DOCSLIB.ORG

Phylogenetic Relationships of Santalum Album and Its Adulterants As Inferred from Nuclear DNA Sequences

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Phylogenetic Relationships of Santalum Album and Its Adulterants As Inferred from Nuclear DNA Sequences International Journal of Agriculture and Forestry 2012, 2(4): 150-156 DOI: 10.5923/j.ijaf.20120204.03 Phylogenetic Relationships of Santalum album and its Adulterants as Inferred from Nuclear DNA Sequences Anupama Chembath1, Balasundaran M1,*, Sujanapal P2 1Forest Genetics and Biotechnology Division, Kerala Forest Research Institute, Peechi, Thrissur, Kerala, 680653, India 2Sustainable Forest Management Division, Kerala Forest Research Institute, Peechi, Thrissur, Kerala, 680653, India Abstract The East Indian sandalwood, Santalum album, valued for its fragrant oil yielding heartwood is a major ingre- dient in indigenous medicines and perfumes. Scarcity of sandal has led to illegal felling of sandal trees, and adulteration of sandalwood and oil. This study represents the first molecular phylogeny of S. album and its adulterant species Osyris wightiana, Erythroxylum monogynum, Buxus sempervirens, Ximenia americana, Osyris lanceolata, and Chukrasia tabularis through 18S and 26S rDNA sequencing. In the Maximum Parsimony (MP) tree for 18S and 26S rDNA data sets, moderate to high bootstrap support was obtained for the nodes. For 18S rDNA data sets, the tree had B. sempervirens and X. Americana as the upper branch, with E. monogynum branched separately to the cluster. The lower branch had S. album and O. wightiana with O. lanceolata joining separately to both clades of the tree. In the MP tree for 26S rDNA datasets, S. album and O. wightiana formed the major cluster with X. americana clustering separate and B. sempervirens and O. wightiana as the lower branch with C. tabularis clustering separate to the tree. The molecular data presented here provided useful information for resolving the phylogenetic relationship of these plants. Inferences from this study are in accordance with Cronquist’s system of classification of flowering plants where all the species originate from a single phylogenetic tree of Rosidae. Keywords Santalum Album, Adulterants, Gene Sequencing, Sequence Comparison, Molecular Phylogeny For this reason, sandalwood is often adulterated using 1. Introduction Osyris spp. Osyris lanceolata Hochst. & Steud., a member of Santalaceae family, also called Tanzanian Sandalwood or Santalum album L., commercially known as East Indian East African Sandalwood, possesses scented heart wood. sandalwood is a medium sized, xylem tapping, root Trees of the genus Osyris are either shrubs or small ever- hemi-parasitic tree belonging to the family Santalaceae. The green trees, and are usually root hemi-parasites. But the oil, species, commonly known as sandal is valued for its heart- used in pharmaceutical and cosmetic industries abroad, lacks wood containing the precious sandal oil. The Indian san- the sensuality of East Indian sandalwood oil. dalwood has the highest oil content (6 to 7%) and a desirable O. wightiana Wall. ex Wight. is found to occur rarely in aroma profile, highly prized in perfumery and indigenous higher altitudes (900 m above m.s.l.) of Idukki district of medicine[1]. Kerala state[4] and in Tamil Nadu[5] in India. Erythroxylum The annual production of sandalwood worldwide is esti- monogynum Roxb., possessing fragrant heartwood, native to mated between 200 to 300 tonnes, of which 90 per cent is the Indian subcontinent is the source of ‘Indian bastard from India. Scarcity of sandal in open market and consequent sandal’, also used to adulterate sandalwood[6]. Erythroxy- price hike to exorbitant level have led to illegal felling and laceae comprises 200 species distributed throughout the smuggling of trees. Sandal has been categorized as ‘Vul- tropics. The root bark contains alkaloids; the heartwood is nerable’ in the Red Data List by IUCN[2]. Due to its com- light brown which is very durable and easy to work. mercial importance, sandalwood arriving for trade in the Other scented woods often used to adulterate sandalwood market is adulterated with many other indigenous as well as are Buxus sempervirens L., Ximenia americana L. and imported scented wood species. Chukrasia tabularis var. velutina. B. sempervirens, com- Rao et al.[3] have listed a few timbers that are used for monly known as American boxwood, a member of the adulterating sandalwood. Wood of S. album and Osyris Buxaceae family is an evergreen shrub native to Western and species are strikingly similar in most of the wood anatomical Southern Europe, Northwest Africa and Southwest Asia[7]. characters. Wood is very hard and heavy, used for engraving, marquetry and wood turning. X. Americana, belonging to Olacaceae * Corresponding author: [email protected] (Balasundaran M) family, also known as ‘false sandalwood’ is a small, shrubby Published online at http://journal.sapub.org/ijaf tree native to Central and South Florida and the African Copyright © 2012 Scientific & Academic Publishing. All Rights Reserved tropics[8]. It has hemi-parasitic roots, but it does not require a International Journal of Agriculture and Forestry 2012, 2(4): 150-156 151 host to thrive. Bark and roots are used for tanning and wood were synthesized at MWG Biotech Pvt. Ltd., Bangalore, for firewood and charcoal. C. tabularis, a member of the India. Using these primers, we PCR amplified 18S and 26S Meliaceae family, locally known as ‘agil’ in Kerala, is a rDNA of S. album and O. wightiana using DNA from leaf deciduous medium-sized tree found in India, Bangladesh, samples of the species collected from Marayur as template. China, Thailand and Malaysia[9]. Freshly cut wood has a The primer sets used for amplifying O. wightiana loci were fragrant odour, but dried wood has no characteristic odour. used for the amplification of loci from E. monogynum, col- Planed surfaces have a high lustrous satiny sheen. The timber lected from the same area. is highly prized for superior cabinet work, decorative panel- ling, interior joinery, carving, toys and turnery. 2.3. PCR Amplification and Sequencing The state of knowledge about relationships among the PCR amplification reactions were performed using various lineages of land plants is currently incomplete[10]. FINNZYMES High Fidelity PCR Kit. The PCR products Clarification of phylogenetic relationships among Santalales were subjected to sequencing at MWG Biotech Pvt. Ltd. The and their adulterant groups presents opportunities to better 26S rDNA region of E. monogynum could not be amplified; understand their evolutionary and interfamilial relationships. hence it was not included in the present study. The se- Ribosomal RNA or DNA sequences (rRNA/ rDNA) have quencing was performed using BigDye terminator v3.1 cycle frequently been used to reconstruct deep branches of evolu- sequencing Kit containing AmpliTac DNA polymerase tionary history. The gene containing highly conserved as (Applied Biosystems). well as variable regions facilitate alignments of nucleotide sequences derived from phylogenetically linked taxa[11]. Table 1. 18S and 26S rDNA primers designed and developed for S. album, E. monogynum and Osyris sp. 18S rRNA/rDNA has been used for phylogeny reconstruc- NCBI Tm( ) tion within many groups of eukaryotes[12]. Although phy- Ac- and logenetic analysis of 18S rDNA sequences provides criti- Primer Sequence (5'-3') ces- Product℃ sion cally independent data set for the assessment of higher-level size(bp) relationships, in many instances analysis of 18S rDNA se- No 57.3 18SA/F TCCTGCCAGTAGTCATATGC FJ58 quence alone will not provide adequate resolution. Com- 1695 8874 bining 26S rDNA sequence data and 18S rDNA sequence 18SA/R AAGGTTCAGTGGACTTCTCG 57.3 55.9 data would increase the quantum of phylogenetically in- 18OL/F GTCTCAAAGATTAAGCCATGC FJ58 1668 8875 formative history fourfold and provide greater resolution and 18OL/R TAAGGTTCAGTGAACTTCTCG 55.9 support at higher taxonomic levels [13]. The present inves- 55.9 18ER/F GTCTCAAAGATTAAGCCATGC FJ58 1587 tigation has been designed to deduce the evolutionary rela- 8876 tionships among S. album and its adulterant wood species 18ER/R TAAGGTTCAGTGAACTTCTCG 55.9 54.0 26SA/F CCGTTGAGTTTAAGCATATCA FJ58 using rDNA sequencing and comparison studies. 3204 8877 26SA/R TACCCTGTCGCATATTTAAGT 54.0 57.3 26OL/F GTTACCCGCTGAGTTTAAGC FJ58 3264 8878 2. Materials and Methods 26OL/R CACTCTGCCGCTTACAATAC 57.3 2.1. Sample Collection and DNA Extraction 2.4. Phylogenetic Analyses Semi-dry logs and leaf samples of Santalum album were Phylogenetic analyses were conducted using Molecular collected from Marayur Sandalwood reserve forest located Evolutionary Genetics Analysis (MEGA) software version on the leeward side of the Western Ghats in the South West 4[15]. Sequences were manually aligned using Alignment region of India. Samples of Osyris wightiana and Explorer (AE) in MEGA 4 and separate alignments were Erythroxylum monogynum were collected from Chinnar created for 18S and 26S rDNA data sets. Sequences of 18S wildlife sanctuary located adjacent to the Marayur sandal and 26S rDNA of sandalwood adulterants Buxus semper- reserve forest. All these places lie at 10º15’ N latitude and virens (L54065, AF389243), Ximenia americana (L24428, 77º11’ E longitude. DNA extractions were accomplished DQ790220) and Osyris lanceolata (U42803, AF389274), using QIAGEN DNeasy Plant Mini Kit and the DNA was and 26S rDNA of Chukrasia tabularis (AY128154) depos- used as template for PCR amplification of ribosomal DNA ited in the NCBI nucleotide library were chosen as outgroups using specific primers designed and developed for Santalum and were included in the alignment. The 18S rDNA sequence and Osyris species. of C. tabularis was unavailable
Load more

Recommended publications
  • 3 Informe Sobre Las Mariposas Diurnas En Los
    Mariposas diurnas del Real Jardín Botánico de Madrid – CSIC Octubre 2018 Textos: Irene Gómez Undiano Diego Gil Tapetado Sandra Grzechnik Elvira Caro Francisco J. Cabrero Fotografías: Biodiversidad Virtual (www.biodiversidadvirtual.org) Muestreos realizados principalmente por: Irene Gómez & Patricia Martínez El Grupo de Seguimiento de Biodiversidad UCM (Entomofauna) lo componen (curso 2017‐2018): Francisco J. Cabrero Roberto Cañizares Elvira Caro Patricia Durán Pablo de la Fuente Diego Gil Tapetado Irene Gómez Undiano Sandra Grzechnik Alba Gutiérrez Diego López Índice 1. Las mariposas diurnas como bioindicadores de la Biodiversidad a. ¿Qué es un indicador? b. ¿Qué es un bioindicador o indicador biológico? c. ¿Para qué sirve un bioindicador? d. Características generales que debe tener un organismo para ser bioindicador e. Los Lepidópteros como bioindicadores f. Antecedentes en el RJBM‐CSIC 2. Programa de seguimiento de mariposas diurnas en el RJBM‐CSIC a. Metodología b. Esfuerzo de muestreo 3. Inventario provisional y potencial de mariposas diurnas en el RJBM‐CSIC a. Listado b. Fichas c. Fenología 4. Listado de relaciones entre plantas nutricias y especies de mariposas diurnas poten‐ cialmente presentes en el RJBM‐CSIC a. Listado de plantas nutricias por mariposas b. Listado de mariposas por plantas nutricias 5. Estado de conservación de las mariposas diurnas del RJBM‐CSIC 6. Propuestas de mejora de las poblaciones de mariposas diurnas a. Análisis DAFO b. Medidas para la conservación o mejora de la comunidad de mariposas diurnas 7. Referencias bibliográficas Anexo 1. Las mariposas diurnas como bioindicadores de la Biodiversidad La biodiversidad es posiblemente uno de los elementos más dinámicos del ecosistema urbano. Esto implica que precisa de acciones de conservación continuas, que deben ser evaluadas continuamen‐ te, puesto que los cambios pueden verse reflejados en un tiempo relativamente corto.
    [Show full text]
  • Cop16 Prop. 69
    Original language: English CoP16 Prop. 69 CONVENTION ON INTERNATIONAL TRADE IN ENDANGERED SPECIES OF WILD FAUNA AND FLORA ____________________ Sixteenth meeting of the Conference of the Parties Bangkok (Thailand), 3-14 March 2013 CONSIDERATION OF PROPOSALS FOR AMENDMENT OF APPENDICES I AND II A. Proposal Inclusion of Osyris lanceolata Hochst. & Steud. (1832), East African Sandalwood in Appendix II of CITES in accordance with Article II, paragraph 2 (a) of the Convention and Resolution Conf.9.24 (Rev.CoP), Annex 2 a, paragraph B. The Genus Osyris is currently known to contain the single species Osyris lanceolata. B. Proponent Kenya*. C. Supporting statement 1. Taxonomy 1.1 Class: Angiospermae 1.2 Order: Santalales 1.3 Family: Santalaceae 1.4 Genus, species or subspecies, including author and year: Osyris lanceolata Hochst. & Steud. (1832) 1.5 Scientific synonyms: Osyris quadripartita Decne (1836) O. abyssinica Hochst. ex A. Rich (1850) O. wightiana J. Graham (1839) O. arborea A.DC. (1857) O. pendula Balf.f. (1884) O. rigidissima Engl. (1895) O. tenuifolia Engl. (1895) O. parvifolia Baker (1910) O. urundiensis De Wild. (1925) O. oblanceolata Peter (1932) O. densifolia Peter (1932) O. laeta Peter (1932) O. compressa sensu auct., non (Berg.) (1954) 1.6 Common names: English: East African Sandalwood; African sandalwood French: * The geographical designations employed in this document do not imply the expression of any opinion whatsoever on the part of the CITES Secretariat or the United Nations Environment Programme concerning the legal status of any country, territory, or area, or concerning the delimitation of its frontiers or boundaries. The responsibility for the contents of the document rests exclusively with its author.
    [Show full text]
  • Status of the Genera Colpoon, Osyris and Rhoiacarpos in South Africa
    Bothalia - African Biodiversity & Conservation ISSN: (Online) 2311-9284, (Print) 0006-8241 Page 1 of 7 Short Communication Status of the Genera Colpoon, Osyris and Rhoiacarpos in South Africa Author: Background: The taxonomic and phylogenetic status of Colpoon, Osyris and Rhoiacarpos Daniel L. Nickrent (Santalaceae, Osyrideae) is reviewed. Affiliation: Objectives: To resolve confusion regarding whether Colpoon is deserving of generic status 1College of Science, separate from Osyris. Department of Plant Biology, Southern Illinois University, Methods: Existing morphological information was examined for the three genera as well as United States previously published molecular phylogenies. Corresponding author: Results: Daniel Nickrent, From both morphological and phylogenetic perspectives, Colpoon is distinct from [email protected] Osyris. The status of Rhoiacarpos was not contentious and this genus is also easily differentiated from the other two genera in Osyrideae. Dates: Received: 16 May 2017 Conclusions: Colpoon and Osyris are not congeneric; therefore, floras, databases and herbarium Accepted: 10 Oct. 2017 collections should recognise these as distinct taxa. Published: 13 Nov. 2017 How to cite this article: Nickrent, D.L, 2017, ‘Status of Introduction the Genera Colpoon, Osyris and Rhoiacarpos in South Over the past several decades, some confusion has surrounded the taxonomic circumscription Africa’, Bothalia 47(1), a2260. of three genera of South African Santalaceae, tribe Osyrideae: Osyris L. (1753), Colpoon https://doi.org/10.4102/abc. P.J.Bergius (1767) and Rhoiacarpos A.DC (1857). The taxonomic history and generic boundaries v47i1.2260 (from a morphological perspective) of these three taxa were discussed by Stauffer (1961). For Copyright: several decades following Stauffer’s work, these three genera were generally treated as © 2017.
    [Show full text]
  • SABONET Report No 18
    ii Quick Guide This book is divided into two sections: the first part provides descriptions of some common trees and shrubs of Botswana, and the second is the complete checklist. The scientific names of the families, genera, and species are arranged alphabetically. Vernacular names are also arranged alphabetically, starting with Setswana and followed by English. Setswana names are separated by a semi-colon from English names. A glossary at the end of the book defines botanical terms used in the text. Species that are listed in the Red Data List for Botswana are indicated by an ® preceding the name. The letters N, SW, and SE indicate the distribution of the species within Botswana according to the Flora zambesiaca geographical regions. Flora zambesiaca regions used in the checklist. Administrative District FZ geographical region Central District SE & N Chobe District N Ghanzi District SW Kgalagadi District SW Kgatleng District SE Kweneng District SW & SE Ngamiland District N North East District N South East District SE Southern District SW & SE N CHOBE DISTRICT NGAMILAND DISTRICT ZIMBABWE NAMIBIA NORTH EAST DISTRICT CENTRAL DISTRICT GHANZI DISTRICT KWENENG DISTRICT KGATLENG KGALAGADI DISTRICT DISTRICT SOUTHERN SOUTH EAST DISTRICT DISTRICT SOUTH AFRICA 0 Kilometres 400 i ii Trees of Botswana: names and distribution Moffat P. Setshogo & Fanie Venter iii Recommended citation format SETSHOGO, M.P. & VENTER, F. 2003. Trees of Botswana: names and distribution. Southern African Botanical Diversity Network Report No. 18. Pretoria. Produced by University of Botswana Herbarium Private Bag UB00704 Gaborone Tel: (267) 355 2602 Fax: (267) 318 5097 E-mail: [email protected] Published by Southern African Botanical Diversity Network (SABONET), c/o National Botanical Institute, Private Bag X101, 0001 Pretoria and University of Botswana Herbarium, Private Bag UB00704, Gaborone.
    [Show full text]
  • CITES and Timber (PDF)
    This guide covers the main timber species regulated CITES and Timber by the Convention on International Trade in Endangered Species (CITES). It provides information CITES and Timber on the key issues regarding the implementation of the Convention for this important group of plants. A guide to CITES-listed tree species Written for the non-expert, individual sections cover the species found in significant trade, with details on their distribution, uses, traded parts and derivatives, and scientific and common names. Madeleine Groves Madeleine Groves Additional sections cover timber identification and measurement, guidance on CITES documentation and key resources. and Catherine Rutherford shop.kew.org/kewbooksonline Madeleine Groves Catherine Rutherford CITES and Timber A guide to CITES-listed tree species Madeleine Groves Catherine Rutherford © The Board of Trustees of the Royal Botanic Gardens, Kew 2015 Illustrations and photographs © Royal Botanic Gardens, Kew, unless otherwise stated in the captions The authors have asserted their rights to be identified as the authors of this work in accordance with the Copyright, Designs and Patents Act 1988 All rights reserved. No part of this publication may be reproduced, stored in a retrieval system, or transmitted, in any form, or by any means, electronic, mechanical, photocopying, recording or otherwise, without written permission of the publisher unless in accordance with the provisions of the Copyright Designs and Patents Act 1988. Great care has been taken to maintain the accuracy of the information contained in this work. However, neither the publisher, the editors nor authors can be held responsible for any consequences arising from use of the information contained herein.
    [Show full text]
  • Effect of Crude Leaf Extract of Osyris Quadripartita on Plasmodium Berghei in Swiss Albino Mice Senait Girma1, Mirutse Giday2, Berhanu Erko2 and Hassen Mamo*1*
    Girma et al. BMC Complementary and Alternative Medicine (2015) 15:184 DOI 10.1186/s12906-015-0715-3 RESEARCH ARTICLE Open Access Effect of crude leaf extract of Osyris quadripartita on Plasmodium berghei in Swiss albino mice Senait Girma1, Mirutse Giday2, Berhanu Erko2 and Hassen Mamo*1* Abstract Background: Continuous emergence of multi-drug-resistant malaria parasites and their rapid spread across the globe warrant urgent search for new anti-malarial chemotherapeutics. Traditional medicinal plants have been the main sources for screening active phytochemicals against malaria. Accordingly, this study was aimed at evaluating the anti-malarial activity of Osyris quadripartita Salzm. Ex Decne., a plant which is used for traditional malaria treatment by local people in different parts of Ethiopia. Methods: Aqueous, chloroform and methanol crude leaf extracts of the plant have been prepared and tested for acute toxicity and anti-malarial efficacy in Plasmodium berghei (ANKA strain)-infected Swiss albino mice. Results: At three oral doses of 200, 400 and 600 mg/kg the plant material was safe, chemosuppressive and thus prevented body weight loss, hematological abnormalities and increased mice mean survival time compared to the negative control. The most efficacious extract was that of chloroform which prolonged mean mouse survival past day 11 of infection with all the mice in this group having the highest parasitemia suppression rate (41.3 %, at 600 mg/kg) although parasite clearance was not achieved compared to the standard drug (chloroquine) against the parasite. Conclusion: The finding supports the traditional use of the plant for the treatment of malaria. However, further confirmatory studies followed by isolation and characterization of the active anti-malarial compound (s) of the plant that is/are responsible for the observed parasite suppression is needed before it is recommended for malaria drug search and discovery.
    [Show full text]
  • The First Mistletoes: Origins of Aerial Parasitism in Santalales
    Available online at www.sciencedirect.com Molecular Phylogenetics and Evolution 47 (2008) 523–537 www.elsevier.com/locate/ympev The first mistletoes: Origins of aerial parasitism in Santalales Romina Vidal-Russell, Daniel L. Nickrent * Department of Plant Biology, Southern Illinois University, Carbondale, IL 62901-6509, USA Received 16 April 2007; revised 11 October 2007; accepted 17 January 2008 Available online 26 January 2008 Abstract Past molecular phylogenetic work has shown that aerial parasites have evolved five times independently in the sandalwood order (Santalales), but the absolute timing of these diversifications was not addressed. DNA sequences from nuclear SSU and LSU rDNA, and chloroplast rbcL, matK and trnL-F from 39 santalalean taxa were obtained. Separate and combined data partitions were analyzed with maximum parsimony and Bayesian inference. Time estimates were performed with Bayesian relaxed molecular clock and penalized likelihood methods using published fossil data. Both methods gave comparable divergence dates for the major clades. These data confirm five origins of aerial parasitism, first in Misodendraceae ca. 80 Mya and subsequently in Viscaceae (72 Mya), ‘‘Eremolepidaceae” (53 Mya), tribe Amphorogyneae in Santalaceae (46 Mya), and Loranthaceae (28 Mya). The rapid adaptive radiation and speciation in Loranthaceae coincides with the appearance of savanna biomes during the Oligocene. In all clades except Misodendraceae, it appears that aerial parasites evolved from ancestors that were polymorphic for either root or stem parasitism—a condition here termed amphi- phagous. Convergences in morphological features associated with the mistletoe habit have occurred such as the squamate habit, seed attachment structures, unisexual flowers, and loss of chlorophyll. Ó 2008 Elsevier Inc.
    [Show full text]
  • Santalales Santalacae) Communities in the Tlemcen Region
    Biodiversity Journal, 2021, 12 (2): 369–378 https://doi.org/10.31396/Biodiv.Jour.2021.12.2.369.378 Composition and diversity of Osyris L. (Santalales Santalacae) communities in the Tlemcen region Ibrahim Benmechta1*, Rédda Aboura1 & Brahim Babali1 ¹Laboratory of Ecology and Management of Natural Ecosystems BP119, Department of Ecology and Environment, Faculty of Nature and Life Sciences and Earth and Universe Sciences University of Tlemcen, 13000 Algeria *Corresponding author, email: [email protected] ABSTRACT The region of Tlemcen has a very rich and diverse flora heritage thanks to its geological and climatic variations. The genus Osyris L. (Santalales Santalaceae) is a semi-parasitic species which remains continually subject to host plants that are not well known in our study area. Our main objective was to search for this species, to inventory the taxa which enter into the structuring of its populations in the Tlemcen region and then to characterize them systemati- cally, biologically and biogeographically. The bioclimatic approach of the stations studied shows a lower semi-arid bioclimatic stage which has an influence on the floristic procession of these stands dominated by therophytes. The floristic inventory carried out enabled us, above all, to identify certain host plants specific to the presence of this genus with its two species Osyris alba L. and O. lanceolata, Ochst et Steud. in the Tlemcen region. This presence obeys specific ecological conditions which will give a certain distribution that we will detail in our next work. KEY WORDS Osyris; ecology; diversity; Tlemcen, Algeria. Received 19.01.2021; accepted 13.04.2021; published online 28.05.2021 INTRODUCTION world, including Osyris alba L.
    [Show full text]
  • (Osyris Lanceolata) Populations in Kenya Using ISSR Molecular Markers
    East African Agricultural and Forestry Journal ISSN: 0012-8325 (Print) 2313-450X (Online) Journal homepage: https://www.tandfonline.com/loi/teaf20 Genetic diversity of endangered sandalwood (Osyris lanceolata) populations in Kenya using ISSR molecular markers KP Andiego, OG Dangasuk, DW Odee, FS Omondi, DF Otieno & BK Balozi To cite this article: KP Andiego, OG Dangasuk, DW Odee, FS Omondi, DF Otieno & BK Balozi (2019) Genetic diversity of endangered sandalwood (Osyrislanceolata) populations in Kenya using ISSR molecular markers, East African Agricultural and Forestry Journal, 83:2, 80-93, DOI: 10.1080/00128325.2019.1605964 To link to this article: https://doi.org/10.1080/00128325.2019.1605964 Published online: 10 Jun 2019. Submit your article to this journal Article views: 125 View related articles View Crossmark data Citing articles: 2 View citing articles Full Terms & Conditions of access and use can be found at https://www.tandfonline.com/action/journalInformation?journalCode=teaf20 EAST AFRICAN AGRICULTURAL AND FORESTRY JOURNAL 2018, VOL. 83, NO. 2, 80–93 https://doi.org/10.1080/00128325.2019.1605964 Genetic diversity of endangered sandalwood (Osyris lanceolata) populations in Kenya using ISSR molecular markers KP Andiego a, OG Dangasukb, DW Odeec,d, FS Omondic, DF Otienob and BK Balozia aDepartment of Forestry and Wood Science, University of Eldoret, Kenya; bDepartment of Biological Sciences, University of Eldoret, Kenya; cBiotechnology Laboratory, Kenya Forestry Research Institute, Nairobi, Kenya; dNERC Centre for Ecology and Hydrology, Bush Estate, Edinburgh, United Kingdom ABSTRACT KEYWORDS Osyris lanceolata is an evergreen, drought tolerant tropical African conservation; effective tree species belonging to the family Santalaceae. It is endangered, alleles; endangered species; owing to overexploitation for its essential oil used in cosmetics and genetic diversity; genotype pharmaceutical industries.
    [Show full text]
  • Osyris Lanceolata Hochst
    Osyris lanceolata Hochst. & Steud. ex A. DC. Santalaceae LOCAL NAMES Afrikaans (rotslooibas,bergbas,looibas,pruimbos); Catalan (arraià. Ginestó valencià); English (East African sandalwood,Transvaal sumach,rock tannin-bush,bark bush); Spanish (bayón); Xhosa (intshakasa,intekeza,ingondotha-mpete); Zulu (umbulunyathi) BOTANIC DESCRIPTION Osyris lanceolata is a large, slender hardy shrub or a small tree (7-10 m tall). This multi-stemmed, evergreen hemi-parasitic plant has a round to irregular canopy and a grey smooth bark (later thick and rough). Leaves and flowers (Bart Wursten) Leaves sparse, blue-green, simple, alternate, lanceolate, sometimes egg- shaped, slightly glaucous, thick in texture, smooth with a waxy bloom, crowded along the stems; the apex is broadly tapering to rounded with a fine, sharp tip. The base is broadly tapering; lamina 2.5-7.5 cm, entire and rolled; petiole short, winged up to 0.6 cm, attachment to the stem forming ridges running down the stem. Twigs and leaves point upwards. Flowers small, unisexual, yellow-green, becoming red when ripe; borne in leaf axils in short panicles or clusters of 2-3 flowers. Male flowers in axillary cymes, female solitary; all floral parts in fours. fruit (Bart Wursten) Fruit small, edible, 1-seeded drupe, about 1 cm long, fleshy, egg-shaped, and green at first, turning yellow and becoming bright red to purple-black when ripe; crowned with a persistent calyx. BIOLOGY O. lanceolata is monoecious, flowering from March to August or even later, September to February with fruits ripening between May and September. In some areas the fruit is available throughout the year, but most abundant from July to December.
    [Show full text]
  • Phylogeny of Basal Eudicots: Insights from Non-Coding and Rapidly Evolving DNA Andreas Worberga, Dietmar Quandtb, Anna-Magdalena Barniskeb, Cornelia Lo¨Hnea, Khidir W
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Elsevier - Publisher Connector ARTICLE IN PRESS Organisms, Diversity & Evolution 7 (2007) 55–77 www.elsevier.de/ode Phylogeny of basal eudicots: Insights from non-coding and rapidly evolving DNA Andreas Worberga, Dietmar Quandtb, Anna-Magdalena Barniskeb, Cornelia Lo¨hnea, Khidir W. Hiluc, Thomas Borscha,Ã aNees-Institut fu¨r Biodiversita¨t der Pflanzen, Rheinische Friedrich-Wilhelms-Universita¨t Bonn, Meckenheimer Allee 170, 53115 Bonn, Germany bInstitut fu¨r Botanik, Technische Universita¨t Dresden, Zellescher Weg 20b, 01217 Dresden, Germany cDepartment of Biological Sciences, Virginia Tech, Blacksburg, VA 24061, USA Received 13 June 2006; accepted 10 August 2006 Dedicated to Wilhelm Barthlott on the occasion of his 60th birthday Abstract Sequence data of the trnL group I intron, the petD group II intron, the trnL-F and petB-D spacers, and the rapidly evolving matK gene were analysed from all families of the basal eudicot grade and from representatives of 19 core eudicot orders. The dataset comprised 5654 positions of aligned sequence plus a matrix of 1087 binary indel characters. Mutational hotspots correspond in number and extension to hotspots already known from basal angiosperms and, with respect to secondary structure, are generally located in terminal parts of stem-loop regions. Parsimony, Bayesian, and likelihood analyses depict Ranunculales as sister to all remaining eudicots with maximum support. The branching order in the basal eudicot grade is further resolved as Sabiales, Proteales, Trochodendrales, and Buxales. Nearly all of the backbone nodes gain high confidence, except for the node showing Proteales diverging before Trochodendrales, which is only moderately supported (83% JK).
    [Show full text]
  • Phylogenetic Relationships Among Early-Diverging Eudicots Based on Four Genes: Were the Eudicots Ancestrally Woody?
    MOLECULAR PHYLOGENETICS AND EVOLUTION Molecular Phylogenetics and Evolution 31 (2004) 16–30 www.elsevier.com/locate/ympev Phylogenetic relationships among early-diverging eudicots based on four genes: were the eudicots ancestrally woody? Sangtae Kim,a,* Douglas E. Soltis,b,* Pamela S. Soltis,c Michael J. Zanis,d and Youngbae Suhe a Department of Botany, University of Florida, Gainesville, FL 32611, USA b Department of Botany and the Genetics Institute, University of Florida, Gainesville, FL 32611, USA c Florida Museum of Natural History and the Genetics Institute, University of Florida, Gainesville, FL 32611, USA d School of Biological Sciences, Washington State University, Pullman, WA 99164, USA e Natural Products Research Institute, Seoul National University, Seoul 110-460, Republic of Korea Received 24 October 2002; revised 23 July 2003 Abstract Based on analyses of combined data sets of three genes (18S rDNA, rbcL, and atpB), phylogenetic relationships among the early- diverging eudicot lineages (Ranunculales, Proteales, Trochodendraceae, Sabiaceae, and Buxaceae) remain unclear, as are relationships within Ranunculales, especially the placement of Eupteleaceae. To clarify relationships among these early-diverging eudicot lineages, we added entire sequences of 26S rDNA to the existing three-gene data set. In the combined analyses of four genes based on parsimony, ML, and Bayesian analysis, Ranunculales are strongly supported as a clade and are sister to other eudicots. Proteales appear as sister to the remaining eudicots, which are weakly (59%) supported as a clade. Relationships among Trocho- dendraceae, Buxaceae (including Didymeles), Sabiaceae, and Proteales remain unclear. Within Ranunculales, Eupteleaceae are sister to all other Ranunculales, with bootstrap support of 70% in parsimony analysis and with posterior probability of 1.00 in Bayesian analysis.
    [Show full text]