Multiple Regulatory Regions on the 5' Side of the Mouse Ea Gene

Proc. Nad. Acad. Sci. USA Vol. 85, pp. 3075-3079, May 1988 Immunology Multiple regulatory regions on the 5' side of the mouse Ea gene (major histocompatibility genes/y-interferon/y-interferon response region) DIMITRIS THANOS*, GEORGE MAVROTHALASSITIS*, AND JOSEPH PAPAMATHEAKIS*t *Institute of Molecular Biology and Biotechnology, Research Center of Crete, P.O. Box 1527, and tDepartment of Biology, University of Crete, 711 10 Heraklion, Crete, Greece Communicated by Fotis C. Kafatos, December 10, 1987

ABSTRACT The function of the 5'-flanking region of the motifs in the 5'-flanking region of all major histocompatibil- mouse major histocompatibility complex gene E4 has been ity complex class II genes (15, 16). We provide evidence that studied by deletion analysis with the chloramphenicol acetyl- the CS are elements necessary for the inducibility by IFN-y. transferase gene as a transient expression marker in various cell lines. This analysis reveals the presence of several control regions on the 5' side of the gene. Sequences between base pair MATERIALS AND METHODS (bp) -873 and bp -353 have a negative function in human Plasmid Constructions. The following vectors were used and mouse fibroblasts but not in the mouse macrophage line for cloning Ea and E1n gene fragments. pL51CAT was derived WEHI-3. Additional positive and negative elements have been from pSV2CAT (17) by replacing the 350-base-pair (bp) Acc mapped between bp - 353 and bp - 38. A V-interferon I-Sph I fragment by a pUC19 polylinker. pLSVOCAT was response region has been also identified within that sequence. derived from pL51CAT by elimination of the 150-bp Sma I The 5' and 3' boundaries of the -interferon response region (polylinker)-HindIII fragment. aGSCAT was produced by have been located between bp - 164 and bp -43. Inducible inserting the Pst I-Dde I fragment of a-globin (bp - 590 to bp human cell lines showed the same y-interferon response region + 20) in the Xba I site of the polylinker and subsequent endpoints with the mouse cell line WEHI-3. A DNA fragment removal of the Sma I fragment spanning bp -235 to bp - 85. spanning the equivalent region of the mouse E' gene confers aGXCAT was derived from aGSCAT by removing upstream yinterferon inducibility to the simian virus 40 and a-globin globin sequences with Xma I (bp -54), Sal I (polylinker) promoters in an orientation-independent manner. We further digestion, and religation. The 5', 3', and internal deletions provide evidence that the conserved sequence motifs on the 5' were generated on the Rsa I-Pvu I fragment (bp - 353 to bp side of all major histocompatibility complex class II genes are + 14) of the Ea gene by using convenient restriction sites or indispensable for -interferon induction. BAL-31 exonuclease, and their endpoints were determined by dideoxy sequencing. The sequence ACCCTCGACTC- Human and mouse major histocompatibility complex class II TAG links the original endpoints of internal deletions. genes are regulated by lymphokines including interferons Polylinker sequences between the original deletion end- and other cellular factors (1). Macrophages and B lympho- points and CAT sequences are as follows: ACCCCTAGAG- cytes are the main cellular targets for class II induction by GATCCCC (5' and internal deletions) and ACCC (3' dele- y-interferon (IFN-'y) and interleukin 4 (2-4), respectively. In tions). Deletion plasmids are named by their terminal base addition, other cell types such as fibroblasts and endothelial relative to the site cells (5) are induced to express class II genes in response to pairs, transcription initiation (position IFN-'y. Class II expression is critical for antigen presentation + 1). and hence the development of immune response (6, 7). The Cell Culture and Transfections. Leukemic cell lines were cell-surface density of class II antigens plays an important maintained in RPMI 1640 with 10% (vol/vol) fetal calf serum role in determining the strength of the immune response by and 5 x 10-6 M 2-mercaptoethanol. All other cell lines were generation of helper T cells (8, 9). Inappropriately high levels grown in Dulbecco's modified Eagle's medium with 10% of class II gene expression may be part of positive feedback (vol/vol) fetal calf serum. All media contained gentamycin at loops operating in certain autoimmune reactions (10, 11). At 50 Ag/ml. Transfections of 150,000 cells by the calcium the other extreme, lack of normal class II gene expression phosphate technique were performed essentially as described will produce severe immunodeficiency (12). by Graham and Van der Eb (18). For transfections with the Many gene-specific cis-acting regulatory elements that DEAE-dextran method, i07 exponentially growing cells were mediate responses to a variety of stimuli, including hor- incubated for 30 min in serum-free medium containing 50 mM mones, are known. The presence of both constitutive and Tris HCl (pH 7.4), DEAE-dextran at 300 ,tg/ml, and DNA at interferon-inducible regulatory sequences on the 5' side of 6 pug/ml. This medium was removed, and the cells were the promoter region of mouse class I genes has been shown further incubated in medium containing serum and 100 ,uM (13, 14). To study class II gene regulatory sequences we chloroquine diphosphate for 1.5 hr before washing the cells have used plasmid constructs carrying 5' sequences of the and incubating in regular medium. Cells were harvested mouse Ea and E,, genes fused to the chloramphenicol ace- usually 40-44 hr after initiation of the transfection. tyltransferase (CAT) gene. Various cell lines were transfect- Response to interferons (100 units/ml) was usually evalu- ed with these constructs, and CAT activities were deter- ated at the end of 22-24 hr of incubation. Recombinant mined in transient expression assays. We describe here the human a-interferon and IFN-y were produced by Genentech identification of several control regions on the 5' side of the (South San Francisco, CA) and supplied by Boeringher Ea gene, including a IFN-y response region. The IFN-y Ingelheim (Vienna, Austria). A mixture of mouse a- and response region encompasses the conserved sequence (CS) p-interferon (type I) was kindly provided by I. Gresser (Villejuif, France). The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" Abbreviations: IFN-'y, y-interferon; CS, conserved sequence(s); in accordance with 18 U.S.C. §1734 solely to indicate this fact. SV40, simian virus 40; CAT, chloramphenicol acetyltransferase.

3075 3076 Immunology: Thanos et al. Proc. Natl. Acad. Sci. USA 85 (1988) CAT and RNA Analysis. CAT assays were performed A +1 essentially as described by Gorman et al. (17). Enzyme S activities were normalized by assays (13) -1717 I- P3-galactosidase H through cotransfection of test plasmids with pCH110 (19). i R Isolation of total cellular RNA, agarose/formaldehyde - gels, and transfer to GeneScreen membranes were as de- -33-215p. scribed by Maniatis et al. (20). Hybridizations were per- x formed with nick-translated fragments. S1 protection analysis was performed with 5'-end-labeled DNA probes as de- - 630 scribed by Weaver and Weissman (21). B

RESULTS * * * * * fiq.: V::; 0

Mouse Class 1 5' Genomic Sequences Confer IFN-y Induc- * *ft ,@O@ e ibility to the a-Globin Gene. Mouse class II-human a2-globin 40 0A hybrids were constructed (Fig. 1A) and transfected into _I* 6 , *- HeLa cells, which have an endogenous class II response to O'm.s _f. a do IFN-y (unpublished data). RNA expression and response to _ + -4_ + - + _9+ - + IFN-'y were studied by RNA gel blot analysis and S1 nuclease mapping. These hybrids showed increased levels of 1 717 8 73 353 215 97 630 RNA in response to IFN-y from the expected initiation sites ofthe E, and E, genes (Fig. 1B). Plasmid constructs with the simian virus 40 (SV40) enhancer-promoter region fused to the E. gene (bp 14 to bp 5390) or an intact a-globin gene did not respond to IFN-y (data not shown). These results suggest that sequences within bp -630 to bp + 50 and bp ..****P*, S.,. - 353 to bp + 14 of the E,, and E, genes, respectively, are _ + 8. + _ + _ + - + _ + involved in IFN--y control. Deletion Analysis of the 5' Region of E. Gene. To analyze FIG. 2. Structure of 5' deleted E.-CAT gene fusion constructs. in more detail the sequences involved in IFN-,y response, we (A) Position of transcription initiation site (arrow), class II- have studied deletions from bp - 1717 of the E, gene fused conserved sequences (solid box) and TATA box (triangle) are to the CAT gene (Fig. 2A). Transient expression assays were indicated. The bp - 630 to bp + 50 construct is an E fusion to CAT. performed by transfection in HeLa, xeroderma GM4429B, The rest are E. constructs fused at bp + 14 to CXT. S, Sal I; H, HincII; R, Rsa I; A, AcC I; X, Xmn I; B, BamHI. (B) Analysis of and the mouse macrophage-like line WEHI-3. Treatment with CAT activities of the deletions after transient expression into GM4429B or WEHI-3 cells (upper and lower sets, respectively) A following a 24-hr incubation in the absence (-) or presence (+) of human or mouse IFN-y. The 5' endpoints of each construct are -630 Ep T r shown between sets. +50 +36 IFN-y over the last 20-24 hr before termination of the -2451 +80 experiment showed stimulation of CAT activity for all plasmids except the deletion at bp -97 (Fig. 2B). Heterologous - 353 Ea IVrl IFN-y showed marginal stimulation of CAT activity and a- or type I interferon was totally inactive (data not shown). +14 +36 Since these experiments locate a region critical for IFN-y response on the 3' side of bp - 215, we decided to study this region in more detail. A set ofBAL-31 5' deletions studied in B IFN--inducible cell lines places the 5' boundary of the E Ea IFN-y response region between bp - 164 and bp -150 _-+ _-+ (Table 1). To define the 3' boundary of the IFN-y control region, we have similarly studied five 3' BAL-31 deletions all with the same 5' end at bp - 353. Results from these deletions fused to the human a2-globin promoter at bp -85 are shown in Table 1. Deletions at bp - 98 and bp - 107 that eliminate the two proximal motifs of the class II CS completely destroy inducibility. Sequences between bp -43 and bp -65 that include the proximal CS that carries a reverse CCAAT box (22) (see Discussion) were dispensable. The same set of FIG. 1. Structure and IFN-y response of mouse class II-globin deletion endpoints was also tested in a foreshortened a- gene hybrid plasmids. (A) Hybrids of the EU (bp - 353 to bp + 14) globin derivative of aGCAT in which all sequences on the 5' and E (bp - 630 to bp + 50) genes with the human a2-globin gene side of bp - 54 (aGXCAT) are deleted and, therefore, lacks from bp +20 to bp +930 (solid bar). Constructs are in the pUC19 the CCAAT box of the globin promoter. In this case the vector (hatched bar). Initiation of transcription from the class II sequences between bp -43 and bp -65 are required for genes (arrow) and TATA box (triangle) are indicated. DNA fragments used in S1 protection analysis are shown below each of the response. The difference between the two sets of deletions constructs. (B) Protection analysis of RNA isolated from HeLa cells based on aGSCAT and aGXCAT plasmids may be explained transfected with the class II-globin hybrids following incubation on the assumption that the globin CCAAT box can substitute with (+) or without (-) IFN-y for 24 hr. The major start sites for the reverse CCAAT sequence of the proximal class II (indicated by dots) are 94 (Ef) and 58 (EU) nucleotides long. CS. Immunology: Thanos et A Proc. Natl. Acad. Sci. USA 85 (1988) 3077

Table 1. Effect of various 5' and 3' deletions on l6 r z A B IFN-y inducibility 0 3' Deletion < 12 5' Deletion IFN-y inducibility -1 as Position, IFN-y Position, bp inducibility bp aGSCAT aGXCAT -4 U 4 -182 + -21 + + _ -176 + -43 + + I I I + - + -164 + -65 + 0 1 2 3 -150 + -98 - COPIES R F -113 - -107 - -103 - FIG. 4. IFN-y inducibility of the EB gene fragment from bp -77 -91 - to bp -208 placed on the 5' side of heterologous promoters. (A) -71 - Induction ratio (vertical axis) of CAT activity by one, two, or three -38 - tandem copies of the En, sequence in front of the SV40 promoter in +, For 5' deletions, a 7- to 15-fold induction ratio in GM4429B HeLa (o), GM4429B (A), or C127 and LTK- (A) cells. (B) CAT and in HeLa or a 7- to 10-fold induction ratio in WEHI-3 cells. +, activity before (-) or after (+) IFN-y treatment by a single copy of For 3' deletions, based on the two a-globin-CAT vectors (aGSCAT the E,, fragment placed in front of the a-globin promoter in reverse and aGXCAT), a 4- to 7-fold ratio. ±, For marginal induction. -, (R) or forward (F) orientation. Results shown are from GM4429B For lack of induction. cells. To further investigate the role of the CS in IFN-y re- showed 1.5- to 2.5-fold induction in HeLa and xeroderma sponse, we have generated internal deletions by using the 5' cells, whereas two or three tandem copies exhibit higher deletion at bp -38 linked to 3' deletions at bp - 107, bp induced levels in either cell line (Fig. 4A). Analogous results -65, and bp -43. Another such deletion was produced by were obtained with the human osteosarcoma line 143B and linking the 5' deletion at bp - 71 to the 3' deletion at bp - 98 WEHI-3 cells, although in the latter even a single copy would (Fig. 3). Testing those deletions confirmed that both se- increase CAT activity 4- to 6-fold in the presence of IFN-y quences from bp - 65 to bp - 38 and from bp - 98 to bp - 71 (data not shown). are indispensable for IFN-y inducibility. In addition, a Plasmids carrying one copy of this fragment in front of the construct carrying the segment from bp - 353 to bp - 43 in globin promoter in either orientation showed up to 18-fold reverse orientation was still inducible although at a lower stimulation in response to IFN-y (Fig. 4B). However, one, level than the forward construct (Fig. 3). A decrease (as two, or three tandem copies, when placed at bp - 580 of the much as 40%) of CAT activity was occasionally seen with a-globin, showed only 1.5- to 2.5-fold stimulation (data not certain constructs (Fig. 3) treated with IFN-'y. This was also shown). observed with noninducible promoters such as SV40 and No effect was seen in the mouse fibroblast cell lines C127 a-globin, and we believe that it reflects a nonspecific effect and LTK - (that show no endogenous class II response to of IFN-y. Qualitatively similar results were obtained with all IFN-y) with either SV40 (Fig. 4A) or globin constructs (data deletions in WEHI-3 cells. not shown). The IFN-y Response Region Can Function as an Inducible Basal Levels of Expression Reveal Multiple Control Regions Enhancer-Like Element. Results from the 5' and 3' deletions on the 5' Side of the E. Gene. Basal level activities of the indicate that a IFN-'y response region resides between bp plasmid constructs studied here indicated that multiple con- - 164 and either bp -64 or bp -42, depending on the trol elements operate in the 5'-flanking region ofthe Ea gene. presence or absence of a CCAAT sequence provided by the The 5' deletions at bp - 1717 and bp -873 invariably had a-globin promoter. We have studied this further by placing low basal activities in the inducible cell lines tested (see an analogous region of the E. gene, the Hae III fragment results with GM4429B in Fig. 5). This was also observed in from bp -77 to bp -208 (15), in front of the SV40 and other class II-negative human (i.e., K562 leukemia) or a2-globin promoters (at bp - 165 on PLS1CAT and bp -85 mouse (LTK- or C127) cells that do not respond to IFN-y, on aGSCAT, respectively). Results on the inducibility of but not in the WEHI-3 cell line (Fig. 5) that expresses transfected plasmids are shown in Fig. 4. Plasmids with detectable amounts ofclass II mRNA in the uninduced state. insertions of a single copy in front of the SV40 promoter The same cell-type specificity was observed for another negative region mapping on the 5' side of bp -97. These data -355 - 160 - 1 20 - 80 - 40 41 suggest that both negative control regions are operative in I ov I I I I I IND * 3531 U M = 7-15 40 38.1 v <1 30 _ 8-13 0 4-6 20 o 20 v i N -0-4OW-4 65~~~~~~~S 381i <1 _ 10a1 i 0 7107 381Z' . <1

I _ § 9 711 <1 A . ._ .IIv -1600 -800 -300 -200 -100 +1 711 _ yr* <1 FIG. 5. Basal levels of relative CAT activity. One arbitrary unit FIG. 3. Effect of internal deletions of IFN-y inducibility. Induc- of CAT activity was assigned to the construct showing the minimal tion ratio (IND) of internal deletions. Symbols are as in Fig. 2. Solid activity. The pattern of 5' deletions in GM4429B (solid line) or boxes locate class II CS in expanded view. WEHI-3 (broken line) is shown. 3078 Immunology: Thanos et A Proc. Natl. Acad. Sci. USA 85 (1988) many class II-negative cells, regardless of a IFN-y-inducible the role of box B in the IFN-y response, although box A was phenotype. dispensable (30). Additional control sequences operate closer to the pro- The sequence including the IFN-y response region is still moter region. In WEHI-3 cells elimination of sequences from inducible when reversed, and it, therefore, resembles an bp -183 gradually reduced basal levels of CAT activity. A inducible enhancer element. The presence of CS in all known gradient of >30-fold difference in CAT activity was observed class II genes suggests a common mechanism for IFN-y between bp -183 and bp -97 with 5' deletions. This positive inducibility and conservation of trans-acting factors between control region was also observed in class II-negative mouse or human and mouse. However, certain genes carrying the CS human cells as well as in the class II-positive A20-2J and Raji have been described, but they are not inducible by IFN-y B-lymphocyte cell lines. (31-33). It is not known whether this is due to certain critical All these data suggest that the 5' region of the Ea gene and nucleotide replacements within this region or to the operation possibly other class II genes carry a variety of control of cis elements that suppress the induction mechanism. elements that may have cell-type-specific functions as The consensus sequence of box B (T/C- -TT/GCTGAT- shown by the differences in cell-type-associated profiles. TGGT/CT) contains a reverse CCAAT box (26). CCAAT sequences are known to be important elements of promoters. Reverse CCAAT sequences have been shown to play an DISCUSSION important role for the normal operation of the thymidine We have shown that a sequence on the 5' side of the promoter kinase (TK) promoter (34) and the expression or induction of region of the Ea gene and the corresponding region of the EB Ea (30) and Xenopus hsp7O heat shock gene (35). In the latter gene is a response region for activation by IFN-y. Since the case the reverse CCAAT sequence has been proposed to transcripts do not include the IFN-y response region, we mediate interactions between heat shock element binding presume that activation is transcriptional, although results factors and the promoter (35, 36). Binding of nuclear factors exclude the of to reverse CCAAT sequences has been demonstrated for Ea from this study cannot possibility posttran- and DQ8 genes (refs. 22 and 37 and unpublished data). scriptional mechanisms indicated in other interferon-induc- we in ible genes (23, 24). From our data may conclude that in Ea, and possibly it DRa, that lack forward CCAAT sequences, the reverse One major feature of the IFN-'y response region is that CCAAT has a dual role of proper promoter function and includes short sequence motifs (CS) conserved between the IFN-y inducibility. In other class II genes certain functions human and mouse class II genes. This region of homology of the reverse CCAAT box may be substituted by the forward consists of three subregions located on the 5' side of the CCAAT box. In support of this hypothesis in another IFN-- TATA box of class II genes, known as the heptamer (H) and inducible gene coding for the invariant chain, no reverse box A and B (or X and Y) (Fig. 6). The detection ofthese CS led CCAAT sequence can be identified within the promoter to suggestions about their role in class II gene regulation (15, region (38). 16, 26, 27). The consensus sequence for interferon response of class I A IFN-'y response region mapping within bp - 159 of the genes (14) is partially homologous to subregion H. The DQf3 gene has been identified (28). Although the results were significance of this is not obvious since class I genes respond not verified by fine scale analysis or 3' deletions, it was to a-, f3-, or y-interferon, whereas class II genes are effi- suggested that the box A is involved in IFN-y regulation. ciently induced by IFN-y only. Similarly, IFN-y response has been observed within bp - 297 Basal level expression of the deletions suggests the pres- of the DRa gene (29). ence of other control regions or subregions important for the We now present evidence that indeed the CS is involved in regulation of the Ea gene (Fig. 5). A negative region resides IFN--y regulation. According to our 5'-deletion analysis, all upstream of bp - 353 and operates in class II-negative cells. three subregions (boxes H, A, and B), along with a 5' stretch Interestingly, such a suppression mechanism does not seem of 40 bp, are required and, therefore, constitute the mini- to operate in the WEHI-3 macrophage line that expresses mum response region ofEa gene. In addition, this, as well as low levels of class II mRNA before induction -and the class surrounding sequences, show functional characteristics im- II-positive B-cell lines A20-2J and Raji. Elimination of the portant for the constitutive or cell-type-specific expression upstream negative region invariably increased basal levels of the Ea gene. Data from transgenic mice also demonstrate without a proportional increase of induced levels of CAT induction ratio in the absence of 220 200 180 activity: the observed sequences upstream of bp - 353 was 3-5 times lower. This TTTGTCTACAGCCTTTATTATTTTTTTGTTAATAAGGTGGAAAAATTTCTTCTTGAGGAA may be due to elimination of a regulatory element of upstream location that is inactivated in response to IFN-'y or removal of binding sites for positive transcription factors, 160 140 120 present also or enhanced during induction. AATTATTTCTTGAAATGTTAAGTGGAAACTCGGATACTAAATAGGACCTGGTTGACAAGGA Another negative control region residing within the IFN-y - A H response region that functions in class II-negative cells maps close to the heptamer (H) motif. Deletions from bp - 113 to bp - 97 increase CAT levels in the absence of induction. The 100 80 60 function of this region was not obvious in WEHI-3 or class * V To V * S ACCCTTTCCTAGCAACAGATGTGTCAGTCTGAAACATTTTTCTGATTGGTTAAAAGTTGA II-positive B-cell lines that showed a nearly monotonic A A A A B decrease of activity when sequences on the 3' side of bp -182 were serially deleted. Its location within the IFN-y response region, in an area highly conserved between DRa 40 20 +1 and E,, suggests that this region has important regulatory GTGCTTTGGATTTTAATCCCTTTTAGTTCTTGTTAATTCTGCCTCAGTCTGCGATCGC functions, possibly a target role for derepression during -A IFN-y induction. Interestingly, the equivalent region ofDQ/3 FIG. 6. Sequence of a critical region of the E. gene promoter is a binding site for factors from Raji but not HeLa extracts (25). Endpoints of deletions are indicated by arrowheads above (5' (37). deletions) or below (3' deletions) the sequence. The TATA box and Two positively acting regions have been located inter- core sequences of heptamer (H) and A and B boxes are underlined. spersed with the negative ones. One maps on the 3' side of Immunology: Thanos et al. Proc. Natl. Acad. Sci. USA 85 (1988) 3079 bp -182 and operates in lymphoid (A20-2J and Raji) or 8. Matis, L. A., Jones, P. P., Murphy, D. B., Hedrick, S. M., nonlymphoid cells, including human and mouse fibroblasts Lerner, E. A., Janeway, C. A., Jr., McNicholas, J. M. & and HeLa cells. This indicates that it has a general role for Schwartz, R. H. (1982) J. Exp. Med. 155, 508-523. 9. Matis, L. A., Glimcher, L. H., Paul, W. E. & Schwartz, R. H. gene expression. The 5' limit of this region coincides with (1983) Proc. Natl. Acad. Sci. USA 80, 6019-6023. the 5' boundary of the IFN-y response region and, therefore, 10. Rosenberg, Y. J., Steinberg, A. D. & Santoro, T. J. (1984) it may control expression levels both before and after induc- Immunol. Today 5, 64-66. tion. 11. Foulis, A. K. & Farquharson, M. A. (1986) Diabetes 35, Finally, the region of box A has a positive function since 1215-1224. it contributes to high basal expression levels. This effect is 12. de Preval, C., Lisowska-Grospierre, B., Loche, M., Griscelli, seen by 5'-deletion analysis of class II-negative cells that C. & Mach, B. (1985) Nature (London) 318, 291-293. 13. Kimura, A., Israel, A., Le Bail, 0. & Kourilsky, P. (1986) Cell also show action of the negative region overlapping the 44, 261-272. heptamer. Evidence for nuclear factor binding to this region 14. Israel, A., Kimura, A., Fournier, A., Fellous, M. & Kourilsky, and its role in transcriptional control (30) supports the hypo- P. (1986) Nature (London) 322, 743-746. thesis that it is an important regulatory element. 15. Saito, H., Maki, R. A., Clayton, L. K. & Tonegawa, S. (1983) The overall analysis indicates that control of the Ea gene Proc. Nat!. Acad. Sci. USA 80, 5520-5524. expression is under at least two negative and two positive 16. Mathis, J. D., Benoist, C. O., Williams, V. E., Kanter, M. R. & elements. The negative elements may suppress expression McDevitt, H. 0. (1983) Cell 32, 745-754. of their would then 17. Gorman, C. M., Moffat, C. F. & Howard, H. (1982) Mol. Cell. before induction and inactivation action Biol. 2, 1044-1051. be part of the IFN-y-induction mechanism. The operation of 18. Graham, F. L. & Van der Eb, A. J. (1973) Virology 57, 456-467. the negative sequence residing within the IFN-'y response 19. Hall, C., Jacob, E., Ringold, G. & Lee, F. (1983) J. Mol. Appl. region shates certain analogies with the human 8-interferon Genet. 2, 101-109. gene regulatory region (39). Other regulatory signals such as 20. Maniatis, T., Fritsch, E. F. & Sambrook, J. (1982) Molecular interleukin 4 may override these negative regions or directly Cloning: A Laboratory Manual (Cold Spring Harbor Lab., Cold enhance the activity of the positive regions. Interactions Spring Harbor, NY), pp. 202-203. between positive and negative sequences and further action 21. Weaver, R. F. & Weissman, C. (1979) Nucleic Acids Res. 7, 1175-1193. of trans-acting molecules may give a spectrum of responses 22. Dorn, A., Bollekens, J., Staub, A., Benoist, C. & Mathis, D. related to cell lineage, developmental stage, or signal (1987) Cell 50, 863-872. present. 23. Friedman, R. L., Manly, S. P., McMahon, M., Kerr, J. M. & Further investigation of class II gene regulation will re- Stark, G. R. (1984) Cell 38, 745-755. quire a more detailed delimitation of cis-acting sequences by 24. Rahmsdorf, H. J., Harth, N., Eades, A. M., Litfin, M., Stein- selected nucleotide replacements, rather than deletions. metz, M., Forni, L. & Herrlich, P. (1986) J. Immunol. 136, This, in conjunction with studying protein-DNA interactions 2293-2299. 25. Hyldig-Nielsen, J. J., Schenning, L., Hammerling, U., Wid- during constitutive or induced state of expression, will help mark, E., Heldin, E., Lind, P., Servenius, B., Lund, T., to increase our understanding of the major histocompatibil- Flavell, R., Lee, J. S., Trowsdale, J., Schreier, P. H., Za- ity complex class II gene regulation. blitzky, F., Larhammar, D., Peterson, P. A. & Rask, L. (1983) Nucleic Acids Res. 11, 5055-5071. We thank F. C. Kafatos for critical suggestions, M. Steinmetz for 26. Kelly, A. & Trowsdale, J. (1985) Nucleic Acids Res. 13, cosmid clones, G. Adolf and I. Gresser for interferons, and A. 1607-1621. Bygrave for cell-culture assistance. This work was supported by 27. Servenius, B., Rask, L. & Peterson, P. A. (1987) J. Biol. Chem. grants from the Hellenic Secretariat General for Research and 262, 8759-8766. Technology. 28. Boss, J. M. & Strominger, J. L. (1986) Proc. Natl. Acad. Sci. USA 83, 9139-9143. 1. Mengle-Gaw, L. & McDevitt, H. 0. (1985) Annu. Rev. Immu- 29. Basta, P. V., Sherman, P. A. & Ting, J. P.-Y. (1987) J. nol. 3, 367-3%. Immunol. 138, 1275-1280. 2. Steeg, P. S., Moore, R. N., Johnson, H. M. & Oppenheim, J. J. 30. Dorn, A., Durand, B., Marfing, C., Leu Meur, M., Benoist, C. (1982) J. Exp. Med. 156, 1780-1793. & Mathis, D. (1987) Proc. Nat!. Acad. Sci. USA 84, 6249-6253. 3. Zlotnik, A., Shimonkevitz, R. P., Gefter, M. L., Kappler, J. & 31. Wake, C. & Flavell, R. A. (1985) Cell 42, 623-628. Marrack, P. (1983) J. Immunol. 131, 2814-2820. 32. Tonelle, C., de Mars, R. & Long, E. 0. (1985) EMBO J. 4, 4. Noma, Y., Sideras, P., Naito, T., Bergstedt-Lindquist, S., 2839-2847. Azuma, C., Severinson, E., Tanabe, T., Kinashi, T., Matsuda, 33. Braunstein, N. S. & Germain, R. N. (1986) EMBO J. 5, F., Yaoita, Y. & Honjo, T. (1986) Nature (London) 326, 2469-2476. 640-646. 34. Graves, B. J., Johnson, P. F. & McKnight, S. L. (1986) Cell 44, 5. Collins, T., Korman, A. J., Wake, C. T., Boss, J. M., Kappes, 565-576. D. J., Fiers, W., Ault, K. A., Gimbrone, M. A., Jr., Strominger, 35. Bienz, M. (1986) Cell 46, 1037-1042. J. L. & Pober, J. S. (1984) Proc. Nat!. Acad. Sci. USA 81, 36. Bienz, M. & Pelham, H. R. B. (1986) Cell 45, 753-760. 4917-4921. 37. Miwa, K., Doyle, C. & Strominger, J. L. (1987) Proc. Natl. 6. Pober, J. S., Collins, T., Gimbrone, M. A., Jr., Cotran, R. S., Acad. Sci. USA 84, 4939-4943. Gitlin, J. D., Fiers, W., Clayberger, C., Krensky, A. M., 38. Koch, N., Lauer, W., Habicht, J. & Dobberstein, B. (1987) Burakoff, S. J. & Reiss, C. S. (1983) Nature (London) 305, EMBO J. 6, 1677-1683. 726-729. 39. Goudbourn, S., Burstein, H. & Maniatis, T. (1986) Cell 45, 7. Unanue, E. R. & Allen, P. M. (1987) Science 236, 551-557. 601-610.