Somatostatin, Cortistatin, Ghrelin and Their Receptors: from an Endocrine System to a Pleiotropic System of Patho- Physiologic Relevance

DEPARTAMENTO DE BIOLGÍA CELULAR, FISIOLOGÍA E INMUNOLOGÍA

Somatostatin, cortistatin, ghrelin and their receptors: From an endocrine system to a pleiotropic system of pathophysiologic relevance

Manuel D. Gahete Ortiz Córdoba 2010

TITULO: Somatostatin, cortistatin, ghrelin and their receptors: from an endocrine system to a pleitropic system of pathophysiologic relevance

AUTOR: MANUEL D. GAHETE ORTIZ

ISBN-13: 978-84-693-2990-0

DEPARTAMENTO DE BIOLGÍA CELULAR,

FISIOLOGÍA E INMUNOLOGÍA

Somatostatin, cortistatin, ghrelin and their receptors: From an endocrine system to a pleiotropic system of pathophysiologic relevance

Memoria de Tesis Doctoral presentada por Manuel D. Gahete Ortiz, Licenciado en Biología, para optar al grado de Doctor en Ciencias.

Los Directores

Dr. Justo P. Castaño Fuentes Dr. Raúl Luque Huertas Profesor Titular de Biología Celular Investigador Ramón y Cajal de la Universidad de Córdoba Universidad de Córdoba

En Córdoba, a 8 de Marzo de 2010

DEPARTAMENTO DE BIOLGÍA GRUPO DE CELULAR, FISIOLOGÍA E ENDORINOLOGÍA INMUNOLOGÍA CELULAR Y MOLECULAR

Dº Justo Pastor Castaño Fuentes y Dº Raúl Luque Huertas, Profesor Titular e Investigador Contratado del Departamento de Biología Celular, Fisiología e Inmunología de la Uniersidad de Córdoba,

INFORMAN

Que Dº Manuel David Gahete Ortiz, Licenciado en Biología, ha realizado bajo nuestra dirección el trabajo titulado “Somatostatin, cortistatin, ghrelin and their receptors: From an endocrine system to a pleiotropic system of patho-physiologic relevance” y que bajo nuestro juicio reúne los méritos suficientes para optar al Grado de Doctor en Ciencias

Y para que conste, firmo la presente en Córdoba, a 8 de Marzo de 2010

Fdo.: Prof Dr. Justo Pastor Fdo.: Dr. Raúl Miguel Castaño Fuentes Luque Huertas

Esta Tesis Doctoral ha sido realizada en el Departamento de Biología Celular, Fisiología e Inmunología de la Universidad de Córdoba, bajo la dirección de los Dres. Justo P. Castaño Fuentes y Raúl Luque Huertas. Dicho proyecto fue subvencionado mediante una beca del Programa Nacional de becas de FPU (FPU-AP20052473) concedida por el Ministerio de Educación y Ciencia.

“Si he conseguido ver más lejos

es porque me he aupado en

hombros de gigantes”

Isaac Newton

“La potencia intelectual de un hombre

se mide por la dosis de humor

que es capaz de utilizar”

Friedrich Nietzsche

AGRADECIMIENTOS

Cuando termina un ciclo parece inevitable echar la vista atrás y hacer balance; yo he tenido la oportunidad de hacer lo que realmente me gusta y por eso, en mi caso, la experiencia ha sido positiva, de hecho ya lo dijo Lee Smolin “en el fondo, los científicos somos gente con suerte; podemos jugar a lo que queramos durante toda la vida”. Además, he tenido el placer de compartir este camino con gente que me ha ayudado a crecer en todos los aspectos, con los que compartido grandes momentos y de los que conservaré un buen recuerdo. Mis primeras palabras de agradecimiento van dirigidas a mis directores de Tesis, Justo y Raúl, que hace ya algún tiempo me “convencieron” para iniciar esta aventura científica; ellos me han guiado durante todo este proceso y me han ayudado a terminar en tiempo y forma. Justo, tú me has enseñado a buscarle una finalidad a la ciencia, a mirar más allá, a no conformarme, a esforzarme al máximo, a dar lo mejor de mí. En definitiva me has enseñado que la ciencia no es sólo un trabajo sino una forma de entender la vida. Raúl, tú has sido un referente, un ejemplo a seguir. Tu apoyo y amistad han sido indispensables para mí. Gracias a ti he aprendido que un buen científico puede ser una persona leal, colaboradora, comprometida y solidaria. También gracias por tu apoyo Antonio, tú has sido como un director de Tesis para mí. Siempre he podido contar con tus consejos en el laboratorio y con tus historias en el comedor. Gracias también a Paco, María, Soco y Rafa por ayudarme a madurar científicamente y por mostrarme siempre otros puntos de vista. Compartir el día a día con vosotros, me ha enseñado mucho, a nivel personal y profesional. No quiero olvidarme de los doctores con los que he compartido mis visitas al extranjero; gracias a Rhonda por su hospitalidad y apoyo absoluto, a Stefan por enseñarme otra forma trabajar en el laboratorio y a Hubert, ejemplo de una vida dedicada a la ciencia. Obviamente, tengo mucho que agradecer a Alberto, que ha pasado de ser “aquel tipo raro de barbas que se sentaba al fondo del laboratorio” a un gran apoyo y amigo tanto dentro como fuera del laboratorio. Contigo he compartido todos los momentos, los buenos y los malos. Deseo que todo tu esfuerzo y dedicación tengan pronto su recompensa. También gracias a ti, Bea, por ayudarme a sobrellevar a tu novio en estos últimos años. Quiero hacer también una mención especial a Mario que me enseñó mucho y me guió durante momentos duros, a Ana por contagiarme su buen humor, a David con el que he compartido buenos ratos de ciencia y deporte, a Ester por aguantarme durante tantos años, a Jose por tu espontaneidad e inconformismo, y a Anabel, gracias por tu ayuda y por hacerme más ameno el día a día Gracias también a mi familia y amigos. Especialmente a mis padres y mi hermano, que siempre han estado a mi lado, dándome su apoyo, pendientes de cada cosa que he necesitado. Por supuesto, tengo muchísimo que agradecer a Almudena. Tú has sido la razón para seguir, la luz al final del túnel, quien ha estado siempre a mi lado, quien me ha dado fuerza en momentos de debilidad, quien ha disfrutando junto a mí de los buenos momentos, quien me ha dado su apoyo incondicional. Tú has sido mi baluarte, sin ti no lo hubiera conseguido. Por último, gracias a todas y cada una de las personas que, en algún momento, han compartido esta andanza conmigo. Todos vosotros formáis parte te este trabajo, sin vuestra ayuda no hubiera sido posible.

A Almudena, mis padres y mi hermano

LIST OF PUBLICATIONS

This Thesis is based on the research articles listed bellow, which will be referred in the text by their Roman numerals.

I. Raúl M. Luque, Manuel D. Gahete, Ute Hochgeschwender, and Rhonda D. Kineman. Evidence that endogenous SST inhibits ACTH and ghrelin expression by independent pathways. 2006. American Journal of Physiology: Endocrinology and Metabolism 291(2), 395–403.

II. Manuel D. Gahete, José Córdoba-Chacón, Roberto Salvatori, Justo P. Castaño, Rhonda D. Kineman, Raúl M. Luque. Metabolic regulation of ghrelin O-acyl transferase (GOAT) expression in the mouse hypothalamus, pituitary, and stomach. 2010. Molecular and Cellular Endocrinology 317(1-2), 154-60.

III. Manuel D. Gahete, Alicia Rubio, Mario Durán-Prado, Jesús Ávila, Raúl M. Luque, Justo P. Castaño. Expression of somatostatin, cortistatin, and their receptors, as well as dopamine receptors, but not of neprilysin, are reduced in the temporal lobe of Alzheimer disease patients. 2010. Journal of Alzheimer Disease. DOI: 10.3233/JAD-2010-1385

IV. Manuel D Gahete, Raúl M. Luque, Justo P. Castaño. A novel human ghrelin transcript containing intron-2 (In2-ghrelin) as well as Ghrelin-O-acyltransferase is over-expressed in breast cancer: pathophysiological relevance. Manuscript.

V. Manuel D Gahete, Raúl M. Luque, Justo P. Castaño. The sst5 truncated isoform, sst5TMD4, is expressed in primary breast cancer samples and increases the malignancy of breast MCF-7 cells. Manuscript.

VI. Manuel D. Gahete, Raúl M. Luque, Justo P. Castaño. Expression of the ghrelin and neurotensin systems is altered in the temporal lobe of Alzheimer disease patients. Manuscript.

LIST OF ABBREVIATIONS

aa – amino acid ACTH – Adrenocorticotropic hormone AD – Alzheimer Disease CNS – Central nervous system CST – Cortistatin DIO – Diet-induced obesity GH – Growth hormone GHRL – Ghrelin/obestatin gene GHRH – Growth hormone releasing hormone GHRP-6 - Growth hormone releasing peptide 6 GHS-R – Ghrelin receptor GIT – Gastrointestinal tract GOAT – Ghrelin O-acyltransferase GPCR – G-protein coupled receptor HPT - hypothalamus MBOAT – Membrane-bound O-acyltransferase NMUR - Neuromedin receptor NTSR - Neurotensin receptor PC - Prohormone convertase Pit – Pituitary gland PRL - Prolactin SST – Somatostatin sst – Somatostatin receptor TMD – Transmembrane domain UAG – non-acylated ghrelin

TABLE OF CONTENTS

Table of contents

1.- Introduction ...... - 1 - 2.- Aims of the study ...... - 13 - 3.- Results and general discussion ...... - 17 - 3.1.- Regulation of SST, ghrelin and GOAT in metabolic conditions (Articles I & II)...... - 17 - 3.2.- SST, ghrelin and breast cancer (Articles IV & V) ...... - 19 - 3.2.1- The role of sst5TMD4 in breast cancer (Article IV) ...... - 20 - 3.2.2- In2-ghrelin variant and breast cancer (Article V) ...... - 21 - 3.3.- SST, ghrelin and Alzheimer Disease (Articles III & VI) ...... - 23 - 3.3.1- SST and ssts in Alzheimer Disease (Article III) ...... - 24 - 3.3.2- Ghrelin system in Alzheimer Disease (Article VI) ...... - 25 - 4.- General conclusions ...... - 29 - 5.- References ...... - 33 -

1.- INTRODUCTION

Somatostatin and ghrelin: background

Somatostatin (SST) and ghrelin are two peptides that exhibit a clear difference from structural, evolutive and functional points of view. However, these peptides also display a number of relevant similarities and overlaps. Thus, both peptides are processed from prepro-hormones that generate several biologically active peptides (for review, see (Tostivint et al., 2006; Garg, 2007)), which exert their physiological functions through binding to G-protein coupled receptor (GPCRs) (Kojima et al., 1999; Moller et al., 2003). In addition, although both peptides were primarily hypothesized by their hypophysotropic action at the hypothalamus, they are in fact mainly produced in the gastrointestinal tract (GIT), and have been shown to be tightly linked to a regulatory interplay between endocrine and metabolic processes (Patel, 1999; Cordido et al., 2009). Interestingly, although both peptides were isolated while searching a positive regulator of pituitary somatotropes (Brazeau et al., 1973; Kojima et al., 1999), their actual roles in the regulation of growth hormone (GH) secretion are opposite. Specifically, SST is the most potent and the only evolutively conserved inhibitor of GH release in the vertebrate lineage, whereas ghrelin is, together with GH-releasing hormone (GHRH), the most important stimulus for GH secretion in mammals (for review, see (Gahete et al., 2009)). Another similarity between SST and ghrelin systems is that despite being thoroughly studied, some of their actions are still uncertain or controversial and, as will be discussed later, cannot be explained by the interaction with their known receptors. Accordingly, there are still a number of questions that remains to be solved in order to fully understand the (patho)physiological functions that have been associated to SST and/or ghrelin systems. There are three potential, non-excluding causes which could help to explain, at least in part, the uncertain or controversial issues related to the functional features of SST and ghrelin systems: 1) the wide, growing diversity of SST- and ghrelin-related peptides and their receptors with new components being frequently added to each system; 2) the lack of complete, integrative studies focusing in the multiple components of these systems at different levels (central and peripheral), or 3) the molecular and functional interactions between the SST- and ghrelin-family members, which are still poorly studied and can increase not only the complexity but also the versatility of these systems, likely including novel undiscovered functions.

1.- INTRODUCTION

Somatostatin, cortistatin, and ghrelin peptidic family SST and ghrelin are the leading members of two families of peptides, each comprising several components, which are generated through different mechanism, from the existence of orthologous genes, to alternative transcriptional splicing and/or post- translational processing and modifications. Specifically, SST is a 14-aminoacid hypothalamic peptide (SST-14) containing a disulfide bridge that allows its cyclic structure, which was originally discovered in 1973 by its ability to inhibit GH secretion (Brazeau et al., 1973). However, rather than generating SST-14 alone, human SST precursor (prepro-SST) can also generate an amino-terminally extended isoform of 28 residues, named SST-28, which shares similar but not identical functions or tissular distribution with SST-14 (Pierotti and Harmar, 1985). Moreover, recent data suggest that processing of the N-terminal part of prepro-SST gives also rise to neuronostatin, a totally new peptide distinct from SST (Samson et al., 2008). Furthermore, SST shares its evolutive history with a closely related gene, cortistatin (CST), which encodes a peptide originally discovered in 1996 in rats as a 14-aminoacid cortical peptide (CST-14) (de Lecea et al., 1996) and subsequently found in humans, as a 17-residue peptide that shares 11 of 14 amino acids of SST-14 including the disulfide bridge and the FWK motif, which are crucial to exert their biological effects (Fukusumi et al., 1997) (Fig. 1). Both peptides, SST and CST, are encoded by orthologous genes derived from a hypothetical common SST/CST ancestor gene (Tostivint et al., 2004). Similar to SST, CST precursor (prepro-CST) can originate also several peptides (CST-14 and CST-28 in rodents and CST-17 and CST-29 in humans) which are analogous to somatostatin peptides (SST14 and SST28, respectively).

5´UTR Ancestral SST/CST gene 3´UTR

gene duplication

5ÚTR SST gene 3ÚTR 5ÚTR CST gene 3ÚTR transcription/translation

SP prepro-SST prepro-hormones SP prepro-CST

pro-SST pro-hormones pro-CST

SerAlaAsn SerAsnPro AlaMetAlaPro ArgGlu Arg LysAlaGly CysLysAsnPhePhe Gln GluGlyAla Pro ProGln Gln Ser AlaLys LysGlu AspArgMetPro CysLysAsnPhePhe

S Trp S Trp S Lys S Lys SST28 PheThrCysSer Thr CST29 Lys PheSerCysSer Thr

Gly Cys Lys AsnPhe Phe Asp Arg Met Pro Cys Lys AsnPhe Phe

S Trp S Trp SST14 S Lys S Lys Cys Ser PheThr Thr CST17 LysCys Ser Ser Phe Thr

Figure 1. Schematic representation of SST/CST gene evolution and processing.

1.- INTRODUCTION

The relationship between SST and CST has remained unclear during years because the precursors of SST and CST peptides exhibit low similarities (nucleotide and amino-acid level), except for the C-terminal regions, which are highly conserved and codify the mature peptides (Tostivint et al., 2004). Ghrelin identification represented a bright example of reverse pharmacology, where the use of an orphan receptor enabled the discovery of an endogenous ligands (Kojima et al., 1999). In fact, the endogenous ghrelin-receptor (GHS-R) was initially discovered by its ability to bind to artificial compounds with GH-releasing activity (the so-called GH secretagogues or GHSs) such as GHRP‐6 or hexarelin (Howard et al., 1996). Then, almost 25 years after the synthesis of the first GHS, the endogenous ligand for the orphan receptor was found. Specifically, ghrelin is a 28 amino acid peptide that was originally identified by Kangawa’s group from a gastric extract (Kojima et al., 1999). The mature peptide is cleaved from its precursor, prepro-ghrelin, by prohormone convertases (PC1/3) and is characterized by a very specific and unique structural modification, as the hydroxyl group of serine in position 3 is covalently acylated by an n‐octanoic acid residue, which is crucial for the biologic activity of the peptide, including GH release and orexigenic effects (for review, see (Zhu et al., 2006)). Of note, no other naturally occurring peptide has been previously shown to have this acyl-group as a posttranslational modification. The enzyme responsible for the acylation of ghrelin has been recently identified as the fourth member of the membrane-bound O-acyltransferases superfamily (MBOAT4) and was named accordingly as ghrelin O-acyltransferase (GOAT) (Gutierrez et al., 2008; Yang et al., 2008). Although acylated-ghrelin is the major active product of the ghrelin gene, it is now well- established that its prepro-hormone can generate various bioactive molecules besides acylated-ghrelin, which are generated by several mechanism, including alternative splicing, extensive post-translational modifications or intron retaining processes (i.e. exon3-deleted-ghrelin, des-Gln14-ghrelin, non-acylated ghrelin, and mouse In2-ghrelin variant, respectively), and whose precise roles have not been fully elucidated (for review, see (Seim et al., 2009)). Interestingly, non-acylated ghrelin (UAG) is present in serum in far greater concentrations than acylated-ghrelin, yet it is unable to exert any recognizable endocrine activity (Broglio et al., 2004). In addition, it has been recently demonstrated that ghrelin precursor can be processed to yield a completely different, 25-aa mature peptide, named obestatin, which was originally postulated as a natural antagonist of ghrelin (Zhang et al., 2005), yet this idea could not be confirmed by other groups and is currently under debate (Qader et al., 2008).

1.- INTRODUCTION

Ghrelin gene Signal peptide (SP) (GHRL) -1 1 2 3 4 Ghrelin C-terminal Obestatin Exon 1 Exon -1 transcription transcription Δex1-pro-ghrelin

mRNA -1 2 3 4 Native prepro-ghrelin Protein SP C-terminal Obestatin 1 2 3 4 Δex1-pro-des-Gln14ghrelin SP Ghrelin C-terminal Obestatin mRNA -1 2 3 4 Protein SP C-terminal Prepro-des-Gln14-ghrelin Obestatin 1 2 3 4 Δex1-pro-ghrelin

SP Ghrelin C-terminal mRNA -1 3 4 Obestatin Protein SP Δ2 C-terminal Δex3-prepro-ghrelin Obestatin 1 2 4 Δex1-pro-des-Gln14ghrelin mRNA SP Ghrelin Δ3 C-terminal -1 4 Protein SP Δ3 C-terminal Figure 2. Schematic representation of alternative human ghrelin gene transcription.

SST/CST, and ghrelin receptors The complexity and versatility of the SST/CST and ghrelin systems are also influenced by their receptors. To date, five different intronless genes which encode for 5 SST/CST receptors (sst1-5), as well as a carboxy-terminal spliced variant of the sst2, named sst2B, have been identified and are currently classified as Class A GPCRs (Moller et al., 2003). Like SST and CST, ssts are widely expressed throughout the body (Patel, 1999). All ssts show a comparable subnanomolar binding affinity to SST and CST, and display the typical molecular architecture shared by GPCRs comprising seven putative transmembrane domains (7TMD), the conserved DRY motif at the cytoplasmic face of TMD3 and N-linked glycosilation sites in the N-terminal domain (Moller et al., 2003). According to their sequence identity and pharmacological properties, ssts can be subdivided into two groups, namely SST1, which comprises sst2, sst3 and sst5, and SST2, which includes sst1 and sst4. In spite of their branched evolutive process, sequences of ssts are highly conserved among species as well as among the sst-subtypes, being more divergent in their N- and C-terminal domains (Moaeen-ud-Din and Yang, 2009). Interestingly, the most conserved sst-subtype across species seems to be the sst1, whereas the most divergent one is the sst5, this suggesting the existence of a unique evolutionary relevance for sst5, which is supported by its involvement in certain atypical processes,

1.- INTRODUCTION such as the ability of sst5 to mediate stimulatory actions of SST and CST on GH secretion in various species (primate, pig and/or rodent) (Baranowska et al., 2006; Luque et al., 2006; Luque et al., 2008). The complexity and versatility of the sst family is further enhanced by the fact that several of these receptors are often present simultaneously in the same cells, where they are able to functionally interact with each other or with other GPCR family members forming homo- and/or hetero-dimers complexes that can couple to different signaling cascades to mediate multiple actions (Duran-Prado et al., 2008). In addition, our laboratory has recently identified and characterized new functional truncated variants of the sst5, with less than 7TMD, in various mammalian species (human, mouse, rat and pig) (Duran-Prado et al., 2009; Cordoba-Chacon et al., 2010; Durán-Prado et al., In preparation). These truncated sst5 variants have unique ligand-selective signaling properties, distinct distribution in normal tissues and pituitary tumors and different cellular localization to that of the originally identified, long sst5 isoform. Study of these novel variants could contribute to further our understanding of the already complex and highly versatile functional system comprised by SST, CST, and their receptor-subtypes.

Figure 3. Schematic representation of SST/CST and ghrelin receptors signaling. AC: Adenilate ciclase; AMPc: Cyclic adenosine monophosphate; ATP: Adenosine triphosphate; G: G-protein; IP3: inositol 2+ triphosphate; PIP2: phosphatidylinositol bisphosphate; PKA: Protein kinase A; PKC: Protein kinase C; PKcaM: Ca / calmodulin dependent protein kinase; PLA: Phospholipase A; PLC: Phospholipase C; PTP: Protein tyrosine phosphatase.

1.- INTRODUCTION

On the other hand, to date, only one gene encoding for ghrelin receptors (GHS-R) has been identified. Specifically, transcription of this gene can lead to the generation of a full- length GPCR with 7TMD (GHS-R1a) (Howard et al., 1996) that is widely expressed throughout the organism of several species, or alternatively, to a truncated version with 5TMD (GHS-R1b), which hitherto has only been found to date in human and bovine species (Colinet et al., 2009). Interestingly, GHS-R1a has been reported to specifically bind acylated-ghrelin but not des-acyl-ghrelin, while the endogenous ligand of GHS-R1b is still undiscovered and its precise role is as yet unclear. It is also worth noting that ghrelin receptors share a high evolutive identity with neurotensin receptors (NTSR1-3) (McKee et al., 1997) and, together with neuromedin U receptors (NMUR1-2), comprise a unique phylogenetic family, the so-called ghrelin receptor family (Holst et al., 2004). Interestingly, some members of this family (GHS-R1b and NTSR1) are able to physically and functionally interact as it has recently been shown in cancer cells, thereby further increasing the complexity and versatility of the ghrelin system (Takahashi et al., 2006).

Actions of SST, CST and ghrelin systems Over the last years, a number of detailed and extensive studies on the physiologic regulatory systems integrated by SST, CST and their receptors, sst1-sst5, and by ghrelin and its receptors, GHS-R1a/1b, has revealed the existence of common and strikingly parallel phenomena in their functionality. Thus, contrary to the earlier “one hormone-one receptor-one function” simplistic and unidirectional notion, it is now well established that each of these systems is in fact composed of multiple peptides and various receptors which can act in concert to exert a number of actions. Indeed, SST and CST, as well as ghrelin, have been found to oppositely regulate the physiology of various adenohypophysial cell types by acting directly at the pituitary level or indirectly at the central (hypothalamic) level. Specifically, besides the well-known effect of SST, CST, ghrelin or their synthetic analogs in regulating oppositely GH release from pituitary somatotropes, both systems also act on prolactin (PRL)- or ACTH-producing cells to influence their secretory capacity (inhibition by SST/CST and stimulation by ghrelin) (Enjalbert et al., 1982; Shimon et al., 1997; Rubinfeld et al., 2004; Schmid et al., 2005; Rubinfeld et al., 2006). In addition to the well-known functions of SST, CST, ghrelin and their receptors at the pituitary-hypothalamus interface, both systems have been reported to influence common endocrine and non-endocrine relevant processes at multiple levels, from central nervous system (CNS) to peripheral tissues in normal and pathological conditions. As an example, both systems play important regulatory actions (and interactions) on beta cell function

1.- INTRODUCTION and survival, as well as in glucose homeostasis (Efendic et al., 1974; Gerich et al., 1975; Brown et al., 1976; Gauna and van der Lely, 2005; Grottoli et al., 2006; Dezaki et al., 2008; Qader et al., 2008; Volante et al., 2009), although the molecular mechanisms underlying those effects are not fully elucidated. In a reciprocal loop, changes in the metabolic environment as those seen in severe metabolic dysregulation (i.e., obesity, fasting) tightly regulate multiple components of both systems at various levels (e.g. hypothalamus, pituitary, pancreas, etc). In addition to these metabolic actions, SST/CST and ghrelin have also been involved in the regulation of cortical functions. Indeed, both peptides, SST and CST, are widely expressed at CNS, where they act as neurotransmitters and neuromodulators (Viollet et al., 2008). However, at this level, SST and CST seem to exert different, and even opposite, actions. Specifically, CST causes hypo-motility, depresses cortical excitability and increases slow wave sleep without affecting REM sleep, whereas SST causes hyper-motility and enhances cortical excitability and REM sleep (de Lecea et al., 1996). In contrast, SST and CST, together with ghrelin, which has also been found to acts as a neuromodulator (Martin et al., 2005; Miao et al., 2007; Xu et al., 2009), seem to possess similar roles in cognitive processes, where they act as positive stimulus in memory and learning processes (Epelbaum et al., 2009; Toth et al., 2009a; Toth et al., 2009b). CST and ghrelin (and to a lesser extent SST) have also been reported to exert potent anti-inflammatory actions in therapeutically relevant models of arthritis or inflammatory bowel disease (Gonzalez-Rey et al., 2006; Gonzalez-Rey et al., 2007; Bulgarelli et al., 2009) and can also influence atherogenesis (Liu et al., ; Kellokoski et al., 2009). In this context, it is noteworthy that both neuropeptide-receptor systems are highly expressed in a number of different tumors, where they can exert relevant and unique pathophysiological actions (Waseem et al., 2008; Watt et al., 2008; Nikolopoulos et al., 2009; Volante et al., 2009). For example, SST and its long-acting synthetic analogs (octreotide, lanreotide) can inhibit abnormal hormone or peptide secretion in different types of tumors of endocrine and non- endocrine nature (i.e. pituitary, gastro-entero-pancreatic, etc) (Hofland et al., 2005; Grottoli et al., 2006; Giordano et al., 2007a) wherein they can also counteract cell growth and/or promote apoptosis via the sst expressed in tumoral cells (Reubi et al., 1990; Cameron Smith et al., 2003; Watt et al., 2008). In fact, these properties of SST analogs have served as the basis for their use in the treatment of a number of pituitary and neuroendocrine tumor pathologies (Vallette and Serri, 2008; Oberg, 2009). On the other hand, the pathophysiological role and therapeutic potential of the presence of ghrelin and its receptors in tumors is less understand, as is the case, for example, for ghrelin presence

1.- INTRODUCTION in corticotropinomas causing Cushing’s disease where it can stimulate hormone secretion via GHS-R (Martinez-Fuentes et al., 2006). Nevertheless, expression of these neuropeptide systems is not restricted to neuroendocrine tumors, but also extends to different types of cancers. Indeed, it has long been known that SST and sst1-5, and more recently CST, ghrelin and GHS-Rs are functionally present in different cancers, such as breast, lung, ovary, prostate, or colon (Reubi et al., 1990; Cassoni et al., 2001; Cameron Smith et al., 2003; Jeffery et al., 2005; Watt et al., 2008). However, their function and potential clinical application in these contexts is still to be elucidated.

Cross-regulation and interaction of SST/CST and ghrelin systems The remarkable overlap in the functional targets of SST/CST and ghrelin systems is accompanied by a tight and intrincated functional cross-regulation across the mammalian lineage. For example, it has been found that SST infusion reduce plasma ghrelin levels in rats (Shimada et al., 2003), and humans (Norrelund et al., 2002). On the other hand, ghrelin seems to exert a divergent action on SST release at systemic and local levels since ghrelin infusion seems to elevate plasma SST levels in humans (Arosio et al., 2003) while it reduces SST secretion in pancreas explants (Egido et al., 2002). The close relationship between SST/CST and ghrelin system is also patent at the molecular level. In fact, albeit SST and CST peptides exhibit similar subnanomolar binding affinities to all the ssts, their biological actions are not absolutely overlapping, indicating that other receptors should mediate SST and CST divergent actions. In this scenario, CST but not SST has been found to activate the human proadenomedulin receptor MgrX2 (Robas et al., 2003). Moreover, CST but not SST has also been found to specifically activate the human GHS-R1a (Deghenghi et al., 2001) which suggests that CST could represent a natural link between ghrelin and SST/CST systems. Furthermore, our group has recently identified new functional truncated variants of sst5, with less than 7TMD, in humans (Duran-Prado et al., 2009), pigs (Durán-Prado et al., In preparation), mice and rats (Cordoba-Chacon et al., 2010) which exhibit different signaling capacities in response to SST or CST. Finally, an additional line of evidences supporting the profound relation between SST/CST and ghrelin systems, which also increases the complexity of these systems comes from the recent demonstration that sst5 can physically interact with GHS-R1a forming heterodimers, which could modify the signaling elicited by ghrelin and/or SST. However, the functional consequences of this interaction are still unknown.

1.- INTRODUCTION

In sum, there is emerging evidences to support the notion that, rather than being isolated neuropeptide-receptor systems with distinct, separate functions, SST, CST, ghrelin and their related peptides and receptors comprise a network of physiologically interrelated components able to functionally interact at the molecular, cellular and organismal level to regulate multiple functions in health and disease. In this scenario, the next challenge will be to identify, characterize and place in a physiological context and in a position of potential therapeutic application the elements comprising the SS/CST/ghrelin- receptor supra-system, their interactions and new components.

2.- AIMS OF THE STUDY

The general aim of this study was to further our knowledge of the role of the SST/CST and ghrelin systems in (patho)physiological conditions that extend outside the most classical neuroendocrine hypothalamus-pituitary actions, and incorporate new functions and interactions at the interface of cancer, and metabolic and neurodegenerative disorders.

This general aim was developed into the following specific objectives:

Objective 1. To investigate the reciprocal crosstalk between SST and ghrelin systems in conditions of metabolic stress in the mouse. Specifically, to explore regulation of SST/ghrelin expression by fasting at the hypothalamus-pituitary-stomach axis, and to explore the role of endogenous SST in the control of ghrelin plasma levels, as well as ghrelin expression in this axis, using SST knock-out mice. Additionally, we will analyze the possible involvement of the ghrelin-acylation enzyme (GOAT) in controlling acyl/desacyl-ghrelin levels under metabolic insults (fasting and diet- induced obese mice models).

Objective 2. To explore the putative relevance of SST/CST and ghrelin systems, especially their two novel members, sst5TMD4 and In2-ghrelin variant, in breast cancer. To this end, levels of expression of the individual components of the two systems will be measured in human breast cancer samples, and their putative functional relevance was addressed by using human breast cancer cell lines.

Objective 3. To study the potential roles of the SST/CST and ghrelin systems in Alzheimer disease (AD). To this end, the absolute mRNA levels of individual components of the SST/CST and ghrelin systems were evaluated in three regions of the temporal lobe of AD patients and matched controls.

3.- RESULTS AND GENERAL DISCUSSION

3.1.- Regulation of SST, ghrelin and GOAT in metabolic conditions (Articles I & II) It is now well-established that SST and ghrelin exert key regulatory roles in the hypothamalus (HPT)-Pituitary (Pit)-stomach axis in normal conditions and under extreme metabolic challenges (fasting and obesity), by acting via endocrine, paracrine or autocrine mechanism (Mounier et al., 1989; Ferraro et al., 1996; Horvath et al., 2001; Dimaraki and Jaffe, 2006). In order to determine whether a reciprocal regulatory loop also exists wherein catabolic (fasting) or obese states influence the production of HPT, Pit or stomach SST and/or ghrelin, we used mice model. These animals are widely employed to study the consequences that a patho-physiologic state can cause on specific tissues and cell functions because of their easy experimental manipulation (Hochgeschwender and Brennan, 1995; Luque and Kineman, 2006; Luque et al., 2007; Luque et al., 2009). Likewise, mice are ideally suited to study the pathophysiological importance of gene products because of the feasibility to generate genetically modified mice over- or under- expressing the product of interest (i.e., knockout models) (Hochgeschwender and Brennan, 1995; Luque and Kineman, 2007; Luque et al., 2009). Accordingly, we used male mice under extreme metabolic conditions (fasting and obesity) to measure the expression levels of SST and/or ghrelin and compared with matched-controls. In addition, we also determined the potential role that endogenous SST plays in the regulation of ghrelin gene synthesis at the HPT, Pit and stomach levels, as well as in the secretion of circulating acylated- and total-ghrelin levels in male mice, with or without endogenous SST [SST- intact controls and SST-knockout(KO)], and under normal or catabolic conditions (48h- fasting). Our results indicated that SST was highly expressed in mouse HPT and stomach and, although fasting tends to decrease HPT and stomach SST mRNA levels, these differences did not reach statistical significance. Similarly, HPT and stomach ghrelin mRNA levels were not significantly altered in fasted mice compared to fed-control mice; conversely, Pit ghrelin expression was increased in fasting. On the other hand, ghrelin mRNA levels in Pit and stomach, but not in HPT, were decreased in obese mice. Furthermore, although circulating levels of total (acylated + desacylated) ghrelin were not altered in fasted mice compared with fed mice, plasma levels of active (acylated) ghrelin were drastically increased in fasted mice. Diet-induced obese mice tended (50% reduction, p=0.13) to suppress total-ghrelin levels in mice without altering acylated-ghrelin levels, which was consistent with a significant decline in stomach ghrelin expression (considered the major source of circulating ghrelin). The remarkable difference in the regulation of total and acylated ghrelin in plasma during fasting and obesity, together with the discovery of the GOAT enzyme as the acyl-

3.- RESULTS AND GENERAL DISCUSSION transferase responsible for ghrelin acylation (Gutierrez et al., 2008; Yang et al., 2008), led us to investigate whether the expression of the GOAT enzyme could be one of the underlying mechanisms responsible for the divergent regulation of circulating total and acylated ghrelin observed in extreme metabolic conditions. Our results indicated, for the first time, that GOAT is expressed at high levels in stomach and its regulation correlates with circulating acylated-ghrelin levels in fasted and obese mice (up-regulation and downregulation, respectively). Interestingly, we found that GOAT was also present and regulated in HPT and Pit in response to metabolic extremes, since a significant increase in HPT and Pit GOAT mRNA levels under fasting conditions but a decline in Pit, but not HPT, in the obese state were observed. Nonetheless, our data clearly demonstrated that GOAT mRNA levels paralleled the expression levels of ghrelin in the mouse tissues analyzed (Stomach  pituitary = hypothalamus). This, coupled to the previous data showing that the precursor peptide processing enzymes PC1/3 are expressed in stomach, Pit and HPT (Macro et al., 1996; Dong and Day, 2002; Nillni, 2007), strongly support that in addition to the plasma acylated-ghrelin produced by the stomach, locally production of ghrelin could be an alternative source of acylated-ghrelin within the Pit and HPT. Intriguingly, our results suggest that the substrate of GOAT activity in the mouse Pit may not be limited to the native-ghrelin locally produced within this gland. In fact, our laboratory has previously identified a spliced mRNA ghrelin variant that retains the intron 2 (In2-ghrelin variant; (Kineman et al., 2007)), which may be of biological relevance because it is expressed at higher levels than the native ghrelin transcript in the Pit and is regulated under metabolic stress (fasting and diet-induced obesity (DIO)). Interestingly, we have found that GOAT expression levels closely paralleled those of In2-ghrelin variant, but not those of native- ghrelin, in the mouse models analyzed (fasting, DIO and knockout models), thereby suggesting that In2-ghrelin variant could be a primary substrate for GOAT in the Pit. Finally, our data using a SST-KO mouse model (Zeyda et al., 2001) support previous indications suggesting the existence of a profound relation between SST/CST and ghrelin systems (Egido et al., 2002; Norrelund et al., 2002; Arosio et al., 2003; Shimada et al., 2003). Specifically, SST-KO mice exhibited increased ghrelin mRNA expression in the stomach, as well as elevated circulating levels of total-ghrelin, but not acylated-ghrelin, as compared to SST-intact control mice. This suggests that endogenous SST can inhibit ghrelin mRNA expression and consequently circulating total ghrelin levels in mice. Interestingly, fasting did not alter neither stomach ghrelin mRNA expression nor plasma total-ghrelin levels; however, it did increase circulating acylated-ghrelin levels in both SST-KO and SST-intact mice, compared with their controls fed SST-KO and SST-intact mice,

3.- RESULTS AND GENERAL DISCUSSION suggesting the existence of a different player, independent of SST regulation, that regulate plasma acylated-ghrelin levels in fasting conditions. In all, our results indicate that the expression of the SST/ghrelin system in the HPT- Pit-stomach axis is tightly regulated by metabolic conditions and is strongly influenced by the presence of SST. In addition, our data also show novel evidence for the coordinated regulation of GOAT and In2-ghrelin variant expression in this axis, which suggest a potential functional relevance of this system.

3.2.- SST, ghrelin and breast cancer (Articles IV & V) SST/CST/ssts and ghrelin/GHS-Rs are two well-known endocrine regulatory systems composed of multiple peptides and receptors which are widely expressed and exert multiple actions in normal and pathological conditions (Patel, 1999; Cordido et al., 2009). In this context, it is noteworthy that SST/CST-ghrelin systems are highly expressed in a number of different endocrine-related tumors, including breast cancer. Moreover, there is emerging evidence showing that specific components of these systems can play relevant and unique pathophysiological roles in these pathologies, likely by regulating cell proliferation and tumor progression (Waseem et al., 2008; Watt et al., 2008; Nikolopoulos et al., 2009). This may be of particular relevance in breast cancer, a multi-factorial pathology profoundly influenced by endocrine factors, such as circulating and/or locally- produced GH, IGF-I and estrogen (Haslam, 1988; Laban et al., 2003). In fact, antihormonal treatments using therapeutic agents that block the effect of estrogens (e.g. tamoxifen) are widely used in the management of breast cancer patients, since these drugs are effective in blocking the in vivo and in vitro estrogen-mediated effects of GH/IGF-I axis on tumor progression and/or proliferation of breast cancer cells (Laban et al., 2003). As mentioned above, SST/CST and ghrelin systems are widely expressed in breast cancer tissues and derived cell lines (Cameron Smith et al., 2003; Jeffery et al., 2005), suggesting a possible autocrine and/or paracrine function. However, the precise role and the local regulation of SST/CST and ghrelin systems in breast cancer are still uncertain. Indeed, clinical trials using long-acting SST analogs have been unsatisfactory (Watt et al., 2008), and in vitro assays have failed to demonstrate any relevant effect of ghrelin in breast cancer cell lines. Nevertheless, hope for a potential application of these agents still exist because, there is data indicatingº that SST-analogs can reduce plasma IGF-1 in breast cancer patients (Dolan et al., 2001), and this could be relevant in antihormonal therapies, as IGF-1r seems to be crucial in the development of endocrine therapy resistance (Casa et al., 2008).

3.- RESULTS AND GENERAL DISCUSSION

In this context, the following two studies (Papers III & IV) were conducted to determine the putative relevance of SST/CST, ghrelin and their receptors in breast cancer, specially focusing in two novel components of these systems recently identified by our research group: 1) the truncated human sst5TMD4 (Duran-Prado et al., 2009; Durán- Prado et al., 2010) and 2) a human In2-ghrelin variant (Papers IV of this work).

3.2.1- The role of sst5TMD4 in breast cancer (Article IV) In this study, we report for the first time the presence of the new truncated isoform sst5TMD4 (Duran-Prado et al., 2009) in breast cancer. Specifically, expression of sst5TMD4 was found in 28% of the human breast cancer samples analyzed (n=12 out 40) and its expression was highly correlated with that of sst2. Interestingly, when sst2 and sst5TMD4 were coexpressed in the same cell lines (hamster ovarian CHO-K1 or human breast cancer MCF-7 cells), they show a preferential intracellular localization, which was comparable to that previously described for sst5TMD4 alone (Duran-Prado et al., 2009) and also parallel to that reported recently for the endogenous sst1-5 expressed in MCF-7 (Watt and Kumar, 2006). In line with this, use of a Fluorescence resonance energy transfer (FRET) analysis demonstrated that sst5TMD4 is able to physically interact with sst2, and physically retain a high proportion of this receptor in the intracellular compartments, thus acting as a dominant negative for sst2. This is further supported by the fact that sst5TMD4 is also capable to alter the normal ability of sst2 to signal in terms of intracellular calcium mobilization in response to its endogenous ligands (SST and CST). Interestingly, it has been previously reported that the alteration of the sst2 plasma membrane localization could lead to the elimination of an inhibitory sst2-mediated autocrine loop, which derives into an epithelium-mesenchymal transition (EMT), and enhanced proliferation and invasion (Benali et al., 2000; Leu et al., 2008). Interestingly, in addition to the dominant- negative role observed for sst5TMD4 over sst2 in cell models, we have found that stable expression of sst5TMD4 in MCF-7 cells leads to a mesenchymal-like or fibroblastoid appearance instead of the usual epithelial morphology signature of this cell type, reinforcing the notion that sst5TMD4 could play a relevant role in the patho-physiology of breast cancer cells. In fact, compared with mock transfected cells, sst5TMD4-stably transfected cells showed higher migratory and proliferative abilities, two properties that could be determinant in tumoral progression and metastases. Taken together, our findings that sst5TMD4 expression is directly correlated with the most clinically aggressive samples obtained from patients with breast tumors, as well as with enhanced signs of malignancy in in vitro cells models, it is tempting to speculate that the presence and

3.- RESULTS AND GENERAL DISCUSSION actions of the truncated sst5TMD4 could contribute, at least in part, to the development and increase of malignancy observed in some breast cancer. In order to ascertain the molecular basis of the increased malignancy features of MCF-7 cells transfected with sst5TMD4, we studied two major signal transduction pathways known to be involved in proliferation, migration and phenotype transformation in cancer cells, Akt and extracellular signal-regulated kinases (ERKs) (Santen et al., 2002; Liu et al., 2007). Our results indicate that the basal phosphorylation levels of Akt and ERK are different in sst5TMD4-stably transfected cells compared with mock-transfected control cells. Specifically, sst5TMD4-expressing cells show a higher level of both, P-Akt and P-ERK levels than cells that do not express sst5TMD4. These elevations in P-Akt and P- ERK levels observed in sst5TMD4-stably transfected cells compared with control cells could be linked to, and may perhaps underline, the malignant characteristics associated to breast cancer cells, because it has previously demonstrated that P-Akt levels are increased in 30-40% of the human breast cancer samples compared with controls, and that this elevation promotes epithelial-mesenchymal transition, which derives in tumor progression to an invasive and metastatic carcinoma (Liu et al., 2007). In addition, it has been shown that mitogen-activated protein kinases (MAPK) cascades are even more important than Akt in breast cancer. Specifically, ERK1 and ERK2 are the two most relevant MAP kinases isoforms in breast cancer and are usually over-expressed and over- phosphorylated in certain type of mammary tumors, especially, node positive primary tumors (Santen et al., 2002). The increase in P-ERK levels has been associated to poor survival in triple negative cancers (estrogen receptors-, progesterone receptors-, and epithelial-growth factor receptors-lacking breast cancers) where such increase is considered a poor prognosis factor (Eralp et al., 2008). Inasmuch as several evidences pointing to a basal, constitutive inhibitory effect of endogenous SST, possibly via sst2, on P-ERK levels (Ben-Shlomo et al., 2007), our data showing that sst5TMD4 alters the localization and functionality of sst2, lends credence to the view that the elevated P-ERK levels observed in sst5TMD4-expressing breast cancer cells could be associated to a blockade of a constitutive inhibitory action of SST/sst2, and that this, in turn, is linked to the bad progression and features of cancer cells expressing this receptor variant.

3.2.2- In2-ghrelin variant and breast cancer (Paper V) Similar to that previously found in the murine ghrelin gene (Kineman et al., 2007), we have demonstrated that the human ghrelin gene can also suffer processes of intron (In) retention to generate a new ghrelin-variant. Specifically, human In2-ghrelin transcript variant contains Exon(Ex)0, Ex1, In2 and Ex2 but lacks Ex3 and Ex4 compared with the

3.- RESULTS AND GENERAL DISCUSSION native-ghrelin transcript. Given the fact that the In2-variant and native-ghrelin transcripts share the Ex0 and 1, we speculate that the human In2-ghrelin variant share with the native form the start codon, located in the exon 1, originating a new transcript of 117 amino acids (prepro-In2-ghrelin) with similar 5´-sequence. In consequence, human In2-ghrelin variant mRNA could codify a new prepro-In2-ghrelin peptide, that would contain a similar signal peptide sequence, and, most importantly, would conserve the putative acylation site at Ser3 in the N-terminus present in the native prepro-ghrelin but, having a totally different C-terminal tail than that of native prepro-ghrelin. In2-ghrelin variant was found to be widely expressed in various human tissues (n=22) which might indicate that this novel variant could be physiologically relevant and exert specific biological actions. Interestingly, we observed a remarkably high correlation between the expression levels of In2-ghrelin variant, but not of native-ghrelin, and those of GOAT in human tissues (R2=0,921). Accordingly, it seems reasonable to propose that In2-ghrelin variant may be a primary substrate for GOAT in human tissues. On the other hand, expression levels of human native-ghrelin and In2-ghrelin variant were not correlated in the human tissues studied, suggesting that the expression of both transcripts is likely to be differentially regulated in humans in a tissue-dependent manner. Pathophysiologic relevance of human In2-ghrelin variant was supported by the fact that its expression levels were found to be highly up-regulated (8-fold) in ductal breast cancer samples (n=40) compared with breast tissue controls (n=4). Moreover, in this same context, we showed for first time that GOAT enzyme is present in normal mammary gland and breast cancer tissues in human. Similar to that found with the In2-ghrelin variant, the expression levels of GOAT were significantly higher in breast cancer samples compared with normal mammary gland samples. In fact, we found a strong, positive correlation between the expression levels of In2-ghrelin variant and GOAT in breast cancer samples analyzed, an observation that reinforces our notion that In2-ghrelin variant could be a primary substrate for GOAT in humans. In clear agreement with previous immunohistochemistry results showing very low levels of native-ghrelin in the normal breast epithelium, with moderately higher levels in the breast cancer samples (Jeffery et al., 2005), our current data show a slight but non-significant increase of native-ghrelin mRNA levels in breast cancer samples. In addition, we observed very low levels of expression of the acyl-ghrelin receptor GHS-R1a in both normal and tumoral breast tissues, whereas, in striking contrast, the truncated receptor variant GHS-R1b was strongly expressed in tumoral samples but undetectable in normal breast samples. These latter findings compare well with those previously reported by Jeffery et al (Jeffery et al., 2005). Interestingly, in the present study, we observe a positive, albeit not significant,

3.- RESULTS AND GENERAL DISCUSSION correlation trend (R2=0,403; p=0.097) between the expression levels of GHS-R1b and In2- ghrelin variant, but not with native-ghrelin. Intriguingly, in vitro experiments using a human model of breast cancer cells (MDA- MB-231 cell line) further support and extend the potentially important physiologic role of the novel In2-ghrelin variant derived from the data obtained in human breast cancer samples. Indeed, as previously observed in breast cancer tissues, MDA-MB-231 cells also expressed high levels of In2-ghrelin variant, GOAT and GHS-R1b, whereas the expression of native-ghrelin and GHS-R1a were very low. Of note, overexpression of In2-ghrelin variant in MDA-MB-231 cells resulted in an increased rate of basal proliferation compared with mock-transfected control cells. Additionally, we have observed that treatment with acyl-ghrelin oppositely regulates the expression levels of native-ghrelin and In2-ghrelin variant. Specifically, treatment with both acylated- and non-acylated-ghrelin significantly up-regulate the expression levels of native-ghrelin while down-regulate the mRNA levels of In2-ghrelin variant suggesting that an auto-regulatory loop is in place in these cell type involving these two ghrelin variants. Furthermore, we also observed that treatment with tamoxifen significantly reduced the expression levels of In2-ghrelin mRNA levels, while it tends to up-regulate native-ghrelin mRNA levels. Accordingly, since tamoxifen is currently used as a primary therapeutic agent for the treatment of estrogen receptor (ER)-positive breast cancers (Jordan, 2007) and because the ghrelin axis has been reported to exert relevant actions in cancer cells (Jeffery et al., 2005), it is tempting to propose that our current findings may have important implications for this pathology, and therefore that they merit further, detailed investigation in future studies.

3.3.- SST, ghrelin and Alzheimer Disease (Articles III and VI) There is increasing evidence that the SST/CST and ghrelin systems play relevant roles in the regulation of cognitive processes (Viollet et al., 2008). Indeed, SST and ghrelin are considered as positive stimuli in spatial and motor learning (Zeyda et al., 2001; Toth et al., 2009a; Toth et al., 2009b), and SST and CST have been reported to be involved in memory consolidation and evocation (Mendez-Diaz et al., 2005; Kluge et al., 2008). Of note, SST is one of the most severely reduced peptides in Alzheimer’s disease (AD) (Davis et al., 1988; Bissette and Nemeroff, 1992b; Nemeroff et al., 1992; Molchan et al., 1993; Nilsson et al., 2001), a neurodegenerative disorder characterized by cognitive deficits, such as impairment of episodic memory. Moreover, in addition to the extracellular accumulation of amyloid-β (Aβ) in senile plaques (SP) and the intracellular aggregation of hyperphosphorylated tau protein comprising neurofibrillar tangles (NFTs), the two major neuropathological hallmarks of AD (Selkoe, 2001), abnormalities in several neuropeptides

3.- RESULTS AND GENERAL DISCUSSION and neurotransmitters systems (such as SST) have also been found, and are suggested to play substantial roles in this pathology (Bissette and Nemeroff, 1992a; Proto et al., 2006; Epelbaum et al., 2009). As mentioned earlier, SST/CST and ghrelin systems are involved in the regulation of a wide variety of processes, such as inflammation, endocrine homeostasis, energy balance, or obesity. Interestingly, AD is currently considered a multifactorial disorder, whose origin and progression have been claimed to be influenced by inflammatory, energetic (obesity), and endocrine (GH-IGF1) signals (Giordano et al., 2007b; Erol, 2008). Nevertheless, despite these clear overlaps, data reported hitherto on the regulation of SST/CST and ghrelin systems in the brain of AD patients are scarce and/or inconclusive. In the following two articles, we have explored by qrtRT-PCR the mRNA levels of SST, CST, and ghrelin, as well as, their receptors and other related components (i.e. neprilysin, a SST-regulated enzyme involved in Aβ degradation) in the three regions, inferior, medial, and superior, of the temporal lobe, one of the most affected cortical structures in AD (Braak and Braak, 1991).

3.3.1- SST and ssts in Alzheimer Disease (Article III) It is nowadays widely accepted that SST is one of the most selectively reduced neuropeptides in the brain of AD patients (Davis et al., 1988; Nemeroff et al., 1992; Epelbaum et al., 2009). However, there is no precise quantitative data on the expression of SST and its receptors in the brain of AD patients and, surprisingly no data has been reported concerning its highly related peptide CST. In our study, use of qrtRT-PCR allowed to confirm that SST expression displays a remarkable reduction (83.9%) in the temporal lobe of AD patients as compared with controls. Additionally, it demonstrated for the first time that CST is expressed in the temporal lobe of AD patients. In fact, similar to that found for SST, we observed that CST mRNA levels were significantly decreased in the whole temporal region of AD patients as compared to control samples. However, since the extent of reduction (40%) for CST was lower than that observed for SST, CST expression levels were higher than those of SST in temporal region of AD patients. It is worth noting that the reduction in SST expression was observed in the three regions of the temporal lobe of AD patients (inferior, medial, and superior) that were analyzed, whereas CST mRNA levels were only significantly decreased in the inferior temporal region. The divergent mRNA alteration observed for SST and CST in AD patients compared to controls may imply that these peptides play a dissimilar role in AD, which could be region-dependent. Additionally, we observed that neprilysin is also present in the whole temporal lobe; however, its expression levels were considerably lower than those of SST and CST. Although there was a trend for neprilysin mRNA levels to be down-regulated in the whole temporal lobe of AD

3.- RESULTS AND GENERAL DISCUSSION compared with control subjects, this difference did not reach statistical significance. Hence, our data suggest that Aβ accumulation in the temporal lobe could be due to a lack of neprilysin activation by SST rather than to a reduction of its expression. Data regarding the presence and/or abundance of SST/CST receptors (ssts) in AD are even more limited and controversial than those reported for their ligands (Beal et al., 1985; Krantic et al., 1992; Kumar, 2005). In this study, we used specific sets of primers to independently determine the mRNA copy number of each sst subtype, and found that all five ssts are expressed, at very different levels, in the temporal cortex of control brains (sst2 ≥ sst1 ≥ sst3 > sst4 >> sst5). Interestingly, an overall reduction of 53% in the number of ssts mRNA copies was observed in AD temporal cortex as compared with control samples. Specifically, analysis of the individual receptor subtypes revealed that while sst1, sst3, and sst4 mRNA levels were significantly reduced, expression of sst2 showed a numerical reduction that did not reach statistical significance. Interestingly, the reduction of sst1-4 expression in AD patients was mainly restricted to the inferior temporal gyrus and was not so apparent in the medial and superior lobe. On the other hand, expression levels of sst5 were not altered between AD and control patients in any of the whole temporal regions analyzed. Taken together, these and our previous results suggest that Aβ accumulation in the temporal lobe may not be only due to a lack of neprilysin activation by SST but also to a reduction of SST sensitivity caused by decreased levels of ssts.

3.3.2- Ghrelin system in Alzheimer Disease (Article VI) Although ghrelin has been reported to act as a positive stimulus in memory and learning processes (Toth et al., 2009a; Toth et al., 2009b), to our knowledge this is the first study systematically analyzing expression of the ghrelin axis in brains of AD patients in comparison to control subjects. Absolute quantification of mRNA copy number in the temporal cortex demonstrated that ghrelin, In2-ghrelin variant, as well as GOAT mRNAs are abundantly expressed in the brain of both control and AD subjects. Yet, when comparing expression levels between control and AD samples, we observed a general reduction of native-ghrelin (50%) and In2-ghrelin variant (41%) in the whole temporal gyrus of AD patients, although this difference did not reach statistical significance for the In2-ghrelin variant, likely due to the limited number of samples measured and the intrinsic inter-individual and inter-region variability. Notwithstanding this, it is interesting to note that In2-ghrelin variant expression was detected in the medial and superior, but not in the inferior temporal lobe regions, whereas native-ghrelin expression was detected in all regions. In addition, we noticed that In2-ghrelin variant expression was severely decreased in the superior lobe, while the reduction in native-ghrelin mRNA levels

3.- RESULTS AND GENERAL DISCUSSION observed in AD patients was mainly detected in the inferior lobe. Along these same lines, GOAT mRNA levels did not change in whole brains of AD patients as compared with matched controls; however, when each region was considered separately, a significant reduction in GOAT expression was observed in the inferior, but not in the medial and superior lobes of AD patients. We also analyzed the expression levels of both ghrelin receptor (GHS-R) transcripts, GHS-R1a and GHS-R1b, in the temporal lobe of AD and control subjects. This showed that both receptors are expressed at similar levels in control subjects, whereas their abundance in the temporal region of AD patients was regulated in a strikingly opposite manner. Thus, while expression of GHS-R1a was markedly reduced in AD tissues, GHS-R1b mRNA levels were increased by 3-fold in the whole temporal lobe of AD patients as compared with controls. Although the pathophysiological relevance of these findings is still unknown, our results are reminiscent of previous data showing that GHS-R1b is more expressed than GHS-R1a in other pathological situations, such as colorectal cancer (Waseem et al., 2008), adrenocortical tumors (Barzon et al., 2005), and, as shown in the present Thesis, in breast cancer. Interestingly, it has been recently demonstrated that GHS-R1b can heterodimerize with GHS-R1a, acting as a dominant-negative receptor, partially blocking GHS-R1a functionality (Chu et al., 2007; Leung et al., 2007). In this context, our data may imply that the elevated expression of GHS-R1b observed in AD patients could block the positive memory and learning roles exerted by ghrelin via its full- length GHS-R1a receptor (Toth et al., 2009a; Toth et al., 2009b), and therefore, this event could contribute, at least in part, to the cognitive deficit and impaired episodic memory processes observed in AD patients. Since ghrelin levels have been shown not to vary in the cerebrospinal fluid of AD patients (Proto et al., 2006), our findings could suggest that locally-produced acylated/ non-acylated native-ghrelin and/or In2-ghrelin variant may exert autocrine and/or paracrine functions in the human temporal lobe. This idea would be supported by a previous study on human astrocytoma cell lines (Dixit et al., 2006), which demonstrated that ghrelin/GHS-R1a-axis could constitute an autocrine regulatory pathway regulating astrocytoma cell migration and invasiveness of cancers in humans. Hence, in that ghrelin system has been demonstrated to directly influence memory processes (Carlini et al., 2002; Carlini et al., 2004; Diano et al., 2006; Carlini et al., 2008; Carvajal et al., 2009), the breakdown of the ghrelin system in the temporal lobe of AD patients reported herein could help to explain, at least in part, the impairment of memory processes observed in AD.

4.- GENERAL CONCLUSSION

4.- GENERAL CONCLUSIONS

1.- The SST and ghrelin systems are differentially and tissue-specifically regulated by metabolic insults at the hypothalamus-pituitary-stomach axis, where both systems appear to crosstalk. In particular: 1.a.- Fasting profoundly alters SST and ghrelin expression in mouse hypothalamus- pituitary-stomach axis as well as ghrelin levels in plasma. 1.b.- Endogenous SST tone is a relevant regulator of ghrelin, since circulating ghrelin as well as its stomach mRNA levels are increased in SST knock-out mice. 1.c.- Mouse GOAT mRNA regulation, together with GOAT activity and substrate availability, could act in concert to control acyl-ghrelin plasma levels under conditions of metabolic challenge. 2.- The SST/CST and the ghrelin systems are dysregulated in human breast cancer, wherein some new components of these systems (sst5TMD4, In2-ghrelin, GHS-R1b, GOAT) may particularly contribute to this pathology, as supported by: 2.a.- sst5TMD4 is present in aggressive breast cancers, where it is associated with bad prognosis markers, and its expression in breast cancer cell lines increases their malignancy, possibly by altering signaling and disrupting a protective feedback loop involving sst2/SST. 2.b.- In2-ghrelin is a new human ghrelin variant that, together with GHS-R1b and GOAT, but not native ghrelin or GHS-R1a, is highly expressed in human breast cancer samples, and whose overexpression promotes augmented proliferation in breast cancer cell lines. 3.- The SST/CST and ghrelin systems are profoundly impaired in one of the most important memory-related regions, the temporal gyrus, of the brain of Alzheimer disease patients as compared to matched controls. In particular: 3.a.- A global, albeit peptide-specific and region-dependent reduction in SST, CST and sst1-4, is patent in temporal lobe of AD patients 3.b.- Dysregulation of ghrelin system in AD includes a reduction of ghrelin, In2-ghrelin, GOAT, and GHS-R1a mRNA levels as well as a strong increase in the GHS-R1b expression. Since SST/CST and ghrelin systems directly influence memory processes potentially exerting “protective” roles, breakdown of these systems in the temporal lobe of AD patients may contribute the impairment of memory processes observed in this pathology.

4.- GENERAL CONCLUSIONS

Global corollary: The SST/CST and ghrelin systems are present and their components differentially regulated in axes and pathological conditions markedly distinct and distant from their original neuroendoendocrine actions at the hypothalamus-pituitary unit. Accordingly, it seems reasonable to propose that SST/CST, ghrelin and their receptors and related peptides comprise two highly interrelated pleiotropic systems, with additional pathophysiological roles than those previously envisioned, which also unveil likely new targets for therapeutic intervention.

5.- REFERENCES

Arosio, M., C. L. Ronchi, C. Gebbia, V. Cappiello, P. Beck-Peccoz and M. Peracchi, 2003. Stimulatory effects of ghrelin on circulating somatostatin and pancreatic polypeptide levels. J Clin Endocrinol Metab. 88 (2): 701-4. Baranowska, B., M. Chmielowska, E. Wolinska-Witort, W. Bik, A. Baranowska-Bik and L. Martynska, 2006. Direct effect of cortistatin on GH release from cultured pituitary cells in the rat. Neuro Endocrinol Lett. 27 (1-2): 153-6. Barzon, L., M. Pacenti, G. Masi, A. L. Stefani, K. Fincati and G. Palu, 2005. Loss of growth hormone secretagogue receptor 1a and overexpression of type 1b receptor transcripts in human adrenocortical tumors. Oncology. 68 (4-6): 414-21. Beal, M. F., M. F. Mazurek, V. T. Tran, G. Chattha, E. D. Bird and J. B. Martin, 1985. Reduced numbers of somatostatin receptors in the cerebral cortex in Alzheimer's disease. Science. 229 (4710): 289-91. Ben-Shlomo, A., O. Pichurin, N. J. Barshop, K. A. Wawrowsky, J. Taylor, M. D. Culler, V. Chesnokova, N. A. Liu and S. Melmed, 2007. Selective regulation of somatostatin receptor subtype signaling: evidence for constitutive receptor activation. Mol Endocrinol. 21 (10): 2565-78. Benali, N., P. Cordelier, D. Calise, P. Pages, P. Rochaix, A. Nagy, J. P. Esteve, P. M. Pour, A. V. Schally, N. Vaysse, C. Susini and L. Buscail, 2000. Inhibition of growth and metastatic progression of pancreatic carcinoma in hamster after somatostatin receptor subtype 2 (sst2) gene expression and administration of cytotoxic somatostatin analog AN-238. Proc Natl Acad Sci U S A. 97 (16): 9180-5. Bissette, G. and C. B. Nemeroff, 1992a. Biochemical and neuropeptide alterations in Alzheimer's disease. Clin Neuropharmacol. 15: 33-34. Bissette, G. and C. B. Nemeroff, 1992b. Biochemical and neuropeptide alterations in Alzheimer's disease. Clin Neuropharmacol. 15 Suppl 1 Pt A: 33A-34A. Braak, H. and E. Braak, 1991. Neuropathological stageing of Alzheimer-related changes. Acta Neuropathol. 82 (4): 239-59. Brazeau, P., W. Vale, R. Burgus, N. Ling, M. Butcher, J. Rivier and R. Guillemin, 1973. Hypothalamic polypeptide that inhibits the secretion of immunoreactive pituitary growth hormone. Science. 179 (68): 77-9. Broglio, F., C. Gottero, F. Prodam, C. Gauna, G. Muccioli, M. Papotti, T. Abribat, A. J. Van Der Lely and E. Ghigo, 2004. Non-acylated ghrelin counteracts the metabolic but not the neuroendocrine response to acylated ghrelin in humans. J Clin Endocrinol Metab. 89 (6): 3062-5. Brown, M., J. Rivier and W. Vale, 1976. Biological activity of somatostatin and somatostatin analogs on inhibtion of arginine-induced insulin and glucagon release in the rat. Endocrinology. 98 (2): 336-43. Bulgarelli, I., L. Tamiazzo, E. Bresciani, D. Rapetti, S. Caporali, D. Lattuada, V. Locatelli and A. Torsello, 2009. Desacyl-ghrelin and synthetic GH-secretagogues modulate the production of inflammatory cytokines in mouse microglia cells stimulated by beta-amyloid fibrils. J Neurosci Res. 87 (12): 2718-27. Cameron Smith, M., C. Orlando, M. Serio and M. Maggi, 2003. Somatostatin receptors and breast cancer. J Endocrinol Invest. 26 (8 Suppl): 125-30. Carlini, V. P., A. C. Martini, H. B. Schioth, R. D. Ruiz, M. Fiol de Cuneo and S. R. de Barioglio, 2008. Decreased memory for novel object recognition in chronically food-restricted mice is reversed by acute ghrelin administration. Neuroscience. 153 (4): 929-34. Carlini, V. P., M. E. Monzon, M. M. Varas, A. B. Cragnolini, H. B. Schioth, T. N. Scimonelli and S. R. de Barioglio, 2002. Ghrelin increases anxiety-like behavior and memory retention in rats. Biochem Biophys Res Commun. 299 (5): 739-43. Carlini, V. P., M. M. Varas, A. B. Cragnolini, H. B. Schioth, T. N. Scimonelli and S. R. de Barioglio, 2004. Differential role of the hippocampus, amygdala, and dorsal raphe nucleus in regulating feeding, memory, and anxiety-like behavioral responses to ghrelin. Biochem Biophys Res Commun. 313 (3): 635-41. Carvajal, P., V. P. Carlini, H. B. Schioth, S. R. de Barioglio and N. A. Salvatierra, 2009. Central ghrelin increases anxiety in the Open Field test and impairs retention memory in a passive avoidance task in neonatal chicks. Neurobiol Learn Mem. 91 (4): 402-7. Casa, A. J., R. K. Dearth, B. C. Litzenburger, A. V. Lee and X. Cui, 2008. The type I insulin-like growth factor receptor pathway: a key player in cancer therapeutic resistance. Front Biosci. 13: 3273-87. Cassoni, P., M. Papotti, C. Ghe, F. Catapano, A. Sapino, A. Graziani, R. Deghenghi, T. Reissmann, E. Ghigo and G. Muccioli, 2001. Identification, characterization, and biological activity of

5.- REFERENCES

specific receptors for natural (ghrelin) and synthetic growth hormone secretagogues and analogs in human breast carcinomas and cell lines. J Clin Endocrinol Metab. 86 (4): 1738- 45. Colinet, F. G., S. Vanderick, B. Charloteaux, A. Eggen, N. Gengler, B. Renaville, R. Brasseur, D. Portetelle and R. Renaville, 2009. Genomic location of the bovine growth hormone secretagogue receptor (GHSR) gene and investigation of genetic polymorphism. Anim Biotechnol. 20 (1): 28-33. Cordido, F., M. L. Isidro, R. Nemina and S. Sangiao-Alvarellos, 2009. Ghrelin and growth hormone secretagogues, physiological and pharmacological aspect. Curr Drug Discov Technol. 6 (1): 34-42. Cordoba-Chacon, J., M. D. Gahete, M. Duran-Prado, A. I. Pozo-Salas, M. M. Malagon, F. Gracia-Navarro, R. D. Kineman, R. M. Luque and J. P. Castano, 2010. Identification and characterization of new functional truncated variants of somatostatin receptor subtype 5 in rodents. Cell Mol Life Sci. Chu, K. M., K. B. Chow, P. K. Leung, P. N. Lau, C. B. Chan, C. H. Cheng and H. Wise, 2007. Over- expression of the truncated ghrelin receptor polypeptide attenuates the constitutive activation of phosphatidylinositol-specific phospholipase C by ghrelin receptors but has no effect on ghrelin-stimulated extracellular signal-regulated kinase 1/2 activity. Int J Biochem Cell Biol. 39 (4): 752-64. Davis, K. L., M. Davidson, R. K. Yang, B. M. Davis, L. J. Siever, R. C. Mohs, T. Ryan, E. Coccaro, L. Bierer and S. D. Targum, 1988. CSF somatostatin in Alzheimer's disease, depressed patients, and control subjects. Biol Psychiatry. 24 (6): 710-2. de Lecea, L., J. R. Criado, O. Prospero-Garcia, K. M. Gautvik, P. Schweitzer, P. E. Danielson, C. L. Dunlop, G. R. Siggins, S. J. Henriksen and J. G. Sutcliffe, 1996. A cortical neuropeptide with neuronal depressant and sleep-modulating properties. Nature. 381 (6579): 242-5. Deghenghi, R., M. Papotti, E. Ghigo and G. Muccioli, 2001. Cortistatin, but not somatostatin, binds to growth hormone secretagogue (GHS) receptors of human pituitary gland. J Endocrinol Invest. 24 (1): 1-3. Dezaki, K., H. Sone and T. Yada, 2008. Ghrelin is a physiological regulator of insulin release in pancreatic islets and glucose homeostasis. Pharmacol Ther. 118 (2): 239-49. Diano, S., S. A. Farr, S. C. Benoit, E. C. McNay, I. da Silva, B. Horvath, F. S. Gaskin, N. Nonaka, L. B. Jaeger, W. A. Banks, J. E. Morley, S. Pinto, R. S. Sherwin, L. Xu, K. A. Yamada, M. W. Sleeman, M. H. Tschop and T. L. Horvath, 2006. Ghrelin controls hippocampal spine synapse density and memory performance. Nat Neurosci. 9 (3): 381-8. Dimaraki, E. V. and C. A. Jaffe, 2006. Role of endogenous ghrelin in growth hormone secretion, appetite regulation and metabolism. Rev Endocr Metab Disord. 7 (4): 237-49. Dixit, V. D., A. T. Weeraratna, H. Yang, D. Bertak, A. Cooper-Jenkins, G. J. Riggins, C. G. Eberhart and D. D. Taub, 2006. Ghrelin and the growth hormone secretagogue receptor constitute a novel autocrine pathway in astrocytoma motility. J Biol Chem. 281 (24): 16681-90. Dolan, J. T., D. M. Miltenburg, T. S. Granchi, C. C. Miller, 3rd and F. C. Brunicardi, 2001. Treatment of metastatic breast cancer with somatostatin analogues--a meta-analysis. Ann Surg Oncol. 8 (3): 227-33. Dong, W. and R. Day, 2002. Gene expression of proprotein convertases in individual rat anterior pituitary cells and their regulation in corticotrophs mediated by glucocorticoids. Endocrinology. 143 (1): 254-62. Durán-Prado, M., M. D. Gahete, M. M. Malagón, R. M. Luque and J. P. Castano, In preparation. Cloning of two new porcine sst5 truncated isoforms, psst5b and psst5c: study of their function and heterodimerization with psst5a and psst2. Duran-Prado, M., M. D. Gahete, A. J. Martinez-Fuentes, R. M. Luque, A. Quintero, S. M. Webb, P. Benito-Lopez, A. Leal, S. Schulz, F. Gracia-Navarro, M. M. Malagon and J. P. Castano, 2009. Identification and characterization of two novel truncated but functional isoforms of the somatostatin receptor subtype 5 differentially present in pituitary tumors. J Clin Endocrinol Metab. 94 (7): 2634-43. Duran-Prado, M., M. M. Malagon, F. Gracia-Navarro and J. P. Castano, 2008. Dimerization of G protein-coupled receptors: new avenues for somatostatin receptor signalling, control and functioning. Mol Cell Endocrinol. 286 (1-2): 63-8. Durán-Prado, M., A. Saveanu, R. M. Luque, M. D. Gahete, F. Gracia-Navarro, P. Jaquet, H. Dufour, M. M. Malagón, M. D. Culler, A. Barlier and J. P. Castaño, 2010. A potential inhibitory role for the

5.- REFERENCES

new truncated variant of somatostatin receptor 5 (sst5TMD4) in pituitary adenomas poorly responsive to somatostatin analogs. J Clin Endocrinol Metab. Efendic, S., R. Luft and V. Grill, 1974. Effect of somatostatin on glucose induced insulin release in isolated perfused rat pancreas and isolated rat pancreatic islets. FEBS Lett. 42 (2): 169-72. Egido, E. M., J. Rodriguez-Gallardo, R. A. Silvestre and J. Marco, 2002. Inhibitory effect of ghrelin on insulin and pancreatic somatostatin secretion. Eur J Endocrinol. 146 (2): 241-4. Enjalbert, A., J. Epelbaum, S. Arancibia, L. Tapia-Arancibia, M. T. Bluet-Pajot and C. Kordon, 1982. Reciprocal interactions of somatostatin with thyrotropin-releasing hormone and vasoactive intestinal peptide on prolactin and growth hormone secretion in vitro. Endocrinology. 111 (1): 42-7. Epelbaum, J., J. L. Guillou, F. Gastambide, D. Hoyer, E. Duron and C. Viollet, 2009. Somatostatin, Alzheimer's disease and cognition: An old story coming of age? Prog Neurobiol. 89 (2): 153-61. Eralp, Y., D. Derin, Y. Ozluk, E. Yavuz, N. Guney, P. Saip, M. Muslumanoglu, A. Igci, S. Kucucuk, M. Dincer, A. Aydiner and E. Topuz, 2008. MAPK overexpression is associated with anthracycline resistance and increased risk for recurrence in patients with triple-negative breast cancer. Ann Oncol. 19 (4): 669-74. Erol, A., 2008. An integrated and unifying hypothesis for the metabolic basis of sporadic Alzheimer's disease. J Alzheimers Dis. 13 (3): 241-53. Ferraro, G., B. Annibale, M. Marignani, C. Azzoni, T. D'Adda, G. D'Ambra, C. Bordi and G. delle Fave, 1996. Effectiveness of octreotide in controlling fasting hypergastrinemia and related enterochromaffin-like cell growth. J Clin Endocrinol Metab. 81 (2): 677-83. Fukusumi, S., C. Kitada, S. Takekawa, H. Kizawa, J. Sakamoto, M. Miyamoto, S. Hinuma, K. Kitano and M. Fujino, 1997. Identification and characterization of a novel human cortistatin-like peptide. Biochem Biophys Res Commun. 232 (1): 157-63. Gahete, M. D., M. Duran-Prado, R. M. Luque, A. J. Martinez-Fuentes, A. Quintero, E. Gutierrez-Pascual, J. Cordoba-Chacon, M. M. Malagon, F. Gracia-Navarro and J. P. Castano, 2009. Understanding the multifactorial control of growth hormone release by somatotropes: lessons from comparative endocrinology. Ann N Y Acad Sci. 1163: 137-53. Garg, A., 2007. The ongoing saga of obestatin: is it a hormone? J Clin Endocrinol Metab. 92 (9): 3396-8. Gauna, C. and A. J. van der Lely, 2005. Somatostatin, cortistatin, ghrelin and glucose metabolism. J Endocrinol Invest. 28 (11 Suppl International): 127-31. Gerich, J. E., R. Lovinger and G. M. Grodsky, 1975. Inhibition by somatostatin of glucagon and insulin release from the perfused rat pancreas in response to arginine, isoproterenol and theophylline: evidence for a preferential effect on glucagon secretion. Endocrinology. 96 (3): 749-54. Giordano, R., A. Picu, L. Bonelli, F. Broglio, F. Prodam, S. Grottoli, G. Muccioli, E. Ghigo and E. Arvat, 2007a. The activation of somatostatinergic receptors by either somatostatin-14 or cortistatin-17 often inhibits ACTH hypersecretion in patients with Cushing's disease. Eur J Endocrinol. 157 (4): 393-8. Giordano, V., G. Peluso, M. Iannuccelli, P. Benatti, R. Nicolai and M. Calvani, 2007b. Systemic and brain metabolic dysfunction as a new paradigm for approaching Alzheimer's dementia. Neurochem Res. 32 (4-5): 555-67. Gonzalez-Rey, E., A. Chorny, R. G. Del Moral, N. Varela and M. Delgado, 2007. Therapeutic effect of cortistatin on experimental arthritis by downregulating inflammatory and Th1 responses. Ann Rheum Dis. 66 (5): 582-8. Gonzalez-Rey, E., A. Chorny, G. Robledo and M. Delgado, 2006. Cortistatin, a new antiinflammatory peptide with therapeutic effect on lethal endotoxemia. J Exp Med. 203 (3): 563-71. Grottoli, S., V. Gasco, F. Broglio, R. Baldelli, F. Ragazzoni, F. Gallenca, A. Mainolfi, F. Prodam, G. Muccioli and E. Ghigo, 2006. Cortistatin-17 and somatostatin-14 display the same effects on growth hormone, prolactin, and insulin secretion in patients with acromegaly or prolactinoma. J Clin Endocrinol Metab. 91 (4): 1595-9. Gutierrez, J. A., P. J. Solenberg, D. R. Perkins, J. A. Willency, M. D. Knierman, Z. Jin, D. R. Witcher, S. Luo, J. E. Onyia and J. E. Hale, 2008. Ghrelin octanoylation mediated by an orphan lipid transferase. Proc Natl Acad Sci U S A. 105 (17): 6320-5. Haslam, S. Z., 1988. Local versus systemically mediated effects of estrogen on normal mammary epithelial cell deoxyribonucleic acid synthesis. Endocrinology. 122 (3): 860-7. Hochgeschwender, U. and M. B. Brennan, 1995. Mouse knockouts rule OK. Nature. 375 (6532): 543.

5.- REFERENCES

Hofland, L. J., J. van der Hoek, R. Feelders, M. O. van Aken, P. M. van Koetsveld, M. Waaijers, D. Sprij- Mooij, C. Bruns, G. Weckbecker, W. W. de Herder, A. Beckers and S. W. Lamberts, 2005. The multi-ligand somatostatin analogue SOM230 inhibits ACTH secretion by cultured human corticotroph adenomas via somatostatin receptor type 5. Eur J Endocrinol. 152 (4): 645- 54. Holst, B., N. D. Holliday, A. Bach, C. E. Elling, H. M. Cox and T. W. Schwartz, 2004. Common structural basis for constitutive activity of the ghrelin receptor family. J Biol Chem. 279 (51): 53806- 17. Horvath, T. L., S. Diano, P. Sotonyi, M. Heiman and M. Tschop, 2001. Minireview: ghrelin and the regulation of energy balance--a hypothalamic perspective. Endocrinology. 142 (10): 4163- 9. Howard, A. D., S. D. Feighner, D. F. Cully, J. P. Arena, P. A. Liberator, C. I. Rosenblum, M. Hamelin, D. L. Hreniuk, O. C. Palyha, J. Anderson, P. S. Paress, C. Diaz, M. Chou, K. K. Liu, K. K. McKee, S. S. Pong, L. Y. Chaung, A. Elbrecht, M. Dashkevicz, R. Heavens, M. Rigby, D. J. Sirinathsinghji, D. C. Dean, D. G. Melillo, A. A. Patchett, R. Nargund, P. R. Griffin, J. A. DeMartino, S. K. Gupta, J. M. Schaeffer, R. G. Smith and L. H. Van der Ploeg, 1996. A receptor in pituitary and hypothalamus that functions in growth hormone release. Science. 273 (5277): 974-7. Jeffery, P. L., R. E. Murray, A. H. Yeh, J. F. McNamara, R. P. Duncan, G. D. Francis, A. C. Herington and L. K. Chopin, 2005. Expression and function of the ghrelin axis, including a novel preproghrelin isoform, in human breast cancer tissues and cell lines. Endocr Relat Cancer. 12 (4): 839-50. Jordan, V. C., 2007. New insights into the metabolism of tamoxifen and its role in the treatment and prevention of breast cancer. Steroids. 72 (13): 829-42. Kellokoski, E., A. Kunnari, M. Jokela, S. Makela, Y. A. Kesaniemi and S. Horkko, 2009. Ghrelin and obestatin modulate early atherogenic processes on cells: enhancement of monocyte adhesion and oxidized low-density lipoprotein binding. Metabolism. 58 (11): 1572-80. Kineman, R. D., M. D. Gahete and R. M. Luque, 2007. Identification of a mouse ghrelin gene transcript that contains intron 2 and is regulated in the pituitary and hypothalamus in response to metabolic stress. J Mol Endocrinol. 38 (5): 511-21. Kluge, C., C. Stoppel, C. Szinyei, O. Stork and H. C. Pape, 2008. Role of the somatostatin system in contextual fear memory and hippocampal synaptic plasticity. Learn Mem. 15 (4): 252-60. Kojima, M., H. Hosoda, Y. Date, M. Nakazato, H. Matsuo and K. Kangawa, 1999. Ghrelin is a growth- hormone-releasing acylated peptide from stomach. Nature. 402 (6762): 656-60. Krantic, S., Y. Robitaille and R. Quirion, 1992. Deficits in the somatostatin SS1 receptor sub-type in frontal and temporal cortices in Alzheimer's disease. Brain Res. 573 (2): 299-304. Kumar, U., 2005. Expression of somatostatin receptor subtypes (SSTR1-5) in Alzheimer's disease brain: an immunohistochemical analysis. Neuroscience. 134 (2): 525-38. Laban, C., S. A. Bustin and P. J. Jenkins, 2003. The GH-IGF-I axis and breast cancer. Trends Endocrinol Metab. 14 (1): 28-34. Leu, F. P., M. Nandi and C. Niu, 2008. The effect of transforming growth factor beta on human neuroendocrine tumor BON cell proliferation and differentiation is mediated through somatostatin signaling. Mol Cancer Res. 6 (6): 1029-42. Leung, P. K., K. B. Chow, P. N. Lau, K. M. Chu, C. B. Chan, C. H. Cheng and H. Wise, 2007. The truncated ghrelin receptor polypeptide (GHS-R1b) acts as a dominant-negative mutant of the ghrelin receptor. Cell Signal. 19 (5): 1011-22. Liu, W., J. Bagaitkar and K. Watabe, 2007. Roles of AKT signal in breast cancer. Front Biosci. 12: 4011-9. Liu, Y., Y. B. Zhou, G. G. Zhang, Y. Cai, X. H. Duan, X. Teng, J. Q. Song, Y. Shi, C. S. Tang, X. H. Yin and Y. F. Qi, Cortistatin attenuates vascular calcification in rats. Regul Pept. 159 (1-3): 35-43. Luque, R., Q. Lin and R. Kineman, 2009. Understanding the interrelationship between metabolism and the GH-Axis. Clemmons DR, Attanasio AF eds. Hypothalamic-Pituitary Disease and Obesity, 11th International HypoCCS Meeting. Bristol, UK.: BioScientifica Ltd; 33-56. Luque, R. M., M. Duran-Prado, S. Garcia-Navarro, F. Gracia-Navarro, R. D. Kineman, M. M. Malagon and J. P. Castano, 2006. Identification of the somatostatin receptor subtypes (sst) mediating the divergent, stimulatory/inhibitory actions of somatostatin on growth hormone secretion. Endocrinology. 147 (6): 2902-8. Luque, R. M. and R. D. Kineman, 2006. Impact of obesity on the growth hormone axis: evidence for a direct inhibitory effect of hyperinsulinemia on pituitary function. Endocrinology. 147 (6): 2754-63.

5.- REFERENCES

Luque, R. M. and R. D. Kineman, 2007. Gender-dependent role of endogenous somatostatin in regulating growth hormone-axis function in mice. Endocrinology. 148 (12): 5998-6006. Luque, R. M., S. Park and R. D. Kineman, 2007. Severity of the catabolic condition differentially modulates hypothalamic expression of growth hormone-releasing hormone in the fasted mouse: potential role of neuropeptide Y and corticotropin-releasing hormone. Endocrinology. 148 (1): 300-9. Luque, R. M., S. Park and R. D. Kineman, 2008. Role of endogenous somatostatin in regulating GH output under basal conditions and in response to metabolic extremes. Mol Cell Endocrinol. 286 (1-2): 155-68. Macro, J. A., R. Dimaline and G. J. Dockray, 1996. Identification and expression of prohormone- converting enzymes in the rat stomach. Am J Physiol. 270 (1 Pt 1): G87-93. Martin, S., E. Dicou, J. P. Vincent and J. Mazella, 2005. Neurotensin and the neurotensin receptor-3 in microglial cells. J Neurosci Res. 81 (3): 322-6. Martinez-Fuentes, A. J., J. Moreno-Fernandez, R. Vazquez-Martinez, M. Duran-Prado, A. de la Riva, M. Tena-Sempere, C. Dieguez, L. Jimenez-Reina, S. M. Webb, A. Pumar, A. Leal-Cerro, P. Benito- Lopez, M. M. Malagon and J. P. Castano, 2006. Ghrelin is produced by and directly activates corticotrope cells from adrenocorticotropin-secreting adenomas. J Clin Endocrinol Metab. 91 (6): 2225-31. McKee, K. K., C. P. Tan, O. C. Palyha, J. Liu, S. D. Feighner, D. L. Hreniuk, R. G. Smith, A. D. Howard and L. H. Van der Ploeg, 1997. Cloning and characterization of two human G protein-coupled receptor genes (GPR38 and GPR39) related to the growth hormone secretagogue and neurotensin receptors. Genomics. 46 (3): 426-34. Mendez-Diaz, M., L. Irwin, M. Gomez-Chavarin, A. Jimenez-Anguiano, R. Cabeza, E. Murillo- Rodriguez and O. Prospero-Garcia, 2005. Cortistatin modulates memory evocation in rats. Eur J Pharmacol. 507 (1-3): 21-8. Miao, Y., Q. Xia, Z. Hou, Y. Zheng, H. Pan and S. Zhu, 2007. Ghrelin protects cortical neuron against focal ischemia/reperfusion in rats. Biochem Biophys Res Commun. 359 (3): 795-800. Moaeen-ud-Din, M. and L. G. Yang, 2009. Evolutionary history of the somatostatin and somatostatin receptors. J Genet. 88 (1): 41-53. Molchan, S. E., J. L. Hill, R. A. Martinez, B. A. Lawlor, A. M. Mellow, D. R. Rubinow, G. Bissette, C. B. Nemeroff and T. Sunderland, 1993. CSF somatostatin in Alzheimer's disease and major depression: relationship to hypothalamic-pituitary-adrenal axis and clinical measures. Psychoneuroendocrinology. 18 (7): 509-19. Moller, L. N., C. E. Stidsen, B. Hartmann and J. J. Holst, 2003. Somatostatin receptors. Biochim Biophys Acta. 1616 (1): 1-84. Mounier, F., M. T. Bluet-Pajot, D. Durand, C. Kordon, R. Rasolonjanahary and J. Epelbaum, 1989. Involvement of central somatostatin in the alteration of GH secretion in starved rats. Horm Res. 31 (5-6): 266-70. Nemeroff, C. B., D. L. Knight and G. Bissette, 1992. Somatostatin: a neuropeptide system pathologically altered in Alzheimer's disease and depression. Clin Neuropharmacol. 15 Suppl 1 Pt A: 311A-312A. Nikolopoulos, D., S. Theocharis and G. Kouraklis, 2009. Ghrelin's role on gastrointestinal tract cancer. Surg Oncol. Nilsson, C. L., A. Brinkmalm, L. Minthon, K. Blennow and R. Ekman, 2001. Processing of neuropeptide Y, galanin, and somatostatin in the cerebrospinal fluid of patients with Alzheimer's disease and frontotemporal dementia. Peptides. 22 (12): 2105-12. Nillni, E. A., 2007. Regulation of prohormone convertases in hypothalamic neurons: implications for prothyrotropin-releasing hormone and proopiomelanocortin. Endocrinology. 148 (9): 4191-200. Norrelund, H., T. K. Hansen, H. Orskov, H. Hosoda, M. Kojima, K. Kangawa, J. Weeke, N. Moller, J. S. Christiansen and J. O. Jorgensen, 2002. Ghrelin immunoreactivity in human plasma is suppressed by somatostatin. Clin Endocrinol (Oxf). 57 (4): 539-46. Oberg, K., 2009. Somatostatin analog octreotide LAR in gastro-entero-pancreatic tumors. Expert Rev Anticancer Ther. 9 (5): 557-66. Patel, Y. C., 1999. Somatostatin and its receptor family. Front Neuroendocrinol. 20 (3): 157-98. Pierotti, A. R. and A. J. Harmar, 1985. Multiple forms of somatostatin-like immunoreactivity in the hypothalamus and amygdala of the rat: selective localization of somatostatin-28 in the median eminence. J Endocrinol. 105 (3): 383-9.

5.- REFERENCES

Proto, C., D. Romualdi, R. M. Cento, R. S. Spada, G. Di Mento, R. Ferri and A. Lanzone, 2006. Plasma levels of neuropeptides in Alzheimer's disease. Gynecol Endocrinol. 22 (4): 213-8. Qader, S. S., R. Hakanson, J. F. Rehfeld, I. Lundquist and A. Salehi, 2008. Proghrelin-derived peptides influence the secretion of insulin, glucagon, pancreatic polypeptide and somatostatin: a study on isolated islets from mouse and rat pancreas. Regul Pept. 146 (1-3): 230-7. Reubi, J. C., B. Waser, J. A. Foekens, J. G. Klijn, S. W. Lamberts and J. Laissue, 1990. Somatostatin receptor incidence and distribution in breast cancer using receptor autoradiography: relationship to EGF receptors. Int J Cancer. 46 (3): 416-20. Robas, N., E. Mead and M. Fidock, 2003. MrgX2 is a high potency cortistatin receptor expressed in dorsal root ganglion. J Biol Chem. 278 (45): 44400-4. Rubinfeld, H., M. Hadani, G. Barkai, J. E. Taylor, M. D. Culler and I. Shimon, 2006. Cortistatin inhibits growth hormone release from human fetal and adenoma pituitary cells and prolactin secretion from cultured prolactinomas. J Clin Endocrinol Metab. 91 (6): 2257-63. Rubinfeld, H., M. Hadani, J. E. Taylor, J. Z. Dong, J. Comstock, Y. Shen, D. DeOliveira, R. Datta, M. D. Culler and I. Shimon, 2004. Novel ghrelin analogs with improved affinity for the GH secretagogue receptor stimulate GH and prolactin release from human pituitary cells. Eur J Endocrinol. 151 (6): 787-95. Samson, W. K., J. V. Zhang, O. Avsian-Kretchmer, K. Cui, G. L. Yosten, C. Klein, R. M. Lyu, Y. X. Wang, X. Q. Chen, J. Yang, C. J. Price, T. D. Hoyda, A. V. Ferguson, X. B. Yuan, J. K. Chang and A. J. Hsueh, 2008. Neuronostatin encoded by the somatostatin gene regulates neuronal, cardiovascular, and metabolic functions. J Biol Chem. 283 (46): 31949-59. Santen, R. J., R. X. Song, R. McPherson, R. Kumar, L. Adam, M. H. Jeng and W. Yue, 2002. The role of mitogen-activated protein (MAP) kinase in breast cancer. J Steroid Biochem Mol Biol. 80 (2): 239-56. Schmid, D. A., K. Held, M. Ising, M. Uhr, J. C. Weikel and A. Steiger, 2005. Ghrelin stimulates appetite, imagination of food, GH, ACTH, and cortisol, but does not affect leptin in normal controls. Neuropsychopharmacology. 30 (6): 1187-92. Seim, I., A. C. Herington and L. K. Chopin, 2009. New insights into the molecular complexity of the ghrelin gene locus. Cytokine Growth Factor Rev. Selkoe, D. J., 2001. Alzheimer's disease: genes, proteins, and therapy. Physiol Rev. 81 (2): 741-66. Shimada, M., Y. Date, M. S. Mondal, K. Toshinai, T. Shimbara, K. Fukunaga, N. Murakami, M. Miyazato, K. Kangawa, H. Yoshimatsu, H. Matsuo and M. Nakazato, 2003. Somatostatin suppresses ghrelin secretion from the rat stomach. Biochem Biophys Res Commun. 302 (3): 520-5. Shimon, I., J. E. Taylor, J. Z. Dong, R. A. Bitonte, S. Kim, B. Morgan, D. H. Coy, M. D. Culler and S. Melmed, 1997. Somatostatin receptor subtype specificity in human fetal pituitary cultures. Differential role of SSTR2 and SSTR5 for growth hormone, thyroid-stimulating hormone, and prolactin regulation. J Clin Invest. 99 (4): 789-98. Takahashi, K., C. Furukawa, A. Takano, N. Ishikawa, T. Kato, S. Hayama, C. Suzuki, W. Yasui, K. Inai, S. Sone, T. Ito, H. Nishimura, E. Tsuchiya, Y. Nakamura and Y. Daigo, 2006. The neuromedin U- growth hormone secretagogue receptor 1b/neurotensin receptor 1 oncogenic signaling pathway as a therapeutic target for lung cancer. Cancer Res. 66 (19): 9408-19. Tostivint, H., L. Joly, I. Lihrmann, M. Ekker and H. Vaudry, 2004. Chromosomal localization of three somatostatin genes in zebrafish. Evidence that the [Pro2]-somatostatin-14 isoform and cortistatin are encoded by orthologous genes. J Mol Endocrinol. 33 (3): R1-8. Tostivint, H., L. Joly, I. Lihrmann, C. Parmentier, A. Lebon, M. Morisson, A. Calas, M. Ekker and H. Vaudry, 2006. Comparative genomics provides evidence for close evolutionary relationships between the urotensin II and somatostatin gene families. Proc Natl Acad Sci U S A. 103 (7): 2237-42. Toth, K., K. Laszlo and L. Lenard, 2009a. Role of intraamygdaloid acylated-ghrelin in spatial learning. Brain Res Bull. Toth, K., K. Laszlo, E. Lukacs and L. Lenard, 2009b. Intraamygdaloid microinjection of acylated- ghrelin influences passive avoidance learning. Behav Brain Res. 202 (2): 308-11. Vallette, S. and O. Serri, 2008. Octreotide LAR for the treatment of acromegaly. Expert Opin Drug Metab Toxicol. 4 (6): 783-93. Viollet, C., G. Lepousez, C. Loudes, C. Videau, A. Simon and J. Epelbaum, 2008. Somatostatinergic systems in brain: networks and functions. Mol Cell Endocrinol. 286 (1-2): 75-87. Volante, M., R. Rosas, P. Ceppi, I. Rapa, P. Cassoni, B. Wiedenmann, F. Settanni, R. Granata and M. Papotti, 2009. Obestatin in human neuroendocrine tissues and tumours: expression and effect on tumour growth. J Pathol.

5.- REFERENCES

Waseem, T., R. Javaid Ur, F. Ahmad, M. Azam and M. A. Qureshi, 2008. Role of ghrelin axis in colorectal cancer: a novel association. Peptides. 29 (8): 1369-76. Watt, H. L., G. Kharmate and U. Kumar, 2008. Biology of somatostatin in breast cancer. Mol Cell Endocrinol. 286 (1-2): 251-61. Watt, H. L. and U. Kumar, 2006. Colocalization of somatostatin receptors and epidermal growth factor receptors in breast cancer cells. Cancer Cell Int. 6: 5. Xu, J., S. Wang, Y. Lin, L. Cao, R. Wang and Z. Chi, 2009. Ghrelin protects against cell death of hippocampal neurons in pilocarpine-induced seizures in rats. Neurosci Lett. 453 (1): 58- 61. Yang, J., M. S. Brown, G. Liang, N. V. Grishin and J. L. Goldstein, 2008. Identification of the acyltransferase that octanoylates ghrelin, an appetite-stimulating peptide hormone. Cell. 132 (3): 387-96. Zeyda, T., N. Diehl, R. Paylor, M. B. Brennan and U. Hochgeschwender, 2001. Impairment in motor learning of somatostatin null mutant mice. Brain Res. 906 (1-2): 107-14. Zhang, J. V., P. G. Ren, O. Avsian-Kretchmer, C. W. Luo, R. Rauch, C. Klein and A. J. Hsueh, 2005. Obestatin, a peptide encoded by the ghrelin gene, opposes ghrelin's effects on food intake. Science. 310 (5750): 996-9. Zhu, X., Y. Cao, K. Voogd and D. F. Steiner, 2006. On the processing of proghrelin to ghrelin. J Biol Chem. 281 (50): 38867-70.

ARTICLE I

Am J Physiol Endocrinol Metab 291: E395–E403, 2006; doi:10.1152/ajpendo.00038.2006.

Evidence that endogenous SST inhibits ACTH and ghrelin expression by independent pathways

Raul M. Luque,1,2 Manuel D. Gahete,1,2 Ute Hochgeschwender,3 and Rhonda D. Kineman1,2 1Section of Diabetes, Endocrinology, and Metabolism, Department of Medicine, University of Illinois at Chicago; 2Research and Development Division, Jesse Brown Veteran’s Administration Medical Center, Chicago, Illinois; and 3Oklahoma Medical Research Foundation, Molecular, Cell, and Developmental Biology Program, Oklahoma City, Oklahoma Submitted 26 January 2006; accepted in ﬁnal form 24 March 2006

Luque, Raul M., Manuel D. Gahete, Ute Hochgeschwender, and where glucocorticoids directly inhibit basal and CRH-mediated Rhonda D. Kineman. Evidence that endogenous SST inhibits ACTH ACTH release (19, 25). However, a recent study (20) demon- and ghrelin expression by independent pathways. Am J Physiol Endocri- strates that an sst5 selective agonist can inhibit ACTH release nol Metab 291: E395–E403, 2006; doi:10.1152/ajpendo.00038.2006.— in vitro in the presence of glucocorticoids. The inhibitory Corticosterone and total ghrelin levels are increased in somatostatin Ϫ Ϫ action of exogenous SST on ACTH release has prompted (SST) knockout mice (Sst / ) compared with SST-intact controls (Sstϩ/ϩ). Because exogenous ghrelin can increase glucocorticoids, the speculation regarding the role of endogenous SST as a corti- Downloaded from question arises whether elevated levels of ghrelin contribute to ele- cotropin release-inhibiting factor (14). More recent observa- vated corticosterone levels in SstϪ/Ϫ mice. We report that SstϪ/Ϫ mice tions support such a role, where pituitaries of sst2 knockout had elevated mRNA levels for pituitary proopiomelanocortin mice release more ACTH in vitro (47) and corticosterone Ϫ Ϫ (POMC), the precursor of adrenocorticotropic hormone (ACTH), levels are elevated in SST knockout mice (Sst / ) (50). whereas mRNA levels for hypothalamic corticotropin-releasing hor- Preliminary data generated by our laboratory have confirmed mone (CRH) did not differ from Sstϩ/ϩ mice. Furthermore, SST that basal corticosterone levels are elevated in both male and suppressed pituitary POMC mRNA levels and ACTH release in vitro female SstϪ/Ϫ mice (28). Interestingly, using an assay that ajpendo.physiology.org independently of CRH actions. In contrast, it has been reported that recognizes both the n-octanoyl and des-acyl forms of ghrelin, ghrelin increases glucocorticoids via a central effect on CRH secretion we also found that total ghrelin levels of SstϪ/Ϫ mice were and that n-octanoyl ghrelin is the form of ghrelin that activates the Ͼ2-fold that of Sstϩ/ϩ controls. The n-octanoyl modified form GHS-R1a and modulates CRH neuronal activity. Consistent with elevations in total ghrelin levels, SstϪ/Ϫ mice displayed an increase in of ghrelin, via activation of the GHS-R1a, has been shown to stomach ghrelin mRNA levels, whereas hypothalamic and pituitary enhance food intake and stimulate the release of growth hor- expression of ghrelin was not altered. Despite the increase in total mone and glucocorticoids, whereas the des-acyl form of ghre- ghrelin levels, circulating levels of n-octanoyl ghrelin were not altered lin, via an unknown receptor pathway, has been shown to in SstϪ/Ϫ mice. Because glucocorticoids and ghrelin increase in decrease food intake, regulate cardiac and adipocyte function, response to fasting, we examined the impact of fasting on the adrenal and mediate cell proliferation and apoptosis in a variety of on October 14, 2008 axis and ghrelin in Sstϩ/ϩ and SstϪ/Ϫ mice and found that endogenous tissues (for review see Refs. 9, 11, 16, 23, and 24). Because SST does not significantly contribute to this adaptive response. We n-octanoyl ghrelin and its synthetic analogs [growth hormone conclude that endogenous SST inhibits basal ghrelin gene expression secretagogues (GHS)] have been shown to increase ACTH and in a tissue specific manner and independently and directly inhibits glucocorticoids in chickens, rats, mice, and humans (4, 5, 37, pituitary ACTH synthesis and release. Thus endogenous SST exerts an inhibitory effect on ghrelin synthesis and on the adrenal axis 45), where this action is thought to be mediated by an increase through independent pathways. in CRH neuronal activity and CRH gene expression (5, 17, 18, 21), we hypothesized that the elevated ghrelin levels may in somatostatin; adrenocorticotropic hormone; hypothalamic-pituitary- part be responsible for the increase in corticosterone levels in adrenal axis; corticotropin-releasing hormone; pituitary; stomach the SstϪ/Ϫ mice. However, it should be noted that the role of ghrelin in mediating the hypothalamic-pituitary-adrenal (HPA) axis may represent a pharmacological response given that a SOMATOSTATIN (SST), OR ITS SYNTHETIC ANALOGS, can reduce circulating adrenocorticotropic hormone (ACTH) and glu- recent report (27) demonstrated that administration of ghrelin cocorticoid levels in rats and humans in vivo (19, 43, 46). The in fed subjects, to achieve circulating concentration observed inhibitory actions of SST are believed to be due, at least in part, just prior to anticipated food intake, did not affect circulating to a direct effect on the pituitary. This hypothesis is supported ACTH or cortisol levels. by the fact that SST can block corticotropin-releasing hormone Therefore, to further explore the interrelationship between endogenous SST, ghrelin, and adrenal function we compared (CRH)-mediated ACTH release in cultures of primary rat ϩ/ϩ Ϫ/Ϫ pituitary cells, mouse pituitary tumor cells (AtT-20), and cul- the HPA axis of fed Sst and Sst mice in relation to tures of human corticotropinomas (20, 25, 44), where this circulating ghrelin levels (measured as total or n-octanoyl only) effect appears to be mediated by the SST receptors sst2 and/or and ghrelin gene expression in the stomach, pituitary, and sst5 (20, 43, 44). Both the in vivo and in vitro inhibitory effects hypothalamus. Because a rise in glucocorticoids and ghrelin of SST on ACTH release can be masked by glucocorticoids, represent a part of the adaptive response to fasting, we also examined the role endogenous SST plays in mediating this

Address for reprint requests and other correspondence: R. D. Kineman, Jesse Brown VA Medical Center, Research and Development Division, M. P. 151, The costs of publication of this article were defrayed in part by the payment West Side, Suite No. 6215, 820 South Damen Ave., Chicago, Illinois 60612 of page charges. The article must therefore be hereby marked “advertisement” (e-mail: [email protected]). in accordance with 18 U.S.C. Section 1734 solely to indicate this fact. http://www.ajpendo.org E395 E396 EFFECTS OF ENDOGENOUS SST ON ADRENAL AXIS AND GHRELIN response. Finally, we examined the direct effect of SST and pituitaries were dispersed in 1.7-ml polypropylene microfuge tubes ghrelin on proopiomelanocortin (POMC) mRNA levels and (2–3 pituitaries/1 ml digestion medium/tube), and baboon pituitaries ACTH release in primary pituitary cell cultures. were dispersed in spinner flasks (1 pituitary/30 ml digestion medium/ flask). All culture reagents were obtained from Sigma-Aldrich (St. MATERIALS AND METHODS Louis, MO) unless otherwise specified. Cells were plated at 2 ϫ 105/well in ␣-MEM (Invitrogen, Grand Island, NY) containing 10% Animals. Development and initial characterization of SST knockout horse serum, 0.15% BSA, 6 mM HEPES, and penicillin-streptomycin Ϫ Ϫ (Sst / ) mice have been previously reported (50). Male mice, het- (Invitrogen). After a 24-h incubation cultures were rinsed in serum erozygous for the SST-null mutation, were bred in a C57BL/6J free medium, and vehicle or SST (100 nM) and CRH (10 nM), alone ϩ/ϩ background (Jackson Laboratory, Bar Harbor, ME) to generate Sst or in combination, were added or cultures were treated with ghrelin Ϫ/Ϫ and Sst mice for this study. Genotypes were determined by PCR (10 nM, 3–5 wells/treatment group). Cultures were incubated for an of tail-snip DNA, using primers and genotyping protocol reported in additional 18 h, and medium was removed and frozen for subsequent tm1Ute the Jackson Laboratory web site for the 129S-Sst /J background analysis of ACTH levels and total cellular RNA recovered for deter- ϭ (http://jaxmice.jax.org/pub-cgi/protocols/protocols.sh?objtype protocol mination of POMC mRNA levels, as described below. ϭ &protocol_id 210). All experimental procedures were approved by RNA isolation and reverse transcription. Total RNA was extracted the Animal Care and Use Committees of the University of Illinois at from whole hypothalami and pituitaries or from primary pituitary cell Chicago and the Jesse Brown Veteran’s Administration Medical cultures using the Absolutely RNA RT-PCR Miniprep kit (Stratagene, Center. Animals were housed under a 12:12-h light-dark cycle La Jolla, CA) with DNAse treatment according to the manufacturer’s (lights-on 0700). All mice were handled daily at least 1 wk prior to instructions. For RNA extraction from whole stomachs, the protocol

euthanasia to acclimate them to personnel and handling procedures. Downloaded from was modified. Specifically, the stomach was placed in a 15-ml In vivo studies. For studies examining the impact of endogenous polypropylene conical tube containing 2 ml of lysis buffer. The SST on the adrenal axis and ghrelin, male mice 9–10 wk of age were sample was mechanically homogenized using a conical tephalon weighed and food was withdrawn (0800–0900) from a subset of pestle for ϳ5 min. Homogenates (1.5 ml) were transferred to 1.7-ml mice, whereas the remaining received food ad libitum (n ϭ 4–10 microfuge tubes and centrifuged at 13,000 rpm for 15 min, and 200 ␮l mice/genotype/treatment group). Forty-eight hours later mice were ␮ weighed and killed by decapitation, without anesthesia. Trunk blood of the supernatant were mixed with 400 l of lysis buffer. The was mixed with 15 ␮l of MiniProtease inhibitor (Roche, Nutley, NJ) solution was subjected to further homogenization for 1 min and and placed on ice until centrifugation at 13,000 rpm for 10 min. centrifuged for 5 min, and supernatants were then column purified ajpendo.physiology.org Plasma was stored at Ϫ80°C until evaluation of circulating hormones. using the Absolutely RNA RT-PCR Miniprep kit as instructed. The Hypothalami, pituitaries, and stomachs were collected and frozen in amount of recovered RNA from hypothalami, pituitaries, and stom- liquid nitrogen and stored at Ϫ80°C until analysis of mRNA levels by achs, was determined by the Ribogreen RNA quantification kit (Mo- ␮ quantitative real-time RT-PCR (qrtRT-PCR, see below). lecular Probes, Eugene, OR). Total RNA (1 g for whole tissue ␮ Primary pituitary cell cultures. For studies examining the direct extracts and 0.25 g for primary pituitary cell cultures) was reversed effects of SST and ghrelin on pituitary POMC mRNA levels and transcribed (RT) in a 20-␮l volume using random hexamer primers ACTH release, pituitaries were collected from 10- to 12-wk-old male and reagents supplied in the cDNA First Strand Synthesis kit (MRI mice from a mixed background (C57BL/6J ϫ FVB/N; n ϭ 3–5 Fermentas, Hanover, MD). RT reactions were treated with Ribonu- pituitaries pooled/experiment, 3 separate experiments) or randomly clease H (1 U, MRI Fermentas), and duplicate aliquots (1 ␮l) of the on October 14, 2008 cycling female baboons ranging in age from 7 to 12 yr (n ϭ 1 resulting cDNA were amplified by qrtRT-PCR, where samples are run pituitary/experiment, 2–5 separate experiments). Mouse pituitaries against synthetic standards to estimate mRNA copy number (see were obtained after CO2 asphyxiation, whereas baboon pituitaries below). were obtained after pentobarbital sodium overdose from control Primer selection. Specific primers for all mouse transcripts were animals under Institutional Animal Care and Use Committee-ap- designed using published sequences as templates [GenBank, National proved studies conducted by other University of Illinois at Chicago Center for Biotechnology Information (NCBI); Table 1]. To obtain investigators. Pituitaries were enzymatically dispersed into single partial nucleotide sequences of the baboon POMC and cyclophilin A cells as previously described (2), with the exception that mouse coding region, we aligned published cDNA sequences from a variety

Table 1. Species-speciﬁc primers used for quantitative real-time RT-PCR

GenBank Nucleotide Gene Accession No. Primer Sequence Position Product Size Mouse CRH NM_205769 Sense: TCTGGATCTCACCTTCCACCT Sn 630 95 Antisense: CCATCAGTTTCCTGTTGCTGT As 724 POMC NM_008895 Sense: GAGGCCTTTCCCCTAGAGTT Sn 617 154 Antisense: CACCGTAACGCTTGTCCTT As 770 Ghrelin NM_021488 Sense: TCCAAGAAGCCACCAGCTAA Sn 164 126 Antisense: AACATCGAAGGGAGCATTGA As 289 SST NM_009215 Sense: TCTGCATCGTCCTGGCTTT Sn 138 113 Antisense: CTTGGCCAGTTCCTGTTTCC As 250 Cyclophilin A NM_008907 Sense: TGGTCTTTGGGAAGGTGAAAG Sn 421 109 Antisense: TGTCCACAGTCGGAAATGGT As 529 Baboon POMC DQ315472 Sense: CCCTACAGGATGGAGCACTT Sn 7 127 Antisense: CGTTCTTGATGATGGCGTTT As 133 Cyclophilin A DQ315473 Sense: CAAGACGGAGTGGTTGGATG Sn 351 122 Antisense: TGGTGGTCTTCTTGCTGGTC As 472 CRH, corticotropin-releasing hormone; POMC, proopiomelanocortin; SST, somatostatin.

AJP-Endocrinol Metab • VOL 291 • AUGUST 2006 • www.ajpendo.org EFFECTS OF ENDOGENOUS SST ON ADRENAL AXIS AND GHRELIN E397 of several primate species [human, Pan troglodytes (chimpanzee) and ␮lofdH2O. Thermal cycling profile consisted of a preincubation step Macaca nemestrina (pig-tailed macaque)] and selected primers cor- at 95°C for 10 min followed by 40 cycles of denaturation (95°C, 30 s), responding to areas of 100% homology. Using these primers, we annealing (61°C, 1 min), and extension (72°C, 30 s). The efficiency of amplified cDNA generated from baboon pituitary total RNA. The amplification for all curves was between 97 and 103%, meaning all product generated was sequenced and demonstrated close similarity to templates in each cycle were copied. To estimate the starting copy POMC and cyclophilin A transcripts of other primates. This sequence number of cDNA (as shown in Table 2), RT samples were PCR was submitted to GenBank, and the accession numbers, which are amplified, and the signal compared with that of standard curve run on shown in Table 1, were subsequently used to select primers appro- the same plate. In addition, total RNA samples that were not RT and priate for real-time PCR. Specifically, primers were selected using a no-cDNA control were routinely run in each plate to control for Primer 3 software (http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_ genomic DNA contamination and to monitor potential exogenous www.cgi; Steve Rozen, Whitehead Institute for Biomedical Research) contamination, respectively. Also, to control for variations in the with selection parameters set to 1) pick primers that span an intron amount of RNA used in the RT reaction and the efficiency of the RT (when known) and that differ by no more than 0.2°C in annealing reaction, mRNA copy number of the transcript of interest was ad- temperature, 2) exclude primers that may form primer dimers, and 3) justed by the mRNA copy number of cyclophilin A (a peptidyl amplify a product of 90–200 bp. Sequences of selected primers were isomerase), where cyclophilin A mRNA level did not significantly used in BLAST (NCBI) searches to check for potential homology to vary between experimental groups, within tissue type (Table 2). sequences other than the designated target. Primers were then used in Assessments of hormones levels. Commercial ELISA kits were a standard PCR reaction to amplify cDNA generated by reverse used for determination of circulating levels of corticosterone (Octeia transcription, and products were run on agarose gels and stained with Rat/Mouse ELISA, cat. no. AC-14F1; IDS, Fountain Hills, AZ) and ethidium bromide to confirm that only one band, of the expected size, total and n-octanoyl ghrelin (Rat/Mouse ELISA, cat. nos. EZGDAC- Downloaded from was amplified and no primer dimers formed. These PCR products 87K and EZGAC-86K, respectively; Linco). Circulating ACTH levels were then column purified (Qiagen, Valencia, CA) and sequenced to were not assessed in these mice due to the limited volume of plasma confirm target specificity. The primers, the expected product sizes, collected (200–300 ␮l/mouse). However, ACTH release from pri- annealing temperatures and Genbank accession numbers are provided mary mouse and baboon pituitary cultures treated with SST and/or in Table 1. CRH, or those treated with ghrelin, was measured using the ALPCO Confirmation of primer efficiency, construction of standard curves, ACTH ELISA kit (cat. no. 21-SDX018), where the amino acid and qrtRT-PCR. The initial screening of primer efficiency in a

sequence of mouse and primate ACTH do not differ. ajpendo.physiology.org real-time PCR reaction was performed amplifying twofold dilutions Statistical analysis. Samples from all groups within an experiment of RT products, where optimal efficiency was demonstrated by a were processed at the same time; therefore, the in vivo effects of difference of one cycle threshold between dilutions. At the end of the genotype/fasting and the in vitro effects of SST/CRH were assessed amplification, the final products were subjected to graded tempera- by two-way ANOVA followed by a Newman-Keuls test for multiple ture-dependent dissociation to verify that only one product was comparisons. Effects of fasting on SST mRNA levels in Sstϩ/ϩ or the amplified. For real-time PCR reaction, IQ SYBR Green Supermix in vitro effects of ghrelin on POMC mRNA levels and ACTH release (Bio-Rad, Hercules, CA) was used, where thermocycling and fluores- were assessed by Student’s t-test. P Ͻ 0.05 was considered signifi- cence detection were performed using a Stratagene Mx3000p real- cant. All values are expressed as means Ϯ SE. All statistical analyses time PCR machine. If preliminary primer efficiency tests were con- were performed using the GB-STAT software package (Dynamic firmed, the concentration of purified PCR products (generated by Microsystems, Silver Spring, MD). on October 14, 2008 standard PCR and purified for sequencing as described above) was determined using Molecular Probe’s Picogreen DNA quantification kit, and the PCR products were serial diluted to obtain standards RESULTS containing 101,102,103,104,105, and 106 copies of synthetic template per 1 ␮l. Standards were then amplified by real-time and Somatostatin. Absolute hypothalamic and stomach SST and standard curves generated by the Stratagene Mx3000p Software. The cyclophilin A mRNA copy numbers, as determined by qrtRT- final volume of the PCR reaction was 25 ␮l: 1 ␮l of RT sample, 12.5 PCR, are shown in Table 2, whereas Fig. 1 illustrates hypo- ␮l of the IQ SYBR Green Supermix, 0.375 ␮l of each primer (10 ␮M thalamic and stomach SST mRNA copy number, adjusted by stock solution), 0.375 ␮l of the reference dye (Bio-Rad), and 10.375 cyclophilin A mRNA copy number, in Sstϩ/ϩ and SstϪ/Ϫ mice.

Table 2. Absolute cDNA copy number/0.05 ␮g total RNA of gene transcripts in the hypothalamus, pituitary, and stomach of fed and fasted (48 h) Sstϩ/ϩ and SstϪ/Ϫ mice, as determined by quantitative real-time RT-PCR

Sstϩ/ϩ SstϪ/Ϫ

Fed Fasted Fed Fasted Hypothalamus Cyclophilin A 204,279Ϯ36,352 235,119Ϯ35,305 206,973Ϯ22,778 252,667Ϯ44,545 SST 37,878Ϯ3,614 36,490Ϯ7,383 ND ND CRH 80Ϯ11 124Ϯ27 67Ϯ9 116Ϯ18 Ghrelin 17Ϯ218Ϯ217Ϯ323Ϯ6 Pituitary Cyclophilin A 130,493Ϯ18,570 123,535Ϯ9,931 131,479Ϯ15,341 125,613Ϯ7,300 POMC 1,875,000Ϯ275,984 1,414,520Ϯ97,762 2,810,857Ϯ123,729 2,110,800Ϯ172,841 Ghrelin 30Ϯ467Ϯ940Ϯ670Ϯ7 Stomach Cyclophilin A 157,686Ϯ18,046 178,200Ϯ9,342 155,513Ϯ10,126 149,350Ϯ6,674 SST 55,687Ϯ6,754 45,597Ϯ10,466 ND ND Ghrelin 170,228Ϯ37,406 249,320Ϯ34,145 336,713Ϯ37,421 304,650Ϯ28,158 Values represent means Ϯ SE. ND, not detectable.

AJP-Endocrinol Metab • VOL 291 • AUGUST 2006 • www.ajpendo.org E398 EFFECTS OF ENDOGENOUS SST ON ADRENAL AXIS AND GHRELIN fasting did result in an overall increase in CRH mRNA levels, independent of genotype (P Ͻ 0.05; Fig. 2C). Effect of SST on POMC mRNA levels and ACTH release in primary pituitary cell cultures. The enhanced levels of pituitary POMC mRNA of SstϪ/Ϫ mice occurred independently of increases in hypothalamic CRH expression, suggesting SST may directly mediate pituitary ACTH synthesis. To further explore this possibility, we examined the effects of SST (100 nM, 18 h) on POMC mRNA levels and ACTH release in primary mouse pituitary cell cultures in the presence and absence of CRH (10 nM), and the results are presented in Fig. 3A. In the mouse, SST alone decreased POMC mRNA levels Downloaded from ajpendo.physiology.org

Fig. 1. Somatostatin (SST) mRNA levels in the hypothalamus (A) and stomach (B) of fed and fasted (48 h) Sstϩ/ϩ and SstϪ/Ϫ male mice (n ϭ 5 mice/group). SST mRNA copy number was determined by quantitative real- time RT-PCR (qrtRT-PCR), and the values were adjusted by cyclophilin A copy number as an internal control. Values represent means Ϯ SE. n.d., not detectable by qrtRT-PCR. on October 14, 2008 SST mRNA levels were undetectable by qrtRT-PCR in SstϪ/Ϫ mice in both the hypothalamus (Fig. 1A) and stomach (Fig. 1B), thus confirming the PCR genotyping results. In Sstϩ/ϩ mice, fasting tended to suppress hypothalamic and stomach SST mRNA levels; however, these effects did not reach statistical significance. A modest inhibitory effect of fasting on hypothalamic SST expression has been previously reported in mice (35). However, in the rat, fasting has been reported to enhance SST mRNA levels in the pyloric antrum but not the acid-secreting region of the stomach (38, 48), although others report a regional increase or decrease in SST mRNA following fasting, depending on the housekeeping gene used as the internal control (49). HPA axis of Sstϩ/ϩ vs. SstϪ/Ϫ mice. Circulating corticosterone levels were significantly elevated in SstϪ/Ϫ mice compared with wild-type controls (Fig. 2A). Forty-eight hours of fasting increased corticosterone levels, where this rise did not significantly differ between genotype. Elevated corticosterone levels of fed SstϪ/Ϫ mice were associated with a significant increase in pituitary POMC mRNA levels compared with ϩ/ϩ Fig. 2. Circulating corticosterone levels (A), pituitary proopiomelanocortico- Sst mice (Fig. 2B). It should be noted that the differences in tropin (POMC) mRNA levels (B), and hypothalamic corticotropin-releasing pituitary POMC expression were maintained between geno- hormone (CRH) mRNA levels (C) of fed and fasted (48 h) Sstϩ/ϩ and SstϪ/Ϫ types following the 48-h fast. Despite the elevated levels of male mice (n ϭ 5–8 mice/group). Pituitary POMC mRNA and hypothalamic POMC mRNA, SstϪ/Ϫ mice tended to have lower levels of CRH mRNA copy numbers were determined by qrtRT-PCR, and the values Sstϩ/ϩ were adjusted by cyclophilin A copy number as an internal control. Values hypothalamic CRH mRNA compared with mice, con- represent means Ϯ SE. *Values that differ within genotype in response to sistent with corticosterone negative feedback; however, this fasting; †values that differ between genotype within dietary group. P Ͻ 0.05 did not reach statistical significance (P Ͻ 0.17). However, was considered significant.

AJP-Endocrinol Metab • VOL 291 • AUGUST 2006 • www.ajpendo.org EFFECTS OF ENDOGENOUS SST ON ADRENAL AXIS AND GHRELIN E399

Fig. 3. Effect of 18-h treatment of SST (100 nM) and/or CRH (10 nM) on POMC mRNA levels and adrenocorticotropic hormone (ACTH) release in primary pituitary cell cultures from mice (A) and baboons (B). POMC mRNA copy numbers were determined by qrtRT-PCR, and the values were adjusted by cyclophilin A copy number as an internal control. Values are expressed as %vehicle- treated controls (set at 100%) within experiment and represent means Ϯ SE of 3 independent experiments for mice (4–6 wells/ treatment/experiment) and 2 independent experiments for baboons (4–6 replicates/ treatment/experiment). In this set of experiments, the amount of ACTH released per 2 ϫ 105 cells over the 18-h period in vehicle- treated cultures was 179 Ϯ 35 pg/ml for Downloaded from mouse and 12,548 Ϯ 1,049 pg/ml for baboon. *Values that differ from vehicle-treated controls; †values that differ from cultures treated with SST or CRH alone. P Ͻ 0.05 was considered signiﬁcant. ajpendo.physiology.org

and ACTH release. Although it has been previously reported Circulating ghrelin and ghrelin mRNA levels in Sstϩ/ϩ vs. that CRH enhances POMC mRNA levels in primary rat pitu- SstϪ/Ϫ mice. Total circulating ghrelin levels were dramatically itary cell cultures (12, 15), CRH did not alter POMC expres- elevated in SstϪ/Ϫ vs. Sstϩ/ϩ mice in both the fed and fasted sion in mouse pituitary cultures but did stimulate ACTH state (Fig. 4A). The elevation in circulating total ghrelin levels

Ϫ Ϫ on October 14, 2008 release, where this action was blunted by coculture with SST. of Sst / mice was associated with a significant increase in A similar dissociation between the direct pituitary effects of ghrelin mRNA levels in the stomach (Fig. 4C). Although Ϫ/Ϫ CRH on POMC mRNA levels and ACTH release has been Sst mice displayed a clear increase in ghrelin expression, previously reported in the sheep (26). However, it should also circulating levels of n-octanoyl ghrelin did not differ between be noted that CRH has been shown to enhance POMC mRNA genotype (Fig. 4B). Interestingly, fasting had an overall stimulatory effect on n-octanoyl ghrelin levels, where the response levels in AtT20 cells, an ACTH-producing tumor cell line ϩ/ϩ derived from a mouse pituitary (1). Therefore, the effects of reached significance in the Sst mice (Fig. 4B). However, CRH on POMC expression not only vary between species but total ghrelin levels (Fig. 4A) and stomach ghrelin mRNA levels are also dependent on the pathophysiological state of the tissue (Fig. 4C) were not significantly altered by fasting. tested. Although the stomach is the primary source of circulating ghrelin (3), ghrelin has been detected in both the hypothalamus To determine whether the inhibitory action of SST on (39) and pituitary (22). Therefore, we also examined whether POMC expression and ACTH release is confined to the mouse endogenous SST and fasting interact to regulate hypothalamic model, or represents a regulatory control mechanism that can and pituitary expression of ghrelin. The hypothalamus and be observed across species, we repeated the in vitro experiment pituitary did express detectable levels of ghrelin (Table 2). using primary pituitary cell cultures from a nonhuman primate However, when hypothalamic and pituitary ghrelin mRNA (Papio anubis, baboon), and the results are shown in Fig. 3B. levels were compared with those expressed in the stomach, the As in the mouse, SST alone decreased POMC mRNA levels absolute mRNA copy number was 10,000- and 5,000-fold less, and ACTH release following an 18-h treatment. In contrast to respectively. Hypothalamic ghrelin mRNA levels did not differ the mouse, CRH stimulated both pituitary POMC mRNA between genotype or in response to fasting (Fig. 5A), incon- levels and ACTH release. Also, SST effectively blocked CRH sistent with reports in the rat, where hypothalamic ghrelin stimulation of POMC mRNA levels and blunted CRH-induced mRNA levels were reduced by 24- and 48-h fasting (39). At ACTH release. Taken together, these results confirm that the the level of the pituitary, ghrelin mRNA levels did not differ effects of CRH on pituitary ACTH synthesis are species between genotype; however, fasting significantly increased dependent. Nonetheless, they clearly demonstrate that SST, pituitary ghrelin expression in both groups (Fig. 5B). independently of CRH, can work directly at the level of the Effect of ghrelin on POMC mRNA levels and ACTH release pituitary to reduce ACTH synthesis and release in two diverse in primary pituitary cell cultures. It has been previously shown species. that ghrelin (n-octanoyl) or its synthetic analogs do not affect

AJP-Endocrinol Metab • VOL 291 • AUGUST 2006 • www.ajpendo.org E400 EFFECTS OF ENDOGENOUS SST ON ADRENAL AXIS AND GHRELIN did have a modest but signiﬁcant stimulatory effect on ACTH release in baboon pituitary cell cultures, where the values shown are the means of ﬁve separate experiments, performed on cultures from different baboons. In three experiments ghrelin had no effect on ACTH release, whereas in two experiments ghrelin showed a clear 60% increase in ACTH released into the medium over the 18-h culture period (data not shown). Given that these pituitary cell cultures were prepared from randomly cycling female baboons of different ages, we cannot exclude the possibility that reproductive environment may alter the corticotrope response to ghrelin.

DISCUSSION In SstϪ/Ϫ mice, corticosterone levels were more than dou- bled compared with their respective Sstϩ/ϩ control values, as previously reported (50). In this study, we demonstrate that elevation in glucocorticoid levels in the SstϪ/Ϫ mouse are

associated with a signiﬁcant increase in pituitary POMC ex- Downloaded from pression, without a concomitant rise in hypothalamic CRH expression. These in vivo results, coupled with our present in vitro ﬁndings showing that SST can directly suppress POMC mRNA levels and ACTH release in primary mouse pituitary cell cultures and with the fact that pituitaries of sst2 knockout mice release more ACTH in vitro (47), strongly support the hypothesis that, at least in the mouse, endogenous SST can act ajpendo.physiology.org as a corticotropin synthesis/release-inhibiting factor (14). The on October 14, 2008

Fig. 4. Circulating total ghrelin (A), n-octanoyl ghrelin (B), and stomach ghrelin mRNA levels (C) of fed and fasted (48 h) Sstϩ/ϩ and SstϪ/Ϫ male mice (n ϭ 5–8 mice/group). Stomach ghrelin mRNA levels were determined by qrtRT-PCR, and the values were adjusted by cyclophilin A copy number as an internal control. Values represent means Ϯ SE. *Values that differ within genotype in response to fasting; †values that differ between genotype within dietary group. P Ͻ 0.05 was considered significant. the release of ACTH from primary rat pituitary cell cultures or primary cultures from human fetal pituitaries (13, 41). How- ever, a synthetic ghrelin analog was effective in stimulating ACTH release in cultures from human corticotropinomas (7). Given that the direct pituitary effects of ghrelin on ACTH release may be dependent on the species, age, and physiological state of the tissue donor, we tested the direct effects of ghrelin (10 nM) on POMC mRNA levels and ACTH release in primary pituitary cell cultures from normal mice and baboons, Fig. 5. Hypothalamic (A) and pituitary (B) ghrelin mRNA levels of fed and ϩ ϩ Ϫ Ϫ and the results are shown in Fig. 6. Ghrelin had no significant fasted (48 h) Sst / and Sst / male mice (n ϭ 5–8 mice/group). Ghrelin mRNA copy numbers in the hypothalamus and the pituitary were determined effect on POMC mRNA levels in pituitary cell cultures pre- by qrtRT-PCR, and the values were adjusted by cyclophilin A copy number as pared from mice or baboons. Likewise, ghrelin did not affect an internal control. Values represent means Ϯ SE. *Values that differ within ACTH release from mouse pituitary cells. However, ghrelin genotype in response to fasting. P Ͻ 0.05 was considered significant.

AJP-Endocrinol Metab • VOL 291 • AUGUST 2006 • www.ajpendo.org EFFECTS OF ENDOGENOUS SST ON ADRENAL AXIS AND GHRELIN E401

Fig. 6. Effect of 18-h treatment of n-octanoyl ghrelin (10 nM) on POMC mRNA levels and ACTH release in primary pituitary cell cultures from mice (A) and baboons (B). POMC mRNA copy numbers were determined by qrtRT-PCR, and the values were adjusted by cyclophilin A copy number as an internal control. Values are expressed as %vehicle-treated controls (set at 100%) within experiment and represent means Ϯ SE of 3 independent experiments for mice (4–5 wells/treatment/experiment) and 5 independent experiments for baboons (4–6 replicates/treatment/ experiment). In this set of experiments, the amount of ACTH released per 2 ϫ 105 cells over the 18-h period in vehicle-treated cultures was 1,792 Ϯ 68

pg/ml for mouse and 4,476 Ϯ 1,050 pg/ml for Downloaded from baboon. *Values that differ from vehicle-treated controls. P Ͻ 0.05 was considered significant. ajpendo.physiology.org fact that the direct inhibitory actions of SST on POMC mRNA ghrelin levels, where ϳ90% represents the des-acyl form (31). levels and ACTH release were also observed in primary pitu- Our present results demonstrate that regulation of ghrelin gene itary cell cultures from a nonhuman primate suggests that expression and posttranslational modification of ghrelin, via its endogenous SST may also play an important role in regulating acylation, are not always linked. This disconnection has also corticotroph function in higher-order mammalian species, such been observed in adult mice following feeding of C:8 medium- as humans. chain fatty acids, where n-octanoyl ghrelin levels rose, in the on October 14, 2008 We also observed that total circulating ghrelin and stomach absence of changes in total ghrelin levels (32). Also, n- ghrelin mRNA levels [the primary source of circulating ghrelin octanoyl ghrelin levels, but not total ghrelin levels, are reported (3)] were increased in SstϪ/Ϫ mice, indicating that endogenous to fall during the transition from suckling to weaning in mice SST tone is a critical regulator of ghrelin synthesis. This is and rats, where milk is rich in medium-chain fatty acids (33). consistent with reports demonstrating that treatment with SST Taken together, these results indicate that dietary medium- or its synthetic analog (octreotide) suppresses circulating chain fatty acids can be used as direct substrates for acylation ghrelin in rats and humans (6, 34, 42), where this effect is of existing ghrelin. Although the specific enzymatic pathway thought to be primarily mediated via sst2 (42). The inhibitory mediating acylation of ghrelin remains to be defined, we can effect of SST on ghrelin release can also be observed following conclude from our present results that endogenous SST tone perfusion of SST into the gastric artery, suggesting a direct has no major impact on this process in fed or fasted mice. effect on gastric ghrelin production (40). In fact, SST produced We originally hypothesized that the elevated ghrelin levels locally in the stomach may play a major role in mediating observed in the SstϪ/Ϫ mouse may contribute to the elevated ghrelin synthesis and release, given that SST-producing gastric glucocorticoids observed in this mutant model. Previous stud- cells directly contact ghrelin-producing cells (40). In contrast ies indicate that the stimulatory effect of ghrelin on the adrenal to the role of endogenous SST in regulating gastric ghrelin axis of the rat is not mediated by direct pituitary effects on expression, hypothalamic and pituitary ghrelin mRNA levels ACTH secretion (13), consistent with our present in vitro were not altered in the SstϪ/Ϫ mice compared with Sstϩ/ϩ results where primary mouse pituitary cell cultures were used. controls, demonstrating that the regulatory action of SST on Also, ghrelin does not appear to have a direct effect on adrenal ghrelin expression is tissue specific. steroidogenesis (8). However, the major impact of ghrelin on Despite the rise in total ghrelin output, n-octanoyl ghrelin glucocorticoid production is likely mediated centrally by en- levels were unaltered in SstϪ/Ϫ mice. Also, fasting resulted in hancing CRH neuronal activity via neuropeptide Y-mediated a rise in n-octanoyl ghrelin in both Sstϩ/ϩ and SstϪ/Ϫ mice suppression of GABA inhibitory tone (10). Given that the without significant changes in total circulating ghrelin levels or stimulatory effect of ghrelin on CRH release requires its acyl stomach ghrelin gene expression, consistent with reports of modification (30), we might conclude that SST-mediated al- others showing no effect of fasting on total circulating ghrelin teration in total circulating ghrelin levels is not responsible for levels in the mouse (29, 36). This is in contrast to the effects of alterations in the adrenal axis of the SstϪ/Ϫ mice. We cannot fasting in rats, where increases in circulating levels of n- ignore the possibility that centrally produced n-octanoyl ghre- octanoyl ghrelin are clearly reflected by increases in total lin may be regulated by SST (39). If hypothalamic n-octanoyl

AJP-Endocrinol Metab • VOL 291 • AUGUST 2006 • www.ajpendo.org E402 EFFECTS OF ENDOGENOUS SST ON ADRENAL AXIS AND GHRELIN ghrelin levels were modulated by endogenous SST, we might a novel hypothalamic circuit regulating energy homeostasis. Neuron 37: have anticipated a change in CRH expression in the SstϪ/Ϫ on 649–661, 2004. the basis of previous observations (5, 21) showing that intra- 11. Cummings DE, Foster-Schubert KE, and Overduin J. Ghrelin and energy balance: focus on current controversies. Curr Drug Targets 6: cerebroventricular delivery of ghrelin or GH-releasing pep- 153–169, 2005. tide-6 increases CRH mRNA levels in mice. However, the lack 12. Dave JR, Eiden LE, Lozovsky D, Waschek JA, and Eskay RC. of endogenous SST had no stimulatory effect on hypothalamic Calcium-independent and calcium-dependent mechanisms regulate corti- CRH expression. cotropin-releasing factor-stimulated pro-opiomelanocortin peptide secre- Taken together, these findings do not support our original tion and messenger ribonucleic acid production. Endocrinology 120: 305–310, 1987. hypothesis that elevated levels of ghrelin contribute to elevated Ϫ/Ϫ 13. Elias KA, Ingle GS, Burnier JP, Hammonds RG, McDowell RS, corticosterone levels in the Sst mouse. However, our find- Rawson TE, Somers TC, Stanley MS, and Cronin MJ. In vitro ings do support a role for endogenous SST as a true cortico- characterization of four novel classes of growth hormone-releasing pep- tropin release-inhibiting factor under basal (fed) conditions, tide. Endocrinology 136: 5694–5699, 1995. although endogenous SST does not play a major role in 14. Engler D, Reidie E, and Kola I. The corticotropin-release inhibitory regulating the HPA axis in the fasted state. Our results also factor hypothesis: a review of the evidence for the existence of inhibitory as well as stimulatory hypophysiotropic regulation of adrenocorticotropin reveal that endogenous SST suppresses gastrointestinal ghrelin secretion and biosynthesis. Endocr Rev 20: 460–500, 1999. production; however, SST does not play a role in regulating 15. Gagner JP and Drouin J. Opposite regulation of proopiomelanocortin posttranslational acylation of ghrelin in the fed or fasted state. gene transcription by glucocorticoids and CRH. Mol Cell Biol 40: 25–32, 1985. Downloaded from GRANTS 16. Ghigo E, Broglio F, Me E, Prodam F, and Ragazzoni F. Ghrelin: more than a new frontier in neuroendocrinology. J Endocrinol Invest 27: This work was supported by the “Secretaria de Universidades, Investiga- 101–104, 2005. cioń y Tecnologıá de la Junta de Andalucia” (to R. M. Luque), an Endocrine 17. Giordano R, Pellegrino M, Picu A, Bonelli L, Balbo M, Berardelli R, Society Fellowship Award (to M. D. Gahete), and National Institute of Lanfranco F, Ghigo E, and Arvat E. Neuroregulation of the hypothal- Diabetes and Digestive and Kidney Diseases Grant DK-30677 (to R. D. amus-pituitary-adrenal (HPA) axis in humans: effects of GABA-, miner- Kineman). alocorticoid-, and GH-secretagogue-receptor modulation. Scientific World Journal 17: 1–11, 2006. ajpendo.physiology.org REFERENCES 18. Hirotani C, Oki Y, Ukai K, Okuno T, Kurasaki S, Ohyama T, Doi N, Sasaki K, and Ase K. 1. Affolter HU and Reisine T. Corticotropin-releasing factor increases ACTH releasing activity of KP-102 (GHRP-2) in pro-opiomelanocortin messenger RNA in mouse anterior pituitary tumor rats is mediated mainly by release of CRF. Naunyn Schmiedebergs Arch cells. J Biol Chem 260: 15477–15481, 1985. Pharmacol 371: 54–60, 2005. 2. Aleppo G, Moskal SF II, DeGrandis PA, Kineman RD, and Frohman 19. Hofland LJ and Lamberts SW. Somatostatin receptors in pituitary LA. Homologous down-regulation of growth hormone-releasing hormone function, diagnosis and therapy. Front Horm Res 32: 235–252, 2004. receptor mRNA levels. Endocrinology 138: 1058–1065, 1997. 20. Hofland LJ, van der Hoek J, Feelders R, van Aken MO, Van Koets- 3. Ariyasu H, Takaya K, Tagami T, Ogawa Y, Hosoda K, Akamizu T, veld PM, Waaihers M, Sprij-Mooij D, Bruns C, Weckbecker G, de Suda M, Koh T, Natsui K, Toyooka S, Shirakami G, Usui T, Shimatsu Herder WW, Beckers A, and Lamberts SW. The multi-ligand somatostatin analogue SOM230 inhibits ACTH secretion by cultured human A, Doi K, Hosoda H, Kojima M, Kangawa K, and Nakao K. Stomach on October 14, 2008 is a major source of circulating ghrelin, and feeding state determines corticotroph adenomas via somatostatin receptor type 5. Eur J Endocrinol plasma ghrelin-like immunoreactivity levels in humans. J Clin Endocrinol 152: 645–654, 2005. Metab 86: 4753–4758, 2001. 21. Johnstone LE, Srisawat R, and Leng G. Hypothalamic expression of 4. Arvat E, Maccario M, DiVito L, Broglio F, Benso A, Gottero C, NPY mRNA, vasopressin mRNA and CRF mRNA in response to food Papotti M, Muccioli G, Dieguez C, Casanueva FF, Deghenghi R, restriction and central administration of the orexigenic peptide GHRP-6. Camanni F, and Ghigo E. Endocrine activities of ghrelin, a natural Stress 8: 59–67, 2005. growth hormone secretagogue (GHS), in humans: comparison and inter- 22. Kamegai J, Tamura H, Shimizu T, Ishii S, Sugihara H, and Oikawa S. actions with hexarelin, a nonnatural peptidyl GHS, and GH-releasing Regulation of the ghrelin gene: growth hormone-releasing hormone up- hormone. J Clin Endocrinol Metab 86: 1169–1174, 2001. regulates ghrelin mRNA in the pituitary. Endocrinology 142: 4154–4157, 5. Asakawa A, Inui A, Kaga T, Yuzuriha H, Nagata T, Fujimiya M, 2001. Katsuura G, Makino S, Fujino MA, and Kasuga M. A role of ghrelin 23. Kojima M and Kangawa K. Ghrelin: structure and function. Physiol Rev in neuroendocrine and behavioral responses to stress in mice. Neuroen- 85: 495–522, 2005. docrinology 74: 143–147, 2001. 24. Korbonits M, Goldstone AP, Gueorguiev M, and Grossman AB. 6. Barkan AL, Dimarki EV, Jessup SK, Symons KV, Ermolenko M, and Ghrelin—a hormone with multiple functions. Front Neuroendocrinol 25: Jaffe CA. Ghrelin secretion in humans is sexually dimorphic, suppressed 27–68, 2004. by somatostatin, and not affected by the ambient growth hormone levels. 25. Lamberts SW, Zuyderwijk J, Den Holder F, Van Koetsveld P, and J Clin Endocrinol Metab 88: 2180–2184, 2003. Hofland L. Studies on the conditions determining the inhibitory effect of 7. Barlier A, Zamora AJ, Grino M, Gunz G, Pellegrini-Bouiller I, somatostatin on adrenocorticotropin, prolactin and thyrotropin release by Morange-Ramos I, Figarella-Branger D, Dufour H, Jaquet P, and cultured rat pituitary cells. Neuroendocrinology 50: 44–50, 1989. Enjalbert A. Expression of functional growth hormone secretagogue Levin N, Wallace C, Bengani N, Blum M, Farnworth P, Ian-Smith A, receptors in human pituitary adenomas: polymerase chain reaction, triple 26. in-situ hybridization and cell culture studies. J Neuroendocrinol 11: and Roberts JL. Ovine anterior pituitary proopiomelanocortin gene 491–502, 1999. expression is not increased by ACTH secretagogues in vitro. Endocrinol- 8. Barreiro ML, Pinilla L, Aguilar E, and Tena-Sempere M. Expression ogy 132: 1692–1700, 1993. and homologous regulation of GH secretagogue receptor mRNA in rat 27. Lucidi P, Murdolo G, Di Loreto C, Parlanti N, De Cicco A, Fatone C, adrenal gland. Eur J Endocrinol 147: 677–688, 2002. Taglioni C, Fanelli C, Broglio F, Ghigo E, Bolli GB, Santeusanio F, 9. Cao JM, Ong H, and Chen C. Effects of ghrelin and synthetic GH and De Feo P. Metabolic and endocrine effects of physiologic increments secretagogues on the cardiovascular system. Trends Endocrinol Metab 17: in plasma ghrelin concentrations. Nutr Metab Cardiovasc Dis 15: 410– 13–18, 2006. 417, 2005. 10. Cowley MA, Smith RG, Diano S, Tschop M, Pronchuk N, Grove KL, 28. Luque RM and Kineman RD. Somatostatin (SRIF) functions as a Strasburger CJ, Bidlingmaier M, Esterman M, Heiman ML, Garcia- modulator of fasting-induced changes in neuropeptide Y (NPY) and Segura LM, Nillni EA, Mendez P, Low MJ, Sotonyi P, Friedman JM, growth hormone (GH)-releasing hormone (GHRH) expression (Abstract Liu H, Pinto S, Colmers WF, Cone RC, and Horvath TL. The P1-223). Program of the 85th Annual Meeting of the Endocrine Society, distribution and mechanism of action of ghrelin in the CNS demonstrates New Orleans, LA, 2004, p. 207.

AJP-Endocrinol Metab • VOL 291 • AUGUST 2006 • www.ajpendo.org EFFECTS OF ENDOGENOUS SST ON ADRENAL AXIS AND GHRELIN E403

29. Moesgaard SG, Ahren B, Carr RD, Gram DX, Brand CL, and 39. Sato T, Fukue Y, Teranishi H, Yoshida Y, and Kojima M. Molecular Sundler F. Effects of high-fat feeding and fasting on ghrelin expression in forms of hypothalamic ghrelin and its regulation by fasting and 2-deoxy- the mouse stomach. Regul Pept 120: 261–267, 2004. D-glucose administration. Endocrinology 146: 2510–2516, 2005. 30. Mozid AM, Tringali G, Forsling ML, Hendricks MS, Ajodha S, 40. Shimada H, Date Y, Modal MS, Toshinai K, Shimbara T, Fukunaga Edwards R, Navarra P, Grossman AB, and Korbonits M. Ghrelin is K, Murakami N, Miyazato M, Kangawa K, Yoshimatsu H, Matsuo H, released from rat hypothalamic explants and stimulates corticotrophin- and Nakazato M. Somatostatin suppresses ghrelin secretion from the rat releasing hormone and arginine-vasopressin. Horm Metab Res 35: 455– stomach. Biochem Biophys Res Commun 302: 520–525, 2003. 459, 2003. 41. Shimon I, Yan X, and Melmed S. Human fetal pituitary expresses 31. Murakami M, Hayashida T, Kuroiwa T, Nakahara K, Ida T, Modal functional growth hormone-releasing peptide receptors. J Clin Endocrinol MS, Nakazato M, Kojima M, and Kangawa K. Role for central ghrelin Metab 83: 174–178, 1998. in food intake and secretion profile of stomach ghrelin in rats. J Endocri- 42. Silva AP, Bethmann K, Raulf F, and Schmid HA. Regulation of ghrelin nol 174: 283–288, 2002. secretion by somatostatin analogs in rats. Eur J Endocrinol 152: 887–894, 32. Nishi Y, Hiejima H, Hosoda H, Kaiya H, Mori K, Fukue Y, Yanase T, 2005. Nawata H, Kangawa K, and Kojima M. Ingested medium-chain fatty 43. Silva AP, Schoeffter P, Weckbecker G, Bruns C, and Schmid HA. acids are directly utilized for the acyl modification of ghrelin. Endocri- Regulation of CRH-induced secretion of ACTH and corticosterone by nology 146: 2255–2364, 2005. SOM230 in rats. Eur J Endocrinol 153: R7–R10, 2005. 33. Nishi Y, Hiejima H, Mifune H, Sato R, Kangawa K, and Kojima M. 44. Strowski M, Dachkevicz MP, Parmar RM, Wilkinson H, Kohler M, Developmental changes in the pattern of ghrelin’s acyl modification and Schaeffer JM, and Blake AD. Somatostatin receptor subtypes 2 and 5 inhibit corticotropin-releasing hormone-stimulated adrenocortico- the levels of acyl-modified ghrelins in murine stomach. Endocrinology tropin secretion from AtT-20 cells. Neuroendocrinology 75: 339–346, 146: 2709–2715, 2005. 2002. 34. Norrelund H, Hansen TK, Orskov H, Hosoda H, Kojima M, Kangawa 45. Takaya K, Ariyasu H, Kanamoto N, Iwakura H, Yoshimoto A, K, Weeke J, Moller N, Christiansen JS, and Jorgensen JO. Ghrelin Downloaded from Harada M, Mori K, Komatsu Y, Usui T, Shimatsu A, Ogawa Y, immunoreactivity in human plasma is suppressed by somatostatin. Clin Hosoda K, Akamizu T, Kojima M, Kangawa K, and Nakao K. Ghrelin Endocrinol (Oxf) 57: 539–546, 2002. strongly stimulates growth hormone (GH) release in humans. J Clin 35. Park S, Peng XD, Frohman LA, and Kineman RD. Expression analysis Endocrinol Metab 85: 4908–4911, 2005. of hypothalamic and pituitary components of the growth hormone axis in 46. van der Hoek J, Lamberts SW, and Hofland LJ. The role of soma- ϩ/ϩ fasted and streptozotocin-treated neuropeptide Y (NPY)-intact (NPY ) tostatin analogs in Cushing’s disease. Pituitary 7: 257–264, 2004. Ϫ/Ϫ and NPY-knockout (NPY ) mice. Neuroendocrinology 81: 360–371, 47. Viollet C, Vaillend C, Videau C, Bluet-Pajot MT, Ungerer A, 2005. L’Hertier A, Potier B, Billard JM, Schaeffer J, Smith RG, Rohrer SP, 36. Perreault M, Istrate N, Wang L, Nichols AJ, Tozzo E, and Stricker- Wilkinson H, Zheng H, and Epelbaum J. Involvement of sst2 soma- ajpendo.physiology.org Krongrad A. Resistance to the orexigenic effect of ghrelin in dietary- tostatin receptor in locomotor exploratory activity and emotional reactivity induced obesity in mice: reversal upon weight loss. Int J Obes Relat Metab in mice. Eur J Neurosci 12: 3761–3770, 2000. Disord 28: 879–885, 2004. 48. Wu SV, Sumii K, Mogard M, and Walsh JH. Regulation of gastric 37. Saito ES, Kaiya H, Tachibana T, Tomonaga S, Denbow DM, Kangawa somatostatin gene expression. Metabolism 39: 125–130, 1990. K, and Furase M. Inhibitory effect of ghrelin on food intake is mediated 49. Yamada H, Chen D, Monstein HJ, and Hakanson R. Effects of fasting by the corticotropin-releasing factor system in neonatal chicks. Regul Pept on the expression of gastrin, cholescystokinin, and somatostatin genes and 125: 201–208, 2005. various housekeeping genes in the pancreas and upper digestive tract of 38. Sandvik AK, Dimaline R, Forster ER, Evans D, and Dockray GJ. rats. Biochem Biophys Res Commun 231: 835–838, 1997. Differential control of soamtostatin messenger RNA in rat gastric corpus 50. Zeyda T, Diehl N, Paylor R, Brennan MB, and Hochgeschwender U. and antrum. Role of acid, food, and capsaicin-sensitive afferent. J Clin Impairment in motor learning of somatostatin null mutant mice. Brain Res on October 14, 2008 Invest 91: 244–250, 1993. 906: 107–117, 2001.

AJP-Endocrinol Metab • VOL 291 • AUGUST 2006 • www.ajpendo.org

ARTICLE II

Molecular and Cellular Endocrinology 317 (2010) 154–160

Contents lists available at ScienceDirect

Molecular and Cellular Endocrinology

journal homepage: www.elsevier.com/locate/mce

Metabolic regulation of ghrelin O-acyl transferase (GOAT) expression in the mouse hypothalamus, pituitary, and stomach

Manuel D. Gahete a, Jose Córdoba-Chacón a, Roberto Salvatori b, Justo P. Castano˜ a, Rhonda D. Kineman c,d, Raul M. Luque a,∗ a Department of Cell Biology, Physiology and Immunology, University of Cordoba, Instituto Maimónides de Investigación Biomédica de Córdoba (IMIBIC), and CIBER Fisiopatología de la Obesidad y Nutrición, 14004 Córdoba, Spain b Johns Hopkins University School of Medicine, Baltimore, MD 21287, United States c Research and Development Division, Jesse Brown Veterans Affairs Medical Center, Chicago, IL 60612, United States d Department of Medicine, Section of Endocrinology, Diabetes and Metabolism, University of Illinois at Chicago, Chicago, IL 60612, United States article info abstract

Article history: Ghrelin acts as an endocrine link connecting physiological processes regulating food intake, body com- Received 21 October 2009 position, growth, and energy balance. Ghrelin is the only peptide known to undergo octanoylation. The Accepted 16 December 2009 enzyme mediating this process, ghrelin O-acyltransferase (GOAT), is expressed in the gastrointestinal tract (GI; primary source of circulating ghrelin) as well as other tissues. The present study demonstrates Keywords: that stomach GOAT mRNA levels correlate with circulating acylated-ghrelin levels in fasted and diet- Ghrelin O-acyl transferase (GOAT) induced obese mice. In addition, GOAT was found to be expressed in both the pituitary and hypothalamus Mouse models (fasting, obesity, knockouts) (two target tissues of ghrelin’s actions), and regulated in response to metabolic status. Using primary Stomach Pituitary pituitary cell cultures as a model system to study the regulation of GOAT expression, we found that Hypothalamus acylated-ghrelin, but not desacyl-ghrelin, increased GOAT expression. In addition, growth-hormone- releasing hormone (GHRH) and leptin increased, while somatostatin (SST) decreased GOAT expression. The physiologic relevance of these later results is supported by the observation that pituitary GOAT expression in mice lacking GHRH, SST and leptin showed opposite changes to those observed after in vitro treatment with the corresponding peptides. Therefore, it seems plausible that these hormones directly contribute to the regulation of pituitary GOAT. Interestingly, in all the models studied, pituitary GOAT expression paralleled changes in the expression of a dominant spliced-variant of ghrelin (In2-ghrelin) and therefore this transcript may be a primary substrate for pituitary GOAT. Collectively, these observations support the notion that the GI tract is not the only source of acylated-ghrelin, but in fact locally produced des-acylated-ghrelin could be converted to acylated-ghrelin within target tissues by locally active GOAT, to mediate its tissue-speciﬁc effects. © 2010 Elsevier Ireland Ltd. All rights reserved.

1. Introduction mature 28-amino acid peptide ghrelin (Garg, 2007). Only a small proportion of circulating ghrelin is acylated, while the remaining is The primary source of circulating ghrelin is the stomach, where in the unmodified or des-acylated form, where both forms have bio- proghrelin can be modified by the addition of an O-linked octanoyl logical effects (van der Lely et al., 2004; Kojima and Kangawa, 2005). side group added to its serine-3 residue, via the actions of ghrelin Acylated-ghrelin is the primary endogenous ligand for the growth O-acyltransferase (GOAT) to produce acylated-proghrelin (Kojima hormone secretagogue receptor (GHS-R), and it is now recognized et al., 1999; Ariyasu et al., 2001; Garg, 2007; Gonzalez et al., 2008; that the acyl-ghrelin/GHS-R system exerts actions on multiple tis- Gutierrez et al., 2008; Yang et al., 2008; Gomez et al., 2009; Sakata sues, many of them related to regulation of metabolic functions et al., 2009). Then, prohormone convertase 1/3 (PC1/3) can fur- (for review, van der Lely et al., 2004). In particular, acylated-ghrelin ther process proghrelin (acylated or des-acylated) to generate the works at the level of the hypothalamus as a potent orexigenic signal (Kojima and Kangawa, 2005), and at the level of the pituitary to modulate hormone release including augmentation of growth hormone (GH), adrenocorticotropin (ACTH) and prolactin release ∗ Corresponding author at: Department of Cell Biology, Physiology and Immunol- (Kojima and Kangawa, 2005; Gahete et al., 2009). In addition, ogy, Campus Universitario de Rabanales, Edificio Severo Ochoa (C6), Planta acylated-ghrelin acts systemically to regulate glucose homeosta- 3, University of Córdoba, E-14014 Córdoba, Spain. Tel.: +34 957 21 85 94; fax: +34 957 21 86 34. sis and adiposity, where the deletion of the genes encoding ghrelin E-mail address: [email protected] (R.M. Luque). or its receptor prevents diet-induced obesity, improves insulin sen-

0303-7207/$ – see front matter © 2010 Elsevier Ireland Ltd. All rights reserved. doi:10.1016/j.mce.2009.12.023 M.D. Gahete et al. / Molecular and Cellular Endocrinology 317 (2010) 154–160 155 sitivity and enhances glucose-stimulated insulin secretion (Yada et delivering a total of 15.6 ␮g of leptin each day) or from a group of ob/ob mice pair- al., 2008). fed along with the leptin-treated animals that was used as an additional control Although the GI track is considered the major source of acylated- (control 2) to match the food intake of leptin-treated mice (Luque and Kineman, 2006; Luque et al., 2007a) in order to differentiate between direct effects of leptin ghrelin, other tissues express ghrelin, PC1/3 and GOAT (Gonzalez and those mediated indirectly by leptin-induced reduction in food intake and weight et al., 2008; Gutierrez et al., 2008; Yang et al., 2008) (for review, loss. van der Lely et al., 2004). Therefore, it is possible that locally produced non-acylated-proghrelin might be converted to acylated- 2.3. Direct regulation of GOAT mRNA levels by acylated-ghrelin, desacyl-ghrelin, proghrelin within target tissues by locally active GOAT, to mediate GHRH, SST, leptin, NPY, insulin and IGF-I in mouse primary pituitary cell cultures tissue-specific effects. Local production of acyl-ghrelin is supported To examine whether primary regulatory hormones for the pituitary-metabolic by a recent report demonstrating that acylated-ghrelin can be interface can directly control pituitary GOAT expression, pituitaries of 8–12- produced by a thyroid and a pituitary cell line that express ghre- week-old male C57Bl6 mice obtained from “Centro de Instrumentación Científica” lin, PC1/3 and GOAT if n-octanoic acid is available as a substrate (University of Granada, Spain) or from Jackson Laboratories (Bar Harbor, ME, USA) were enzymatically dispersed (n = 3–5 pituitaries pooled/experiment, 6–7 sepa- (Takahashi et al., 2009). Given the fact that hypothalamus and pitu- rate experiments) into single cells and cultured (250,000 cells/well, 24-well plates) itary are targets for acylated-ghrelin, coupled with the fact that in serum containing ␣-MEM, as previously described (Luque et al., 2006; Luque these tissues also express ghrelin (for review, van der Lely et al., and Kineman, 2006). After 24–48 h of culture, media was removed and wells were 2004), GOAT (Gonzalez et al., 2008; Gutierrez et al., 2008; Yang washed in serum-free media and subsequently treated with mouse acylated-ghrelin, et al., 2008) and PC1/3 (Dong and Day, 2002; Nillni, 2007), it is desacyl-ghrelin, GHRH, NPY, insulin, IGF-I (10 nM each), SST-14 (100 nM) and mouse leptin (10 ng/ml), for 24 h (Sigma, Saint Louis, MO or Phoenix, Burlingame, CA, USA), possible that local production of acylated-ghrelin, as well as that and then total cellular RNA was extracted for determination of GOAT mRNA lev- produced by the GI tract, may play an important role in regu- els by qrtRT-PCR (see below). In order to determine if the direct actions of GHRH, lating this neuroendocrine axis in response to metabolic signals. SST, NPY or leptin could be important in maintaining in vivo expression of pitu- Therefore, the goals of the current study were (1) to determine itary GOAT, total RNA obtained from pituitaries of 9–11-week-old GHRH-knockout whether GOAT expression in the stomach correlates with circulat- (KO) (B6129PF1/J), SST-KO mice (C57Bl/6J), NPY-KO mice (129/sv), leptin-KO (ob/ob; C57Bl/6J) and their respective littermate controls used in other studies (Alba and ing acylated-ghrelin levels in mice under conditions of metabolic Salvatori, 2004; Park et al., 2005; Luque et al., 2006, 2007b,c; Luque and Kineman, stress (i.e., fasting, and obese mouse models), (2) to confirm if 2006, 2007), were also evaluated from GOAT mRNA levels by qrtRT-PCR. GOAT is expressed within the hypothalamus and pituitary and if expression levels are mediated by metabolic stress and (3) to 2.4. RNA isolation and reverse transcription (RT) determine whether primary regulatory factors for the pituitary- Tissues and cell cultures were processed for recovery of total RNA using the metabolic interface can directly regulate GOAT expression, by using Absolutely RNA RT-PCR Miniprep Kit with Deoxyribonuclease treatment (Strata- primary mouse pituitary cell cultures as a model system. gene, La Jolla, CA) as previously described (Luque et al., 2006, 2007c; Luque and Kineman, 2006, 2007). The amount of RNA recovered was determined using the 2. Material and methods Ribogreen RNA quantification kit (Molecular Probes, Eugene, OR). Total RNA (1 ␮g for whole tissue extract and 0.25 ␮g for primary cell cultures) was reversed tran- 2.1. Animals and cell culture scribed with enzyme and buffers supplied in the cDNA First Strand Synthesis kit (MRI Fermentas, Hanover, MD). cDNA was treated with ribonuclease H (1 U; MRI All experimental procedures were approved by the Animal Care and Use Com- Fermentas) and duplicate aliquots (1 ␮l) were amplified by qrtRT-PCR, in which mittees of the University of Cordoba, University of Illinois at Chicago and the Jesse samples were run against synthetic standards to estimate mRNA copy number, as Brown VA Medical Center. Mice were housed under standard conditions of light described below. (12-h light, 12-h dark cycle; lights on at 07:00 h) and temperature (22–24 ◦C), with free access to tap water and food (standard rodent chow; LabDiet, St. Louis, 2.5. Quantification of GOAT and ghrelin mRNA levels by qrtRT-PCR MO, USA; Catalog no. 5008; fat, 17 kcal%, carbohydrate, 56 kcal%; protein, 27 kcal%). Leptin-deficient ob/ob mice and their corresponding controls were purchased from Details regarding the development, validation, and application of a qrtRT-PCR to Jackson Laboratories, while growth-hormone-releasing hormone (GHRH), somato- measure expression levels of mouse transcripts, including ghrelin mRNA levels, have statin (SST) and neuropeptide Y (NPY) knockout mice were bred in house. Original been reported previously (Luque et al., 2006, 2007a,c; Luque and Kineman, 2006, breeders were obtained from Dr. Ute Hochgeschwender (SST-KO), Dr. Richard D. 2007; Kineman et al., 2007). Specific primer sequences, GenBank accession numbers Palmiter (NPY-KO) and Dr. Roberto Salvatori (GHRH-KO) as previously reported and product sizes for mouse GOAT, ghrelin and cyclophilin used in this study were (Alba and Salvatori, 2004; Park et al., 2005; Luque et al., 2006, 2007b,c; Luque and as follows: GOAT (Mboat4; forward 5-ATTTGTGAAGGGAAGGTGGAG-3 and reverse Kineman, 2006, 2007). Mice were handled daily at least 1 week prior to euthanasia to 5-CAGGAGAGCAGGGAAAAAGAG-3,NM001126314, 120 bp); ghrelin (forward acclimate them to personnel and handling procedures and were sacrificed by decap- 5-TCCAAGAAGCCACCAGCTAA-3 and reverse 5-AACATCGAAGGGAGCATTGA-3, itation, without anesthesia, under fed conditions unless otherwise specified. Trunk NM 021488, 126 bp) and cyclophilin (forward 5-TGGTCTTTGGGAAGGTGAAAG-3 blood was immediately mixed with MiniProtease inhibitor (Roche, Nutley, NJ) and and reverse 5-TGTCCACAGTCGGAAATGGT-3,NM008907, 109 bp). Primers were ◦ placed on ice, centrifuged and plasma was stored at −80 C until analysis of total- selected using Primer 3 software (Rozen and Skaletsky, 2000) with selection param- and acylated-ghrelin by ELISA (Linco, St. Charles, MO) following the manufacturer’s eters set to identify primer sets that: (1) span an intron (when possible), (2) differ instructions, including the addition of hydrochloric acid at a final concentration of by no more that 1 ◦C in annealing temperature, (3) are at least 20 bp in length, (4) 0.05N in order to prevent rapid des-acylation of ghrelin after the plasma collection. have a GC content between 45 and 55%, but (5) exclude primers that may form Tissues (stomachs, pituitaries and hypothalami) were immediately frozen in liquid primer-dimers. Sequences of selected primers were used in BLAST (NCBI) searches ◦ nitrogen and stored at −80 C until further analysis of mRNA levels by quantitative to check for potential homology to sequences other than the designated target. Initial real-time RT-PCR (qrtRT-PCR; see below). screening of primer efficiency using real-time detection was performed by amplifying 2-fold dilutions of RT products, where optimal efficiency was demonstrated 2.2. Influence of metabolic stress on circulating total and acylated-ghrelin and by a difference of one cycle threshold between dilutions and a clear melting peak stomach, pituitary and hypothalamic GOAT mRNA levels followed by a graded temperature-dependent dissociation to verify that only one product was amplified. The thermocycling profile consisted of one cycle of 95 ◦C for For these studies, serum and tissues previously processed and analyzed for other 10 min, 40 cycles of 95 ◦C for 30 s, 61 ◦C for 1 min, and 72 ◦C for 30 s. PCR products endpoints were used, where each study is listed below followed by a brief summary were then column-purified (QIAGEN, Valencia, CA) and sequenced to confirm target of the experimental design. Fasting – Ten-week-old male C57Bl/6J mice were either specificity. After confirmation of primer efficiency and specificity, the concentration fed ad libitum or fasted for 12 h (food removed at 19:00 h), 24 h or 48 h (food removed of purified products was determined using Molecular Probe’s Picogreen DNA quan- at 07:00 h) (Luque et al., 2007c). An additional group of 8–9-week-old male C57Bl/6 tification kit, and PCR products were serial diluted to obtain standards containing x FVBN mice (n = 5/group) were also fed ad libitum or fasted for 24 h (Kineman et 1, 101,102,103,104,105, and 106 copies of synthetic template. Standards were then al., 2007). For these and subsequent studies all tissues and blood were collected amplified by real-time PCR, and standard curves were generated using Stratagene between 07:00 and 09:00 h. Diet-induced obesity (DIO) – Male C57Bl/6J mice (n = 6–7) Mx3000p software. The slope of a standard curve for each template examined was were fed a low-fat (LFD; 10 kcal% from fat) or a high-fat (HFD; 60 kcal% from fat) diet approximately −3.33 (R2 ≈ 1), indicating that the efficiency of amplification of our starting at 4 weeks of age and killed at 20 weeks (Luque and Kineman, 2006). Leptin- primers was 100%, meaning that all templates in each cycle were copied. To deter- deficient mice (ob/ob) – Blood and tissues were analyzed from 10-week-old ob/ob mine the starting copy number of cDNA, RT samples were PCR amplified and the mice and their littermates-controls (ob/?), as well as from ob/ob mice treated with signal was compared with that of a specific standard curve of each transcript run on vehicle (control 1), leptin (7 d via osmotic mini-pumps released at a rate of 0.5 ␮l/h, the same plate. In addition, total RNA samples that were not reversed transcribed and 156 M.D. Gahete et al. / Molecular and Cellular Endocrinology 317 (2010) 154–160 a no DNA control were run on each plate to control for genomic DNA contamination model systems (Kineman et al., 2007; Luque et al., 2007a,c). These and to monitor potential exogenous contamination, respectively. Also, to control for results are summarized in Fig. 1 as the relative changes in ghrelin variations in the amount of RNA used in the RT reaction and the efficiency of the mRNA levels (=, ↑, ↓), as compared to controls, as shown below each RT reaction, mRNA copy number of the transcript of interest was adjusted by the mRNA copy number of cyclophilin A (used as housekeeping gene), where cyclophilin graph of tissue-specific GOAT expression. A mRNA levels did not significantly vary between experimental groups, within tissue type or treatment group (data not shown). 3.2. Effects of nutrient deprivation on GOAT/ghrelin axis

2.6. Data presentation and statistical analysis As shown in Fig. 1, panel A, fasting did not alter circulat-

Samples from all groups within an experiment were processed at the same time. ing levels of total-ghrelin or stomach ghrelin expression, but did The effects of fasting and leptin replacement were assessed by one-way ANOVA increase circulating acylated-ghrelin (12 and 24 h) and stomach followed by a Newman–Keuls test for multiple comparisons, while the effects of GOAT mRNA levels (24 h). The impact of 24 h fasting on stomach obesity, genotype and the in vitro effects of acylated-ghrelin, desacyl-ghrelin, GHRH, GOAT mRNA levels was confirmed in tissues taken from an inde- SST, NPY, leptin, insulin and IGF-I were assessed by Student’s t-test. p < 0.05 was pendent set of male mice from another study (Kineman et al., 2007), considered significant. All data are expressed as means ± SEM. The in vivo effects of fasting/obesity/genotype were obtained from a minimum of 5 animals per group. using two different primer sets for amplification of the GOAT tran- Results from in vitro studies were obtained from 3 to 7 separate, independent exper- scripts (supplemental Fig. 1). These results differ from those of a iments (3–5 wells/treatment) carried out in different days and with different cells recent report by Kirchner et al. (2009) showing that fasting (12, preparation. Endpoints displaying heterogeneity of variance were log transformed 24 and 36 h) significantly increased total-ghrelin levels and tended prior to analysis. All statistical analyses were performed using the GB-STAT software to increase acylated-ghrelin levels, but unexpectedly suppressed package (Dynamic Microsystems, Inc., Silver Spring, MD, USA). stomach GOAT mRNA in C57Bl/6 male mice. It is possible that such differences may be related to the time of food withdrawal, time of 3. Results and discussion sample collection, type of standard rodent chow provided and/or the method of euthanasia which were not clearly defined in that 3.1. Quantification of GOAT mRNA levels in mouse stomachs, study. In fact, Kirchner et al. (2009) observed a diurnal pattern of pituitaries and hypothalami circulating ghrelin and stomach ghrelin/GOAT mRNA levels, as well as an association between stomach GOAT expression and the type Using qrtRT-PCR, we found that GOAT mRNA levels were 5- of dietary lipids supplied. It is also possible that the differences fold greater in the stomach as compared to the pituitary and observed are related to the analytical techniques applied, where hypothalamus (Table 1). These results are consistent with other circulating ghrelin levels were assessed by commercial assays in reports showing relative expression levels of GOAT in both human the current study, but in the case of Kirchner et al. (2009), were (Gutierrez et al., 2008) and rodent (Gonzalez et al., 2008; Yang et assessed by MALDI-TOF mass spectrometry of immunoprecipitated al., 2008; Sakata et al., 2009) tissues. Interestingly, the expression ghrelin. Finally, with respect to GOAT mRNA levels, although both level of GOAT transcripts in the mouse tissues analyzed in the cur- the current study and that of Kirchner et al. (2009) used real-time rent study (Table 1) paralleled the mRNA levels of ghrelin in the RT-PCR, the primer sets used and the characteristics and prop- same tissues (stomach pituitary = hypothalamus), as previously erties of the primers were not the same (length of primers, GC reported (Kineman et al., 2007). content, etc.). Nonetheless, our current observations are consis- Since it has been previously reported that the enzyme PC1/3 tent with other reports showing a clear rise in acylated-ghrelin which is required for the conversion of preprohormones, including levels in fasted humans and other species (for review: Casanueva pre-proghrelin to its 28 amino acid form, is also expressed in the and Dieguez, 2002; Gottero et al., 2004; Kojima and Kangawa, pituitary and hypothalamus (Dong and Day, 2002; Nillni, 2007), 2005; Williams and Cummings, 2005; Cummings, 2006), includ- as well as the GI tract (Macro et al., 1996), it is possible that the ing mice (Perreault et al., 2004; Luque et al., 2006, 2007c; Zizzari source of acylated-ghrelin within the pituitary and hypothalamus et al., 2007), as well as an increase in stomach GOAT mRNA lev- may include locally produced ghrelin, in addition to that found in els in rats subjected to 21 days of caloric-restriction (Gonzalez et the circulation. Therefore, the current study compared the impact al., 2008). However, it should be noted that like Kirchner et al., of metabolic stress (fasting and obesity) on circulating ghrelin (acy- Liu et al. failed to detect a rise in circulating acylated-ghrelin in lated and total) levels, as well as GOAT and ghrelin mRNA levels in fasted humans (Liu et al., 2008). It should also be emphasized that the stomach, pituitary and hypothalamus. Specifically, Fig. 1 illus- in the current study the fasting-induced rise in acylated-ghrelin trates the impact of fasting, diet-induced obesity (DIO) and obesity was observed at 12 and 24 h, but began to fall after 48 h, while caused by leptin deficiency (ob/ob mice) on circulating acylated- the fasting-induced rise in GOAT mRNA was only observed at 24 h. and total-ghrelin levels and stomach GOAT mRNA levels (panels A, These results suggest that an increase in GOAT expression levels B and C, respectively), as well as pituitary and hypothalamic GOAT in the stomach may only in part contribute to the rise in circulat- mRNA levels (panels D, E and F, respectively). It should be noted ing acyl-ghrelin, where enhanced GOAT activity and/or substrate that, in some cases we have previously published the regulation of availability may precede that process. However, after 48 h of fast- stomach, pituitary and hypothalamic ghrelin mRNA levels in these ing circulating acylated-ghrelin levels and GOAT mRNA levels did not differ from controls (Fig. 1, panel A), where 48 h of fasting in Table 1 a mouse represent a severe catabolic state (Luque et al., 2007c). Absolute cDNA copy number/0.05 ␮g total RNA of GOAT gene transcripts in the This observation is consistent with reports showing that the pro- stomach, pituitary and hypothalamus of male C57Bl/6 mice, as determined by quan- portion of circulating acylated-ghrelin falls after long-term fasting titative real-time RT-PCR. in humans (61.5 h-fasting) (Liu et al., 2008) and rats (48 h-fasting) GOAT mRNA copy # (Toshinai et al., 2001; Gonzalez et al., 2008) and with the recent Whole tissue: observation indicating that 48 h of fasting did not significantly alter Stomach 357 ± 46 stomach GOAT mRNA expression in rats (Gonzalez et al., 2008; Pituitary 67 ± 8 Takahashi et al., 2009). Taken together our current results sug- Hypothalamus 73 ± 5 gest that changes in stomach GOAT expression may contribute Primary pituitary cell culture: 63 ± 2 in part to fasting-induced changes in circulating acylated-ghrelin Values represent means ± SEM (n = 27–43 control tissues or control culture- levels, a hypothesis previously put forth by other laboratories wells/experimental or treatment group). (Gonzalez et al., 2008; Gualillo et al., 2008). However, given the M.D. Gahete et al. / Molecular and Cellular Endocrinology 317 (2010) 154–160 157

Fig. 1. Circulating total- and acylated-ghrelin and stomach, hypothalamus and pituitary GOAT mRNA levels in: mice fed ad libitum or fasted for 12-, 24-, and 48-h (panels A and D), mice fed a low-fat diet (LFD control group) or high-fat diet (HFD obese group) (panels B and E) and lean controls (/?) and obese (ob/ob) mice (panels C and F). Values are shown as mean ± SEM (n = 5–8 mice/group) and expressed as percent of the respective control group (set at 100%). Group means that do not share a common letter (a and b) significantly differ (p < 0.05; panels A and D). Asterisks (*p < 0.05, **p < 0.01) indicate values that significantly differ from lean control LFD or /? values. The tissue-specific regulation of ghrelin mRNA levels in these mice models as previously reported (Kineman et al., 2007; Luque et al., 2007a,c) are shown below each graph of tissue-specific GOAT expression and are provided as the relative changes (=, ↑, ↓) as compared to controls.

only other report examining this relationship in mice gave dif- 3.3. Effects of obesity on GOAT/ghrelin axis ferent results (Kirchner et al., 2009), and the fact that there are many potential levels of GOAT regulation (transcriptional, trans- As shown in Fig. 1, panel B, diet-induced obesity tended (50% lational, enzyme activity level, substrate availability), it will be reduction, p = 0.13) to suppress total-ghrelin levels in mice with- important for other laboratories to validate and confirm these find- out altering acylated-ghrelin levels, consistent with a significant ings. decline in stomach ghrelin expression, while GOAT mRNA levels 158 M.D. Gahete et al. / Molecular and Cellular Endocrinology 317 (2010) 154–160 remained unchanged. In contrast, obesity as a result of leptin deficiency (ob/ob mice; Fig. 1, panel C) led to a significant decline in circulating acylated-ghrelin levels (and a downward trend in total-ghrelin levels), changes which were accompanied by a significant decrease in stomach ghrelin but not GOAT mRNA levels, similar to DIO mice. This is the first report to explore the impact of DIO on stomach GOAT and ghrelin expression, while a previous study showed similar results for stomach GOAT and ghrelin mRNA levels in ob/ob mice (Kirchner et al., 2009). In addition, others have reported a significant decline in total- or desacyl- ghrelin in DIO (Ueno et al., 2007) and obese Ay (Nonogaki et al., 2006) mice and a reduction in total- and acylated-ghrelin levels in obese humans (Casanueva and Dieguez, 2002; Gottero et al., 2004; Ghigo et al., 2005; Kojima and Kangawa, 2005), where DIO-induced alterations in acylated-ghrelin levels may be dependent on the time of day sampled (Perreault et al., 2004). Taken together these results indicate that the decline in circulating total- ghrelin levels in the obese state could be in part due to a decline in stomach ghrelin gene expression, however alterations in circulating acylated-ghrelin may be related to factors independent of GOAT expression, such as the rate of degradation of acylated- ghrelin, GOAT enzyme activity levels or substrate (ghrelin or fatty acid) availability.

3.4. Impact of metabolic stress (fasting and obesity) on hypothalamic and pituitary GOAT expression

As shown in Fig. 1, panel D, fasting also enhanced expression of GOAT at both the hypothalamic [at 48 h (p = 0.0016)] and pituitary [24 h (p = 0.017) and 12 h (p = 0.051)] level. Interestingly, it should be noted that the timing of the GOAT mRNA rise was different from that observed in the stomach (Fig. 1, panel A). Conversely, DIO (Fig. 1, panel E) and obesity caused by leptin deficiency (Fig. 1, panel F) did not alter hypothalamic GOAT expression, but did result in a significant decline in pituitary GOAT mRNA levels. As in the stomach, hypothalamic and pituitary GOAT expression did not always parallel local changes in ghrelin expression. Taken together, these Fig. 2. Top panel: Effect of 24-h treatment with acylated-ghrelin, growth-hormone- releasing hormone (GHRH), somatostatin (SST), neuropeptide Y (NPY), leptin, insulin results suggest that local production (ghrelin gene expression) and IGF-I on GOAT mRNA levels in mouse primary pituitary cell cultures. Data repre- and/or modification (via GOAT gene expression) of ghrelin may sent the mean ± SEM (n = 3–7 experiment performed in different cell preparations; contribute to the regulation of hypothalamic and pituitary function 3–4 wells/treatment). Bottom panel: GOAT mRNA expression levels in pituitaries of independent of circulating ghrelin levels produced by the stomach growth-hormone-releasing hormone knockout (GHRH-KO), somatostatin knockout (SST-KO), neuropeptide Y knockout (NPY-KO) and ob/ob (leptin deficient) mice. Val- which would be supported by a recent study indicating that var- ues are shown as mean ± SEM and expressed as percent of intact control mice (set ious cell lines, including the mouse pituitary cell line AtT20, can at 100%; n = 5–9 mice/group). Asterisks (*p < 0.05, **p < 0.01, ***p < 0.001) indicate produce acylated-ghrelin when both ghrelin and GOAT are present values that significantly differ from respective controls (shown by the dotted line in the cells and when substrate (fatty acid) is available in the culture set at 100%). medium (Takahashi et al., 2009). up-regulated in fasting (Henry et al., 2001; Park et al., 2005; Luque 3.5. Direct regulation of GOAT mRNA levels by ghrelin, et al., 2006, 2007c; Kirchner et al., 2009) and down-regulated in desacyl-ghrelin, GHRH, SST, leptin, NPY, insulin and IGF-I in obesity (Tannenbaum et al., 1990; Ahmad et al., 1993; Maccario et mouse primary pituitary cell cultures al., 1999; Lin et al., 2000; Perreault et al., 2004; Luque and Kineman, 2006; Nonogaki et al., 2006; Luque et al., 2007a) while those for Given the dynamic changes in pituitary GOAT expression in SST, leptin, insulin and IGF-I are down-regulated in fasting (Henry both fasting (up-regulation; Fig. 1, panel D) and obesity (down- et al., 2001; Frystyk, 2004; Park et al., 2005; Luque et al., 2006; regulation; Fig. 1, panels E and F), we used primary mouse pituitary Gonzalez et al., 2008) and up-regulated in obesity (Zhou et al., cell cultures as a model system to explore which central or sys- 1997; Frystyk, 2004; Luque and Kineman, 2006; Luque et al., 2007b, temic factors might mediate these changes. First, to confirm that 2008), we incubated primary pituitary cell cultures with these hor- mouse primary pituitary cells maintain differentiated function (i.e. mones for 24 h and measured the impact on GOAT mRNA levels. As GOAT expression) after dispersion and culture, the absolute mRNA shown in Fig. 2, top panel, acylated-ghrelin clearly stimulated GOAT levels (copy numbers/0.05 ␮g total RNA) of GOAT were compared expression compared to vehicle-treated controls (set at 100%). In between whole tissue extracts and extracts prepared from pitu- order to confirm that this effect on GOAT mRNA levels was directly itary cultures 24 h after incubation in serum-free media, and the exerted by acylated-ghrelin and not by desacyl-ghrelin (as result of results are shown in Table 1. Transcript levels did not significantly a des-octanoylation of acylated-ghrelin in the pituitary cell cultures vary between in vivo and in vitro samples, indicating that the cell after 24 h of incubation), pituitary cell cultures were treated with preparation and culture conditions were appropriate to maintain desacyl-ghrelin for 24 h. The results clearly indicate that treatment GOAT expression. Based on reports from our laboratory and others with desacyl-ghrelin did not alter GOAT mRNA levels. In addition, showing that the levels and/or actions of ghrelin, GHRH and NPY are as shown in Fig. 2 (top panel), GHRH and leptin stimulated and M.D. Gahete et al. / Molecular and Cellular Endocrinology 317 (2010) 154–160 159

Table 2 the pituitary to ghrelin and GHRH actions, might initiate local pro- Relative effect of metabolic condition (fasting, obesity) or inactivating mutations in duction of acylated-ghrelin by augmentation of ghrelin and GOAT growth-hormone-releasing hormone (GHRH), somatostatin (SST) or leptin genes on pituitary GOAT, ghrelin and In2-ghrelin variant mRNA levels, as determined expression, thereby acting as a positive ultrashort feedback loop by quantitative real-time RT-PCR. This summary represents data presented in the to enhance or facilitate GH release. In contrast, GH output is sup- current report, combined with previously published reports (Kineman et al., 2007; pressed in obesity, an effect which is believed to be due in part to Luque et al., 2007a,c). enhanced SST tone (for review see Luque et al., 2008) and a decline GOAT mRNA Native ghrelin In2-ghrelin in pituitary of GHRH-R, GHS-R and GH (Luque and Kineman, 2006; Luque et al., 2008). In this context, our data would support the idea Fasting 24 h ↑↑ ↑ Diet-induced obese ↓ No change ↓ that part of the negative effects of SST on somatotrope function GHRH-KO ↓ No change ↓ could include direct suppression of GOAT expression and a decline SST-KO ↑↑ ↑a of locally produced acylated-ghrelin, further contributing to the ↓↓ ↓ Leptin-KO (ob/ob) decline in GH release observed with weight gain. a Differences observed only in females. In summary, we report herein a series of novel analyses on the regulation of the mouse GOAT/ghrelin system at the SST inhibited pituitary GOAT expression, while NPY, insulin and circulating-stomach–pituitary-hypothalamic levels by energy sta- IGF-I had no effect, compared to vehicle-treated controls (set at tus and relevant metabolic cues in the mouse. By applying a 100%). In order to determine if these direct actions might also be combination of studies involving in vivo models (fasting, obesity important in maintaining pituitary GOAT expression in vivo,we and knockout mice) and primary pituitary cell cultures, our results examined pituitary expression of GOAT in available mouse mod- further characterize the impact of changes in body energy stores on els that lack GHRH, SST, NPY and leptin. Accordingly, we found the expression of GOAT in different tissues and define the role of an opposite effect of GHRH-KO, SST-KO and leptin-KO on pituitary key regulators, such as acylated-ghrelin itself, GHRH, SST and lep- GOAT expression, as compared to that observed after in vitro treat- tin on the control of GOAT expression in the mouse. The fact that ment with the corresponding hormone (Fig. 2, bottom panel). It is GOAT mRNA levels are oppositely regulated in extreme metabolic also interesting to note that when the impact of leptin replacement states (fasting, DIO) and its regulation is tissue-dependent suggests was examined in the ob/ob model (Luque et al., 2007a), we observed that this enzyme may be of biological relevance in coordinating that pituitary and stomach GOAT mRNA levels were greater than the neuroendocrine response to metabolic stress. Although much that observed in pair-fed controls (supplemental Fig. 2), which is work remains to be done to fully understand how GOAT fits into the consistent with the report of Gonzalez et al. (2008) showing that control of energy homeostasis, our results reinforce the contention administration of exogenous leptin markedly increased expression that GOAT/acylated-ghrelin system could operate as a novel molec- levels of GOAT in the stomach of fasted rats. Taken together these ular conduit for the integration of energy balance, metabolism and results indicate that acylated-ghrelin may in fact regulate its own pituitary function. production at the level of the pituitary by increasing the expression of GOAT. In addition, these results clearly demonstrate that GHRH, Acknowledgements SST and leptin are key regulators of pituitary GOAT expression, an observation which may in part explain changes in pituitary GOAT The authors would like to thank Dr. Ute Hochgeschwender expression observed in response to metabolic extremes. Intrigu- (Oklahoma Medical Research Foundation, Oklahoma City, OK) for ingly, the substrate of GOAT activity in the mouse pituitary may not the SST knockout mice, Dr. Richard D. Palmiter (Howard Hughes be limited to native ghrelin being locally produced within the pitu- Medical Institute, University of Washington, Seattle, WA) for the itary, because our laboratory has identified a spliced mRNA ghrelin NPY knockout. variant containing exon2, intron2 and exon3, but lacking exon1, 4 Funding: This work is supported in part by grants from Pro- and 5 (In2-ghrelin variant; Kineman et al., 2007) which is expressed grama Nacional de becas de FPU (FPU-AP20052473, to MDG) and at higher levels than the native ghrelin transcript in the pituitary Programa Ramon y Cajal del Ministerio de Educación y Ciencia, (139 ± 24 copies for In2-ghrelin variant versus 18 ± 3 copies for Spain (RYC-2007-00186, to RML); Ayudas predoctorales de forma- native ghrelin/0.05 ␮g RNA). If this variant is translated, it would cion en investigacion en salud del Fondo de Investigación sanitaria encode a protein that would include the first 36 amino acid of the del Instituto de Salud Carlos III (FI06/00804; to JCC) and by grants pre-proghrelin, where residues 24–28 represent the first five amino from Junta de Andalucía BIO-0139 and CTS-01705 and Ministerio acids of mature ghrelin and thus contain the Ser-3 acylation site. It is de Ciencia e Innovacion/FEDER BFU2007-60180/BFI, BFU2008- interesting to note that when we compared the impact of metabolic 01136/BFISpain, and NIDDK 30677 and the Department of Veterans stress (fasting and DIO) or GHRH, SST and leptin deficiency on pitu- Affairs, Veterans Health Administration, Office of Research and itary expression of GOAT, native ghrelin and In2-ghrelin, the levels Development Merit Award (to RDK). CIBER is an initiative of Insti- of GOAT expression paralleled those of In2-ghrelin variant but not tuto de Salud Carlos III (Ministerio de Sanidad, Ministerio de Ciencia native ghrelin, in all cases (summarized in Table 2, and details e Innovación, Spain). presented in supplemental Fig. 3). Based on these observations it seems reasonable to propose that the In2-ghrelin variant could be Appendix A. Supplementary data a primary substrate for GOAT in the anterior pituitary gland. Although more experiments are required to fully elucidate Supplementary data associated with this article can be found, in the physiologic significance of our findings in the pituitary, our the online version, at doi:10.1016/j.mce.2009.12.023. data give credence to the possibility that local production and/or modification of ghrelin (des-acylated to acylated via GOAT gene expression) may contribute to the fine regulation of pituitary func- References tion in response to metabolic stress. For example, circulating GH Ahmad, I., Finkelstein, J.A., Downs, T.R., Frohman, L.A., 1993. Obesity-associated levels are known to rise in response to fasting in the mouse, and decrease in growth hormone-releasing hormone gene expression: a mecha- this is associated with an increase in pituitary expression of GH, nism for reduced growth hormone mRNA levels in genetically obese Zucker GHRH-R and GHS-R and a decline in SST receptor expression (rat rats. Neuroendocrinology 58 (3), 332–337. Alba, M., Salvatori, R., 2004. A mouse with targeted ablation of the growth hormone- and mouse; Luque et al., 2007a, 2008). The acute rise in systemic releasing hormone gene: a new model of isolated growth hormone deficiency. acylated-ghrelin, in combination with an increased sensitivity of Endocrinology 145 (9), 4134–4143. 160 M.D. Gahete et al. / Molecular and Cellular Endocrinology 317 (2010) 154–160

Ariyasu, H., Takaya, K., Tagami, T., Ogawa, Y., Hosoda, K., Akamizu, T., Suda, M., Koh, Luque, R.M., Kineman, R.D., 2007. Gender-dependent role of endogenous somato- T., Natsui, K., Toyooka, S., Shirakami, G., Usui, T., Shimatsu, A., Doi, K., Hosoda, H., statin in regulating growth hormone-axis function in mice. Endocrinology 148 Kojima, M., Kangawa, K., Nakao, K., 2001. Stomach is a major source of circulat- (12), 5998–6006. ing ghrelin, and feeding state determines plasma ghrelin-like immunoreactivity Luque, R.M., Kineman, R.D., Tena-Sempere, M., 2007b. Regulation of hypothalamic levels in humans. J. Clin. Endocrinol. Metab. 86 (10), 4753–4758. expression of KiSS-1 and GPR54 genes by metabolic factors: analyses using Casanueva, F.F., Dieguez, C., 2002. Ghrelin: the link connecting growth with mouse models and a cell line. Endocrinology 148 (10), 4601–4611. metabolism and energy homeostasis. Rev. Endocr. Metab. Disord. 3 (4), 325–338. Luque, R.M., Park, S., Kineman, R.D., 2007c. Severity of the catabolic condition dif- Cummings, D.E., 2006. Ghrelin and the short- and long-term regulation of appetite ferentially modulates hypothalamic expression of growth hormone-releasing and body weight. Physiol. Behav. 89 (1), 71–84. hormone in the fasted mouse: potential role of neuropeptide Y and Dong, W., Day, R., 2002. Gene expression of proprotein convertases in individual corticotropin-releasing hormone. Endocrinology 148 (1), 300–309. rat anterior pituitary cells and their regulation in corticotrophs mediated by Luque, R.M., Park, S., Kineman, R.D., 2008. Role of endogenous somatostatin in regu- glucocorticoids. Endocrinology 143 (1), 254–262. lating GH output under basal conditions and in response to metabolic extremes. Frystyk, J., 2004. Free insulin-like growth factors—measurements and relationships Mol. Cell. Endocrinol. 286 (1–2), 155–168. to growth hormone secretion and glucose homeostasis. Growth Horm. IGF Res. Maccario, M., Gauna, C., Procopio, M., Di Vito, L., Rossetto, R., Oleandri, S.E., Grottoli, 14 (5), 337–375. S., Ganzaroli, C., Aimaretti, G., Ghigo, E., 1999. Assessment of GH/IGF-I axis in Gahete, M.D., Duran-Prado, M., Luque, R.M., Martinez-Fuentes, A.J., Quintero, A., obesity by evaluation of IGF-I levels and the GH response to GHRH + arginine Gutierrez-Pascual, E., Cordoba-Chacon, J., Malagon, M.M., Gracia-Navarro, F., test. J. Endocrinol. Invest. 22 (6), 424–429. Castano, J.P., 2009. Understanding the multifactorial control of growth hormone Macro, J.A., Dimaline, R., Dockray, G.J., 1996. Identification and expression of release by somatotropes: lessons from comparative endocrinology. Ann. N.Y. prohormone-converting enzymes in the rat stomach. Am. J. Physiol. 270 (1 Pt Acad. Sci. 1163, 137–153. 1), G87–G93. Garg, A., 2007. The ongoing saga of obestatin: is it a hormone? J. Clin. Endocrinol. Nillni, E.A., 2007. Regulation of prohormone convertases in hypothalamic neurons: Metab. 92 (9), 3396–3398. implications for prothyrotropin-releasing hormone and proopiomelanocortin. Ghigo, E., Broglio, F., Arvat, E., Maccario, M., Papotti, M., Muccioli, G., 2005. Ghre- Endocrinology 148 (9), 4191–4200. lin: more than a natural GH secretagogue and/or an orexigenic factor. Clin. Nonogaki, K., Nozue, K., Oka, Y., 2006. Hyperphagia alters expression of hypothala- Endocrinol. (Oxf.) 62 (1), 1–17. mic 5-HT2C and 5-HT1B receptor genes and plasma des-acyl ghrelin levels in Gomez, R., Lago, F., Gomez-Reino, J.J., Dieguez, C., Gualillo, O., 2009. Expression Ay mice. Endocrinology 147 (12), 5893–5900. and modulation of ghrelin O-acyltransferase in cultured chondrocytes. Arthritis Park, S., Peng, X.D., Frohman, L.A., Kineman, R.D., 2005. Expression analysis of Rheum. 60 (6), 1704–1709. hypothalamic and pituitary components of the growth hormone axis in fasted Gonzalez, C.R., Vazquez, M.J., Lopez, M., Dieguez, C., 2008. Influence of chronic and streptozotocin-treated neuropeptide Y (NPY)-intact (NPY+/+) and NPY- undernutrition and leptin on GOAT mRNA levels in rat stomach mucosa. J. Mol. knockout (NPY−/−) mice. Neuroendocrinology 81 (6), 360–371. Endocrinol. 41 (6), 415–421. Perreault, M., Istrate, N., Wang, L., Nichols, A.J., Tozzo, E., Stricker-Krongrad, A., 2004. Gottero, C., Broglio, F., Prodam, F., Destefanis, S., Bellone, S., Benso, A., Gauna, C., Arvat, Resistance to the orexigenic effect of ghrelin in dietary-induced obesity in mice: E., van der Lely, A.J., Ghigo, E., 2004. Ghrelin: a link between eating disorders, reversal upon weight loss. Int. J. Obes. Relat. Metab. Disord. 28 (7), 879–885. obesity and reproduction. Nutr. Neurosci. 7 (5–6), 255–270. Rozen, S., Skaletsky, H., 2000. Primer3 on the WWW for general users and for biol- Gualillo, O., Lago, F., Dieguez, C., 2008. Introducing GOAT: a target for obesity and ogist programmers. Methods Mol. Biol. 132, 365–386. anti-diabetic drugs? Trends Pharmacol. Sci. 29 (8), 398–401. Sakata, I., Yang, J., Lee, C., Osborne-Lawrence, S., Rovinsky, S., Elmquist, J.K., Zigman, J., Gutierrez, J.A., Solenberg, P.J., Perkins, D.R., Willency, J.A., Knierman, M.D., Jin, Z., 2009. Co-localization of ghrelin O-acyltransferase (GOAT) and ghrelin in gastric Witcher, D.R., Luo, S., Onyia, J.E., Hale, J.E., 2008. Ghrelin octanoylation mediated mucosal cells. Am. J. Physiol. Endocrinol. Metab. 297 (1), E134–E141. by an orphan lipid transferase. Proc. Natl. Acad. Sci. U.S.A. 105 (17), 6320–6325. Takahashi, T., Ida, T., Sato, T., Nakashima, Y., Nakamura, Y., Tsuji, A., Kojima, M., 2009. Henry, B.A., Rao, A., Tilbrook, A.J., Clarke, I.J., 2001. Chronic food-restriction alters Production of n-octanoyl-modified ghrelin in cultured cells requires prohor- the expression of somatostatin and growth hormone-releasing hormone in the mone processing protease and ghrelin O-acyltransferase, as well as n-octanoic ovariectomised ewe. J. Endocrinol. 170 (1), R1–R5. acid. J. Biochem.. Kineman, R.D., Gahete, M.D., Luque, R.M., 2007. Identification of a mouse ghre- Tannenbaum, G.S., Lapointe, M., Gurd, W., Finkelstein, J.A., 1990. Mechanisms of lin gene transcript that contains intron 2 and is regulated in the pituitary impaired growth hormone secretion in genetically obese Zucker rats: roles and hypothalamus in response to metabolic stress. J. Mol. Endocrinol. 38 (5), of growth hormone-releasing factor and somatostatin. Endocrinology 127 (6), 511–521. 3087–3095. Kirchner, H., Gutierrez, J.A., Solenberg, P.J., Pfluger, P.T., Czyzyk, T.A., Willency, J.A., Toshinai, K., Mondal, M.S., Nakazato, M., Date, Y., Murakami, N., Kojima, M., Kangawa, Schurmann, A., Joost, H.G., Jandacek, R.J., Hale, J.E., Heiman, M.L., Tschop, M.H., K., Matsukura, S., 2001. Upregulation of ghrelin expression in the stomach upon 2009. GOAT links dietary lipids with the endocrine control of energy balance. fasting, insulin-induced hypoglycemia, and leptin administration. Biochem. Bio- Nat. Med. 15 (7), 741–745. phys. Res. Commun. 281 (5), 1220–1225. Kojima, M., Hosoda, H., Date, Y., Nakazato, M., Matsuo, H., Kangawa, K., 1999. Ghre- Ueno, N., Asakawa, A., Inui, A., 2007. Blunted metabolic response to fasting in obese lin is a growth-hormone-releasing acylated peptide from stomach. Nature 402 mice. Endocrine 32 (2), 192–196. (6762), 656–660. van der Lely, A.J., Tschop, M., Heiman, M.L., Ghigo, E., 2004. Biological, physiological, Kojima, M., Kangawa, K., 2005. Ghrelin: structure and function. Physiol. Rev. 85 (2), pathophysiological, and pharmacological aspects of ghrelin. Endocr. Rev. 25 (3), 495–522. 426–457. Lin, S., Storlien, L.H., Huang, X.F., 2000. Leptin receptor, NPY, POMC mRNA expression Williams, D.L., Cummings, D.E., 2005. Regulation of ghrelin in physiologic and patho- in the diet-induced obese mouse brain. Brain Res. 875 (1–2), 89–95. physiologic states. J. Nutr. 135 (5), 1320–1325. Liu, J., Prudom, C.E., Nass, R., Pezzoli, S.S., Oliveri, M.C., Johnson, M.L., Veldhuis, P., Yada, T., Dezaki, K., Sone, H., Koizumi, M., Damdindorj, B., Nakata, M., Kakei, M., Gordon, D.A., Howard, A.D., Witcher, D.R., Geysen, H.M., Gaylinn, B.D., Thorner, 2008. Ghrelin regulates insulin release and glycemia: physiological role and M.O., 2008. Novel ghrelin assays provide evidence for independent regulation of therapeutic potential. Curr. Diab. Rev. 4 (1), 18–23. ghrelin acylation and secretion in healthy young men. J. Clin. Endocrinol. Metab. Yang, J., Brown, M.S., Liang, G., Grishin, N.V., Goldstein, J.L., 2008. Identification of 93 (5), 1980–1987. the acyltransferase that octanoylates ghrelin, an appetite-stimulating peptide Luque, R.M., Gahete, M.D., Hochgeschwender, U., Kineman, R.D., 2006. Evidence that hormone. Cell 132 (3), 387–396. endogenous SST inhibits ACTH and ghrelin expression by independent path- Zhou, X., De Schepper, J., Vergeylen, A., Luis, O., Delhase, M., Hooghe-Peters, E.L., ways. Am. J. Physiol. Endocrinol. Metab. 291 (2), E395–E403. 1997. Cafeteria diet-induced obese rats have an increased somatostatin protein Luque, R.M., Huang, Z.H., Shah, B., Mazzone, T., Kineman, R.D., 2007a. Effects of lep- content and gene expression in the periventricular nucleus. J. Endocrinol. Invest. tin replacement on hypothalamic-pituitary growth hormone axis function and 20 (5), 264–269. circulating ghrelin levels in ob/ob mice. Am. J. Physiol. Endocrinol. Metab. 292 Zizzari, P., Longchamps, R., Epelbaum, J., Bluet-Pajot, M.T., 2007. Obestatin partially (3), E891–E899. affects ghrelin stimulation of food intake and growth hormone secretion in Luque, R.M., Kineman, R.D., 2006. Impact of obesity on the growth hormone axis: rodents. Endocrinology 148 (4), 1648–1653. evidence for a direct inhibitory effect of hyperinsulinemia on pituitary function. Endocrinology 147 (6), 2754–2763.

ARTICLE III

Journal of Alzheimer’s Disease ISSN: 1387-2877 IOS Press DOI: 10.3233/JAD-2010-1385

Expression of Somatostatin, Cortistatin, and Their Receptors, as well as Dopamine

Receptors, but not of Neprilysin, are Reduced in the Temporal Lobe of Alzheimer’s

Disease Patients

Manuel D. Gahetea, Alicia Rubiob, Mario Durán-Pradoa, Jesús Avilab, Raúl M. Luquea and

Justo P. Castañoa

aDepartment of Cell Biology, Physiology and Immunology, University of Córdoba, and

Instituto Maimónides de Investigación Biomédica de Córdoba (IMIBIC), and CIBER

Fisiopatología de la Obesidad y Nutrición (CIBERobn), Córdoba, Spain

bCentro de Biología Molecular ‘‘Severo Ochoa’’, Consejo Superior de Investigaciones

Científicas/Universidad Autónoma de Madrid (CSIC/UAM), and CIBER Enfermedades

Neurodegenerativas (CIBERNED), Madrid, Spain

Running title: Somatostatin/dopamine system in Alzheimer disease.

Accepted 30 December 2009

Correspondence to: Dr. Justo P. Castaño, Department of Cell Biology, Physiology and

Immunology, Campus Universitario de Rabanales, Edificio Severo Ochoa, Planta 3,

University of Córdoba, 14014 Córdoba, Spain; Tel: +34 957 21 22 56, Fax: +34 957 21 86

34, Email: [email protected].

Abstract Alzheimer disease (AD) is a progressive neurodegenerative disorder characterized by severe cognitive deficit, wherein the impairment of episodic memory is the major hallmark. AD patients exhibit augmented accumulation of amyloid-β (Aβ) and hyperphosphorylated tau protein in specific brain regions. In addition, several neuropeptides/neurotransmitter axes clearly associated with cognitive processes, Aβ turnover, and tau phosphorylation have also been found to be impaired in AD, such as somatostatin(SST)/cortistatin(CST) and dopamine(DA) systems. However, to date there is no precise quantitative data on the expression of these systems in the human brain of AD and normal patients. Here we measured by quantitative real-time PCR the mRNA levels of SST/CST, DA and their receptors (sst1-5 and drd1-5, respectively) in addition to neprilysin (a SST-regulated enzyme involved in Aβ degradation) in three regions of the temporal lobe, one of the cortical regions most severely affected by AD. Our results reveal that some components of SST/CST- and DA-axes are divergently altered in the three areas of AD patients. Despite this region-specific regulation, an overall, common reduction of these systems was observed in the temporal lobe of AD patients. Conversely, neprilysin expression was not altered in AD, suggesting that Aβ accumulation observed in AD is due to a lack of neprilysin activation by SST rather than to a reduction of its expression. Collectively, our results define a comprehensive scenario wherein reduction of ssts, drds, and sst ligands SST and CST, could be involved, at least in part, in some of the more important defects observed in AD.

Keywords: Somatostatin, cortistatin, dopamine, somatostatin receptors (ssts), dopamine receptors (drds), neprilysin, Alzheimer Disease (AD), brain temporal lobe.

Introduction Alzheimer disease (AD) is a progressive neurodegenerative disorder diagnosed to more than 50% of people above the age of 85 [1] and represents the predominant cause of senile dementia. Since the first and most severe cognitive deficit in AD is the impairment of episodic memory and the temporal lobe is essential for episodic memory functions, the major AD pathology is located in this structure [2]. Neuropathologically, AD is characterized by the intracellular aggregation of hyperphosphorylated tau protein comprising neurofibrillar tangles (NFTs) [3] and the extracellular accumulation of amyloid-β (Aβ) in senile plaques (SP), mainly located in the temporal lobe of the brain [2]. The steady-state level on Aβ is determined by its synthesis/clearance balance. In contrast to familial AD, the underlying pathogenic mechanism of sporadic cases of AD is still unclear. However, some authors have suggested that the impaired clearance of Aβ could be responsible for these cases of AD [4, 5]. Aβ catabolism is mediated by a group of proteolytic enzymes (i.e. neprilysin) which exhibit different subcellular localization and act on distinct forms of Aβ [6, 7]. Indeed, neprilysin seems to play a key role in decreasing the levels of Aβ deposition in brain [8-10]. However, data concerning its mRNA expression, protein levels and activity in AD brains are still controversial [11-16]. Although NTFs and SP are the major hallmarks of this disease, abnormalities in several neuropeptides and neurotransmitters have also been suggested to play an important role in AD. Specifically, somatostatin (SST) is one of the most selectively reduced neuropeptides in the brain of AD patients and, to date, is the only tested peptide capable to upregulate neprilysin activity in primary cortical neurons [17, 18]. Moreover, we have recently shown that SST and its highly related peptide cortistatin (CST) act as potent inhibitors of tau phosphorylation [19]. Dopamine (DA) is a well-known neurotransmitter involved in cognitive functions. Although some studies suggest that DA can be involved in AD, the precise role of the dopaminergic system in this pathology remains still unclear. Interestingly, some studies

1 have functionally linked these systems by showing that somatostatin (ssts) and dopamine receptors (drds) can interact in the presence of their ligands to generate new receptors with altered pharmacological and functional properties [20, 21]. Thus, available information supports the notion that both the somatostatinergic and dopaminergic systems and perhaps their interactions can play relevant roles in AD. However, elucidation of those potential roles would require a precise assessment of the presence of each of these components in relevant areas of the human brain. Unfortunately, there is a lack of quantitative consistent data concerning expression of the molecular components of these systems in temporal lobe of AD patients. Accordingly, in the present study, we carried out a detailed quantification of mRNA expression levels of these systems (SST, CST, sst1-5, neprilysin and drd1-5) in both, control subjects and AD patients, by quantitative real-time PCR (qrt-PCR) in three different regions (inferior, medial and superior) of the temporal lobe, the most affected cortical structure in AD [2].

Material and methods Tissue samples. Human brain tissues were obtained from the Netherlands Brain Bank (Netherlands Institute for Neuroscience, Amsterdam) which supplies post-mortem specimens from clinically well documented and neuropathologically confirmed cases and controls. The Netherlands Brain Bank abides to all local ethical legislation. All material has been collected from donors for or from whom a written informed consent for a brain autopsy and the use of the material and clinical information for research purposes had been obtained by the Netherlands Brain Bank. Frozen samples used in this study were from three different regions of the temporal lobe (inferior, medial and superior) of six patients (four males and two females, 68-91 years) with the clinical diagnosis of AD and six non- demented controls (four males and two females, 73-93 years). Tissue samples were taken at death and during 3-5h post-mortem intervals. Available clinicopathological details of each patient are shown in Table 1. Nucleic acids isolation and reverse transcription (RT). Total RNA from frozen samples was isolated with the RNA Miniprep Kit (Stratagene, Texas, USA) following manufacturer’s instructions and the amount was quantified using the Nanodrop ND-1000 spectrophotometer (Nanodrop Technologies, DE, USA). For RT- PCR studies, 1 µg of total RNA were reverse transcribed using the AMV kit (Roche diagnostics, Mannheim, Germany). Quantitative real-time PCR (qrt-PCR) measurements. Expression of sst1-5, their ligands (SST and CST) as well as neprilysin and the dopamine receptors (drd1, drd2total, drd2long, drd3, drd4, and drd5) was screened by qrt-PCR using specific primers for each transcript (Table 2). Since it was not possible to design a specific and efficient set of primers to selectively amplify drd2short, we designed two separate set of primers to amplify drd2total and drd2long [22]. Details of primer selection, verification of primer specificity, and confirmation of efficiency as well as construction of standard curves have been previously reported in detail [22, 23]. Amplifications were performed using the iCycler IQ™ system (Biorad, CA, USA). The final volume of the PCR reaction was 25 µl including 100 ng of sample, 12.5µl of IQ™ SYBR Green Supermix (Biorad), 1µl of each primer (10 µM stock solution) and 9.5µl of dH2O. The thermocycling profile consisted of 40 cycles at 94º C for 30s, 61º C for 30s, and 72º C for 30s. In addition, a non-DNA control was run on each plate to monitor potential exogenous contamination. To control for variations in the amount of RNA used in the RT reaction and the efficiency of the RT reaction, the expression level (copy number) of one housekeeping gene (cyclophilin-A) was determined for each sample where cyclophilin A copy number was not altered between experimental groups. At the end of the amplification, the final product was subjected to graded temperature dependent dissociation to verify that only one product was amplified. In addition, PCR products were run on 2% agarose gel containing ethidium bromide to confirm that only one band, of the expected size, was amplified and

2 all PCR products were then column-purified (Bioneer Inc., CA, USA) and sequenced to confirm target specificity. To determine the starting copy number of cDNA, RT samples were PCR amplified, and the signal was compared with that of a specific standard curve for each transcript run on the same plate (1, 101, 102, 103, 104, 105 , 106 copies). It should be noted that the slope of a standard curve for each template examined was between -3,31 and -3,35 (R2 of the standard curve between 0,997 and 1,002) indicating that the efficiency of amplification was close to a 100%, meaning that all templates in each cycle were copied. Statistical analysis. Kolmogorov-Smirnov test was used to assess the normality of the distribution of all variables. Student's t-test analysis was used for normally distributed variables, while Mann-Whitney U-test was used for nonparametric variables. P values less than 0.05 were considered significant. All statistical analyses were performed using the GraphPad Prism and SPSS 13.0 software packages.

Results

Expression of SST, CST and neprilysin in the brain of control subjects and AD patients. It is widely accepted that SST is one of the most selectively reduced neuropeptides in the brain of AD patients [18]; however, no data has been reported concerning its highly related peptide CST. Additionally, data concerning neprilysin mRNA expression, protein level and activity are still controversial [11-16]. In the present study, absolute quantification of mRNA copy number in the temporal cortex by qrt-PCR confirmed a remarkable 83.9% reduction of SST expression in AD patients as compared with controls (Table 3). This difference is highly significant (p≤0.0001) when comparing the whole temporal gyrus (Figure 1, left panel), and was also significant when each lobe was considered separately (Figure 1, left panel). Likewise, SST mRNA level difference between AD and control subjects is consistent in both, female and male genders (data not shown). CST expression has not been analyzed in detail hitherto in brains of AD patients. In fact, this is the first report demonstrating that CST is expressed in temporal lobe from AD patients, wherein CST mRNA levels are higher than those of SST (136,216 ± 15,561 vs. 58,709 ± 13,490 copies/100ng of total RNA, respectively; Table 3). Nevertheless, and similar to that found for its highly related peptide SST, we observed that CST mRNA levels are decreased in the whole temporal region of AD patients as compared to control samples (p=0.016), although the extent of reduction (40%) is lower than that observed for SST (Table 3 and Figure 1, middle panel). In contrast, when each lobe was analyzed separately, we observed that CST mRNA levels were significantly decreased only in the inferior temporal region (p=0.0014) and not in the medial and superior gyrus (Figure 1, middle panel). Similar to SST, no differences were observed between genders (data not shown). Quantification of neprilysin mRNA copy number revealed that the absolute expression level of this gene is, by and large, considerably lower than that of SST and CST (Table 3). In whole temporal lobe, neprilysin mRNA levels are slightly lower in AD patients compared to control subjects, although this difference does not reach statistical significance (Table 3 and Figure 1, right panel). Similarly, no significant differences are found between temporal regions (Figure 1) or between genders (data not shown). As mentioned before, we used cyclophilin as internal control whose mean mRNA copy number in non-demented control was 3,412 ± 1,080 copies/100ng of RNA and, in AD patients was 3,158 ± 1,227 (p=0.72). These results are consistent with previous data reporting that the mRNA expression levels of cyclophilin remain consistently unaltered in brains from AD patients [12, 24, 25].

Expression of SST/CST receptors (ssts) in brain of control subjects and AD patients. The data reported on the presence and/or abundance of SST/CST receptors (ssts) in AD are limited and controversial [26-28]. Using a set of specific primers to determine the mRNA copy number of each sst subtype (Table 2), we found that all five ssts are expressed

3 in temporal cortex of control brains, although at very different levels (sst2 ≥ sst1 ≥ sst3 > sst4 >> sst5) (Table 3). Interestingly, an overall reduction of 53% in the number of ssts mRNA copies was observed in AD temporal cortex. Specifically, sst1, sst3 and sst4 were significantly reduced (p=0.015; p=0.016 and p=0.025; respectively), while reduction of sst2 copy number was not significant and expression level of sst5 did not change (Figure 2) in the whole temporal region of AD patients compared with controls samples. Gender comparison did not reveal differences in the expression of ssts between female and male patients (data not shown), except for sst4, whose mRNA expression was drastically reduced only in AD females compared to controls (females: 1,174±230 vs. 210±55 copies/100ng total RNA, respectively [p=0.019]; males: 800±178 vs. 1,037±390 copies/100ng total RNA, respectively [p=0.628]). Interestingly, the reduction of ssts expression in AD patients is mainly restricted to the inferior temporal gyrus, where mRNA level of sst1, sst2 and sst3 are significantly reduced and where sst4 shows also a similar trend (p=0.07) (Figure 2). Additionally, expression of sst3 and sst4 shows a trend to be reduced in the superior temporal lobe of AD brains compared to controls (p=0.08 and p=0.06, respectively).

Expression of dopamine receptors (drds) in brain of control subjects and AD patients. Although dopamine has been associated with cognitive functions, attenuation of learning impairment and neuroprotection [29-32], only drd2 has been studied in detail to date in brains of AD patients [33-35]. Here, we used a set of specific primers to determine the mRNA copy number of each drd subtype (Table 2). Our results indicate that all five drds are expressed in whole temporal cortex of control brains, although at very different levels (drd1 > drd5 ≥ drd4 > drd2 >> drd3) (Table 3). Of note, in AD whole temporal cortex, we quantified an overall reduction of 50% in the mRNA copy number of drds compared to controls. Specifically, drd1, drd2T, drd2L, drd3 and drd4, were significantly reduced, while the reduction of drd5 copy number in the whole temporal lobe did not reach statistical significance (Figure 3). Gender comparisons did not detect differences in the expression of drds between female and male patients (data not shown), except for drd3, whose mRNA expression, despite its low (but detectable) levels, was found to be reduced only in female AD patients compared to controls (females: 9±2 vs. 2±1 copies/100ng total RNA, respectively [p=0.014]; males: 6±2 vs. 8±2 copies/100ng total RNA, respectively [p=679]). The reduction of drds expression, similar to that of ssts, is mainly circumscribed to the inferior temporal gyrus, where mRNA level of all the drds were markedly reduced, including drd5 (Figure 3). Additionally, expression of drd2T and drd2L were also statistically reduced in the superior temporal lobe of AD brains compared to controls (p=0.046 and p=0.011, respectively).

Discussion Somatostatin (SST) is a cyclic, 14 amino acid neuropeptide originally identified in hypothalamus as a potent inhibitor of pituitary growth hormone release [36]. However, SST was soon found to be widely expressed throughout different tissues and to be especially abundant in the central nervous system (CNS), where it exerts important functions as neurotransmitter and neuromodulator [37]. More than 20 years later, a neuropeptide with strong structural and functional homology to SST was identified and was named cortistatin (CST) after its predominant expression in cortex [38], although it is also present in peripheral tissues [39, 40]. It is widely accepted that SST is one of the most selectively reduced neuropeptides in the brain and cerebrospinal fluid (CSF) of AD patients [18, 41-45]. In contrast, and despite the close relationship between the two peptides, no data has been reported hitherto concerning CST levels in AD. Here, we have quantified by qrtPCR the mRNA copy number of both transcripts in the temporal gyrus, the most affected region by Aβ accumulation [2] of control and AD patients. Consistent with data reported previously for this and other CNS regions [18, 41-45], we observed a

4 remarkable reduction (83,9%) of SST mRNA levels in AD patients compared to controls. Since SST produced in the neurons of the temporal lobe can be released locally or distantly in other cortical structures through the terminal-axons of the somatostatinergic neurons [37], it could be argued that the decrease of SST levels observed in this and other CNS regions [18, 41-45] can be, in part, due to the des-regulation of SST mRNA in the temporal lobe. Interestingly, our results indicate, for the first time, that CST is also significantly reduced in this cortical region, although the magnitude of the decrease was considerably lower (below 40%) as compared with SST (reduction of 83,9%). A detailed analysis of this decrease in the different regions (inferior, medial and superior) of the temporal lobe revealed the possible origin of the SST-CST differences. Indeed, whereas SST mRNA levels were drastically reduced in all these regions, CST mRNA expression was only decreased in the inferior gyrus region of the temporal lobe but not in the superior and medial regions. The divergent mRNA alteration observed for SST and CST in AD patients compared to controls suggest that these peptides may play a dissimilar role in the disease and that this role could be region-dependent. Indeed, in spite of the high homology exhibited by SST and CST, it has been already reported that these peptides can exert different and, even, opposite actions. Specifically, although SST and CST basically act as two siblings in regulating endocrine secretions (for review, see [46]), SST causes hyper-motility and enhances cortical excitability and REM sleep, whereas CST causes hypo-motility, depresses cortical excitability and increases slow wave sleep without affecting REM sleep [38]. Furthermore, CST (but not SST) has been reported to be a potent endogenous anti-inflammatory peptide [47]. It has also been reported that SST and CST exert direct actions in processes involved in AD generation and/or progression. Thus, treatment of primary cortical neurons with either SST or CST similarly induced, albeit with different kinetics, phosphorylation of tau at Ser262 [19], a parameter that has been reported to be modified in the brain of patients with AD [48]. In addition, SST exerts a positive role in the catabolism of Aβ. Specifically, SST increases the activity of neprilysin [17] and insulin-degrading enzyme (IDE) [49], two of the best known Aβ-degrading enzymes. Conversely, the role of CST on the regulation of neprilysin or IDE activity has not yet been investigated. In fact, SST is the only tested peptide capable to up-regulate neprilysin activity in primary cortical neurons [17]. Neprilysin plays a key role in decreasing the levels of Aβ deposition in brain [8-10]. However, data concerning mRNA expression, protein level, and activity of this enzyme in the brains of AD patients are still controversial, although most studies report a lack of change or a reduction of neprilysin mRNA or protein in AD [11-16]. In agreement with these data, our results indicate that neprilysin mRNA copy number did not significantly vary in AD temporal lobe, despite a slight numerical reduction compared with control subjects. Since such a small decrease of neprilysin in AD could not satisfactorily explain the high level of Aβ accumulation in the whole temporal lobe, some authors have suggested that this accumulation is due to a lack of neprilysin activation by SST rather than to a reduction of its expression [50] which would be supported by the data presented in this report. The potential contribution of SST and CST to the pathogenesis of AD could be elicited not only through changes in their expression but also through variations in the levels of their receptors. SST and CST exert their biological actions by binding to five members of the so- called family of somatostatin receptors, which belong to the superfamily of G protein coupled receptors (GPCRs) (sst1-5) [51]. Both peptides exhibit a comparable subnanomolar binding affinity to the five ssts, which could help to explain why both peptides share many actions at different targets [51]. On the other hand, CST, unlike SST, has been suggested to bind to the ghrelin receptor 1A (GHSR-1A) [52] and also to bind to the Mrgx2 receptor [53, 54]. It has been hypothesized that activation of these non-SST receptors by CST might be involved in the dissimilar or, in some instances, opposite actions of both peptides. All five ssts are present in the brain [55] and several reports [26- 28], but not all [56], have shown that their expression patterns are altered in AD in a

5 region-dependent manner. Thus, in earlier studies, measurements of ssts concentration in the temporal cortex of AD patients and controls by selective and non-selective radioligand assays showed that total receptor levels were reduced approximately by half in AD patients [26, 27]. Moreover, Scatchard analysis indicated a reduction in receptor number rather than a change in affinity [26, 27]. More recently, immunocytochemical studies revealed that the expression patterns of the five ssts are not uniformly altered in frontal cortex of AD patients, since sst2, sst4 and sst5 levels were decreased in AD, while sst1 was not altered and sst3 was increased [28]. Our recent results are in agreement with Beal´s data, as they show an overall 53% decrease in ssts mRNA copy number in the whole temporal lobe of AD patients compared with controls. On the other hand, the pattern of individual receptors whose changes in expression would contribute to this overall decrease is not identical to that described in frontal cortex in previous studies [28]. Indeed, our results indicate a reduction of more than 50% in the mRNA copy number of sst1, sst3 and sst4 (in this latter case, only in females) in whole temporal lobe of AD patients, whereas sst2 expression showed a small non- significant decrease and sst5 levels did not vary. Of note, we observed that the major changes in ssts expression pattern were restricted to the inferior gyrus of the temporal region, while data reported previously [28] specifically focused the analysis to the frontal cortex of AD patients. Consequently, the lack of parallelism with previous results may be related to differences in both, the brain regions analyzed and the different end points (mRNA vs. protein) measured in each study. The frequent pattern of coexpression of different ssts in this and other tissues has important implications, since these receptors have the capacity to interact with each other and thereby modify their functional properties of individual ssts [57-59]. Indeed, studies with SST agonists suggest that the coexpression of specific ssts can be critical to promote precise biological actions. Thus, for example, infusions of octreotide, a SST agonist selective for sst2, 3 and 5, in AD patients caused a significant degree of memory improvement in story recall as compared with placebo conditions [60]. In contrast, this analog was not able to mimic SST and CST actions on tau phosphorylation, probably because the activation of sst2, sst3 and sst5 is not enough to increase the phosphorylation of this protein, and others receptors, specifically sst4, could be crucial in this process as previously demonstrated by our laboratory [19]. Interestingly, ssts are also able to interact with other GPCRs, including opioid [61] and dopamine receptors [20, 21], thereby originating new receptors with altered pharmacological and/or functional properties. Specifically, sst2 and sst5 have been reported to interact with drd2. Dopamine is a well-known major neurotransmitter in the CNS, involved in neuronal functions as important as emotion and cognition. Accordingly, the possible impact of the dopamine system in AD has been extensively studied, and, although several studies point out an important role of this system in this pathology [29- 32], a comprehensive, definite conclusion on its impact in AD has not been reached. Thus, whereas previous studies have shown that the dopaminergic system does not seem to be drastically affected in AD as compared to other neuromodulatory systems, some reports have suggested that this system could be impaired in this disease [34, 35, 62, 63]. In line with this, the levels of expression of drds in different brain regions and their role in AD are still unclear and controversial. Immunocytochemical studies of some drd subtypes in various brain regions of AD patients indicate that drd subtypes could be regulated in AD in a region-specific manner [32-35, 64]. More recently, a drds screening in frontal cortex of AD patients showed that protein levels of drd1, drd2, drd3 and drd4 are reduced whereas drd5 is increased in AD patients as compared with controls [65]. In the present study, the use of a precise quantitative approach (qrt-PCR) to measure drds expression in temporal lobe indicates similar although not identical tendencies to those observed by Kumar and Patel in frontal cortex. Indeed, we observed an overall reduction of drds mRNA levels in AD, as compared with controls. Specifically, the expression of all five drds is clearly reduced in the inferior region of temporal lobe in AD and mRNA levels of drd2 are also decreased in the superior region. These findings differ from those reported in frontal

6 cortex [65] likely due to differences in both brain regions analyzed and the end point (mRNA vs. protein) measured. Notwithstanding, it is most noteworthy that the balance of Gs and Gi/0 coupled receptors (drd1/drd5 and drd2/drd3/drd4, respectively), which shows an equilibrate expression in control subjects, was found to be clearly altered in AD patients, thus reinforcing the contention that there is a clear impairment of the dopaminergic axis in the temporal lobe of AD patients. In summary, the results presented herein provide for the first time a precise quantitative measure of changes in mRNA copy number of important molecular components of the SST/CST/ssts and drds systems in a key brain region in AD. Our data indicate that, in AD, mRNA levels of SST and CST but not neprilysin are markedly decreased in the temporal lobe, one of the most important cortical structures in memory and cognition, and the most affected region by SP accumulation and, consequently, by AD. Since accumulation of Aβ in non-familial AD has been suggested to be related with Aβ catabolism impairment, and neprilysin expression is not significantly affected in these patients, we and other suggest that formation of SN in temporal lobe of AD patients could be originated by the lack of neprilysin stimulation, due to the loss of SST and, possibly, also of CST. The reduction of the stimulatory effect elicited by SST would be potentiated by the overall decrease of ssts mRNA levels in the temporal lobe, shown in this work. Furthermore, the previously reported impairment of the dopaminergic system in AD would also be potentiated by the marked reduction of drds transcripts in temporal lobe reported herein. Taken together, our results indicate a general decrease of potentially “protective” neuropeptide/ neurotransmitter/receptor systems (i.e., somatostatinergic and dopaminergic systems) in the whole temporal lobe of AD patients, being the inferior gyrus the most sensitive region for these reductions in the temporal lobe. Future works should aim at dissecting the precise role of individual receptors in this pathology and on their potential value as specific therapeutic target in AD.

Acknowledgements: This work is supported in part by grants from Programa Nacional de becas de FPU (FPU-AP20052473, to MDG) and Programa Ramon y Cajal del Ministerio de Educación y Ciencia, Spain (RYC-2007-00186, to RML) and CIBERNED (to AR) and by grants from Junta de Andalucía BIO-0139 and CTS-01705, Ministerio de Ciencia e Innovacion/FEDER BFU2007-60180/BFI, BFU2008-01136/BFI, Spain, Ministerio de Sanidad, Spain SAF 2006-02424, CIBERNED CB06/05/0035, Noscira 2008/285, Comunidad de Madrid SAL/0202/2006, Fundación M. Botín and an institutional grant from Fundación R. Areces. CIBER is an initiative of Instituto de Salud Carlos III (Ministerio de Sanidad, Ministerio de Ciencia e Innovación, Spain). We thank the Netherlands Brain Bank (Coordinator Dr. I. Huitinga) for provision of the human brain material. None of the funding organizations had any further role in the study design; in the collection, analysis and interpretation of data; in the writing of the report; or in the decision to submit the paper for publication.

References 1. Golomb J, Kluger A, Ferris S (2000) Mild cognitive impairment: identifying and treating the earliest stages of Alzheimer’s disease. Neurosci News 3 46–53. 2. Braak H, Braak E (1991) Neuropathological stageing of Alzheimer-related changes. Acta Neuropathol 82, 239-259. 3. Selkoe DJ (2001) Alzheimer's disease: genes, proteins, and therapy. Physiol Rev 81, 741-766. 4. Higuchi M, Iwata N, Saido TC (2005) Understanding molecular mechanisms of proteolysis in Alzheimer's disease: progress toward therapeutic interventions. Biochim Biophys Acta 1751, 60- 67.

5. Leissring MA, Farris W, Chang AY, Walsh DM, Wu X, Sun X, Frosch MP, Selkoe DJ (2003) Enhanced proteolysis of beta-amyloid in APP transgenic mice prevents plaque formation, secondary pathology, and premature death. Neuron 40, 1087-1093. 6. Carson JA, Turner AJ (2002) Beta-amyloid catabolism: roles for neprilysin (NEP) and other metallopeptidases? J Neurochem 81, 1-8. 7. Eckman EA, Eckman CB (2005) Abeta-degrading enzymes: modulators of Alzheimer's disease pathogenesis and targets for therapeutic intervention. Biochem Soc Trans 33, 1101-1105. 8. Hama E, Shirotani K, Iwata N, Saido TC (2004) Effects of neprilysin chimeric proteins targeted to subcellular compartments on amyloid beta peptide clearance in primary neurons. J Biol Chem 279, 30259-30264. 9. Iwata N, Mizukami H, Shirotani K, Takaki Y, Muramatsu S, Lu B, Gerard NP, Gerard C, Ozawa K, Saido TC (2004) Presynaptic localization of neprilysin contributes to efficient clearance of amyloid-beta peptide in mouse brain. J Neurosci 24, 991-998. 10. Marr RA, Guan H, Rockenstein E, Kindy M, Gage FH, Verma I, Masliah E, Hersh LB (2004) Neprilysin regulates amyloid Beta peptide levels. J Mol Neurosci 22, 5-11. 11. Carpentier M, Robitaille Y, DesGroseillers L, Boileau G, Marcinkiewicz M (2002) Declining expression of neprilysin in Alzheimer disease vasculature: possible involvement in cerebral amyloid angiopathy. J Neuropathol Exp Neurol 61, 849-856. 12. Hellstrom-Lindahl E, Ravid R, Nordberg A (2008) Age-dependent decline of neprilysin in Alzheimer's disease and normal brain: inverse correlation with A beta levels. Neurobiol Aging 29, 210-221. 13. Pardossi-Piquard R, Petit A, Kawarai T, Sunyach C, Alves da Costa C, Vincent B, Ring S, D'Adamio L, Shen J, Muller U, St George Hyslop P, Checler F (2005) Presenilin-dependent transcriptional control of the Abeta-degrading enzyme neprilysin by intracellular domains of betaAPP and APLP. Neuron 46, 541-554. 14. Russo R, Borghi R, Markesbery W, Tabaton M, Piccini A (2005) Neprylisin decreases uniformly in Alzheimer's disease and in normal aging. FEBS Lett 579, 6027-6030. 15. Wang DS, Lipton RB, Katz MJ, Davies P, Buschke H, Kuslansky G, Verghese J, Younkin SG, Eckman C, Dickson DW (2005) Decreased neprilysin immunoreactivity in Alzheimer disease, but not in pathological aging. J Neuropathol Exp Neurol 64, 378-385. 16. Yasojima K, Akiyama H, McGeer EG, McGeer PL (2001) Reduced neprilysin in high plaque areas of Alzheimer brain: a possible relationship to deficient degradation of beta-amyloid peptide. Neurosci Lett 297, 97-100. 17. Saito T, Iwata N, Tsubuki S, Takaki Y, Takano J, Huang SM, Suemoto T, Higuchi M, Saido TC (2005) Somatostatin regulates brain amyloid beta peptide Abeta42 through modulation of proteolytic degradation. Nat Med 11, 434-439. 18. Epelbaum J, Guillou JL, Gastambide F, Hoyer D, Duron E, Viollet C (2009) Somatostatin, Alzheimer's disease and cognition: An old story coming of age? Prog Neurobiol 89, 153-161. 19. Rubio A, Perez M, de Lecea L, Avila J (2008) Effect of cortistatin on tau phosphorylation at Ser262 site. J Neurosci Res 86, 2462-2475. 20. Baragli A, Alturaihi H, Watt HL, Abdallah A, Kumar U (2007) Heterooligomerization of human dopamine receptor 2 and somatostatin receptor 2 Co-immunoprecipitation and fluorescence resonance energy transfer analysis. Cell Signal 19, 2304-2316. 21. Rocheville M, Lange DC, Kumar U, Patel SC, Patel RC, Patel YC (2000) Receptors for dopamine and somatostatin: formation of hetero-oligomers with enhanced functional activity. Science 288, 154-157. 22. Neto LV, Machado Ede O, Luque RM, Taboada GF, Marcondes JB, Chimelli LM, Quintella LP, Niemeyer P, Jr., de Carvalho DP, Kineman RD, Gadelha MR (2009) Expression analysis of dopamine receptor subtypes in normal human pituitaries, nonfunctioning pituitary adenomas and somatotropinomas, and the association between dopamine and somatostatin receptors with clinical response to octreotide-LAR in acromegaly. J Clin Endocrinol Metab 94, 1931-1937. 23. Taboada GF, Luque RM, Bastos W, Guimaraes RF, Marcondes JB, Chimelli LM, Fontes R, Mata PJ, Filho PN, Carvalho DP, Kineman RD, Gadelha MR (2007) Quantitative analysis of somatostatin receptor subtype (SSTR1-5) gene expression levels in somatotropinomas and non- functioning pituitary adenomas. Eur J Endocrinol 156, 65-74.

24. Hellstrom-Lindahl E, Mousavi M, Zhang X, Ravid R, Nordberg A (1999) Regional distribution of nicotinic receptor subunit mRNAs in human brain: comparison between Alzheimer and normal brain. Brain Res Mol Brain Res 66, 94-103. 25. Mousavi M, Hellstrom-Lindahl E, Guan ZZ, Shan KR, Ravid R, Nordberg A (2003) Protein and mRNA levels of nicotinic receptors in brain of tobacco using controls and patients with Alzheimer's disease. Neuroscience 122, 515-520. 26. Beal MF, Mazurek MF, Tran VT, Chattha G, Bird ED, Martin JB (1985) Reduced numbers of somatostatin receptors in the cerebral cortex in Alzheimer's disease. Science 229, 289-291. 27. Krantic S, Robitaille Y, Quirion R (1992) Deficits in the somatostatin SS1 receptor sub-type in frontal and temporal cortices in Alzheimer's disease. Brain Res 573, 299-304. 28. Kumar U (2005) Expression of somatostatin receptor subtypes (SSTR1-5) in Alzheimer's disease brain: an immunohistochemical analysis. Neuroscience 134, 525-538. 29. Backman L, Ginovart N, Dixon RA, Wahlin TB, Wahlin A, Halldin C, Farde L (2000) Age-related cognitive deficits mediated by changes in the striatal dopamine system. Am J Psychiatry 157, 635-637. 30. Bozzi Y, Vallone D, Borrelli E (2000) Neuroprotective role of dopamine against hippocampal cell death. J Neurosci 20, 8643-9. 31. Umegaki H, Munoz J, Meyer RC, Spangler EL, Yoshimura J, Ikari H, Iguchi A, Ingram DK (2001) Involvement of dopamine D(2) receptors in complex maze learning and acetylcholine release in ventral hippocampus of rats. Neuroscience 103, 27-33. 32. Volkow ND, Gur RC, Wang GJ, Fowler JS, Moberg PJ, Ding YS, Hitzemann R, Smith G, Logan J (1998) Association between decline in brain dopamine activity with age and cognitive and motor impairment in healthy individuals. Am J Psychiatry 155, 344-349. 33. Joyce JN, Myers AJ, Gurevich E (1998) Dopamine D2 receptor bands in normal human temporal cortex are absent in Alzheimer's disease. Brain Res 784, 7-17. 34. Kemppainen N, Ruottinen H, Nagren K, Rinne JO (2000) PET shows that striatal dopamine D1 and D2 receptors are differentially affected in AD. Neurology 55, 205-209. 35. Pizzolato G, Chierichetti F, Fabbri M, Cagnin A, Dam M, Ferlin G, Battistin L (1996) Reduced striatal dopamine receptors in Alzheimer's disease: single photon emission tomography study with the D2 tracer [123I]-IBZM. Neurology 47, 1065-1068. 36. Brazeau P, Vale W, Burgus R, Ling N, Butcher M, Rivier J, Guillemin R (1973) Hypothalamic polypeptide that inhibits the secretion of immunoreactive pituitary growth hormone. Science 179, 77-79. 37. Viollet C, Lepousez G, Loudes C, Videau C, Simon A, Epelbaum J (2008) Somatostatinergic systems in brain: networks and functions. Mol Cell Endocrinol 286, 75-87. 38. de Lecea L, Criado JR, Prospero-Garcia O, Gautvik KM, Schweitzer P, Danielson PE, Dunlop CL, Siggins GR, Henriksen SJ, Sutcliffe JG (1996) A cortical neuropeptide with neuronal depressant and sleep-modulating properties. Nature 381, 242-245. 39. Broglio F, Grottoli S, Arvat E, Ghigo E (2008) Endocrine actions of cortistatin: in vivo studies. Mol Cell Endocrinol 286, 123-127. 40. Rubio A, Avila J, de Lecea L (2007) Cortistatin as a therapeutic target in inflammation. Expert Opin Ther Targets 11, 1-9. 41. Bissette G, Nemeroff CB (1992) Biochemical and neuropeptide alterations in Alzheimer's disease. Clin Neuropharmacol 15, 33-34. 42. Davis KL, Davidson M, Yang RK, Davis BM, Siever LJ, Mohs RC, Ryan T, Coccaro E, Bierer L, Targum SD (1988) CSF somatostatin in Alzheimer's disease, depressed patients, and control subjects. Biol Psychiatry 24, 710-712. 43. Molchan SE, Hill JL, Martinez RA, Lawlor BA, Mellow AM, Rubinow DR, Bissette G, Nemeroff CB, Sunderland T (1993) CSF somatostatin in Alzheimer's disease and major depression: relationship to hypothalamic-pituitary-adrenal axis and clinical measures. Psychoneuroendocrinology 18, 509-519. 44. Nemeroff CB, Knight DL, Bissette G (1992) Somatostatin: a neuropeptide system pathologically altered in Alzheimer's disease and depression. Clin Neuropharmacol 15, 311-312. 45. Nilsson CL, Brinkmalm A, Minthon L, Blennow K, Ekman R (2001) Processing of neuropeptide Y, galanin, and somatostatin in the cerebrospinal fluid of patients with Alzheimer's disease and frontotemporal dementia. Peptides 22, 2105-2112.

46. Gahete MD, Duran-Prado M, Luque RM, Martinez-Fuentes AJ, Vazquez-Martinez R, Malagon MM, Castano JP (2008) Are somatostatin and cortistatin two siblings in regulating endocrine secretions? In vitro work ahead. Mol Cell Endocrinol 286, 128-134. 47. Gonzalez-Rey E, Chorny A, Robledo G, Delgado M (2006) Cortistatin, a new antiinflammatory peptide with therapeutic effect on lethal endotoxemia. J Exp Med 203, 563-571. 48. Morishima-Kawashima M, Hasegawa M, Takio K, Suzuki M, Yoshida H, Titani K, Ihara Y (1995) Proline-directed and non-proline-directed phosphorylation of PHF-tau. J Biol Chem 270, 823- 829. 49. Ciaccio C, Tundo GR, Grasso G, Spoto G, Marasco D, Ruvo M, Gioia M, Rizzarelli E, Coletta M (2009) Somatostatin: a novel substrate and a modulator of insulin-degrading enzyme activity. J Mol Biol 385, 1556-1567. 50. Hama E, Saido TC (2005) Etiology of sporadic Alzheimer's disease: somatostatin, neprilysin, and amyloid beta peptide. Med Hypotheses 65, 498-500. 51. Moller LN, Stidsen CE, Hartmann B, Holst JJ (2003) Somatostatin receptors. Biochim Biophys Acta 1616, 1-84. 52. Deghenghi R, Papotti M, Ghigo E, Muccioli G (2001) Cortistatin, but not somatostatin, binds to growth hormone secretagogue (GHS) receptors of human pituitary gland. J Endocrinol Invest 24, 1-3. 53. Robas N, Mead E, Fidock M (2003) MrgX2 is a high potency cortistatin receptor expressed in dorsal root ganglion. J Biol Chem 278, 44400-44404. 54. Nothacker HP, Wang Z, Zeng H, Mahata SK, O'Connor DT, Civelli O (2005) Proadrenomedullin N- terminal peptide and cortistatin activation of MrgX2 receptor is based on a common structural motif. Eur J Pharmacol 519, 191-193. 55. Wulfsen I, Meyerhof W, Fehr S, Richter D (1993) Expression patterns of rat somatostatin receptor genes in pre- and postnatal brain and pituitary. J Neurochem 61, 1549-1552. 56. Whitford C, Candy J, Edwardson J, Perry R (1988) Cortical somatostatinergic system not affected in Alzheimer's and Parkinson's diseases. J Neurol Sci 86, 13-18. 57. Duran-Prado M, Malagon MM, Gracia-Navarro F, Castano JP (2008) Dimerization of G protein- coupled receptors: new avenues for somatostatin receptor signalling, control and functioning. Mol Cell Endocrinol 286, 63-68. 58. Krantic S, Goddard I, Saveanu A, Giannetti N, Fombonne J, Cardoso A, Jaquet P, Enjalbert A (2004) Novel modalities of somatostatin actions. Eur J Endocrinol 151, 643-655. 59. Siehler S, Nunn C, Hannon J, Feuerbach D, Hoyer D (2008) Pharmacological profile of somatostatin and cortistatin receptors. Mol Cell Endocrinol 286, 26-34. 60. Craft S, Asthana S, Newcomer JW, Wilkinson CW, Matos IT, Baker LD, Cherrier M, Lofgreen C, Latendresse S, Petrova A, Plymate S, Raskind M, Grimwood K, Veith RC (1999) Enhancement of memory in Alzheimer disease with insulin and somatostatin, but not glucose. Arch Gen Psychiatry 56, 1135-1140. 61. Pfeiffer M, Koch T, Schroder H, Laugsch M, Hollt V, Schulz S (2002) Heterodimerization of somatostatin and opioid receptors cross-modulates phosphorylation, internalization, and desensitization. J Biol Chem 277, 19762-19772. 62. Rinne JO, Sahlberg N, Ruottinen H, Nagren K, Lehikoinen P (1998) Striatal uptake of the dopamine reuptake ligand [11C]beta-CFT is reduced in Alzheimer's disease assessed by positron emission tomography. Neurology 50, 152-156. 63. Kemppainen N, Marjamaki P, Roytta M, Rinne JO (2001) Different pattern of reduction of striatal dopamine reuptake sites in Alzheimer's disease and ageing. J Neural Transm 108, 827- 836. 64. Piggott MA, Perry EK, Marshall EF, McKeith IG, Johnson M, Melrose HL, Court JA, Lloyd S, Fairbairn A, Brown A, Thompson P, Perry RH (1998) Nigrostriatal dopaminergic activities in dementia with Lewy bodies in relation to neuroleptic sensitivity: comparisons with Parkinson's disease. Biol Psychiatry 44, 765-774. 65. Kumar U, Patel SC (2007) Immunohistochemical localization of dopamine receptor subtypes (D1R-D5R) in Alzheimer's disease brain. Brain Res 1131, 187-196.

Table 1 Case details of control subjects and AD patients Case (NBB number) Age Gender Tangles Senile plaques PM time (h) ApoE Genotype Controls S00/183 73 F 0 B 4:00 3/2 S00/318 83 F 1 B 5:30 3/2 S94/068 85 F 1 B 5:00 S96/204 93 F 1 A 4:25 S95/181 74 M 3 C 5:00 4/3 S01/206 85 M 1 B 4:15 4/4 AD patients S03/117 70 F 6 C 4:30 3/3 S03/162 72 F 6 C 3:45 4/3 S05/307 85 F 6 C 5:00 3/3 S05/236 91 F 6 C 4:35 4/3 S05/072 68 M 6 C 4:15 4/4 S04/188 73 M 6 C 5:00 4/3 Case (NBB number), age at death (years), gender (F: female; M: male), Braak Stages according to neurofibrillary pathology [0-6] and senile plaques [A-C] [2], post-mortem time (in hours) and ApoE genotype of control and AD brains used in this study are shown.

Table 2 Primer sequences, product sizes and GeneBank accession numbers Product GeneBank Gene Sense Antisense lenght Accession (bp) number SST AACCCAACCAGACGGAGAA TAGCCGGGTTTGAGTTAGCA 111 BC032625 CST CTCCAGTCAGCCCACAAGAT CAAGCGAGGAAAGTCAGGAG 173 NM_001302 sst1 CACATTTCTCATGGGCTTCCT ACAAACACCATCACCACCATC 165 BC035618 sst2 GGCATGTTTGACTTTGTGGTG GTCTCATTCAGCCGGGATTT 185 NM001050 sst3 TGCCTTCTTTGGGCTCTACTT ATCCTCCTCCTCAGTCTTCTCC 190 NM001051 sst4 CGTGGTCGTCTTTGTGCTCT AAGGATCGGCGGAAGTTGT 174 BC069063 sst5 CTGGTGTTTGCGGGATGTT GAAGCTCTGGCGGAAGTTGT 183 NM001053 Neprilysin GACCTCGTTGACTGGTGGACT CTGATAGGCTCTGTATGCTTGACC 186 NM000902 drd1 GACCACCACAGGTAATGGAAAG AAGAAAGGTAGCCAACAGCACA 141 AF498961 drd2T CGAGCATCCTGAACTTGTGTG GCGTTATTGAGTCCGAAGAGG 172 NM016574 drd2L CTCCTCCATCGTCTCCTTCT CGGTGCAGAGTTTCATGTCC 188 NM000795 drd3 GTACAGCCAGCATCCTTAATCTCT ACAGAAGAGGGCAGGACACA 168 U32499 drd4 GACGCCCTTCTTCGTGGT GACAGTGTAGATGACGGGGTTG 130 L12398 drd5 CTGGGCTAACTCCTCACTCAAC ATTGCTGATGTTCACCGTCTC 130 AY136750 Cyclophilin TGGTCTTTGGGAAGGTGAAAG TGTCCACAGTCGGAAATGGT 109 AF022115

Table 3 Absolute cDNA copy number/100ng of total RNA of each transcript in AD and controls patients as determined by quantitative real-time PCR Control mean Percentage of AD mean (n=6) p-value (n=6) change SST 365,572 ± 62,842 58,709 ± 13,490 -83,9 p≤0.0001 CST 221,342 ± 29,919 136,216 ± 15,561 -38,5 p=0.016 sst1 2,312 ± 483 992 ± 243 -57,1 p=0.015 sst2 2,497 ± 617 1,400 ± 354 -43,9 p=0.148 sst3 2,277 ± 613 886 ± 309 -61,1 p=0.016 sst4 1,000 ± 170 486 ±160 -51,6 p=0.025 sst5 14 ± 5 13 ± 4 -3,6 p=0.316 Neprilysin 36 ± 17 26 ± 8 -29,6 p=0.907 drd1 2,430 ± 389 1,203 ± 238 -50,5 p=0.030 drd2T 995 ± 202 221 ± 45 -77,8 p=0.007 drd2L 273 ± 51 43 ± 11 -84,4 p=0.007 drd3 8 ± 2 4 ± 1 -55,7 p=0.047 drd4 1,519 ± 225 819 ± 139 -46,1 p=0.031 drd5 1,750 ± 348 1,212 ± 261 -30,8 p=0.083 Values represent mean ± SEM

Figure legends Figure. 1. mRNA levels of somatostatin (SST), cortistatin (CST) and neprilysin. Absolute mRNA copy number of SST, CST and neprilysin were measured using quantitative real time PCR in brain temporal lobe of normal (black columns; control) and Alzheimer disease (AD) (gray columns) subjects. Values indicate mean mRNA copy number ± SEM (adjusted by cyclophilin mRNA copy number) of these genes in the whole temporal lobe or in specific regions (inferior, medial and superior) of the temporal lobe. (*, p≤0.05; **, p≤0.01; ***, p≤0.001).

Figure. 2. mRNA levels of somatostatin receptors subtypes (sst1-5). Absolute mRNA copy number sst1-5 were specifically measured using quantitative real time PCR in brain temporal lobe of normal (black columns; control) and Alzheimer disease (AD) (gray columns) subjects. Values indicate mean mRNA copy number ± SEM (adjusted by cyclophilin mRNA copy number) of these genes in the whole temporal lobe or in specific regions (inferior, medial and superior) of the temporal lobe. (*, p≤0.05; **, p≤0.01).

Figure. 3. mRNA levels of dopamine receptors (drd1-5). Absolute mRNA copy number of drd1-5 were specifically measured using quantitative real time PCR in brain temporal lobe of normal (black columns; control) and Alzheimer disease (AD) (gray columns) subjects. Values indicate mean mRNA copy number ± SEM (adjusted by cyclophilin mRNA copy number) of these genes in the whole temporal lobe or in specific regions (inferior, medial and superior) of the temporal lobe. (*, p≤0.05; **, p≤0.01).

Figure 1

Figure 2

Figure 3

ARTICLE IV

A novel human ghrelin transcript containing intron-2 (In2-ghrelin) as well as

Ghrelin-O-acyltransferase is over-expressed in breast cancer: pathophysiological relevance.

Manuel D. Gahete1, Raúl M. Luque1, Justo P. Castaño1.

1Dpt. of Cell Biology, Physiology & Immunology. Univ. of Córdoba, IMIBIC, and CIBERobn06/03,

Córdoba, Spain.

Running title: In2-ghrelin variant in breast cancer

Keywords: Ghrelin, splicing, In2-variant, GOAT, breast cancer

Address all correspondence and requests for reprints to:

Dr. Justo P. Castaño. Email: [email protected]. Tel: + 34 957 212256

Dr. Raul M. Luque. Email: [email protected]. Tel: + 34 957 218594

Dpt. de Biología Celular, Fisiología e Inmunología. Edif. Severo Ochoa. Planta 3.

Campus Univ. Rabanales, 14014-Córdoba, Spain.

Abstract The human ghrelin/obestatin gene contains 5 exons(Ex), with Ex2-Ex4 encoding a 117 amino-acid(aa) preproprotein that is processed to yield a 28-aa(ghrelin) and/or a 25- aa(obestatin) mature peptides which have biological activities in multiple tissues. However, the ghrelin/obestatin gene encodes several additional peptides, generated by alternative splicing or post-translational modifications. Our laboratory has recently identified a spliced mRNA ghrelin variant in the mouse containing Ex2, intron(In)2 and Ex3, but lacking Ex1,4 and 5 (named In2-ghrelin variant), which may be of biological relevance because its expression is regulated in a tissue-dependent manner in response to metabolic status. In the present work, we have identified a new ghrelin variant in humans which contains Ex0-1, In2, and Ex2 but lacks Ex3-4, which would encode a new prepropeptide that conserves the signal peptide and the first 12aa of native-ghrelin (including the Ser3-octanoylation) while having a different C-terminal tail. The expression of In2-variant was detected in 22 human tissues and its expression levels were positively correlated with ghrelin-O-acyltransferase (GOAT; R2=0,921) but not native-ghrelin (R2=- 0,025) expression, suggesting that In2-ghrelin could be a primary substrate for GOAT in human tissues. Interestingly, the level of In2-ghrelin variant expression in breast cancer samples was 8-times that of normal mammary tissue (P0.01), and correlated with GOAT (R2=0,655) and ghrelin receptor type 1b (GHSR-1b; R2=0,403), but not native-ghrelin or GHSR1a expression. These data together with the fact that In2-ghrelin variant overexpression increased the basal proliferation of MDA-MB-231 breast cancer cells, suggest that the In2-ghrelin may play a relevant role in breast cancer pathology.

Introduction Ghrelin is a multifunctional 28-amino acids (aa) hormone mainly produced in the stomach (1), but it is also expressed by a wide variety of tissues where it can act as a paracrine or autocrine factor (2-4). Ghrelin can be acylated by the ghrelin O- acyltransferase (GOAT) enzyme (5, 6), and this form of ghrelin has been recognized as the natural ligand of the type 1a growth hormone secretagogue receptor (GHSR1a) (1). To date, multiple physiological functions have been directly associated to the acyl- ghrelin/GHSR1a system, many of them related to regulation of energy balance and metabolic function at the central and peripheral level (7, 8). In addition, ghrelin expression has been detected (at mRNA and protein levels) in many endocrine and non-endocrine tumor cell types (i.e. gastroenteropancreatic, pulmonary, pituitary, testicular, ovarian, prostate and breast tumors), as well as in their related cancer cell lines, where ghrelin has been shown to control neoplastic cell proliferation (9-17). Interestingly, a truncated isoform of GHSR1a, referred to as GHSR type 1b (GHSR1b), has also been found in the majority of the tumors and cancer cell lines cited above, however, the precise role that GHSR1b plays in tumor regulation remains unknown (15, 18-20). Human ghrelin is encoded in the GHRL gene, whose transcription originates a 117 residues immature prepro-peptide (prepro-ghrelin) that can be acylated by the GOAT enzyme to be further processed by prohormone convertases (PC1, PC7, Furin), resulting in acyl-ghrelin or desacylated-ghrelin (DAG) (21, 22). Originally, human GHRL was thought to span 5kb on chromosome 3, with a 20 bp non-translated Exon (Ex; termed Ex0) and four coding Ex (Ex1-4). The prepro-ghrelin signal peptide is encoded by Ex1, and the coding sequence (CDS) of the mature ghrelin hormone is encoded by Ex2 and Ex3 (22). However, recent studies have demonstrated that prepro-ghrelin mRNA also encodes obestatin (23). The tissue- and cell-specific expression, as well as biological effects of obestatin, differs from that exhibited by ghrelin (24-26). In addition to ghrelin and obestatin, other peptides may also be encoded by the human GHRL, because re-examination of the genomic structure revealed that this gene spans 7.2 kb (27-29), with a novel upstream Ex-1 and extended exonic regions of Ex0 and Ex1 (27). Multiple tissue-specific, alternatively spliced

transcripts generated by the upstream exons have been recently identified, many lacking regions encoding ghrelin or obestatin and some encoding unique ghrelin/obestatin- derived transcripts including ex1-proghrelin, ex1-2-proghrelin, ex1-3-proghrelin (29). Also an alternative splice site in the intron (In)-2 of the human and rodent ghrelin genes have been identified, which results in the translation of a biologically active peptide identical to mature ghrelin except for the loss of a single glutamine residue at position14 (named des-Gln14-ghrelin) (30, 31). In addition, ghrelin transcript lacking the exon that encodes obestatin (named Ex3-deleted ghrelin in humans, and Ex4-deleted ghrelin in mice) was identified and found to be highly expressed in human breast and prostate cancer tissues and derived-cell lines (12, 17, 32). Therefore, it is now appreciated that the human ghrelin gene is regulated at multiple levels to yield transcripts and proteins of diverse function which can have their homologous counterparts in other mammalian species. Previously, our group has described a murine ghrelin transcript that retains In2, Ex2 and Ex3, but lacks Ex1, Ex4 and Ex5, and was named In2-ghrelin (33). Although translation of In2-ghrelin mRNA has not been demonstrated, the mRNA expression is 10- and 50-fold greater than that of the native-ghrelin in the pituitary and the hypothalamus, respectively. Importantly, In2-ghrelin mRNA levels where found to be regulated under extreme metabolic conditions (fasting and obesity) (33), and expression levels paralleled those of GOAT mRNA (34), suggesting that In2-ghrelin may be a primary substrate for GOAT. In that the sequence of In2 in the human and mouse ghrelin genes show high homology (29, 35), and the fact that intron 2 of human ghrelin possesses the typical hallmarks of retained introns (i.e., to be short introns flanked by weak splice sites) (36), the objective of the present work was to determine if In2 is also retained in the human ghrelin gene transcript and if so, to compare and contrast the tissue distribution of this putative transcript with that of native-ghrelin, and genes critical with ghrelin peptide modification (GOAT) and function (GHS-R1a and GHS-R1b). This manuscript demonstrates the existence of a new spliced mRNA variant of the human GHRL that retains In2 (named In2-ghrelin) which is present in a variety of human tissues and to be regulated in human breast cancer.

Patients and methods Patients and samples A commercial panel of total RNA from various human tissues was obtained from Clontech (Human Total Master Panel II and human pituitary gland poly-A RNA; Palo Alto, CA). A group of 40 sporadic invasive ductal breast carcinomas and 4 normal breast samples were obtained from Tumour Bank-CNIO (Madrid). The mean patient age at surgery was 53 years (range, 27 to 87 years). This study was approved by the Ethics Committee of the University of Cordoba, and the Tumour Bank-CNIO (Madrid). Informed consent was obtained from each patient before study entry. Cell lines As previously reported (37), MDA-MB-231 cell line (ATCC, Manassas, VA) was maintained in Dulbecco’s Modified Eagle Medium (DMEM) supplemented with 10% fetal bovine serum (FBS), 1% antibiotic-antimycotic and 2mM L-glutamine at 37º C and 5% CO2. For in vitro treatments, cells were cultured during 24h with DMEM complemented with charcoal-treated serum containing 10-7M of ghrelin, DAG, estradiol, tamoxifen, somatostatin (SST) or cortistatin (CST). RNA isolation and reverse transcription (RT) Nucleic acids were isolated with Trizol (Invitrogen, Barcelona, Spain) following the manufacturer’s instructions and treated with DNase as previously described (38, 39). The amount of RNA recovered was determined using the Ribogreen RNA quantification kit (Molecular Probes, Eugene, OR, USA). Total RNA (2µg) was reverse transcribed (RT) with the cDNA First-Strand Synthesis kit (Fermentas, Hanover, MD, USA). Primer selection and standard or quantitative real- time RT-PCR (qrtRT-PCR)

Primers used for standard PCR and qrtRT-PCR (Supplemental table 1 and 2) were selected using the human ghrelin gene sequence as template (GeneID: NM_016362) and primer3 software (http://frodo.wi.mit.edu). For standard PCR, 2X Master Mix PCR reagent (MRI-Fermentas) and brain cDNA were used following the manufacturer’s recommendations. The thermocycling profile consisted of one cycle of 94ºC for 4min, followed by 30-40 cycles of 94ºC (30sec), 58-62ºC (depending on the primer set; 30sec), and 72º (30-60s; depending on the product size), and a final cycle of 72ºC during 5min. Absolute expression levels of ghrelin, In2-ghrelin variant, GOAT, GHS-R1a and GHS-R1b was screened by qrtRT-PCR using specific primers (Supplemental table 2). Details regarding selection of primers, verification of primer specificity, confirmation of primer efficiency, construction of standard curves for each transcript as well as the details of the development, validation, and application of a qrtRT-PCR to measure expression levels of different human genes have been reported previously (40). The final volume of the PCR reaction was 25 µl including 100ng of sample and 12.5ml of IQ™ SYBR Green Supermix (Biorad). The thermocycling profile consisted of 40 cycles at 94º C (30s), 61º C (30s), and 72º C (30s). To determine the starting copy number of cDNA, we used a specific standard curve of each transcript run in the same plate. Non-RT RNA samples and non-DNA controls were run on each plate to control for genomic DNA or exogenous contamination, respectively. Final PCR products were subjected to graded temperature-dependent dissociation to verify that only one product was amplified. PCR products were then run on 2% agarose gel containing ethidium bromide to confirm that only one band, of the expected size, were amplified. All PCR products were then column-purified (Bioneer Inc., CA, USA) and sequenced to confirm target specificity. To control for variations in the amount of RNA used, the expression level of one housekeeping gene (beta-actin) was determined for each sample where beta-actin copy number was not altered between experimental groups (data not shown). Cloning of In2-ghrelin variant and transfection of breast cancer cell lines PCR amplification of the full coding sequence of In2-ghrelin variant was done using cDNA of MDA-MB-231 cells as template, Sn-520 and As-953 primers (Supplemental table 1), and the high-fidelity-polymerase i-MAXII (iNtRON Biotechnology, Seongnam, Korea). The PCR product was directly cloned into pGEM-t vector (Promega, Madrid, Spain) to be further subcloned into the pCDNA3.1+ vector (Invitrogen) using an specific set of primers with the HindIII and BamHI restriction sites, respectively (In2-Hind-Up: TCTCAAGCTTATGCCCTCCCCAGGGAC and In2-Bam-Low: TGTGGGATCCCTAGAGCTCGGGGCTGCAG). MDA-MB-231 cells were transfected using Lipofectamine-2000TM (Gibco, Barcelona, Spain) as previously reported (38, 41). Transient transfected with empty pCDNA3.1+ (mock transfected) MDA-MB-231 cells were used as negative control. In Vitro Proliferation Assays Basal cell proliferation was evaluated in mock- or In2-ghrelin variant transient transfected MDA-MB-231 cells using Alamar-Blue reagent (Biosource International) as previously reported using other transcripts (38, 41). Briefly, after transfection, 2000 mock- or In2-ghrelin variant transfected cells/well were seeded in a 96 well plate and cultured during 5 days. Then, cells were starved (serum-free media) during 24h and cellular proliferation rate was measured, every 24h, for the following 4 days. The day of measurement, cells were incubated for 3 hours in 10% alamar blue/ DMEM with 10% of FBS and then, alamar reduction was measured in a BioTek Synergy HT fluorescence plate reader (BioTek Instruments, Inc., Vermont, USA), exciting at 560 nm and reading at 590 nm. Medium with alamar blue was replaced and washed twice with fresh medium immediately after each measurement. Kinetics curves were fitted to exponential growth curves with GraphPad Prism 4 (GraphPad Software, San Diego, CA). Doubling time and K growing constant were calculated from these exponential curves and the results obtained in the In2-ghrelin variant transient transfected MDA-MB-231 cells were expressed as

percentage of control (mock-transfected cells). In all instances, cells were seeded per quadruplicate and the assays were repeated three times. Statistical analysis Samples from all patients, tissues or cell cultures within the same experiment were processed at the same time and therefore correlations between expression of transcripts in different tissues (Fig. 2 and 3) were assessed by bilateral (two-tailed) Pearson´s correlation test while variations between normal vs. tumoral breast samples (Fig. 3) were assessed by Student´s t-test. Effect of pCDNA (mock) or In2-ghrelin variant transfection on in vitro proliferation assays was assessed by two-way ANOVA followed by a Newman- Keuls test for multiple comparisons. P≤0.05 was considered significant. All values are expressed as means ± SEM.

Results

Identification of the human In2-ghrelin variant using standard RT-PCR As illustrated in Fig. 1A, the coding region of the human ghrelin gene (GHRL) consist of one noncoding (Ex0) and four coding (Ex1-Ex4) exons, where the 28-aa mature ghrelin is encoded by Ex1-Ex2, while the 25-aa mature obestatin is encoded by Ex3. In order to search for an In2-ghrelin variant in the human gene, we designed several sets of PCR primers located in Ex1 (sense) and Ex2 (antisense), thereby flanking In2 of the human GHRL gene (Figure 1B, sets 1-2). When brain cDNA was used as a template, two PCR bands were amplified by each primer set, one of the expected size for native-ghrelin (99bp and 239bp, respectively) and one for the putative In2-ghrelin variant (293bp and 433bp, respectively) (Figure 1B-C). Sequencing of the PCR products confirmed the lower bands (99 and 293bp) corresponded to native-ghrelin, while the higher bands (239 and 433bp) corresponded to a variant that retains the entire In2. Additionally, we designed a pair of primers that would exclusively amplify the In2-variant using an antisense primer located entirely in the intronic region (Figure 1B, set 3), resulting in a single band of the expected size and sequence (215bp; Figure 1D), while no bands were amplified in non- retrotranscribed and non-cDNA control, demonstrating that the band observed was not the consequence of genomic or external contamination, respectively. In order to study if other exons, different to Ex1-2, are present in the novel human In2-ghrelin mRNA variant, we selected primers located in Ex0, 3, and 4 (Figure 1B, sets 4-8 and Figure 1E-H) and combined these with primers in Ex1 and 2. PCR products obtained with these combinations of primers revealed that human In2-ghrelin variant comprises Ex0, Ex1, In2 and Ex2, but lacks Ex3 and Ex4. This novel sequence of the In2-ghrelin variant was submitted to Genbank (accession #: GU942497). Since In2-variant and native-ghrelin share the Ex0 and 1, it is tempting to propose that the human In2-ghrelin variant shares the same start codon as native-ghrelin, located in the Ex1. If this were correct, translation of In2-ghrelin variant mRNA would encode a 117aa protein (prepro-In2-ghrelin), sharing the first 36aa of native-prepro-ghrelin, including the signal peptide (24aa: MPSPGTVCSLLLLGMLWLDLAMA) and the first 12aa of the mature native-ghrelin, which include the putative acylation site at Ser3. However, as occurred with the mouse In2-ghrelin variant (33), the reading frame of the human In2- ghrelin variant would be altered by the intron retention, thereby encoding a completely novel C-terminal tail where the obestatin would not be produced. Interestingly, in addition to human and mouse, we also identified the In2-ghrelin variant in a primate model (baboon, Papio Anubis) (Supplemental Fig. 1). Comparisons of human, baboon and mouse In2-ghrelin variants show the existence of a high inter-specific homology (at mRNA and protein level). Using a prepropeptide cleavage sites finder software (ProP 1.0 Server software), we have found various putative cleavage sites (i.e., Arg-42 and Lys-63) located in the human prepro-In2-ghrelin, which exhibit a similar cleavage score than the cleavage sites located in the prepro-ghrelin/obestatin precursor, whose processing would generate

ghrelin and obestatin. Although, it would be predicted that the first 12aa of native-ghrelin would be retained in a peptide encoded by In2-ghrelin transcript, use of two commercially available antibodies directed against this epitope [Rabbit Anti-Human Ghrelin, Alpha Diagnostic, San Antonio, TX (Cat. # GHS11-S) and Chicken Anti-Human Ghrelin, GeneTex, Inc., Irvine, CA (Cat. # GTX15861, USA)] failed to detect either native-ghrelin or In2 ghrelin (data not shown). mRNA expression levels of In2-ghrelin variant in human tissues In order to analyze the presence and abundance of In2-ghrelin variant in human tissues, we used the primer set 3 shown in Fig1B, and supplemental table 2 in qrtRT-PCR to exclusively amplify this transcript. Result of qrtRT-PCR using a variety of human tissues as templates showed that In2-ghrelin variant was expressed in the 22 tissues analyzed. However, the expression levels were quite variable (Figure 2A), where In2-ghrelin variant mRNA was abundantly expressed in thymus but also in several endocrine organs such as pituitary and stomach. We also measured the expression levels of native-ghrelin, GOAT, GHS-R1a and GHS-R1b, in the same human samples and the results are shown in Fig. 2B and table 1. Interestingly, we observed that expression levels of native-ghrelin and In2- ghrelin variant did not share a tissue-specific expression pattern (Pearson´s coefficient= - 0,041) (Figure 2D-E). However, when comparing the expression levels of each ghrelin transcripts to GOAT, we found a strong correlation between In2-ghrelin variant and GOAT levels (Pearson´s coefficient= 0,921; Figure 2C and E) in all the tissues analyzed, while there was no significant correlation between native-ghrelin and GOAT (Pearson´s coefficient= -0,025; Figure 2E). Finally, our data showed that mRNA expression levels of both ghrelin receptors (GHS-R1a and R1b) did not correlate with native or In2-variant ghrelin in the human tissues analyzed (Figure 2E).

In2-ghrelin variant is overexpressed in breast cancer samples. qrtRT-PCR results showed that In2-ghrelin variant is expressed in normal mammary gland (595 copies) and, surprisingly, the expression levels of In2-ghrelin variant were found to be 8-fold up-regulated in a battery of 40 sporadic invasive ductal breast carcinomas compared with their matched controls samples (p=0,0042) (Fig. 3A; Table 2). In contrast, expression levels of native-ghrelin did not differ between normal mammary and breast cancer samples (Fig 3A; Table 2); however, the mRNA levels of GOAT were up-regulated in breast cancer samples (Fig. 3A), and were significantly correlated with the expression levels of In2-ghrelin variant (Pearson´s coefficient= 0,655; p≤0,001; Figure 3B-C). mRNA levels of GHS-R1a were low (less than 10 copies) in both normal and tumoral breast samples (Fig. 3A; Table 2), and no significant differences were found between those experimental groups. Interestingly, the expression of GHS-R1b were not detected in normal mammary samples but were highly expressed in breast cancers samples (more than 350 copies) (Figure 3A; Table 2). Although GHS-R1a mRNA levels do not correlate with native-ghrelin or In2-ghrelin variant levels, we found that expression levels of GHS-R1b parallels with In2-ghrelin [two-tailed-Pearson´s coefficient=0,403; p=0.097 and one-tailed-Pearson´s coefficient=0,403; p=0.049] but not with native-ghrelin (Pearson´s coefficient= 0,122) mRNA levels (Figure 3B-C).

In2-ghrelin variant increases the proliferation rate of MDA-MB-231 cells and its expression is regulated by ghrelin and tamoxifen. To study the in vitro action and regulation of In2-ghrelin transcript, we used a breast cancer cell line, MDA-MB-231, which expresses In2-ghrelin variant, GOAT and GHS- R1b transcripts at high levels while the expression of native-ghrelin and GHS-R1a were almost undetectable (Table 2), a pattern that was similar to that observed in primary breast cancers. In vitro kinetic proliferation assays using MDA-MB-231 cells transfected with In2-ghrelin variant or empty vector (mock-control) indicated cells that over-express In2-ghrelin variant have a higher proliferative rate compared with mock-transfected cells

(Figure 4A). Specifically, cells that over-express In2-ghrelin variants exhibited a lower doubling time than mock-transfected cells (1,21 days vs. 1,43 days, respectively) being these differences statistically significant at 2, 3, and 4 days after serum starvation (p≤0,05, p≤0,01, and p≤0,001, respectively). Strikingly, expression levels of the native-ghrelin and In2-ghrelin variant transcripts were divergently regulated where treatment (24h) with acylated-ghrelin or DAG increased native-ghrelin mRNA levels, while In2-ghrelin variant levels were reduced, although the negative impact of DAG did not reach statistical significance (Figure 4B). Tamoxifen treatment tended to increase native-ghrelin expression but significantly reduced In2-ghrelin variant mRNA levels, while estradiol treatment did not alter the expression levels of native-ghrelin or In2-ghrelin variant (Figure 4B). It should be noted that expression levels of GOAT, GHS-R1a and GHS-R1b were not significantly altered in MDA-MB-231 with these treatments (Data not shown).

Discussion The results of the current study indicated the human ghrelin gene, similar to that reported in the mouse gene (33), can retain In2, one type of alternative splicing likely associated with the failure of intron detection which occurs more frequently in short introns flanked by weak splice sites (36). Specifically, human In2-ghrelin variant contains Ex0, Ex1, In2 and Ex2 but lacks Ex3 and Ex4. Given the fact that the In2-variant and native- ghrelin share the Ex0 and 1, we speculate that both share the same start codon, located in the Ex1. If this were the case, the first 36aa of the prepro-In2-ghrelin, including the signal peptide, and the first 12aa of the mature native-ghrelin, including the putative acylation site at Ser3, would be identical to that encoded by the native-prepro-ghrelin mRNA. However, as occurred with the mouse In2-ghrelin variant, the reading frame of the human In2-ghrelin variant would be altered by the intron retention, encoding a completely novel C-terminal tail where obestatin would not be produced. Specifically, the novel preproIn2- ghrelin would possess a C-terminal tail with various putative cleavage sites which exhibit a similar cleavage score than the cleavage sites located in the prepro-ghrelin/obestatin precursor whose processing would generate ghrelin and obestatin, suggesting that different peptides could be processed from the In2-ghrelin variant. Interestingly, baboon ghrelin gene also undergoes processes of In2-retention which together with the fact that In2-ghrelin variants are highly conserved across species suggests that relevant functional parallels of this novel transcript may have occurred through mammal’s evolution. It is becoming recognized that the GHRL gene is very complex and can be regulated at multiple levels (27, 29, 42). In fact, several peptides are generated by alternative splicing of the ghrelin gene or by post-translational modifications (e.g. obestatin…) (21, 22, 27-29). Our data demonstrate that a In2-ghrelin variant transcript is processed from the GHRL gene, similar to that previously reported in the mouse (33), and it is expressed in a wide variety of human tissues, suggesting this novel variant could be physiologically relevant and exert important biological actions in humans. Interestingly, expression levels of human native-ghrelin and In2-ghrelin variant were not correlated in the normal tissues studied, suggesting that the transcription of both variants could be differentially regulated in human tissues. Indeed, splice site recognition depends on several factors, such as mRNA regulatory elements or protein factors (43), which could modulate the expression of intron retaining and intron spliced isoform in a tissue-dependent manner (44-46). Of note, we clearly observed that expression levels of In2-ghrelin variant, but not of native-ghrelin, were strongly correlated with GOAT mRNA levels in human tissues. Given the possibility that translation of In2-ghrelin variant would produce a prepro-peptide having the first 12aa similar to that of native-ghrelin, including the Serine-3 that is octanoylated by GOAT enzyme, it is reasonable to suggest that In2-ghrelin variant may be a primary substrate for GOAT in human tissues. This idea will be in keeping with a recent report showing that In2- ghrelin variant may also be a primary substrate for GOAT in mice (34), since its expression clearly parallels changes in the expression level of GOAT in the pituitary of all mouse models analyzed (fasting, obesity and different knockout models), although it remains to

be determined if the putative novel protein of the human In2-ghrelin variant could be acylated by GOAT. Our data also indicate that In2-ghrelin variant could play relevant role in human breast cancer. Specifically, we observed that In2-ghrelin variant expression was strongly up-regulated in ductal breast cancer samples compared with normal breast tissue (8-fold increase). In accordance with our findings, a previous high-throughput sequencing analysis using tissues samples obtained from excised human breast tumors samples (47) identified an ORF expressed sequence tags (EST) (GenBank: BF929001.1) that shares 99% nucleotide sequence homology with the human In2-ghrelin variant identify in the present report. Since the study of Dias-Neto focused on clone central portions of expressed coding regions by PCR amplifications, the clone homologous to In2-ghrelin variant (BF929001.1) contain the complete In2 of human ghrelin gene, but not the complete 5´- and 3´-regions. These results strongly suggest that the partial sequence obtained by Dias Neto corresponds to the novel human In2-ghrelin variant reported herein. This report is the first to show that the GOAT enzyme is present in breast cancer tissues where GOAT mRNA levels were found to be significantly increased compared with normal human mammary gland samples. Similar to that observed in the battery of normal tissues analyzed, the absolute copy number of In2-ghrelin variant, but not of native- ghrelin, show a significant and positive strong correlation with GOAT expression in breast cancer, reinforcing the idea that In2-ghrelin variant could be the primary substrate for GOAT enzyme in these pathological circumstances. Our studies also demonstrate an upregulation of GHS-R1b which positively correlated with the expression of In2-ghrelin variant, while GHS-R1a and native-ghrelin were no significantly elevated in tumor samples. This latter finding is consistent with previous immunohistochemistry (IHC) results showing very low levels of native-ghrelin in the normal breast epithelium, with moderate elevation in breast cancer samples (12). It is interesting to mention that previous observations suggest GHS-R1b could have a dominant negative role, by binding and internalizing GHS-R1a (48), however the disproportionately high levels of GHS-R1b relative to GHS-R1a (60-fold) found in human breast cancer samples suggest this receptor may serves a different role in this pathology. Nonetheless, our data may be important for clinical purpose since this is the first report showing the presence of differential expression of the In2-ghrelin variant, GOAT and GHS-R1b in the breast cancer tissues which could represent potential novel markers as diagnostic/prognostic for breast pathogenesis. Intriguingly, we found that human breast cancer MDA-MB-231 cells were a good model to study the physiological relevance of the novel In2-ghrelin variant since the expression patterns of the ghrelin-axis in MDA-MB-231 cells were similar to that found in primary human breast cancer samples. Specifically, MDA-MB-231 cells expressed In2- ghrelin variant, GOAT and GHS-R1b while the expression of native-ghrelin and GHS-R1a was very low. Interestingly, we found that the expression of native-ghrelin and In2-ghrelin variant can be oppositely regulated by acylated-ghrelin and DAG. To our knowledge, this is the first report showing that ghrelin (acyl-ghrelin and DAG) can regulate its own synthesis (native-ghrelin and In2-ghrelin transcripts). Specifically, although native-ghrelin mRNA is expressed at very low levels in MDA-MB-231, treatment with both endogenous peptides (acyl-ghrelin and DAG) significantly up-regulate the expression levels of native-ghrelin while decreasing the expression of In2-ghrelin variant, the dominant ghrelin form in breast cancer cells, suggesting the existence of an auto-regulatory loop in this cell type. In addition to this regulatory loop, we also found that tamoxifen significantly reduce In2- ghrelin mRNA levels while trend to increase native-ghrelin mRNA levels in MDA-MB-231 cells. This latter observation may have patho-physiological implications in breast cancer because tamoxifen is currently used for the treatment of estrogen receptors (ER) positive breast cancers and ghrelin axis have been reported to exert relevant actions in cancer cells (12). Indeed, although tamoxifen is an ER blocker and MDA-MB-231 is an estrogen- independent breast cancer cell line, several studies have reported effects of tamoxifen and

other ER modulators such as raloxifene in ER-negative breast cancer cell lines via activation of several intracellular signaling pathways (PKC, PLD) through ER-independent mechanisms (49, 50). Finally, in support of a physiologically relevant role of In2-ghrelin variant in breast cancer, we demonstrated that overexpression of In2-ghrelin variant in MDA-MB-231 cells promote a robust increase in the proliferation rate as compared with mock-transfected cells suggesting that a blockade of the In2-ghrelin variant may have some therapeutic benefit. This results are also in keeping with previous reports showing that the ghrelin system is present in a wide range of cancer cell models where it can play a relevant role in controlling their proliferative rate in a paracrine/autocrine fashion (14, 15), including breast cancer cell lines (12) where it precise role is still controversial. Therefore, the present results extend the pro-proliferative role of native-ghrelin to its splice In2-ghrelin variant, which seems to influence cell proliferation through an autocrine/paracrine pathway.

References

1. Kojima M, Hosoda H, Date Y, Nakazato M, Matsuo H, Kangawa K. Ghrelin is a growth- hormone-releasing acylated peptide from stomach. Nature 1999;402(6762):656-60. 2. Leite-Moreira AF, Rocha-Sousa A, Henriques-Coelho T. Cardiac, skeletal, and smooth muscle regulation by ghrelin. Vitamins and hormones 2008;77:207-38. 3. Tena-Sempere M. Exploring the role of ghrelin as novel regulator of gonadal function. Growth Horm IGF Res 2005;15(2):83-8. 4. Lago F, Gonzalez-Juanatey JR, Casanueva FF, Gomez-Reino J, Dieguez C, Gualillo O. Ghrelin, the same peptide for different functions: player or bystander? Vitamins and hormones 2005;71:405-32. 5. Gutierrez JA, Solenberg PJ, Perkins DR, et al. Ghrelin octanoylation mediated by an orphan lipid transferase. Proc Natl Acad Sci U S A 2008;105(17):6320-5. 6. Yang J, Brown MS, Liang G, Grishin NV, Goldstein JL. Identification of the acyltransferase that octanoylates ghrelin, an appetite-stimulating peptide hormone. Cell 2008;132(3):387-96. 7. Horvath TL, Diano S, Sotonyi P, Heiman M, Tschop M. Minireview: ghrelin and the regulation of energy balance--a hypothalamic perspective. Endocrinology 2001;142(10):4163-9. 8. van der Lely AJ, Tschop M, Heiman ML, Ghigo E. Biological, physiological, pathophysiological, and pharmacological aspects of ghrelin. Endocrine reviews 2004;25(3):426-57. 9. Ekeblad S, Lejonklou MH, Grimfjard P, et al. Co-expression of ghrelin and its receptor in pancreatic endocrine tumours. Clinical endocrinology 2007;66(1):115-22. 10. Gaytan F, Barreiro ML, Caminos JE, et al. Expression of ghrelin and its functional receptor, the type 1a growth hormone secretagogue receptor, in normal human testis and testicular tumors. J Clin Endocrinol Metab 2004;89(1):400-9. 11. Gaytan F, Morales C, Barreiro ML, et al. Expression of growth hormone secretagogue receptor type 1a, the functional ghrelin receptor, in human ovarian surface epithelium, mullerian duct derivatives, and ovarian tumors. J Clin Endocrinol Metab 2005;90(3):1798-804. 12. Jeffery PL, Murray RE, Yeh AH, et al. Expression and function of the ghrelin axis, including a novel preproghrelin isoform, in human breast cancer tissues and cell lines. Endocrine-related cancer 2005;12(4):839-50. 13. Lanfranco F, Baldi M, Cassoni P, Bosco M, Ghe C, Muccioli G. Ghrelin and prostate cancer. Vitamins and hormones 2008;77:301-24. 14. Leontiou CA, Franchi G, Korbonits M. Ghrelin in neuroendocrine organs and tumours. Pituitary 2007;10(3):213-25. 15. Nikolopoulos D, Theocharis S, Kouraklis G. Ghrelin's role on gastrointestinal tract cancer. Surgical oncology 2009. 16. Waseem T, Javaid Ur R, Ahmad F, Azam M, Qureshi MA. Role of ghrelin axis in colorectal cancer: a novel association. Peptides 2008;29(8):1369-76. 17. Yeh AH, Jeffery PL, Duncan RP, Herington AC, Chopin LK. Ghrelin and a novel preproghrelin isoform are highly expressed in prostate cancer and ghrelin activates mitogen-activated protein kinase in prostate cancer. Clin Cancer Res 2005;11(23):8295-303.

18. Barzon L, Pacenti M, Masi G, Stefani AL, Fincati K, Palu G. Loss of growth hormone secretagogue receptor 1a and overexpression of type 1b receptor transcripts in human adrenocortical tumors. Oncology 2005;68(4-6):414-21. 19. Carraro G, Albertin G, Abudukerimu A, Aragona F, Nussdorfer GG. Growth hormone secretagogue receptor subtypes 1a and 1b are expressed in the human adrenal cortex. International journal of molecular medicine 2004;13(2):295-8. 20. Takahashi K, Furukawa C, Takano A, et al. The neuromedin U-growth hormone secretagogue receptor 1b/neurotensin receptor 1 oncogenic signaling pathway as a therapeutic target for lung cancer. Cancer research 2006;66(19):9408-19. 21. Garg A. The ongoing saga of obestatin: is it a hormone? J Clin Endocrinol Metab 2007;92(9):3396-8. 22. Zhu X, Cao Y, Voogd K, Steiner DF. On the processing of proghrelin to ghrelin. The Journal of biological chemistry 2006;281(50):38867-70. 23. Zhang JV, Ren PG, Avsian-Kretchmer O, et al. Obestatin, a peptide encoded by the ghrelin gene, opposes ghrelin's effects on food intake. Science 2005;310(5750):996-9. 24. Karaoglu A, Aydin S, Dagli AF, et al. Expression of obestatin and ghrelin in papillary thyroid carcinoma. Molecular and cellular biochemistry 2009;323(1-2):113-8. 25. Tsolakis AV, Grimelius L, Stridsberg M, et al. Obestatin/ghrelin cells in normal mucosa and endocrine tumours of the stomach. Eur J Endocrinol 2009;160(6):941-9. 26. Volante M, Rosas R, Ceppi P, et al. Obestatin in human neuroendocrine tissues and tumours: expression and effect on tumour growth. The Journal of pathology 2009. 27. Seim I, Collet C, Herington AC, Chopin LK. Revised genomic structure of the human ghrelin gene and identification of novel exons, alternative splice variants and natural antisense transcripts. BMC genomics 2007;8:298. 28. Seim I, Amorim L, Walpole C, Carter S, Chopin LK, Herington AC. Ghrelin gene-related peptides: multi-functional endocrine/autocrine modulators in health and disease. Clinical and experimental pharmacology & physiology 2009. 29. Seim I, Herington AC, Chopin LK. New insights into the molecular complexity of the ghrelin gene locus. Cytokine & growth factor reviews 2009. 30. Hosoda H, Kojima M, Matsuo H, Kangawa K. Purification and characterization of rat des- Gln14-Ghrelin, a second endogenous ligand for the growth hormone secretagogue receptor. The Journal of biological chemistry 2000;275(29):21995-2000. 31. Hosoda H, Kojima M, Mizushima T, Shimizu S, Kangawa K. Structural divergence of human ghrelin. Identification of multiple ghrelin-derived molecules produced by post-translational processing. The Journal of biological chemistry 2003;278(1):64-70. 32. Jeffery PL, Duncan RP, Yeh AH, et al. Expression of the ghrelin axis in the mouse: an exon 4- deleted mouse proghrelin variant encodes a novel C terminal peptide. Endocrinology 2005;146(1):432-40. 33. Kineman RD, Gahete MD, Luque RM. Identification of a mouse ghrelin gene transcript that contains intron 2 and is regulated in the pituitary and hypothalamus in response to metabolic stress. J Mol Endocrinol 2007;38(5):511-21. 34. Gahete MD, Cordoba-Chacon J, Salvatori R, Castano JP, Kineman RD, Luque RM. Metabolic regulation of ghrelin O-acyl transferase (GOAT) expression in the mouse hypothalamus, pituitary, and stomach. Molecular and cellular endocrinology 2010;317(1-2):154-60. 35. Seim I, Carter SL, Herington AC, Chopin LK. The proximal first exon architecture of the murine ghrelin gene is highly similar to its human orthologue. BMC research notes 2009;2(1):85. 36. Sakabe NJ, de Souza SJ. Sequence features responsible for intron retention in human. BMC genomics 2007;8:59. 37. Sarrio D, Palacios J, Hergueta-Redondo M, Gomez-Lopez G, Cano A, Moreno-Bueno G. Functional characterization of E- and P-cadherin in invasive breast cancer cells. BMC cancer 2009;9:74. 38. Duran-Prado M, Gahete MD, Martinez-Fuentes AJ, et al. Identification and characterization of two novel truncated but functional isoforms of the somatostatin receptor subtype 5 differentially present in pituitary tumors. J Clin Endocrinol Metab 2009;94(7):2634-43. 39. Martinez-Fuentes AJ, Moreno-Fernandez J, Vazquez-Martinez R, et al. Ghrelin is produced by and directly activates corticotrope cells from adrenocorticotropin-secreting adenomas. J Clin Endocrinol Metab 2006;91(6):2225-31.

40. Taboada GF, Luque RM, Bastos W, et al. Quantitative analysis of somatostatin receptor subtype (SSTR1-5) gene expression levels in somatotropinomas and non-functioning pituitary adenomas. Eur J Endocrinol 2007;156(1):65-74. 41. Cordoba-Chacon J, Gahete MD, Duran-Prado M, et al. Identification and characterization of new functional truncated variants of somatostatin receptor subtype 5 in rodents. Cell Mol Life Sci 2010. 42. Soares JB, Leite-Moreira AF. Ghrelin, des-acyl ghrelin and obestatin: three pieces of the same puzzle. Peptides 2008;29(7):1255-70. 43. Matlin AJ, Clark F, Smith CW. Understanding alternative splicing: towards a cellular code. Nature reviews 2005;6(5):386-98. 44. Galante PA, Sakabe NJ, Kirschbaum-Slager N, de Souza SJ. Detection and evaluation of intron retention events in the human transcriptome. RNA (New York, NY 2004;10(5):757-65. 45. Popielarz M, Cavaloc Y, Mattei MG, Gattoni R, Stevenin J. The gene encoding human splicing factor 9G8. Structure, chromosomal localization, and expression of alternatively processed transcripts. The Journal of biological chemistry 1995;270(30):17830-5. 46. Ledee DR, Chen J, Tonelli LH, Takase H, Gery I, Zelenka PS. Differential expression of splice variants of chemokine CCL27 mRNA in lens, cornea, and retina of the normal mouse eye. Molecular vision 2004;10:663-7. 47. Dias Neto E, Correa RG, Verjovski-Almeida S, et al. Shotgun sequencing of the human transcriptome with ORF expressed sequence tags. Proc Natl Acad Sci U S A 2000;97(7):3491-6. 48. Leung PK, Chow KB, Lau PN, et al. The truncated ghrelin receptor polypeptide (GHS-R1b) acts as a dominant-negative mutant of the ghrelin receptor. Cellular signalling 2007;19(5):1011-22. 49. Boyan BD, Sylvia VL, Frambach T, et al. Estrogen-dependent rapid activation of protein kinase C in estrogen receptor-positive MCF-7 breast cancer cells and estrogen receptor-negative HCC38 cells is membrane-mediated and inhibited by tamoxifen. Endocrinology 2003;144(5):1812- 24. 50. Eisen SF, Brown HA. Selective estrogen receptor (ER) modulators differentially regulate phospholipase D catalytic activity in ER-negative breast cancer cells. Molecular pharmacology 2002;62(4):911-20.

Figure legends

Figure 1: Schematic representation of the human In2-ghrelin variant. (A) Classical organization of human ghrelin-obestatin gene consisting of 5 exons (Ex0-4) and 4 introns (In1-4). Structure of prepro-ghrelin/obestatin and prepro-In2-ghrelin mRNA precursors is also indicated. (B) Schematic diagram showing the primer position (indicated with arrows) used to detect, clone and/or quantitatively amplify the human In2-ghrelin. Exons are represented as boxes and introns as lines. (C-H) PCR products separated on agarose gel. (I) Nucleotide and aminoacid sequences of In2- ghrelin. In-2 sequence and the putative start and stop codons are underlined.

Figure 2: Tissue distribution of the human In2-ghrelin variant. (A) Quantitative expression levels on In2-ghrelin. (B) PCR bands of ghrelin-axis transcripts amplified from human tissues, where lane order corresponds to the order shown in panel A. Correlation between In2-ghrelin and GOAT (C) or native-ghrelin (D) expression in human tissues. (E) Correlations values between In2-ghrelin and/or native-ghrelin with GOAT and GHSR1a/1b expression in human tissues.

Figure 3: In2-ghrelin variant in human breast samples. (A) Quantitative expression levels of the ghrelin-axis in normal and breast cancer samples. Values are shown as the mean ± S.E.M (* P<0.05, ** P<0.01; indicate differences from controls). (B) Correlations between In2-ghrelin and ghrelin, GOAT, GHSR1a/1b expression in breast cancer samples. (C) Correlations values between In2- ghrelin and/or native-ghrelin with GOAT, GHSR1a/1b expression in breast cancer samples.

Figure 4: Effect and expression regulation of In2-ghrelin variant in MDA-MB-231 cells in vitro. (A) Proliferation kinetics of MDA-MB-231 transfected with In2-ghrelin or control-mock. (B) Regulation of native-ghrelin and In2-ghrelin expression in MDA-MB-231. The data represent the means ± SEM. Asterisks (* P<0.05, ** P<0.01, *** P<0.001; indicate differences from controls).

Table 1 Absolute mRNA copy number of ghrelin axis components in human tissues In2- Tissue Ghrelin GOAT GHSR1a GHSR1b B-actin ghrelin Bone Marrow 4750 720 1150 n.d. 2 1880000 Brain 1783 1140 1170 13 1 2680000 Fetal Brain 879 1740 2500 259 23 5470000 Fetal Liver 1287 84 1360 n.d. n.d. 1010000 Heart 1689 365 1400 n.d. 2 677000 Kidney 6235 1140 972 n.d. 1 2430000 Liver 788 295 658 n.d. n.d. 837000 Lung 3427 778 2360 12 3 5330000 Placenta 928 512 1680 3 19 2150000 Prostate 1434 969 953 n.d. 4 1370000 Skeletal Muscle 433 361 154 n.d. 2 243000 Spleen 4498 615 2580 n.d. 1 2440000 Testis 2341 2490 1270 186 19 2900000 Thymus 3618 6520 17200 2 3 6690000 Trachea 2100 510 421 5 3 1730000 Uterus 1218 975 1510 n.d. 2 5730000 Colon 980 641 1080 11 3 3460000 Small Intestine 18516 985 1040 11 2 3350000 Spinal Cord 2756 1050 907 292 11 3570000 Stomach 44229 680 1630 15 8 2360000 Pituitary 634 129 732 3060 554 313000

Table 2 Expression level of ghrelin axis in breast tissues and cell lines In2-ghrelin Ghrelin GOAT GHSR1a GHSR1b Normal breast 595 442 202 3 n.d. Tumoral breast 5155 664 991 6 373 MDA-MB-231 5783 3 552 3 193 Values represent mean copy number of each transcript per 100ng of total mRNA

ARTICLE V

The sst5 truncated isoform, sst5TMD4, is expressed in primary breast cancer samples and increases the malignancy of breast MCF-7 cells.

Manuel D Gahete1, Raúl M Luque1, Justo P Castaño1

1Dept. Cell Biology, Physiology & Immunology. Univ. Córdoba, 14014, Spain

Corresponding author and request for reprints:

Dr. Justo P. Castaño Department of Cell Biology, Physiology and Immunology Edificio Severo Ochoa. Planta 3. Campus de Rabanales. University of Córdoba E-14014 Córdoba Spain. Phone: +34 957 21 85 94 Fax: +34 957 218634 E-mail: [email protected]

*These authors equally contributed to this work

Running title: truncated somatostatin receptor sst5TMD4 and breast cancer

Summary The activation of somatostatin receptors, ssts, leads to the inhibition of cellular processes including proliferation and invasion. ssts are expressed in normal tissues and highly expressed in tumors, including breast cancers. In this work, we show how a newly discovered sst, sst5TMD4, conversely increases the malignancy of MCF-7 breast cancer cells. Cells expressing the endogenous or transfected sst5TMD4, have increased P-ERK1/2 and P-Akt levels, and also an elevated expression of cyclin D1 and Arp2/3 complex, which leads to the acquisition of a mesenchymal-like phenotype, and to their enhanced invasion and proliferation abilities. In breast cancer samples, sst5TMD4 was found in aggressive tumors, were it is co-expressed with the sst2. sst5TMD4 interacts with sst2 and may promote this phenotypic and functional alteration by disrupting sst2 functioning, eliminating an inhibitory somatostatin feedback.

Significance The high expression of somatostatin receptors, ssts, in tumor cells, added to their antiproliferative effects after activation make them a suitable target for diagnose purposes, but also for the treatment of these pathologies with somatostatin and its analogues. Indeed, the use of sst2 preferring compounds as octreotide or lanreotide has been extensively used for fighting against the secretory/proliferative aspects of multiple kinds of neuroendocrine tumors, being a notably successful strategy. Thus, sst2 is considered a good prognosis factor. However, the use of somatostatin and its analogues in the treatment of breast cancer has not been as thriving as expected, even though sst2 is overexpressed in these tumors. In this paper, we describe the presence of a new player in the scene of ssts and breast cancer, sst5TMD4, which expression overlaps to that of sst2, and confers the cell more aggressive features.

INTRODUCTION Breast cancer is the most frequent type of cancer in women (27%) (Pollan et al., 2007) and the second most frequent neoplasia overall (Parkin et al., 2005), having an approximate 30% mortality rate (Orlando et al., 2004; Parkin et al., 2005). Far away from eradicating, its incidence is estimated to increase in a 10% in industrialized world in the next 7 years (Parkin et al., 2005), which is fortunately counteracted by a better prognosis and treatment, due to the effort at identifying new and earlier prognosis factors and specific molecular signatures (Dowsett et al., 2007). Among these molecular signatures somatostatin (SST) receptors or ssts stand out. Ssts receptors family is composed by five non-allelic intronless genes, encoding five seven transmembrane receptors, sst1-5, which are widely distributed in normal and tumor tissues (Moller et al., 2003). In addition, two new truncated variants of the sst5, originated by non classical splicing, have been recently discovered in human pituitary tumors (Duran-Prado et al., 2009). ssts, are densely expressed in breast cancer cells as well as in many other neuroendocrine tumors compared to their normal tissues (Weckbecker et al., 2003). More in detail, 50-70% of breast tumors are positive for at least one of the five ssts (Fekete et al., 1989; Reubi, 2003; Reubi et al., 1990; van Eijck et al., 1994) being sst2, overall, the most qualitative and quantitatively abundant in tumor cells (Orlando et al., 2004; Pilichowska et al., 2000; Pinzani et al., 2001; Reubi, 2003; Reubi et al., 2001; Schulz et al., 1998; Xu et al., 1996). Likewise, sst2 is considered a good prognosis factor, due to its association with low proliferative and invasive breast cancers (Orlando et al., 2004). ssts inhibit deregulated proliferation and invasion (Barresi et al., 2008; Kahan et al., 1999; Keri et al., 1996; Pola et al., 2003; Sun et al., 2007a). Inhibitory responses triggered by ssts after activation by their natural or synthetic ligands rely on their ability to turn on inhibitory cascades, by mechanisms dependent and independent of Gi/o proteins (Moller et al., 2003; Weckbecker et al., 2003). This includes the modulation of ERK/1/2 and Akt phosphorilation (Lahlou et al., 2003; Moller et al., 2003) which are the two major signal transduction pathways involved the transformation and enhanced proliferation and migration of cancer cells (Liu et al., 2007b; Santen et al., 2002; Shen and Brown, 2003). The antiproliferative effect of somatostatin in breast cancer cells, in vitro, is so long known (Setyono-Han et al., 1987). Similarly, sst appears effective at inhibiting proliferation and migration of prostate cancer cells and neuroblastoma cells through downregulation of Akt, or Akt and ERK cascades, respectively (Pola et al., 2003; Sun et al., 2007a). These effects are not restricted to in vitro cancer models. sst and their analogues also result effective, in vivo, inhibiting the growth of induced xenografts and animal tumors (Kahan et al., 1999; Keri et al., 1996) as well as combating the growth of neuroendocrine tumors, where it has been demonstrated that its efficiency is due to a downregulation of the ERK cascade (Hubina et al., 2006). The lost of sst2 expression in certain cancer cells is translated in the elimination of an autocrine inhibitory loop that lead to phenotypical and functioning alterations (Benali et al., 2000; Leu et al., 2008). In some instances, the elimination of the negative sst feedback mediated by sst2 resulted in epithelial to mesenchymal transition, EMT, and in increased cell proliferation (Leu et al., 2008). Similarly, in pancreatic cancer cells, the loss of the sst2 mediated autocrine sst-induced inhibition increases the proliferation and metastasis of these cells, in vivo and in vitro (Benali et al., 2000). In the present work, we propose that a new player in the system SST/ssts, the truncated isoform of sst5, sst5TMD4, is present in breast cancer and breaks the inhibitory SST signaling mediated by sst2 in these cells. We show that sst5TMD4 is qualitative and quantitatively positively correlated with sst2 expression in primary breast cancer samples, which pathological characteristics fit to the most aggressive/metastatic tumors analyzed. We have demonstrated by fluorescence resonance energy transfer, FRET, that these two receptors, sst2 and sst5TMD4, are interacting and form heterodimers. Moreover, their physical interaction is translated to an inhibition of sst2 function and functioning in both, CHO-K1 and MCF-7 cells, resulting in a blockade of calcium signaling and increased basal P-ERK and P-Akt levels. As consequence, sst5TMD4 expressing cells alter their morphology, showing increased invasion ability and proliferative rates, in vitro and in vivo in xenograft models.

RESULTS

Real time quantitative PCR and IHC analysis of breast cancer samples sst5TMD4 and sst2 expression levels were evaluated by real time PCR in 40 ductal breast carcinomas and 4 normal tissues. sst5TMD4 mRNA was detected in 28% of breast cancer samples and was expressed under the detection limit of real time PCR or not detected in the other samples, including negative controls. The pathological stage of each tumor was evaluated by immunohistochemical techniques, based in the presence of ER, p53 and Her2neu. The criterion to assess invasiveness was the metastases of cancer cells to lymph nodes. Comparison of sst5TMD4 expression with the pathological classification of each tumor, revealed that presence of sst5TMD4 was correlated with lower levels of ER (p=0.053), p53 (p=0.037) and Her2neu (p=0.038) (Figure 1). Additionally, the expression of sst5TMD4 was positively correlated with the most invasive/metastatic tumors (p≤0.001) (Figure 1). Accordingly with previous results, we detected that sst2 was ubiquitously expressed in both normal and tumor samples (supplemental Figure 1). Interestingly, in tumors expressing sst2 and sst5TMD4, the expression level of both receptors was positively correlated (R2=0.715) (Figure 2.A).

Interaction between sst5TMD4 and sst2 Due to the high correlation of sst5TMD4 and sst2 expression in the same tumors, we used a heterologous cell model, CHO-K1 cells, to ascertain the possible relevance of the interaction between sst2 and sst5TMD4 or between native sst5 and the truncated sst5TMD4. Confocal microscopy studies using recombinant forms of these receptors tagged with fluorescent proteins revealed that presence of sst5TMD4 is able to modify the subcellular localization of sst2 (Figure 2.B). Plasma membrane localization is mainly observed when sst2 is expressed alone in CHO-K1 cells, while sst5TMD4 exhibit a predominant intracellular distribution as previously reported (Duran-Prado et al., 2009). However, coexpression of both receptors in the same cell altered the localization of sst2 at the plasma membrane being mainly retained intracellularly (Figure 2.B). Similar results were obtained, by immnunocytochemistry, for the sst2 and sst5TMD4 endogenous receptors in the breast cancer cell model MCF-7 (Figure 2.C). We reproduced the same experiments with the wild type sst5 and sst5TMD4. The results indicate that sst5TMD4 is also capable to modify the subcelullar localization of sst5 when both receptors, transfected or endogenous, are coexpressed in CHO-K1 or MCF-7 cells, respectively (Figure 2.F and G). FRET technique was lately used to determine if sst5TMD4 and sst2 tagged with fluorescent proteins were able to interact. This approach revealed that the recombinant sst2 forms constitutive multimeric structures as shown by a FRET efficiency value of 67%, and recombinant sst5TMD4 also homodimerizes although with a lower FRET efficiency value (43%; supplemental Figure 2). To determine the ability of sst5TMD4 to modify sst2 homodimerization, competitive FRET assays were performed using CHO-K1 cells, transfected with a constant amount of tagged sst2 and increasing quantities of untagged sst5TMD4 (Figure 2.D). We observed that transfection with equimolecular concentrations of untagged sst5TMD4 reduced sst2 FRET efficiency in 35%, whereas a quantity 5-fold higher reduced this value in 63% (Figure 2.D). Furthermore, coexpresion and physical interaction of sst5TMD4 and sst2 was translated in a functional interaction. Specifically, application of a Ca2+ imaging approach by microflurimetry demonstrated that the capability of sst2 transfected CHO-K1 cells to increase the free cytosolic calcium concentration, [Ca2+]i, in response to SST-14 is reduced when cells also expressed sst5TMD4 (Figure 2.E). In contrast, sst5TMD4 failed to alter sst5 homodimerization and neither its capability to respond to SST-14 (Figure 2.H and I), thus, reinforcing the selectivity of the truncated receptor to regulate, specifically, the functioning of sst2.

Characterization of MCF-7 ssts expression profile To explore the role and functionality of sst5TMD4 in a homologous model, we used the breast cancer cell line MCF-7, which expresses sst2, sst5 and sst5TMD4. Interestingly, the expression pattern of truncated somatostatin receptor 5 was modified during culturing (Figure 3A). Specifically, we checked by PCR that the mRNA corresponding to sst5TMD4 completely disappeared after 10 passages (Figure 3.B), which was accompanied by an absence of protein (Figure 3C). On the other hand, sst2 and the wild type sst5 mRNA were not altered during culturing (Figure 3A). This feature allowed studying the role of endogenous sst5TMD4 in MCF-7 cell line, and studying the functioning of MCF-7 with or lacking sst5TMD4, without the needed of silencing its expression. Therefore, MCF-7 cells that endogenously expressed sst5TMD4 (“Initial passages”) and MCF-7 cells that lack its expression (“Final passages”) were compared to analyze the role of the endogenous sst5TMD4.

Measurement of [Ca2+]i in single MCF-7 cells Application of a Ca2+ imaging approach demonstrated that the presence or absence of sst5TMD4 in MCF-7 can modify the cellular response to somatostatin (SST). Administration of SST to cells that endogenously express sst5TMD4 (Initial passages) did not alter [Ca2+]i (Figure 3.D). However, caused a 20% reduction in the [Ca2+]i in more than 70% of cells that lacks sst5TMD4 (final passages, Figure 3.D). In order to check if this response was due to culturing, we also analyzed [Ca2+]i dynamics in MCF-7 cells stably transfected with sst5TMD4 or with the empty expression vector (mock). Accordingly, almost 80% of mock transfected MCF-7 cells reduced [Ca2+]i upon SST treatment but only 25% the cells transfected with sst5TMD4 inhibited [Ca2+]I after challenge with SST (Figure 3.E). These results suggest that the presence of sst5TMD4 in MCF-7 cells alters calcium signaling in response to SST-14.

MCF-7 cells phenotype MCF-7 stably transfected cells with or without sst5TMD4 where used to study if the presence of this receptor modified the typical epithelial cell phenotype of this breast cancer cell model. More than 20% of sst5TMD4-transfected MCF-7 cells exhibited a mesenchymal-like phenotype in contrast to the 5% of mock-transfected MCF-7 (Figure 3.F). Specifically, we observed that the expression of the epithelial marker E-cadherin was decreased in cells expressing sst5TMD4 (Figure 3.G). More in detail, we observed a 75% reduction of E-cadherin mRNA level in sst5TMD4-transfected MCF-7 compared with mock controls (P=0,0051; Figure 3.G, left panel). Accordingly, we also observed a significant reduction of E-cadherin protein in this cells (P=0,0086; Figure 3.G, right panel).

MAPKs and Akt fosforilation assays in MCF-7 cells with or without sst5TMD4 Inmunoblotting assays were performed to determine basal level of both, active/phosporilated ERK1/2 (P-ERK) and Akt (P-Akt) in MCF-7 cells expressing or lacking sst5TMD5. Western-blotting results showed that MCF-7 cells of “initial passages”, which express sst5TMD5, have higher levels of p-ERKs/ERKs (P=0.040) and p-Akt/Akt (P=0.002) compared to MCF-7 cells of “final passages” which lack sst5TMD4 (Figure 4.A and C, left panels). Similarly, sst5TMD4 stably transfected MCF-7 cells also exhibited higher levels of phosphorilation of both kinases compared with MCF-7 cells stably transfected with the empty vector, mock, (P=0.006 and P=0.003, respectively, Figure 4.C and D, left panels). Time-course experiments also showed differences in the regulation of these two kinase cascades between sst5TMD4-expressing and sst5TMD4-lacking cells in response to SST. Indeed, SST treatment leads to a decrease of basally elevated p-ERKs levels in MCF-7 cells of initial passages or in sst5TMD4-stably transfected cells, reaching the low levels observed in MCF-7 cells of final passages (40% reduction, P=0.021) or in MCF-7 cells stably transfected with empty vector (mock, 55% reduction, P=0.021), respectively. In contrast, SST treatment did not alter basal P-ERK levels of MCF-7 cells of final passages or stably transfected with empty vector (Figure 4A and B, right panels). Oppositely, PI3K-Akt pathway was inversely regulated by SST in MCF-7 cells. Specifically SST treatment leads to a 42 and 48% increase in p-Akt levels in cells expressing the endogenous or the transfected sst5TMD4, respectively (P=0.015 and P=0.042) while p-Akt levels were neither altered in sst5TMD4-lacking cells (Figure 4C and D, right panels).

Migration and invasion assays Invasion assays carried out in matrigel and collagen IV polycarbotate treated filters, showed that sst5TMD4-trasfected MCF-7, but not mock transfected cells cells, were able to invade (Figure 5.A). Specifically, mock trasfected MCF-7 cells were not able to invade, neither in matrigel nor in collagen coated filters (Figure 5.A), whereas invasion of sst5TMD4 expressing MCF-7 cells was enhanced by 48 and 35% compared to control in matrigel (P=0.032) and collagen (P=0.029) coated filters, respectively (Figure 5.A). Consistent with these results, wound healing assays carried out with the same MCF-7 cells showed that the ability to migrate after 24h was also higher in cells expressing sst5TMD4 than in mock transfected cells (P<0.001), indicating that the presence of sst5TMD4 increases the basal migration ability of MCF-7 cells (Figure 5.B, left graph). Treatment with SST did not modify the wound recovery ability of mock transfected cells. However, SST completely restored the migratory ability of MCF-7 cells expressing sst5TMD4 to the levels observed in mock transfected cells (Figure 5.B, right graph). We also measured the expression level of genes involved in cellular migration and invasion. Specifically, we quantified the expression of the actin-related protein (Arp) 2/3 complex, which enables the formation of new branched actin filament networks at the cell surface of migrating cells (Yamaguchi et al., 2005). Our results indicated that mRNA levels of three transcripts corresponding to the heptameric Arp2/3 complex, Arp2, Arp3 and p16, were overexpressed in sst5TMD4 expressing MCF-7 cells compared mock transfected cells (Figure 5.C). In particular, Arp2 expression was increased in 228% (P=0.007), Arp3 in 223% (P=0.017) and p16 in 357% (P=0.044). We also analyzed the expression of the metalloproteases MMP-2 and MMP-9. MMP-2 was downregulated in a 50% (P=0.0118) in cells lacking sst5TMD4 expression (MCF-7 cells in final passages, Figure 5.D, left) and its expression was three fold increased (Figure 5.D, right, P=0.0354) after the reintroduction of the recombinant receptor. The same tendency was observed for MMP-9 expression levels, though did not reach statistical significance (Figure 5.E, P=0.0778 and P=0.1806).

MCF-7 proliferation The evaluation of cell proliferation and viability, measured with Alamar Blue, revealed that the ability of MCF-7 cells lacking sst5TMD4 (“Final passages”) to proliferate (24h incubation) was 30% lower (P<0.0001) than that observed in MCF-7 cells expressing sst5TMD4 (“Initial passages”) (Figure 6.A, top panel). Consistent with these results, MCF-7 cells transfected with sst5TMD4 showed a higher basal proliferation rate (P<0.0001) compared to mock transfected cells (Figure 6.A, lower panel). Furthermore, kinetic proliferation assays using stably transfected MCF-7 cells (Figure 6.B), showed that cells transfected with sst5TMD4 proliferated more than mock transfected MCF-7 cells, exhibiting a lower doubling time (P=0.037). Similarly, sst5TMD4 expressing cells showed an increased exponential growing constant, K, compared to mock transfected cells (P=0.041) (Figure 6.B). Consistent with these results, mRNA levels of the positive cell cycle regulator cyclin D3 were increased in a 175% (P=0.005) in sst5TMD4 transfected cells vs. mock-transfected cells (Figure 6.B).

Growing of subcutaneous xenografts The effect of the presence of sst5TMD4 on cell proliferation was evaluated in an in vivo model of induced subcutaneous xenograft in nude mice (Figure 6.C). Consistent with in vitro data, the results obtained in vivo indicate that subcutaneous tumors induced with sst5TMD4 transfected cells, grew more than the induced with mock MCF-7 cells, being this difference significant after the fourth week of injection (76 vs. 50 mm2, respectively, P=0.01, Figure 6.C, left panel). This difference between the tumor growth of sst5TMD4- and mock-transfected cells induced xenografts was maintained until the ninth week, when the experiment was ended (131 vs. 102 mm2, respectively, P=0.03). In addition, the xenograft induced with mock transfected cells exhibit the ultrastructure of a typical well differentiated breast tumor (Figure 6.C, middle panel), while sst5TMD4 transfected cells produced unorganized structures, characteristic of a undifferentiated tumor (Figure 6.C, right panel).

DISCUSSION Ssts are expressed in breast tumors (Schulz et al., 1998), being the sst2 the most expressed one (Orlando et al., 2004). In support with this notion, our results indicate that sst2 and sst5, but not other receptors, are expressed in the breast tumor samples analyzed, being sst2 the most expressed, both by number of positive tumors and by expression level. In addition, we show for the first time, the presence of the new truncated isoform sst5TMD4 in breast cancer cells. Specifically, expression of sst5TMD4 was roughly in one third of the samples analyzed which was rather unexpected since we recently have shown that the expression of this variant is restricted to lung, kidney, liver, brain, and some kind of pituitary tumors (Duran-Prado et al., 2009). Nonetheless, to our knowledge, there are two indirect references in which the presence of sst5TMD4 could have been detected in breast tumors. Specifically, almost two decades ago, Prévost et al., detected by cross-linking with lanreotide, the presence or a reactive band of 27 KDa in protein extracts obtained from breast cancer samples (Prevost et al., 1993) which molecular weight was much smaller than the obtained for the known ssts to that date, but that matches with that of sst5TMD4 shown herein. In addition, a few years later, Xu et al., demonstrated by RNAse protection assays the presence of a band corresponding to a putative sst5 mRNA in the cell line MCF- 7 (Xu et al., 1996). However, they failed to detect the protein because the antibody used was raised against the C terminal domain, which does not recognize the sst5TMD4. As shown previously, when both receptors, sst2 and sst5TMD4 are coexpressed in the same cell (CHO-K1 or MCF-7 cells), they show a preferential intracellular localization, comparable to the described for the sst5TMD4 alone (Duran-Prado et al., 2009) and parallel to reported recently by Watt et al., for the endogenous ssts expressed in MCF-7 (Watt and Kumar, 2006). Our results shown herein confirm that the colocalization between sst5TMD4 and sst2 and their intracellular localization is not a mere spatial overlapping of their signals but involve physical interaction. sst5TMD4 recruit a high proportion of sst2 intracellularly by physical interaction, acting as dominant negative to sst2 in terms of localization, which is extended to its function. In recent times, it has been described the expression of sst2 in high grade meningiomas, were, interestingly, the receptor show a preferential cytoplasmatic localization in most of the tumors (Barresi et al., 2008), as it was reported for pancreatic cells (Papotti et al., 2002) and for the endogenous ssts expressed in the hepatic cell line HepG2 (Notas et al., 2004). We have to remember that the availability of ssts at the plasma membrane is essential and determinant for an effective treatment of these tumor pathologies using sst and analogues as well as with labeled derivates (Huang et al., 2000; Krenning et al., 2004; Sun et al., 2007b; Weckbecker et al., 2003). Moreover, the alteration of sst2 membrane localization could lead to the elimination of an inhibitory sst2-mediated autocrine loop, which derives to EMT, and enhanced proliferation and invasion (Benali et al., 2000; Leu et al., 2008). To date, there are many cases of truncated GPCRs that function as dominant negative to their wild type (Bakker et al., 2006; Blanpain et al., 2000; Chelli and Alizon, 2001; Grosse et al., 1997; Lee et al., 2000; Neill et al., 2004; Pawson et al., 2005; Sarmiento et al., 2004; Seck et al., 2005) and it has been suggested that the presence of these truncated variants could act as a new regulatory mechanism to finely tune the response to a ligand, by altering the availability, affinity and functionality of the wild type receptor (Bakker et al., 2006). We show in this report that the sst5TMD4 is one of these receptors since the presence of sst5TMD4 in breast cancer cells modify the cellular responses of these cells to its endogenous ligand SST. In addition, there are many other evidences of natural or “laboratory mutant” truncated receptors that posses their own function that usually differs from their wild type (Perron et al., 2005; Seck et al., 2005) or sometimes have constitutive activity (Hasegawa et al., 1996). For instance, as described recently, the ghrelin receptor isoform B, GHSR-B, (Petersenn, 2002), is highly expressed in lung cancer cells, where it heterodimerizes with neurotensin receptor 1, originating a new heteroreceptor that promotes cell proliferation and migration in response to neuromedin U (Takahashi et al., 2006). The new sst5 variant reported herein, sst5TMD4, also seems to play its own function in MCF-7 tumor cells. First of all, the stably expression of sst5TMD4 in MCF-7 cells leads to a mesenchymal-like or fibroblastoid appearance as shown for MDCK cells transfected with Snail (Cano et al., 2000) or HMLE cells treated with TGFβ (Mani et al., 2008), instead of the usual epithelial morphology signature of this cell type. Moreover, these sst5TMD4 stably transfected cells, showed increased migratory and proliferative basal abilities which correlates to the observed phenotype (Cano et al., 2000) and which, at last instance, could be determinant in tumor progression and metastases. Overall, as we found that sst5TMD4 expression correlated to the most aggressive of a series of breast tumor samples, it is tempting to speculate that their increased malignancy could be due, at least in part, to the presence of the truncated receptor. In order to ascertain the molecular basis of the transformation of MCF-7 cells by transfection with sst5TMD4, we studied two major signal transduction pathways involved in proliferation, migration and phenotype transformation in cancer cells, Akt and ERK (Liu et al., 2007b; Santen et al., 2002; Shen and Brown, 2003). Our results indicate, for the first time, that the basal phosphorilation levels of Akt and ERK are different in MCF-7 cells on initial and final passages. Specifically, cells of initial passages which express endogenously the sst5TMD4 variant, show a higher level of both, P-Akt and P-ERK levels than cells of final passages which do not express sst5TMD4. Moreover, the re-insertion of sst5TMD4 variant in MCF-7 cells of final passages increased both P-Akt and P-ERK levels to that observed in initial passages, which is ultimately translated to higher proliferation and migration rates. Akt phosphorilated level is increased in 30-40% of breast cancers vs. control samples, and promotes epithelial-mesenchymal transition, which derives in tumor progression to an invasive and metastatic carcinoma (Liu et al., 2007b). Other studies have correlated activation of Akt with a decrease in disease free survival and, consequently, it may have prognostic relevance in breast cancer (Liu et al., 2007a; Perez-Tenorio and Stal, 2002; Schmitz et al., 2004). It is known that the PI3K/Akt pathway can be activated by several factors: estrogens, epidermal growth factor (EGF), insulin-like growth factor (IGF), and the HER2/neu network. Actually, several studies have tried to explain high levels of p-Akt due to the presence of specific receptors, such as estrogen receptor (ERs) or HER2/neu, since in vivo studies have shown that Akt is frequently activated in patients with HER2/neu- overexpressing breast tumors (Tokunaga et al., 2006b; Tokunaga et al., 2006c) and with (ER)-positive tumors (Kirkegaard et al., 2005; Tokunaga et al., 2006a). However, additional data suggest that other factors able to stimulate Akt network in breast cancer might exist. Specifically, triple-negative breast cancers, although lacking ERs, PgRs and HER2/neu are also characterized by increased phosphorylation of Akt kinase (Umemura et al., 2007). Moreover, in cancer cells, the Akt is overexpressed and its expression correlates to ER negative tumors. Interestingly, we have found an inverse correlation between presence of both ERs and HER2/neu and expression of sst5TMD4. To our knowledge, though Akt regulation, stimulation and inhibition, by ssts is not novel (Charland et al., 2001; Grozinsky-Glasberg et al., 2008; Sellers et al., 2000), this is the first time that there is a direct link between expression of an sst, Akt and breast cancer, and moreover, that the solely presence of a specific sst leads to increased Akt phosphorilated levels in a breast cancer cell line. However, more studies are needed to determine if sst5TMD4 can also increase basal levels of p-Akt in human primary breast tumors. Our results presented herein, also show that cells expressing sst5TMD4 exhibit increased P-ERK levels. In breast cancer, it has been shown that MAPK cascades are even more important than Akt. Specifically, ERK1 and ERK2 are the most relevant MAP kinases in breast cancer and are usually over-expressed and over-phosphorilated in certain type of mammary tumors, especially, node positive primary tumors (Santen et al., 2002). This increased P-ERK level is associated to poor survival in triple negative cancers and is considered a poor prognosis factor (Eralp et al., 2008). Furthermore, the constitutive activation of ERK signaling could derive to antiestrogen resistance (Donovan et al., 2001). Somatostatin receptors are coupled to ERK signaling (Florio et al., 1999; Lahlou et al., 2003; Pola et al., 2003; Sellers et al., 1999). However, somatostatin is not only an inhibitor and exerts a dual stimulatory/inhibitory effect on P-ERK and also on cell proliferation. More in detail, sst1 and sst2 increase P-ERK which is accompanied by a decrease in cell proliferation (Florio et al., 1999; Lahlou et al., 2003). On the other hand, sst4 also stimulates P-ERK but this time, resulting in increased proliferation (Sellers et al., 1999). It has also been reported that somatostatin inhibits P-ERK and cell proliferation in human neuroblastoma cells that express the endogenous sst2 receptor (Pola et al., 2003). In addition, there is evidence appointing to a constitutive inhibitory effect of endogenous murine ssts expressed in AtT20 to P-ERK (Ben-Shlomo et al., 2007). Specifically, the selective silencing of sst2, sst5 and sst3 receptors expressed in these cells resulted in increased both cAMP and P-ERK levels (Ben-Shlomo et al., 2007). Taking in account that the novel sst5TMD4 has a role of dominant negative to sst2 signaling, it is tempting to propose that these increased p-ERK levels could be derived of a blockade of the constitutive inhibitory action of sst2. Our data show that stimulation of sst5TMD4-expressing MCF-7 with SST lead to a negative cross-talk between Akt and ERK signaling pathways. Specifically, addition of SST to MCF-7 cells expressing sst5TMD4 provoked a slight but significant increase in Akt phosphorilation and a decrease in ERKs phosphorilation. Crosstalk between the PI3K-Akt and the Raf/MEK/ERK pathways has been reported at multiple levels, though the results are rather opposing. Some studies suggest that the PI3K-Akt pathway enhances Raf/MEK/ERK (Germack et al., 2004; Jaquet et al., 2005; la Sala et al., 2005; Sebolt-Leopold and Herrera, 2004; Vivanco and Sawyers, 2002). However, PI3K-Akt and Ras-Raf-MEK- ERK signaling pathways have also been reported be inversely regulated (Guan et al., 2000; Moelling et al., 2002; Reusch et al., 2001; Rommel et al., 1999). Interestingly, first evidences showing inhibition of ERK pathway by maintained high levels of Akt were reported in MCF-7 cells, suggesting that this cross-talk might switch the biological response to some compounds from growth arrest to proliferation (Zimmermann and Moelling, 1999). Our results and previous data reported in MCF-7 cells suggest that SST treatment of cells expressing sst5TMD4 leads to an increase in Akt phosphorilation that could provoke the concomitant inhibition of Raf-MEK-ERK pathway. In addition, we have observed that SST can inhibit the capacity of invasion of sst5TMD4-MCF-7 cells; therefore, in presence of SST, p-ERK levels and invasiveness of sst5TMD4-expressing- and sst5TMD4-lacking cells are related. These data are consistent with latest reports showing that Raf-MEK-ERK signaling pathway is directly involved in cell invasion through activation of Focal Adhesion Kinase (FAK) (Behmoaram et al., 2008; Sawai et al., 2005). Results shown herein indicate that the presence of sst5TMD4 in the breast cancer cell line MCF-7 increased Arp2/3 expression, which it is involved with the increased ability of these cells to invade. Increased and sustained basal P-ERK level, as we observe in sst5TMD4-MCF-7 expressing cells, derives in an activation of the Arp2/3 complex (Martinez-Quiles et al., 2004; Nakanishi et al., 2007) which can be reinforced by increased P-Akt (Lee et al., 2006). Arp2/3 complex, as other scaffolding proteins that link migratory signals to the actin cytoskeleton, are upregulated in invasive and metastatic breast cancer cells (Sahai, 2005; Wang et al., 2005; Yamaguchi and Condeelis, 2007). The heptameric Arp2/3 complex is an activator of actin filament nucleation and branching, and is essential in the formation of invadopodia in other cancer types (Wang et al., 2005; Yamaguchi and Condeelis, 2007). Knocking down its expression or expressing a dominant negative isoform results in a complete blockade of carcinoma cell invasiveness (Yamaguchi et al., 2005). In sum, our results describe the presence of a new player, sst5TMD4, in the scene of SST/ssts and breast cancer. Specifically, we show for the first time, the presence of the truncated isoform sst5TMD4 in sporadic ductal invasive breast cancer samples and MCF-7 cells and how this receptor alters the phenotype of epithelial breast cancer cells, enhancing their ability of growing and invading. sst5TMD4 is able to interact physically and modify sst2, but not sst5, mediated SST-14 signaling, resulting in an impaired calcium response and increased basal ERK and Akt phosphorilation levels. The role of this receptor in aggressive breast cancers could be disrupting an sst2 mediated SST-14 negative feedback. Sst5TMD4 could be considered as a bad prognosis factor for certain breast cancers.

EXPERIMENTAL PROCEDURES

Breast samples We analyzed a group of 40 sporadic invasive ductal breast carcinomas and 4 normal breast samples obtained from Tumour Bank-CNIO (Madrid). The mean patient age at surgery was 53 years (range, 27 to 87 years). This study was approved by the ethic committee of the institution.

Cell Lines MCF-7 cell line (ATCC, Manassas, VA) was maintained in Dulbecco’s Modified Eagle Medium (DMEM) supplemented with 10% fetal bovine serum (FBS), 1% antibiotic- antimycotic and 2 mM L-glutamine. CHO-K1 cells (ATCC) were cultured using F12 medium and the same supplements as above. Both cell lines were maintained at 37º C and 5% CO2.

Plasmids and transfection sst5TMD4 sequence (DQ448304) was modified by PCR to include HindIII and BamHI restriction sites that were used clone it into the pCDNA3.1+ vector (Invitrogen, Barcelona, Spain). sst2A (AY236542) and sst5 (NM_001053) receptors inserted into pCDNA3.1+ vector (clones SST200000 and SST500000 respectively) were obtained from Missouri S&T cDNA Resource Center (http://www.cdna.org/). sst5TMD4 and sst2 were inserted into the HindIII and BamHI sites of E-YFP-N1 and E-CFP-N1 vectors (Clontech, NJ, USA) removing the TGA sequence from the antisense primer. For sst5, the antisense primer incorporated an EcoRI restriction site. Both MCF-7 and CHO-K1 cell lines were transfected using Lipofectamine 2000TM (Gibco, Barcelona, Spain) according to the manufacturer’s protocol. pCDNA3.1+ and derived vectors were used for stable transfection. To select stable transfectants, geneticin (G418; Gibco) was added to the culture media at 1mg/mL. Cells were maintained for one month, replacing the medium every week. Clones were characterized by immunolabeling and PCR. Stable clones of MCF-7 cells transfected with empty pCDNA3.1+ (mock transfected) were used as negative control.

Antibodies Immunostaining of human sst5TMD4 was carried out using a rabbit polyclonal antiserum, generated through a commercial source (Genosphere Biotechnologies, Paris, France) which was generated against the sequence CRERLSGHKSWQEKG, which is unique for the sst5TMD4 isoform, and only identified this receptor variant. Antibodies against sst2 (goat anti-SST2 (A-20)) and sst5 (goat anti-SST5 (D-15)) were purchased from Santa Cruz Biotechnology, Inc. (CA, USA). The corresponding secondary antibodies were Alexa Fluor 488 donkey anti-goat and Alexa Fluor 594 chicken anti-rabbit (Invitrogen). Antibody against total ERKs (ERK 2(C-14) were purchased from Santa Cruz Biotechnology, Inc. and antibodies against phospho-ERKs (Phospho-p44/42 MAPK (thr202/Tyr204)), Akt and phosphor-Akt (Phospho-Akt (Ser473)) were purchased from Cell Signaling Technology, Inc. (MA, USA). The secondary antibody used in western blotting was horseradish peroxidase (HRP) goat anti-rabbit IgG (Sigma, Barcelona, Spain). The rat anti-E-cadherin antibody and the corresponding horseradish peroxidase (HRP) goat anti-rat IgG were kindly provided by A. Cano.In E-Cadherin experiments, we use mouse anti-β-actin antibody (Sigma) as loading control; the corresponding secondary antibody was horseradish peroxidase (HRP) goat anti-mouse IgG (Sigma).

PCR and quantitative real time PCR An amount of 100 ng of cDNA was used for each PCR. Qualitative PCR was used to detect the presence of ssts in MCF-7 cells. Quantitative PCR was used to quantify sst2, sst5, sst5TMD4, Arp2, Arp3, p16, cyclin D3, E-cadherin, MMP-2 and MMP-9. 18S was used as internal standard. Primer pairs were sst2_S 5`-TCAAGTCGGCCAAGTGGAGGAG-3`, sst2_AS 5`-CATGATGGGCAAGATGACCAGC-3`, sst5A_S 5`-CCGCCAGAGCTTCCAGAAGGTT-3`, sst5A _AS 5`-GCTGGTCTGCATAAGCCCGTTG-3`, sst5TMD4_5`-GTCCTGTCTCTGTGCATGTCGCT-3`, sst5TMD4_AS 5`-CAGGATTTGTGCCCACTCAGCC-3´, arp2_S 5`- ACAACTTTTGGATGACCCGACAA-3`, arp2_AS 5`-ACCTTTCCAGTCAAAGGGCAGAG-3`, arp3_S 5`-CCAATCCGCCATGGTATAGTTGA-3`, arp3_AS 5`-CACAGCAATGTACAAGCCTGGAA-3`, p16_S 5`-TGGGTGAATACCACTGCCAAGTT-3´, p16_AS 5`-GATGTTCATGCCCAACAAGCTCT- 3`, hECAD_S 5`- AACACATTTGCCCAATTCCA-3`, hECAD_AS 5`- CACTACCCCCTACCCCTCAA- 3`, hMMP2_S 5`- CTACGATGGAGGCGCTAATG-3`, hMMP2_AS 5`- ACTCTTTGTCCGTTTTGGGG-3`, hMMP9_S 5`- CAGTGCCATGTAAATCCCCA-3`, hMMP9_AS 5`- CACCTCCACTCCTCCCTTTC-3`, 18s_S 5`-CCCATTCGAACGTCTGCCCTATC-3` and 18s_AS 5`-TGCTGCCTTCCTTGGATGTGGTA-3`. For qualitative PCR, we used EcoTaq polymerase (Ecogen, Barcelona, Spain). For real time quantitative PCR, we used a 2x master mix from BioRad (BioRad, Madrid, Spain) with the SYBR chemistry. The reactions were supplemented with 5 µl of 1.5 M betaine (Sigma) to amplify sst5TMD4. All PCR reactions were carried out in an iCycler IQ™ termal cycler (BioRad).

Confocal imaging CHO-K1 cells growing onto glass coverslips were transiently cotransfected with sst2-YFP and sst5TMD4-CFP or sst5-CFP and sst5TMD4-YFP. Twenty four hours after transfection, cells were rinsed in PBS, fixed for 5 min in 4% paraformaldehyde, rinsed twice in PBS and mounted onto a slide using Fluoromount (Molecular Probes, Eugene, OR). Images were acquired with a Leica Espectral TCS-SP2-AOBS confocal scanning microscope (Leica Corp, Heidelberg, Germany) with the CFP and YFP channels. Images of CFP and YFP channels were analyzed and merged with ImageJ (NIH, Bethesda, MD).

FRET measurements The interaction among the truncated sst5TMD4 isoform and sst2 and sst5A was evaluated by competitive FRET, in which sst2 and sst5A homodimerization is evaluated in the presence of increasing amounts of untagged sst5TMD4. Images of CHO-K1 transfected cells were acquired with an inverted Nikon Eclipse TE2000 E scope equipped with a 400 DCLP dichroic filter (Chroma, Rockingham) and recorded with an ORCA II BT digital camera, both controlled with MetaMorph software (Imaging Corporation, West Chester, PA). Net FRET was calculated using the three filters method with the methodology developed previously (Duran-Prado et al., 2007). FRET efficiency was calculated in relation to the positive control consisting in a vector with E-CFP and E-YFP coupled in frame, which provided the upper FRET efficiency limit (100%). Images were acquired with the MetaMorph software and analyzed with ImageJ and Microsoft Excel 2007. For image analysis and coefficient calculation, background was always subtracted in each picture. A 1:1 E-YFP/E-CFP ratio and equal E-YFP and E-CFP intensities between all samples were use for FRET measurements.

Measurement of free cytosolic calcium concentration ([Ca2+]i) in single cells MCF-7 or CHO-K1 cells were plated onto poly L-lysine treated 25mm-coverslips. For MCF- 7 cells, 24h before the experiment the medium was replaced by charcoal-stripped medium. The day of the measurement MCF-7 and CHO-K1 cells were incubated for 30 min at 37º C with 2.5 µM of the Ca2+ indicator dye Fura-2 AM (Molecular Probes, Eugene, OR) in phenol red-free DMEM containing 20 mM NaHCO3, pH 7.4. Coverslips were washed with phenol red-free DMEM and mounted on the stage of a Nikon Eclipse TE2000 E microscope (Nikon, Tokyo, Japan) with attached back thinned-CCD cooled digital camera (ORCA II BT; Hamamatsu Photonics, Hamamatsu, Japan). Cells were examined under a 40X oil immersion objective during exposure to alternating 340- and 380-nm light beams, and the intensity of light emission at 505 nm was measured every 5s. Changes in [Ca2+]i after 10-7 SST administration were recorded as background subtracted ratios of the corresponding excitation wavelengths (340/F380) using MetaFluor Sofware (Imaging Corporation). In the case of cells cotransfected with the receptor pairs sst2- YFP/sst5TMD4-CFP and sst5-YFP/sst5TMD4-CFP, only cells with the same quantity of YFP and CFP, namely receptor, were selected for analysis.

Western blotting Cells were cultured to subconfluence in 6-well plates, assayed for the indicated time, and immediately lysed in pre-warmed SDS-DTT sample buffer (62,5mM Tris-HCl, 2% SDS, 20% glicerol, 100mM DTT and 0,005% bromophenol blue) followed by sonication for 10 sec and boiling for 5 min at 95º C. To detect sst5TMD4 truncated receptor, cells cultured in 50 cm2 culture flasks were detached with a cells scraper in PBS solution (containing 5 mM EDTA, 0.02 % sodium azide, 15 U/ml DNase1 and protease inhibitors). Then, cells were lysated with a 25-G gauge, incubated for 30 minutes at 4º C and centrifuged at 13.000g for 10 min. Pellet was resuspended in warm SDS-DTT sample buffer and lysates were sonicated for 10 sec and boiled for 5 min at 95º C. In both instances, proteins were separated by SDS-PAGE and transferred to nitrocellulose membranes (Millipore). Membranes were blocked with 5% non fat dry milk in Tris-buffered saline/0.05% Tween 20 and incubated with the primary antibodies for ERK1/2, p-ERK1/2, p-Akt, Akt, E- Cadherin, β-actin or anti-sst5TMD4 and the appropriate secondary antibodies. Proteins were developed using an enhanced chemiluminescence detection system (GE Healthcare, UK) with dyed molecular weight markers. Where corresponding, a densitometric analysis of the bands was carried out with ImageJ software. The relative p-ERK and p-Akt values were obtained from normalization of p-ERK1/2 or p-Akt values against the total ERK1/2 or β-Akt values, respectively, or normalization of E-Cadherin against β-actin values.

In Vitro Proliferation Assays Basal cell proliferation was evaluated in cells coming from “initial” and “final” passages, and in transiently and stably transfected MCF-7 cells, in all instances using Alamar-Blue reagent (Biosource International). Briefly, the day of measurement, cells were incubated for 3 hours in 10% alamar blue/ serum free-DMEM and then, alamar reduction was measured in a BioTek Synergy HT fluorescence plate reader (BioTek Instruments, Inc., Vermont, USA), exciting at 560 nm and reading at 590 nm. Results are expressed as RFU or percentage vs. control (mock transfected cells). For initial and final passages cells, 5000 cells/well were counted and seeded in a 96 well plate and basal proliferation was evaluated 24h after seeding. For transiently transfected cells, 5000 cells/well were plated and transfected 24h after seeding. Proliferation was evaluated 48h after transfection. For kinetics proliferation experiments in mock and sst5TMD4 stably transfected cells, 1500 cells were seeded and cultured during 5 days, measuring proliferation in days 3, 4 and 5. Medium was replaced by fresh medium immediately after each measurement. Kinetics curves were fitted to exponential growth curves with GraphPad Prism 4 (GraphPad Software, San Diego, CA). Doubling time and K growing constant were calculated from these exponential curves. In all instances, cells were seeded per quadruplicate and all assays were repeated a minimum of three times.

Migration and Invasion Assays The ability of mock and sst5TMD4 stably transfected cells to migrate was evaluated by wound healing technique. Briefly, MCF-7 stable cells were plated at sub-confluence in 12 well plates. Confluent cells were serum-starved for 24h and after synchronization the wound was made using a 10 µl sterile pipette tip. Wells were rinsed in PBS and then cells were incubated for 24h in FBS supplemented medium. Wound healing was calculated as the area of a 400 pixels rectangle centered in the picture 24h after the wound vs. the area of the rectangle just after doing the wound. Three experiments were performed in independent days, in which four random pictures along the wound were acquired per well. Invasion of mock and sst5TMD4 stably transfected cells was evaluated by a modified Boyden chamber method, using a 48 well chemotaxis chamber (NeuroProbe, Gaithersburg, MD). Briefly, 10000 cells per well were seeded onto a 8µM pore PDVF membrane (NeuroProbe) previously treated with collagen type IV (BD Biosciences, San Jose, CA) or matrigel (BD Biosciencies). Cells were placed on the upper chamber onto the membrane. The lower well was filled with FBS-free media (negative control) and 10% FBS, including three replicates per condition. After 6h incubation, non migrated cells were removed and migrated cells fixed in methanol and stained with DAPI. Images were taken with a standard fluorescence microscope and a 20X objective. Three random fields per well were imaged for further analysis with ImageJ.

Xenografts Animal maintenance and experiments were carried out following the European Regulations for Animal Care and the ethics committee of the University of Cordoba. Six- week-old female athymic Swiss nude mice (Charles River Laboratories) were subcutaneously grafted in the ﬂank with 2x106 mock or sst5TMD4 stably transfected MCF- 7 cells. Tumor growth was monitored once a week with a digital caliper, at the site of injection. Tumors were allowed to grow during three months, at which point animals were euthanized. The tumor volume was calculated using the formula: (length x width)/(4 x π). Each tumor was dissected, ﬁxed in formaldehyde and sectioned at 8 µM histopathologic examination after hematoxylin and eosin staining.

Statistics Statistical analysis was performed with SPSS 15 (Chicago, Illinois, USA) and GraphPad Prism 4. Data are expressed as mean ± SEM obtained from, at least, three separate, independent experiments carried out in different days and with different cell preparations (n=3). Statistical analysis was carried out using Student´s t-test followed by a Mann- Whitney statistical test or one-way ANOVA (Kruskal-Wallis test) followed by a statistical test for multiple comparisons (Dunn’s test). Differences were considered to be significant at P=0.05 or lower.

BIBLIOGRAPHY Bakker, R. A., Lozada, A. F., van Marle, A., Shenton, F. C., Drutel, G., Karlstedt, K., Hoffmann, M., Lintunen, M., Yamamoto, Y., van Rijn, R. M., et al. (2006). Discovery of naturally occurring splice variants of the rat histamine H3 receptor that act as dominant-negative isoforms. Mol Pharmacol 69, 1194-1206. Barresi, V., Alafaci, C., Salpietro, F., and Tuccari, G. (2008). Sstr2A immunohistochemical expression in human meningiomas: is there a correlation with the histological grade, proliferation or microvessel density? Oncology reports 20, 485-492. Behmoaram, E., Bijian, K., Jie, S., Xu, Y., Darnel, A., Bismar, T. A., and Alaoui-Jamali, M. A. (2008). Focal adhesion kinase-related proline-rich tyrosine kinase 2 and focal adhesion kinase are co- overexpressed in early-stage and invasive ErbB-2-positive breast cancer and cooperate for breast cancer cell tumorigenesis and invasiveness. Am J Pathol 173, 1540-1550. Ben-Shlomo, A., Pichurin, O., Barshop, N. J., Wawrowsky, K. A., Taylor, J., Culler, M. D., Chesnokova, V., Liu, N. A., and Melmed, S. (2007). Selective regulation of somatostatin receptor subtype signaling: evidence for constitutive receptor activation. Mol Endocrinol 21, 2565-2578. Benali, N., Cordelier, P., Calise, D., Pages, P., Rochaix, P., Nagy, A., Esteve, J. P., Pour, P. M., Schally, A. V., Vaysse, N., et al. (2000). Inhibition of growth and metastatic progression of pancreatic carcinoma in hamster after somatostatin receptor subtype 2 (sst2) gene expression and administration of cytotoxic somatostatin analog AN-238. Proc Natl Acad Sci U S A 97, 9180-9185. Blanpain, C., Lee, B., Tackoen, M., Puffer, B., Boom, A., Libert, F., Sharron, M., Wittamer, V., Vassart, G., Doms, R. W., and Parmentier, M. (2000). Multiple nonfunctional alleles of CCR5 are frequent in various human populations. Blood 96, 1638-1645. Cano, A., Perez-Moreno, M. A., Rodrigo, I., Locascio, A., Blanco, M. J., del Barrio, M. G., Portillo, F., and Nieto, M. A. (2000). The transcription factor snail controls epithelial-mesenchymal transitions by repressing E-cadherin expression. Nature cell biology 2, 76-83. Charland, S., Boucher, M. J., Houde, M., and Rivard, N. (2001). Somatostatin inhibits Akt phosphorylation and cell cycle entry, but not p42/p44 mitogen-activated protein (MAP) kinase activation in normal and tumoral pancreatic acinar cells. Endocrinology 142, 121-128. Chelli, M., and Alizon, M. (2001). Determinants of the trans-dominant negative effect of truncated forms of the CCR5 chemokine receptor. The Journal of biological chemistry 276, 46975-46982. Donovan, J. C., Milic, A., and Slingerland, J. M. (2001). Constitutive MEK/MAPK activation leads to p27(Kip1) deregulation and antiestrogen resistance in human breast cancer cells. J Biol Chem 276, 40888-40895. Dowsett, M., Goldhirsch, A., Hayes, D. F., Senn, H. J., Wood, W., and Viale, G. (2007). International Web-based consultation on priorities for translational breast cancer research. Breast Cancer Res 9, R81. Duran-Prado, M., Bucharles, C., Gonzalez, B. J., Vazquez-Martinez, R., Martinez-Fuentes, A. J., Garcia- Navarro, S., Rhodes, S. J., Vaudry, H., Malagon, M. M., and Castano, J. P. (2007). Porcine somatostatin receptor 2 displays typical pharmacological sst2 features but unique dynamics of homodimerization and internalization. Endocrinology 148, 411-421. Duran-Prado, M., Gahete, M. D., Martinez-Fuentes, A. J., Luque, R. M., Quintero, A., Webb, S. M., Benito-Lopez, P., Leal, A., Schulz, S., Gracia-Navarro, F., et al. (2009). Identification and characterization of two novel truncated but functional isoforms of the somatostatin receptor subtype 5 differentially present in pituitary tumors. J Clin Endocrinol Metab, jc.2008-2564. Eralp, Y., Derin, D., Ozluk, Y., Yavuz, E., Guney, N., Saip, P., Muslumanoglu, M., Igci, A., Kucucuk, S., Dincer, M., et al. (2008). MAPK overexpression is associated with anthracycline resistance and increased risk for recurrence in patients with triple-negative breast cancer. Ann Oncol 19, 669-674. Fekete, M., Wittliff, J. L., and Schally, A. V. (1989). Characteristics and distribution of receptors for [D-TRP6]-luteinizing hormone-releasing hormone, somatostatin, epidermal growth factor, and sex steroids in 500 biopsy samples of human breast cancer. J Clin Lab Anal 3, 137-147. Florio, T., Yao, H., Carey, K. D., Dillon, T. J., and Stork, P. J. (1999). Somatostatin activation of mitogen-activated protein kinase via somatostatin receptor 1 (SSTR1). Mol Endocrinol 13, 24-37. Germack, R., Griffin, M., and Dickenson, J. M. (2004). Activation of protein kinase B by adenosine A1 and A3 receptors in newborn rat cardiomyocytes. Journal of molecular and cellular cardiology 37, 989-999. Grosse, R., Schoneberg, T., Schultz, G., and Gudermann, T. (1997). Inhibition of gonadotropin- releasing hormone receptor signaling by expression of a splice variant of the human receptor. Mol Endocrinol 11, 1305-1318. Grozinsky-Glasberg, S., Franchi, G., Teng, M., Leontiou, C. A., Ribeiro de Oliveira, A., Jr., Dalino, P., Salahuddin, N., Korbonits, M., and Grossman, A. B. (2008). Octreotide and the mTOR inhibitor RAD001 (everolimus) block proliferation and interact with the Akt-mTOR-p70S6K pathway in a neuro-endocrine tumour cell Line. Neuroendocrinology 87, 168-181. Guan, K. L., Figueroa, C., Brtva, T. R., Zhu, T., Taylor, J., Barber, T. D., and Vojtek, A. B. (2000). Negative regulation of the serine/threonine kinase B-Raf by Akt. J Biol Chem 275, 27354-27359. Hasegawa, H., Negishi, M., and Ichikawa, A. (1996). Two isoforms of the prostaglandin E receptor EP3 subtype different in agonist-independent constitutive activity. J Biol Chem 271, 1857-1860. Huang, C. M., Wu, Y. T., and Chen, S. T. (2000). Targeting delivery of paclitaxel into tumor cells via somatostatin receptor endocytosis. Chemistry & biology 7, 453-461. Hubina, E., Nanzer, A. M., Hanson, M. R., Ciccarelli, E., Losa, M., Gaia, D., Papotti, M., Terreni, M. R., Khalaf, S., Jordan, S., et al. (2006). Somatostatin analogues stimulate p27 expression and inhibit the MAP kinase pathway in pituitary tumours. European journal of endocrinology / European Federation of Endocrine Societies 155, 371-379. Jaquet, P., Gunz, G., Saveanu, A., Dufour, H., Taylor, J., Dong, J., Kim, S., Moreau, J. P., Enjalbert, A., and Culler, M. D. (2005). Efficacy of chimeric molecules directed towards multiple somatostatin and dopamine receptors on inhibition of GH and prolactin secretion from GH-secreting pituitary adenomas classified as partially responsive to somatostatin analog therapy. Eur J Endocrinol 153, 135-141. Kahan, Z., Nagy, A., Schally, A. V., Hebert, F., Sun, B., Groot, K., and Halmos, G. (1999). Inhibition of growth of MX-1, MCF-7-MIII and MDA-MB-231 human breast cancer xenografts after administration of a targeted cytotoxic analog of somatostatin, AN-238. Int J Cancer 82, 592-598. Keri, G., Erchegyi, J., Horvath, A., Mezo, I., Idei, M., Vantus, T., Balogh, A., Vadasz, Z., Bokonyi, G., Seprodi, J., et al. (1996). A tumor-selective somatostatin analog (TT-232) with strong in vitro and in vivo antitumor activity. Proceedings of the National Academy of Sciences of the United States of America 93, 12513-12518. Kirkegaard, T., Witton, C. J., McGlynn, L. M., Tovey, S. M., Dunne, B., Lyon, A., and Bartlett, J. M. (2005). AKT activation predicts outcome in breast cancer patients treated with tamoxifen. The Journal of pathology 207, 139-146. Krenning, E. P., Kwekkeboom, D. J., Valkema, R., Pauwels, S., Kvols, L. K., and De Jong, M. (2004). Peptide receptor radionuclide therapy. Annals of the New York Academy of Sciences 1014, 234-245. la Sala, A., Gadina, M., and Kelsall, B. L. (2005). G(i)-protein-dependent inhibition of IL-12 production is mediated by activation of the phosphatidylinositol 3-kinase-protein 3 kinase B/Akt pathway and JNK. J Immunol 175, 2994-2999. Lahlou, H., Saint-Laurent, N., Esteve, J. P., Eychene, A., Pradayrol, L., Pyronnet, S., and Susini, C. (2003). sst2 Somatostatin receptor inhibits cell proliferation through Ras-, Rap1-, and B-Raf- dependent ERK2 activation. J Biol Chem 278, 39356-39371. Lee, J. F., Ozaki, H., Zhan, X., Wang, E., Hla, T., and Lee, M. J. (2006). Sphingosine-1-phosphate signaling regulates lamellipodia localization of cortactin complexes in endothelial cells. Histochemistry and cell biology 126, 297-304. Lee, S. P., O'Dowd, B. F., Ng, G. Y., Varghese, G., Akil, H., Mansour, A., Nguyen, T., and George, S. R. (2000). Inhibition of cell surface expression by mutant receptors demonstrates that D2 dopamine receptors exist as oligomers in the cell. Mol Pharmacol 58, 120-128. Leu, F. P., Nandi, M., and Niu, C. (2008). The effect of transforming growth factor beta on human neuroendocrine tumor BON cell proliferation and differentiation is mediated through somatostatin signaling. Mol Cancer Res 6, 1029-1042. Liu, C., Zhou, S., Ke, C. S., Li, N. P., and Wu, R. L. (2007a). [Activation and prognostic significance of AKT, NF-kappaB and STAT3 in breast cancer with lymph node metastasis and estrogen receptor expression]. Ai zheng = Aizheng = Chinese journal of cancer 26, 929-936. Liu, W., Bagaitkar, J., and Watabe, K. (2007b). Roles of AKT signal in breast cancer. Front Biosci 12, 4011-4019. Mani, S. A., Guo, W., Liao, M. J., Eaton, E. N., Ayyanan, A., Zhou, A. Y., Brooks, M., Reinhard, F., Zhang, C. C., Shipitsin, M., et al. (2008). The epithelial-mesenchymal transition generates cells with properties of stem cells. Cell 133, 704-715. Martinez-Quiles, N., Ho, H. Y., Kirschner, M. W., Ramesh, N., and Geha, R. S. (2004). Erk/Src phosphorylation of cortactin acts as a switch on-switch off mechanism that controls its ability to activate N-WASP. Molecular and cellular biology 24, 5269-5280. Moelling, K., Schad, K., Bosse, M., Zimmermann, S., and Schweneker, M. (2002). Regulation of Raf- Akt Cross-talk. J Biol Chem 277, 31099-31106. Moller, L. N., Stidsen, C. E., Hartmann, B., and Holst, J. J. (2003). Somatostatin receptors. Biochim Biophys Acta 1616, 1-84. Nakanishi, O., Suetsugu, S., Yamazaki, D., and Takenawa, T. (2007). Effect of WAVE2 phosphorylation on activation of the Arp2/3 complex. Journal of biochemistry 141, 319-325. Neill, J. D., Musgrove, L. C., and Duck, L. W. (2004). Newly recognized GnRH receptors: function and relative role. Trends Endocrinol Metab 15, 383-392. Notas, G., Kolios, G., Mastrodimou, N., Kampa, M., Vasilaki, A., Xidakis, C., Castanas, E., Thermos, K., and Kouroumalis, E. (2004). Cortistatin production by HepG2 human hepatocellular carcinoma cell line and distribution of somatostatin receptors. J Hepatol 40, 792-798. Orlando, C., Raggi, C. C., Bianchi, S., Distante, V., Simi, L., Vezzosi, V., Gelmini, S., Pinzani, P., Smith, M. C., Buonamano, A., et al. (2004). Measurement of somatostatin receptor subtype 2 mRNA in breast cancer and corresponding normal tissue. Endocr Relat Cancer 11, 323-332. Papotti, M., Bongiovanni, M., Volante, M., Allia, E., Landolfi, S., Helboe, L., Schindler, M., Cole, S. L., and Bussolati, G. (2002). Expression of somatostatin receptor types 1-5 in 81 cases of gastrointestinal and pancreatic endocrine tumors. A correlative immunohistochemical and reverse-transcriptase polymerase chain reaction analysis. Virchows Arch 440, 461-475. Parkin, D. M., Bray, F., Ferlay, J., and Pisani, P. (2005). Global cancer statistics, 2002. CA Cancer J Clin 55, 74-108. Pawson, A. J., Maudsley, S., Morgan, K., Davidson, L., Naor, Z., and Millar, R. P. (2005). Inhibition of human type i gonadotropin-releasing hormone receptor (GnRHR) function by expression of a human type II GnRHR gene fragment. Endocrinology 146, 2639-2649. Perez-Tenorio, G., and Stal, O. (2002). Activation of AKT/PKB in breast cancer predicts a worse outcome among endocrine treated patients. British journal of cancer 86, 540-545. Perron, A., Sarret, P., Gendron, L., Stroh, T., and Beaudet, A. (2005). Identification and functional characterization of a 5-transmembrane domain variant isoform of the NTS2 neurotensin receptor in rat central nervous system. J Biol Chem 280, 10219-10227. Petersenn, S. (2002). Structure and regulation of the growth hormone secretagogue receptor. Minerva Endocrinol 27, 243-256. Pilichowska, M., Kimura, N., Schindler, M., Suzuki, A., Yoshida, R., and Nagura, H. (2000). Expression of somatostatin type 2A receptor correlates with estrogen receptor in human breast carcinoma. Endocr Pathol 11, 57-67. Pinzani, P., Orlando, C., Raggi, C. C., Distante, V., Valanzano, R., Tricarico, C., Maggi, M., Serio, M., and Pazzagli, M. (2001). Type-2 somatostatin receptor mRNA levels in breast and colon cancer determined by a quantitative RT-PCR assay based on dual label fluorogenic probe and the TaqMan technology. Regul Pept 99, 79-86. Pola, S., Cattaneo, M. G., and Vicentini, L. M. (2003). Anti-migratory and anti-invasive effect of somatostatin in human neuroblastoma cells: involvement of Rac and MAP kinase activity. J Biol Chem 278, 40601-40606. Pollan, M., Ramis, R., Aragones, N., Perez-Gomez, B., Gomez, D., Lope, V., Garcia-Perez, J., Carrasco, J. M., Garcia-Mendizabal, M. J., and Lopez-Abente, G. (2007). Municipal distribution of breast cancer mortality among women in Spain. BMC Cancer 7, 78. Prevost, G., Provost, P., Salle, V., Lanson, M., and Thomas, F. (1993). A cross-linking assay allows the detection of receptors for the somatostatin analogue, lanreotide in human breast tumours. Eur J Cancer 29A, 1589-1592. Reubi, J. C. (2003). Peptide receptors as molecular targets for cancer diagnosis and therapy. Endocr Rev 24, 389-427. Reubi, J. C., Waser, B., Foekens, J. A., Klijn, J. G., Lamberts, S. W., and Laissue, J. (1990). Somatostatin receptor incidence and distribution in breast cancer using receptor autoradiography: relationship to EGF receptors. Int J Cancer 46, 416-420. Reubi, J. C., Waser, B., Schaer, J. C., and Laissue, J. A. (2001). Somatostatin receptor sst1-sst5 expression in normal and neoplastic human tissues using receptor autoradiography with subtype- selective ligands. Eur J Nucl Med 28, 836-846. Reusch, H. P., Zimmermann, S., Schaefer, M., Paul, M., and Moelling, K. (2001). Regulation of Raf by Akt controls growth and differentiation in vascular smooth muscle cells. J Biol Chem 276, 33630- 33637. Rommel, C., Clarke, B. A., Zimmermann, S., Nunez, L., Rossman, R., Reid, K., Moelling, K., Yancopoulos, G. D., and Glass, D. J. (1999). Differentiation stage-specific inhibition of the Raf-MEK- ERK pathway by Akt. Science 286, 1738-1741. Sahai, E. (2005). Mechanisms of cancer cell invasion. Current opinion in genetics & development 15, 87-96. Santen, R. J., Song, R. X., McPherson, R., Kumar, R., Adam, L., Jeng, M. H., and Yue, W. (2002). The role of mitogen-activated protein (MAP) kinase in breast cancer. The Journal of steroid biochemistry and molecular biology 80, 239-256. Sarmiento, J. M., Anazco, C. C., Campos, D. M., Prado, G. N., Navarro, J., and Gonzalez, C. B. (2004). Novel down-regulatory mechanism of the surface expression of the vasopressin V2 receptor by an alternative splice receptor variant. J Biol Chem 279, 47017-47023. Sawai, H., Okada, Y., Funahashi, H., Matsuo, Y., Takahashi, H., Takeyama, H., and Manabe, T. (2005). Activation of focal adhesion kinase enhances the adhesion and invasion of pancreatic cancer cells via extracellular signal-regulated kinase-1/2 signaling pathway activation. Molecular cancer 4, 37. Schmitz, K. J., Otterbach, F., Callies, R., Levkau, B., Holscher, M., Hoffmann, O., Grabellus, F., Kimmig, R., Schmid, K. W., and Baba, H. A. (2004). Prognostic relevance of activated Akt kinase in node- negative breast cancer: a clinicopathological study of 99 cases. Mod Pathol 17, 15-21. Schulz, S., Schulz, S., Schmitt, J., Wiborny, D., Schmidt, H., Olbricht, S., Weise, W., Roessner, A., Gramsch, C., and Hollt, V. (1998). Immunocytochemical detection of somatostatin receptors sst1, sst2A, sst2B, and sst3 in paraffin-embedded breast cancer tissue using subtype-specific antibodies. Clin Cancer Res 4, 2047-2052. Sebolt-Leopold, J. S., and Herrera, R. (2004). Targeting the mitogen-activated protein kinase cascade to treat cancer. Nat Rev Cancer 4, 937-947. Seck, T., Pellegrini, M., Florea, A. M., Grignoux, V., Baron, R., Mierke, D. F., and Horne, W. C. (2005). The delta e13 isoform of the calcitonin receptor forms a six-transmembrane domain receptor with dominant-negative effects on receptor surface expression and signaling. Mol Endocrinol 19, 2132- 2144. Sellers, L. A., Alderton, F., Carruthers, A. M., Schindler, M., and Humphrey, P. P. (2000). Receptor isoforms mediate opposing proliferative effects through gbetagamma-activated p38 or Akt pathways. Molecular and cellular biology 20, 5974-5985. Sellers, L. A., Feniuk, W., Humphrey, P. P., and Lauder, H. (1999). Activated G protein-coupled receptor induces tyrosine phosphorylation of STAT3 and agonist-selective serine phosphorylation via sustained stimulation of mitogen-activated protein kinase. Resultant effects on cell proliferation. J Biol Chem 274, 16423-16430. Setyono-Han, B., Henkelman, M. S., Foekens, J. A., and Klijn, G. M. (1987). Direct inhibitory effects of somatostatin (analogues) on the growth of human breast cancer cells. Cancer research 47, 1566- 1570. Shen, Q., and Brown, P. H. (2003). Novel agents for the prevention of breast cancer: targeting transcription factors and signal transduction pathways. Journal of mammary gland biology and neoplasia 8, 45-73. Sun, L. C., Luo, J., Mackey, L. V., Fuselier, J. A., and Coy, D. H. (2007a). A conjugate of camptothecin and a somatostatin analog against prostate cancer cell invasion via a possible signaling pathway involving PI3K/Akt, alphaVbeta3/alphaVbeta5 and MMP-2/-9. Cancer letters 246, 157-166. Sun, M. L., Wei, J. M., Wang, X. W., Li, L., Wang, P., Li, M., and Yi, C. H. (2007b). Paclitaxel-octreotide conjugates inhibit growth of human non-small cell lung cancer cells in vitro. Experimental oncology 29, 186-191. Takahashi, K., Furukawa, C., Takano, A., Ishikawa, N., Kato, T., Hayama, S., Suzuki, C., Yasui, W., Inai, K., Sone, S., et al. (2006). The neuromedin u-growth hormone secretagogue receptor 1b/neurotensin receptor 1 oncogenic signaling pathway as a therapeutic target for lung cancer. Cancer Res 66, 9408-9419. Tokunaga, E., Kataoka, A., Kimura, Y., Oki, E., Mashino, K., Nishida, K., Koga, T., Morita, M., Kakeji, Y., Baba, H., et al. (2006a). The association between Akt activation and resistance to hormone therapy in metastatic breast cancer. Eur J Cancer 42, 629-635. Tokunaga, E., Kimura, Y., Mashino, K., Oki, E., Kataoka, A., Ohno, S., Morita, M., Kakeji, Y., Baba, H., and Maehara, Y. (2006b). Activation of PI3K/Akt signaling and hormone resistance in breast cancer. Breast cancer (Tokyo, Japan) 13, 137-144. Tokunaga, E., Kimura, Y., Oki, E., Ueda, N., Futatsugi, M., Mashino, K., Yamamoto, M., Ikebe, M., Kakeji, Y., Baba, H., and Maehara, Y. (2006c). Akt is frequently activated in HER2/neu-positive breast cancers and associated with poor prognosis among hormone-treated patients. International journal of cancer 118, 284-289. Umemura, S., Yoshida, S., Ohta, Y., Naito, K., Osamura, R. Y., and Tokuda, Y. (2007). Increased phosphorylation of Akt in triple-negative breast cancers. Cancer science 98, 1889-1892. van Eijck, C. H., Krenning, E. P., Bootsma, A., Oei, H. Y., van Pel, R., Lindemans, J., Jeekel, J., Reubi, J. C., and Lamberts, S. W. (1994). Somatostatin-receptor scintigraphy in primary breast cancer. Lancet 343, 640-643. Vivanco, I., and Sawyers, C. L. (2002). The phosphatidylinositol 3-Kinase AKT pathway in human cancer. Nat Rev Cancer 2, 489-501. Wang, W., Goswami, S., Sahai, E., Wyckoff, J. B., Segall, J. E., and Condeelis, J. S. (2005). Tumor cells caught in the act of invading: their strategy for enhanced cell motility. Trends in cell biology 15, 138-145. Watt, H. L., and Kumar, U. (2006). Colocalization of somatostatin receptors and epidermal growth factor receptors in breast cancer cells. Cancer Cell Int 6, 5. Weckbecker, G., Lewis, I., Albert, R., Schmid, H. A., Hoyer, D., and Bruns, C. (2003). Opportunities in somatostatin research: biological, chemical and therapeutic aspects. Nat Rev Drug Discov 2, 999- 1017. Xu, Y., Song, J., Berelowitz, M., and Bruno, J. F. (1996). Estrogen regulates somatostatin receptor subtype 2 messenger ribonucleic acid expression in human breast cancer cells. Endocrinology 137, 5634-5640. Yamaguchi, H., and Condeelis, J. (2007). Regulation of the actin cytoskeleton in cancer cell migration and invasion. Biochimica et biophysica acta 1773, 642-652. Yamaguchi, H., Lorenz, M., Kempiak, S., Sarmiento, C., Coniglio, S., Symons, M., Segall, J., Eddy, R., Miki, H., Takenawa, T., and Condeelis, J. (2005). Molecular mechanisms of invadopodium formation: the role of the N-WASP-Arp2/3 complex pathway and cofilin. The Journal of cell biology 168, 441- 452. Zimmermann, S., and Moelling, K. (1999). Phosphorylation and regulation of Raf by Akt (protein kinase B). Science 286, 1741-1744.

FIGURE LEGENDS

Figure 1. Correlation of sst5TMD4 and tumor markers in 40 sporadic ductal breast cancer samples. Graphs show statistical analysis correlating presence of sst5TMD4 to diverse tumor parameters. sst5TMD4 expression is inversely correlated with levels of ER (P=0.053), p53 (P=0.037) and Her2neu (P=0.038) and directly correlated with tumor invasiveness (P≤0.001), measured as the presence of tumor cells in lymph nodes.

Figure 2. Coexpression of sst2 and sst5TMD4 in primary breast cancers; physical and functional interaction of sst2 and sst5TMD4 in homologous and heterologous cell models. (A) Correlation between expression levels, by quantitative RT-PCR, of sst5TMD4 and sst2 in ductal breast cancer samples possitive for sst5TMD4 (R2=0,715, n=40). (B, F) Representative images of CHO-K1 cells transiently transfected with sst2-YFP and sst5TMD4-CFP (B) or sst5-YFP and sst5TMD4-CFP (F). Colocalization of each pair of receptors is shown in yellow. (C, G) Representative images of confocal colocalization of the endogenous sst2 or sst5 with sst5TMD4 in MCF-7 obtained by immunocytochemistry. Pictures show MCF-7 cells immunolabelled with sst2 or sst5 (green) and sst5TMD4 (red) specific antibodies. Colocalization of each pair of receptors is shown in yellow. (D, H) Measurements of competitive FRET assays using CHO-K1 cells transfected with tagged sst2 (D) or tagged sst5 (H) and increasing amounts of untagged sst5TMD4. The data represent the means ± SEM of three independent experiments (more than 30 cells in three independent experiments). (E, I) Measurements of free cytosolic calcium ([Ca2+]i) in CHO-K1 cells transiently transfected with sst2 alone or with sst2 and sst5TMD4 (E) and with sst5 alone or with sst5 and sst5TMD4 (I) in response to SST-14. The data represent the means ± SEM of more than 15 cells.

Figure 3. Molecular, functional and morphological analysis of the MCF-7 cell line. (A) RT-PCR analysis of somatostatin receptors (sst2, sst5, and sst5TMD4) and 18s during the culturing of MCF-7 cells. (B) RT-PCR quantification of sst5TMD4 in MCF-7 cells of initial and final passages and in stably transfected mock- and sst5TMD4-MCF-7. (C) Western blotting analysis of sst5TMD4 in MCF-7 cells of initial and final passages and in stably transfected mock- and sst5TMD4-MCF-7. (D) Representative profiles of changes in the concentration of free cytosolic calcium ([Ca2+]i) in MCF-7 cells of initial and final passages in response to 10-7 M SST-14 administration and percentage of responsive cells of each passage. The data represent the means ± SEM of more than 150 cells measured in three separate experiments. (E) Representative profiles of changes in the concentration of free cytosolic calcium ([Ca2+]i) in MCF-7 cells transiently transfected with sst5TMD4 in response to 10-7 M SST- 14. Inset indicates the percentage of responsive cells of each passage. The data represent the means ± SEM of more than 150 cells measured in three separate experiments. (F) Morphological analysis of MCF-7 cells stably transfected with or without sst5TMD4. Pictures shows representative images of MCF-7 cells transfected with the mock vector and sst5TMD4 construct. Total and mesenchymal-like cells were counted in mock- and sst5TMD4-MCF-7 cultures. Results are represented as percentage of cells with mesenchymal-like morphology versus total cells. The data represent the means ± SEM of more than 450 cells per group. Black arrows indicate cells with mesenchymal-like morphology. (G) Expression of E-cadherin in stably transfected MCF-7. Quantitative real time PCR quantification of E-cadherin mRNA in transfected MCF-7 cells (left chart; P=0.0051). Western blot analysis of E-cadherin protein from stably transfected MCF-7. The actin blot is serving as a loading control. Representative immunoblots are shown. Densitometric readings are given as mean ± SD values and normalized to actin expression (right chart; P=0,0086).

Figure 4. Basal and induced phosphorilation of mitogen-activated protein kinases (MAPKs) and Akt kinase in MCF-7 cells. Lysates from MCF-7 cells were subjected to western blotting with anti-ERKs, anti-phospho-ERKs (p-ERKs), anti-Akt and anti-phospho- Akt (p-Akt) antibodies. Densytometric analysis of the bands was done with ImageJ software. Quantitative data from the immunoreactive bands were normalized against the corresponding control values (total ERK and Akt). (A) Representative western-blotting and quantification of basal levels of phosphorilated ERKs in MCF-7 of initial and final passages. (B) Representative western-blotting and quantification of basal p-ERKs levels in transfected MCF-7 (mock or sst5TMD4). (C) Representative western-blotting and quantification of basal levels of phosphorilated Akt in MCF-7 of initial and final passages. (D) Representative western-blotting and quantification of basal p-Akt levels in transfected MCF-7 (mock or sst5TMD4). Regulation of phosphorilation of ERK and Akt by 10-7M of SST was determined by time- course experiments. In all instances, the data represent the means ± SEM of three independent experiments.

Figure 5. Invasion and migration of MCF-7 cells, in vitro. (A) Representative pictures of invasion assays of mock- and sst5TMD4-transfected MCF-7 cells plated onto Matrigel or collagen IV treated filters in response to a 10% FBS gradient. Charts represent percentage of migrated cells after 6h versus control in collagen and matrigel treated filters. The data represent the means ± SEM of three independent experiments. (B) Representative pictures of wound healing assays carried out with stably transfected mock- and sst5TMD4-MCF-7 cells. Panels show pictures at time 0 and 24h under basal conditions or treated for 24h with 10-7 M SST. Lower charts show percentage of wound area vs. time 0. The data represent the mean ± SEM of three independent experiments. (C) Quantification of mRNA levels of Arp complex components in mock- and sst5TMD4- MCF-7 cells. Quantitative PCR was used to detect the presence of components of the actin- related protein (Arp) 2/3 complex in stably transfected MCF-7 cells. The data represent the means ± SEM of four independent experiments. (D and E) Quantitative real time PCR quantification of MMP-2 (D) and MMP-9 (E) in different passages (left) or transfected MCF-7 cells (right), respectively. The data represent the means ± SEM of four independent experiments.

Figure 6. Proliferation of sst5TMD4 expressing MCF-7 cells is increased both, in vitro and in vivo. (A) Percentage of basal proliferation after 24h in initial and final cultures of MCF-7 (top) and in transient transfected MCF-7 cells (bottom). The data represent the means ± SEM of, at least, three independent experiments. (B) Proliferation kinetics of stably transfected MCF-7 (mock and sst5TMD4) cultured for 5 days (top panel). Doubling time, growth constant (K) and mRNA levels of cyclin D3 of each cell clone (lower panel). The data represent the means ± SEM of three independent experiments. (C) Growing of mock- and sst5TMD4-MCF-7 xenografts subcutaneously inoculated into nude mice. Left chart show growth curves of induced tumors up to 9 weeks. A representative picture of hematoxylin-eosin staining for each group is shown in right pictures.

Figure 2

Figure 4

Figure 5

Figure 6

Supplemental Figure 1

Supplemental Figure 2

ARTICLE VI

Expression of the ghrelin and neurotensin systems is altered in

the temporal lobe of Alzheimer disease patients

Abbreviated title: Ghrelin/neurotensin systems in Alzheimer disease

Authors: Manuel D. Gahete1, Raúl M. Luque1, Justo P. Castaño1

Affiliations: 1Department of Cell Biology, Physiology and Immunology, University of

Córdoba, Instituto Maimónides de Investigación Biomédica de Córdoba (IMIBIC), and

CIBER Fisiopatología de la Obesidad y Nutrición (CIBERobn), 14014 Córdoba, Spain.

Corresponding author: Dr. Justo P. Castaño, Department of Cell Biology, Physiology and

Immunology; Campus Universitario de Rabanales, Edificio Severo Ochoa (C6), Planta 3;

University of Córdoba, E-14014 Córdoba, Spain.

E-mail: [email protected]

Phone: +34 957 21 85 94, Fax: +34 957 21 86 34.

Six keywords: Ghrelin, In2-ghrelin variant, neurotensin, GHSR and NTSR, Alzheimer´s

Disease, brain temporal lobe.

Abstract Ghrelin and neurotensin (NTS) are two neuroendocrine peptides with opposite roles in food intake and energy homeostasis, albeit exert similar actions improving memory and learning processes. Their actions are mediated by two-ghrelin GPCRs (GHSR1a/1b) and three-NTS receptors, two GPCRs (NTSR1/2) and one non-GPCR (NTSR3). Noteworthy, GHSRs and NTSRs display a high evolutionary identity and compose the so-called ghrelin- receptor-like family. Since, ghrelin and NTS systems are clearly involved in energy balance regulation and cognitive processes, both have been proposed to be altered in Alzheimer disease (AD), a dementia syndrome clearly influenced by the metabolic state. Although it has been demonstrated that ghrelin and NTS can attenuate AD-related cognitive impairment, a comprehensive analysis of these systems in AD has been not yet underwent. Therefore, we have analyzed by quantitative-real time PCR the ghrelin/NTS axis in one of the most affected cortical regions in AD, the temporal gyrus. Specifically, we observed a marked reduction of ghrelin, In2-ghrelin variant (a recently discovered variant), GOAT (the enzyme responsible to its acylation), and GHSR1a expression, whereas the mRNA levels of the dominant-negative GHSR1b was increased. Similarly, we observed a profound decrease in the mRNA copy number of NTSR1 and NTSR2, and a slight reduction in NTS expression. In contrast, expression of NTSR3, a receptor involved in neuronal apoptosis, did not vary. Collectively, our results represent the first quantitative evidence showing that ghrelin/NTS systems are altered in the brain of AD patients which could help to explain, in part, the severe cognitive deficit observed in this pathology.

Introduction The endogenous brain-gut peptides ghrelin and neurotensin (NTS) are the most studied members of two complex peptides-receptors families. Ghrelin gene encodes a family of related-peptides which can be generated by alternative splicing and/or post- translational modifications (Seim, 2009). Ghrelin and likely In2-ghrelin variant (a splicing isoform recently identified by our group, can be acylated by the Ghrelin-O-acyltransferase (GOAT) enzyme (Gutierrez, 2008; Yang, 2008). Although desacyl-ghrelin (DAG) is the most abundant form in the circulation, only acyl-ghrelin binds to G-protein coupled receptor type 1a (GHSR1a), which is encoded by a gene that also originates an alternative spliced variant (GHSR1b) whose precise role is still known. Conversely, three neurotensin receptor, two GPCRs (NTSR1/2) and one non-GPCR [NTSR3, also known as sortilin (SORT- 1)], encoded by independent genes have been hitherto described (Vincent, 1999). Interestingly, ghrelin and NTS GPCRs share a high evolutionary identity and compose the so-called ghrelin receptor family (Holst, 2004). Indeed, NTSR1 and GHSR1b have also been reported to functionally interact in lung cancer cells to mediate the proliferative effect of the NTS-related peptide neuromedin-U (NMU) (Takahashi, 2006). Because ghrelin and NTS are involved in food intake, body weight gain, energy homeostasis, and adiposity, it has been suggested that the dys-regulation of ghrelin and/or NTS systems could be directly associated with obesity and metabolic syndrome (Williams, 1991; Chollet, 2009). In addition, ghrelin and NTS systems are also involved in inflammatory processes (Bossard, 2007; Koon, 2009), and neuromodulation acting as positive stimulus in memory and learning processes (Ohinata, 2007; Yamauchi, 2007; Toth, 2009a; Toth, 2009b). Therefore, since Alzheimer´s disease (AD) is a neurodegenerative disorder characterized by severe cognitive deficit, and is clearly influenced by metabolic syndrome, obesity, energy impairment and inflammation (Giordano, 2007; Erol, 2008), the question of whether modulation of ghrelin and NTS systems is relevant in this pathology has recently emerged (Giordano, 2007). Indeed, evidences supporting a close relationship between ghrelin or NTS systems and AD have been recently demonstrated. For instance, DAG can act as a “neuroprotective” molecule through binding to CD36, which interferes in the initiation of signaling cascades that lead to neuronal dysfunction and death (Bulgarelli, 2009). In addition, NTSR3 has been shown to be involved in neurodegeneration since can interact with two protein up-regulated in 3

AD, the pro-neural growth factor (NGF) and p75, forming a heterotrimer capable of induce neuronal apoptosis (Clewes, 2008). In spite of AD is also characterized by the impairment of several neuropeptides/neurotransmitter systems (Golomb, 2000), few studies have been addressed to understand the precise regulation of ghrelin and NTS systems in AD pathology. Since the temporal lobe is one of the most important cortical structures in memory and cognition, and one the most affected region in AD (Braak and Braak, 1991), in the present study, we carried out a detailed quantification of mRNA levels of ghrelin and NTS systems (ghrelin, In2-ghrelin variant, GOAT, GHSR1a/b, NTS, and NTSRs) using quantitative real-time PCR (qrt-PCR) in three different regions of the temporal lobe (inferior, medial and superior) of control and AD human brains.

Material and methods Tissue samples. Human brain tissues were obtained from the Netherlands Brain Bank (Netherlands Institute for Neuroscience, Amsterdam) which supplies post-mortem specimens from clinically well documented and neuropathologically confirmed cases and controls as recently reported (Gahete, 2010). The Netherlands Brain Bank abides to all local ethical legislation. Frozen samples used in this study were from three different regions of the temporal lobe (inferior, medial and superior) of six patients (four males and two females, 68-91 years) with the clinical diagnosis of AD and six non-demented controls (four males and two females, 73-93 years). Tissue samples were taken at death and during 3-5h post- mortem intervals. Available clinicopathological details of each patient are shown in Table 1. Nucleic acids isolation and reverse transcription (RT). Total RNA from frozen samples was isolated with the RNA Miniprep Kit (Stratagene, Texas, USA) following manufacturer’s instructions and the amount was quantified using the Nanodrop ND-1000 spectrophotometer (Nanodrop Technologies, DE, USA). For RT-PCR studies, 1 µg of total RNA were reverse transcribed using the AMV kit (Roche diagnostics, Mannheim, Germany). Quantitative real-time PCR (qrt-PCR) measurements. Expression of ghrelin, In2-ghrelin variant, GOAT, GHSR1a, and GHSR1b, as well as NTS, NMU, NTSR1, NTSR2, and NTSR3 was screened by qrt-PCR using specific primers for each transcript (Table 2). Details of primer selection, verification of primer specificity, confirmation of PCR efficiency, construction of standard curves as well as confirmation of target specificity (verification of graded temperature dependent dissociation curves and sequence analysis) have been previously reported in detail (Taboada, 2007; Neto, 2009). Amplifications were performed using the iCycler IQ™ system (Biorad, CA, USA) as previously described (Gahete, 2010). A non-DNA control was always run on each plate to monitor potential exogenous contamination. To control for variations in the amount of RNA used in the RT reaction and the efficiency of the RT reaction, the expression level (copy number) of one housekeeping gene (cyclophilin-A) was determined for each sample where cyclophilin A copy number was not altered between experimental groups. To determine the starting copy number of cDNA, RT samples were PCR amplified, and the signal was compared with that of a specific standard curve for each transcript run on the same plate (1, 101, 102, 103, 104, 105 , 106 copies). It should be noted that the slope of a standard curve for each template examined was between -3,31 and -3,35 (R2 of the standard curve between 0,997 and 1,002) indicating that the efficiency of amplification was close to a 100%, meaning that all templates in each cycle were copied. Statistical analysis. Kolmogorov-Smirnov test was used to assess the normality of the distribution of all variables. Student's t-test analysis was used for normally distributed variables, while Mann-Whitney U-test was used for nonparametric variables. P values less than 0.05 were 4 considered significant. All statistical analyses were performed using the GraphPad Prism and SPSS 13.0 software packages.

Results Expression of ghrelin axis in the brain of control subjects and AD patients. Absolute quantification of mRNA copy number in the temporal cortex showed that ghrelin and In2-ghrelin variant, as well as GOAT, were highly expressed in the brain of both control and AD subjects (Table 3). Specifically, we observed a clear reduction of ghrelin expression (48,8%) in the whole temporal gyrus of AD patients as compared with controls (Table 3 and Figure 1A). In contrast, when each lobe was analyzed separately, we observed that ghrelin expression was statistically decreased only in the inferior temporal region and not in the medial and superior gyrus. In addition, although the expression levels of In2-ghrelin variant tended to decrease in the whole temporal gyrus (41%), this difference did not reach statistical significance (Figure 1B). Interestingly, In2-ghrelin variant mRNA expression was not detected in the inferior lobe, did not change in the medial lobe but it was severely decreased in the superior lobe. GOAT mRNA levels did not change in the whole temporal gyrus of AD patients as compared with matched controls (Figure 1C); however, when each region was considered separately, we unexpectedly observed a significant reduction of GOAT expression in the inferior lobe of AD patients compared with control subject, whereas no variations were observed in the medial and superior lobes (Figure 1C). It should be noted that no differences between genders were observed in ghrelin, In2-ghrelin variant and GOAT expression differences between AD and control subjects (data not shown). As internal standard, we used cyclophilin, a housekeeping gene whose mRNA expression has been reported to remain consistently unaltered in brains from AD patients (Mousavi, 2003; Merali, 2004; Hellstrom-Lindahl, 2008). In fact, consistent with that data, the mean mRNA copy number measured in this study for cyclophilin in non-demented control was 3,412 ± 1,080 copies/100ng of RNA and, in AD patients 3,158 ± 1,227 (p=0.72). We also analyzed the expression levels of ghrelin receptor gene (GHSR) transcripts, GHSR1a and GHSR1b, in the temporal lobe of AD and control subjects. Both receptors were present in control subjects, being GHSR1a more expressed than GHSR1b; however, their regulation were absolutely opposite in the temporal region of AD patients (Table 3). Specifically, mRNA levels of GHSR1a were markedly reduced (54%) in the whole temporal lobe of AD patients compared with normal controls (Figure 1D). When each region was considered separately, we observed that GHSR1a expression was also significantly reduced in the inferior and superior regions; however, it was not altered in the medial region of AD patients compared with controls. On the other hand, GHSR1b mRNA levels were 3-fold increased (P≤0,001) in the whole temporal lobe of AD patients as compared with controls (Figure 1E), and this difference was consistently observed across cortical regions (inferior, medial and superior) of AD patients. As a result, we found that the GHSR1a/GHSR1b ratio is completely altered in AD pathology. Indeed, while the majority of the control subjects present a GHSR1a/GHSR1b ratio higher than 1 (5 of 6 controls), meaning a higher amount of GHSR1a than GHSR1b mRNA, AD patients have a GHSR1a/GHSR1b ratio ≤ than 1 (5 of 6 patients  1 and one patient with a ratio of 1; Figure 1F). No differences between genders were observed in GHSR1a or GHSR1b mRNA levels between AD and control subjects (data not shown).

Expression of NTS axis in the brain of control subjects and AD patients. Quantification of NTS and NMU mRNA copy numbers revealed that the expression levels of these genes were, by and large, considerably lower than that of ghrelin or In2- ghrelin (Table 3). In whole temporal lobe, expression levels of NTS and NMU tend to be lower in AD patients compared to control subjects, although this difference did not reach statistical significance (Table 3). Similarly, no significant differences in NTS expression level were found within the three temporal regions (inferior, medial and superior) of AD 5 patients compared with controls (Figure 2A). Interestingly, a significant reduction in NMU mRNA levels was observed in the superior lobe of AD patients compared with controls while no differences were found in the inferior or medial cortical regions (Figure 2B). We also analyzed the expression levels of NTS receptors (NTSR) transcripts, NTSR1-3, in the temporal lobe of AD and control subjects. We found that all three NTSRs were expressed in temporal cortex of control brains, although at very different levels (NTSR2 >> NTSR3 >>> NTSR1) (Table 3). Interestingly, an overall reduction of 50% in the number of NTSRs mRNA copies was observed in AD temporal cortex compared with controls. Specifically, expression level of NTSR1 and NTSR2 were significantly reduced while NTSR3 mRNA levels did not change in the whole temporal region of AD patients compared with controls samples (Fig. 2D-E). When each region was considered separately, we observed a consistent reduction of NTSR1 and NTSR2 in the three areas analyzed of AD patients (Figure 2C and D, respectively), while NTSR3 expression was not significantly altered in any of the regions (Figure 2E). Again, gender comparison did not reveal any differences in the expression of NTS axis between female and male patients (Data not shown).

Discussion Alzheimer disease (AD) is a progressive disorder characterized by severe cognitive deficit, augmented accumulation of amyloid-β (Aβ), hyperphosphorylated tau proteins, and impairment of several neuropeptides/neurotransmitter systems (Golomb, 2000; Selkoe, 2001). Similar to that occurred in other neurodegenerative disorders, AD is profoundly affected by the metabolic and inflammatory status (Giordano, 2007; Erol, 2008). However, although ghrelin and NTS peptides are well-known key players in the regulation of energy balance (Remaury, 2002; Cui, 2005; De Vriese and Delporte, 2007; 2008) and some inflammatory processes (Bossard, 2007; Koon, 2009), their systems have not yet been comprehensively studied in AD. To our knowledge, this is the first report quantitatively analyzing the ghrelin and NTS axis in brains of AD patients. Specifically, we have focused our studies in the temporal lobe of AD patients since the most severe cognitive deficit in AD is the impairment of episodic memory, and this cortical structure, the temporal lobe, is the most important area associated with episodic memory functions (Braak and Braak, 1991). Our results demonstrate that ghrelin and its recently discover splice variant, In2-ghrelin, are highly expressed in the temporal lobe of control subjects. Interestingly, the expression of ghrelin and In2-ghrelin variant were found to be down- regulated in a region-specific manner in AD patients compared with controls (inferior region for ghrelin and superior region for In2-ghrelin variant), suggesting the existence of a divergent regulation of the ghrelin gene to generate a specific ghrelin transcript isoform in the temporal lobe of AD patients. Although it has been demonstrated that ghrelin plasma levels decrease with age in normal subjects (Rigamonti, 2002), this is the first report showing that AD patients have further reduction in brain ghrelin mRNA production compared with age-matched controls. Surprisingly, the mRNA levels of the enzyme responsible to acylate ghrelin, and likely In2-ghrelin variant, were not notably altered in the whole temporal lobe. However, when each lobe was analyzed separately, we found that changes in GOAT expression parallel those of ghrelin (down-regulation exclusively in the inferior gyrus) which could suggest that native ghrelin could be a primary substrate for GOAT in that specific cortical region. Since it has been found that ghrelin levels do not vary in the cerebrospinal fluid of AD patients compared with age-matched controls (Proto, 2006), our findings suggest that the locally-produced acylated/non-acylated ghrelin and In2-ghrelin variant could exert autocrine and/or paracrine function in the temporal lobe, similar to that observed in astrocytoma cell lines (Dixit, 2006), where ghrelin and GHSR1a constitute a autocrine pathway controlling astrocytoma motility. Indeed, it is commonly accepted that ghrelin exert the majority of its actions through binding to GHSR-1a (Castaneda, 2009), a GPCR widely distributed in human tissues, including brain (Guan, 1997). Even more, a significant proportion of these actions have been reported to be 6 mediated by an autocrine loop (Jeffery, 2003; Dixit, 2006). Our results demonstrate that mRNA levels of GHSR1a were more abundant than GHSR1b in normal subjects; however, the relative expression of these receptors were completely opposite in AD patients since expression levels of GHSR1a were drastically reduced in a region-specific manner while GHSR1b mRNA levels were potently up-regulated in all temporal lobe regions of AD patient. These results are in keeping with previous reports showing that GHSR1b is more expressed in some pathologies, such as colorectal cancer (Waseem, 2008), adrenocortical tumors (Barzon, 2005), and breast cancer. Interestingly, it has been recently demonstrated that GHSR1b can heterodimerize with GHSR1a, promoting their translocation to the nucleus and thereby, GHSR1b could act as a dominant-negative receptor, partially blocking GHSR1a functionality (Chu, 2007; Leung, 2007). In consequence, since ghrelin has been demonstrated to act as a positive stimulus in learning a memory processes, we could hypothesized that overexpression of GHSR1b could be, at least, partially responsible of the severe cognitive impairment that occurs in AD. In addition, the data presented in this manuscript may be important for clinical purpose since this is the first report showing the existence of differential expression of the ghrelin axis in the brain of AD patients compared with normal controls which could represent potential novel markers as diagnostic/prognostic for this pathology. Although NTS has been also found to be involved in memory consolidation (Ohinata, 2007; Yamauchi, 2007), and in learning processes (Tirado-Santiago, 2006), its role in AD pathogenesis has not been yet comprehensible analyzed. In the present work, we have quantitatively analyze the mRNA levels of NTS system (NTS, NTSR1, NTSR2, and NTSR3) in AD patients, as well as, a highly-related peptide, NMU, since it has been reported that this peptide is able to bind to heterodimers of GHSR1b/NTSR1 (Takahashi, 2006). Specifically, we have observed that both peptides, NTS and NMU, are expressed, although at very low levels, in the human temporal lobe. In AD patients, NTS and NMU expression tend to be decreased; however, this differences were only significant for NMU expression in the superior temporal lobe of AD patients which suggest the existence of a region-dependent regulation of NMU expression in the brain of AD patients compared with controls subjects. In accordance with our data, the results obtained in early studies indicate no change (Biggins, 1983; Yates, 1985) or a tendency to decrease (Ferrier, 1983; Nemeroff, 1989; Benzing, 1990; Benzing, 1992) in the NTS-immunoreactivity in different cortical regions of AD patients. However, to our knowledge, no previous data have been reported concerning NMU expression in brains of AD patients. Since 90´s, it has been extensively demonstrated that NTSRs are widely distributed in mammalian brains (Quirion, 1992). Accordingly, we have detected significant mRNA levels of all three NTSRs in the brain of control subjects. However, the absolute mRNA copy number differed considerably, being NTSR2>>NTSR3>>>NTSR1. We found that NTSR1 and NTSR2 mRNA levels were abruptly reduced in the temporal lobe of AD patients compared with controls. These results are consistent with a report showing a 57% reduction in the NTS- binding sites in the hippocampus of AD patients compared with controls by radioligand binding assays (Jansen, 1990). In contrast, we found that expression levels of NTSR3 were not significantly altered in AD samples which would also be consistent with previous observations showing that sortilin/NTSR3 immunohistochemistry levels do not vary in basal forebrains of AD patients (Allen, 1990; Clewes, 2008). Nonetheless, our data showing an significant overall (50%) reduction in NTSR1 and NTSR2 in the temporal lobe of AD patients could be patho-physiologically relevant because: 1) the temporal lobe is the major cortical structure involved in episodic memory functions, 2) it has been demonstrated that NTS can act as a positive stimulus in learning and memory processes, and 3) it has been shown that NTSR2 is the major receptor involved in NTS-mediated memory actions (Yamauchi, 2007). Therefore, a reduction in NTSR in the temporal lobe of AD patients, including the most abundant NTSR2, could also help to explain the impairment in the cognitive function observed in this pathology. 7

In summary, the results presented in this work suggest a noteworthy dysregulation of ghrelin and NTS system in the temporal lobe of AD patients, not only originated by a reduction of ghrelin, In2-ghrelin variant, GOAT, GHSR1a, NTSR1 and NTSR2 mRNA levels but also by a strong increase in the GHSR1b mRNA expression. This data may be important for clinicians dealing with AD patients because we shown that some components of the ghrelin and NTS axis are finely regulated in the brain of AD patients compared with normal subjects and therefore, they could represent potential novel markers as diagnostic/prognostic for this pathology. In addition, since ghrelin and NTS have been demonstrated to directly influence memory and learning processes (Carlini, 2002; Carlini, 2004; Diano, 2006; Tirado-Santiago, 2006; Carlini, 2007; Ohinata, 2007; Yamauchi, 2007; Carlini, 2008; Carvajal, 2009), the breakdown of the ghrelin and NTS systems reported herein in the temporal lobe of AD patients could help to explain, at least in part, the impairment of cognitive processes observed in AD. However, future studies should be addressed to evaluate the precise role of each component of these regulatory systems in this pathology and on their potential value as specific therapeutic target and diagnostic/prognostic markers in AD.

References

Allen SJ, Dawbarn D, MacGowan SH, Wilcock GK, Treanor J, Moss TH (1990) A quantitative morphometric analysis of basal forebrain neurons expressing NGF receptors in normal and Alzheimer’s disease brain. Dementia 1, 125–137. Barzon L, Pacenti M, Masi G, Stefani AL, Fincati K, Palu G (2005) Loss of growth hormone secretagogue receptor 1a and overexpression of type 1b receptor transcripts in human adrenocortical tumors. Oncology 68:414-421. Benzing WC, Mufson EJ, Jennes L, Armstrong DM (1990) Reduction of neurotensin immunoreactivity in the amygdala in Alzheimer's disease. Brain Res 537:298-302. Benzing WC, Mufson EJ, Jennes L, Stopa EG, Armstrong DM (1992) Distribution of neurotensin immunoreactivity within the human amygdaloid complex: a comparison with acetylcholinesterase- and Nissl-stained tissue sections. J Comp Neurol 317:283-297. Biggins JA, Perry EK, McDermott JR, Smith AI, Perry RH, Edwardson JA (1983) Post mortem levels of thyrotropin-releasing hormone and neurotensin in the amygdala in Alzheimer's disease, schizophrenia and depression. J Neurol Sci 58:117-122. Bossard C, Souaze F, Jarry A, Bezieau S, Mosnier JF, Forgez P, Laboisse CL (2007) Over-expression of neurotensin high-affinity receptor 1 (NTS1) in relation with its ligand neurotensin (NT) and nuclear beta-catenin in inflammatory bowel disease-related oncogenesis. Peptides 28:2030-2035. Braak H, Braak E (1991) Neuropathological stageing of Alzheimer-related changes. Acta Neuropathol 82:239- 259. Bulgarelli I, Tamiazzo L, Bresciani E, Rapetti D, Caporali S, Lattuada D, Locatelli V, Torsello A (2009) Desacyl- ghrelin and synthetic GH-secretagogues modulate the production of inflammatory cytokines in mouse microglia cells stimulated by beta-amyloid fibrils. J Neurosci Res 87:2718-2727. Carlini VP, Gaydou RC, Schioth HB, de Barioglio SR (2007) Selective serotonin reuptake inhibitor (fluoxetine) decreases the effects of ghrelin on memory retention and food intake. Regul Pept 140:65-73. Carlini VP, Varas MM, Cragnolini AB, Schioth HB, Scimonelli TN, de Barioglio SR (2004) Differential role of the hippocampus, amygdala, and dorsal raphe nucleus in regulating feeding, memory, and anxiety-like behavioral responses to ghrelin. Biochem Biophys Res Commun 313:635-641. Carlini VP, Martini AC, Schioth HB, Ruiz RD, Fiol de Cuneo M, de Barioglio SR (2008) Decreased memory for novel object recognition in chronically food-restricted mice is reversed by acute ghrelin administration. Neuroscience 153:929-934. Carlini VP, Monzon ME, Varas MM, Cragnolini AB, Schioth HB, Scimonelli TN, de Barioglio SR (2002) Ghrelin increases anxiety-like behavior and memory retention in rats. Biochem Biophys Res Commun 299:739-743. Carvajal P, Carlini VP, Schioth HB, de Barioglio SR, Salvatierra NA (2009) Central ghrelin increases anxiety in the Open Field test and impairs retention memory in a passive avoidance task in neonatal chicks. Neurobiol Learn Mem 91:402-407. Castaneda TR, Tong J, Datta R, Culler M, Tschop MH (2009) Ghrelin in the regulation of body weight and metabolism. Front Neuroendocrinol. Clewes O, Fahey MS, Tyler SJ, Watson JJ, Seok H, Catania C, Cho K, Dawbarn D, Allen SJ (2008) Human ProNGF: biological effects and binding profiles at TrkA, P75NTR and sortilin. J Neurochem 107:1124-1135. 8

Cui H, Cai F, Belsham DD (2005) Anorexigenic hormones leptin, insulin, and alpha-melanocyte-stimulating hormone directly induce neurotensin (NT) gene expression in novel NT-expressing cell models. J Neurosci 25:9497-9506. Chollet C, Meyer K, Beck-Sickinger AG (2009) Ghrelin--a novel generation of anti-obesity drug: design, pharmacomodulation and biological activity of ghrelin analogues. J Pept Sci 15:711-730. Chu KM, Chow KB, Leung PK, Lau PN, Chan CB, Cheng CH, Wise H (2007) Over-expression of the truncated ghrelin receptor polypeptide attenuates the constitutive activation of phosphatidylinositol-specific phospholipase C by ghrelin receptors but has no effect on ghrelin-stimulated extracellular signal- regulated kinase 1/2 activity. Int J Biochem Cell Biol 39:752-764. De Vriese C, Delporte C (2007) Influence of ghrelin on food intake and energy homeostasis. Curr Opin Clin Nutr Metab Care 10:615-619. De Vriese C, Delporte C (2008) Ghrelin: a new peptide regulating growth hormone release and food intake. Int J Biochem Cell Biol 40:1420-1424. Diano S, Farr SA, Benoit SC, McNay EC, da Silva I, Horvath B, Gaskin FS, Nonaka N, Jaeger LB, Banks WA, Morley JE, Pinto S, Sherwin RS, Xu L, Yamada KA, Sleeman MW, Tschop MH, Horvath TL (2006) Ghrelin controls hippocampal spine synapse density and memory performance. Nat Neurosci 9:381-388. Dixit VD, Weeraratna AT, Yang H, Bertak D, Cooper-Jenkins A, Riggins GJ, Eberhart CG, Taub DD (2006) Ghrelin and the growth hormone secretagogue receptor constitute a novel autocrine pathway in astrocytoma motility. J Biol Chem 281:16681-16690. Erol A (2008) An integrated and unifying hypothesis for the metabolic basis of sporadic Alzheimer's disease. J Alzheimers Dis 13:241-253. Ferrier IN, Cross AJ, Johnson JA, Roberts GW, Crow TJ, Corsellis JA, Lee YC, O'Shaughnessy D, Adrian TE, McGregor GP, et al. (1983) Neuropeptides in Alzheimer type dementia. J Neurol Sci 62:159-170. Gahete MD, Rubio A, Duran-Prado M, Avila J, Luque RM, Castano JP (2010) Expression of Somatostatin, Cortistatin, and Their Receptors, as well as Dopamine Receptors, but not of Neprilysin, are Reduced in the Temporal Lobe of Alzheimer's Disease Patients. J Alzheimers Dis. Giordano V, Peluso G, Iannuccelli M, Benatti P, Nicolai R, Calvani M (2007) Systemic and brain metabolic dysfunction as a new paradigm for approaching Alzheimer's dementia. Neurochem Res 32:555-567. Golomb J, Kluger A, Ferris S (2000) Mild cognitive impairment: identifying and treating the earliest stages of Alzheimer’s disease. Neurosci News 3 46–53. Guan XM, Yu H, Palyha OC, McKee KK, Feighner SD, Sirinathsinghji DJ, Smith RG, Van der Ploeg LH, Howard AD (1997) Distribution of mRNA encoding the growth hormone secretagogue receptor in brain and peripheral tissues. Brain Res Mol Brain Res 48:23-29. Gutierrez JA, Solenberg PJ, Perkins DR, Willency JA, Knierman MD, Jin Z, Witcher DR, Luo S, Onyia JE, Hale JE (2008) Ghrelin octanoylation mediated by an orphan lipid transferase. Proc Natl Acad Sci U S A 105:6320-6325. Hellstrom-Lindahl E, Ravid R, Nordberg A (2008) Age-dependent decline of neprilysin in Alzheimer's disease and normal brain: inverse correlation with A beta levels. Neurobiol Aging 29:210-221. Holst B, Holliday ND, Bach A, Elling CE, Cox HM, Schwartz TW (2004) Common structural basis for constitutive activity of the ghrelin receptor family. J Biol Chem 279:53806-53817. Jansen KL, Faull RL, Dragunow M, Synek BL (1990) Alzheimer's disease: changes in hippocampal N-methyl-D- aspartate, quisqualate, neurotensin, adenosine, benzodiazepine, serotonin and opioid receptors--an autoradiographic study. Neuroscience 39:613-627. Jeffery PL, Herington AC, Chopin LK (2003) The potential autocrine/paracrine roles of ghrelin and its receptor in hormone-dependent cancer. Cytokine Growth Factor Rev 14:113-122. Koon HW, Kim YS, Xu H, Kumar A, Zhao D, Karagiannides I, Dobner PR, Pothoulakis C (2009) Neurotensin induces IL-6 secretion in mouse preadipocytes and adipose tissues during 2,4,6,- trinitrobenzensulphonic acid-induced colitis. Proc Natl Acad Sci U S A 106:8766-8771. Leung PK, Chow KB, Lau PN, Chu KM, Chan CB, Cheng CH, Wise H (2007) The truncated ghrelin receptor polypeptide (GHS-R1b) acts as a dominant-negative mutant of the ghrelin receptor. Cell Signal 19:1011-1022. Merali Z, Du L, Hrdina P, Palkovits M, Faludi G, Poulter MO, Anisman H (2004) Dysregulation in the suicide brain: mRNA expression of corticotropin-releasing hormone receptors and GABA(A) receptor subunits in frontal cortical brain region. J Neurosci 24:1478-1485. Mousavi M, Hellstrom-Lindahl E, Guan ZZ, Shan KR, Ravid R, Nordberg A (2003) Protein and mRNA levels of nicotinic receptors in brain of tobacco using controls and patients with Alzheimer's disease. Neuroscience 122:515-520. Nemeroff CB, Kizer JS, Reynolds GP, Bissette G (1989) Neuropeptides in Alzheimer's disease: a postmortem study. Regul Pept 25:123-130. Neto LV, Machado ED, Luque RM, Taboada GF, Marcondes JB, Chimelli LM, Quintella LP, Niemeyer PJ, de Carvalho DP, Kineman RD, Gadelha MR (2009) Expression analysis of dopamine receptor subtypes in normal human pituitaries, non-functioning pituitary adenomas and somatotropinomas, and the association between dopamine and somatostatin receptors with clinical response to octreotide-LAR in acromegaly. J Clin Endocrinol Metab. 9

Ohinata K, Sonoda S, Inoue N, Yamauchi R, Wada K, Yoshikawa M (2007) beta-Lactotensin, a neurotensin agonist peptide derived from bovine beta-lactoglobulin, enhances memory consolidation in mice. Peptides 28:1470-1474. Proto C, Romualdi D, Cento RM, Spada RS, Di Mento G, Ferri R, Lanzone A (2006) Plasma levels of neuropeptides in Alzheimer's disease. Gynecol Endocrinol 22:213-218. Quirion R, Rowe WB, Lapchak PA, Araujo DM, Beaudet A (1992) Distribution of neurotensin receptors in mammalian brain. What it is telling us about its interactions with other neurotransmitter systems. Ann N Y Acad Sci 668:109-119. Remaury A, Vita N, Gendreau S, Jung M, Arnone M, Poncelet M, Culouscou JM, Le Fur G, Soubrie P, Caput D, Shire D, Kopf M, Ferrara P (2002) Targeted inactivation of the neurotensin type 1 receptor reveals its role in body temperature control and feeding behavior but not in analgesia. Brain Res 953:63-72. Rigamonti AE, Pincelli AI, Corra B, Viarengo R, Bonomo SM, Galimberti D, Scacchi M, Scarpini E, Cavagnini F, Muller EE (2002) Plasma ghrelin concentrations in elderly subjects: comparison with anorexic and obese patients. J Endocrinol 175:R1-5. Seim I, Herington AC, Chopin LK (2009) New insights into the molecular complexity of the ghrelin gene locus. Cytokine Growth Factor Rev. Selkoe DJ (2001) Alzheimer's disease: genes, proteins, and therapy. Physiol Rev 81:741-766. Taboada GF, Luque RM, Bastos W, Guimaraes RF, Marcondes JB, Chimelli LM, Fontes R, Mata PJ, Filho PN, Carvalho DP, Kineman RD, Gadelha MR (2007) Quantitative analysis of somatostatin receptor subtype (SSTR1-5) gene expression levels in somatotropinomas and non-functioning pituitary adenomas. Eur J Endocrinol 156:65-74. Takahashi K, Furukawa C, Takano A, Ishikawa N, Kato T, Hayama S, Suzuki C, Yasui W, Inai K, Sone S, Ito T, Nishimura H, Tsuchiya E, Nakamura Y, Daigo Y (2006) The neuromedin U-growth hormone secretagogue receptor 1b/neurotensin receptor 1 oncogenic signaling pathway as a therapeutic target for lung cancer. Cancer Res 66:9408-9419. Tirado-Santiago G, Lazaro-Munoz G, Rodriguez-Gonzalez V, Maldonado-Vlaar CS (2006) Microinfusions of neurotensin antagonist SR 48692 within the nucleus accumbens core impair spatial learning in rats. Behav Neurosci 120:1093-1102. Toth K, Laszlo K, Lenard L (2009a) Role of intraamygdaloid acylated-ghrelin in spatial learning. Brain Res Bull. Toth K, Laszlo K, Lukacs E, Lenard L (2009b) Intraamygdaloid microinjection of acylated-ghrelin influences passive avoidance learning. Behav Brain Res 202:308-311. Vincent JP, Mazella J, Kitabgi P (1999) Neurotensin and neurotensin receptors. Trends Pharmacol Sci 20:302- 309. Waseem T, Javaid Ur R, Ahmad F, Azam M, Qureshi MA (2008) Role of ghrelin axis in colorectal cancer: a novel association. Peptides 29:1369-1376. Williams G, Cardoso H, Lee YC, Ghatei MA, Flatt PR, Bailey CJ, Bloom SR (1991) Reduced hypothalamic neurotensin concentrations in the genetically obese diabetic (ob/ob) mouse: possible relationship to obesity. Metabolism 40:1112-1116. Yamauchi R, Wada E, Kamichi S, Yamada D, Maeno H, Delawary M, Nakazawa T, Yamamoto T, Wada K (2007) Neurotensin type 2 receptor is involved in fear memory in mice. J Neurochem 102:1669-1676. Yang J, Brown MS, Liang G, Grishin NV, Goldstein JL (2008) Identification of the acyltransferase that octanoylates ghrelin, an appetite-stimulating peptide hormone. Cell 132:387-396. Yates CM, Fink G, Bennie JG, Gordon A, Simpson J, Eskay RL (1985) Neurotensin immunoreactivity in post- mortem brain is increased in Down's syndrome but not in Alzheimer-type dementia. J Neurol Sci 67:327-335.

Table 1 Case details of control subjects and AD patients Case (NBB number) Age Gender Tangles Senile plaques PM time (h) ApoE Genotype Controls S00/183 73 F 0 B 4:00 3/2 S00/318 83 F 1 B 5:30 3/2 S94/068 85 F 1 B 5:00 S96/204 93 F 1 A 4:25 S95/181 74 M 3 C 5:00 4/3 S01/206 85 M 1 B 4:15 4/4 AD patients S03/117 70 F 6 C 4:30 3/3 S03/162 72 F 6 C 3:45 4/3 S05/307 85 F 6 C 5:00 3/3 S05/236 91 F 6 C 4:35 4/3 S05/072 68 M 6 C 4:15 4/4 S04/188 73 M 6 C 5:00 4/3 Case (NBB number), age at death (years), gender (F: female; M: male), Braak Stages according to neurofibrillary pathology [0-6] and senile plaques [A-C] (Braak and Braak, 1991), post- mortem time (in hours) and ApoE genotype of control and AD brains used in this study are shown.

Table 2 Primer sequences, product sizes and Genebank accession numbers Product GeneBank Gene Sense Antisense lenght Accession (bp) number Ghrelin TCAGGGGTTCAGTACCAGCA CAAGCGAAAAGCCAGATGAC 158 NM_016362.3 In2-ghrelin TCTGGGCTTCAGTCTTCTCC GTTCATCCTCTGCCCCTTCT 215 XXX GOAT TTGCTCTTTTTCCCTGCTCTC ACTGCCACGTTTAGGCATTCT 161 NM_001100916 GHSR1a TGAAAATGCTGGCTGTAGTGG AGGACAAAGGACACGAGGTTG 168 NM_198407 GHSR1b GGACCAGAACCACAAGCAAA AGAGAGAAGGGAGAAGGCACA 107 NM_004122 NTS GGCTTTTCAACACTGGGAGTTA AGGGTCTTCTGGGTTTATTCTCA 140 NM_006183 NMU CACAGAAGTTGGGCAAGTCAA CATTCCGTGGCCTGAATAAAA 168 NM_006681 NTSR1 AGCAGTGGACTCCGTTCCTC AAGTTGGCAGAGACGAGGTTG 118 NM_002531 NTSR2 CCAGGTGAATGTGCTGGTGT TCCATACGATGAAGCTGAGGAG 185 NM_012344 NTSR3 GCCAAATGGGGATCAGACA CAGCCATCACAGAGGCAAAA 184 NM_002959

Table 3 Absolute cDNA copy number/100ng of total RNA of each transcript in AD and controls patients as determined by quantitative real-time PCR Percentage of Control mean (n=6) AD mean (n=6) p-value change Ghrelin 153.564 ± 22.961 78.650 ± 7.751 -48,8 p=0.027 In2-ghrelin 61.768 ± 12.853 35.912 ± 5.573 -41,9 p=0.101 GOAT 128.506 ± 18.749 124.705 ± 32.045 -3,0 p=0.392 GHSR1a 10.725 ± 1.812 4.920 ± 462 -54,1 p=0.029 GHSR1b 6.641 ± 903 27.951 ± 1.492 320,9 p≤0.001 NTS 66 ± 9 54 ± 6 -17,6 p=0.730 NMU 64 ± 18 59 ± 14 -7,3 p=0.375 NTSR1 1.838 ± 229 321 ±87 -82,5 p=0.002 NTSR2 266.514 ± 41.775 109.158 ± 31.643 -59,0 p=0.019 NTSR3 77.768 ± 14.326 66.055 ± 11.223 -15,1 p=0.445 Values represent mean ± SEM

Figure legends Figure. 1. Absolute mRNA copy number of ghrelin (A), In2-ghrelin variant (B), GOAT (C), GHSR1a (D), GHSR1b (E), and GHSR1a/GHSR1b ratio (F) measured by quantitative real time PCR in brain temporal lobe of normal (black columns or dots; control) and Alzheimer disease (AD) (gray columns or dots) subjects. Values indicate mean mRNA copy number ± SEM of each transcript (adjusted by cyclophilin mRNA copy number) in the whole temporal lobe or in specific regions (inferior, medial and superior) of the temporal lobe. Asterisks (*p≤0.05; **, p≤0.01; ***, p≤0.001) indicate values that differ from controls. Figure. 2. Absolute mRNA copy number of NTS (A), NMU (B), NTSR1 (C), NTSR2 (D), and NTSR3 (E) measured by quantitative real time PCR in brain temporal lobe of normal (black columns; control) and Alzheimer disease (AD) (gray columns) subjects. Values indicate mean mRNA copy number ± SEM of each transcript (adjusted by cyclophilin mRNA copy number) in the whole temporal lobe or in specific regions (inferior, medial and superior) of the temporal lobe. Asterisks (*, p≤0.05; **, p≤0.01) indicate values that differ from controls.