a potential linker protein between PCDH15 and the

MET channel. I think that the study of this gene in zebrafish will agree with previous mouse data, showing that components of the MET apparatus are conserved. MACF1 is a linker protein that may connect hair cell stereocilia with the cuticular plate (Antonellis et al.,

2014). I would hypothesize lack of macf1a will cause the animal to have greater- than- normal MET responses, because the movement of stereocilia will be larger without something that holding their roots. To sum up, this thesis work will allow the assessment of potentially critical genes in hair cell function.

Chapter 3: Generation of transgenic zebrafish line expressing dendra2 tagged β-actin in hair cells

Introduction

β-actin in Hair Cell

β-actin is the main component of the cytoskeleton of hair cell stereocilia. The β-actin monomers assemble into polymers filaments in hair cell bundles and help the hair bundle to maintain its shape and rigidity (Hwang et al., 2015). Mice lack of β-actin and γ-actin are embryonic lethal (Perrin et al., 2010). The β-actin polymer filament is polar: it has a “+” end and a “–” end. There are 2 models of β-actin dynamics in the hair bundle. The first one is the stationary model: β-actin is very stable in mice hair cells and only small amount of molecule exchange occurs at the “+” end (Drummond et al., 2015; Zhang et al., 2012). The second is the treadmilling model: β-actin monomers are incorporated into the filament from the “+” end, tip of the stereocilium, and dissociate from the “–” end, which is at the bottom of the stereocilium, the stereociliary β-actin molecules migrate from the tip to the bottom of the stereocilia (Narayanan et al., 2015; Rzadzinska et al., 2004).

A previous study from our lab revealed that molecular turnover of β-actin in zebrafish stereocilia neither happened only on the tips nor followed the treadmilling pattern by fluorescence recovery after photo-bleaching (FRAP) experiment (Hwang et al., 2015)

(Figure 3.1). However, the bleached β-actin molecules were not fluorescently trackable, in that specific dynamics pattern cannot be observed from FRAP. In order to track the molecular dynamics of β-actin in certain regions of the stereocilia, I generated a transgenic

zebrafish line that expresses β-actin and a photoconvertible fluorescent tag dendra2 as a fusion protein in zebrafish hair cells, to monitor the region of interest by photoconversion.

Figure 3.1. β-actin exchanging on an hourly timescale in live zebrafish hair cells. (A and

B) Schematics of a hair bundle (A) and β-actin-mCherry (B). (C) Hair bundle (arrowhead) and cuticular plate (asterisk) labeled with β-actin-mCherry in transgenic zebrafish. (D)

Confocal image of three stereocilia (arrowheads) from a splayed hair bundle, revealing even labeling across each stereocilium. Splayed bundles are rare in this transgenic. Limited portions of each stereocilium are in the plane of focus. (E) Quantitative fluorescence recovery of a bundle containing β-actin-mCherry after a midsection bleach (yellow bracket). Figure adapted from (Hwang et al., 2015).

Dendra2

Dendra2 is a variant of Dendra (denGFP) from the soft coral Dendronephthya sp

(Adam et al., 2009). Unlike classic fluorescent proteins, dendra2 can be photoconverted irreversibly from green to red fluorescence by a 490 nm laser (Adam et al., 2009; Chudakov et al., 2007) (Figure 3.2). Moreover, it was found that a 405 nm UV laser has a higher efficiency in photoconverting dendra2, as reported by Drummond et al., (2015). Red and green fluorescence are both detectable after photoconversion, and the red fluorescence is stable. Therefore, it is a very useful tool to track protein movements. In this study, we used a pv3b (parvalbumin 3b) promoter to drive the expression of β-actin-dendra2 fusion protein in hair cells (McDermott et al., 2010).

Figure 3.2. Structural changes of dendra2. Dendra2 shows green fluorescence (left bottom).

After photoconversion by 490 nm laser, dendra2 changes its structure and yields red fluorescence (right). Figure adapted from (Chudakov et al., 2007).

Materials and Methods

Plasmid Preparation and Microinjection

The Tol2 transposon system was used as an efficient tool to deliver foreign DNA into the zebrafish genome (Balciunas et al., 2006). A mixture of construct pv3b/β-actin/dendra2

(120 ng/µl), Tol2 RNA (25 ng/µl), phenol Red (0.125%), and KCl buffer (0.1 M KCl in

ddH2O, up to 6 µl of total volume) was injected into one-cell stage zebrafish embryos.

Injected embryos were kept in blue water in a 28 ℃ incubator.

Screening for Positive Fish

On 4-7 dpf, the zebrafish babies were anesthetized in 1× tricaine (0.612 mM of Ethyl

3-aminobenzoate methanesulfonic acid (Sigma-Aldrich Co. LLC.) in fish water) and screened for green fluorescence in the ear or the lateral line system under a stereomicroscope (Leica MZ16 F). Positive embryos were then raised up to adult fish and set up to cross with wild-type fish individually for founder screening. Embryos were acquired and screened for green fluorescence in ear or lateral line system using a stereomicroscope at 4-7 dpf. Potential founders were bred with wild-type fish.

Photoconversion

The photoconversion experiment was adapted from the protocol of fluorescence recovery after photo-bleaching (FRAP) experiment. Fish at the age of 6 dpf were anesthetized in 1x tricaine and mounted in 0.1% (w/v) low melting point agarose (Promega) on glass-bottom dishes (MatTek). Each photoconversion experiment was then conducted using a laser scanning confocal microscope (True Confocal Scanner SP8; Leica

Microsystems) with 40x /1.3 numerical aperture oil-immersion objectives. A 1 µm x 0.02

µm rectangular region of a crista hair cell bundle was selected and photoconverted for

0.626 s using 20% laser power of 405 nm UV laser. Images were collected using an excitation wavelength of 488 nm (for dendra2 green version) with emission wavelength of

500 – 530 nm and excitation wavelength of 543 nm (for dendra2 red version) with emission wavelength of 560– 650 nm. No saturated images were used.

Results

Zebrafish ear crista hair cells were selected for photoconversion. Under confocal microscope, green fluorescence was evenly distributed all over the bundle. We were able to convert a small region of the hair bundle into red (Figure 3.3 B). Before photoconversion, the bundle (arrow) was only labeled with the green version of Dendra2. After photoconversion, the converted region in the bundle showed a decrease of the green fluorescence and formed a stripe-like gap, indicating the conversion of some Dendra2 molecules in this region (Figure 3.3 B left column). Correspondingly, a very clear red fluorescence puncta emerged in the photoconverted region in the red channel (Figure 3.3

B middle column). The merged images (Figure 3.3 B right column) showed a clear overlap of the photoconverted Dendra2 red version in the Dendra2 green version labeled hair bundle.

Figure 3.3. Photoconversion of β-actin-dendra2. (A) Schematic of the β-actin-dendra2 fusion protein. (B) Confocal images from before photoconversion and immediately after photoconversion of a zebrafish anterior crista that express dendra2-tagged β-actin in hair cell bundles. A 1 µm x 0.02 µm rectangular region across the bundle on the top (arrow) was selected to be photoconverted with a 405 nm UV laser for 0.626 s. Embedded images in the right columns showed the enlarged views of the bundle processed with photoconversion with an unconverted control bundle next to it. Scale bar = 10 µm.

Discussion

Advantages and Disadvantages

In this experiment, we generated a very useful tool, β-actin-dendra2 transgenic zebrafish line, for future β-actin dynamics and related studies. After test, β-actin-dendra2 expressed in hair cell and distributed in stereocilia evenly. The dendra2 green signals are easy to see and converted dendra2 red signals are also strong enough to detect. Moreover, the entire experiment can be done in live zebrafish embryos which can better reveal the true pattern of β-actin dynamics in vivo.

Due to the limitation of the microscope and the small size of the zebrafish hair bundle, the temporal and spatial resolution required to perform photoconversion in a single stereocilium of the zebrafish hair cell is currently not yet accomplished. The minimum width of the region selected for photoconversion is larger than the diameter of single stereocilium, making single stereocilium photoconversion impossible.

Ideas for Future Experiments

Based on current knowledge of β-actin in zebrafish hair cells, some ideas of future experiments were made.

The time-lapse experiment of observation after photoconversion can be done to study dynamics of β-actin in the hair cell bundle. Photoconversion can be done in the middle

(Figure 3.4 A), bottom (Figure 3.4 B), or tips (Figure 3.4 C) of hair cell stereocilia. Even the cuticular plate area (Figure 3.4 D) can be selected to convert and study since it is also

rich in β-actin. Possibilities of upward, downward, or bidirectional movements exist in all situations.

A B C

D E F

Figure 3.4. Schematics of future β-actin-dendra2 experiments. Red rectangle represents selected region for photoconversion. Red (dashed) arrows show potential movements of the converted β-actin-dendra2 fusion protein. (A) Photoconvert the middle part of the hair bundle. (B) Photoconvert the anchor part of hair bundle. (C) Photoconvert the tips of

stereocilia. (D) Photoconvert the cuticular plate. (E) Photoconvert a short stereocilium. (F)

Photoconvert a long stereocilium.

If possible, a study of interchanging of β-actin between different stereocilia can also be done. A short (Figure 3.4 E) or a long (Figure 3.4 F) single stereocilium could be photoconverted and monitored. β-actin could move to other stereocilia or the cell body meaning red could diffuse both directions.

References

Adam, V., Nienhaus, K., Bourgeois, D., and Nienhaus, G.U. (2009). Structural basis of enhanced photoconversion yield in green fluorescent protein-like protein Dendra2.

Biochemistry 48, 4905–4915.

Antonellis, P.J., Pollock, L.M., Chou, S.-W., Hassan, A., Geng, R., Chen, X., Fuchs, E.,

Alagramam, K.N., Auer, M., and McDermott, B.M. (2014). ACF7 Is a Hair-Bundle

Antecedent, Positioned to Integrate Cuticular Plate Actin and Somatic Tubulin. J. Neurosci.

34, 305–312.

Balciunas, D., Wangensteen, K.J., Wilber, A., Bell, J., Geurts, A., Sivasubbu, S., Wang,

X., Hackett, P.B., Largaespada, D.A., McIvor, R.S., et al. (2006). Harnessing a High

Cargo-Capacity Transposon for Genetic Applications in Vertebrates. PLoS Genet. 2, e169.

Beurg, M., Fettiplace, R., Nam, J.-H., and Ricci, A.J. (2009). Localization of inner hair cell mechanotransducer channels using high-speed calcium imaging. Nat. Neurosci. 12, 553–

558.

Beurg, M., Kim, K.X., and Fettiplace, R. (2014). Conductance and block of hair-cell mechanotransducer channels in transmembrane channel – like protein mutants. 55–69.

Beurg, M., Xiong, W., Zhao, B., Müller, U., and Fettiplace, R. (2015). Subunit determination of the conductance of hair-cell mechanotransducer channels. Proc. Natl.

Acad. Sci. 112, 1589–1594.

Beurg, M., Goldring, A.C., Ricci, A.J., and Fettiplace, R. (2016). Development and localization of reverse-polarity mechanotransducer channels in cochlear hair cells. 113,

6767–6772.

Bleckmann, H., and Zelick, R. (2009). Lateral line system of fish. Integr. Zool. 4, 13–25.

Chatzigeorgiou, M., Bang, S., Hwang, S.W., and Schafer, W.R. (2013). tmc-1 encodes a sodium-sensitive channel required for salt chemosensation in C. elegans. Nature 494, 95–

99.

Chudakov, D.M., Lukyanov, S., and Lukyanov, K.A. (2007). Tracking intracellular protein movements using photoswitchable fluorescent proteins PS-CFP2 and Dendra2. Nat. Protoc.

2, 2024–2032.

Corey, D.P. (2006). What is the hair cell transduction channel? J. Physiol. 576, 23–28.

Drummond, M.C., Barzik, M., Bird, J.E., Zhang, D.-S., Lechene, C.P., Corey, D.P.,

Cunningham, L.L., and Friedman, T.B. (2015). Live-cell imaging of actin dynamics reveals mechanisms of stereocilia length regulation in the inner ear. Nat. Commun. 6, 6873.

Fettiplace, R. (2016). Is TMC1 the Hair Cell Mechanotransducer Channel? Biophys. J. 111,

3–9.

Fettiplace, R., and Kim, K.X. (2014). The physiology of mechanoelectrical transduction channels in hearing. Physiol. Rev. 94, 951–986.

Fuchs, P.A. (2015). How many proteins does it take to gate hair cell mechanotransduction?

Proc. Natl. Acad. Sci. 112, 1254–1255.

Gagnon, J.A., Valen, E., Thyme, S.B., Huang, P., Ahkmetova, L., Pauli, A., Montague,

T.G., Zimmerman, S., Richter, C., and Schier, A.F. (2014). Efficient mutagenesis by Cas9 protein-mediated oligonucleotide insertion and large-scale assessment of single-guide

RNAs. PLoS One 9, 1–8.

Ghysen, A., and Dambly-Chaudière, C. (2004). Development of the zebrafish lateral line.

Curr. Opin. Neurobiol. 14, 67–73.

Gillespie, P.G., and Müller, U. (2009). Mechanotransduction by Hair Cells: Models,

Molecules, and Mechanisms. Cell 139, 33–44.

Gleason, M.R., Nagiel, A., Jamet, S., Vologodskaia, M., López-Schier, H., and Hudspeth,

A.J. (2009). The transmembrane inner ear (Tmie) protein is essential for normal hearing and balance in the zebrafish. Proc. Natl. Acad. Sci. U. S. A. 106, 21347–21352.

Gong, T.L., Besirli, C.G., and Lomax, M.I. (2001). MACF1 gene structure : a hybrid of plectin and dystrophin. 861, 852–861.

Guillet, M., Sendin, G., Bourien, J., Puel, J.-L., and Nouvian, R. (2016). Actin Filaments

Regulate Exocytosis at the Hair Cell Ribbon Synapse. J. Neurosci. 36, 649–654.

Gupta, T., Marlow, F.L., Ferriola, D., Mackiewicz, K., Dapprich, J., Monos, D., and

Mullins, M.C. (2010). Microtubule actin crosslinking factor 1 regulates the balbiani body and animal-vegetal polarity of the zebrafish oocyte. PLoS Genet. 6, 14–18.

Howe, K., Clark, M.D., Torroja, C.F., Torrance, J., Berthelot, C., Muffato, M., Collins,

J.E.J.E., Humphray, S., McLaren, K., Matthews, L., et al. (2013). The zebrafish reference genome sequence and its relationship to the human genome. Nature 496, 498–503.

Hwang, P., Chou, S.W., Chen, Z., and McDermott, B.M. (2015). The Stereociliary

Paracrystal Is a Dynamic Cytoskeletal Scaffold In Vivo. Cell Rep. 13, 1287–1294.

Hwang, W.Y., Fu, Y., Reyon, D., Maeder, M.L., Kaini, P., Sander, J.D., Joung, J.K.,

Peterson, R.T., and Yeh, J.J. (2013). Heritable and Precise Zebrafish Genome Editing

Using a CRISPR-Cas System. 8, 1–9.

Kalay, E., Li, Y., Uzumcu, A., Uyguner, O., Collin, R.W., Caylan, R., Ulubil-emiroglu,

M., Kersten, F.F.J., Hafiz, G., Wijk, E. Van, et al. (2006). Mutations in the lipoma HMGIC fusion recessive nonsyndromic hearing loss Mutations in the lipoma HMGIC fusion

partner-like 5 ( LHFPL5 ) Gene Cause Autosomal Recessive Nonsyndromic Hearing Loss.

Hum. Mutat. 27, 633–639.

Kandel, E.R., Schwartz, J.H., Jessell, T.M., Siegelbaum, S.A., and Hudspeth, A.J. (2012).

The Inner Ear. In Principles of Neural Science, Fifth Editon, pp. 654–681.

Kappler, J.A., Starr, C.J., Chan, D.K., Kollmar, R., and Hudspeth, A.J. (2004). A nonsense mutation in the gene encoding a zebrafish myosin VI isoform causes defects in hair-cell mechanotransduction. Proc. Natl. Acad. Sci. U. S. A. 101, 13056–13061.

Kawashima, Y., Géléoc, G.S.G., Kurima, K., Labay, V., Lelli, A., Asai, Y., Makishima, T.,

Wu, D.K., Santina, C.C. Della, Holt, J.R., et al. (2011). Mechanotransduction in mouse inner ear hair cells requires transmembrane channel – like genes. J. Clin. Invest. 121, 4796–

4809.

Kawashima, Y., Kurima, K., Pan, B., Griffith, A.J., and Holt, J.R. (2014). Transmembrane channel-like (TMC) genes are required for auditory and vestibular mechanosensation.

Pflügers Arch. - Eur. J. Physiol. 85–94.

Kim, K.X., and Fettiplace, R. (2012). Developmental changes in the cochlear hair cell mechanotransducer channel and their regulation by transmembrane channel–like proteins.

J. Gen. Physiol. 141, 141–148.

Kim, K.X., Beurg, M., Hackney, C.M., Furness, D.N., Mahendrasingam, S., and Fettiplace,

R. (2013). The role of transmembrane channel-like proteins in the operation of hair cell mechanotransducer channels. J. Gen. Physiol. 142, 493–505.

Kodama, A., Karakesisoglou, I., Wong, E., Vaezi, A., and Fuchs, E. (2003). ACF7: An essential integrator of microtubule dynamics. Cell 115, 343–354.

Kurima, K., Ebrahim, S., Pan, B., Sedlacek, M., Sengupta, P., Millis, B.A., Cui, R.,

Nakanishi, H., Fujikawa, T., Kawashima, Y., et al. (2015). TMC1 and TMC2 Localize at the Site of Mechanotransduction in Mammalian Inner Ear Hair Cell Stereocilia. Cell Rep.

12, 1606–1617.

Labay, V., Weichert, R.M., Makishima, T., and Griffith, A.J. (2010). Topology of

Transmembrane Channel-like Gene 1 Protein †. Biochemistry 49, 8592–8598.

Leung, C.L., Sun, D., Zheng, M., Knowles, D.R., and Liem, R.K.H. (1999). Microtubule

Actin Cross-linking Factor (MACF): A Hybrid of Dystonin and Dystrophin that Can

Interact with the Actin and Microtubule Cytoskeletons. J. Cell Biol. 147, 1275–1285.

Longo-Guess, C.M., Gagnon, L.H., Cook, S. a, Wu, J., Zheng, Q.Y., and Johnson, K.R.

(2005). A missense mutation in the previously undescribed gene Tmhs underlies deafness in hurry-scurry (hscy) mice. Proc. Natl. Acad. Sci. U. S. A. 102, 7894–7899.

Maeda, R., Kindt, K.S., Mo, W., Morgan, C.P., Erickson, T., Zhao, H., Clemens-Grisham,

R., Barr-Gillespie, P.G., and Nicolson, T. (2014). Tip-link protein protocadherin 15 interacts with transmembrane channel-like proteins TMC1 and TMC2. Proc. Natl. Acad.

Sci. 111, 12907–12912.

Magrassi, L., Purves, D., and Lichtman, J.W. (1987). Fluorescent probes that stain living nerve terminals. J. Neurosci. 7, 1207–1214.

Marcotti, W., Corns, L.F., Desmonds, T., Kirkwood, N.K., Richardson, G.P., and Kros, J.

(2014). Transduction without Tip Links in Cochlear Hair Cells Is Mediated by Ion

Channels with Permeation Properties Distinct from Those of the Mechano-Electrical

Transducer Channel. J. Neurosci. 34, 5505–5514.

McDermott, B.M., Asai, Y., Baucom, J.M., Jani, S.D., Castellanos, Y., Gomez, G.,

McClintock, J.M., Starr, C.J., and Hudspeth, A.J. (2010). Transgenic labeling of hair cells

in the zebrafish acousticolateralis system. Gene Expr. Patterns 10, 113–118.

Meeker, N.D., Hutchinson, S.A., Ho, L., and Trede, N.S. (2007). Method for isolation of

PCR-ready genomic DNA from zebrafish tissues. Biotechniques 43, 610–614.

Meyers, J.R., MacDonald, R.B., Duggan, A., Lenzi, D., Standaert, D.G., Corwin, J.T., and

Corey, D.P. (2003). Lighting up the senses: FM1-43 loading of sensory cells through nonselective ion channels. J. Neurosci. 23, 4054–4065.

Montague, T.G., Cruz, J.M., Gagnon, J.A., Church, G.M., and Valen, E. (2014).

CHOPCHOP: A CRISPR/Cas9 and TALEN web tool for genome editing. Nucleic Acids

Res. 42, 401–407.

Narayanan, P., Chatterton, P., Ikeda, A., Ikeda, S., Corey, D.P., Ervasti, J.M., and Perrin,

B.J. (2015). Length regulation of mechanosensitive stereocilia depends on very slow actin dynamics and filament severing proteins. Nat Commun. 6, 554–561.

Nicolson, T. (2005). The genetics of hearing and balance in zebrafish. Annu. Rev. Genet.

39, 9–22.

Pan, B., Géléoc, G.S., Asai, Y., Horwitz, G.C., Kurima, K., Ishikawa, K., Kawashima, Y.,

Griffith, A.J., and Holt, J.R. (2013). TMC1 and TMC2 are components of the mechanotransduction channel in hair cells of the mammalian inner ear. Neuron 79, 504–

515.

Perrin, B.J., Sonnemann, K.J., Ervasti, J.M., Rafael-Fortney, J., and Ervasti, J. (2010). β-

Actin and γ-Actin Are Each Dispensable for Auditory Hair Cell Development But

Required for Stereocilia Maintenance. PLoS Genet. 6, e1001158.

Rzadzinska, A.K., Schneider, M.E., Davies, C., Riordan, G.P., and Kachar, B. (2004). An actin molecular treadmill and myosins maintain stereocilia functional architecture and self-

renewal. J. Cell Biol. 164, 887–897.

Scheffer, D.I., Zhang, D.S., Shen, J., Indzhykulian, A., Karavitaki, K.D., Xu, Y.J., Wang,

Q., Lin, J.J.C., Chen, Z.Y., and Corey, D.P. (2015). XIRP2, an actin-binding protein essential for inner ear hair-cell stereocilia. Cell Rep. 10, 1811–1818.

Tu, Z., Yang, W., Yan, S., Guo, X., and Li, X.-J. (2015). CRISPR/Cas9: a powerful genetic engineering tool for establishing large animal models of neurodegenerative diseases. Mol.

Neurodegener. 10, 35.

Varshney, G.K., Pei, W., Lafave, M.C., Idol, J., Xu, L., Gallardo, V., Carrington, B.,

Bishop, K., Jones, M., Li, M., et al. (2015). High-throughput gene targeting and phenotyping in zebrafish using CRISPR / Cas9. Genome Res. 25, 1–13.

Vollrath, M.A., Kwan, K.Y., and Corey, D.P. (2007). The micromachinery of mechanotransduction in hair cells. Annu. Rev. Neurosci. 30, 339–365.

Whitfield, T.T. (2002). Zebrafish as a model for hearing and deafness. J. Neurobiol. 53,

157–171.

Wu, Z., and Müller, U. (2016). Molecular Identity of the Mechanotransduction Channel in

Hair Cells: Not Quiet There Yet. J. Neurosci. 36, 10927–10934.

Wu, Z., Grillet, N., Zhao, B., Cunningham, C., Harkins-Perry, S., Coste, B., Ranade, S.,

Zebarjadi, N., Beurg, M., Fettiplace, R., et al. (2016). Mechanosensory hair cells express two molecularly distinct mechanotransduction channels. Nat. Neurosci. 20, 24–35.

Xiong, W., Grillet, N., Elledge, H.M., Wagner, T.F.J., Zhao, B., Johnson, K.R.,

Kazmierczak, P., and M??ller, U. (2012). TMHS is an integral component of the mechanotransduction machinery of cochlear hair cells. Cell 151, 1283–1295.

Zhang, D.-S., Piazza, V., Perrin, B.J., Rzadzinska, A.K., Poczatek, J.C., Wang, M., Prosser,

H.M., Ervasti, J.M., Corey, D.P., and Lechene, C.P. (2012). Multi-isotope imaging mass spectrometry reveals slow protein turnover in hair-cell stereocilia. Nature 481, 520–524.

Zhao, B., Wu, Z., Grillet, N., Yan, L., Xiong, W., Harkins-Perry, S., and M??ller, U. (2014).

TMIE is an essential component of the mechanotransduction machinery of cochlear hair cells. Neuron 84, 954–967.