Role of IRF6 in Epithelial Cell-Mediated Host Defence and Inflammation

Role of IRF6 in epithelial cell-mediated host defence and inflammation

Divya Ramnath

M. Molecular Biology

A thesis submitted for the degree of Doctor of Philosophy at

The University of Queensland in 2014

Institute for Molecular Bioscience Abstract Abstract

Members of the Interferon Regulatory Factor (IRF) family of transcription factors have essential roles in developmental pathways, as well as immune function and host defence. IRF6 has a well- characterized role in epithelial cell differentiation, but has not been studied in the context of immune function. In this thesis, I investigated IRF6 involvement in Toll-like Receptor (TLR) responses in epithelial cells. In contrast to the ubiquitous and myeloid-restricted expression patterns of IRF3 and IRF8, respectively, IRF6 was selectively expressed in a range of human epithelial cell types, particularly keratinocytes. Keratinocyte differentiation also increased IRF6 mRNA and protein expression. Primary human keratinocytes, as well as the keratinocyte cell line HaCaT, responded weakly to most TLR ligands, with the exception of the TLR3 agonist poly(IC). Poly(IC) robustly upregulated mRNA expression of IFN-β, as well as the chemokines IL-8, CCL5 and CCL20 in both of these cell types. Surprisingly, poly(IC) also selectively upregulated mRNAs encoding IL-23p19 and EBI3, two members of the IL-12 family that have not been shown to heterodimerize. Although IRF6 enhanced poly(IC)-inducible IFN-β promoter activity in HEK- TLR3 cells, silencing IRF6 expression did not decrease poly(IC)-inducible IFN-β mRNA expression in primary keratinocytes. Several other inducible genes were also unaffected, however knock-down of IRF6 did impair poly(IC)-inducible IL-23p19 mRNA expression in primary keratinocytes. Conversely, ectopic expression of IRF6 in the bladder epithelial cell line T24 conferred poly(IC)-inducible IL-23p19 mRNA expression. To investigate the mechanisms responsible, the IL-23p19 promoter was cloned and transient transfection analyses were performed. These experiments indicated that IRF6 enhanced IL-23p19 promoter activity upon poly(IC) stimulation. Poly(IC) also trigged nuclear translocation of IRF6 in keratinocytes. However, IL- 23p19 protein was not detected in supernatants or cell lysates from poly(IC)-activated keratinocytes. Therefore, the effect of inflammatory stimuli, like IFN-γ, on keratinocyte responses to poly(IC) was examined. IFN-γ priming enhanced poly(IC)-inducible gene expression but still did not license IL-23p19 secretion. Interestingly, keratinocyte differentiation increased poly(IC)- inducible IL-23p19 mRNA expression, but decreased poly(IC)-inducible IFN-β mRNA expression upon IFN-γ priming. Collectively, these data suggest that IRF6 promotes a sub-set of TLR3 responses in human keratinocytes.

Studies were also undertaken to determine whether IRF6 is involved in MyD88-dependent signalling responses in keratinocytes. Most MyD88-dependent TLR agonists were generally ineffective at triggering inflammatory responses in these cells. Investigation of other MyD88- ii dependent ligands revealed that the TLR7 agonist imiquimod and the TLR2/6 agonist FSL-1 did upregulate inflammatory chemokine expression in keratinocytes. Knock-down studies suggested that IRF6 contributed to TLR7-inducible CCL5 and IFN-β mRNA expression in these cells. Given the modest effects of most MyD88-dependent TLR agonists on inflammatory responses in keratinocytes, factors that may enhance these responses were also investigated. Keratinocyte differentiation increased imiquimod-inducible CCL5 mRNA expression in keratinocytes, whereas there was no clear effect of IFN-γ priming. The role of IRF6 in promoting TLR2/6 responses in keratinocytes remains unresolved. In total, my findings posit IRF6 as a transducer of a sub-set of MyD88-dependent and -independent TLR responses in keratinocytes, implicating it as a sentinel transcription factor in pathogen sensing by the skin.

iii

Declaration by author

This thesis is composed of my original work, and contains no material previously published or written by another person except where due reference has been made in the text. I have clearly stated the contribution by others to jointly-authored works that I have included in my thesis.

I have clearly stated the contribution of others to my thesis as a whole, including statistical assistance, survey design, data analysis, significant technical procedures, professional editorial advice, and any other original research work used or reported in my thesis. The content of my thesis is the result of work I have carried out since the commencement of my research higher degree candidature and does not include a substantial part of work that has been submitted to qualify for the award of any other degree or diploma in any university or other tertiary institution. I have clearly stated which parts of my thesis, if any, have been submitted to qualify for another award.

I acknowledge that an electronic copy of my thesis must be lodged with the University Library and, subject to the General Award Rules of The University of Queensland, immediately made available for research and study in accordance with the Copyright Act 1968.

I acknowledge that copyright of all material contained in my thesis resides with the copyright holder(s) of that material. Where appropriate I have obtained copyright permission from the copyright holder to reproduce material in this thesis.

Publications during candidature

Conference Abstracts

Ramnath, D., Bergot, A.S., Scholz, G.M., Sweet, M.J. (2011) IRF6: An epithelial cell-specific component of TLR signalling? Brisbane Immunology Group 12th Annual Meeting, Sea-world Resort, Gold Coast, QLD, Australia.

Ramnath, D., Bergot, A.S., Scholz, G.M., Sweet, M.J. (2012) IRF6: An epithelial cell-specific component of TLR signalling. TLROZ 2012 conference, Melbourne, VIC, Australia.

Ramnath, D., Bergot, A.S., Sturm, R.A., Scholz, G.M., Sweet, M.J. (2013) IRF6: An epithelial cell-specific component of TLR signalling. Australasian society of Immunology 43rd Annual Scientific Meeting, Wellington, New Zealand. (I was unable to attend this conference since I did not receive a visa for travel. This talk was kindly presented by Dr. Katryn Stacey, University of Queensland, on my behalf).

Publications included in this thesis

No publications included.

Contributions by others to the thesis

A/Prof. Matthew Sweet made a significant and substantial contribution to the conception and design of this project, as well as interpretation of data and critical revision of the thesis. A/Prof. Glen Scholz also provided significant input in project design and provided plasmids used in these studies. A/Prof. Richard Sturm provided support in technical work related to culturing of human keratinocytes and critically revised this thesis. Dr. Anne-Sophie Bergot, Dr. Makrina Totsika, Dr. Timothy Barnett, Dr. Nilesh Bokil and A/Prof. Kiarash Khosrotehrani provided cells or tissue samples used in these studies, as indicated in materials and methods. Dr. Kolja Schaale and Dr. Ronan Kapetanovic also contributed to critical revision of this thesis. Mr. Daniel Hohenhaus and Mr. John Griffin provided technical support with microscopy studies and Russell Medical Centre, Queensland provided skin samples used in this thesis.

Statement of parts of the thesis submitted to qualify for the award of another degree

None.

Acknowledgements

I have been privileged to work with a number of people during my PhD, who have supported and inspired me during this challenging duration of my study. I would first like to give my appreciation and thanks to my PhD advisor, A/Prof. Matt Sweet for his invaluable support, encouragement and guidance throughout my PhD, without which I would never have made it to the end. I would also like to thank my co-supervisors A/Prof. Glen Scholz and A/Prof. Rick Sturm for their help and guidance in my project. I would also like to extend my sincere thanks to my thesis committee members, Dr. Kate Schroder, A/Prof. Stuart Kellie and Prof. Mark Walker, for their comments and criticism that were very useful for improving my project. I would also like to thank UQ and IMB for providing me this wonderful opportunity to pursue my PhD here.

My experience working in the Sweet group has been both comfortable and stimulating, for which I would like to thank all the members of Group Sweet, past and present. Thanks Dan, Greg, Juliana, Kolja, Katja, Mel, Nabilah, Nilesh, Ronan, Selene, Sian and Tam; you have been a fantastic group to work with and made it such an enjoyable and memorable experience to work in the lab. I would also like to thank the people who shared the PhD “Fishbowl” office with me for your cheerful chats and being such great friends. Also thanks to all the members of Groups Schroder and Stacey for the useful discussions and comments during lab meetings. Thank you to all the fellow scientists on Level 5, IMB for just being around and the many conversations that made working late at night or on weekends more bearable. Many thanks to everyone who provided technical support and/or reagents that were essential for this work. Thanks to all the support staff, in particular Dr. Amanda Carozzi and Mrs. Anne Tobin, and the scientists in the IMB for being such a pleasure to work with. A special thanks to Dr. Terry Russell and his staff at Russell Medical Centre for their support throughout my PhD.

I would also like to give my appreciation to Dr. David Pennisi, Dr. Richa Dave and Dr. Steve Broomfield for their cordial support and guidance, before and during my PhD, and sharing their valuable experience in science with me. It has really helped me understand my potential and develop myself into a better scientist.

Many thanks to all my friends, (too many to list here, but you know who you are!) for your friendship and much needed distractions from work. It has been an incredible journey, and I am glad that you were with me making this an amazing and fun experience!

Lastly, I thank almighty, my parents, my brother and sister-in-law, and my extended family for their constant encouragement, for believing in me and not letting me quit when times were tough!

vii

Thanks for being so understanding and lifting my spirits when things were just not right. It would have been impossible to pursue this without your patience and support. I would also like to thank my family in Brisbane, my late cousin Uma, her husband and two girls Manasa and Sharada for their support. Thanks for being so tolerant when I failed to visit/call due to busy work schedule. Finally, I would like to thank my Grandfather, who has always been there cheering me up, and stood by me through the good times and bad. For him, this is a dream come true.

viii

Keywords

interferon regulatory factor, toll-like receptor, inflammation, epithelial cell, keratinocytes, barrier defence

Australian and New Zealand Standard Research Classifications (ANZSRC)

ANZSRC code: 060111, Signal Transduction, 50%

ANZSRC code: 110707, Innate Immunity, 30%

ANZSRC code: 110304, Dermatology, 20%

Fields of Research (FoR) Classification

FoR code: 1107, Immunology, 80%

FoR code: 0601, Biochemistry and Cell Biology, 20%

Table of Contents

ABSTRACT ...... ii

LIST OF FIGURES ...... xv

LIST OF TABLES ...... xvi

LIST OF ABBREVIATIONS ...... xviii

1 INTRODUCTION ...... 1

1.1 BARRIER DEFENCE ...... 2

1.2 PATHOGEN EVASION OF BARRIER DEFENCE ...... 3

1.3 PATTERN RECOGNITION RECEPTORS ...... 4 1.3.1 Toll-like Receptors (TLRs) ...... 5 1.3.2 Nod-like receptors (NLRs) ...... 9 1.3.3 RIG-I-like receptors (RLRs) ...... 9 1.3.4 C-type lectin receptors (CLRs) ...... 10 1.3.5 The PYHIN family ...... 10

1.4 INTERFERON REGULATORY FACTORS (IRFS) ...... 11 1.4.1 IRFs in TLR Signalling ...... 14 1.4.2 Major Target of IRFs ...... 16

1.5 INTERFERON REGULATORY FACTOR 6 ...... 19 1.5.1 Developmental functions of IRF6 ...... 20 1.5.2 IRF6 Regulation ...... 22

1.6 TLRS IN EPITHELIAL CELLS ...... 23 1.6.1 TLR localization in epithelial cells ...... 28 1.6.2 TLR responsiveness of keratinocytes ...... 28

1.7 PROJECT AIMS AND HYPOTHESIS ...... 31 1.7.1 Hypothesis ...... 32 1.7.2 Research Aims ...... 32

2 MATERIALS AND METHODS ...... 33

2.1 MATERIALS ...... 34 2.1.1 General Reagents ...... 34 2.1.2 Primers ...... 34 2.1.3 Plasmids ...... 35

2.1.4 Antibodies...... 35 2.1.5 TLR agonists ...... 36 2.1.6 siRNAs ...... 37

2.2 METHODS ...... 37 2.2.1 Cell lines and culture conditions ...... 37 2.2.2 Primary Cells ...... 40 2.2.3 Storage of cells ...... 41 2.2.4 Sub-culturing techniques...... 41 2.2.5 PAMP stimulation ...... 41 2.2.6 RNA extraction and reverse transcriptase PCR ...... 42 2.2.7 Real-time PCR (qPCR) ...... 42 2.2.8 Western blotting ...... 42 2.2.9 Gene silencing ...... 43 2.2.10 Enzyme-linked Immunosorbent Assays (ELISA) ...... 43 2.2.11 PCR Cloning ...... 44 2.2.12 Plasmid purification ...... 45 2.2.13 Transient transfection analysis and reporter gene assays ...... 45 2.2.14 Nuclear and Cytoplasmic fractionation ...... 46 2.2.15 Immunofluoresence microscopy ...... 46 2.2.16 Flow Cytometry ...... 47 2.2.17 Immunohistochemistry (IHC) ...... 47 2.2.18 Pathogen infection assays ...... 47 2.2.19 Data presentation and statistical analyses ...... 48

3 IRF6 EXPRESSION AND TLR RESPONSES IN EPITHELIAL CELL POPULATIONS...... 49

3.1 INTRODUCTION ...... 50

3.2 RESULTS ...... 51 3.2.1 Human keratinocytes express high levels of IRF6 mRNA and protein ...... 51 3.2.2 The TLR3 agonist poly(IC) triggers IL-8 production from human keratinocytes...... 53 3.2.3 Poly(IC) upregulates the expression of a sub-set of TLR target genes in primary human keratinocytes ...... 54 3.2.4 HaCaT cells behave similarly to primary keratinocytes in responsiveness to different TLR agonists ...... 56

3.2.5 Poly(IC)-inducible IL-23p19 mRNA expression does not occur in IRF6-deficient T24 cells 56 3.2.6 Confirmation of activity of TLR agonists on RAW-ELAM cells ...... 59 3.2.7 IRF6 expression during keratinocyte differentiation ...... 60 3.2.8 Differentiation status of primary human keratinocytes does not affect TLR mRNA expression...... 61 3.2.9 Differentiation status of primary human keratinocytes does not greatly influence poly(IC)-responsiveness ...... 63

3.3 SUMMARY AND DISCUSSION OF CHAPTER 3 ...... 63 3.3.1 IRF6 expression is enriched in keratinocytes ...... 63 3.3.2 Human keratinocytes are responsive to the TLR3 agonist poly(IC) ...... 64 3.3.3 The differentiation status of keratinocytes does not affect TLR3 responsiveness ...... 67

4 IRF6 INVOLVEMENT IN POLY(IC)-REGULATED GENE EXPRESSION IN KERATINOCYTES...... 69

4.1 INTRODUCTION ...... 70

4.2 RESULTS ...... 71 4.2.1 IRF6 activates the IFN-β promoter ...... 71 4.2.2 IRF6 expression enhances poly(IC)-mediated IFN-β promoter activity ...... 71 4.2.3 IRF6 knockdown selectively impairs TLR3-induced IL-23p19 expression in primary keratinocytes ...... 74 4.2.4 IRF6 over-expression in T24 cells enhances poly(IC)-inducible IL-23p19 expression . 76 4.2.5 IRF6 enhances IL-23p19 promoter activity upon poly(IC) stimulation ...... 77 4.2.6 Poly(IC) stimulation may promote IRF6 nuclear translocation ...... 79 4.2.7 Attempts to detect IL-23p19 protein in poly(IC)-stimulated keratinocyte supernatants and cell lysates ...... 81 4.2.8 IFN-γ priming enhances keratinocyte responses to poly(IC)...... 82 4.2.9 Differentiation status of keratinocytes partially affects TLR3 responses after IFN-γ priming ...... 83

4.3 SUMMARY AND DISCUSSION OF CHAPTER 4 ...... 85 4.3.1 IRF6 involvement in regulation of IFN-β expression ...... 85 4.3.2 Regulation of poly(IC)-inducible IL-23p19 expression by IRF6 ...... 86 4.3.3 Effects of IFN-γ-priming on poly(IC) responses in keratinocytes...... 89

5 INVESTIGATION OF THE ROLE OF IRF6 IN MYD88-DEPENDENT TLR SIGNALLING IN KERATINOCYTES...... 91 xii

5.1 INTRODUCTION ...... 92

5.2 RESULTS ...... 93 5.2.1 Primary keratinocytes are responsive to the TLR7 agonist Imiquimod ...... 93 5.2.2 IRF6 knockdown impairs TLR7-mediated IFN-β and CCL5 gene induction in primary keratinocytes ...... 94 5.2.3 Keratinocyte differentiation enhances imiquimod inducible CCL5 expression...... 95 5.2.4 IFN-γ priming does not affect imiquimod-inducible gene expression ...... 96 5.2.5 Differentiation status of keratinocytes has little effect on IFN-γ priming of TLR7 responses ...... 97 5.2.6 Primary keratinocytes respond to the TLR2/6 agonist FSL-1 ...... 98 5.2.7 Effect of IRF6 knockdown on TLR2/6 responses in primary keratinocytes ...... 99 5.2.8 Investigation of FSL-1-mediated IRF6 nuclear expression in primary keratinocytes . 100

5.3 SUMMARY AND DISCUSSION OF CHAPTER 5 ...... 102 5.3.1 Involvement of IRF6 in TLR7 responses in keratinocytes ...... 102 5.3.2 Involvement of IRF6 in TLR2/6 responses in keratinocytes ...... 104

6 FINAL DISCUSSION ...... 108

6.1 INTRODUCTION ...... 109

6.2 ROLES OF IRF6 IN TRIF-DEPENDENT TLR SIGNALLING IN KERATINOCYTES ...... 109 6.2.1 The functions of TLR3 in keratinocytes...... 109 6.2.2 The role of IRF6 in TLR3 signalling ...... 110 6.2.3 Possible role(s) of IL-23p19 in skin homeostasis and pathology ...... 112 6.2.4 A proposed model for IRF6 involvement in TLR3 signalling ...... 114

6.3 THE ROLES OF IRF6 IN MYD88-DEPENDENT TLR SIGNALLING IN KERATINOCYTES ...... 114 6.3.1 Why are most of the MyD88-dependent TLRs inactive in keratinocytes? ...... 114 6.3.2 The role of IRF6 in MyD88-dependent TLR signalling ...... 117 6.3.3 The roles of TLR7 in skin pathology ...... 119 6.3.4 The role of IRF6 in TLR7 signalling ...... 119 6.3.5 Role of TLR2/6 signalling in keratinocytes ...... 120 6.3.6 Role of IRF6 in anti-bacterial responses of keratinocytes ...... 121 6.3.7 A proposed model for the role of IRF6 in MyD88-dependent TLR signalling ...... 122

6.4 COMPARISON OF TRIF- AND MYD88-DEPENDENT TLR RESPONSES IN KERATINOCYTES ...... 123 6.4.1 IRF6 expression in proliferating versus differentiated keratinocytes ...... 123 6.4.2 Interplay between IFN-γ priming and differentiation status on TLR responses ...... 124

6.5 FUTURE DIRECTIONS ...... 126

xiii

6.5.1 Limitations of this thesis and future experiments...... 126 6.5.2 Conclusion ...... 128

7 REFERENCES ...... 129

xiv

List of Figures List of Figures

Figure 1.1. MyD88-dependent and -independent TLR4 signalling pathways. 8

Figure 1.2. Overview of the IRF family. 12

Figure 1.3. IRFs impart specificity to TLR signalling. 15

Figure 2.1. A schematic diagram indicating IRF6 siRNA targeting sites. 37

Figure 2.2. Plasmid map of pIL-23p19-luc. 44

Figure 3.1. Human keratinocytes express high levels of IRF6. 52

Figure 3.2. The TLR3 agonist poly(IC) triggers IL-8 production from human keratinocytes. 54

Figure 3.3. Poly(IC) triggers robust gene expression changes in primary keratinocytes. 55

Figure 3.4. HaCaT cells respond to TLR agonists in a similar way to primary keratinocytes. 57

Figure 3.5. T24 cells respond to poly(IC), but do not induce IL-23p19 mRNA expression upon poly(IC) stimulation. 58

Figure 3.6. Zymosan, Pam3Cys and LPS were active on RAW-ELAM cells. 59

Figure 3.7. IRF6 expression in primary keratinocytes during differentiation. 61

Figure 3.8. TLR mRNA expression is not regulated during primary human keratinocyte differentiation. 62

Figure 3.9. Differentiation status does not affect poly(IC)-inducible IL-8 production from primary keratinocytes. 63

Figure 4.1. IRF6 activates the IFN-β promoter in HEK293 cells. 72

Figure 4.2. IRF6 expression enhances poly(IC)-mediated activation of the IFN-β promoter activity. 73

Figure 4.3. IRF6 knockdown selectively impairs TLR3-inducible IL-23p19 mRNA expression in primary keratinocyte. 75

Figure 4.4. Effects of IRF6 knock-down on inducible gene expression in human keratinocytes are apparent with independent siRNAs. 76

Figure 4.5. IRF6 over-expression in T24 cells confers poly(IC)-inducible IL-23p19 mRNA expression. 77

Figure 4.6. IRF6 enhances poly(IC)-inducible activity of the IL-23p19 promoter in xv

RAW264.7 cells. 78

Figure 4.7. Poly(IC) stimulation may promote IRF6 nuclear translocation. 80

Figure 4.8. IL-23p19 protein was not detected in poly(IC)-stimulated keratinocyte supernatants or cell lysates. 82

Figure 4.9. IFN-γ priming enhances poly(IC)-regulated inflammatory responses in keratinocytes. 83

Figure 4.10. Differentiation status differentially affects the ability of IFN-γ to prime poly(IC) responses in keratinocytes. 84

Figure 5.1. Primary keratinocytes are responsive to the TLR7 ligand imiquimod. 94

Figure 5.2. IRF6 knock-down impairs TLR7-mediated IFN-β and CCL5 gene induction in primary keratinocytes. 95

Figure 5.3. Keratinocyte differentiation enhances imiquimod-inducible CCL5 expression. 96

Figure 5.4. IFN-γ priming does not enhance imiquimod-inducible gene expression. 97

Figure 5.5. Differentiation of keratinocytes does not permit IFN-γ priming of TLR7 responses. 98

Figure 5.6. Primary keratinocytes respond to the TLR2/6 ligand FSL-1. 99

Figure 5.7. Effect of IRF6 knock-down on FSL-1 responses in primary keratinocytes. 100

Figure 5.8. FSL-1 increases IRF6 protein expression in primary human keratinocytes. 101

Figure 5.9. Phosphorylation sites in IRF6. 103

Figure 6.1. IRF6 IHC in wounded skin of mice. 112

Figure 6.2. A proposed model for IRF6 involvement in TLR3 signalling. 115

Figure 6.3. IRF6 does not affect intracellular survival of GAS within primary keratinocytes. 122

Figure 6.4. A proposed model for IRF6 involvement in MyD88-dependent TLR signalling. 123

Figure 6.5. A proposed model for IRF6 involvement TLR signalling upon keratinocyte differentiation. 125

List of Tables

xvi

List of Tables

Table 1.1. TLR Recognition of Microbial Components. 6

Table 1.2. The expression of various human (h) and mouse (m) TLRs in epithelial 25-27 cells from different anatomical locations.

Table 1.3. TLR responses in keratinocytes. 29-31

Table 2.1. List of Primers used for qPCR. 34-35

Table 2.2. List of Antibodies used in this thesis. 35-36

xvii

List of Abbreviations List of Abbreviations

µg microgram µl microlitre µm micrometre µM micromolar aa amino acid AD atopic dermatitis AIM2 absent in melanoma 2 AMP anti-microbial peptide ANOVA analysis of variance AP-1 activator protein-1 ASC apoptosis-associated speck-like protein containing a CARD bp base pairs Ca2+ calcium CARD caspase recruitment domain CBP CREB-binding protein CCL C-C motif ligand CCR C-C motif receptor cDC conventional dendritic cells cDNA complementary DNA CLR C-type Lectin like Receptor cm2 centimetre square CTLD C-type lectin like domain CXCL C-X-C motif ligand d day DAMP danger associated molecular patterns DAPI 4', 6-diamidino-2-phenylindole DBD DNA binding domain

xviii

DC dendritic cells DMSO dimethyl sulfoxide DNA deoxyribonucleic acid ds double stranded E. coli Escherichia coli EBI Epstein-Barr virus induced gene ELISA enzyme-linked Immunosorbent Assay ERK extracellular signal-regulated kinases FBS foetal bovine serum FSL-1 Pam2CGDPKHPKSF g grams g gravity GAS Group A Streptococcus GFP green fluorescent protein gp130 glycoprotein-130 h hour(s) HIV human immunodeficiency virus HMDM human monocyte derived macrophages HPRT hypoxanthine-guanine phosphoribosyltransferase HPV human papilloma virus HRP horseradish peroxidase HSV herpes simplex virus IAD IRF-associated domain IEC intestinal epithelial cells IFI interferon inducible protein IFN interferon IHC immunohistochemistry IKK IκB Kinase IL interleukin IRAK IL-1R-associated kinase

xix

IRF interferon regulatory factor ISRE IFN-stimulated response element ITAM immunoreceptor tyrosine-based activation motif IVL involucrin IκB inhibitor of NF-κB JAK Janus kinase JNK c-Jun N-terminal Kinase K or Lys lysine K14 keratin 14 l litre LGP2 laboratory of genetics and physiology 2 LPS lipopolysaccharide LRR leucine rich repeat LTA lipoteichoic acid M molar MAL MyD88 adaptor-like MAP3K mitogen-activated protein kinase kinase kinase MAPK mitogen-activated protein kinase Maspin mammary serine protease inhibitor MCS9.7 multi-species conserved enhancer sequence 9.7 MDA-5 melanoma differentiation-associated gene 5 MEE medial edge epithelial mg milligram min minute(s) ml millilitre mM millimolar MOI multiplicity of infection mRNA messenger RNA MyD88 myeloid differentiation primary response gene 88 NES nuclear export signal

NF-κB nuclear factor kappa B ng nanogram NK natural killer cell NLR nod-like receptor nm nanometre nM nanomolar NSCLP non-syndromic cleft lip/palate Pam3Cys tripalmitoyl-S-glycerylcysteine PAMP pathogen-associated molecular pattern PBS phosphate buffered saline PCR polymerase chain reaction pDC plasmacytoid dendritic cells PGN peptidoglycan pM picomolar PMA phorbol 12-myristate 13-acetate Poly(IC) polyinosinic-polycytidylic acid PPS popliteal pterygium syndrome PRE positive regulatory element PRR pattern recognition receptors PYD pyrin domain qPCR quantitative real-time PCR R receptor RANTES regulated on activation, normal T cell expressed and secreted RIG-I retinoic acid-inducible gene – I RIP receptor-interacting protein RLR RIG-I-like Receptor RNA ribonucleic acid ROCK rho-associated protein kinase S. aureus Staphylococcus aureus SCC squamous cell carcinoma

xxi

Ser or S serine Sfn stratifin SIGN specific intracellular adhesion molecule-3 grabbing non-integrin siRNA small interfering RNA ss single stranded STAT signal transducer and activator of transcription STING stimulator of interferon genes TAB TAK-1 associated binding proteins TAK1 transforming growth factor-beta activated kinase1 TBK-1 TANK binding kinase 1 TGFβ3 transforming growth factor beta3 Th T helper cell THY Todd-Hewitt containing 0.2% yeast extract TIR toll interleukin 1 receptor TIRAP TIR domain-containing adaptor protein TLR toll-like Receptor TNF-α tumour necrosis factor alpha TPL2 tumour progression locus 2 TRAF tumour necrosis factor receptor associated factor TRAM TRIF-related adaptor molecule Treg T regulatory cell TRIF TIR domain-containing adaptor-inducing IFN TSLP thymic stromal lymphoprotein TSS transcription start site U units UPEC uropathogenic E. coli UTI urinary tract infection UV ultraviolet VWS Van der Woude's syndrome WSX-1 cytokine receptor WSX-1

xxii

Introduction

1 Introduction

Introduction In mammals, immunity is a multi-layered system that is comprised of barrier defence, innate immunity and acquired immunity. Barrier defence provides the first line of protection and acts to prevent microbial entry. If this defence is breached, the innate immune system is rapidly activated, and acts to contain and/or destroy the invading microorganism. Successful pathogens can overcome barrier defence and innate immunity, and in this instance, the acquired immune system is activated in a delayed fashion. This is a highly specific response that utilizes both cellular and humoral components. Although innate and acquired immunity have been extensively studied in immune defence, it is now appreciated that barrier defence plays an active and important role in host protection. This project focuses on a specific molecular component of barrier defence (IRF6), and the contribution of this component to host responses to pathogen challenge.

1.1 Barrier defence Barrier defence consists of physical, mechanical, chemical and microbiological barriers that prevent microorganisms from breaching epithelial tissues. Pathogens can gain access to the body by either subverting epithelial cell function or through opportunistic means, for example damaged or wounded epithelial tissue, or through vector-mediated entry (Frischknecht 2007, Diamond, Beckloff et al. 2009). Physical barriers are provided by epithelial cells themselves, which form tight junctions to generate an impenetrable barrier. Mucous membranes also surround the openings of various organs such as the lungs, intestines, and the genitourinary tract that are exposed to the external environment and microbial challenge (Acheson and Luccioli 2004). These secrete mucus to prevent pathogens from coming into physical contact with epithelial cells (Acheson and Luccioli 2004). Mechanical defence includes the beating of tiny hairs (cilia), the flushing action of tears and urine, and coughing/sneezing, which all directly eject pathogens and other irritants from mucosal surfaces (Stannard and O'Callaghan 2006, Diamond, Beckloff et al. 2009, Potempa and Pike 2009).

Chemical barriers include acidic conditions in the stomach that destroy some pathogens, thus preventing them from entering the digestive system, as well as a range of anti-microbial agents (such as lysozyme and anti-microbial peptides) present in various body fluids, including sebum, phlegm, saliva and tears (Dommett, Zilbauer et al. 2005, Potempa and Pike 2009). Lysozymes are hydrolytic enzymes, which are ubiquitously present in animals (Ito, Yoshikawa et al. 1999, Zhao, Song et al. 2007, Callewaert and Michiels 2010). They act broadly against a variety of microorganisms by cleaving the β-1,4 linked glycosidic bond of peptidoglycan (PGN), which is enriched in the cell walls of Gram-positive bacteria (Ito, Yoshikawa et al. 1999, Zhao, Song et al. 2007).

Introduction Defensins and cathelicidins are the two main anti-microbial peptide (AMP) families. Defensins are cationic peptides characterized by six conserved cysteine residues that form disulfide bridges. They are classified into α-defensins, β-defensins and θ-defensins based on the alignment of their disulfide bridges, sites of expression and biological activities (Raj and Dentino 2002, Guani-Guerra, Santos- Mendoza et al. 2010, Tecle, Tripathi et al. 2010). In humans, α-defensins are primarily expressed by neutrophils, with disulfide bridging between cysteines 1-6, 2-4 and 3-5 (White, Wimley et al. 1995). α-defensins consists of six members. These are the four human neutrophil peptides 1-4, and the two epithelial α-defensins 5 and 6, which are expressed in the mucosal layer of the small intestine (Quayle, Porter et al. 1998, Ouellette 2004, Tecle, Tripathi et al. 2010). β-defensins are produced by epithelial cells of the respiratory, gastrointestinal and genitourinary tracts, as well as by keratinocytes in the skin (White, Wimley et al. 1995, Raj and Dentino 2002, Schutte and McCray 2002, Ganz 2003, Tecle, Tripathi et al. 2010). They contain disulfide bridges between cysteines 1-5, 2-4 and 3-6 (Guani-Guerra, Santos-Mendoza et al. 2010). Defensins are produced in response to pathogen challenge, and have direct anti-microbial effects. They can also have a range of other important biological activities, including acting as chemoattractants and stimulators of pro- inflammatory cytokine production (Guani-Guerra, Santos-Mendoza et al. 2010, Tecle, Tripathi et al. 2010). Human neutrophil peptides-1-4 (α-defensins) demonstrate antiviral activity in vitro against adenovirus, human papilloma virus (HPV) and human immunodeficiency virus-1 (HIV-1) infection (Klotman and Chang 2006). β-defensins prevent viral infections through multiple mechanisms such as disrupting the viral envelope, inhibiting viral entry to the cell by binding to viral glycoproteins and receptors and interfering with the cell-signalling pathways of viral replication (Klotman and Chang 2006). β-defensins synergize with other AMPs to act against Gram-negative and Gram- positive bacteria (Harder, Meyer-Hoffert et al. 2000, Klotman and Chang 2006). Cathelicidins contain a highly conserved N-terminal cathelin domain (Zanetti, Gennaro et al. 1995). The human cathelicidin gene codes for an inactive precursor protein, human cationic antimicrobial peptide-18, which is processed to the active LL-37 peptide in response to appropriate signals (Cowland, Johnsen et al. 1995, Frohm, Agerberth et al. 1997). Human cationic antimicrobial peptide-18 is produced by several cell types including myeloid cells and epithelial cells of the urinary and respiratory tracts and keratinocytes (Cowland, Johnsen et al. 1995, Frohm, Agerberth et al. 1997). Cathelicidins exhibit potent antimicrobial effects against Streptococcus pyogenes or Group A Streptococcus (GAS) infections in the skin (Dorschner, Pestonjamasp et al. 2001).

1.2 Pathogen evasion of Barrier defence Although some pathogens enter the body through opportunistic means, many others use specific virulence mechanisms to breach the epithelium. Several pathogens are able to adhere to, and invade

Introduction epithelial cells. For example, Uropathogenic Escherichia coli (E. coli) (UPEC), a specific subset of extraintestinal pathogenic E. coli causing urinary tract infections (UTI), use fimbrae to bind to epithelial cells of the urinary tract (Mulvey, Schilling et al. 2001, Mulvey 2002, Nielubowicz and Mobley 2010). They also produce toxins such as cytotoxic necrotizing factor 1, which kills host epithelial cells and thus help to breach barrier defence (Amieva, Salama et al. 2002, Chu, Wang et al. 2010, Nielubowicz and Mobley 2010). Turn-over or exfoliation is a physiological process of intestinal epithelial cells that allows cells to regenerate and eliminate surface bacteria (Frost, Bland et al. 1997). However, opportunistic enteric bacteria such as Shigella and Clostridia use this to gain entry into the cells via the inter-cellular spaces (Takeuchi 1982, Riegler, Sedivy et al. 1995). Salmonella typhimurium utilizes a type III secretion system to inject virulent effector proteins into epithelial cells to promote bacterial uptake by macropinocytosis and to paralyze intestinal epithelium-mediated inflammatory responses, thereby gaining access to the body (Hansen-Wester and Hensel 2001, Zhou and Galan 2001). Gram-positive bacteria such as GAS also utilize numerous mechanisms to breach the epithelial barrier. These include M protein, fibronectin-binding proteins, hyaluronic acid capsule, extracellular enzymes and toxins, which allow the bacteria to colonize and invade cells (LaPenta, Rubens et al. 1994, Molinari and Chhatwal 1999, Cue, Southern et al. 2000). These are some of the many mechanisms utilized by bacterial pathogens to successfully gain entry into the host.

Although epithelial cells are sometimes regarded as non-specific components of host defence, it is now clear that they contribute more actively. For example, they are able to initiate inflammatory responses by virtue of the expression of a range of microbial-sensing pattern recognition receptors (Hornef, Normark et al. 2003, Hornef and Bogdan 2005). These sense specific microbial products, thus enabling epithelial cells to recognize particular classes of pathogens, and to trigger the most appropriate inflammatory response for containment and resolution of the infection.

1.3 Pattern Recognition Receptors Pattern recognition receptors (PRRs) recognize and respond to specific molecular structures on microorganisms. Such structures, commonly referred to as pathogen-associated molecular patterns (PAMPs), are often essential for survival and/or pathogenicity, and are thus conserved across many microbial species (Akira, Uematsu et al. 2006). PRRs can be located at the cell-surface or intracellularly, and are predominantly expressed by innate immune cells such as macrophages and dendritic cells (DC) (Akira, Uematsu et al. 2006). There are several distinct families of PRRs including the Toll-like receptors (TLRs), Nod-like receptors (NLRs), RIG-I-like receptors (RLRs), C-type lectin receptors (CLRs) and the PYHIN family (Akira, Uematsu et al. 2006). TLRs are the

Introduction most comprehensively studied PRRs and are a major focus of this project. TLRs will be discussed in detail in this review, while brief overviews will be provided for the other PRR families.

1.3.1 Toll-like Receptors (TLRs) The Toll receptor was first identified in Drosophila as a transmembrane protein that was essential for normal dorso-ventral patterning in developing embryos (Anderson, Jurgens et al. 1985). Further studies showed that this receptor was also involved in Drosophila host defence through recognition of fungal infection and subsequent production of the anti-fungal peptide drosomycin (Lemaitre, Nicolas et al. 1996). In 1997, Medzhitov et. al used an expressed sequence tag database to discover the hToll protein (now termed TLR4) on the basis of its homology to Drosophila Toll (Medzhitov, Preston-Hurlburt et al. 1997). Subsequently, mouse genetic studies showed that a mutation in the Tlr4 gene was responsible for the hyporesponsiveness of the C3H/HeJ mouse strain to lipopolysaccharide (LPS), a component of the cell wall of Gram-negative bacteria (Poltorak, He et al. 1998, Hoshino, Takeuchi et al. 1999). Genetic deletion of Tlr4 subsequently confirmed that this receptor was indeed required for LPS responsiveness (Hoshino, Takeuchi et al. 1999). Subsequently, a family of these receptors were identified (Rock, Hardiman et al. 1998). TLRs are type I transmembrane receptors containing an extracellular leucine-rich repeat (LRR) domain, as well as a cytoplasmic domain, which is homologous to the interleukin 1 receptor (IL-1R) (Hashimoto, Hudson et al. 1988, Keith and Gay 1990, Gay and Keith 1991). This intracellular domain is referred to as the Toll interleukin 1 receptor (TIR) domain. In Drosophila, Toll signalling promotes immune responses by activating the transcription factor Dorsal, a homologue of the mammalian Rel/NF-κB family (Lemaitre, Nicolas et al. 1996). In mammals, signalling through TLRs activates nuclear factor kappaB (NF-κB), which is normally maintained in an inactive form in the cytoplasm through interaction with inhibitor of NF-κB (IκB) (Ganchi, Sun et al. 1992, Henkel, Zabel et al. 1992, Henkel, Machleidt et al. 1993).

A total of 13 TLRs have been identified in humans and mice; 10 in humans (TLR1-10) and 12 in mice (TLR1-9, 11-13) (Beutler 2004). Each TLR recognizes specific PAMPs (Table 1.1) and activates distinct but overlapping signalling pathways through the use of specific combinations of adaptor proteins that initiate signalling. This enables the host to respond to distinct classes of pathogens to elicit the most appropriate type of immune response to deal with that pathogen class. TLR1 can heterodimerize with TLR2 to identify triacyl lipopeptides of bacteria, including mycobacteria (Takeuchi, Sato et al. 2002). TLR2 has also been shown to associate with TLR6 to detect diacyl lipopeptides of mycoplasma (Takeuchi, Kawai et al. 2001). TLR3 recognizes double- stranded (ds) RNA from viruses (Alexopoulou, Holt et al. 2001). TLR4 recognizes LPS from Gram- negative bacteria (above), while TLR5 recognizes flagellin from flagellated bacteria (Hayashi, 5

Introduction Smith et al. 2001). TLR7 and TLR8 recognize single-stranded (ss) viral RNA (Heil, Hemmi et al. 2004, Lund, Alexopoulou et al. 2004) and TLR9 recognizes non-methylated CpG DNA from bacteria and DNA viruses (Hemmi, Takeuchi et al. 2000, Bauer, Kirschning et al. 2001, Takeshita, Leifer et al. 2001). A role for human TLR10 has not been identified yet, but studies have shown that TLR10 is closely related to TLR1 and TLR6 and can recognize bacterial lipopeptides in association with TLR2 (Hasan, Chaffois et al. 2005, Guan, Ranoa et al. 2010, Regan, Nally et al. 2013). In mice, TLR11 and TLR12 recognize the profilin molecule and uropathogenic bacteria (Zhang, Zhang et al. 2004, Lauw, Caffrey et al. 2005, Yarovinsky, Zhang et al. 2005, Koblansky, Jankovic et al. 2013, Raetz, Kibardin et al. 2013). TLR13 was recently shown to recognize bacterial RNA (Hidmark, von Saint Paul et al. 2012, Oldenburg, Kruger et al. 2012).

TLR Typical Ligands Species

TLR1/2 Triacyl lipopeptides Bacteria, including mycobacteria TLR2 Lipopeptides Gram-positive bacteria, Mycoplasma TLR3 dsRNA Viruses TLR4 Lipopolysaccharide (LPS) Gram-negative bacteria TLR5 Flagellin Flagellated bacteria TLR2/6 Diacyl lipopeptides Mycoplasma TLR7 ssRNA, Imidazoquinolines RNA viruses TLR8 ssRNA RNA viruses TLR9 CpG-DNA Bacteria, including mycobacteria and DNA viruses TLR2/10 Lipopeptides Bacteria TLR11 Profilin Toxoplasma gondii and uropathogenic bacteria TLR12 Profilin Toxoplasma gondii TLR13 Bacterial RNA Bacterial ribosomal RNA

Table 1.1. TLR Recognition of Microbial Components. Specific components of microorganisms recognized by different TLRs are indicated. This table is adapted from (Akira 2006).

1.3.1.1 TLR Localization TLRs are localized in different compartments of the cell, depending on their function in detecting extracellular versus intracellular pathogens. In phagocytic cells, TLRs that recognize the external structure of pathogens (TLRs 1, 2, 4, 5 and 6) are usually located at the cell surface, whereas TLRs

Introduction that recognize nucleic acids (TLRs 3, 7, 8 and 9) are found intracellularly within endosomal compartments (Kawai and Akira 2007). Intracellular localization of these TLRs enables them to identify microbial nucleic acids after phagocytosis and pathogen destruction (Barton, Kagan et al. 2006). Recently, TLR4 has also been shown to be localized in endosomes (Kagan, Su et al. 2008).

1.3.1.2 TLR Signalling TLR signalling is initiated upon the binding of the TLR to its specific ligand (as mentioned in Table 1.1). Activated TLRs recruit adaptor proteins, which bind to the TIR domain of the TLRs. These adaptor proteins include myeloid differentiation primary response gene 88 (MyD88), MyD88-adaptor-like (MAL), TIR domain-containing adaptor-inducing IFN (TRIF) and TRIF- related adaptor molecule (TRAM) (Medzhitov, Preston-Hurlburt et al. 1998, Fitzgerald, Palsson- McDermott et al. 2001, Yamamoto, Sato et al. 2002, Fitzgerald, Rowe et al. 2003). These TIR domain-containing adaptor proteins, separately or in combination, provide specificity to TLR signalling. Based on the adaptor molecule used, TLR signalling can be classified as MyD88- dependent or TRIF-dependent. TRIF-dependent signalling is discussed in detail in Chapter 4, whilst MyD88-dependent signalling is extensively described in Chapter 5. In brief, in response to PAMP recognition, all TLRs, except for TLR3, recruit the adaptor protein MyD88, in presence or absence of MAL (Figure 1.1) (Takeda and Akira 2004). This recruitment initiates downstream signalling via IL-1R-associated kinases (IRAKs) (IRAK4 and IRAK1) and tumour necrosis factor associated factor-6 (TRAF6) and subsequently the activation of a mitogen-activated protein kinase (MAPK) kinase kinase (MAP3K) called transforming growth factor-beta activated kinase1 (TAK1) (Takeda and Akira 2004). TAK1, in turn, activates MAPKs such as extracellular signal-regulated kinases (ERK), p38 and c-Jun N-terminal kinases (JNK) (Takeda and Akira 2004). In addition, TRAF6 activates inhibitor of kappaB kinase complex (IKK), which comprises of subunits α and β (IKKα and IKKβ), as well as NF-κB essential modulator (NEMO)/IKKγ. This leads to the phosphorylation and degradation of IκB-α, thus permitting the release and nuclear translocation of the transcription factor NF-κB (Takeda and Akira 2004). NF-κB, activator protein-1 (AP-1) and other transcription factors then drive inducible expression of target pro-inflammatory genes (Takeda and Akira 2004). Whilst TLR 1, 2, 4, 5, 6, 7, 8 and 9 all engage the MyD88 pathway, TLR3 and TLR4 utilize the TRIF-dependent pathway (Figure 1.1) (Takeda and Akira 2004). Upon LPS recognition, TLR4 initially signals via the MyD88-dependent pathway, however, it is subsequently endocytosed and switches to TRIF signalling in early endosomes (Kagan, Su et al. 2008). TRIF signalling activates the serine/threonine kinase TANK binding kinase 1 (TBK-1), which phosphorylates the transcription factor interferon regulating factor 3 (IRF3) (Takeda and Akira 2004). IRF3 phosphorylation leads to its nuclear translocation and subsequent activation of type-1

Introduction interferons (IFN) (Takeda and Akira 2004). IRFs are important transcription factors that are linked to both MyD88- and TRIF- dependent TLR signalling. Their roles in TLR signalling are further discussed in Section 1.4.

Figure 1.1. MyD88-dependent and -independent TLR4 signalling pathways. Upon stimulation with their appropriate ligands, TLR signalling is activated. TLR4 utilizes both MyD88-dependent and independent pathways to activate signalling. MyD88-dependent signalling uses MyD88 as an adaptor to initiate downstream signalling via IRAK4, IRAK1 and TRAF6. TRAF-6 activates TAK1, which in turn activates the p38 and JNK MAPK arms. In addition, TRAF6 activates NF-κB by mediating degradation of IκB-α. NF-κB, AP-1 and other transcription factors then drive inducible expression of pro-inflammatory target genes. TLR4 also utilizes TRIF and TRAM to activate IKK-ε and TBK-1, which in turn activate IRF3. IRF3 is then translocated into the nucleus to activate IFN-β transcription. This diagram was modelled on the figure within (Watts 2008). 8

Introduction 1.3.2 Nod-like receptors (NLRs) NLRs are cytosolic pathogen sensors. There are 22 NLRs identified in humans and 34 in mice (Ting, Lovering et al. 2008). All NLRs contain a central nucleotide binding or NACHT domain which mediates self-oligomerization and activates the NLR signalling pathway (Baccala, Gonzalez- Quintial et al. 2009). They also contain a C-terminal LRR domain that controls activation and N- terminal effector domains, such as the caspase recruitment domain (CARD) and pyrin domain, which mediates protein-protein interactions to initiate inflammatory responses (Baccala, Gonzalez- Quintial et al. 2009). Based on their N-terminal effector domain, NLRs are classified into five groups, NLRA (containing an acidic transactivation domain), NLRB (containing baculoviral inhibitory repeat-like domain), NLRC (containing CARD domain), NLRP (containing pyrin domain) and NLRX (containing an unknown domain) (Ting, Lovering et al. 2008). NOD1 and NOD2 are well-characterized receptors of the NLRC family. Upon activation, both NOD1 and NOD2 recruit an adaptor protein receptor interacting protein (RIP) 2 (Chamaillard, Hashimoto et al. 2003, Park, Kim et al. 2007). RIP2 in turn activates the IKK complex which causes phosphorylation and degradation of IκB and activation of the NF-κB pathway (Abbott, Wilkins et al. 2004, Park, Kim et al. 2007). Some NLRP and NLRC family members also form a caspase-1 activating inflammasome complex (Poyet, Srinivasula et al. 2001, Martinon, Burns et al. 2002, Tschopp, Martinon et al. 2003, Agostini, Martinon et al. 2004, Boyden and Dietrich 2006). Caspase-1 signalling leads to the maturation of IL-1β and other inflammatory cytokines, and proinflammatory cell death or pyroptosis (Suzuki, Franchi et al. 2007). NLR-mediated inflammasome activation involves the adaptor molecule called apoptosis-associated speck-like protein containing a CARD (ASC) and CARD8 (Suzuki, Franchi et al. 2007, Taniguchi and Sagara 2007). NLR interaction with ASC and caspase-1 leads to autoactivation of caspase-1, and the processing of IL-1β, IL-18 and other proinflammatory mediators (Johnston, Rahman et al. 2007).

1.3.3 RIG-I-like receptors (RLRs) RLRs are also cytosolic and recognize of microbial or self nucleic acids within the cytoplasm. They are RNA helicases that contain a central DExD/H box helicase domain, C-terminal regulatory domain and two N-terminal CARD domains (Yoneyama, Kikuchi et al. 2005). The RLR family includes three members – Retinoic acid-inducible gene – I (RIG-I), melanoma differentiation- associated gene 5 (MDA5) and laboratory of genetics and physiology 2 (LGP2) (Parisien, Bamming et al. 2009). LGP2 lacks the N-terminal CARD domain and was initially thought to negatively regulate RIG-I signalling by binding to its regulatory domain (Parisien, Bamming et al. 2009). However, in vivo studies on Lgp-/- mice showed that LGP2 positively mediates RLR responses (Satoh, Kato et al. 2010). Following viral infection, RLR signalling is activated. The adaptor for the

Introduction RLR signalling pathway is IFN-β promoter stimulator 1, which possesses an N-terminal CARD domain (Kawai, Takahashi et al. 2005). The binding of IFN-β promoter stimulator 1 leads to the activation of IKK-i and TBK-1, which phosphorylates the transcription factors IRF3 and IRF7 (Kawai, Takahashi et al. 2005). The IRFs induce transcription of type1 IFNs and IFN-inducible genes. Inducible expression of type I IFNs and IFN-inducible genes downstream of RLRs enables an effective anti-viral response.

1.3.4 C-type lectin receptors (CLRs) CLRs consist of a calcium (Ca2+)-dependent carbohydrate recognition domain, the C-type lectin- like domain (CTLD), which mediates pathogen recognition (Zelensky and Gready 2005, Geijtenbeek and Gringhuis 2009). CLRs recognize and bind to carbohydrates, for example β- glucans from fungi (Zelensky and Gready 2004). Carbohydrate recognition enhances phagocytosis and also promotes inflammatory signalling. CLRs are classified into 17 groups based on their molecular structures and phylogeny (Geijtenbeek and Gringhuis 2009). The type I receptors or the mannose receptors are transmembrane proteins with an extracellular N-terminal cysteine-rich domain, fibronectin type II repeat domain and eight CTLDs and a C-terminal cytoplasmic tail (Kerrigan and Brown 2009). The type II receptors are also transmembrane proteins with a single extracellular N-terminal CTLD. These receptors include the specific intracellular adhesion molecule-3 grabbing non-integrin (SIGN) family members, e.g. DC-SIGN (DC specific) (Kerrigan and Brown 2009). The type I and type II receptors recognize mannose residues on the surface of pathogens, and this enables phagocytosis and pathogen destruction (Kerrigan and Brown 2009). Dectin 1 is a major β-glucan receptor of group V CLRs. It has a single extracellular CTLD and a cytoplasmic domain containing an immunoreceptor tyrosine-based activation motif (ITAM) (Yokota, Takashima et al. 2001, Brown, Taylor et al. 2002). Dectin 1 can function in the absence of Ca2+ (Ariizumi, Shen et al. 2000). Dectin 1 can also recognize the TLR-2 ligand zymosan and can cooperate with TLR2 to enhance immune responses (Gantner, Simmons et al. 2003). Upon activation, the tyrosine residue of the ITAM domain of Dectin 1 is phosphorylated by Src kinases. This leads to the activation of Syk (a tyrosine kinase), which further initiates various cellular process such as phagocytosis and generation of reactive oxygen species (Garcia-Garcia and Rosales 2002, Rogers, Slack et al. 2005, Underhill, Rossnagle et al. 2005, Kerrigan and Brown 2011).

1.3.5 The PYHIN family The PYHIN family contains an N-terminal Pyrin domain and a C-terminal HIN-200 domain (Goubau, Rehwinkel et al. 2010). The members of this family have been shown to sense foreign double stranded DNA in the cytoplasm and to undergo cell death in response to this signal (Ludlow, Johnstone et al. 2005). There are four PYHIN family members identified in humans – interferon- 10

Introduction inducible protein X (IFIX) or PYHIN1, myeloid cell nuclear differentiation antigen (MNDA), absent in melanoma 2 (AIM2) and interferon-inducible protein 16 (IFI16) (Ludlow, Johnstone et al. 2005, Goubau, Rehwinkel et al. 2010). The latter contains two HIN domains, whilst the other three contain a single HIN domain. AIM2 is involved in inflammasome activation. AIM2 recognizes cytosolic dsDNA and binds to it through its HIN domain (Hornung, Ablasser et al. 2009). AIM2 interacts with the ASC adaptor molecule via PYD-PYD interactions (Hornung, Ablasser et al. 2009). This promotes the assembly of the inflammasome and activation of caspase 1, which triggers maturation of the proinflammatory cytokine IL-1β (Hornung, Ablasser et al. 2009). IFI16 was also reported to recognize dsDNA and induce IFN-β production via the signalling protein stimulator of interferon genes (STING) (Unterholzner, Keating et al. 2010). IFI16 is predominantly present in the nucleus, but a small amount of the protein is present in the cytoplasm, which recognizes DNA and initiates downstream signalling (Hornung, Ablasser et al. 2009, Unterholzner, Keating et al. 2010). Thus, PYHIN family members may be involved in both promoting IFN- production and inflammasome activation.

1.4 Interferon Regulatory Factors (IRFs) Several of the PRRs described above (e.g. specific TLRs, RLRs and PYHINs) trigger production of type I IFNs, which elicit an anti-viral gene expression program, as well as a potent pro- inflammatory response. Members of the IRF transcription factor family are required for pathogen- inducible type I IFN production. There are nine IRF family members (IRF1-9) in mammals (Figure 1.2), and these primarily regulate transcription of IFNs and IFN-inducible genes (Taniguchi, Ogasawara et al. 2001). IRFs possess an amino N-terminal DNA binding domain (DBD), which is characterized by a series of five conserved tryptophan residues (Taniguchi, Ogasawara et al. 2001). X-ray crystal structures of the IRF1 and IRF2 DBDs has revealed that this module is comprised of three α helices flanked on one side by four stranded anti-parallel β-sheets (Fujii, Shimizu et al. 1999). The tryptophan repeat region forms a helix-turn-helix domain and recognizes the IFN- stimulated response element sequence (ISRE: 5’-A/GNGAAANNGAAACT-3’) or similar sequences such as IRF-binding elements, positive regulatory element (PRE) and IFN consensus sequence, all of which possess a conserved core sequence 5’-GAAA-3’(Tanaka, Kawakami et al. 1993, Fujii, Shimizu et al. 1999).

Introduction

Figure 1.2. Overview of the IRF family. A schematic diagram of IRF family members showing the conserved N-terminal DNA binding domain and the IRF-association domain (IAD1 or 2). IRFs 3, 5, 6 and 7 possess a conserved Ser phosphorylation site (Sato, Hata et al. 1998, Marie, Smith et al. 2000, Suhara, Yoneyama et al. 2000, Qin, Liu et al. 2003, Cheng, Brzostek et al. 2006), and IRFs 1-9 possess a conserved Lys acetylation site (Caillaud, Prakash et al. 2002). Some IRF family members also have repression domain(s). The N-terminal and C-terminal ends of the protein are indicated, and the sizes of the different human IRF refseq proteins (in amino acids) are indicated on the right.

The C-terminal regions of IRFs contain the IRF-associated domain 1 or 2 (IAD1, IAD2), which mediate interactions with other IRF members and other transcription factors and/or co-factors (Taniguchi, Ogasawara et al. 2001, Qin, Liu et al. 2003). A crystal structure of IRF3 has shown that the IAD bears a high similarity to the MH2 domain of the Smad transcription factor family (Qin, Liu et al. 2003, Takahasi, Suzuki et al. 2003). The MH2 domain of the Smads reveals a serine (ser or S) residue on its surface, which allows phosphorylation and regulation of the Smad proteins (Qin, Lam et al. 1999, Wu, Chen et al. 2000). The IAD is predicted to be the primary site for protein- protein interactions in IRF family members (Eroshkin and Mushegian 1999, Takahasi, Suzuki et al.

Introduction 2003). IRF3 is constitutively expressed in the cytoplasm of most cells in an inactive form, where the IAD is flanked by two autoinhibitory domains (Eroshkin and Mushegian 1999, Takahasi, Suzuki et al. 2003). Upon phosphorylation, these autoinhibitory structures are rearranged and protein-protein interactions, such as homo and heterodomerization with other IRF family members, as well as binding to other transcriptional factors such as signal transducers and activators of transcription (STAT) 1 and 2, are facilitated (Eroshkin and Mushegian 1999, Meraro, Hashmueli et al. 1999, Lau, Parisien et al. 2000, Takahasi, Suzuki et al. 2003). Phosphorylation also exposes residues required for IRF3 DNA-binding and nuclear accumulation (Qin, Liu et al. 2003). IRF3 also contains a nuclear export signal (NES), which allows it to shuttle from the nucleus (Qin, Liu et al. 2003). IRF3 and IRF7 posttranslational modifications have been studied extensively in the context of TLR signalling. Viral challenge triggers phosphorylation of both IRF3 and IRF7 (Lin, Heylbroeck et al. 1998, Sato, Tanaka et al. 1998, Yoneyama, Suhara et al. 1998, Fitzgerald, McWhirter et al. 2003, Honda, Yanai et al. 2005), and the phosphorylation sites on IRF3 have been mapped to Ser385 and Ser386 (Suhara, Yoneyama et al. 2000). This enables IRF3 to translocate into the nucleus, associate with CREB-binding protein (CBP)/p300 co-activator and activate expression of type I IFN (Weaver, Kumar et al. 1998, Yoneyama, Suhara et al. 1998). IRF7 was also phosphorylated on the Ser residue conserved with the IRF3 phosphorylation site (Au, Moore et al. 1998, Sato, Hata et al. 1998, Marie, Smith et al. 2000), and mutation of this Ser residue, in either IRF3 or IRF7, abolished IRF activity (Sato, Hata et al. 1998, Marie, Smith et al. 2000, Suhara, Yoneyama et al. 2000). Similar studies on IRF5 showed that it was also phosphorylated on the conserved Ser residue by the TBK1 kinase leading to dimerization and transcriptional activation (Cheng, Brzostek et al. 2006). Whilst Ser phosphorylation is required for IRF activation, lysine (Lys or K) acetylation may negatively regulate this family. IRF7 was demonstrated to be acetylated at Lys residue 92 within the DBD (Caillaud, Prakash et al. 2002). This Lys residue was important for DNA binding; acetylation impaired DNA-binding and IRF7 transcriptional activity (Caillaud, Prakash et al. 2002). Interestingly, this Lys site is conserved in all other IRF family members (Caillaud, Prakash et al. 2002).

The IRF family has been primarily studied for its role in TLR signalling, in particular regulating inducible type I IFN production (Ozato, Tailor et al. 2007). However, this family also functions in reproduction and development (Riego, Perez et al. 1995, Bazer, Spencer et al. 1997, Ozato, Tailor et al. 2007), tumour suppression, apoptosis and embryonic development (Tanaka, Kawakami et al. 1993, Kondo, Schutte et al. 2002, Tamura and Ozato 2002, Tsujimura, Nagamura-Inoue et al. 2002). Specific IRF family members have well-established functions in development of immune cell lineages. IRF8 plays an important role in development of immune cells including macrophages,

Introduction monocytes, DCs, natural killer (NK) cells, CD4+ and CD8+ T cells (Tamura and Ozato 2002, Turcotte, Gauthier et al. 2005, Greeneltch, Schneider et al. 2007, Huang, Zhu et al. 2008). IRF8 knockout mice showed impaired myeloid cell differentiation, and also developed a syndrome similar to human chronic or acute myelogenous leukemia (Holtschke, Lohler et al. 1996). Macrophages, monocytes, DCs and T cells from these mice also showed functional abnormalities, with resistance to apoptosis and hypersensitivity to cytokines (Huang, Zhu et al. 2008). These defects indicate the importance of IRF8 in myelopoiesis. Similarly, IRF4 plays a role in B-cell and T-cell maturation (Mittrucker, Matsuyama et al. 1997). Mice lacking IRF4 showed normal B-cells and T-cells initially, however, they progressively develop enlarged spleen and lymph nodes, impaired T-cells responses, decreased serum immunoglobulin concentrations and deficient cytotoxic and antitumour responses (Mittrucker, Matsuyama et al. 1997).

1.4.1 IRFs in TLR Signalling The IRFs impart signalling specificity to individual TLR pathways. IRF1, IRF3, IRF7 and IRF8 have all been linked to TLR3, TLR4, TLR7 and TLR9 signalling (Ozato, Tailor et al. 2007). TLR4 utilizes TRIF and TRAM to activate IRF3 and the IFN pathway (Fitzgerald, Rowe et al. 2003), whereas TLR3 utilizes TRIF, but not TRAM, to activate IRF3 (Fitzgerald, Rowe et al. 2003). Importantly, the activation of IRF3 is unique to TLR3 and TLR4 signalling, amongst the various TLRs (Doyle, Vaidya et al. 2002). IRF3 is constitutively expressed in most cell types (Au, Moore et al. 1995). In response to TLR3 or TLR4 agonists, IRF3 undergoes phosphorylation at the Ser385 and Ser386 sites in the C-terminal region, dimerizes, translocates to the nucleus and activates IFN-β transcription (Weaver, Kumar et al. 1998, Yoneyama, Suhara et al. 1998, Marie, Smith et al. 2000, Suhara, Yoneyama et al. 2000). IRF3 is critical for innate immunity signalling upon viral challenge. Irf3-/- mice were shown to be more susceptible to viral infections and virus-mediated IFN-β production was impaired in these mice (Sato, Suemori et al. 2000). Other IRF family members are involved in other TLR signalling arms. For example, MyD88-dependent signalling activates IRF5 in macrophages (Takaoka, Yanai et al. 2005). IRF5 interacts with MyD88 and TRAF6 upon LPS or CpG DNA stimulation and translocates to the nucleus to activate gene expression (Takaoka, Yanai et al. 2005). In TLR7 signalling, IRAK-1 and TRAF6 interacts with and activates IRF5 (Schoenemeyer, Barnes et al. 2005). IRF8 is also involved in TLR signalling. Studies on macrophages from Irf8-/- mice showed reduced ERK and JNK activation upon LPS +/- IFN-γ stimulation, and this activation was rescued upon retroviral transduction of IRF8 (Zhao, Kong et al. 2006). IRF8 was also demonstrated to interact with TRAF6 and enhance TRAF6 ubiquitination (Zhao, Kong et al. 2006). How this might occur is unclear, but one possibility is that the association with IRF8 somehow promotes TRAF6 autoubiquitination (Zhao, Kong et al. 2006). This study

Introduction suggests that IRF8 mediates responses to some TLR ligands. Apart from IFN- transcription, IRFs are also involved in regulating expression of some chemokines, such as Chemokine (C-C motif) ligand (CCL) 5 (CCL5) (Lin, Heylbroeck et al. 1999, Genin, Algarte et al. 2000, Melchjorsen and Paludan 2003), as well as the IL-12 family of cytokines that control differentiation of T cell sub-sets (Bettelli and Kuchroo 2005). The IL-12 cytokine is composed of two sub-units, p35 and p40, and is also produced by some epithelial cells in response to pathogen challenge (Snijders, Hilkens et al. 1996, Walter, Kajiwara et al. 2001). The p40 subunit also combines with p19 to form the cytokine IL-23 (Oppmann, Lesley et al. 2000). IRF1 and IRF8 have been shown to regulate IL-12p40 gene expression and play crucial roles in T helper cell type 1 immune responses (Figure 1.3) (Taki, Sato et al. 1997, Masumi, Tamaoki et al. 2002). IRF1, IRF5 and IRF7 all activated the IL-12p35 promoter activity, whereas IRF3 repressed this response (Figure 1.3) (Dahlberg, Auble et al. 2006).

Figure 1.3. IRFs impart specificity to TLR signalling. (A) The IRFs impart signalling specificity to individual TLR pathways. TLR3 and TLR4 utilize the TRIF adaptor to activate IRF3, while TLRs 4, 7, 8, and 9 utilize the MyD88 adaptor to activate IRF5 and IRF-7 to trigger gene expression. (B) IRFs impart cell-type specific TLR signalling. MyD88-dependent TLR signalling activates IRF1 in cDCs, IRF7 in pDCs, and IRF5 in macrophages. (C) Different IRFs regulate expression of different sub-units of the IL-12 cytokine family. For example, transcription of the IL- 12p35 sub-unit is driven by IRF1/5/7, while transcription of the IL-12p40 sub-unit is driven by IRF1 or IRF8.

Introduction

In addition to being responsible for differences in gene expression programs triggered by distinct TLR agonists, IRF family members also contribute to cell type-specific responses to individual TLR ligands. One well-characterized example is TLR9 signalling in DCs. Based on their surface markers, DCs can be categorized into several populations, including plasmacytoid DCs (pDCs) and conventional DCs (cDCs). These cells also vary in their responses to pathogen challenge. In pDCs, IRF7 is constitutively expressed and is recruited in a MyD88-dependent fashion to promote type I IFN production upon CpG stimulation (Honda, Yanai et al. 2005). MyD88-dependent signalling in pDCs recruits IRAK4, IRAK1 and TRAF6 (Honda, Yanai et al. 2005). The IRAK1-IRAK4-TRAF6 complex binds to IRF7 and TRAF6 polyubiquitinates IRF7 (Honda, Yanai et al. 2004, Kawai, Sato et al. 2004, Uematsu, Sato et al. 2005). IRAK-1 phosphorylates IRF7 at the multiple Ser sites near its C-terminal end, which enables nuclear translocation and activation of type 1 IFN genes (Uematsu, Sato et al. 2005). However, in cDCs, IRF1, rather than IRF7, promotes MyD88- dependent type I IFN (Negishi, Fujita et al. 2006, Schmitz, Heit et al. 2007). In these cells, IRF1 binds directly to MyD88 upon TLR activation and induces expression of IFN-β, IL-12p35 and other inflammatory genes (Negishi, Fujita et al. 2006, Schmitz, Heit et al. 2007). These responses were lost in cDCs from Irf1-/- mice (Negishi, Fujita et al. 2006, Schmitz, Heit et al. 2007). Thus, the expression of individual IRF family members can determine how a specific cell type responds to TLR ligands and/or pathogen challenge (Figure 1.3).

1.4.2 Major Target of IRFs Several target genes for IRFs have been identified, however the major IRF targets in the context of TLR signalling and inflammatory processes are IFN-β, members of the IL-12 cytokine family and some chemokines, e.g. CCL5. The biological roles of these specific cytokines and chemokines are briefly discussed below.

1.4.2.1 IFN-β Interferon was first described as “interfering agent” that interfered with viral replication (Isaacs and Lindenmann 1957). Type I IFNs are expressed in most cell types and play an important role in host defence. IFN-β is a type 1 IFN and acts via the IFNA receptor (Platanias 2005). IFN-β is mainly produced in response to viruses and dsRNA (Platanias 2005). Although IFN-β expression, upon appropriate stimulation, is produced by all cell-types, a major source of IFN-β production is a sub- population of DCs, pDCs (Colonna, Krug et al. 2002, Coccia, Severa et al. 2004).

Introduction 1.4.2.2 Members of the IL-12 cytokine family The IL-12 family of cytokines is comprised of four members that heterodimerize for their biological functions. They are formed by a unique combination of alpha and beta subunits and have diverse roles in innate and acquired immunity. The beta subunits are p40 and Epstein-Barr virus induced gene (EBI) 3, while the alpha subunits are p35, p19 and p28 (Vignali and Kuchroo 2012). IL-12 is formed by the heterodimerization of the p40 and p35 subunits, while IL-23 is formed by the heterodimerization of the p40 and p19 subunits. Both of these cytokines instruct T helper (Th) cell development (Vignali and Kuchroo 2012). IL-27, a heterodimer of EBI3 and p28, and IL-35, a heterodimer of EBI3 and p35, are the other two known members of this cytokine family and have a more immunosuppressive role (Vignali and Kuchroo 2012).

1.4.2.2.1 IL-12 IL-12 promotes IFN-γ production by T-cells and NK cells and facilitates the development and differentiation of T cells to Th 1 cells (Nakamura, Okamura et al. 1989, Hsieh, Macatonia et al. 1993, Manetti, Parronchi et al. 1993, Trinchieri 1993). Upon infection, IL-12 also regulates the expansion and recruitment of CD8+ T cells (Pearce and Shen 2007). IL-12 is produced by various cell types, for example macrophages, dendritic cells and B cells, after PAMP recognition (Trinchieri, Wysocka et al. 1992, Hsieh, Macatonia et al. 1993, Macatonia, Hosken et al. 1995, Gately, Renzetti et al. 1998). IL-12-triggered IFN-γ production induces pro-inflammatory cytokines that are important for clearing intracellular pathogens (Langrish, McKenzie et al. 2004). The IL-12 receptor (IL-12R) comprises of two sub-units, IL-12Rβ1 and IL-12Rβ2 (Chua, Chizzonite et al. 1994, Presky, Yang et al. 1996). Upon binding to the receptor, the Janus kinase (JAK) /STAT pathway is activated. IL-12R activates the STAT4 transcription factor to enable transcriptional activation of target genes (Bacon, Petricoin et al. 1995, Jacobson, Szabo et al. 1995, Kaplan, Sun et al. 1996). IL-12R is expressed mainly by NK cells and activated Th1 cells, but was also shown to be expressed by DCs in vitro (Desai, Quinn et al. 1992, Grohmann, Belladonna et al. 1998). Dysregulated production of IL-12 is associated with various inflammatory conditions, including Crohn’s disease and multiple sclerosis (Nicoletti, Patti et al. 1996, Balashov, Smith et al. 1997, Monteleone, Biancone et al. 1997, Parronchi, Romagnani et al. 1997, Gee, Guzzo et al. 2009).

1.4.2.2.2 IL-23 IL-23 was discovered in 2000, when Oppmann et. al. showed the p40 can covalently attach to a new subunit, p19, through disulphide bonding (Oppmann, Lesley et al. 2000). IL-23 is produced by macrophages and dendritic cells in response to PAMPs and has similar, but distinct functions to IL- 12 (Langrish, McKenzie et al. 2004). IL-23 is recognised by IL-12Rβ1 and the IL-23R receptors, which is expressed by T-cells, NK cells, monocytes, DCs and activated macrophages (Parham, 17

Introduction Chirica et al. 2002). Downstream signalling through this receptor also results in activation of the JAK/STAT signalling pathway (Parham, Chirica et al. 2002). IL-23 is important for the development, maintenance and function of Th17 cells, since p19-/- mice have impaired Th17 responses, despite having normal IFN-γ production (Happel, Zheng et al. 2003, Murphy, Langrish et al. 2003, Ghilardi, Kljavin et al. 2004, Schulz, Kohler et al. 2008, Riol-Blanco, Lazarevic et al. 2010). In contrast, p35-/- mice have more Th17 cells (Murphy, Langrish et al. 2003). Th17 cells produce IL-17 and IL-22, cytokines that are important for clearing extracellular pathogens but also drive autoimmune diseases (Happel, Zheng et al. 2003, van de Veerdonk, Gresnigt et al. 2009, Waite and Skokos 2012). Excessive production of IL-23/IL-17 in skin drives dysregulated inflammation and leads to psoriasis (Lee, Trepicchio et al. 2004, Tonel, Conrad et al. 2010, Mudigonda, Mudigonda et al. 2012). Anti-IL-23 or anti-IL-17 therapies have thus been developed for the treatment of psoriasis (Krueger, Langley et al. 2007, Leonardi, Kimball et al. 2008, Kurzeja, Rudnicka et al. 2011).

1.4.2.2.3 IL-27 IL-27 was identified by Pflanz et. al. as a heterodimeric cytokine composed of EBI3 and p28 subunits, which was structurally homologous to IL-12 subunits p40 and p35 (Pflanz, Timans et al. 2002). It is mainly produced by macrophages and DCs in response to TLR agonists (Pflanz, Timans et al. 2002). IL-27 signals through its receptor IL-27R, which is composed of the cytokine receptor WSX-1 and glycoprotein-130 (gp130) (Pflanz, Timans et al. 2002, Pflanz, Hibbert et al. 2004). The latter is a component of the IL-6 receptor family and is thus shared by this family of cytokines (IL- 6, IL-11 etc) (Taga and Kishimoto 1997). IL-27 receptor signalling also activates the JAK/STAT pathway in T cells and promotes Th1 cell development, therefore, IL-27 was initially thought to be a pro-inflammatory cytokine (Pflanz, Timans et al. 2002, Hibbert, Pflanz et al. 2003, Lucas, Ghilardi et al. 2003, Takeda, Hamano et al. 2003, Stumhofer and Hunter 2008). However, subsequent studies in vivo revealed that IL-27 limited T cell-mediated inflammation and inhibited Th1, Th2, and Th17 responses (Hamano, Himeno et al. 2003, Villarino, Hibbert et al. 2003, Stumhofer and Hunter 2008). IL-27 was also shown to activate T-cells to produce the anti- inflammatory cytokine IL-10 (Awasthi, Carrier et al. 2007, Fitzgerald, Zhang et al. 2007, Stumhofer, Silver et al. 2007).

Introduction 1.4.2.2.4 IL-35 IL-35, a heterodimer of the EBI3 and p35 subunits, is an immunosuppressive cytokine (Devergne, Birkenbach et al. 1997). IL-35 is mainly produced by Treg cells and is also important for their development (Collison, Workman et al. 2007). Very little is known about IL-35 function, however one study showed that IL-35 inhibits T cell proliferation by inducing cell cycle arrest at the G1 phase (Collison, Workman et al. 2007, Collison, Chaturvedi et al. 2010, Chaturvedi, Collison et al. 2011).

1.4.2.3 CCL5 CCL5, also known as regulated on activation, normal T cell expressed and secreted (RANTES), is a member of the CC chemokine family (Lapteva and Huang 2010). CCL5 is a potent chemotractant of T cells, but also attracts DCs, NK cells, eosinophils, basophils and mast cells to sites of inflammation (Stanford and Issekutz 2003, Grayson and Holtzman 2006). CCL5 is produced by various cells including macrophages, platelets, eosinophils, fibroblasts, epithelial cells, endothelial cells and endometrial cells (Grayson and Holtzman 2006). CCL5 mediates its inflammatory responses through the C-C motif receptor 5 (CCR5) (Blanpain, Buser et al. 2001). CCL5 has been implicated to have a role in various biological processes including control of certain pathogens, for example HIV, and enhanced inflammation in inflammatory conditions, such as atherosclerosis, and cancer (Cocchi, DeVico et al. 1995, Levy 2009, Lapteva and Huang 2010, Katsounas, Schlaak et al. 2011). CCL5 is also essential for costimulation of T cells, and Ccl5-/- mice show defective T cell proliferation and inflammatory responses (e.g. IFN-γ, IL-2) following antigen stimulation (Taub, Turcovski-Corrales et al. 1996, Makino, Cook et al. 2002).

1.5 Interferon Regulatory Factor 6 One IRF family member that has not been studied in the context of TLR signalling is IRF6. The IRF6 gene is 19kb in size and encodes a 467 amino acid (aa) transcription factor. As with other family members, IRF6 has a highly conserved N-terminal DBD with the five conserved tryptophan residues (aa 13-113), and a less conserved C-terminal domain (aa 226-394) (Figure 1.2). IRF6 has 89% homology (aa sequence similarity) with IRF5, which has been shown to activate IFN transcription upon viral infection (Barnes, Moore et al. 2001, Barnes, Field et al. 2003, Takaoka, Tamura et al. 2008), participate in TLR4-mediated MyD88 signalling (Ouyang, Negishi et al. 2007) and suppress tumour formation by regulating the cell cycle and promoting apoptosis (Barnes, Kellum et al. 2003). IRF6 function has primarily been studied in the context of developmental pathways.

Introduction 1.5.1 Developmental functions of IRF6 IRF6 has an important role in development in humans and in mice. It is primarily expressed by epithelial cells of various tissues in mouse, chicken, zebrafish and Xenopus laevis embryos (Ben, Jabs et al. 2005, Ingraham, Kinoshita et al. 2006, Knight, Schutte et al. 2006, Richardson, Dixon et al. 2006, Sabel, d'Alencon et al. 2009). In mice, enriched IRF6 expression was seen in the developing secondary palate and adult skin (Kondo, Schutte et al. 2002). IRF6 expression was also present in the medial edges of the paired palatal shelves, palatal rugae, tooth germs, thyroglossal duct, external genitalia, hair follicles and skin throughout the body (Kondo, Schutte et al. 2002). Consistent with these expression patterns, genetic variations in IRF6 are associated with various degrees of cleft lip, cleft palate, undifferentiated skin and syndactyly in humans (Kondo, Schutte et al. 2002, Zucchero, Cooper et al. 2004, Blanton, Cortez et al. 2005, Ghassibe, Bayet et al. 2005, Scapoli, Palmieri et al. 2005, Srichomthong, Siriwan et al. 2005, Park, McIntosh et al. 2007, Jugessur, Shi et al. 2009). Van der Woude syndrome (VWS) is the most common form of syndromic orofacial clefting and is characterized by lip pits, cleft lips, cleft palate and hypodontia. Popliteal pterygium syndrome (PPS) has orofacial features similar to VWS with the addition of webbed skin of legs, genital hypoplasia, oral synychia, adhesions between the eyelids and syndactyly. Both of these syndromes are autosomal dominant. The loci for VWS and PPS were mapped to human chromosome 1q32-q41 (Murray, Nishimura et al. 1990, Sander, Schmelzle et al. 1994, Schutte, Basart et al. 1999), and IRF6 was subsequently identified as the defective gene in these syndromes (Koillinen, Wong et al. 2001). The first identified mutation in IRF6 was a nonsense mutation in one affected twin of monozygotic twins (Kondo, Schutte et al. 2002). The parents and the other twin had no defect and did not show any mutation in IRF6 (Kondo, Schutte et al. 2002). The mutation in the affected twin occurred in exon 4 of IRF6. This results in the generation of a stop codon at residue 92 (instead of glutamic acid); consequently the encoded protein is truncated and non-functional (Kondo, Schutte et al. 2002). Subsequently, 45 unrelated patients with VWS and 13 patients with PPS were found to have a mutation in IRF6 (Kondo, Schutte et al. 2002). Mutations in the gene are frequently observed in the DBD or the IAD1 (Kondo, Schutte et al. 2002, Little, Rorick et al. 2009).

In normal palate formation, the paired palatal shelves extend from the maxilla towards each other and fuse. The medial edge epithelial (MEE) lining of the palatal shelves is lost following the fusion and the surrounding mesenchyme migrates and fuses to the palatal cleft (Knight, Schutte et al. 2006). IRF6 is expressed in the medial edge epithelium and the levels of IRF6 expression showed a rapid increase prior to the fusion events (Knight, Schutte et al. 2006). The elimination of the MEE may involve multiple cellular processes including apoptosis, migration and/or epithelial-to-

Introduction mesenchyme transition (Martinez-Alvarez, Tudela et al. 2000, Cuervo, Valencia et al. 2002). How IRF6 mutations result in improper fusion events is still unclear at this stage. Studies on mice deficient in transforming growth factor beta3 (TGFβ3), which also exhibits cleft palate, have revealed decreased IRF6 expression in the MEE of these mice (Kaartinen, Voncken et al. 1995, Proetzel, Pawlowski et al. 1995). This suggests that IRF6 may have a role in the elimination of the MEE lining through one or more of the above mentioned cellular processes. Mutations in the Notch ligand Jagged2 also exhibits craniofacial and limb defects, similar to IRF6 (Jiang, Lan et al. 1998, Richardson, Dixon et al. 2009). This suggests that IRF6 may collaborate with Notch signalling during oral periderm differentiation and palatal fusion events (Richardson, Dixon et al. 2009).

Consistent with the genetic defects in humans, IRF6 null mice show severe abnormalities in skin, limb and craniofacial development and die shortly after birth (Ingraham, Kinoshita et al. 2006, Richardson, Dixon et al. 2006). IRF6 null mice also have dysregulated keratinocyte development (Ingraham, Kinoshita et al. 2006, Richardson, Dixon et al. 2006). In mice, four stratified layers of epidermis are formed during development. These layers, from innermost to outer, are basal, spinous, granular and cornified. Mice deficient in IRF6 did not have a normal stratified epidermis and showed a thicker epidermis compared to wild-type mice (Ingraham, Kinoshita et al. 2006, Richardson, Dixon et al. 2006). The basal layer was normal, but the spinous layer was expanded, and the outer granular and cornified layers were absent (Ingraham, Kinoshita et al. 2006, Richardson, Dixon et al. 2006). The suprabasal keratinocytes in these mice proliferated and failed to terminally differentiate into the different layers of the epidermis (Ingraham, Kinoshita et al. 2006, Richardson, Dixon et al. 2006). IRF6 null mice displayed ectopic expression of keratin 14 (K14) in the spinous layer. This suggests that IRF6 may negatively regulate K14 expression (Ingraham, Kinoshita et al. 2006, Richardson, Dixon et al. 2006). Notch1 activation has also been shown to induce IRF6 in mouse and human keratinocytes and squamous cell carcinoma (SCC) cell-lines. Conditional deletion of Notch1 and Notch2 in keratinocytes in mice resulted in a significant reduction in IRF6 expression in the epidermis. Previous studies demonstrated that two transcription factors of the POU domain family Skin-1a and Tuberculin skin test reactivity 1 have a role in K14 repression (Sugihara, Kudryavtseva et al. 2001). Also, Skin-1a was shown to interact with CBP, and this interaction may act to silence K14 expression (Sugihara, Kudryavtseva et al. 2001). IRF1, IRF3 and IRF7 can interact with CBP and/or p300 (Yoneyama, Suhara et al. 1998, Yang, Lin et al. 2003, Dornan, Eckert et al. 2004), so it is possible that IRF6 may be involved in K14 repression via interactions with the CBP/p300 coactivator complex. Alternatively, Skin-1a and Tuberculin skin test reactivity 1 may be direct target genes of IRF6. Apart from Irf6-/- mice, Ikkα-/- and stratifin-/- (Sfn) mice display similar phenotypes in the developing epithelium (Takeda, Takeuchi et al. 1999,

Introduction Li, Lu et al. 2005). The expression of IKKα and Sfn in IRF6 mutant mice appeared normal and IRF6 expression was not affected in IKKα or Sfn mutant mice (Ingraham, Kinoshita et al. 2006, Richardson, Dixon et al. 2006). However, double heterozygous mutants of IRF6/Sfn showed similar, but less severe, defects as IRF6 homozygous mice, suggesting that IRF6 and Sfn interact genetically to regulate keratinocyte and epidermal development (Richardson, Dixon et al. 2006). In total, the above studies identify IRF6 as an important regulator of keratinocyte proliferation and differentiation during mouse embryogenesis.

1.5.2 IRF6 Regulation Despite its well-established role in the development of the epidermis, the cellular and molecular mechanisms by which IRF6 functions are poorly understood. IRF6 possesses a multi-species conserved enhancer sequence 9.7 kb upstream of its transcription start site (MCS9.7). MCS9.7 is expressed during early mouse cranio-facial development stages and also in suprabasal layers and differentiated keratinocytes (Rahimov, Marazita et al. 2008). This enhancer region also contains conserved binding sites for p63, Notch and transcription factor activating enhancer binding protein- 2 (Rahimov, Marazita et al. 2008, Thomason, Zhou et al. 2010, Restivo, Nguyen et al. 2011). There are 3 potential binding sites for p63 in the IRF6 locus; one in the MCS9.7 enhancer, one upstream of the transcription start site and one within the first intron (Thomason, Zhou et al. 2010). In addition, within the MCS9.7 enhancer region, there are three ISRE sites, which results in a positive feedback loop for the regulation of IRF6 transcription (Moretti, Marinari et al. 2010, Thomason, Zhou et al. 2010). During palatal development, Pbx proteins regulate the expression of Wnt9b and Wnt3, which in turn regulate p63. p63 then binds to MCS9.7 to regulate Irf6 expression and proper palatal development (Ferretti, Li et al. 2011).

The only biochemically-verified protein that IRF6 has been shown to interact with is mammary serine protease inhibitor (maspin) (Bailey, Khalkhali-Ellis et al. 2005). Maspin is a member of the serpin family of serine protease inhibitors, which is expressed in normal mammary epithelial cells (Zou, Anisowicz et al. 1994). Maspin inhibits tumour invasion and metastasis in breast cancer cells (Zou, Anisowicz et al. 1994, Bailey, Khalkhali-Ellis et al. 2006), and indeed its expression is reduced during tumour development (Sheng, Carey et al. 1996). Further, targeted maspin overexpression in mice resulted in reduced development of mammary lobular-alveolar structures due to increased apoptosis and disrupted cell differentiation (Zhang, Magit et al. 1999). Interestingly, IRF6 was also expressed in normal mammary epithelial cells and, similar to maspin, this expression was lost during tumour progression (Bailey, Khalkhali-Ellis et al. 2005). Analysis of deletion mutants showed that IRF6 directly binds to maspin via the IAD (Bailey, Khalkhali-Ellis et al. 2005). This interaction is likely regulated by IRF6 phosphorylation, since IRF6-maspin 22

Introduction interactions were significantly reduced in cells treated with lambda-phosphatases (Bailey, Khalkhali-Ellis et al. 2005). Subsequent studies on IRF6 in breast development revealed that IRF6 controls breast epithelium differentiation by promoting cell cycle arrest (Bailey, Abbott et al. 2008). IRF6 exists in a non-phosphorylated state in non-proliferating cells, but was rapidly phosphorylated as cells entered the cell cycle (Bailey, Abbott et al. 2008). IRF6 phosphorylation decreased its stability leading to degradation (Bailey, Abbott et al. 2008). This may allow the cell to progress from the Go phase to enter the G1 phase of the cell cycle (Bailey, Abbott et al. 2008). This suggests that IRF6 has a role in regulating proliferation and differentiation of mammary epithelial cells, and presumably the interaction with maspin is involved in this process (Bailey, Abbott et al. 2008).

In SCC, IRF6 down-regulation, due to methylation of a CpG dinucleotide island located in the promoter, was linked to invasiveness and differentiation status. Using siRNA gene knockdown in keratinocytes, as well as a ChIP-seq approach, this study identified IRF6 target genes on a genome wide scale (Botti et al, 2011). These findings should aid in understanding of IRF6 functions in keratinocytes. In summary, IRF6 has an essential role in epithelial development and IRF6 loss of function can lead to developmental defects and tumour development. However, the molecular mechanisms by which IRF6 functions are only just beginning to be elucidated.

1.6 TLRs in Epithelial cells TLRs are expressed predominantly on cell types that are likely to be the first to encounter microbial challenge. Thus, phagocytic cells such as macrophages, neutrophils and DCs express the broadest repertoire of TLRs, although expression is not only restricted to these cell types (Zarember and Godowski 2002). Given the emerging role of epithelial cells in inducible responses to pathogen challenge, it is not surprising that these cells are also reported to express various TLRs (Hippenstiel, Opitz et al. 2006, Gribar, Anand et al. 2008). Table 1.2 shows the expression patterns of various human and mouse TLRs in epithelial cells of the intestine, airway, kidneys, bladder and skin. Responses of epithelial cell-lines to various TLR ligands have also been studied to address which TLR receptors are functionally significant in these cells. In intestinal epithelial cell lines (IEC) like HT-29 and T84, LPS activated NF-κB and triggered the release of pro-inflammatory cytokines, suggesting that these cells express a functional TLR4 signalling complex (Otte, Cario et al. 2004). TLR9 was also shown to be functional in IECs. TLR9 expression was increased and IL-8 was secreted when these cells were exposed to DNA from S. enterica serovar Dublin (Ewaschuk, Backer et al. 2007). In the human keratinocyte cell line HaCaT, LPS induced expression of CD14 and TLR4 (Kollisch, Kalali et al. 2005). Treatment with Candida albicans, as well as heat killed Mycobacterium tuberculosis triggered nuclear translocation on NF-κB and Interleukin 8 (IL-8) production in primary human keratinocytes (Pivarcsi, Bodai et al. 2003). Both primary human 23

Introduction keratinocytes and HaCaT cells secreted the chemokine IL-8 in response to the TLR3 ligand Poly(IC), the TLR2 ligand Tripalmitoyl-S-glycerylcysteine (Pam3Cys) and the TLR5 ligand flagellin (Kollisch, Kalali et al. 2005). Several groups have shown that airway epithelial cells express all TLRs at the mRNA and/or protein levels and can initiate inflammatory responses upon exposure to PAMPs. Airway epithelial cells responded to LPS, as well as invading pathogens such as Streptococcus pneumonia, by producing IL-8 via TLR4 and TLR2 (Armstrong, Medford et al. 2004, Schmeck, Huber et al. 2006). Similar studies performed on mouse primary urinary tract epithelial cells have demonstrated that UPEC and LPS can activate NF-κB signalling and induce pro-inflammatory responses in a TLR4-dependent manner (Tsuboi, Yoshikai et al. 2002, Chassin, Goujon et al. 2006). The above studies suggest that at least some types of epithelial cells express functional PRRs and are actively involved in host defense mechanisms. Other than host defence, there is growing evidence that epithelial-expressed TLRs may also contribute to the development of dysregulated mucosal inflammation (Gribar, Anand et al. 2008).

Introduction TLR Intestinal Epithelium Pulmonary Urothelium Skin References Epithelium

Small Large Airway Renal Ureter and Bladder Epidermis and Intestine Intestine Epithelium Epithelium Keratinocytes

TLR1 RNAh RNAh RNAh,m RNAm N.D. RNAh (Rock, Hardiman et al. 1998, Becker, Diamond et al. 2000, Tsuboi, Yoshikai et al. 2002, Melmed, Thomas et al. 2003, Muir, Soong et al. 2004, Otte, Cario et al. 2004, Greene, Carroll et al. 2005, Kollisch, Kalali et al. 2005, Zhang, Louboutin et al. 2005, Schmeck, Huber et al. 2006)

TLR2 RNAh RNAh,m RNAh,m RNAm RNAm RNAh (Becker, Diamond et al. 2000, Cario, Rosenberg et al. 2000, Backhed, Soderhall et al. 2001, Naik, Kelly et al. 2001, h h h,m h,m h Protein Protein Protein Protein Protein Tsuboi, Yoshikai et al. 2002, Wolfs, Buurman et al. 2002, Melmed, Thomas et al. 2003, Pivarcsi, Bodai et al. 2003, Muir, Soong et al. 2004, Otte, Cario et al. 2004, Greene, Carroll et al. 2005, Hauber, Tulic et al. 2005, Kollisch, Kalali et al. 2005, Zhang, Louboutin et al. 2005, Ortega- Cava, Ishihara et al. 2006, Schmeck, Huber et al. 2006, Shigeoka, Holscher et al. 2007, Szebeni, Veres et al. 2007)

TLR3 Proteinh RNAh RNAh,m RNAm RNAm RNAh (Becker, Diamond et al. 2000, Cario and Podolsky 2000, Cario, Rosenberg et al. 2000, Backhed, Soderhall et al. h h,m h Protein Protein Protein 2001, Tsuboi, Yoshikai et al. 2002, Muir, Soong et al. 2004, Otte, Cario et al. 2004, Greene, Carroll et al. 2005, Kollisch, Kalali et al. 2005, Begon, Michel et al. 2007, Szebeni, Veres et al. 2007)

Introduction TLR4 RNAh,m RNAh,m RNAh,m RNAm RNAh,m RNAh (Becker, Diamond et al. 2000, Cario and Podolsky 2000, Cario, Rosenberg et al. 2000, Backhed, Soderhall et al. h,m h,m h,m h,m h,m h Protein Protein Protein Protein Protein Protein 2001, Hornef, Frisan et al. 2002, Tsuboi, Yoshikai et al. 2002, Wolfs, Buurman et al. 2002, Ortega-Cava, Ishihara et al. 2003, Pivarcsi, Bodai et al. 2003, Bambou, Giraud et al. 2004, Muir, Soong et al. 2004, Otte, Cario et al. 2004, Samuelsson, Hang et al. 2004, Greene, Carroll et al. 2005, Hauber, Tulic et al. 2005, Kollisch, Kalali et al. 2005, Jilling, Simon et al. 2006, Neal, Leaphart et al. 2006, Ortega-Cava, Ishihara et al. 2006, Leaphart, Cavallo et al. 2007, Szebeni, Veres et al. 2007)

TLR5 Proteinh,m RNAh RNAh,m RNAm RNAm RNAh (Becker, Diamond et al. 2000, Backhed, Soderhall et al. 2001, Bambou, Giraud et al. 2004, Muir, Soong et al. 2004, h h,m h Protein Protein Protein Otte, Cario et al. 2004, Greene, Carroll et al. 2005, Kollisch, Kalali et al. 2005, Zhang, Louboutin et al. 2005, Ortega- Cava, Ishihara et al. 2006, Begon, Michel et al. 2007)

TLR6 N.D. RNAh RNAh,m RNAm N.D. RNAh (Becker, Diamond et al. 2000, Tsuboi, Yoshikai et al. 2002, Melmed, Thomas et al. 2003, Muir, Soong et al. 2004, Otte, Cario et al. 2004, Greene, Carroll et al. 2005, Kollisch, Kalali et al. 2005, Zhang, Louboutin et al. 2005)

TLR7 RNA RNAh RNAh,m Absentm N.D. RNAh (Du, Poltorak et al. 2000, Muir, Soong et al. 2004, Otte, Cario et al. 2004, Kollisch, Kalali et al. 2005, Pawar, Patole h Protein et al. 2006, Li, Sohn et al. 2013)

Introduction TLR8 Absent RNAh RNAh,m Absent N.D. Absenth (Du, Poltorak et al. 2000, Muir, Soong et al. 2004, Otte, Cario et al. 2004, Droemann, Albrecht et al. 2005, Kollisch, h,m Protein Kalali et al. 2005, Anders and Schlondorff 2007)

TLR9 Proteinh,m RNAh RNAh,m Absentm N.D. RNAh (Tsuboi, Yoshikai et al. 2002, Anders, Vielhauer et al. 2004, Muir, Soong et al. 2004, Otte, Cario et al. 2004, Rumio, h Protein Besusso et al. 2004, Greene, Carroll et al. 2005, Kollisch, Kalali et al. 2005, Pedersen, Andresen et al. 2005, Begon, Michel et al. 2007, Ewaschuk, Backer et al. 2007, Lebre, van der Aar et al. 2007)

TLR10 N.D. Absenth RNAh,m N.D. N.D. RNAh (Chuang and Ulevitch 2001, Muir, Soong et al. 2004, Otte, Cario et al. 2004, Kollisch, Kalali et al. 2005)

TLR11 N.D. N.D. RNAm RNAm RNAm N.D. (Tsuboi, Yoshikai et al. 2002, Muir, Soong et al. 2004, Zhang, Zhang et al. 2004)

Table 1.2. The expression of various human (h) and mouse (m) TLRs in epithelial cells from different anatomical locations. This information is based on existing literature in which mRNA levels were quantified using qPCR, and protein levels were detected using Western blotting. N.D. = not determined.

Introduction 1.6.1 TLR localization in epithelial cells Although epithelial cells can express TLRs, distinct subcellular localizations have often been reported. For example, in airway epithelium, TLR4 and TLR5 were expressed at the basolateral surface, whereas TLR2 was expressed at the apical surface of these cells (Hertz, Wu et al. 2003, Adamo, Sokol et al. 2004, Muir, Soong et al. 2004). In primary bronchial epithelial cells, TLR4 was localized to the intracellular compartment of the cell (Guillot, Medjane et al. 2004), whilst TLR9 was expressed at the cell surface in these cells (Greene, Carroll et al. 2005). This contrasts with the localization of these TLRs in macrophages and DC, and suggests that there may be distinct regulation and function of TLRs in epithelial cells versus phagocytes. In keratinocytes, TLR1, TLR2 and TLR5 expression was found in the basal cells, whilst TLR4 was expressed in the epidermis of the skin (Kawai, Shimura et al. 2002, Baker, Ovigne et al. 2003, Pivarcsi, Bodai et al. 2003). In IECs, TLR3, TLR4 and TLR5 expression was found on the basolateral surface, while TLR2 and TLR9 were expressed in both the apical and basolateral surfaces (Chabot, Wagner et al. 2006). These differences in localization of the TLRs suggest that epithelial cells may have a unique way of interacting with pathogens and triggering immune responses.

TLRs are also differentially localized in specific cell types of the intestinal epithelium. In normal human colon tissue, TLR2 and TLR4 expression was predominantly localized to the crypt epithelial cells (Cario, Rosenberg et al. 2000, Furrie, Macfarlane et al. 2005). This crypt cell expression of TLR4 has also been reported in mice (Ortega-Cava, Ishihara et al. 2003). In mice, TLR2, 4 and 5 have been shown to be localized on the follicle-associated epithelium and the intestinal epithelium (Chabot, Wagner et al. 2006). TLR2 and TLR9 expression were found on the apical and basolateral pole of the follicle-associated epithelium, but only on the apical surface in intestinal epithelium (Chabot, Wagner et al. 2006). TLR4 was localized internally in the Golgi-apparatus of the epithelium (Hornef, Frisan et al. 2002). The differential localization of TLR4 in IEC may enable it to differentiate between non-pathogenic luminal bacteria and pathogenic bacteria. Thus, there appears to be a very specialized pattern of TLR expression within both the tissue and the epithelial cells. This may be important for host defence and for preventing unwanted responses against non- pathogenic microorganisms. However, it is also worth noting that there are often concerns about the specificity of several antibodies used to detect various TLRs, so this must also be considered when assessing the literature on TLR localization within epithelial cells and specific tissues.

1.6.2 TLR responsiveness of keratinocytes Human skin is constantly exposed to microbes, and is therefore equipped to detect pathogens, and to prevent their entry and multiplication. Skin cells such as keratinocytes have been reported to

Introduction express TLRs and produce inflammatory cytokines in response to PAMPs. Table1.3 summarizes the TLR responses that have been reported in keratinocytes.

TLR Agonist/Pathogen Inflammatory Response References

TLR Agonist

TLR1/2 Pam3Cys, PGN NF-κB nuclear translocation (Kawai, Shimura et al. 2002, Mempel, Voelcker et al. 2003, IL-8, CCL20, CCL2, MMP9, Niebuhr, Baumert et al. 2010) iNOS, β-defensin 2

TLR2/6 Lipoteichoic acid (LTA), NF-κB nuclear translocation (Kawai, Shimura et al. 2002, Zymosan Mempel, Voelcker et al. 2003) IL-8, iNOS, β-defensin 2

TLR3 Polyinosinic-polycytidylic IRF3 nuclear translocation (Kollisch, Kalali et al. 2005, acid (Poly(IC)) Miller, Sorensen et al. 2005, Dai, IFN-α, IFN-β, IL-8, CCL27, Sayama et al. 2006, Lebre, van Chemokine (C-X-C motif) der Aar et al. 2007) ligand (CXCL)9, CXCL10

TLR4 LPS NF-κB nuclear translocation (Song, Park et al. 2002, Kollisch, Kalali et al. 2005) IL-8, IL-1α, IL-1β

TLR5 Flagellin IL-8, Tumour necrosis factor (Kollisch, Kalali et al. 2005, alpha (TNF-α), thymic Lebre, van der Aar et al. 2007) stromal lymphoprotein (TSLP), β-defensins 2 and 3

TLR7 Imiquimod IL-6, IL-8, TNF-α, IL-1β, (Kono, Kondo et al. 1994, Kollisch, Kalali et al. 2005, IL-12, IL-23, IL-17, IFN-γ Olaru and Jensen 2010, Li, Sohn et al. 2013)

TLR9 CpG DNA type 1 IFN, IL-8, β-defensins (Miller, Sorensen et al. 2005, Lebre, van der Aar et al. 2007)

Introduction Pathogen

TLR2 Staphylococcus aureus (S. TNF-α, IL-8, TSLP, β- (Mempel, Voelcker et al. 2003, and 2/6 aureus) defensins Midorikawa, Ouhara et al. 2003, Sumikawa, Asada et al. 2006, Aufiero, Guo et al. 2007, Kisich, Howell et al. 2007, Vu, Baba et al. 2010, Ommori, Ouji et al. 2013)

TLR2 GAS IL-1α, IL-1β, IL-6, IL-8 (Wang, Ruiz et al. 1997)

TLR9 Herpes simplex virus (HSV) type-1 IFN, TNF-α, CCL5, (Schnipper, Levin et al. 1984, colony simulating factors, IL- Melchjorsen and Paludan 2003, 3, defensins Shao, Zhang et al. 2010)

TLR2 Candida albicans NF-κB nuclear translocation (Pivarcsi, Bodai et al. 2003, and 4 Wollina, Kunkel et al. 2004, IL-8, TNF-α, IL-1β, IL-6, Eyerich, Wagener et al. 2011) IFN-γ

Skin Inflammatory Disorders

TLR1-5, Psoriasis IL-23, IL-17, IFN-γ (Baker, Ovigne et al. 2003, Lee, 7 and 9 Trepicchio et al. 2004, Miller, NF-κB activation Sorensen et al. 2005, Piskin, Th17 development and Sylva-Steenland et al. 2006, responses Begon, Michel et al. 2007, Wilson, Boniface et al. 2007, Manel, Unutmaz et al. 2008)

TLR2 Atopic dermatitis (AD) TNF-α, CCL5, IL-1α, IFN-γ (Pastore, Corinti et al. 1998, and 9 Giustizieri, Mascia et al. 2001, Kaburagi, Shimada et al. 2001)

Introduction

Danger-Associated Molecular Patterns (DAMPs)

TLR3 UV-damage (U1 non-coding IL-1β, TNF-α, IL-6 (Skiba, Neill et al. 2005, Lai, Di RNA) Nardo et al. 2009, Bernard, Cowing-Zitron et al. 2012)

TLR3 Wound/Injury (dsRNA from TNF-α, IL-6 (Lai, Di Nardo et al. 2009, Lin, necrotic cells) Fang et al. 2011)

Table 1.3. TLR responses in keratinocytes. Based on existing literature, the responses of keratinocytes to various TLR agonists, common skin pathogens, in skin inflammatory disorders and DAMPs are listed in this table.

1.7 Project Aims and Hypothesis Despite the strong homology of IRF6 with IRF5, an important regulator of TLR responses, only one study has addressed possible IRF6 functions in TLR pathways. Mammary epithelial cells expressed TLR3 at the mRNA level, and the TLR3 ligand poly(IC) was reported to trigger IRF6 translocation into the nucleus (Bailey, Abbott et al. 2008, Bailey and Hendrix 2008). IRF6 expression analyses in mouse and chick embryos indicates that IRF6 is mainly expressed in epithelial cells (Ben, Jabs et al. 2005, Ingraham, Kinoshita et al. 2006, Knight, Schutte et al. 2006, Richardson, Dixon et al. 2006), a finding that is consistent with the phenotypes revealed by IRF6 loss of function in both mice and humans (Kondo, Schutte et al. 2002, Zucchero, Cooper et al. 2004, Blanton, Cortez et al. 2005, Ghassibe, Bayet et al. 2005, Scapoli, Palmieri et al. 2005, Srichomthong, Siriwan et al. 2005, Ingraham, Kinoshita et al. 2006, Richardson, Dixon et al. 2006, Park, McIntosh et al. 2007, Jugessur, Shi et al. 2009). In summary, the existing literature suggests that IRF6 is expressed in epithelial cells, particularly in the skin. This places this IRF family member as a possible component of danger recognition pathways in these cells, but this has not been examined to date. This project therefore aimed to investigate the role of IRF6 in barrier defence.

Introduction

1.7.1 Hypothesis IRF6 contributes to barrier defence by acting as a key component of pattern recognition receptor signalling in epithelial cells.

1.7.2 Research Aims This project aimed to elucidate the role of IRF6 in epithelial cell-mediated inflammatory responses through the following aims:

Aim 1: To characterize IRF6 expression in human epithelial cell populations from distinct anatomical locations.

Aim 2: To investigate the role of IRF6 in poly(IC)-regulated gene expression in keratinocytes.

Aim 3: To investigate the role of IRF6 in MyD88-dependent TLR signalling in keratinocytes.

Materials and Methods

2 Materials and Methods

Materials and Methods 2.1 Materials

2.1.1 General Reagents The Rho-associated protein kinase (ROCK) inhibitor Y27632 was sourced from either Sigma- Aldrich (St Louis, MO, USA) or Reagents Direct (Encinitas, CA, USA), and was used at a final concentration of 5 µM. Calcium chloride (Merck, Darmstadt, Germany) was dissolved in DNase/RNase free water at a concentration of 1 M, autoclaved prior to use and diluted in tissue culture media to a final concentration of 2 mM. Human recombinant IFN-γ (R&D Systems, Minneapolis, MN, USA) was stored at a concentration of 2.5 µg/ml at -200C and diluted in tissue culture media to a final concentration of 2.5 ng/ml. Phorbol 12-myristate 13-acetate (PMA) (Sigma- Aldrich) was solubilised in dimethyl sulfoxide (DMSO) at a concentration of 10 µg/ml, stored at - 800C and was diluted in tissue culture media to a final concentration of 30 ng/ml.

2.1.2 Primers Primers used for quantitative PCR (qPCR) analysis were designed using Primer3 public software (http://www.basic.nwu.edu/biotools/Primer3.html). If possible, at least one of the primer pairs was designed to span exon-exon junctions to avoid amplification of any contaminating genomic DNA. Primer pairs were selected to amplify a product of 80-150 bp and to have melting temperatures (Tm) of 60-640C. Absence of predicted secondary structures and primer dimers was confirmed using Oligo 6.8 software (Molecular Biology Insights, Cascade, CO, USA). Primer concentrations (100-400 nM) were first optimized, prior to use for subsequent quantitative analyses. The amplification of a single product by each primer pair was confirmed by the dissociation curve of each qPCR. Primer pairs used for qPCR are listed in Table 2.1.

Product Exons Primer Forward (5’-3’) Reverse (5’-3’) Size (bp) targetted hIRF6 TAGCGATCTCATTGCCCA CACTACTGGAATGACCTGAAC 139 5-6 hIRF3 CGTGATGGTCAAGGTTGTGC AGAGTGGGTGGCTGTTGGAA 119 6-7 hIRF8 CCAGCCAGTTCTTCCGAGAG CCGGAAACTCTTCCCCAAAG 96 6-7 hHPRT TCAGGCAGTATAATCCAAAGATGGT AGTCTGGCTTATATCCAACACTTCG 84 4-5 hIFN-β CAGTCCTGGAAGAAAAACTGGAGA TTGGCCTTCAGGTAATGCAGAA 109 1 hIL-8 GGAGAAGTTTTTGAAGAGGGCTGA TGCTTGAAGTTTCACTGGCATCTT 93 3-4 hIL- GCTCCAGAAGGCCAGACAAA GCCTCCACTGTGCTGGTTTT 99 2-3 12p35 hIL- GATGCCGTTCACAAGCTCAAGT GACCTCCACCTGCCGAGAAT 126 4-5 12p40 hIL- GGACTCAGGGACAACAGTCAGTTC GAGAAGGCTCCCCTGTGAAAA 103 2-3 23p19

Materials and Methods hCCL5 CTCCAACCCAGCAGTCGTCTT CCAAAGAGTTGATGTACTCCCGAAC 95 2-3 hCCL20 GCGAATCAGAAGCAGCAAGC GCCGTGTGAAGCCCACAATA 90 1-2 hEBI3 CATGGCTCCCTACGTGCTC GGGCTTGATGATGTGCTCTGT 94 3-4 hIL- GCTTTGCGGAATCTCACCTG GGTGGAGATGAAGCAGAGACG 134 2-3 27p28 hIVL GGTCCCATCAAAGCAAGAGG CTGCTCCTGTGGCTCCTTCT 94 1 hTLR1 CACCAAGTTGTCAGCGATGTG CAAATGCAGGAACGGGCTAA 147 1 hTLR2 TGGTGTCTGGCATGTGCTGT CCAGGCCCACATCATTTTCA 104 1 hTLR3 97 3 GCTCTGGAAACACGCAAACC CTCGTCAAAGCCGTTGGACT hTLR4 91 1-2 GAGCCCTGCGTGGAGGT TGGTTGAGAAGGGGAGGTTGT hTLR5 100 1 TGTTTCTGGAAATGGCTGGAC CATGATGTGGTGGGCAAGAA hTLR6 106 1 GTCCCTGGCAAGAGCATTGT AATGGCACCACTCACTCTGGA hTLR7 90 2 ACATCTCCCCAGCGTCCTTT TTTTTGACCCCAGTGGAATAGG hTLR8 108 2 AGCTGCGCTACCACCTTGAA TGCTCTGCATGAGGTTGTCG hTLR9 134 2 ACTTCTTCCAAGGCCTGAGC GGCCAGGTAATTGTCACGGA hTLR10 106 1 TTGACCCTGGCAAAAGCATTA TGGCACCACTCATTCTGGAC Table 2.1. List of Primers used for qPCR.

2.1.3 Plasmids The IRF6 expression constructs, the IFN-β promoter-luciferase construct, pIFN-β-luc (Sato, Suemori et al. 2000) and the pEF (empty vector) plasmids were kindly provided by A/Prof. Glen Scholz (Bio21, University of Melbourne). The human IL-23p19 promoter luciferase construct, pIL- 23p19-luc was PCR cloned from genomic DNA, as described in Section 2.2.11. The renilla reporter plasmid pRL-SV40, as well as the pGL2-Basic (pGL2-B) and the pGL2-Control (pGL2-C) luciferase constructs were from Promega.

2.1.4 Antibodies The antibodies used in these studies are listed in Table 2.2.

Antibody Specificity Antibody Application Dilution Concentration MW of Antigen Source Type (µg/ml) detected (kDa)

Primary Antibodies

Rabbit α- Human Polyclonal WB 1/1000 0.6 60 Cell Signaling IRF6 Technology, IF 1/250 2.4 Danvers, MA, USA IHC 1/1200 0.5

Materials and Methods Rabbit α- Human/ Polyclonal WB 1/2500 0.1 37 Trevigen, GAPDH mouse Gaithersburg, MD, USA

Mouse α- Human/ Monoclonal WB 1/2500 1 74 (Lamin A) Cell Signaling Lamin A/C mouse Technology (4C11) 63 (Lamin C)

Mouse α- Human Monoclonal WB 1/500 1 20 R&D Systems IL-23p19 (727753)

Secondary Antibodies

Goat α- Rabbit IgG - WB 1/2500 0.4 - Cell Signaling rabbit IgG- Technology HRP

Horse α- Mouse IgG - WB 1/2500 0.4 - Cell Signaling mouse IgG- Technology HRP

Goat α- Rabbit IgG - IF 1/400 5 - Molecular rabbit IgG- Probes, Alexa488 Eugene, OR, USA

Chicken α- Rabbit IgG - IF 1/400 5 - Molecular rabbit IgG- Probes Alexa647

Goat α- Rabbit IgG - IHC 1/200 4 - Santa Cruz rabbit IgG- Biotechnology, Biotin Santa Cruz, CA, USA

Table 2.2. List of Antibodies used in this thesis. WB = Western Blotting; IF = Immunoflourescence microscopy; IHC = Immunohistochemistry.

2.1.5 TLR agonists The details and preparation of stock solutions of TLR ligands as follows: Poly(IC) (TLR3 agonist, Invivogen, San Diego, CA, USA), a synthetic dsRNA analogue, was solubilized in sterile water at 1 mg/ml; zymosan (TLR2/Dectin 1 agonist, Sigma-Aldrich), purified from Saccharomyces cerevisiae cell wall, was dissolved in sterile phosphate buffered saline (PBS) at 100 mg/ml; flagellin (TLR5 agonist, Invivogen) is a recombinant flagellin from Salmonella typhimurium and was reconstituted in sterile water at 10 µg/ml; Pam3Cys (TLR1/2 agonist, Calbiochem, Darmstadt, Germany), a bacterial lipoprotein analogue, was solubilised in sterile water at 10 µg/ml; CpG 2006 (TLR9 agonist, Geneworks, Adelaide, SA, Australia), a synthetic oligonucleotide containing unmethylated CpG dinucleotides, was solubilized in sterile water at 5 µM; LPS (TLR4 agonist, Sigma-Aldrich),

Materials and Methods purified from Salmonella enterica serotype Minnesota, was prepared in culture medium at 10 µg/ml; imiquimod (R837) (TLR7 agonist, Invivogen), an imidazoquinoline amine analogue to guanosine, was solubilized in sterile water at 1 mg/ml and Pam2CGDPKHPKSF (FSL-1) (TLR2/6 agonist, Invivogen), a synthetic lipoprotein derived from Mycoplasma salivarium cell wall, was solubilized in sterile water at 10 mg/ml. All stock solutions were stored at -200C.

TLR agonists were diluted in media to achieve a final concentration as follows: Poly(IC) - 30 µg/ml, zymosan - 100 µg/ml, flagellin - 10 ng/ml, Pam3Cys - 15 ng/ml, CpG 2006 - 0.3 µM, LPS - 100 ng/ml, Imiquimod (R837) - 25 µg/ml and FSL-1 - 100 ng/ml.

2.1.6 siRNAs The siRNAs used in gene silencing studies are as follows: IRF6(1) (Invitrogen, Carlsbad, CA, USA, Stealth) (Sense: CAG GCA CCU AUA CAG CCC UUC UAU A; Antisense: UAU AGA AGG GCU GUA UAG GUG CCU G), IRF6(2) (Invitrogen, Pre-made stealth) siRNA Id: HSS105511 IRF6, IRF3 (Invitrogen Stealth) (Sense: GAG AAU ACU GUG GAC CUG CAC AUU U; Antisense: AAA UGU GCA GGU CCA CAG UAU UCU C) and SLC39A8 (Invitrogen Stealth) (Sense: GCC AUC AAU GGU GUG ACA UTT; Antisense: AUG UCA CAC CAU UGA UGG CTT).

Figure 2.1. A schematic diagram indicating IRF6 siRNA targeting sites. This figure is a schematic diagram of the human IRF6 mRNA showing the different exons and the intron region (grey line). The untranslated regions of the mRNA are indicated in green, while the translated regions are indicated in pink. The target sites for the two siRNAs used are indicated by arrows (in exons 7 and 8).

2.2 Methods

2.2.1 Cell lines and culture conditions 2.2.1.1 A498 A498 is a human kidney epithelial cell-line and was kindly provided by Dr. Makrina Totsika (University of Queensland). These cells were originally isolated from a patient with renal carcinoma (Giard, Aaronson et al. 1973). A-498 cells were cultured in Advanced Dulbecco’s Modified Eagle Medium (DMEM) (Life technologies, Carlsbad, 37

Materials and Methods CA, USA) with 10% foetal bovine serum (FBS) (Invitrogen), 2 mM L-glutamine (Invitrogen), 1.5 g/l Sodium bicarbonate (Invitrogen), 20 units(U)/ml Penicillin and 20 µg/ml Streptomycin. For freezing down cells, 10% DMSO was added to complete growth media.

2.2.1.2 BEAS-2B BEAS-2B is a human lung/bronchial epithelial cell-line, which was obtained from the American Tissue Culture Collection (ATCC, Manassas, VA, USA) (CRL-9609). These cells were isolated from normal human bronchial epithelium and were virally transformed to immortalise them (Albright, Jones et al. 1990). BEAS-2B cells were cultured in DMEM-F12 (Ham’s F12) media (Invitrogen), supplemented with 10% FBS, 20 U/ml Penicillin and 20 µg/ml Streptomycin. For freezing down the cells, 10% DMSO was added to complete growth media.

2.2.1.3 CaCo-2 CaCo-2 is a human colon epithelial cell-line, which was kindly provided by Dr. Makrina Totsika (University of Queensland). These cells were isolated from a patient of colorectal adenocarcinoma. Media used for routine culture of CaCo-2 cells was identical to that used for A498 cells.

2.2.1.4 HaCaT HaCaT are a human keratinocyte cell-line and were kindly provided by Dr. Timothy Barnett (University of Queensland). These cells were isolated from normal adult skin and were immortalised as a result of a spontaneous transformation in vitro (Boukamp, Petrussevska et al. 1988). HaCaT cells were cultured in DMEM (Invitrogen) with 10% FBS, 20 U/ml Penicillin and 20 mg/ml Streptomycin. For freezing down the cells, 10% DMSO was added to complete growth media.

2.2.1.5 Human Embryonic Kidney (HEK) 293 and HEK293-TLR3 cells The HEK293 cell-line was derived from human embryonic kidney (Graham, Smiley et al. 1977) and was obtained from ATCC (CRL-1573) . HEK293-TLR3 cells are stably transfected with human TLR3, thus conferring responsiveness to TLR3 agonists (Yamamoto, Sato et al. 2002). Both HEK293 and HEK293-TLR3 cells were cultured as described for HaCaT cells.

Materials and Methods 2.2.1.6 HeLa HeLa is a human cervical epithelial cell-line, which was kindly provided by Dr. Makrina Totsika (University of Queensland). These cells were isolated from a patient’s adenocarcinoma (Jones, McKusick et al. 1971). HeLa cells were cultured in RPMI (Invitrogen) with 10% FBS, 2 mM L-Glutamine, 0.1 mM MEM non-essential amino acids (Invitrogen), 1 mM Sodium pyruvate (Invitrogen), 50 mM HEPES buffer (Invitrogen), 20 U/ml Penicillin and 20 mg/ml Streptomycin. For freezing down HeLa cells, 10% DMSO was added to complete growth media.

2.2.1.7 MCF-7 MCF-7 is a human mammary epithelial cell-line, derived from a metastatic site from a patient with breast adenocarcinoma (Soule, Vazguez et al. 1973). These cells were obtained from ATCC (HTB-22). MCF-7 cells were cultured in Minimum Essential Medium (MEM) (Invitrogen) with 10% FBS, 0.01 mg/ml Bovine Insulin, 2 mM L- Glutamine, 20 U/ml Penicillin and 20 mg/ml Streptomycin. For freezing down the cells, 10% DMSO was added to complete growth media.

2.2.1.8 RAW264.7 and RAW-ELAM RAW264.7 is a mouse macrophage-like cell-line, which was obtained from ATCC (TIB- 71). These cells were originally derived from tumours of mice after Abelson leukaemia virus infection (Raschke, Baird et al. 1978) and exhibit macrophage-like characteristics such as phagocytosis, and also robustly respond to stimulation with PAMPs. RAW- ELAM cells are RAW264 mouse macrophages stably transfected with a construct in which the endothelial leucocyte adhesion molecule (ELAM) promoter drives NF-B- dependent expression of green fluorescent protein (GFP) upon activation (Stacey, Young et al. 2003). RAW264.7 cells were cultured in RPMI with 5% FBS, 2 mM L-glutamine, 20 U/ml Penicillin and 20 mg/ml Streptomycin. For freezing down the cells, freezing media contained 50% FBS, 40% complete growth media and 10% DMSO.

2.2.1.9 T24 T24 is a human bladder epithelial cell-line that was kindly provided by Dr. Makrina Totsika (University of Queensland). These cells were isolated from a patient with transitional cell carcinoma (Bubenik, Baresova et al. 1973). T24 cells were cultured in McCoy’s 5a media (Invitrogen) containing 10% FBS, 20 U/ml Penicillin and 20 mg/ml Streptomycin. For freezing down the cells, 10% DMSO was added to complete growth media.

Materials and Methods 2.2.1.10 THP-1 THP-1 is a human monocytic cell-line, originally derived from the peripheral blood of a patient with acute monocytic leukemia (Tsuchiya, Yamabe et al. 1980). These cells can be differentiated to a macrophage-like phenotype by culturing for 48 h with PMA (Tsuchiya, Yamabe et al. 1980). These cells were obtained from ATCC (TIB-202). THP- 1 cells were cultured in RPMI with 10% FBS, 2 mM L-Glutamine, 1 mM Sodium pyruvate, 10 mM HEPES buffer, 50 μM β-mercaptoethanol, 20 U/ml Penicillin and 20 mg/ml Streptomycin. THP-1 cells were differentiated into macrophages using PMA (30 ng/ml) for 48 h. Undifferentiated cells were frozen down using freezing media, which consisted of 50% FBS, 40% complete growth media and 10% DMSO.

2.2.2 Primary Cells 2.2.2.1 Primary human keratinocytes All work using primary human cells was carried out with the approval of The University of Queensland Medical Research Ethics Committee (Project number H339). Primary epidermal keratinocytes were isolated from neonatal foreskin samples (samples were collected from Russell Medical Centre, Brisbane, Queensland). In brief, samples were rinsed in 70% ethanol, and then rinsed in PBS. Excess fat tissue was then excised from the skin and the skin was incubated overnight at 40C in Dispase II (1 mg/ml) (Roche, Basel, Switzerland) plus antibiotics (20 U/ml penicillin, 20 µg/ml streptomycin and 10 µg/ml gentamicin). The epidermis layer was peeled off and separated from the dermis. The epidermal cells were isolated by incubating in 0.25% trypsin (Invitrogen) for 5 minutes (min) and then cultured in a proliferating state. Primary keratinocytes were maintained in an undifferentiated state in Defined Keratinocyte serum-free media, supplemented with 50 µg/ml bovine pituitary extract and 5 µg/ml epidermal growth factor, 20 U/ml penicillin, 20 µg/ml streptomycin and 10 µg/ml gentamicin (Life technologies). For all experiments, unless stated otherwise, untreated cells were used at low passage numbers (up to 7 passages) to minimise differentiation of cells. To maintain cells in a proliferating state, 5 µM Y27632 (ROCK inhibitor) was included in culture media. To differentiate primary keratinocytes, 2 mM calcium chloride was added for up to 72 h. Undifferentiated cells were frozen down using freezing media, which consisted of complete growth media and 10% FBS and 10% DMSO.

2.2.2.2 Primary human monocyte derived macrophages (HMDM) Human monocyte-derived macrophages (HMDM) were isolated from buffy coats obtained from the Australian Red Cross Blood Service. Generation of HMDMs was 40

Materials and Methods performed by Dr. Nilesh Bokil (Institute for Molecular Bioscience, University of Queensland). In brief, monocytes were isolated by MACS using CD14+ magnetic beads (Miltenyi Biotech, Bergisch Gladbach, Germany), as previously described (Schroder, Irvine et al. 2012). Monocytes were differentiated into macrophages by using 1 X 104 U/ml recombinant human CSF-1 (Chiron, Emeryville, CA, USA). HMDMs were maintained in Iscove’s modified Dulbecco’s medium (Life Technologies) with 20 U/ml penicillin, 20 µg/ml streptomycin and 2 mM L-glutamine.

2.2.3 Storage of cells Cells and cell-lines at a low passage number were stored in liquid nitrogen. Cells at 70-80% confluence were harvested (as described below, Section 2.2.4), pelleted by centrifugation at 500 g for 5 min and resuspended in specific freezing media, described above. Cells were aliquoted into cryo-vials, after which they were frozen slowly in isopropanol using cryo-freezing containers placed at -800C, and then transferred into liquid nitrogen. Cryo-vials of cells were rapidly defrosted in a 370C water bath and resuspended in 10 ml of warmed complete growth media. Cells were then pelleted by centrifugation at 500 g for 5 min, after which they were resuspended in fresh complete growth media and cultured, as described above.

2.2.4 Sub-culturing techniques All cells and cell-lines, except for RAW264.7, RAW-ELAM, THP-1 and HMDMs, were sub- cultured using trypsinization. Briefly, culture media was aspirated out and cells were washed with PBS. Cells were incubated in 0.25% trypsin (Invitrogen) for 1-5 min at 370C. In the case of primary keratinocytes, a trypsin substitute Tryple Express (1 X) (Invitrogen) was used. Trypsin was deactivated using 10% FBS containing media and cells were pelleted down by centrifuging at 500 g for 5 min. RAW264.7, RAW-ELAM and HMDM cells were harvested using 18-gauge blunt end needle to dislodge adherent cells, whilst THP-1 cells are non-adherent. Cells were then pelleted down by centrifuging at 500 g for 5 m. Supernatant was discarded and cells were resuspended in 0 fresh media and cultured in 37 C incubator with 5% CO2.

2.2.5 PAMP stimulation For stimulation of epithelial cells with defined PAMPs, cells were plated out one day (d) before treatment. Cells were stimulated with the PAMPs listed above (Section 2.1.4) by diluting them in the media to achieve the final concentration indicated. Control cells were left unstimulated. For kinetic analyses within individual experiments, culture supernatants and/or cell lysates were harvested from independent replicate wells. That is, a different well of cells was used for each specific time point.

Materials and Methods 2.2.6 RNA extraction and reverse transcriptase PCR Cells were scraped off plates using a cell-scraper and lysed in RNA lysis buffer (Buffer RLT plus 0.1 M β-mercaptoethanol, Qiagen, Valencia, CA, USA) followed by homogenization using a 21- gauge needle. RNA was then extracted according to the manufacturer’s protocol (QIAGEN RNA mini kit). RNA derived from the cell-lines A-549, AGS, HT29, MKN28 and T84 were kindly provided by A/Prof. Glen Scholz (Bio21, University of Melbourne). Absorbance of RNA samples were measured at 260 nm using a ND1000 Nanodrop (Biolab, Auckland, New Zealand) and the values were converted into concentration (µg/ml) using the equation: A260 reading of 1.0 is equivalent of 40 µg/ml RNA. cDNAs were synthesised from 1 μg of extracted RNA using 500 ng oligo dT (Geneworks), 1 X First-strand buffer (Invitrogen), 1 µl 0.1 M DTT (Invitrogen), 1 µl 3.75 µM dNTPs (Invitrogen) and 0.25 µl Superscript III reverse transcriptase (Invitrogen). cDNA synthesis was performed by incubating at 42˚C for 30 min. The synthesized cDNA was diluted 10 times in RNase-free water and subsequently used for qPCR.

2.2.7 Real-time PCR (qPCR) All qPCR reactions were performed using SYBR Green PCR Master Mix (Applied BioSystems, Foster City, CA, USA) and the Applied Biosystems 7900HT RT-PCR or ViiA7 systems. A 10 µl reaction mix was prepared with 1 X SYBR Green PCR Master Mix (5 µl), 100-400 nM primers (forward and reverse) and 2 µl of diluted cDNA. All cDNA samples were run in triplicate in 384- well plate (Invitrogen). Primers designed to amplify specific genes are listed above (Table 2.1), and mRNA levels for specific genes were quantified relative to expression of the house-keeping gene hypoxanthine-guanine phosphoribosyltransferase (HPRT). That is, data were expressed relative to HPRT using the ∆Ct method. The following equation, which is recommended by Applied Biosystems, was used to calculate relative gene expression:

- gene/hprt = 2 ; where Ct = geneCt – hprtCt (the difference in cycle thresholds)

- -x 2 2 SD = 2 - 2 ; where x = Ct + SQRT(SDgene + SDhprt )

2.2.8 Western blotting For analysis of protein expression by immunoblotting, cells were lysed using RIPA lysis buffer (50 mM Tris-HCl pH7.4, 150 mM NaCl, 1 mM EDTA, 1% Triton-X 100, 1% Sodium deoxycholate, 0.1% SDS) containing 1 X complete protease inhibitor cocktail (Roche) and 1 X phosphatase inhibitor (1 mM sodium vanadate, 1 mM sodium pyrophosphate, 1 mM sodium molybdate, 10 mM sodium fluoride). Cell lysates were collected using a cell-scraper and were passed through a 21- gauge needle to homogenize the lysates. Protein concentrations were determined using Bradford’s protein assay (Bio-rad, Hercules, CA, USA) or BCA assay (Pierce, Rockford, IL, USA), according 42

Materials and Methods to the manufacturer’s protocol. Immunoblotting was performed by loading 10 μg of protein lysate on a pre-cast 4-20% gradient SDS-PAGE gel (Bio-rad). The separated proteins were transferred onto methanol-activated polyvinylidene diflouride (PVDF) membranes and were blocked using Blotto which contained 5% Skim milk powder in Tris-buffered saline with Tween 20. Membranes were then probed for specific antigens (IRF6, GAPDH, Lamin A/C or IL-23p19) as per the details in Table 2.2. Horseradish peroxidase (HRP) conjugated α-Rabbit or α-mouse antibody (Cell Signaling Technology) was used as secondary antibody, as per the details in Table 2.2. Immobilon Western Chemiluminescent HRP substrate (Millipore, Billerica, MA, USA) was used for immunodetection.

2.2.9 Gene silencing The listed siRNAs (Section 2.1.6) were diluted in Opti-MEM reduced serum media (Life Technologies) to the final concentration of 200 pM, after which they were transfected into primary keratinocytes (300,000 cells/well of a 12-well plate (Nunc, Thermo Scientific, MA, USA)) using Lipofectamine 2000 reagent 5 µl/transfection (Life technologies) and the reverse transfection method, as described by the manufacturer. Cells were harvested or were stimulated for the indicated timepoints 72 h post-transfection, after which RNA and proteins were extracted and qPCR and immunoblotting were performed (as described in Section 2.2.7 and 2.2.8).

2.2.10 Enzyme-linked Immunosorbent Assays (ELISA) Supernatants were collected from cells treated with different TLR ligands. IL-8 cytokine levels were quantified using a human IL-8 ELISA kit (BD Biosciences, San Jose, CA, USA), according to the manufacturer’s protocol (capture antibody used at 2 µg/ml; detection antibody used at 2 µg/ml). For IL-23p19 ELISA, a human IL-23p19 monoclonal antibody (R&D Systems) was used as capture antibody (1 µg/ml) and a biotinylated α-human IL-23p19 (Bio Legend, San Diego, CA, USA) was used as detection antibody (0.5 µg/ml). Immuno 96-well micro plates (Nunc) were coated overnight with the capture antibody. Recombinant human IL-8 or IL-23 (R&D Systems) standards and samples (50 µl/well) were then added and ELISA plates were incubated for 2 h at 37˚C. After washing, the biotinylated detection antibody was added for 1 h, followed by further washing and a 30 min incubation with Streptavidin-HRP conjugate (1 µg/ml). 3,3′,5,5′-Tetramethylbenzidine (TMB) substrate (Sigma-Aldrich) (100 µl/well) was then added to detect HRP activity, and 2 mM sulphuric acid (100 µl/well) was added to stop the reaction. Absorbance was read on a plate reader at 450 nm, and cytokine levels were determined from the standard curves. The estimated detection limit for the IL-8 ELISA was 80 pg/ml, while for the IL-23p19 ELISA it was 300 pg/ml.

Materials and Methods 2.2.11 PCR Cloning The region immediately upstream of the transcription start site (TSS) of the human IL-23p19 promoter was cloned from genomic DNA from primary keratinocytes into the pGL2B-luciferase construct (Promega, Madison, WI, USA) using the primer pairs, IL-23p19 F (5’-CA CCC GGG ACT GTG AGG CCT GAA ATG-3’) and IL-23p19 R (5’-GC AAG CTT CTT TTT GCC TTC TTC TCA AAT CTG GC-3’). These primer pairs were designed such that the TSS and a putative upstream IRF binding site (-815 to +1 bp) were present in the amplified PCR product. XmaI and HindIII restriction sites were also engineered within the primer sequences, as part of the cloning strategy. The 815 bp PCR product was digested with the XmaI and HindIII restriction enzymes (New England BioLabs, Ipswich, MA, USA) , after which it was ligated into the promoterless luciferase reporter construct pGL2-B, which had previously been digested with XmaI and HindIII (Figure 2.2). Ligations were carried out using T4 DNA ligase (New England BioLabs) using a molar ratio of 1:3 (vector to insert). 10 µl ligation reaction was prepared using 1 X T4 DNA ligase buffer (New England BioLabs), 1 µl T4 DNA ligase and 8 µl of digested vector and insert and incubated at 160C overnight. Ligated plasmids were then transformed and purified as described below (Section 2.2.12).

Figure 2.2. Plasmid map of pIL-23p19-luc. Plasmid map of pIL-23p19-luc was adapted from the pGL2-B map provided by Promega (https://au.promega.com/). The IL-23p19 promoter is marked in grey (inserted using the restriction sites indicated), and the putative IRF and NF-κB binding sites are indicated. The luciferase gene is indicated in green, and the other sites on the plasmid are highlighted in yellow. 44

Materials and Methods 2.2.12 Plasmid purification The above ligations were transformed into Top10 (Invitrogen) or XL-1Blue competent E. coli cells. XL-1Blue E. coli cells were prepared by growing bacteria in super optimal broth media at room temperature until they reach an absorbance (A600) of 0.6. Following this, the cells were centrifuged at 2500 g for 10 min at 40C and resuspended in transformation broth (40C) (10 mM PIPES, 55 mM 0 MnCl2, 15 mM CaCl2, 250 mM KCl, pH 6.7) and centrifuged again at 2500 g for 10 min at 4 C. Cells were then resuspended in transformation broth with 7% DMSO and snap-frozen in liquid nitrogen and subsequently stored in -800C. Mini-preps were performed on transformed bacteria using the alkaline lysis method. Cells were pelleted and resuspended in 250 µl resuspension buffer P1 (Qiagen) followed by lysis in 250 µl lysis buffer P2 (Qiagen). DNA was precipitated using 150 µl cold 3 M sodium acetate (pH 5.2) and 150 µl chloroform and centrifuged at 14000 g for 5 min. The upper layer (containing DNA) was carefully removed and purified by sequential 100% and 70% ethanol washes. The DNA was resuspended in 30 µl of DNase/RNase-free water and subsequently analysed by restriction enzyme digestion and DNA sequencing. Maxi-preps of the sequence-verified pIL-23p19 plasmid, and all other plasmids (Section 2.1.3), were prepared using QIAGEN Maxi-prep Kits (Qiagen), according to the manufacturer’s protocol.

2.2.13 Transient transfection analysis and reporter gene assays HEK293 cells or HEK293-TLR3 cells were transfected with 100 ng of the indicated firefly luciferase reporter plasmid, as well as 10 ng of the SV-40 renilla plasmid. An IRF6 expression plasmid was added to required cells in various concentrations. The total concentration of plasmid DNA was kept constant at 2 μg in all transfections, using empty pEF vector. Cells were seeded overnight, and transient transfections were performed on the following d using 10 µl lipofectamine 2000 reagent (Invitrogen) and 2 μg plasmids (as described above) in 1 ml serum-free DMEM for 6 h, after which the medium was replaced with complete growth medium for 15 h. The cells were then stimulated with 30 μg/ml Poly(IC) for 8 h, then lysed using Passive lysis buffer (Promega Dual Luciferase Kit). Firefly and renilla luciferase activity were then measured using the VICTOR system (PerkinElmer, Waltham, MA, USA), as well as the Promega Dual Luciferase Kit (Promega), according to the manufacturer’s protocol. The firefly luciferase reading was normalized to the renilla luciferase reading to correct for differences in transfection efficiency between different transfections.

RAW264.7 cells were transfected with 5 μg of the indicated firefly luciferase reporter, as well as 5 μg of the IRF6 expression plasmid or empty vector, in 300 μl media in 0.4 cm cuvettes using a Bio- Rad Gene Pulser XCell Electroporator (260 V, 1000 μF). After electroporation, cells were washed in PBS and plated out in 6-well plates (Nunc) and incubated for 20 h, after which cells were 45

Materials and Methods stimulated with 30 μg/ml poly(IC) for 8 h or were left unstimulated. Cells were harvested using the Roche luciferase lysis buffer (Roche) and luciferase activity was measured using a MicroBeta trilux luminometer (PerkinElmer) and Roche Luciferase Reporter Gene Assay kits (Roche), as per the manufacturer’s protocol. Total protein concentrations in lysates were determined using BCA assay (Pierce), as described earlier. Luciferase readings were normalised to total protein.

2.2.14 Nuclear and Cytoplasmic fractionation HaCaT cells were plated out overnight in 10 cm tissue culture dishes (Nunc) and were stimulated on the following d with 30 μg/ml Poly(IC) over a time-course. Cells were detached using 0.25% Trypsin (Invitrogen), and were washed thrice with PBS. Cells were re-suspended in Hypotonic

Wash Buffer (HWB) (10 mM HEPES pH 7.4, 1.5 mM MgCl2, 10 mM KCl) containing 1 X complete protease inhibitor cocktail (Roche), 1 X phosphatase inhibitor (1 mM sodium pyrophosphate, 1 mM sodium molybdate, 10 mM sodium fluoride), 1 mM sodium vanadate (Sigma-Aldrich) and 1 mM phenylmethylsulfonyl fluoride (Sigma-Aldrich) to cause cell swelling, after which they were lysed using 0.1% NP-40. Lysed cells were then centrifuged at 500 g for 5 min and supernatants (cytoplasmic extracts) were collected, aliquoted and stored at -80˚C. The nuclei were then washed with HWB buffer, after which the nuclear proteins were extracted by hypertonic lysis of nuclear membrane using nuclear extraction buffer (NEB) (20 mM HEPES pH 7.8, 1.5 mM

MgCl2, 0.42 M NaCl, 20% glycerol, 0.2 mM EDTA) containing 1 X complete protease inhibitor cocktail (Roche), 1 X phosphatase inhibitor (1 mM sodium pyrophosphate, 1 mM sodium molybdate, 10 mM sodium fluoride), 1 mM sodium vanadate (Sigma-Aldrich) and 1 mM phenylmethylsulfonyl fluoride (Sigma-Aldrich), aliquoted and stored at -80˚C. Protein concentrations in nuclear and cytoplasmic extracts were determined using Bradford’s protein assay (Bio-rad) as per the manufacturer’s protocol. Extracts were subjected to immunoblotting, as described above.

2.2.15 Immunofluoresence microscopy Primary keratinocytes were plated out in 24-well plates containing circular coverslips overnight, after which they were stimulated with 30 μg/ml poly(IC) or 100 ng/ml FSL-1 for 4 h, or were left untreated. Cells were fixed using 4% paraformaldehyde for 15 min, before incubating in blocking buffer (5% FBS, 1% Triton-X100 in PBS). Immunofluorescence staining was performed using a rabbit anti-IRF6 antibody (1 in 250 dilution in blocking buffer), followed by a goat anti-rabbit Alexa-647-conjugated (Invitrogen) secondary antibody. Cells were also stained with 4', 6- diamidino-2-phenylindole (DAPI) (1 µg/ml, Sigma-Aldrich) and 6.6 mg/ml phalloidin (Alexa-594, Invitrogen). Coverslips were mounted on glass slides using mounting media (Dako, Glostrup, Denmark) and sealed using nail polish. Images were captured at 100X using an oil immersion 46

Materials and Methods objective and a Carl Zeiss Meta Inverted LSM 510 microscope (Carl Zeiss, Jena, Germany). Levels of cytoplasmic and nuclear IRF6 in control and stimulated cells were quantified using ImageJ 1.45s software (National Institutes of Health, Bethesda, MD, USA). Samples were blinded by Mr. Daniel Hohenhaus (Institute for Molecular Bioscience, University of Queensland), prior to quantification.

2.2.16 Flow Cytometry RAW-ELAM cells were cultured in complete growth media (Section 2.2.1.8) overnight (1 X 106 cells/well of a 6-well plate), after which they were stimulated with zymosan, Pam3Cys or LPS as per Section 2.15 for 6 h. Cells were then washed and harvested in PBS and fixed in 2% paraformaldehyde for 5 min at room temperature. Following this, cells were centrifuged at 500 g for 5 min and resuspended in PBS. Cells were passed through a 40 µm cell strainer (BD Biosciences) to separate out clumps and GFP levels (mean fluorescence intensity) was calculated using FACS CantoII flow cytometer (BD Biosciences). Data collected were analysed using FlowJo 9.4.4 software (Tree Star, Ashland, OR, USA).

2.2.17 Immunohistochemistry (IHC) IHC was performed on 7 μm sections from wounded adult mouse skin tissue (kindly provided by A/Prof Kiarash Khosrotehrani, University of Queensland). The sections were de-waxed using xylene and were rehydrated in a gradient of ethanol (100, 95, 80 and 70%). Antigen retrieval was also performed using the boiling method; slides were boiled in sodium citrate buffer (10 mM Tri- sodium citrate, 0.05% Tween 20, pH 9.0) for 10 min, after which they were incubated at room temperature for 30 min to enable them to cool down. Hydrogen peroxide (0.3%) (Sigma-Aldrich) treatment was used to quench endogenous peroxidase activity. Slides were blocked in 2% heat- inactivated FBS in PBS for 1 h. The primary antibody (anti-IRF6) was diluted 1:1200 times (Table 2.2) in the blocking solution. Approximately 200 μl of antibody was added to each section, and tissues were incubated overnight at 40C. A secondary biotinylated α-rabbit antibody was diluted in blocking solution, as per the details in Table 2.2, and added to the sections for 1 h, followed by incubation with ABC Reagent (Vector laboratories, Burlingame, CA, USA) for 30 min. The DAB- Plus Substrate kit (Vector Laboratories) was used to visualize reactions. The slides were then dehydrated using gradient of ethanol (70, 80 and 100%) and mounted using a xylene-based mounting media (United Biosciences, Carindale, QLD, Australia).

2.2.18 Pathogen infection assays Primary keratinocytes were cultured in antibiotic-free media for at least 2 passages, prior to their use in infection assays. Cells were plated out one d prior to infection. On the following d, cells were challenged with GAS strain JRS4 at multiplicity of infection of 30. JRS4 (Nakagawa, Amano et al.

Materials and Methods 2004) were grown in Todd-Hewitt containing 0.2% yeast extract (THY) medium at 37°C by Dr. Timothy Barnett (University of Queensland). Following infections, all media was replaced with media containing 100 µg/ml gentamycin to kill all extra-cellular bacteria. To assess intracellular bacterial loads, cell lysates were harvested at 4 and 8 h post-infection using 0.25% trypsin and 0.025% Triton-X100. These were plated out onto THY agar plates. Plates were incubated overnight at 37˚C and intracellular bacterial loads of JRS4 were calculated.

2.2.19 Data presentation and statistical analyses Where data were combined from 3 or more independent experiments, statistical analysis was performed using Prism6 software (Graphpad, San Diego, CA, USA). Error bars and statistical tests used for individual datasets are listed within the relevant figure legends. p-values of 0.05 or less were considered as statistically significant. In some figures, data from individual experiments (usually representative of multiple experiments) are provided. In these cases, statistical analysis was not performed, but error bars from replicates within individual experiments are included to provide an indication of the variance within those individual experiments.

IRF6 expression and TLR responses in epithelial cell populations

3 IRF6 expression and TLR responses in epithelial cell populations

IRF6 expression and TLR responses in epithelial cell populations 3.1 Introduction Developmental studies in mouse, chicken, zebrafish and Xenopus laevis embryos have revealed that IRF6 is primarily expressed by epithelial cells of various tissues (Ben, Jabs et al. 2005, Ingraham, Kinoshita et al. 2006, Knight, Schutte et al. 2006, Richardson, Dixon et al. 2006). In mice, Irf6 expression was reported in the epithelial cells of the developing palate like medial edges of the paired palatal shelves, palatal rugae, tooth germs, thyroglossal duct, and also in the external genitalia, hair follicles and skin throughout the body (Kondo, Schutte et al. 2002). Either an inactivating mutation in Irf6 (Richardson, Dixon et al. 2006) or global knock-out of the gene (Ingraham, Kinoshita et al. 2006) is also associated with abnormalities in skin, limb and craniofacial development in the mouse (Ingraham, Kinoshita et al. 2006, Richardson, Dixon et al. 2006). Keratinocytes from these mice are also hyperproliferative and fail to terminally differentiate (Ingraham, Kinoshita et al. 2006, Richardson, Dixon et al. 2006). In line with these studies, genetic variations in IRF6 are associated with various degrees of cleft lip, cleft palate, undifferentiated skin and syndactyly in humans (Kondo, Schutte et al. 2002, Zucchero, Cooper et al. 2004, Blanton, Cortez et al. 2005, Ghassibe, Bayet et al. 2005, Scapoli, Palmieri et al. 2005, Srichomthong, Siriwan et al. 2005, Park, McIntosh et al. 2007, Jugessur, Shi et al. 2009). However, a detailed analysis of IRF6 expression in various human epithelial cell types has not been performed.

As discussed in Chapter 1, several studies have shown that some epithelial cell types possess functional TLRs and initiate inflammatory responses upon pathogen invasion. IRFs are important components within TLR signalling pathways, and IRF1, IRF3 and IRF7 have been linked to TLR3, TLR4, TLR7 and TLR9 signalling (Taniguchi, Ogasawara et al. 2001, Moynagh 2005, Tamura, Yanai et al. 2008). IRFs have also been shown to impart cell-type specificity within TLR signalling (Taniguchi, Ogasawara et al. 2001, Moynagh 2005, Tamura, Yanai et al. 2008). IRF6 has not been studied in the context of innate immunity and TLR signalling. Given that it is primarily expressed in the epithelial cells in mouse, chicken and zebrafish and that IRFs impart cell-type specificity in TLR signalling, the central hypothesis of this thesis was that IRF6 is an epithelial cell-specific regulator of TLR signalling. Thus, the first aim of this chapter was to characterize IRF6 expression patterns in a panel of human epithelial cell lines. Once this information was determined, responsiveness to a panel of TLR agonists was examined, with a focus on regulated expression of well-characterized IRF target genes.

IRF6 expression and TLR responses in epithelial cell populations 3.2 Results

3.2.1 Human keratinocytes express high levels of IRF6 mRNA and protein For characterization of IRF6 expression patterns, a panel of human epithelial cell lines from diverse anatomical locations was examined. For comparison, gene expression was also analyzed in human monocytic cells (THP-1 cells) and macrophage-like cells (PMA-differentiated THP-1 cells), which are known to express other IRF family members (Honda and Taniguchi 2006). IRF6 mRNA expression, relative to the housekeeping gene HPRT, was analyzed by qPCR. Figure 3.1A shows IRF6 expression in different epithelial cell lines and the two myeloid cell line populations. IRF6 mRNA expression was particularly elevated in keratinocytes (HaCaT), and was also expressed by bladder (T24), colon (CaCo-2, HT29, T84), stomach (AGS, MKN28) and breast epithelial cell lines (MCF-7) (Figure 3.1A). IRF6 mRNA was not detected in kidney (A498, HEK293), respiratory (A549, BEAS-2B), cervical (HeLa) epithelial cell lines, or in the myeloid line THP-1 (Figure 3.1A). Hence, IRF6 was highly expressed in certain epithelial cells, but was not detected in the myeloid cell-lines. As controls, IRF3 and IRF8 mRNA levels were also assessed in these cell lines. IRF3 is a ubiquitously expressed member of the IRF family (Au, Moore et al. 1995), while IRF8 expression is restricted to myeloid cell populations (Tamura and Ozato 2002). As expected, IRF3 mRNA was expressed in all the cell types examined, consistent with its presumed ubiquitous expression (Figure 3.1A). Nonetheless, the levels were somewhat lower in HEK293 cells, HeLa and T84 cells, as compared to the other epithelial cells examined. Also as expected, IRF8 mRNA expression was largely restricted to the myeloid cell types (THP-1 and PMA-differentiated THP-1 cells), although AGS, CaCo-2 and T84 stomach epithelial cells also expressed low levels of this transcription factor. However, the expression in the myeloid cell lines was ~10 fold higher than in these cells (Figure 3.1A). Thus, IRF family members show distinct cellular expression profiles, with IRF6 being expressed by certain epithelial cell populations, but not myeloid cells.

The initial analysis of human epithelial cell lines indicated that IRF6 mRNA was highly expressed by keratinocytes (HaCaT cells). Thus, primary human keratinocytes were next analysed to further validate these findings. For comparison, IRF6 mRNA levels were also quantified in primary human monocytes and monocyte-derived macrophages. Consistent with the cell line data, IRF6 mRNA was highly expressed in primary keratinocytes but was not detected in primary monocytes or macrophages (Figure 3.1B). Again, IRF3 mRNA was present in all cell populations and IRF8 mRNA was restricted to primary monocytes and macrophages (Figure 3.1B). These data from primary cells are thus consistent with the cell line data.

IRF6 expression and TLR responses in epithelial cell populations

Figure 3.1. Human keratinocytes express high levels of IRF6. mRNA levels of IRF6, IRF3 and IRF8, relative to HPRT, were examined by qPCR in a panel of (A) epithelial cell-lines and (B) primary cells. Data represents mean ± SEM of 3 independent experiments, ** p < 0.01, *** p ≤ 0.001, ****p≤ 0.0001 (compared to all other cell populations) (one-way analysis of variance (ANOVA), followed by Tukey’s test), ND indicates that no signal for the indicated gene was detected after 35 PCR cycles in the sample. (C) Whole cell lysates from the indicated cell lines were subjected to SDS PAGE and immunoblotting for IRF6 and GAPDH. Data are representative of 3 independent experiments.

IRF6 expression and TLR responses in epithelial cell populations To determine whether IRF6 protein expression mirrored mRNA expression, immunoblotting was next performed. IRF6 was robustly expressed by primary keratinocytes and the keratinocyte cell- line HaCaT, but was absent in T24, CaCo-2 and HEK293 cells (Figure 3.1C). These data are generally consistent with the mRNA expression profiles as both primary keratinocytes and HaCaT expressed high levels of IRF6 mRNA and protein, whereas HEK293 cells did not. However, the mRNA and protein expression data were not always consistent, since T24 and CaCo-2 cells expressed some IRF6 mRNA but did not express detectable levels of IRF6 protein. Thus, consistent with previous studies in mouse and other species (Ingraham, Kinoshita et al. 2006, Richardson, Dixon et al. 2006), IRF6 expression is enriched in keratinocytes in humans.

3.2.2 The TLR3 agonist poly(IC) triggers IL-8 production from human keratinocytes Given the above findings, responses of epithelial cells that express IRF6 protein (primary keratinocytes, HaCaT cells) to agonists of different TLRs were next assessed. One previous study reported that primary keratinocytes and HaCaT cells responded to agonists of TLR3, TLR5 and TLR1/2 by secreting IL-8 (Kollisch, Kalali et al. 2005). Keratinocytes have also been reported to respond to the TLR3 ligand Poly(IC) with activation and nuclear translocation of IRF3 and production of IFN-α and IFN-β (Dai, Sayama et al. 2006, Lebre, van der Aar et al. 2007). To corroborate TLR responsiveness of keratinocytes, a systematic comparison of human keratinocyte responses to different TLR agonists was performed. IL-8/CXCL8 was first examined, since this neutrophil-attracting CXC chemokine is secreted by epithelial cells in response to a wide range of stimuli (Eckmann, Kagnoff et al. 1993, Schulte, Wattiau et al. 1996, Kollisch, Kalali et al. 2005, Olaru and Jensen 2010). Primary keratinocytes and HaCaT cells were stimulated with agonists of TLR3 (poly(IC)), TLR2/Dectin 1 (zymosan), TLR5 (flagellin), TLR1/2 (Pam3Cys), TLR9 (CpG DNA) and TLR4 (LPS), after which cell supernatants were collected at 4, 8 and 24 h post stimulation, and secreted IL-8 levels were measured by ELISA. The TLR3 ligand poly(IC) triggered robust IL-8 production in both primary keratinocytes and HaCaT cells (Figure 3.2). IL-8 induction was maximal at 24 h post stimulation in primary keratinocytes, while it peaked at 8 hours post stimulation in HaCaT cells. However, neither of these cell populations responded to the other PAMPs examined, at least in terms of IL-8 secretion. These data suggest that the primary functional TLR receptor in keratinocytes appears to be TLR3, although agonists for all TLRs were not examined. Furthermore, it should be noted that cytoplasmic poly(IC) can also activate RIG-I and MDA-5 (Kato, Takeuchi et al. 2008), although treatment with extracellular poly(IC) as performed here preferentially activates endosomal TLR3 (Alexopoulou, Holt et al. 2001).

IRF6 expression and TLR responses in epithelial cell populations

Figure 3.2. The TLR3 agonist poly(IC) triggers IL-8 production from human keratinocytes. Secreted IL-8 levels released from (A) primary keratinocytes and (B) HaCaT cells after stimulation with poly(C) (30 μg/ml), zymosan (100 µg/ml), flagellin (10 ng/ml), Pam3Cys (15 ng/ml), CpG 2006 (0.3 µM), LPS (100 ng/ml) were quantified using ELISA. Data represents mean ± SD of experimental triplicates and is representative of 3 independent experiments.

3.2.3 Poly(IC) upregulates the expression of a sub-set of TLR target genes in primary human keratinocytes IRF family members typically promote TLR-inducible expression of IFN-β and members of the IL- 12 cytokine family (Honda and Taniguchi 2006). I therefore next examined TLR-regulated mRNA expression of IFN-β, as well as the IL-12 family (IL-12p40, IL-12p35, IL-23p19, EBI3 and IL- 27p28) in IRF6-expressing human keratinocytes. IL-8 mRNA was also monitored, given that poly(IC) triggered robust IL-8 secretion in these cells (Figure 3.2). The chemokines CCL5/RANTES and CCL20 were also examined because several studies have demonstrated that IRF family members activate CCL5 gene expression (Lin, Heylbroeck et al. 1999, Genin, Algarte et al. 2000, Melchjorsen and Paludan 2003), and because CCL20 has a well-documented role in promoting leukocyte recruitment to epithelial tissues (Williams 2006, Ito, Carson et al. 2011). Primary keratinocytes responded to Poly(IC) stimulation with robust up-regulation of mRNAs for IFN-β (>10,000 fold), IL-8 (>1,000 fold), IL-23p19 (>40 fold), EBI3 (>100 fold), CCL5 (>10,000 fold) and CCL20 (>60 fold) (Figure 3.3). IL-12p35 mRNA was also very modestly increased (~4 fold). Maximal responses for these genes were apparent at 24 h post stimulation, except for IFN-β, which peaked at the earliest time point examined (4 h post stimulation). Apart from polyIC, the TLR5 ligand flagellin caused a much less pronounced upregulation of IL-8 (~100 fold) and CCL20

IRF6 expression and TLR responses in epithelial cell populations mRNAs (~30 fold) at 4 h post-stimulation. For the TLR target genes examined, these cells were not particularly responsive to the other TLR agonists included in this analysis.

Figure 3.3. Poly(IC) triggers robust gene expression changes in primary keratinocytes. Primary keratinocytes were stimulated with the indicated TLR ligands (concentrations used were identical to that used in Figure 3.2). Total RNA was collected at the indicated time points and mRNA levels of potential IRF6 target genes (A) IL-8, (B) IFN-β, (C) CCL5, (D) CCL20, (E) IL- 23p19, (F) EBI3, (G) IL-12p40, (H) IL-12p35 and (I) IL-27p28 were quantified, relative to HPRT, using qPCR. Data represents mean ± SEM from 3 independent experiments, * p ≤ 0.05, ** p < 0.01, *** p ≤ 0.001, **** p ≤ 0.0001 as compared to unstimulated control (two-way ANOVA, followed by Tukey’s test).

IRF6 expression and TLR responses in epithelial cell populations

3.2.4 HaCaT cells behave similarly to primary keratinocytes in responsiveness to different TLR agonists The above data indicated that poly(IC) upregulated the mRNA expression of a panel of IRF candidate genes in primary human keratinocytes. To determine if similar results were apparent in the human keratinocyte cell-line HaCaT, a similar analysis was performed. Similar results were indeed apparent, with poly(IC) upregulating mRNA expression of IFN-β (65.3 fold), IL-8 (54.8 fold), IL-23p19 (63.7 fold), EBI3 (80 fold), CCL5 (680 fold) and CCL20 (1400 fold) (Figure 3.4). Maximal responses for these genes were apparent at 8 h post-stimulation, except for IFN-β and EBI3, which peaked at 4 h and 24 h post-stimulation, respectively. Apart from poly(IC), most of the other TLR ligands had only modest effects on inflammatory gene expression in HaCaT cells. CpG DNA and LPS both caused a delayed increase in IL-12p35 and IL-12p40 expression (Figure 3.4G- H), but these responses were very weak. Similarly, zymosan only very modestly increased IFN-β (Figure 3.4B) and IL-12p35 mRNA levels (Figure 3.4H). Thus, consistent with the primary keratinocyte data, HaCaT cells responded robustly to poly(IC), whereas agonists for other TLRs had only modest effects, if any (Figure 3.4).

3.2.5 Poly(IC)-inducible IL-23p19 mRNA expression does not occur in IRF6-deficient T24 cells Since T24 cells did not express detectable IRF6 protein (Figure 3.1C), I next assessed whether there were any obvious differences in TLR responsiveness of these cells. As with primary keratinocytes and HaCaT cells, poly(IC) robustly upregulated IFN-β (>3000 fold), CCL5 (25 fold), CCL20 (250 fold), EBI3 (50 fold) and IL-8 (16.7 fold) mRNA expression in T24 cells (Figure 3.5). In contrast, IL-23p19 mRNA was not regulated by this stimulus in these cells. The upregulation of IL-12p35 mRNA by poly(IC) (12 fold) was also somewhat stronger than was apparent for primary keratinocytes and HaCaT cells. T24 cells did not robustly respond to other TLR agonists examined, except for flagellin, Pam3Cys and CpG DNA which induced EBI3 expression very modestly at 24 h. In summary, like keratinocytes, T24 cells primarily responded to poly(IC), but the inducible IL- 23p19 response was absent from these cells. Thus, T24 cells can also be used as a cellular system to overexpress IRF6 and determine the effects on potential IRF6 target genes.

IRF6 expression and TLR responses in epithelial cell populations

Figure 3.4. HaCaT cells respond to the TLR3 agonist poly(IC). HaCaT cells were stimulated with the indicated TLR ligands (concentrations used were identical to that used in Figure 3.2). Total RNA was collected at the indicated time points and mRNA levels of potential IRF6 target genes (A) IL-8 (B) IFN-β, (C) CCL5, (D) CCL20, (E) IL-23p19, (F) EBI3, (G) IL-12p40, (H) IL- 12p35 and (I) IL-27p28 were quantified, relative to HPRT, using qPCR. Data represents mean ± SEM from 3 independent experiments, * p ≤ 0.05, ** p < 0.01, *** p ≤ 0.001, **** p ≤ 0.0001 as compared to unstimulated controls (two-way ANOVA, followed by Tukey’s test).

IRF6 expression and TLR responses in epithelial cell populations

Figure 3.5. T24 cells respond to poly(IC), but do not induce IL-23p19 mRNA expression upon poly(IC) stimulation. T24 cells were stimulated with various TLR ligands (concentrations used were identical to that used in Figure 3.2). Total RNA was collected at indicated timepoints and mRNA levels of potential IRF6 target genes (A) IL-8, (B) IFN-β, (C) CCL5, (D) CCL20, (E) IL- 23p19, (F) EBI3, (G) IL-12p40, (H) IL-12p35 and (I) IL-27p28 were quantified, relative to HPRT, using qPCR. Data represents mean ± SEM from 3 independent experiments, ** p < 0.01, *** p ≤ 0.001, **** p ≤ 0.0001 as compared to unstimulated controls (two-way ANOVA, followed by Tukey’s test).

IRF6 expression and TLR responses in epithelial cell populations 3.2.6 Confirmation of activity of TLR agonists on RAW-ELAM cells For the three cell types examined, poly(IC) triggered robust responses, whereas, in some of the cell types, very weak responses for some genes were also apparent when flagellin, LPS or CpG DNA were used as stimuli. To ensure that the other TLR agonists (Pam3Cys, zymosan) were indeed active at the concentrations used, the effects of these PAMPs were examined using a control cell line. Since RAW-ELAM cells respond to activation signals with NF-B-dependent expression of green fluorescent protein (GFP) (Stacey, Young et al. 2003), these cells provide a convenient read- out for screening TLR agonist activity. Hence, RAW-ELAM cells were stimulated with Pam3Cys or zymosan, as well as LPS as a positive control, and inducible GFP expression was monitored using flow cytometry analysis. All three stimuli upregulated GFP expression in these cells (Figure 3.6A-D). This therefore confirms that both Pam3Cys and zymosan were active at the concentrations used in the epithelial cell experiments. Overall, these data imply that poly(IC) was the only stimulus triggering robust regulated gene expression in human keratinocytes.

Figure 3.6. Zymosan, Pam3Cys and LPS were active on RAW-ELAM cells. RAW-ELAM cells were stimulated with zymosan (100 μg/ml), Pam3Cys (15 ng/ml) or LPS (100 ng/ml), or were left unstimulated for 8 h. Mean fluorescence intensity of GFP was analysed using flow cytometry. Unstimulated control cells were gated in order to determine % cells responding to a particular stimulus. The red histogram (A-C) shows untreated cells and the blue overlay shows (A) zymosan, (B) Pam3Cys or (C) LPS stimulated cells. (D) Data represents the mean fluorescence intensity of unstimulated and stimulated cells. Data was collected from > 5000 events for each sample and represents a single experiment.

IRF6 expression and TLR responses in epithelial cell populations 3.2.7 IRF6 expression during keratinocyte differentiation In contrast to my findings, some studies have reported that certain MyD88-triggering TLR agonists do activate keratinocytes, with IL-8 secretion being observed (Pivarcsi, Bodai et al. 2003, Kollisch, Kalali et al. 2005, Lebre, van der Aar et al. 2007, Miller and Modlin 2007, Niebuhr, Baumert et al. 2010). It was therefore considered that cellular differentiation status could be an important variable modifying TLR responsiveness. Furthermore, IRF6 is known to play a critical role in keratinocyte differentiation (Richardson, Dixon et al. 2006, Restivo, Nguyen et al. 2011, Biggs, Rhea et al. 2012), and so it is possible that the role(s) of IRF6 in TLR responses is impacted by the differentiation state. Therefore, this variable was next examined. IRF6 expression was first examined in proliferating and differentiated primary keratinocytes. The Rho-kinase inhibitor, Y27632, has been shown to increase keratinocyte proliferation and prevent cells from terminally differentiating (Terunuma, Limgala et al. 2010). Therefore, Y27632 was included in primary keratinocyte cultures to maintain them in an undifferentiated state. It is well established in the literature that Ca2+ influx into keratinocytes promotes differentiation, for example by promoting phospholipase C–γ1-mediated transcription of keratinocyte differentiation markers such as involucrin (IVL) (Hennings, Holbrook et al. 1980, Hennings, Michael et al. 1980, Boyce and Ham 1983, Watt 1983, Shipley and Pittelkow 1987, Ng, Su et al. 1996). Hence, extracellular Ca2+ was used to trigger keratinocyte differentiation.

2+ Keratinocytes were cultured in media containing Y27632 (5 μM) or Ca (2 mM CaCl2), or were left untreated for 24 h. RNA was harvested and qPCR was performed to measure gene expression of IRF6. IVL, which is a known marker for keratinocyte differentiation (Watt 1983, Murphy, Flynn et al. 1984), was used as a control gene to monitor the differentiation of the cells. IRF6 mRNA expression was found to be significantly higher in Ca2+-treated keratinocytes when compared to Y27632-treated or untreated keratinocytes (Figure 3.7A). As expected, IVL mRNA expression was high in Ca2+ treated cells, as compared to Y27632 or untreated cells (Figure 3.7B). Hence, IRF6 mRNA expression was higher in differentiated cells when compared to proliferating cells, as anticipated. To determine whether this effect was also apparent at the protein level, IRF6 protein levels were examined in undifferentiated and differentiated keratinocytes using western blotting. Consistent with the gene expression data, IRF6 protein was high in differentiated cells when compared to proliferating cells, which expressed low levels of IRF6 protein (Figure 3.7C). IRF6 expression was also detected in untreated cells, however the level of expression was less when compared to the differentiated cells.

IRF6 expression and TLR responses in epithelial cell populations

Figure 3.7. IRF6 expression in primary keratinocytes during differentiation. Levels of (A) IRF6 and (B) IVL mRNAs (relative to HPRT) in proliferating (Y27632-treated; 5 µM for 24 h) and differentiated (Ca2+-treated; 2 mM for 24 h) primary keratinocytes were determined by qPCR. Data represents mean ± SEM of 3 independent experiments, * p < 0.05, ** p < 0.01 (compared to untreated control) (one-way ANOVA, followed by Tukey’s test). (C) Whole cell lysates from proliferating and differentiated keratinocytes were subjected to SDS PAGE, and immunoblotting for IRF6 and GAPDH was performed. Data are representative of 3 independent experiments.

3.2.8 Differentiation status of primary human keratinocytes does not affect TLR mRNA expression As expected, IRF6 mRNA and protein expression was regulated during keratinocyte differentiation. I next used qPCR to determine whether mRNA expression of any of the TLRs was similarly regulated. Figure 3.8 shows that TLR expression was comparable across all three cell populations examined. This indicates that any differences that may exist in the ability of these cells to respond to TLR agonists is unlikely to result from regulated TLR expression. In contrast, differential IRF6 expression does have the potential to influence TLR responsiveness.

IRF6 expression and TLR responses in epithelial cell populations

Figure 3.8. TLR mRNA expression is not regulated during primary human keratinocyte differentiation. mRNA levels of TLR1 – TLR10 (relative to HPRT) in proliferating (Y27632- treated; 5 µM for 24 h) and differentiated (Ca2+-treated; 2 mM for 24 h) were assessed by qPCR. Data represents mean ± range of 2 independent experiments.

IRF6 expression and TLR responses in epithelial cell populations 3.2.9 Differentiation status of primary human keratinocytes does not greatly influence poly(IC)-responsiveness To determine if keratinocyte differentiation affects responses to the TLR3 agonist poly(IC), inducible IL-8 production from undifferentiated and differentiated cells was measured by ELISA. As previously observed (Figure 3.2), poly(IC) strongly upregulated IL-8 production from these cells, with a maximal response observed at 24 hours post-stimulation. However, there was no significant difference observed in the levels of IL-8 secreted in undifferentiated versus differentiated cells, although differentiated cells showed marginally higher IL-8 levels (Figure 3.9). This suggests that, at least for IL-8 release, differentiation status of keratinocytes does not influence poly(IC)/TLR3 responsiveness. In similar experiments, the effects of differentiation status on MyD88-dependent responses were also assessed (see Chapter 5.2.3).

Figure 3.9. Differentiation status does not affect poly(IC)-inducible IL-8 production from primary keratinocytes. IL-8 chemokine levels released from proliferating (Y27632-treated; 5 µM for 24 h) and differentiated (Ca2+-treated; 2 mM for 24 h) primary keratinocytes stimulated with poly(IC) (30 μg/ml) were quantified using ELISA. Data represents mean ± SEM of 3 independent experiments.

3.3 Summary and discussion of Chapter 3

3.3.1 IRF6 expression is enriched in keratinocytes In humans, IRF6 expression has been reported in oral, epidermal and mammary epithelial cells (Zucchero, Cooper et al. 2003, Zucchero, Cooper et al. 2004, Bailey, Margaryan et al. 2009, Richardson, Dixon et al. 2009, Botti, Spallone et al. 2011, Restivo, Nguyen et al. 2011). However, a detailed expression analysis of IRF6 mRNA and protein in a panel of epithelial cells had not previously been performed. This analysis was undertaken because of the diversity of anatomical locations and functions of epithelial tissues. The finding that IRF6 was expressed at particularly elevated levels in keratinocytes is consistent with findings from mouse models (Ingraham, Kinoshita et al. 2006, Richardson, Dixon et al. 2006), as well as phenotypic effects of IRF6 63

IRF6 expression and TLR responses in epithelial cell populations deficiency in humans (Kondo, Schutte et al. 2002, Botti, Spallone et al. 2011, Restivo, Nguyen et al. 2011). Consistent with prior expectation, IRF3 mRNA was ubiquitously expressed in all cell types examined, whilst IRF8 mRNA was largely restricted to myeloid cells (THP-1 and PMA- differentiated THP-1). The low level of IRF8 mRNA expression in AGS, CaCo-2 and T84 stomach/colon epithelial cells is consistent with its reported constitutive expression in human colon carcinoma cells (Yang, Thangaraju et al. 2007, McGough, Yang et al. 2008).

One interesting observation from this analysis was that IRF6 mRNA expression did not always track with IRF6 protein expression. Although primary keratinocytes and HaCaT cells both expressed high levels of this transcription factor at the mRNA and protein level, T24 and CaCo-2 cells expressed IRF6 mRNA, whereas protein expression was not detectable by immunoblotting. Previous studies have shown that loss of IRF6 expression results in more invasive and progressive SCCs (Botti, Spallone et al. 2011). Cell proliferation leads to IRF6 phosphorylation, and subsequently to cause its proteosomal degradation (Bailey, Abbott et al. 2008), which may contribute to the loss of IRF6 expression in progressive tumours (Botti, Spallone et al. 2011). Hence, it is conceivable that loss of IRF6 protein expression may contribute to transformation and/or metastatic potential of other epithelial cancer cells, such as T24 and/or CaCo-2 cells.

3.3.2 Human keratinocytes are responsive to the TLR3 agonist poly(IC) Since human keratinocytes were shown to express high levels of IRF6, these cells were used as a system to investigate possible IRF6 functions in TLR responses. HaCaT are a spontaneously immortalised human adult skin cells that has characteristics of normal basal keratinocytes (Boukamp, Petrussevska et al. 1988). Thus, they are widely used as a cell line model of keratinocytes (Schurer, Kohne et al. 1993, Lehmann 1997, Altenburger and Kissel 1999, Boukamp 2005, Deyrieux and Wilson 2007, Wiegand, Abel et al. 2009, Ridd, Dhir et al. 2010, Magcwebeba, Riedel et al. 2012, McNeilly, Woods et al. 2012), and were also used in my experiments in addition to primary keratinocytes. Initial characterization showed that both primary keratinocytes and HaCaT cells were primarily responsive to the TLR3 agonist poly(IC); IFN-β, IL-23p19, IL-8, CCL5 and CCL20 mRNAs were all robustly up-regulated. As previously noted, several studies have demonstrated that the cytoplasmic RNA sensors RIG-I and MDA-5 also respond to intracellular poly(IC) (Kato, Takeuchi et al. 2008). However, since extracellular poly(IC) was added to cells, rather than being transfected in, it is unlikely that these receptors are responsible for the effects observed in this study. Nonetheless, future experiments should carefully address the requirement for TLR3 versus the cytoplasmic RNA sensors in mediating poly(IC)-inducible gene expression in keratinocytes.

IRF6 expression and TLR responses in epithelial cell populations A limited number of previous studies have examined TLR responsiveness in human keratinocytes. Keratinocytes have been shown to produce IL-8 upon poly(IC), Pam3Cys, flagellin, zymosan, LPS and CpG-DNA stimulation (Kollisch, Kalali et al. 2005, Lebre, van der Aar et al. 2007, Miller and Modlin 2007). Kollisch et al compared the responses of both primary keratinocytes and HaCaT to various TLR ligands and found that these cells responded to the TLR3 ligand poly(IC), the TLR1/2 ligand Pam3Cys and the TLR5 ligand flagellin with inducible IL-8 production (Kollisch, Kalali et al. 2005). Several other studies have looked at responses of different TLR ligands in keratinocytes. TLR5 ligand flagellin stimulation induced TNF-α, TSLP and β-defensins 2 and 3 expression in primary keratinocytes (Baker, Ovigne et al. 2003, Miller, Sorensen et al. 2005, Lebre, van der Aar et al. 2007, Le, Takai et al. 2011, Xie, Takai et al. 2012), while in my experiments it was mostly inactive. TLR2 activation, by LTA or PGN, activated NF-κB dependent IL-8 and inducible nitric oxide synthase (Pivarcsi, Bodai et al. 2003). Pam3Cys (TLR1/2 ligand) stimulation induced the secretion of CCL20, CCL2, matrix metallopeptidase 9 and IL-8 in primary kerationocytes (Niebuhr, Baumert et al. 2010). Primary keratinocytes and HaCaT cells were also shown to be responsive to TLR2/Dectin 1 ligand zymosan by inducing IL-8 and CCL20 production (Pivarcsi, Koreck et al. 2004). The TLR4 ligand LPS has also been shown to activate keratinocytes to release pro- inflammatory cytokines like IL-8, IL-1α, IL-1β, TNF-α, CCL2 and CCL20, and to upregulate expression of intercellular adhesion molecule 1 (Song, Park et al. 2002, Kollisch, Kalali et al. 2005, Lebre, van der Aar et al. 2007). Stimulation of keratinocytes with CpG DNA also induced IL-8, CCL2, CCL20, CXCL9 and CXCL10 (Kollisch, Kalali et al. 2005, Miller, Sorensen et al. 2005, Lebre, van der Aar et al. 2007). In summary, various studies have reported that keratinocytes were responsive to many MyD88-dependent TLR agonists.

However, most of these agonists did not have any pronounced effects on expression of any genes in keratinocytes in my experiments. Although the activities of these TLR agonists were confirmed in another cell-based assay (RAW-ELAM cells), it is possible that macrophages have enhanced sensitivity to these stimuli as compared to keratinocytes. Thus, it would have been useful to examine keratinocyte responses across concentration ranges for various TLR ligands, including Pam3Cys and zymosan. The outputs examined in these studies (IFN-, IL-12 family members, specific chemokines) largely reflected the focus on the identification of potential IRF6 target genes. Thus, it is possible that keratinocytes do respond to some of the other TLR ligands examined, but with different genes responding. This would seem unlikely given that some of the genes (e.g. IL-8, CCL20) are generically upregulated by most TLR agonists; nonetheless, this possibility cannot be formally excluded.

IRF6 expression and TLR responses in epithelial cell populations Some differences in responses of primary keratinocytes versus HaCaT cells were noted. Primary keratinocytes showed the most pronounced upregulation of IL-8, CCL5, IL-23p19 and EBI3 mRNAs at 24 hours post stimulation, whereas in HaCaT cells maximal responses occurred at 8 hours post-stimulation (with the exception of EBI3). Primary keratinocytes also showed a delayed upregulation of IL-12p35 at 24 hours, whilst this response was not observed in HaCaT cells. However, both cell populations showed robust upregulation of IFN-β at 4 hours post-stimulation. Interestingly, certain differences in primary keratinocytes and HaCaT cell responses to TLR ligands have been reported previously. The levels of poly(IC)-inducible IL-8 and CCL20 were found to be much higher in primary keratinocytes, when compared to HaCaT cells (Olaru and Jensen 2010). Primary keratinocytes and HaCaT cells also respond differently to various stress signals and microbial agents (Bari, Bacsa et al. 2011). Ultraviolet (UV) radiation induced stress caused robust upregulation of TNF-α production in primary keratinocytes, while it was very mildly produced by HaCaT cells (Bari, Bacsa et al. 2011, Muthusamy and Piva 2013). In contrary, UV-exposure and IL-1α treatment in conjunction, showed a greater increase in TNF-α production in HaCaT cells, while only modestly having an effect on primary keratinocytes (Muthusamy and Piva 2013). Nonetheless, in general TLR responsiveness was quite similar between these two cell populations. Since T24 cells did not express detectable IRF6 protein, TLR responsiveness was examined in these cells to screen for possible differences that might be attributable to this transcription factor. T24 cell TLR responses were actually quite similar to keratinocytes; these cells also primarily responded to poly(IC) with upregulation of IL-8, IFN-β and IL-12p35 mRNAs. In contrast, poly(IC) did not upregulate IL-23p19 mRNA expression in these cells, in contrast to the findings with keratinocytes. Hence, the possible involvement of IRF6 in regulating poly(IC)-inducible expression of this gene was subsequently investigated (Chapter 4).

Interestingly, poly(IC) selectively regulated IL-23p19 and EBI3 mRNAs in keratinocytes, without any pronounced effect on other IL-12 family members (IL-12p35 was the only family member regulated, but the effect was very modest by comparison). The IL-12 family of cytokines have α and β sub-units that heterodimerize to form functional cytokines (Gee, Guzzo et al. 2009). Although IL-23p19 and EBI3 are α and β sub-units of this family, they have not previously been reported to form a functional heterodimer. Previously, EBI3 and IL-27p28 heterodimer, IL-27, were found to be co-expressed in macrophages and macrophage derived cells of granulomas (Larousserie, Pflanz et al. 2004), and subsequently studies identified it to have an immunosuppressive function in T cell activation (Stumhofer and Hunter 2008). Therefore, it is possible that IL-23p19 and EBI3, being induced in keratinocytes simultaneously, forms a functional heterodimer, and this is discussed further in Chapter 4 and Chapter 6. One previous study in IEC, using both in vivo and in vitro

IRF6 expression and TLR responses in epithelial cell populations systems, showed that pro-inflammatory mediators like IL-1α or TNF-α up-regulated the expression of IL-12p35, IL-23p19 and EBI3 (Maaser, Egan et al. 2004). EBI3 forms a non-covalently bound heterodimer with IL-12p35, however, the function of this cytokine is not well-characterized. This study also showed the IL-12p35 and EBI3 mRNA induction were not co-ordinately regulated, suggesting that IL-35 may not be the primary cytokine of the IL-12 family secreted by these cells (Maaser, Egan et al. 2004). However, they also found the IL-23p19 is secreted by these cells and its regulation paralleled that of EBI3 (Maaser, Egan et al. 2004). IL-23p19 expression, in the absence of IL-12p40, was also expressed in TNF-α activated endothelial cells, certain Th1- and Th2- polarised T cells and also in rheumatoid arthritis synovial fibroblasts (Brentano, Ospelt et al. 2009). This is in line with what I found in keratinocytes, where IL-23p19 and EBI3 were robustly upregulated in response to poly(IC), whilst IL-12p35 was modestly upregulated when compared to the other two family members.

3.3.3 The differentiation status of keratinocytes does not affect TLR3 responsiveness A previous study in HaCaT cells showed that TLR2 and TLR4 mRNA was upregulated during keratinocyte differentiation (Pivarcsi, Koreck et al. 2004). Cell surface expression of TLR2 and TLR4 also increased. Another study showed that differentiation of keratinocytes permitted inducible expression of beta-defensin 2 and 3 in response to Staphylococcus epidermidis (Lai, Cogen et al. 2010). Finally, the keratinocyte growth and differentiation factor TGF-α upregulated the expression of TLR5 and TLR9 in primary keratinocytes, and enhanced the production of IL-8 and beta-defensins in response to agonists of these receptors (Miller, Sorensen et al. 2005). Although I observed that IRF6 was upregulated during primary human keratinocyte differentiation, which is consistent with previous studies (Richardson, Dixon et al. 2006), I did not observe any effect of differentiation on TLR1-10 mRNA expression or responsiveness to poly(IC). This result contradicts the previous study in HaCaT cells that reported differences in TLR2 and TLR4 mRNA levels between undifferentiated and differentiated keratinocytes (Pivarcsi, Koreck et al. 2004). This may be because HaCaT cell lines are immortalized keratinocytes obtained from adult skin, whilst the differentiation studies in this chapter were performed using primary keratinocytes from neonatal skin. A previous study comparing foetal, neonatal and adult skin did reveal significant differences in TLR expression and responsiveness, with elevated TLR mRNA in neonatal keratinocytes as compared to those from adult skin (Iram, Mildner et al. 2012). This could therefore be one factor to consider, however, basal cells in both foetal and adult skin were reported to have similar expression of the TLRs. Given that I only examined expression of TLRs at the mRNA level, as well as poly(IC)-regulated IL-8 production, my data cannot discount the possibility that keratinocyte differentiation does impact certain TLR responses; this was further investigated within Chapter 5.

IRF6 expression and TLR responses in epithelial cell populations In the next chapter (Chapter 4), I pursued the possible involvement of IRF6 in regulating expression of TLR3-target genes, particularly IL-23p19.

IRF6 involvement in poly(IC)-regulated gene expression in keratinocytes

4 IRF6 involvement in poly(IC)-regulated gene expression in keratinocytes

IRF6 involvement in poly(IC)-regulated gene expression in keratinocytes 4.1 Introduction In the previous chapter (Chapter 3), I demonstrated that human keratinocytes express high levels of IRF6 and primarily respond to the TLR3 agonist poly(IC). In the TLR3 pathway, TRIF interacts directly with the TIR domain of TLR3 and mediates signalling (Yamamoto, Sato et al. 2003). Upon activation, the TRIF pathway leads to the activation of the serine/threonine kinase TBK-1, which in turn phosphorylates the transcription factor IRF3 (Fitzgerald, McWhirter et al. 2003, Fitzgerald, Rowe et al. 2003, Oshiumi, Matsumoto et al. 2003, Sato, Sugiyama et al. 2003). Activation of IRF3 induces production of type I IFN (Au, Moore et al. 1995, Schafer, Lin et al. 1998). IFN-β, in particular, signals in an autocrine fashion to activate the transcription factors STAT1 and STAT2, which leads to activation of type I IFN target genes (Li, Leung et al. 1996, Su and David 2000). Type I IFN target genes mediate anti-viral responses, which are typically required for responses to pathogens activating TLR3 (Doyle, Vaidya et al. 2002, Doyle, O'Connell et al. 2003). Hence, IRF3 mediates essential gene expression programs for host defence against pathogens. TRIF signalling is also able to activate NF-κB via TRAF6 (Jiang, Mak et al. 2004, Cusson-Hermance, Khurana et al. 2005, Sasai, Oshiumi et al. 2005). The C-terminal domain of TRIF contains a receptor-interacting protein homotypic interaction motif. This motif is essential for interactions between TRIF and RIP1 (Meylan, Burns et al. 2004, Kaiser and Offermann 2005). The RIP family is involved in NF-κB activation and in the absence of RIP1, TLR3- and TLR4-mediated NF-κB activation is impaired (Meylan, Burns et al. 2004). RIP1 undergoes K63-linked polyubiquitination and interacts with TRAF6 and TAK1, which results in NF-κB signalling (Ea, Deng et al. 2006, Li, Kobayashi et al. 2006). Although IRF3 is the primary transcription factor driving IFN-β responses in TLR3 signalling, other IRFs such as IRF1, IRF5 and IRF7 have also been shown to activate IFN-β and other IRF target genes (Barnes, Richards et al. 2004, Honda, Yanai et al. 2004, Kawai, Sato et al. 2004, Honda, Ohba et al. 2005, Schoenemeyer, Barnes et al. 2005, Takaoka, Yanai et al. 2005). Importantly, NF-κB co-operates with IRF3 and IRF7 to enhance type I IFN production and antiviral responses (Maniatis, Falvo et al. 1998, Wathelet, Lin et al. 1998, Fitzgerald, Rowe et al. 2003).

IRFs also regulate transcription of some chemokines and the members of the IL-12 family of cytokines (as discussed in Chapter 1) (Honda and Taniguchi 2006). IL-12 family sub-units heterodimerize to form functional cytokines, and these play key roles in skewing adaptive immune responses (Trinchieri 2003, Vignali and Kuchroo 2012). In this chapter, I investigated the role of IRF6 in TLR3 signalling. Particular emphasis was placed on IFN-β as a target gene, given that it is a well-characterized target gene for many IRFs. Since circumstantial evidence in Chapter 3 pointed to a potential role for IRF6 in regulating poly(IC)-inducible IL-23p19 expression, this gene was also a focus of the studies described within.

IRF6 involvement in poly(IC)-regulated gene expression in keratinocytes 4.2 Results

4.2.1 IRF6 activates the IFN-β promoter In the previous chapter, it was established that keratinocytes express high levels of IRF6, that these cells were robustly responsive to the TLR3 ligand, poly(IC), and that this stimulus strongly upregulated IFN-β expression. Since other IRFs are known to activate the IFN-β promoter, the effect of IRF6 on activity of this promoter was initially examined. The PREs of the IFN-β promoter (GAGAAGTGAAAGT) contain well-characterized IRF binding sites (Schafer, Lin et al. 1998, Merika and Thanos 2001, Escalante, Nistal-Villan et al. 2007). Figure 4.1A shows a schematic representation of the IFN-β promoter, including the PREs.

HEK293 cells, which did not express IRF6 mRNA or protein (Figure 3.1A and C), were used to examine regulation of the human IFN-β promoter by IRF6. pGL2C, which contains the SV-40 promoter driving luciferase expression, was used as a specificity control. Cells were also co- transfected with a SV-40 driven Renilla plasmid to normalize transfection efficiency between samples. Co-transfection experiments showed that IRF6 activated the IFN-β promoter in a dose- dependent manner. The maximal amount of IRF6 expression plasmid used increased luciferase activity ~30 fold (Figure 4.1B). The effect was selective, since IRF6 co-transfection did not increase the activity of the pGL2C promoter.

4.2.2 IRF6 expression enhances poly(IC)-mediated IFN-β promoter activity In keratinocytes, the TLR3 ligand Poly(IC) strongly upregulated IFN-β mRNA expression (Figures 3.3B and 3.4B). Therefore, the effect of poly(IC) and IRF6 on IFN-β promoter activity was examined in HEK293 cells ectopically expressing TLR3 (Matsumoto, Kikkawa et al. 2002). In HEK293-TLR3 cells, Poly(IC) strongly activated the IFN-β promoter (~30 fold), and this response was further enhanced (~75 fold) in cells co-transfected with IRF6 (Figure 4.2A and B), however, this increase was not statistically significant for the sample size. As expected, poly(IC) did not activate the IFN-β promoter in parental HEK-293 cells. These data imply that IRF6 may contribute to TLR3-mediated activation of IFN-β expression in keratinocytes. Somewhat surprisingly, IRF6 alone had a more modest effect in activating the IFN-β promoter in HEK293-TLR3 (~3 fold), as compared to the effect observed in HEK293 cells (~5 fold) within the same experiments.

IRF6 involvement in poly(IC)-regulated gene expression in keratinocytes

Figure 4.1. IRF6 activates the IFN-β promoter in HEK293 cells. (A) Schematic representation of the human IFN- promoter, with key regulatory elements indicated. The IFN-β promoter contains four PREs: PREI, PRE II, PRE III and PRE IV. IRF3 or IRF7 bind to PRE I and III regions of the promoter (Munshi, Yie et al. 1999). (B) HEK293 cells were transfected with 100 ng pGL2C or IFN--luc, as well as the indicated amounts of IRF6 expression plasmid. The total DNA concentration was kept constant in each transfection by making up all transfections to a total of 2 µg with empty vector, and 10 ng Renilla-luciferase vector was included to control for transfection efficiency. After 24 h, lysates were prepared, and luciferase activity, relative to the internal Renilla luciferase reporter control, was quantified. Data represents mean ± SD of 3 independent experiments, **** p < 0.0001 (compared to IFN-β promoter alone) (one-way ANOVA, followed by Tukey’s test).

IRF6 involvement in poly(IC)-regulated gene expression in keratinocytes

Figure 4.2. IRF6 expression enhances poly(IC)-mediated activation of the IFN-β promoter activity. HEK293 or HEK293-TLR3 cells were transfected with 100 ng IFN--luc, and 200 ng of IRF6 expression plasmid. The total DNA concentration was kept constant in each transfection by making up all transfections to a total of 2 µg with empty vector, and 10 ng Renilla-luciferase vector was included to control for transfection efficiency. After 24 h, cells were stimulated with poly(IC) (30 µg/ml) for 8 h. Lysates were prepared, and luciferase activity, relative to the internal Renilla luciferase reporter control, was quantified. Data in (A) is presented relative to poly(IC)-treated cells and represents mean ± SEM of 3 independent experiments. Data in (B) is a representative experiment showing raw data, and represents mean ± range of experimental replicates.

IRF6 involvement in poly(IC)-regulated gene expression in keratinocytes 4.2.3 IRF6 knockdown selectively impairs TLR3-induced IL-23p19 expression in primary keratinocytes Although the above transient transfection analysis suggests a role for IRF6 in poly(IC)-inducible IFN-β mRNA expression, such approaches are highly artificial. Therefore, more direct evidence was sought. For this purpose, siRNA-mediated gene silencing was employed. Since keratinocytes also express IRF3, and IRF3 drives TLR3-inducible IFN-β in many cell types (Doyle, Vaidya et al. 2002, Sato, Sugiyama et al. 2003, Sasai, Matsumoto et al. 2006), IRF3 expression was also silenced in these cells. IRF6 knock-down reduced basal IRF6 mRNA (Figure 4.3A) and protein expression (Figure 4.3B), whilst IRF3 knock-down reduced basal IRF3 mRNA expression (Figure 4.3C). In contrast to the conclusions reached from promoter-reporter analysis, silencing of IRF6 expression in primary human keratinocytes did not reduce poly(IC)-inducible IFN-β expression. In fact, there was a trend for increased expression. However, knock-down of IRF3 diminished this response substantially (Figure 4.3D). Knockdown of IRF6, but not IRF3, in these cells resulted in a 2-fold reduction in poly(IC)-inducible IL-23p19 mRNA expression in these cells (Figure 4.3E). This effect was confirmed using two different siRNAs against IRF6 (Figure 4.4A-D). In contrast, IRF6 knockdown had no selective effect, as compared to IRF3 knockdown, on inducible EBI3, CCL5, IL- 8 or CCL20 mRNA levels, although there was a trend for reduced CCL20 mRNA expression (Figure 4.3F-H and J). Finally, treatment with poly(IC) modestly increased (~ 2 fold) IRF6 mRNA expression itself, and this response was also reduced by the IRF6 siRNA (Figure 4.3I), as would be predicted. Collectively, these data indicate that IRF3 drives poly(IC)-inducible IFN-β expression in human keratinocytes, and suggest that IRF6 may actually act as a negative regulator of this response. In contrast, IRF6 specifically promotes poly(IC)-inducible IL-23p19 mRNA expression, thus implicating this transcription factor in a sub-set of TLR3 responses in keratinocytes.

IRF6 involvement in poly(IC)-regulated gene expression in keratinocytes

Figure 4.3. IRF6 knockdown selectively impairs TLR3-inducible IL-23p19 mRNA expression in primary keratinocytes. IRF6 and IRF3 expression in primary human keratinocytes were knocked down by reverse transfection using siRNA (200 pM). After 72 h, cells were stimulated with poly(IC) (30 µg/ml) for 4 h or were left unstimulated, after which total cellular RNA and whole cell lysates were generated. Basal levels of IRF6 mRNA (A) and IRF6 protein (B), as well as (C) IRF3 mRNA were determined by qPCR or immunoblotting. Poly(IC)-inducible levels of mRNAs for (D) IFN-β, (E) IL-23p19, (F) EBI3, (G) CCL5, (H) CCL20, (I) IRF6 and (J) IL-8 were quantified by qPCR. mRNA levels were quantified relative to HPRT and GAPDH was used as a protein loading control to ensure equal loading. Data represents mean ± SEM from 3 independent experiments, * p < 0.05 as compared to other siRNA-treated cells (two-way ANOVA, followed by Tukey’s test). For (D) to (I), data are displayed relative to the poly(IC)-stimulated control. Immunoblotting data in (B) is representative of 2 independent experiments. 75

IRF6 involvement in poly(IC)-regulated gene expression in keratinocytes

Figure 4.4. Effects of IRF6 knock-down on inducible gene expression in human keratinocytes are apparent with independent siRNAs. IRF6 expression in primary human keratinocytes was knocked down by reverse transfection using two different siRNAs (200 pM). After 72 h, cells were stimulated with poly(IC) (30 µg/ml) for 4 h or were left unstimulated. Total RNA was collected and basal mRNA expression of (A) IRF6 and (B) IRF3, as well as inducible mRNA expression of (C) IFN-β and (D) IL-23p19 was quantified, relative to HPRT, by qPCR. Data represents mean ± SD of experimental triplicates and is representative of 2 independent experiments.

4.2.4 IRF6 over-expression in T24 cells enhances poly(IC)-inducible IL-23p19 expression Since gene silencing with independent IRF6 siRNAs identified IL-23p19 as a likely IRF6 target gene in TLR3 signalling, further experimental evidence to support this conclusion was sought. Thus, IRF6 was over-expressed in T24 (bladder epithelial) cells, since these cells do not express IRF6 protein and did not upregulate IL-23p19 mRNA in response to poly(IC) (Figures 3.1C and 3.5E). As expected, ectopic expression of IRF6 resulted in elevated expression of IRF6 mRNA (Figure 4.5A). Poly(IC) treatment further enhanced IRF6 mRNA levels in cells transfected with the IRF6 expression plasmid (Figure 4.5A), consistent with the previously observed upregulation of 76

IRF6 involvement in poly(IC)-regulated gene expression in keratinocytes IRF6 by poly(IC) in keratinocytes (Figure 4.3I). Whereas ectopic expression of IRF6 did not affect poly(IC)-inducible IFN-β mRNA expression (Figure 4.5B), inducible IL-23p19 mRNA expression was increased ~ 2 fold (Figure 4.5C), Poly(IC) induced IRF6 expression was also increased in cells overexpressing IRF6. Interestingly, T24 cells transfected with empty vector did respond to poly(IC) with inducible IL-23p19 mRNA expression (~ 20 fold), which is in contrast to findings with untransfected T24 cells (Figure 3.5E). It is possible that transfection alone somehow affects T24 cell function to permit an inducible IL-23p19 response. Collectively, these data support the conclusion that IL-23p19 is a target gene of IRF6 in TLR3 signalling.

Figure 4.5. IRF6 over-expression in T24 cells confers poly(IC)-inducible IL-23p19 mRNA expression. T24 cells were transfected with either an IRF6 expression plasmid (200 ng) or an empty vector control (200 ng). After 24 h, cells were stimulated for 24 h with poly(IC) (30 µg/ml) or were left unstimulated. mRNA levels of (A) IRF6, (B) IFN-β and (C) IL-23p19 were quantified, relative to HPRT, using qPCR. Data (relative to vector control) represents mean ± range of two independent experiments.

4.2.5 IRF6 enhances IL-23p19 promoter activity upon poly(IC) stimulation Both gene silencing and overexpression approaches suggested that IRF6 contributes to poly(IC)- inducible transcription of IL-23p19. To determine whether IRF6 can activate the human IL-23p19 promoter, gene reporter assays were performed. Figure 4.6A shows a schematic representation of the IL-23p19 promoter highlighting the candidate IRF6 binding sites (ISREs). The human IL-23p19 promoter region containing the potential IRF binding sites was cloned into a luciferase reporter vector. In brief, -815 bp to +1 bp (transcription start site) region of the promoter was amplified from human genomic DNA using primers with flanking restriction sites and cloned into XmaI and HindIII cut pGL2-B vector. 77

IRF6 involvement in poly(IC)-regulated gene expression in keratinocytes Initially, HEK293-TLR3 cells, which did not express IRF6 mRNA or protein (Figure 3.1A and C), were transfected with the IL-23p19 promoter-luciferase reporter construct with or without an IRF6 expression plasmid. An SV40 promoter-luciferase construct (pGL2C) was used as a control. Cells were also transfected with an SV40 promoter driven Renilla vector to normalize transfection efficiency. The IL-23p19 promoter was highly active in HEK293-TLR3 cells (~ 10 fold greater luciferase activity than pGL2C, itself a very strong promoter) (Figure 4.6B). However, overexpression of IRF6 did not further affect the activity of the IL-23p19 promoter. Moreover, treatment with poly(IC) did not increase the activity of the IL-23p19 promoter; in fact, poly(IC) reduced the activity of the promoter in cells that had been co-transfected with an IRF6 expression plasmid.

Figure 4.6. IRF6 enhances poly(IC)-inducible activity of the IL-23p19 promoter in RAW264.7 cells. (A) Schematic representation of the human IL-23p19 promoter, with key regulatory elements indicated. The IL-23p19 promoter contains a putative IRF3 and IRF7 binding site containing the ISRE sequence (Al-Salleeh and Petro 2008). (B) HEK293-TLR3 cells were transfected with 100 ng pGL2C or IL-23p19-luc, as well as 200 ng of IRF6 expression plasmid. Total DNA concentrations were kept constant by making up all transfections to a total of 2 µg with empty vector, and 10 ng Renilla-luciferase vector was included to control for transfection efficiency. After 24 h, cells were stimulated with poly(IC) for 8 h. Lysates were prepared, and luciferase activity, relative to the internal Renilla luciferase reporter control, was quantified. Data represents mean ± range of experimental replicates from a single experiment. (C) RAW264.7 cell-lines were transfected with 5 μg pGL2C or IL-23p19-luc and 5 μg IRF6 plasmid or empty vector for 21 h, and then stimulated with poly(IC) for 8 h. Lysates were prepared and luciferase activity was quantified, relative to total proteins. Data represents mean ± range of two independent experiments. 78

IRF6 involvement in poly(IC)-regulated gene expression in keratinocytes The very high constitutive activity of this promoter in HEK293-TLR3 cells is inconsistent with the very low basal expression of the IL-23p19 gene in the same cells. This suggested that there may be some transcription factor in HEK293 cells driving high levels of luciferase expression in the context of transiently transfected plasmid, which would likely mask any effect of IRF6 in promoting poly(IC)-inducible IL-23p19 promoter expression. For this reason, an alternative cellular system was sought; the RAW264.7 mouse macrophage-like cell-line was thus used as a non-epithelial cell line. These cells were chosen because they are easily transfectable, and being a macrophage-like cell they respond to a range of TLR ligands. Similar experiments were performed using RAW264.7 cells; the IL-23p19 or pGL2C promoter reporter constructs were transfected with or without IRF6 and were subsequently stimulated with poly(IC). Again, the IL-23p19 promoter was active in these cells, but in this case, the activity was comparable to that observed with pGL2C (Figure 4.6C). IRF6 co-transfection did not affect the basal activity of the IL-23p19 promoter, however, the poly(IC) response was enhanced in cells transfected with IRF6 (~ 6 fold), as compared to those transfected with empty vector (~ 2 fold). This effect was specific for the IL-23p19 promoter, since the activity of pGL2C was unaffected by IRF6 co-transfection and/or poly(IC) stimulation. These data therefore suggest that IRF6 activates the IL-23p19 promoter in response to the TLR3 ligand poly(IC).

4.2.6 Poly(IC) stimulation may promote IRF6 nuclear translocation Since previous experimental evidence supported a role for IRF6 in promoting poly(IC)-inducible IL-23p19 mRNA expression, the next aim was to determine whether poly(IC) triggers IRF6 translocation into the nucleus. Thus, primary keratinocytes were stimulated with poly(IC) over a time-course or were left untreated, after which immunofluorescence microscopy was performed to detect IRF6 expression. The cells were also stained with DAPI (nuclear) and Phalloidin (actin) to visualize cell morphology. In initial experiments, IRF6 was predominantly localized to the nucleus, with some staining in the cytoplasm (Figure 4.7A). There also appeared to be some enrichment at the plasma membrane. Upon poly(IC) stimulation, IRF6 was still expressed in both nucleus and cytoplasm, but the cytoplasmic IRF6 pool appeared to be reduced as compared to unstimulated cells (Figure 4.7B). Although this was suggestive of nuclear translocation, this observed effect did not occur in subsequent experiments. Moreover, the high nuclear expression of IRF6 in primary keratinocytes made it difficult to use this approach to monitor nuclear translocation.

Although HaCaT cells also expressed both nuclear and cytoplasmic IRF6, the cytoplasmic pool appeared to be more pronounced than was observed in primary keratinocytes (Figure 4.7C). Thus, these cells were used for subsequent experiments, which involved cell fractionation to examine IRF6 nuclear translocation. HaCaT cells were stimulated with poly(IC) over a time course, after 79

IRF6 involvement in poly(IC)-regulated gene expression in keratinocytes which nuclear and cytoplasmic fractions were extracted. Western blotting was performed on the extracts to monitor IRF6 localization. Levels of GAPDH (cytoplasmic protein) and LaminA/C (nuclear protein) were also quantified by immunoblotting to confirm the purity of extracts, and to ensure equal protein loading. Consistent with microscopy data (Figure 4.7C), IRF6 was predominantly expressed in the cytoplasm in these cells, with some expression in the nucleus (Figure 4.7D). IRF6 expression in the cytoplasm increased at 4 and 8 h post-stimulation. At 6 h post-stimulation, IRF6 levels in the nucleus increased. One interpretation of these data is that poly(IC) increased IRF6 protein expression, with concomitant nuclear translocation at 6 h post- stimulation.

Figure 4.7. Poly(IC) stimulation may promote IRF6 nuclear translocation. IRF6 localization was determined in (A) unstimulated and (B) poly(IC)-stimulated primary keratinocytes using immunofluorescence microscopy, as well as in unstimulated HaCaT cells (C). The arrows indicate cytoplasmic staining and the arrowheads indicate nuclear staining of IRF6. (D) HaCaT cells were stimulated with Poly(IC) (30 µg/ml) over the indicated time course, after which nuclear and cytoplasmic extracts were prepared. Levels of IRF6, GAPDH and Lamin A/C were determined by immunoblotting. Data are representative of 2 independent experiments.

IRF6 involvement in poly(IC)-regulated gene expression in keratinocytes 4.2.7 Attempts to detect IL-23p19 protein in poly(IC)-stimulated keratinocyte supernatants and cell lysates Both gene knockdown and overexpression approaches showed that IRF6 promotes poly(IC)- inducible IL-23p19 mRNA expression. To determine if keratinocytes secrete IL-23p19 protein upon poly(IC) stimulation, HaCaT cells were stimulated with poly(IC) for 4, 8 and 24 h and secreted IL- 23p19 was measured from supernatants using ELISA. Supernatants from LPS-stimulated HMDM were used as a positive control, since HMDMs are known to secrete IL-23 in response to LPS (Verreck, de Boer et al. 2004). As expected, HMDMs responded to LPS stimulation and showed a 4-fold upregulation of IL-23p19 secretion (Figure 4.8A). However, IL-23p19 protein was not detected in HaCaT cell supernatants (data not shown). Functional IL-23 is a heterodimer of IL- 23p19 and IL-12p40 (Vignali and Kuchroo 2012). Since poly(IC) did not upregulate IL-12p40 mRNA expression in keratinocytes, it was considered that IL-23p19 may either not be secreted out of the cell, or may be interacting with another protein. Either of these explanations could account for the failure to detect IL-23p19 in keratinocyte culture supernatants by ELISA. That is, the protein could be present in cell lysates but absent from culture supernatants, or the epitopes recognized by the IL-23p19 antibodies used in the sandwich ELISA could be masked by an interaction with another protein, such as EBI3.

To determine if poly(IC) IL-23p19 could be detected within cell lysates, immunoblotting was performed on cell lysates from poly(IC)-stimulated primary keratinocytes. Recombinant IL-23 protein was used as a positive control. In the case of recombinant protein, both the IL-23 heterodimer (p19/p40; 55 kDa), as well as the IL-23p19 monomer (faint band, 19 kDa) were detected (Figure 4.8B). However, neither of these bands could be detected in either poly(IC)- stimulated keratinocytes or LPS-stimulated HMDM. Given that IL-23p19 in LPS-stimulated HMDM culture supernatants was detectable by ELISA, it was concluded that immunoblotting with anti-IL-23p19 antibody was unlikely to be sufficiently sensitive to detect this protein in keratinocytes.

IRF6 involvement in poly(IC)-regulated gene expression in keratinocytes

Figure 4.8. IL-23p19 protein was not detected in poly(IC)-stimulated keratinocyte supernatants or cell lysates. IL-23p19 ELISA was performed on culture supernatants from (A) HMDMs stimulated with LPS (10 ng/ml) for either 8 or 24 h. Data represents mean ± SD of experimental triplicates. (B) Recombinant IL-23 (10 ng), as well as whole cell lysates from primary human keratinocytes (PEK, +/- 30 µg/mL poly(IC) for 4 h) or HMDM (+/- 10 ng/mL LPS for 8 h), were subjected to SDS PAGE, followed by immunoblotting for IL-23p19, IRF6 and GAPDH. IL-23 (p19/p40) and p19 monomer are indicated with arrows. Data in (A) are mean ± SD from a single experiment, whilst data in (B) are representative of 2 independent experiments.

4.2.8 IFN-γ priming enhances keratinocyte responses to poly(IC) Since IL-23p19 could be detected in HMDM culture supernatants but not those of primary keratinocytes, I next considered the possibility that epithelial cells may require additional stimulation to secrete this cytokine. The pro-inflammatory cytokine IFN-is a classic primer of TLR responses in innate immune cells (Schroder, Sweet et al. 2006), and thus the effects of this cytokine were investigated. Keratinocytes were primed with 2.5 ng/ml IFN-for 24 h, after which poly(IC) responsiveness was examined. IFN-γ priming itself modestly increased the mRNA levels of IL-23p19 and CCL5 (Figure 4.9A and C). IFN-γ priming substantially enhanced (~ 30 fold) poly(IC)-inducible mRNA levels of IL-23p19 (Figure 4.9A), however this treatment regime did not result in detectable IL-23p19 secretion (data not shown). In addition to the effect of IFN-priming on inducible IL-23p19 mRNA levels, those of IFN-β (Figure 4.9B), CCL5 (Figure 4.9C) and CCL20 (Figure 4.9D) were also increased to varying levels. Thus, it was concluded that a second signal that robustly primed inducible IL-23p19 mRNA expression still did not permit detectable IL- 23p19 protein secretion.

IRF6 involvement in poly(IC)-regulated gene expression in keratinocytes

Figure 4.9. IFN-γ priming enhances poly(IC)-regulated inflammatory responses in keratinocytes. Primary keratinocytes were primed with IFN-γ (2.5 ng/ml) for 24 h and then stimulated with poly(IC) (30 µg/ml) for 4, 8 and 24 h. Total RNA was collected at the indicated time points and mRNA levels of (A) IL-23p19, (B) IFN-β, (C) CCL5 and (D) CCL20 were quantified, relative to HPRT, using qPCR. Data represents mean ± range from 2 independent experiments

4.2.9 Differentiation status of keratinocytes partially affects TLR3 responses after IFN-γ priming In the previous chapter, it was observed that differentiation status did not have pronounced effects on poly(IC)-inducible IL-8 release from keratinocytes. However, regulated IL-23p19 expression was not assessed in these experiments, nor was the effect of priming stimuli on differentiated cells. Therefore, the effect of IFN-γ priming on poly(IC)-regulated gene expression was monitored in proliferating versus differentiated keratinocytes. Consistent with the IL-8 data described previously (Figure 3.9), differentiation status alone did not significantly affect the poly(IC) responses examined. Also, as previously observed (Figure 4.9), IFN-γ priming generally enhanced poly(IC) 83

IRF6 involvement in poly(IC)-regulated gene expression in keratinocytes responses in keratinocytes. However, the effect of IFN-γ priming on regulated IFN-β gene expression was greatly reduced in differentiated keratinocytes (Figure 4.10A), whereas the reverse was true in the case of IL-23p19 mRNA expression (Figure 4.10B). This is consistent with increased IRF6 expression in differentiated keratinocytes (Figure 3.7) and previous data from this chapter implicating this transcription factor in positive and negative regulation of IL-23p19 and IFN-β mRNA expression, respectively. Due to time constraints, I did not examine whether poly(IC) promoted IL-23p19 protein secretion from IFN-γ primed that had previously been differentiated. The effects observed were selective, since keratinocyte differentiation status did not have any obvious effect on the capacity of IFN-γ to prime poly(IC)-inducible CCL5 (Figure 4.10C) or CCL20 (Figure 4.10D) expression.

Figure 4.10. Differentiation status differentially affects the ability of IFN-γ to prime poly(IC) responses in keratinocytes. Proliferating (Y27632-treated; 5 μM for 24 h) and differentiated (Ca2+- treated; 2 mM for 24 h) primary keratinocytes were primed with IFN-γ (2.5 ng/ml) for 24 h and then stimulated with poly(IC) (30 μg/ml) for 4 h. Total RNA was collected and mRNA levels of (A) IFN-β, (B) IL-23p19, (C) CCL5 and (D) CCL20 were quantified, relative to HPRT, using qPCR. Data represents mean ± SD from experimental triplicates and is representative of 2 independent experiments. 84

IRF6 involvement in poly(IC)-regulated gene expression in keratinocytes 4.3 Summary and discussion of Chapter 4

4.3.1 IRF6 involvement in regulation of IFN-β expression Members of the IRF family, such as IRF1, IRF3, IRF5 and IRF7 have been shown to be important regulators of TLR-inducible IFN-β transcription. The IFN-β promoter contains 4 characterized PREs: PRE I (-77 to -64), PRE II (-64 to -55), PRE III (-94 to -78) and PRE IV (-102 to -94) (Munshi, Yie et al. 1999). Two of these sites (PRE I and PRE III) are known to bind IRF1, IRF2, IRF3, IRF5 and IRF7 (Fan and Maniatis 1989, Leblanc, Cohen et al. 1990, Palombella and Maniatis 1992, Thanos and Maniatis 1995, Kim and Maniatis 1997, Sato, Tanaka et al. 1998, Wathelet, Lin et al. 1998, Sato, Suemori et al. 2000, Escalante, Nistal-Villan et al. 2007, Panne, Maniatis et al. 2007). IRF1, 3, 5 and 7 positively regulate transcription of IFN-β in different cell types (Reis, Harada et al. 1992, Sato, Tanaka et al. 1998, Honda, Yanai et al. 2005, Schoenemeyer, Barnes et al. 2005, Honda and Taniguchi 2006), while IRF2 is a negative regulator (Hida, Ogasawara et al. 2000). Phylogenetic analysis indicates that IRF6 is most similar to IRF5, showing 89% homology in aa sequence (Taniguchi, Ogasawara et al. 2001, Takaoka, Tamura et al. 2008). This suggests that IRF6 might also positively regulate IFN-β transcription. This conclusion was supported by promoter reporter studies in both HEK293 cells (Figure 4.1B) and HEK293-TLR3 cells (Figure 4.2), however more direct functional analysis (gene silencing) showed that, if anything, IRF6 negatively regulates poly(IC)-inducible IFN-β expression (Figures 4.3D and 4.4C). This functional evidence is also supported by correlative studies; keratinocyte differentiation upregulated IRF6 mRNA and protein expression (Figure 3.7) and concomitantly reduced poly(IC)-inducible IFN-β expression in IFN--primed cells (Figure 4.10A). Taken together, my data do not support a role for IRF6 in promoting inducible IFN-β expression in keratinocytes.

My findings highlight the need for caution when interpreting data from promoter-reporter studies. Although such systems provide a convenient functional read-out of transcriptional activity, the lack of chromatinization of transiently transfected DNA can result in artefacts (Reeves, Gorman et al. 1985, Hebbar and Archer 2008), as seemed to be apparent here. The observed negative regulation of poly(IC)-inducible IFN-β expression by IRF6 (Figures 4.3D and 4.4C) warrants further investigation. IRF6 association with other IRFs has not been reported experimentally, nevertheless, IRF6 has been predicted to associate with IRF5 and IRF8 by affinity-capture mass spectrometry (Li, Wang et al. 2011). IRF5 has also been shown to associate with IRF3 (Barnes, Moore et al. 2001). Thus, it is possible that IRF6 can interact with IRF3 and that this heterodimer has reduced transcriptional activity as compared to the IRF3 homodimer. Alternatively, IRF6 may bind to PRE I and/or PRE III within the IFN-β promoter and interfere with binding by IRF3. These possibilities

IRF6 involvement in poly(IC)-regulated gene expression in keratinocytes could be investigated in the future by co-immunoprecipitation analysis and chromatin immunoprecipitation analysis, respectively.

In contrast to the findings with IRF6 knock-down, gene silencing showed that IRF3 was required for poly(IC)-inducible IFN-β gene expression in keratinocytes (Figures 4.3D and 4.4C). This finding is consistent with an extensive literature in various cell types, including keratinocytes; TRIF-dependent signalling has been shown to activate IRF3 to promote transcription of type-1 IFNs (Honda and Taniguchi 2006). Considering that IRFs have cell-type specific functions (Chapter 1), this conclusion could not necessarily be assumed prior to undertaking these functional studies. A study in keratinocytes have also shown that IRF3 was required for poly(IC)-inducible TSLP expression but not IL-8 expression (Vu, Chen et al. 2011). This is consistent with my data where neither IRF3 nor IRF6 knockdown affected poly(IC)-inducible IL-8 expression (Figure 4.3J). In mouse macrophages, IRF3 has been shown to mediate poly(IC)-inducible CCL5 expression (Doyle, Vaidya et al. 2002), however, IRF3 knockdown did not affect CCL5 expression in keratinocytes (Figure 4.3F). Thus, in keratinocytes, other transcription factors may be involved in expression of target genes, such as IL-8 and CCL5. This requires investigation in future and is further discussed in Chapter 6.

4.3.2 Regulation of poly(IC)-inducible IL-23p19 expression by IRF6 Through both gain-of-function (Figure 4.5C) and loss-of function (Figures 4.3E and 4.4D) approaches, I showed that IL-23p19 is a downstream target gene of IRF6. IRF3 knockdown did not affect regulated IL-23p19 expression, which is consistent with a previous study showing that IRF3 knockdown did not affect regulated expression of IL-23p19 protein in macrophages (Al-Salleeh and Petro 2008). A role for IRF6 in promoting inducible IL-23p19 expression was also supported by IL- 23p19 promoter-reporter studies in RAW264 cells (Figure 4.6C). Interestingly however, I encountered difficulties with interpretation of data using this approach. In initial experiments performed in HEK293-TLR3 cells, I observed that the IL-23p19 promoter displayed very high constitutive activity (Figure 4.6B). These cells do not constitutively express the IL-23p19 gene, so this finding was very surprising. Co-expression of IRF6 did not activate the IL-23p19 promoter and poly(IC) actually suppressed activity of the promoter in cells co-transfected with IRF6 (Figure 4.6B). One possible interpretation of these data is that a strong transcriptional activator activates the IL-23p19 promoter in transfected HEK293-TLR3 cells, again, possibly because the transfected DNA is not chromatinized. In cells co-transfected with an IRF6 plasmid, IRF6 recruitment in response to treatment with poly(IC) could potentially interfere with the activity of this strong transcriptional activator. In a more physiological setting where the promoter is not transcriptionally active, then IRF6 recruitment would be predicted to drive IL-23p19 expression. This is certainly 86

IRF6 involvement in poly(IC)-regulated gene expression in keratinocytes consistent with my observations in transfected RAW264 cells. In these cells, the IL-23p19 promoter had low basal activity and in cells co-transfected with the IRF6 expression plasmid, poly(IC) enhanced promoter activity (Figure 4.6C). Interestingly, the effect of IRF6 in promoting poly(IC)- inducible IL-23p19 expression appeared to be selective. Gene knock-down studies suggested that CCL20 may also be another IRF6 target, although the effect was not statistically significant (Figure 4.3H). However, no effects of IRF6 knock-down on the other poly(IC) target genes studied were observed. At least some evidence was accrued to suggest that poly(IC) triggers nuclear translocation of IRF6 in keratinocytes (Figure 4.7), although the dual localization of IRF6 in both the cytoplasm and nucleus of keratinocytes complicates these studies somewhat. It is also likely that the subcellular localization of IRF6 is dynamically regulated. In this case, use of the nuclear export inhibitor leptomycin B (Wolff, Sanglier et al. 1997) may provide a cleaner system to monitor IRF6 nuclear translocation. Notably, one other study has also reported that poly(IC) triggers IRF6 nuclear translocation in MCF-10A cells (Bailey and Hendrix 2008). Assuming this is the case, more global approaches such as chromatin immunoprecipitation with an anti-IRF6 antibody in poly(IC)-treated keratinocytes are likely to identify TLR3-dependent IRF6 target genes beyond IL-23p19 (see Chapter 6 for further discussion on this).

IRF6 knock-down only partially reduced inducible IL-23p19 expression in keratinocytes, and had no effect on regulated EBI3 expression. The IL-23p19 promoter contains both IRF and NF-κB binding sites (Figure 4.6A). NF-κB has previously been shown to bind to the IL-23p19 promoter and to positively regulate its expression in macrophages and DCs (Carmody, Ruan et al. 2007, Mise-Omata, Kuroda et al. 2007). Given the incomplete effect of IRF6 siRNAs in reducing inducible IL-23p19 expression, it is quite likely that NF-κB also activates this gene in response to poly(IC). This model is consistent with the dual role of NF-κB and IRF3 in driving TLR3-inducible IFN- expression in various cell types (Jiang, Mak et al. 2004, Aksoy, Vanden Berghe et al. 2005, Sankar, Chan et al. 2006, Takaoka, Tamura et al. 2008). The TLR-regulated expression of EBI3 has primarily been studied in macrophages and dendritic cells. Although promoter analyses revealed putative NF-κB and IRF binding sites (Wirtz, Becker et al. 2005), NF-κB was identified as the primary functional regulator of inducible EBI3 expression (Wirtz, Becker et al. 2005, Poleganov, Bachmann et al. 2008). This is consistent with my observation that knock-down of IRF6 or IRF3 did not affect poly(IC)-inducible EBI3 expression in keratinocytes (Figure 4.3F). The differential role of IRF6 in regulating IL-23p19 versus EBI3 expression is also consistent with my previous observation that the time courses of poly(IC)-regulated expression of these two genes showed some differences (Chapter 3).

IRF6 involvement in poly(IC)-regulated gene expression in keratinocytes IL-23p19 is a member of the IL-12 super-family, and has been shown to heterodimerize with IL- 12p40 to form IL-23 (Vignali and Kuchroo 2012). However, poly(IC) did not induce IL-12p40 mRNA expression in either primary keratinocytes or HaCaT Cells (Chapter 3). This was somewhat surprising because IL-12p40 is the only known binding partner for IL-23p19. IL-12 or IL-23 are formed intracellularly by heterodimerization of p35/p40 or p19/p40 subunits, respectively, and are secreted as functional heterodimers (Gubler, Chua et al. 1991, Oppmann, Lesley et al. 2000). IL- 23p19 protein was not detected in culture supernatants or keratinocyte lysates after poly(IC) stimulation. There are several possibilities that could account for this observation. Firstly, it is possible that a second signal is required to elicit IL-23p19 secretion. IFN- was investigated as one such signal that might permit inducible protein release by acting as a priming agent (Figure 4.9). Whilst IFN- priming certainly enhanced poly(IC)-regulated mRNA expression of IL-23p19 and other target genes, I could not detect IL-23p19 protein secretion upon priming. Differentiation status also enhanced inducible IL-23p19 mRNA levels in IFN--primed cells, but due to time constraints, I was not able to examine whether this translated to protein secretion upon poly(IC) stimulation.

An alternative explanation is that one of the IL-23p19 epitopes recognized by the anti-IL-23p19 antibodies used in the sandwich ELISA are masked due to an interaction with either self or another protein. Given the gene expression data, one attractive possibility is that IL-23p19 interacts with EBI3, which is another beta-subunit of the IL-12 family of cytokines (Devergne, Hummel et al. 1996). Both EBI3 and IL-12p40 have a common binding partner, IL-12p35. The interaction between IL-12p35 and IL-12p40 is structurally very similar to that of IL-23p19 and IL-12p40 (Lupardus and Garcia 2008); many of the aa residues in the IL-12p40 binding surface are shared by both proteins (Lupardus and Garcia 2008). However, the interaction between IL-12p35 and EBI3 is distinct from its interaction with IL-12p40 (Jones, Chaturvedi et al. 2012). Considering the similarities in the IL-12p35 and IL-23p19 subunits, it is possible that IL-23p19 interacts with EBI3 in a distinct way as well. Such differences might thus be predicted to interfere with the recognition of IL-23p19 by one or both of the antibodies used in the sandwich ELISA. Another possibility is that IL-23p19 forms a functional homodimer, and that one of the epitopes is masked in this scenario. Some evidence suggests that IL-12p40 and IL-27p28 can function as homodimer or monomer, respectively (Ling, Gately et al. 1995, Gately, Carvajal et al. 1996, Brahmachari and Pahan 2009, Dibra, Cutrera et al. 2012, Garbers, Spudy et al. 2013), so there is at least some support for this concept with other IL-12 family members. In either case, IL-23p19 induction alone suggests a function for this gene independent of IL-12p40 or IL-23. These possibilities could be investigated

IRF6 involvement in poly(IC)-regulated gene expression in keratinocytes by cloning IL-23p19 and EBI3 expression plasmids and performing co-immunoprecipitation analysis to determine whether they interact. This warrants investigation in the future.

4.3.3 Effects of IFN-γ-priming on poly(IC) responses in keratinocytes The pro-inflammatory cytokine IFN-γ is predominantly produced by NK cells and T-cells, and is a potent activator of macrophages (Schroder, Sweet et al. 2006). Consequently, excessive or dysregulated IFN-γ production has been linked to many inflammatory diseases. Similarly, IFN-γ primes and/or drives inflammatory responses in keratinocytes (Barker, Mitra et al. 1991, Groves, Ross et al. 1993, Pastore, Corinti et al. 1998, Albanesi, Scarponi et al. 2001). For example, it promotes the production of IL-8 and intercellular adhesion molecule 1 (Barker, Sarma et al. 1990, Barker, Jones et al. 1991, Li, Ireland et al. 1996), which are both involved in the recruitment of inflammatory cells into the skin (Kalish 1989, Barker, Jones et al. 1991, Nickoloff, Mitra et al. 1993). Not surprisingly then, IFN-γ has been linked to inflammatory conditions of the skin, including psoriasis and dermatitis. For example, psoriatic lesions have been reported to have greater than 10 fold levels of IFN-γ, as compared to uninflamed epidermis (Kaneko, Suzuki et al. 1990). Furthermore, IFN-γ triggers growth arrest in normal keratinocytes, whereas it promotes proliferation of psoriatic keratinocytes (Nickoloff, Basham et al. 1984, Baker, Powles et al. 1988, Barker, Goodlad et al. 1993, Saunders and Jetten 1994). Thus, IFN-γ-primed keratinocytes are often used as in vitro cellular models for dissecting mechanisms involved in psoriasis (Fierlbeck, Rassner et al. 1990, Barker, McHale et al. 2004, Gudjonsson, Johnston et al. 2004). The IL-23/Th17 axis has also been implicated in the pathology of inflammatory skin conditions. For example, genetic variation in IL-12B, IL-12RB, IL-23A and IL-23R are protective against psoriasis (Capon, Di Meglio et al. 2007, Cargill, Schrodi et al. 2007) and elevated IL-23 levels have been reported in lesions of psoriatic patients (Lee, Trepicchio et al. 2004). Thus, my observation that IFN-γ priming alone caused a modest increase in IL-23p19 expression, and that this effect was further enhanced upon poly(IC) stimulation may be of relevance to dysregulated skin inflammation. IFN-γ priming also enhanced poly(IC)-induced expression of CCL5, which has also been shown to be highly expressed in psoriatic skin (Fukuoka, Ogino et al. 1998, Raychaudhuri, Jiang et al. 1999), and CCL20, which is produced in response to Th17 cytokines (Harper, Guo et al. 2009). One previous study in human bronchial epithelial cells showed that IFN-γ stimulation enhanced CCL5 secretion (Olszewska- Pazdrak, Casola et al. 1998). IFN-γ was also reported to stabilize poly(IC)-inducible CCL5 mRNA expression in airway epithelial cells (Homma, Matsukura et al. 2010). This is consistent with my results in keratinocytes where IFN-γ priming itself upregulated CCL5 expression, which was further amplified by poly(IC) stimulation (Figure 4.9C).

IRF6 involvement in poly(IC)-regulated gene expression in keratinocytes In my experiments, poly(IC) was added to the media, therefore, it is presumed that TLR3 mediates the effects I observed. However, dsRNA in the cytoplasm is also recognised by the cytosolic RNA sensors, RIG-I and MDA5 (Kato, Takeuchi et al. 2008). One study reported that poly(IC)-mediated responses were enhanced in human keratinocytes primed with IL-1α, which is also an inflammatory sensitizer, due to the induction of cytosolic RNA receptors (Prens, Kant et al. 2008). It is thus possible that IFN-γ also induces the expression of cytosolic RNA receptors, and that this contributes to the priming effects that I observed in my studies. Keratinocytes did not respond to poly(IC) stimulation with IL-12p40 induction. However, whether IFN-γ enables IL-12p40 upregulation in keratinocytes was not examined. Since psoriatic keratinocytes are reported to express elevated levels of IL-23 (Baghestani, Sadeghi et al. 2010), it is possible that IFN-γ primes IL-12p40 expression in keratinocytes, thereby contributing to increased inflammation during psoriasis. Therefore, the effect of IFN-γ priming on IL-12p40 expression needs to be examined.

Interestingly, IFN-γ priming appeared to differentially affect poly(IC)-inducible expression of IFN- β versus IL-23p19 expression upon cellular differentiation; inducible IFN-β expression was reduced upon differentiation, whereas IL-23p19 expression was increased (Figure 4.10A and B). As discussed above, this may relate to the inducible expression of IRF6 upon keratinocyte differentiation (Figure 3.7), since this transcription factor seemed to have opposing effects on the expression of these target genes (Figures 4.3D and E, 4.4C and D). Thus, it would be interesting to examine whether IFN-γ priming also promotes IRF6 expression or regulates its function (e.g. through post-translational modification). Consistent with such a model, IFN-γ has been shown to promote the expression of the keratinocyte differentiation markers IVL, transglutaminase type 1 and cornifin (Saunders and Jetten 1994, Takahashi, Asano et al. 1999). This might explain why IFN-γ- primed untreated keratinocytes responded in a similar manner as IFN-γ-primed differentiated keratinocytes (Figures 4.10). That is, IFN-γ itself is providing a differentiation signal.

In summary, in this chapter I have provided evidence that IRF6 regulates a sub-set of poly(IC)- inducible genes in human keratinocytes. Preliminary evidence also suggests that IFN- may regulate IRF6 expression or function in differentiated keratinocytes. The selective regulation of IL-23p19 may permit an IL-23-independent function for this IL-12 family sub-unit. This possibility is further discussed in Chapter 6. In the next chapter (Chapter 5), I explored a role for IRF6 in MyD88- dependent TLR responses.

Investigation of the role of IRF6 in MyD88-dependent TLR signaling in keratinocytes

5 Investigation of the role of IRF6 in MyD88-dependent TLR signalling in keratinocytes

Investigation of the role of IRF6 in MyD88-dependent TLR signaling in keratinocytes 5.1 Introduction In my original analysis of TLR responsiveness of keratinocytes, I did not observe pronounced responses of these cells to TLR agonists that signal exclusively via MyD88 (Figures 3.2-3.4). However, agonists of TLR7 and TLR2/6 were not assessed in these original studies. The TLR7 agonist imiquimod has been used as a therapeutic treatment for various skin conditions including basal cell carcinomas, genital warts and actinic keratosis (Bong, Bonnekoh et al. 2002, Geisse, Rich et al. 2002, Novak, Yu et al. 2008). TLR2/6 signalling is involved in the detection of Gram-positive bacteria such as S. aureus, which are common skin commensals (Krishna and Miller 2012). Therefore, it was considered important to know whether keratinocytes respond to TLR7 and/or TLR2/6 agonists, and if so, whether IRF6 is involved in these responses.

In response to their cognate ligands, all TLRs, except for TLR3, recruit the adaptor protein MyD88, which contains a C-terminal TIR domain and an N-terminal death domain (Figure 1.1) (Hultmark 1994, Wesche, Henzel et al. 1997, Burns, Martinon et al. 1998). In the case of TLR4 and TLR2, the protein MAL, also known as TIR domain-containing adaptor protein (TIRAP), acts as a bridging adaptor between MyD88 and the TLRs. Recently, TLR5 has also been shown to associate with MAL in IEC (Choi, Jung et al. 2013). MyD88 binds to the serine/threonine kinase IRAK4 by interacting with the death domain of the protein (Muzio, Ni et al. 1997, Wesche, Henzel et al. 1997). IRAK4 and IRAK1 are then sequentially recruited to the receptor complex (Cao, Henzel et al. 1996, Li, Strelow et al. 2002). The binding of the IRAKs to the receptor complex enables IRAK- 1 phosphorylation and association with the E3 ubiquitin ligase TRAF-6 (Cao, Xiong et al. 1996, Yamin and Miller 1997, Lomaga, Yeh et al. 1999). The IRAK-1/IRAK-4/TRAF-6 complex then dissociates from the receptor complex, after which TRAF-6 interacts with the E2 ubiquitin- conjugating enzyme complex consisting of Ubc13 and Uev1a (Deng, Wang et al. 2000). This interaction results in polyubiquitination at K63 of the ubiquitin molecule, autoubiquitination of TRAF6, and formation of a signalling scaffold (Deng, Wang et al. 2000). A member of the MAP3K family, TAK1, and its two adaptor proteins TAK-1 associated binding proteins 1 and 2 (TAB1 and TAB2) are then recruited (Deng, Wang et al. 2000, Wang, Deng et al. 2001). TAK1 undergoes phosphorylation and activates the p38 and JNK MAPK arms (Wang, Deng et al. 2001). Other MAP3Ks are involved in activating ERKs. Tumour progression locus 2 (TPL2) or MAP3K8 is a serine/threonine kinase that has been shown to activate ERK (Dumitru, Ceci et al. 2000, Cho, Melnick et al. 2005). TPL2 is phosphorylated by the IKK complex and activates ERK via the phosphorylation of MAPK/ERK kinase (MEK) (Banerjee, Gugasyan et al. 2006, Robinson, Beinke et al. 2007, Gantke, Sriskantharajah et al. 2011, Roget, Ben-Addi et al. 2012). These MAPKs activate the transcription factor AP-1 (Medzhitov, Preston-Hurlburt et al. 1997). In addition, TAK1

Investigation of the role of IRF6 in MyD88-dependent TLR signaling in keratinocytes activates IKK, comprising of subunits α and β (IKKα and IKKβ), as well as NEMO/IKKγ. Activated IKK phosphorylates IκB and this promotes its degradation. This in turn permits the release and nuclear translocation of the transcription factor NF-κB (Wang, Deng et al. 2001). NF- κB, AP-1 and other transcription factors then drive inducible expression of target pro-inflammatory genes such as IL-1β, IL-6 and TNF-α (Medzhitov, Preston-Hurlburt et al. 1997).

In addition to activating NF-κB, MyD88-dependent signalling also activates various members of the IRF family (Chapter 1). The activation of different IRFs, depending on the cell type, enables MyD88-dependent TLR signalling pathways to impart cell-type-specific TLR responses. Since IRF6 is highly expressed by keratinocytes (Chapter 3), it may be involved in keratinocyte-specific MyD88-driven TLR signalling responses. In this chapter, I investigated whether keratinocytes are responsiveness to the MyD88-dependent TLR agonists imiquimod (TLR7 agonist) and the synthetic lipopeptide FSL-1 (TLR2/6 agonist). I also investigated whether differentiating or priming agents modulate TLR7 and TLR2/6 responses, and if so, whether IRF6 plays any role in such effects.

5.2 Results

5.2.1 Primary keratinocytes are responsive to the TLR7 agonist Imiquimod The TLR7 agonist imiquimod is commonly used as a topical cream to treat various mild to serious skin conditions (Novak, Yu et al. 2008, Walter, Schafer et al. 2013). The mechanism of action is not well understood, but presumably involves induction of inflammatory responses that help in skin repair. To determine if keratinocytes are responsive to imiquimod, keratinocytes were stimulated for 4, 8 or 24 h with imiquimod, at a concentration previously shown to be stimulatory on other cell types (Schroder, Spille et al. 2007, Huang, Liu et al. 2010). As an initial read-out, IL-8 levels in culture supernatants were measured by ELISA (Figure 5.1A). Imiquimod induced robust IL-8 secretion in these cells at all time points examined (> 30 fold). Regulated gene expression was next examined. Given the effect of imiquimod on regulated IL-8 production (Figure 5.1A), IL-8 mRNA levels were assessed. IFN-β and CCL5 were also examined, because these have been identified as MyD88-dependent IRF target genes in other systems (Tamura, Yanai et al. 2008). As anticipated, imiquimod robustly upregulated IL-8 mRNA levels (~ 35 fold at 8 h post-stimulation) in primary keratinocytes (Figure 5.1B). In contrast, IFN-β mRNA levels were only very modestly, but not significantly, increased across the time course (~ 2 - 3 fold) (Figure 5.1C), and CCL5 mRNA levels expression was upregulated ~ 4 fold at 24 h post-stimulation (Figure 5.1D). IL-23p19, which was identified as an IRF6 target gene in the previous chapter, was only very weakly regulated by imiquimod (~ 2 fold) (data not shown).

Investigation of the role of IRF6 in MyD88-dependent TLR signaling in keratinocytes

Figure 5.1. Primary keratinocytes are responsive to the TLR7 ligand imiquimod. Primary keratinocytes were stimulated with the TLR7 ligand imiquimod (25 µg/ml). At 4, 8 and 24 h post- stimulation, culture supernatants were collected (A) and total RNA was prepared (B – D). (A) IL-8 levels in culture supernatants were measured using ELISA. Data represents mean ± SD of experimental triplicates and is representative of two independent experiments. (B) IL-8, (C) IFN-β and (D) CCL5 mRNA levels, relative to the housekeeping gene HPRT, were quantified using qPCR. Data (relative to the 4 h unstimulated control) represents mean ± SEM from 3 independent experiments, * p < 0.05, ** p < 0.01 as compared to unstimulated control (two-way ANOVA, followed by Tukey’s test).

5.2.2 IRF6 knockdown impairs TLR7-mediated IFN-β and CCL5 gene induction in primary keratinocytes The above data indicated that primary keratinocytes responded to the TLR7 ligand imiquimod with modest upregulation of IFN-β and CCL5. In order to determine if IRF6 is involved in these responses, a siRNA-mediated gene silencing approach was used (as described in Chapter 4). siSLC39A8, that targets another gene, the zinc transporter SLC39A8, was used as a control siRNA in these particular experiments. IRF6 knock-down reduced basal IRF6 mRNA expression (Figure 5.2A). Interestingly, imiquimod also upregulated IRF6 mRNA expression; this response was also reduced by transfection with an IRF6 siRNA (Figure 5.2B). The modest level of imiquimod- mediated IFN-β induction at 4 h post-stimulation (~ 3 fold) was ablated in siIRF6 transfected cells

Investigation of the role of IRF6 in MyD88-dependent TLR signaling in keratinocytes (Figure 5.2C). IRF6 knockdown also diminished imiquimod-inducible CCL5 expression substantially (Figure 5.2D), whilst IL-8 expression was unaffected (Figure 5.2E). These data, therefore, suggest that imiquimod-inducible IFN-β and CCL5 expression in keratinocytes is driven by IRF6.

Figure 5.2. IRF6 knock-down impairs TLR7-mediated IFN-β and CCL5 gene induction in primary keratinocytes. IRF6 expression in primary human keratinocytes was knocked down by reverse transfection using siRNA (200 pM). siSLC39A8 was used as a control siRNA targeting another gene. After 72 h, cells were stimulated with imiquimod (25 µg/mL) for 4 h or were left unstimulated. Total RNA was collected and mRNA expression, relative to HPRT, was quantified by qPCR for (A) IRF6 (basal), (B) IRF6 (inducible), (C) CCL5, (D) IFN-β and (E) IL-8. Data represents mean ± SEM from 4 independent experiments, * p<0.05, ** p<0.01 (compared to siRNA control) (Two-way ANOVA, followed by Tukey’s test). For (B) to (E), data are displayed relative to the imiquimod-stimulated siRNA control.

5.2.3 Keratinocyte differentiation enhances imiquimod inducible CCL5 expression Interestingly, in the siRNA knock-down experiments, imiquimod did increase CCL5 mRNA levels at 4 h post-stimulation (Figure 5.2), in contrast to my previous observations (Figure 5.1). This suggested that the keratinocytes were either primed during transfection, or that they underwent a change in proliferation status which made them more sensitive to imiquimod. To determine if

Investigation of the role of IRF6 in MyD88-dependent TLR signaling in keratinocytes differentiation status affected keratinocyte responsiveness to imiquimod, these cells were treated with Y27632 or Ca2+ for 24 h (as described in Chapter 3), prior to stimulation. mRNA levels of inducible IFN-β and CCL5 were quantitated by qPCR. The untreated and Ca2+-differentiated cells responded with some induction of IFN-β expression at 4 h post-stimulation as previously observed, however proliferating cells (Y27632-treated) did not show this response (Figure 5.3A). Similarly, keratinocyte differentiation status also affected imiquimod-inducible CCL5 expression. In proliferating cells (Y27632-treated), CCL5 mRNA expression was actually downregulated in response to imiquimod, while it was upregulated in differentiated cells (Figure 5.3B). Untreated cells, as observed previously (Figure 5.1D), did not show any CCL5 induction at 4 h post- imiquimod stimulation (Figure 5.3B). These results therefore suggest that differentiation of keratinocytes enhances imiquimod responsiveness, including enabling a more rapid induction of CCL5 expression.

Figure 5.3. Keratinocyte differentiation enhances imiquimod-inducible CCL5 expression. Keratinocytes were treated with Y27632 (5 µM) or Ca2+ (2 mM) for 24 h to maintain proliferation or to induce differentiation, respectively, or were left untreated. Cells were then stimulated with imiquimod (25 μg/ml) for 4 h. Total RNA was collected and mRNA levels of (A) IFN-β and (B) CCL5 were quantified, relative to HPRT, using qPCR. Data (relative to the untreated control) represents mean ± range from 2 independent experiments.

5.2.4 IFN-γ priming does not affect imiquimod-inducible gene expression In the previous chapter, I found that IFN-γ priming enhanced TLR3-inducible expression of certain genes. Therefore, the next aim was to determine if IFN-γ priming also enhances TLR7-mediated responses as well. Primary keratinocytes were primed with IFN-γ for 24 h and then stimulated with imiquimod for 4, 8 and 24 h, after which inducible IFN-β and CCL5 mRNA levels were quantified. Treatment with imiquimod only modestly upregulated IFN-β and CCL5 expression, and these apparent increases were not statistically significant (Figure 5.4A-B). This observation is broadly 96

Investigation of the role of IRF6 in MyD88-dependent TLR signaling in keratinocytes consistent with earlier findings (Figure 5.1), although in the earlier experiments IFN-β was regulated across the entire 24 h time course. IFN-γ alone upregulated mRNA levels of IFN-β and CCL5, but it did not enhance the subsequent response to imiquimod, for IFN-β (Figure 5.4A), and the priming effect on CCL5 was marginal (Figure 5.4B).

Figure 5.4. IFN-γ priming does not enhance imiquimod-inducible gene expression. Keratinocytes were primed with IFN-γ (2.5 ng/ml) for 24 h, and were then stimulated with imiquimod (25 μg/ml) for 4 h. Total RNA was collected and mRNA levels of (A) IFN-β and (B) CCL5 were quantified, relative to HPRT, using qPCR. Data (relative to 4 h control) represents mean ± SEM from 3 independent experiments.

5.2.5 Differentiation status of keratinocytes has little effect on IFN-γ priming of TLR7 responses Since differentiation of keratinocytes appeared to enhance imiquimod-inducible IFN-β and CCL5 expression in keratinocytes, I next wanted to determine if differentiation status affects the capacity of IFN-γ to prime TLR7 responses. Thus, keratinocytes were treated with Y27632 or Ca2+ to maintain proliferation or induce differentiation, respectively. As previously observed (Figure 5.3), differentiation of keratinocytes enhanced imiquimod-regulated gene expression; however, this still did not enable IFN-γ to prime TLR7 responses (Figure 5.5A-B). This was partly because IFN-γ alone robustly upregulated CCL5 mRNA expression in differentiated keratinocytes. These data were also variable between the two experiments performed, possibly because untreated cells had a partially differentiated phenotype in one of the experiments. In summary, these data suggest that primary keratinocytes respond very weakly to imiquimod with IRF6-dependent induction of IFN-β and CCL5.

Investigation of the role of IRF6 in MyD88-dependent TLR signaling in keratinocytes

Figure 5.5. Differentiation of keratinocytes does not permit IFN-γ priming of TLR7 responses. Keratinocytes were treated with Y27632 (5 μM) or Ca2+ (2 mM) for 24 h to maintain proliferation or induce differentiation, respectively, or were left untreated. Cells were then primed with IFN-γ (2.5 ng/ml) for 24 h, after which they were stimulated with imiquimod (25 μg/ml) for 4 h. Total RNA was collected and mRNA levels of (A) IFN-β and (B) CCL5 were quantified, relative to HPRT, using qPCR. Data represents mean ± range from 2 independent experiments.

5.2.6 Primary keratinocytes respond to the TLR2/6 agonist FSL-1 Given that S. aureus is a common skin commensal and that it signals via TLR2/6 (Schroder, Morath et al. 2003, Vu, Baba et al. 2010), responses through this MyD88-dependent signalling platform were also investigated in this chapter. The synthetic lipopeptide FSL-1 (Okusawa, Fujita et al. 2004), which signals via TLR2/6, was used for these studies. Hence, primary keratinocytes were stimulated with FSL-1 (100 ng/ml) for 4, 8 or 24 h, after which mRNA levels of IL-8, IFN-β, CCL5 and IL-23p19 were quantified. FSL-1 strongly upregulated (10 fold) IL-8 expression (Figure 5.6A). This effect was similar to that previously observed with imiquimod (Figure 5.1A-B). In contrast, there was no obvious effect on IFN-β expression (Figure 5.6B). FSL-1 treatment substantially increased mRNA levels of CCL5 (20 fold) and very modestly, but not significantly, increased those of IL-23p19 (5 fold) (Figure 5.6C-D). Interestingly, FSL-1 did not have any effect on IRF6 mRNA expression (Figure 5.6E).

Investigation of the role of IRF6 in MyD88-dependent TLR signaling in keratinocytes

Figure 5.6. Primary keratinocytes respond to the TLR2/6 ligand FSL-1. Primary keratinocytes were stimulated with the TLR2/6 ligand FSL-1 (100ng/ml) for 4, 8 or 24 h. Total RNA was collected at the indicated time points and mRNA levels of (A) IL-8, (B) IFN-β, (C) CCL5, (D) IL- 23p19 and (E) IRF6 were quantified, relative to HPRT, using qPCR. Data represents mean ± SEM from 3 independent experiments. * p<0.05, *** p<0.001 (compared to unstimulated control) (two- way ANOVA, followed by Tukey’s test).

5.2.7 Effect of IRF6 knockdown on TLR2/6 responses in primary keratinocytes To determine if any of the FSL-1-induced responses were dependent on IRF6, IRF6 expression was knocked down in keratinocytes, using previously established approaches. Successful knock-down of IRF6 and IRF3 was confirmed at the mRNA level (Figure 5.7A-B). However, several repeat experiments confirmed the very surprising finding that siRNA transfection almost completely ablated the FSL-1 response (data not shown). A very modest FSL-1 response was retained in only one single experiment, and these data are presented here. FSL-1 inducible IL-8 expression was modestly reduced after knock-down of either IRF6 or IRF3 (Figure 5.7D). The FSL-1-mediated induction of CCL5 was also impaired after IRF6 knock-down, whereas IRF3 knockdown did have an effect (Figure 5.7E). Similarly, inducible IL-23p19 expression also appeared to be reduced by IRF6 knock-down (Figure 5.7F). Given the problems with this experimental approach, these data are difficult to interpret. Nonetheless, they suggest that FSL-1-inducible CCL5 and IL-23p19 expression is IRF6-dependent in keratinocytes.

Investigation of the role of IRF6 in MyD88-dependent TLR signaling in keratinocytes

Figure 5.7. Effect of IRF6 knock-down on FSL-1 responses in primary keratinocytes. IRF6 (using two different siRNAs) and IRF3 gene expression was silenced in primary human keratinocytes by reverse transfection using siRNA (200 pM). siSLC39A8 was used as a control siRNA targeting another gene. After 72 h, cells were stimulated with FSL-1 (100 ng/ml) for 4 h or were left unstimulated. Total RNA was collected and gene expression was quantified, relative to HPRT, for (A) IRF6 (basal), (B) IRF3, (C) IRF6 (inducible), (D) IL-8, (E) CCL5 and (F) IL-23p19 by qPCR. Data represents mean ± SD of experimental triplicates.

5.2.8 Investigation of FSL-1-mediated IRF6 nuclear expression in primary keratinocytes The next aim was to determine whether FSL-1 triggers IRF6 translocation into the nucleus in keratinocytes. Thus, primary keratinocytes were stimulated with FSL-1 over a time-course or were left untreated, after which immunofluorescence microscopy was performed to visualize IRF6 localization. The cells were also stained with DAPI (nuclear) and Phalloidin (actin) to visualize cell morphology. Consistent with previous experiments (see Chapter 4), IRF6 was localized to both the nucleus and the cytoplasm in these cells (Figure 5.8A). Upon stimulation with FSL-1 for 4 h, IRF6 expression levels, in both the nucleus and cytoplasm, appeared to be enhanced as compared to unstimulated cells (Figure 5.8B). This expression was quantified using Image J software. The mean fluorescence intensity per cell of IRF6 in the cytoplasm and in the nucleus was calculated using Phalloidin and DAPI to mark the boundaries. At least 6-8 random frames of cells (7-10 cells/frame) were and quantified, in a blinded fashion, from each experiment. This quantitative analysis confirmed that IRF6 expression was indeed enhanced in both cytoplasm and nucleus upon FSL-1 stimulation (Figure 5.8C-D). This contrasts with the gene expression data in which FSL-1 did not 100

Investigation of the role of IRF6 in MyD88-dependent TLR signaling in keratinocytes upregulate IRF6 mRNA expression (Figure 5.6E). This suggests that FSL-1 treatment may stabilize IRF6 protein, thereby prolonging its half-life. Because of this phenomenon, it is not clear from these data as to whether FSL-1 does trigger IRF6 nuclear translocation.

Figure 5.8. FSL-1 increases IRF6 protein expression in primary human keratinocytes. IRF6 localization was determined in (A) control and (B) FSL-1-stimulated (100 ng/ml for 4 h) primary keratinocytes using immunofluorescence microscopy. The arrows indicate cytoplasmic staining and the arrowheads indicate nuclear staining of IRF6. Mean fluorescence intensity/cell in (C) the cytoplasm and (D) the nucleus in control and FSL-1-stimulated cells was calculated using ImageJ software. Data represents mean ± SEM of 3 independent experiments, using 6-8 different frames of cells per experiment, **** p<0.0001 (compared to control) (Wilcoxon signed rank test).

101

Investigation of the role of IRF6 in MyD88-dependent TLR signaling in keratinocytes 5.3 Summary and discussion of Chapter 5

5.3.1 Involvement of IRF6 in TLR7 responses in keratinocytes Despite it’s clinical use in skin-related conditions, the mechanisms by which imiquimod mediates skin repair are not well understood. In primary human keratinocytes, imiquimod stimulation has previously been shown to activate NF-κB and to upregulate the proinflammatory genes IL-6, IL-8, TNF-α and IL-1β (Kono, Kondo et al. 1994, Kollisch, Kalali et al. 2005, Olaru and Jensen 2010, Li, Sohn et al. 2013). Consistent with this, I also found that imiquimod upregulated IL-8 mRNA expression and induced IL-8 secretion. TLR7 primarily detects ssRNA from viruses and is involved in the production if type-1 IFNs (Diebold, Kaisho et al. 2004, Lund, Alexopoulou et al. 2004). However, there may be a link between TLR7 and the dsDNA virus, HSV-1. HSV-1 is a causative pathogen for cold sores, keratitis, and genital herpes in skin (Grinde 2013). Interestingly, HSV-1 infection was reported to upregulate TLR7 expression in human corneal epithelial cells (Li, Zhang et al. 2006), and imiquimod treatment provided protection against HSV infections (Harrison, Jenski et al. 1988, Bernstein and Harrison 1989, Harrison, Stanberry et al. 1991, Slade, Owens et al. 1998). HSV-infected macrophages and fibroblasts were reported to produce CCL5 in an NF-κB- and IRF3- dependent manner, which may allow migration of other leukocytes to site of infection to initiate appropriate antiviral responses (Melchjorsen and Paludan 2003). My findings that imiquimod upregulated CCL5 and IFN-β mRNAs in an IRF6-dependent manner in keratinocytes may implicate this transcription factor in the therapeutic effects of imiquimod in this setting.

As previously discussed (Chapter 1.2.1), IRFs impart cell-type specific responses in MyD88- dependent signalling. TLR7 uses MyD88-dependent signalling to activate IRF5 in macrophages (Schoenemeyer, Barnes et al. 2005), while it uses IRF1 in cDCs (Negishi, Fujita et al. 2006, Mancuso, Gambuzza et al. 2009, Hoshino, Sasaki et al. 2010) and IRF7 in pDCs to activate transcription of type-1 IFN (Uematsu, Sato et al. 2005). This is due to differential IRF expression; IRF1 is highly expressed in cDCs (Negishi, Fujita et al. 2006, Schmitz, Heit et al. 2007), while IRF7 is highly expressed in pDCs (Honda, Yanai et al. 2005). Considering that IRF6 is highly expressed in keratinocytes, it is likely that TLR7 engages IRF6 for activation of target genes such as IFN-β and CCL5. My data support this conclusion, since IRF6 knockdown impaired the modest imiquimod-mediated induction of IFN-β and CCL5 that was observed in keratinocytes. In the previous chapter, I also showed that IRF6 can activate the IFN-β promoter (see section 4.2.1), and IRF6 has also been shown to enhance IRAK-1-mediated activation of the CCL5 promoter (A/Prof Glen Scholz, personal communication). Whether imiquimod stimulation enhances IRF6-mediated activation of the IFN-β and CCL5 promoters could therefore be investigated in further studies. The conclusion that MyD88 signalling drives IRF6 activation is further supported by the finding that 102

Investigation of the role of IRF6 in MyD88-dependent TLR signaling in keratinocytes IRF6 interacts with IRAK-1, as shown by co-immunoprecipitation analyses (A/Prof Glen Scholz, personal communication). This is interesting in light of the fact that other members of the IRF family (e.g. IRF3, IRF5 and IRF7) have been shown to undergo Ser phosphorylation. The phosphorylation sites have been mapped to Ser-385 and Ser-386 in their C-terminal region of IRF3 (Suhara, Yoneyama et al. 2000). This ser residue is also conserved and functional in IRF5 and IRF7 (Marie, Smith et al. 2000, Cheng, Brzostek et al. 2006). Mutation of the corresponding Ser residues in IRF3 and IRF7 abolished IRF transcriptional activity (Marie, Smith et al. 2000, Suhara, Yoneyama et al. 2000). Multiple protein alignment analysis shows that the Ser sites that are present in IRF3, IRF5 and IRF7 are also conserved in IRF6 (Ser-413 and Ser-424) (A/Prof Glen Scholz, personal communication) (Figure 5.9). Mutational analysis has confirmed that both of these residues are required for maximal IRAK-1-mediated activation of IRF6 transcriptional activity in reporter gene assays (A/Prof Glen Scholz, personal communication). Thus, in the future, these mutants of IRF6 (Ser to Alanine for inactive; Ser to Glutamic acid for phosphomimetic) could be used for analysis of TLR7 signalling responses. This would help determine whether IRF6 phosphorylation is required for TLR7 signalling, and may also help to identify the kinases in the TLR7 signalling pathway that activate IRF6 (presumably IRAK-1, but possibly others as well). In addition, gain-of-function studies are also required to determine if IRF6 overexpression in epithelial cells deficient in IRF6 protein (e.g. T24 cells, Figure 3.1C) can permit imiquimod-inducible IFN-β and CCL5 expression.

Figure 5.9. Phosphorylation sites in IRF6. Protein sequence of human IRF3, 5, 6 and 7 were aligned using ClustalW programs. The Ser phosphorylation sites identified in IRF3 are conserved between all four IRFs and are highlighted in yellow. The known kinases that phosphorylates these IRFs are listed on the right.

There were some intriguing aspects to the findings on TLR7 responsiveness in keratinocytes. Firstly, although imiquimod triggered robust upregulation of IL-8, the effect on IFN-β and CCL5 was very modest. Assuming that the former gene is downstream of NF-B (Mukaida, Mahe et al. 1990, Kunsch and Rosen 1993, Matsusaka, Fujikawa et al. 1993, Stein and Baldwin 1993, Kunsch,

103

Investigation of the role of IRF6 in MyD88-dependent TLR signaling in keratinocytes Lang et al. 1994) and the latter are downstream of IRF6 (Figure 5.2C and D), this would suggest that there may be some mechanism that selectively constrains TLR7-mediated IRF6 activation in keratinocytes. Interestingly, TLR7 responses appeared to be somewhat enhanced when the cells underwent transfection, when compared to normally cultured cells. This suggests that the act of transfection primed or caused a change in these cells that made them more responsive to imiquimod. During transfections, the cells are cultured for 72 h in media without any Y27632, which maintains them in a proliferative state, prior to stimulation with imiquimod. Therefore, these transfected cells, in the absence of Y27632, may be undergoing differentiation prior to TLR7 activation. This conclusion is supported by the observation that TLR7-mediated induction of IFN-β and CCL5 expression was enhanced in Ca2+-treated differentiated keratinocytes, as compared to Y27632-treated proliferating keratinocytes. Since I did not observe any difference in TLR7 mRNA levels upon differentiation (Figure 3.8), it is possible that the effect relates to the increased IRF6 expression that occurs after differentiation (Figure 3.7A and C). My findings contrast with a recent study in primary human keratinocytes, which reported that TLR7 mRNA and TLR7 protein was increased upon differentiation (Li, Sohn et al. 2013). The time of differentiation used in this study differs from my own. Keratinocytes were differentiated for a prolonged time (14 d) (Li, Sohn et al. 2013), as opposed to the 24 h used in my experiments. Thus, it is possible that increases in both TLR7 and IRF6 expression during keratinocyte differentiation permit enhanced imiquimod responsiveness. This warrants further investigation.

5.3.2 Involvement of IRF6 in TLR2/6 responses in keratinocytes TLR2 is the principle receptor that recognizes lipoproteins from Gram-positive bacteria. Previous studies reported that primary human keratinocytes constitutively express functional TLR2 and produce IL-8 and β-defensins when stimulated with TLR2 agonists (Kawai, Shimura et al. 2002, Mempel, Voelcker et al. 2003). In my hands, I did not find any evidence that human keratinocytes respond to the TLR2/TLR1 agonists Pam3Cys and zymosan (Figures 3.2-3.4). In contrast, keratinocytes responded robustly to the TLR2/6 ligand FSL-1 (Figure 5.6). This was of interest because the TLR2/6 heterodimer has been reported to be required for the detection of S. aureus, a skin commensal that is also a significant human pathogen (Lowy 1998, Ozinsky, Underhill et al. 2000, Chiller, Selkin et al. 2001, Morr, Takeuchi et al. 2002, von Aulock, Morath et al. 2003, Hoebe, Georgel et al. 2005, Bunk, Sigel et al. 2010, Vu, Baba et al. 2010). Upon S. aureus infection, keratinocytes have been shown to produce the pro-inflammatory cytokines TNF-α, IL-8 and TSLP, as well as β-defensins (Mempel, Voelcker et al. 2003, Midorikawa, Ouhara et al. 2003, Sumikawa, Asada et al. 2006, Aufiero, Guo et al. 2007, Kisich, Howell et al. 2007, Vu, Baba et al. 2010, Ommori, Ouji et al. 2013). The cell-wall component of S. aureus consists of both diacylated

104

Investigation of the role of IRF6 in MyD88-dependent TLR signaling in keratinocytes and triacylated lipoproteins (Kurokawa, Lee et al. 2009, Tawaratsumida, Furuyashiki et al. 2009), however, the pro-inflammatory responses to S. aureus, such as TSLP induction, was reported to signal via TLR2/6 (Vu, Baba et al. 2010). Activation by S. aureus was also shown to be dependent on staphylococcal lipoprotein SitC which binds to TLR2 (Kurokawa, Lee et al. 2009, Muller, Muller-Anstett et al. 2010, Kurokawa, Kim et al. 2012). Although a role for TLR2 in S. aureus clearance is still debatable (Miller, O'Connell et al. 2006), Tlr2-/- deficient mice have been reported to succumb to S. aureus infection (Takeuchi, Hoshino et al. 2000), thus supporting the view that this receptor has an important in vivo function in response to this pathogen.

My studies in this chapter focused on FSL-1 rather than S. aureus, as both these stimuli are recognized by TLR2/6 (Ozinsky, Underhill et al. 2000, Morr, Takeuchi et al. 2002, Okusawa, Fujita et al. 2004, Vu, Baba et al. 2010). S. aureus also contains SitC, a triacylated lipoprotein that was reported to signal independently of TLR2 (Muller, Muller-Anstett et al. 2010). This suggests that S. aureus may engage other PRRs in addition to TLR2/6, and that it may elicit TLR2/6-dependent and –independent responses. One possibility is that, in keratinocytes, TLR2/6 is the primary receptor that recognizes S. aureus and that this receptor complex sensitizes the cells to induce an initial rapid inflammatory response. For example, the upregulation of IRF6 protein expression by FSL-1 (and presumably S. aureus acting on TLR2/6) may permit enhanced inflammatory responses when a second PRR is engaged. Priming the cells with FSL-1, and then examining responses to other TLR ligands would reveal if this is indeed the case.

Whereas FSL-1 had almost no effect on expression of IFN-β, it triggered pronounced upregulation of IL-8 and CCL5 expression in keratinocytes (Figure 5.6 B and C). Similarly IL-8 was upregulated by S. aureus in keratinocytes (Mempel, Voelcker et al. 2003), whilst CCL5 was reported to be S. aureus-inducible in epidermal Langerhans cells and oseteoblasts (Wright and Friedland 2004, Matsui, Wirotesangthong et al. 2007). Knockdown studies indicated that silencing of IRF6 and IRF3 modestly reduced inducible IL-8 expression. It would be interesting to examine whether combined silencing of these transcription factors would have a more pronounced effect then knockdown of each transcription factor alone. The modest effects of siRNAs targeting IRF6 and IRF3 may also reflect that IL-8 is a well-characterized NF-κB target gene (Mukaida, Mahe et al. 1990, Kunsch and Rosen 1993, Matsusaka, Fujikawa et al. 1993, Stein and Baldwin 1993, Kunsch, Lang et al. 1994). IRF6 knockdown did appear to have a more pronounced effect on FSL-1- inducible CCL5 expression, and the effect was selective since silencing of IRF3 had no clear effect. Unfortunately however, this result could not be replicated as, in subsequent experiments, FSL-1 mediated CCL5 induction was not apparent. Even in the presented experiment, FSL-1-inducible CCL5 and IL-8 expression was very low by comparison to that observed in untransfected cells 105

Investigation of the role of IRF6 in MyD88-dependent TLR signaling in keratinocytes (compare Figures 5.6A and 5.7D). The most obvious explanation is that the process of transfection somehow interferes with TLR2/6 responsiveness of these cells. Since CCL5 induction was lost in cells transfected without any siRNA, it is likely that this lack of response is due to the transfection procedure, and not due to the presence of siRNA. The transfection media contains lipofectamine, which comprises cationic liposomes that forms complexes with negatively charged nucleic acids, fuses with the cell membrane and is delivered into the cells (Felgner, Gadek et al. 1987, Zhao, Watarai et al. 1997). It is possible that the lipofectamine is somehow interfering with TLR2/6 signalling, for example dysregulating expression or trafficking of this receptor complex. Lipofectamine only affected FSL-1 responses, and not poly(IC) or imiquimod responses, thus indicating that TLR responses were not broadly affected. Other transfection approaches, such as electroporation, could be used in the future to reinvestigate the impact of IRF6 knockdown on keratinocyte responses to FSL-1 (and S. aureus).

TLR2 is differentially expressed in the different layers of the skin (Kawai, Shimura et al. 2002, Baker, Ovigne et al. 2003, Pivarcsi, Bodai et al. 2003). In normal skin, TLR2 is more highly expressed in the basal cell layers than in the upper epidermis (Baker, Ovigne et al. 2003). Since basal cells are proliferative in nature, as opposed to the terminally differentiated cells in the upper layers, it is possible that differentiation status affects TLR2/6 responsiveness. Given the findings on the effect of differentiation status on imiquimod responses, an attractive hypothesis is that proliferating keratinocytes in the basal layer are TLR2 responsive and TLR7 unresponsive, whilst the reverse is true for differentiated keratinocytes in the upper epidermis. Future studies on the effects of keratinocyte differentiation on TLR2 responses should thus be performed. If proliferative cells are indeed more responsive to FSL-1, then transfected cells could be cultured in media containing Y27632 to maintain them in a proliferating state. Assuming this model is correct, this would be predicted to restore TLR2/6 responses that are lost due to differentiation of the cells. Hence, these specific conditions might enable an assessment, through gene knockdown, of IRF6 involvement in FSL-1 responses in keratinocytes.

FSL-1 stimulation increased IRF6 protein expression in both the cytoplasm and the nucleus (Figure 5.8 A). However, IRF6 mRNA was unaffected by FSL-1 stimulation (Figure 5.6 E). This complicates analysis of FSL-1-mediated IRF6 nuclear translocation, where a decrease in the cytoplasmic pool and an increase in the nuclear pool of IRF6 would be predicted. Future studies should therefore examine IRF6 nuclear translocation at earlier time points (e.g. 1 to 2 h), since it is possible that FSL-1 does not upregulate IRF6 protein expression by this time. As discussed in Chapter 4, it is also possible that IRF6 is very rapidly exported out of the nucleus, making it difficult to capture nuclear accumulation of IRF6. Treating cells with the nuclear export inhibitor 106

Investigation of the role of IRF6 in MyD88-dependent TLR signaling in keratinocytes leptomycin B prior to FSL-1 stimulation may be a more suitable approach to monitor IRF6 translocation. Live imaging using a GFP-tagged IRF6 construct represents another avenue that could be pursued in the future.

In summary, in this chapter, I identified a possible role for IRF6 in mediating MyD88-dependent CCL5 induction in primary keratinocytes. Together with my findings in Chapter 4, these data suggest that IRF6 has distinct roles in MyD88-dependent and TRIF-dependent TLR signalling. This is further discussed in Chapter 6.

107

Final Discussion

6 Final Discussion

108

Final Discussion 6.1 Introduction The major findings from this thesis were that (1) IRF6 is highly expressed in keratinocytes; (2) keratinocytes respond to the TLR3, TLR7 and TLR2/6 agonists poly(IC), imiquimod and FSL-1, respectively; (3) IRF6 selectively drives polyIC-inducible IL-23p19 expression; (4) IRF6 drives imiquimod-inducible IFN-β and CCL5 expression; and (5) FSL-1 may also promote IRF6- dependent CCL5 expression. These data suggest a role for IRF6 in both TRIF-dependent and MyD88-dependent TLR signalling and this will be discussed further in this chapter. In addition, some preliminary data relating to future directions for this project will also be presented and discussed.

6.2 Roles of IRF6 in TRIF-dependent TLR signalling in keratinocytes

6.2.1 The functions of TLR3 in keratinocytes Keratinocytes were highly sensitive to the synthetic dsRNA analogue poly(IC), which drives TLR3- dependent signalling (Kollisch, Kalali et al. 2005, Miller, Sorensen et al. 2005, Dai, Sayama et al. 2006, Lebre, van der Aar et al. 2007). In humans, dsRNA viruses are not usually pathogens of the skin, and do not typically infect keratinocytes. Nonetheless, TLR3 also has a role in host responses to the dsDNA virus HSV-1, a prevalent pathogen of the skin (Chew, Taylor et al. 2009). Human patients with heterozygous or homozygous mutations in TLR3 are susceptible to HSV-1 encephalitis (Zhang, Jouanguy et al. 2007, Guo, Audry et al. 2011, Sancho-Shimizu, Perez de Diego et al. 2011, Lafaille, Pessach et al. 2012). Therefore, human keratinocytes may use TLR3 to initiate appropriate inflammatory responses to this particular pathogen. Furthermore, TLR3 function is not limited to pathogen recognition. Studies on human keratinocytes have also revealed a role for TLR3 in detecting DAMPs, such as RNA, released from damaged cells (Lai, Di Nardo et al. 2009). More recently, TLR3 was shown to detect UV-damaged U1 non-coding RNA upon exposure to UVB radiation, resulting in the release of inflammatory cytokines, such as TNF-α and IL-6 (Bernard, Cowing-Zitron et al. 2012). UV radiation was also found to activate NF-κB signalling in an IKK- independent manner (Lewis and Spandau 2007) and promote the secretion of pro-inflammatory cytokines, such as IL-6 and TNF-α (Abeyama, Eng et al. 2000, Grandjean-Laquerriere, Gangloff et al. 2002). Interestingly, studies have linked altered pro-inflammatory signalling and cytokine release to UV-induced skin disorders, including SCC (Muthusamy and Piva 2010). UV-damage has also been shown to activate MAPK p38 and JNK signalling (described in Section 5.1) (Chouinard, Valerie et al. 2002, Hildesheim, Awwad et al. 2004, Schieke, Ruwiedel et al. 2005), but whether TLR3 is involved in these responses is unknown at this stage. The MAPK pathways are involved in

109

Final Discussion the maintenance of proliferation, differentiation and homeostasis in the epidermis (Marcinkowska, Wiedlocha et al. 1997, Mitev and Miteva 1999, Zhang, Pelech et al. 2001), however, they also promote the growth of SCC (Tsang and Crowe 1999). For example, in vivo studies in immunocompromised mice showed that adenoviral inhibition of endogenous p38 suppressed SCC growth, while a JNK inhibitor suppressed the proliferation of human head and neck SCC cells (Gross, Boyle et al. 2007, Junttila, Ala-Aho et al. 2007). IRF6, a critical factor for keratinocyte differentiation, has been reported to be downregulated in progressive tumours (discussed further in Section 6.3.4) (Botti, Spallone et al. 2011). Although I found that TLR3 signalling induced IRF expression (Figures 4.3I and 4.7D), it is possible that prolonged activation of these signalling pathways in response to UV radiation may have a different effect, for example downregulating IRF6 expression leading to SCC growth and proliferation. Alternatively, UV radiation likely has additional effects to TLR3 signalling, which may target IRF6 for degradation.

There is also evidence that TLR3 plays a role in responses during physical injury. TLR3 mRNA and protein was upregulated in wounded skin and was required for TNF-α and IL-6 production at wound edges (Lai, Di Nardo et al. 2009, Lin, Fang et al. 2011). Furthermore, Tlr3-/- mice showed delayed wound closure (Lin, Fang et al. 2011). Tlr3 deficiency resulted in decreased chemokine secretion, leading to defective recruitment of neutrophils and macrophages to the site of injury (Lin, Fang et al. 2011, Lin, Wang et al. 2012). TLR3 activation also upregulated the expression of genes associated with maintenance of epidermal structure, such as ATP-binding cassette sub-family A member 12, glucocerebrosidase, acid sphingomyelinase, and transglutaminase 1 (Borkowski, Park et al. 2013). Collectively, these data indicate that TLR3 has a critical role in detecting cell damage signals and initiating wound healing and cell repair processes.

6.2.2 The role of IRF6 in TLR3 signalling In this thesis, I provided evidence that IRF6 is downstream of TLR3 signalling and selectively regulates the expression of IL-23p19, however the mechanism of IRF6 activation by poly(IC) is still unknown. Poly(IC) stimulation upregulated IRF6 mRNA and protein (Figures 4.3I and 4.7D), and appeared to promote its nuclear translocation (Figure 4.7). Therefore, one possibility of IRF6 activation is that it is directly activated by TLR3 signalling to initiate responses. TLR3 signalling also rapidly upregulated IFN-β mRNA expression (4 h post stimulation) in an IRF6-independent and IRF3-dependent manner (Figures 4.3D and 4.4C). Intriguingly, IRF6 dependent responses were delayed and peaked at 24 h post stimulation (Figure 3.3) and concurrently, IRF6 nuclear translocation was also evident at a later time point (6 h post-stimulation) (Figure 4.7D). Thus, it is

110

Final Discussion also possible that TLR3 signalling leads to IFN-β expression, which acts as an autocrine factor to regulate IRF6-dependent responses. These possibilities require further investigation. IRF6 presumably has a role in the regulated expression of poly(IC)-inducible target genes, other than IL- 23p19. A recent study used both ChIP-seq and gene knockdown approaches in differentiating human keratinocytes to identify IRF6 target genes (Botti, Spallone et al. 2011). Although most of the target genes found by this approach were associated with keratinocyte proliferation/differentiation pathways, there were some genes that could potentially be downstream of TLR signalling. For example, two members of the IL-1 cytokine family, IL-37 and IL-36γ, were significantly downregulated in the absence of IRF6 (Botti, Spallone et al. 2011). The biological functions of both these cytokines are not well understood, but interestingly, HSV infection of keratinocytes elicited IL-36γ production (Kumar, McDonnell et al. 2000). Poly(IC) has also been shown to induce IL-36γ expression in keratinocytes, suggesting a potential role for this cytokine downstream of TLR3 signalling in skin (Lian, Milora et al. 2012). IL-37, like other members of the IL-1 family, is also produced as a precursor and must be cleaved by caspase-1 to enable regulated release (Nold, Nold-Petry et al. 2010). IL-37 over-expression in mouse models suppressed LPS- inducible inflammatory cytokines in macrophages, alveolar and colonic epithelial cells (Eidenschenk, Crozat et al. 2010, McNamee, Masterson et al. 2011). Thus, IL-37 appears to have an anti-inflammatory role. Whether TLR3 signalling in keratinocytes drives IRF6-dependent expression of these cytokines remains to be determined.

Since TLR3 signalling has been implicated in wound healing, this raises the question of whether IRF6 has a similar role. Mutations in IRF6 cause cleft lip/palate disorders such as VWS and PPS (Koillinen, Wong et al. 2001). IRF6 mutations are also associated with non-syndromic cleft lip/palate (NSCLP), however this mutation occurs in only 12% of these cases, as opposed to 70% in VWS and 97% in PPS (Kondo, Schutte et al. 2002, Blanton, Cortez et al. 2005, Scapoli, Palmieri et al. 2005, Vieira, Avila et al. 2005, de Lima, Hoper et al. 2009). Comparative analysis of these patients suggests a possible role for IRF6 in wound healing. A study compared patients with VWS and NSCLP after corrective cleft surgery and found that patients with VWS are more likely to have wound complications (Jones, Canady et al. 2010). The study compared 17 VWS patients to 68 patients with NSCLP and found that 47% of patients with VWS had wound complications, as opposed to 19% in NSCLP patients. Although the patient numbers were low and the effects cannot be definitively linked to IRF6, the study still raises the possibility that IRF6 does have a non- redundant role in wound healing in humans. This conclusion is supported by one in vitro study, which showed that IRF6 mRNA was upregulated in normal keratinocytes during scratch wounding (Fitsialos, Chassot et al. 2007). In a preliminary experiment, I also examined the expression of Irf6

111

Final Discussion in mouse tissues during different stages of wound healing. I found that Irf6 expression was lost in the area around the wound, while the surrounding tissue expressed this protein (Figure 6.1). This contrasts somewhat with the above findings of upregulated IRF6 mRNA expression in normal keratinocytes during scratch wound assays (Fitsialos, Chassot et al. 2007), although that study examined mRNA expression, not protein. In fact, I observed a loss of Irf6 at the wound edges. The cells at the wound edges are likely to be rapidly proliferating basal cells, which normally do not express Irf6, so this is perhaps unsurprising. Nonetheless, the expression of IRF6 in the surrounding area, as well its expression during restoration of normal tissue architecture may help coordinate an appropriate wound healing response.

Figure 6.1. IRF6 IHC in wounded skin of mice. Excisions (1 cm2) were made on the back of the mice and wounded skin, along with some surrounding skin, were removed 2, 3, 5, 14 d post injury. IHC was performed on the wounded skin at indicated d post-recovery, using an anti-IRF6 antibody. The wound area of the skin is indicated by arrowheads, and IRF6 staining (brown) is indicated using arrows. At d 14, the wound was healed, therefore, only surrounding tissue is shown. The surrounding area was also stained with an isotype control. Samples for IHC were kindly provided by A/Prof Kiarash Khosrotehrani (UQCCR).

6.2.3 Possible role(s) of IL-23p19 in skin homeostasis and pathology IL-23 is a key pro-inflammatory cytokine driving psoriasis of skin (Tonel, Conrad et al. 2010). This is not surprising, because it is an important cytokine regulator of Th17 cell development (Happel, Zheng et al. 2003, Murphy, Langrish et al. 2003, Ghilardi, Kljavin et al. 2004, Schulz, Kohler et al. 2008, Riol-Blanco, Lazarevic et al. 2010), and clinical studies have shown a central role for the Th17 axis in psoriasis (Blauvelt 2008). Genetic studies have also linked variation in the IL-23p19,

112

Final Discussion IL-12B and IL-23R genes with psoriasis (Capon, Di Meglio et al. 2007, Cargill, Schrodi et al. 2007, Nair, Duffin et al. 2009). Keratinocytes and dermal DCs secrete IL-23, which then activates Th17 cells to produce the pro-inflammatory cytokines IL-17, IL-21 and IL-22 (Lee, Trepicchio et al. 2004, Piskin, Sylva-Steenland et al. 2006, Wilson, Boniface et al. 2007, Manel, Unutmaz et al. 2008). These cytokines further activate keratinocytes, which secrete pro-inflammatory cytokines, chemokines and antimicrobial peptides. The secretion of the CCL20 chemokine by keratinocytes also recruits Th17 cells, thereby sustaining and amplifying skin inflammation (Harper, Guo et al. 2009). Therapeutic approaches targeting IL-23 are now being developed to treat psoriatic lesions and other inflammatory disorders (Kimball, Gordon et al. 2008, Leonardi, Kimball et al. 2008, Kimball, Gordon et al. 2011). Most existing literature would suggest that IL-23 has a negative role in wound healing. For example, IL-17 expression delayed wound closure and an anti-IL-17 blocking antibody restored wound closure (Rodero, Hodgson et al. 2013). Furthermore, Il-12p40-/- mice showed accelerated wound healing capabilities (Matias, Saunus et al. 2011). However, this is not always the case; IL-23 was reported to be required for the normal healing of myocardia after ischemic injury (Savvatis, Pappritz et al. 2013). It is possible that there is an alternative role for IL- 23p19, as opposed to IL-23, in wound healing. Consistent with the selective upregulation of IL- 23p19 mRNA expression in keratinocytes in response to poly(IC) that I observed (Chapter 3), IL- 23p19 was selectively upregulated in UV-damaged keratinocytes (Kennedy-Crispin, Billick et al. 2012). Hence, there is a possibility that IL-23p19 may have a distinct role to IL-23 during keratinocyte injury and skin repair.

In this thesis, I found that poly(IC) robustly induced the mRNA expression of IL-23p19 and EBI3, but not other members of IL-12 cytokine family in keratinocytes. Therefore, it is unlikely that keratinocytes secrete IL-23, which is a combination of IL-12p40 and IL-23p19. Although IL-23p19 and EBI3 have not previously been reported to heterodimerize, it is possible that they do interact since they are α and β sub-units of this cytokine family. EBI3-containing cytokines of the IL-12 cytokine family (IL-27 and IL-35) have more immunosuppressive roles (Banchereau, Pascual et al. 2012). Therefore it is tempting to speculate that a IL-23p19/EBI3 heterodimer, if it indeed exists, may have an immunosuppressive role in skin injury or inflammatory disorders like psoriasis. IL- 12p40 has been reported to form a functional homodimer, which has been shown to suppress Treg cells (Ling, Gately et al. 1995, Gately, Carvajal et al. 1996, Brahmachari and Pahan 2009). Therefore, it is also possible that IL-23p19 could form a homodimer that may have a role in suppression of Th17 cell development and/or function. Also, IL-27p28 has been reported to function as a monomer, IL-30, which binds to the gp130 receptor and acts as a natural antagonist of signalling in the absence of EBI3 (Dibra, Cutrera et al. 2012, Garbers, Spudy et al. 2013). Thus, a

113

Final Discussion third possibility is that IL-23p19 functions as a monomer in antagonizing inflammatory responses in the absence of IL-12p40. Experimental evidence is now required to establish where any of these hypotheses hold true. The IL-23R, which recognizes IL-23p19, is primarily expressed by T cells and NK cells (Parham, Chirica et al. 2002); while WSX-1 receptor, which recognizes EBI3, is expressed by various leukocyte populations including T cells, NK cells, monocytes and mast cells (Pflanz, Hibbert et al. 2004). This suggests that T cells and NK cells would be the likely cellular targets of the IL-23p19/EBI3 heterodimer, the IL-23p19/IL-23p19 homodimer or the IL-23p19 monomer.

6.2.4 A proposed model for IRF6 involvement in TLR3 signalling The proposed model for IRF6 involvement in TLR3-regulated keratinocyte responses is summarised in Figure 6.2. In brief, detection of dsRNA released from damaged cells such as UVB- damaged cells, initiates wound repair via TLR3 (Lai, Di Nardo et al. 2009, Bernard, Cowing-Zitron et al. 2012). This results in the selective upregulation of IL-23p19 and EBI3, the former in an IRF6- dependent manner. IL-23p19 alone, or as a heterodimer with EBI3, has an immunosuppressive role in skin inflammation, thereby contributing to wound healing.

6.3 The roles of IRF6 in MyD88-dependent TLR signalling in keratinocytes

6.3.1 Why are most of the MyD88-dependent TLRs inactive in keratinocytes? Other studies have demonstrated that keratinocytes express functional TLRs (Baker, Ovigne et al. 2003, Mempel, Voelcker et al. 2003, Pivarcsi, Bodai et al. 2003, Pivarcsi, Koreck et al. 2004, Kollisch, Kalali et al. 2005). In this thesis, I found that keratinocytes primarily responded to the TLR3 ligand poly(IC), the TLR7 ligand Imiquimod and the TLR2/6 ligand FSL-1, whilst most of the other TLR ligands were inactive. This contrasts somewhat with previous literature (Baker, Ovigne et al. 2003, Mempel, Voelcker et al. 2003, Pivarcsi, Bodai et al. 2003, Kollisch, Kalali et al. 2005), where some of the TLR ligands that were inactive in my studies induced robust inflammatory responses in the former studies (as discussed in detail in Section 3.3.2). Given that IL-8 was used as my primary screen for TLR responsiveness and that this is a generic target of most TLRs (Eckmann, Kagnoff et al. 1993, Schulte, Wattiau et al. 1996, Kollisch, Kalali et al. 2005, Olaru and Jensen 2010), it seems unlikely that the receptors are active and that I was examining the wrong downstream target. The lack of response to most MyD88-dependent TLR agonists begs the question of what the physiological reason is for this lack of response.

114

Final Discussion

115

Final Discussion

Figure 6.2. A proposed model for IRF6 involvement in TLR3 signalling. An overview of this model, as well as existing evidence to support it, is as follows: (1) TLR3 is activated by dsRNA released during cell-damage relays signalling via TRIF to initiate signalling (Kawai and Akira 2007, Lai, Di Nardo et al. 2009, Bernard, Cowing-Zitron et al. 2012); (2) TRIF-dependent signalling activates kinases, possibly TBK-1, to enable phosphorylation of IRF6 (preliminary data using mutated IRF6 with phosphomimetic glutamic acid replacement of Ser residues, data not shown); (3) Poly(IC) promotes IRF6 nuclear translocation (Figure 4.7) (Bailey and Hendrix 2008); (4) IRF6 is required for Poly(IC)-inducible IL-23p19 expression (Figures 4.3-4.5) while it activates EBI3 in an IRF6-independent manner, likely via NF-κB (Figure 4.3) (Wirtz, Becker et al. 2005, Poleganov, Bachmann et al. 2008); (5) Poly(IC) induces IFN-β in an IRF3-dependent fashion (Figures 4.3-4.4); (6) Autocrine factors, such as IFN-β, may activate IRF6 through autocrine signalling; (7) IL-23p19, produced in an IRF6-dependent manner, may function as a monomer, homodimer or interact with EBI3 to form a heterodimer (experimental evidence required), resulting in functions in wound repair.

116

Final Discussion The epidermis of the skin is constitutively exposed to microbes as a result of its microflora. Therefore, immune responses must be tightly controlled to avoid inappropriate inflammation (Lai and Gallo 2008, Miller 2008, Feldmeyer, Werner et al. 2010, Terhorst, Kalali et al. 2010). Keratinocytes must, therefore, employ tolerance mechanisms to ensure that inflammatory responses are elicited upon detection of pathogenic microorganisms, rather than commensals. One mechanism that enables this is the differential expression of TLRs in the outer versus inner layers of the epidermis (Miller, Sorensen et al. 2005, Begon, Michel et al. 2007, Li, Sohn et al. 2013), and this will be discussed further in Section 6.4.1. However, TLRs are not necessarily absent from keratinocytes in the outermost layers, suggesting that other mechanisms may be at play. One study on IECs showed that these cells were largely unresponsive to TLR2-dependent bacterial ligands, although they expressed TLR1, 2 and 6 (Melmed, Thomas et al. 2003). It also reported that these cells express high levels of Tollip, an inhibitor of TLR signalling (Melmed, Thomas et al. 2003). This suggests that IECs are refractory to TLR-signalling, by virtue of high basal levels of Tollip. Keratinocytes may also express high levels of inhibitory molecules that constrain MyD88- dependent signalling, which could account for my observations (Figures 3.3-3.4). Although it is possible that additional stimuli, such as IFN-γ, may permit responsiveness, my studies with imiquimod do not support such a model (Figures 5.4-5.5). However, due to time constraints, the effect of IFN-γ priming on other MyD88-dependent TLR ligands was not investigated. Hence, this possibility cannot be excluded.

6.3.2 The role of IRF6 in MyD88-dependent TLR signalling In my studies, I identified a role for IRF6 in MyD88-dependent TLR signalling. IRF6 was required for TLR7-inducible IFN-β and CCL5 mRNA expression (Figure 5.2), and may also mediate TLR2/6-dependent CCL5 and IL-23p19 expression (Figure 5.7). Potential role(s) of IL-23p19 in skin inflammation were discussed above (Section 6.2.3). CCL5, a member of the CC chemokine family, recruits leukocytes to the sites of inflammation (Lapteva and Huang 2010, Katsounas, Schlaak et al. 2011). CCL5 acts via the CCR5 receptor, which is primarily expressed by T cells, macrophages, DCs and microglia (Granelli-Piperno, Moser et al. 1996, Raport, Gosling et al. 1996, Albright, Shieh et al. 1999). CCL5/CCR5 preferentially activates T cells (Stanford and Issekutz 2003) and gene knockout studies in mice have shown that Ccl5 is important for T cell proliferation and inflammatory responses (IFN-γ, IL-2) (Makino, Cook et al. 2002). In skin, CCL5 has been associated with immune disorders of the skin such as AD by virtue of its capacity to promote Th2 responses (Yamada, Izutani et al. 1996, Giustizieri, Mascia et al. 2001, Kaburagi, Shimada et al. 2001). Moreover, CCL5 expression was elevated in AD skin as compared to normal skin (Yamada, 117

Final Discussion Izutani et al. 1996). IFN-β is critical for anti-viral responses and is a key target of TLRs such as TLR7 that recognize viral components (Bonjardim, Ferreira et al. 2009). However, the biological function of IFN-β is not limited to anti-viral activities alone. IFN-β also has anti-proliferative and immunomodulatory effects both in vivo and in vitro (Bekisz, Baron et al. 2010). It inhibits proliferation of keratinocytes (Yaar, Karassik et al. 1985, Bielenberg, McCarty et al. 1999), and IFN-based therapy has been used for the treatment of several tumours, including SCCs (Nickoloff, Basham et al. 1985, Naito, Baba et al. 1992, Ismail and Yusuf 2014). Human SCCs expressed reduced levels of IFN-β and genes downstream of IFN-signalling, STATα/β when compared to normal skin (Clifford, Menter et al. 2000). These studies suggest a role for reduced IFN-β expression in the progression of SCC. Since both TLR7 and IRF6 can regulate SCC development (discussed in Sections 6.3.3 and 6.3.4), the IRF6-dependent induction of IFN-β expression upon TLR7 activation (e.g. in response to imiquimod), may contribute to therapeutic effects against SCC. Other than IFN-β, CCL5 and IL-23p19, IRF6 may also have other target genes downstream of MyD88-dependent TLR signalling. Two potential candidates are IL-37 and IL-36γ (discussed in Section 6.2.2). Another potential IRF6 target gene that may be relevant in MyD88-dependent TLR signalling is CXCL16 (Botti, Spallone et al. 2011). CXCL16 is a chemotractant for leukocytes that express its receptor CXC receptor 6, such as T cells, NK T cells, Th1 cells (Matloubian, David et al. 2000, Wilbanks, Zondlo et al. 2001). CXCL16 has also been shown to mediate phagocytosis of bacteria such as E. coli and S. aureus and is also elevated in skin inflammatory conditions, such as psoriasis (Tohyama, Sayama et al. 2007, Oh, Schramme et al. 2009, Gunther, Carballido-Perrig et al. 2012). Thus, CXCL16 is an important chemokine mediating inflammatory responses in epidermis. Whether the genes encoding these cytokines lie downstream of MyD88-dependent (and IRF6-dependent) TLR signalling in keratinocytes is worthy of further investigation.

The trans-activating capacity of IRFs is regulated by their phosphorylation status (Ozato, Tailor et al. 2007). IRF6 also possesses Ser residues that are conserved with those that are phosphorylated in other IRFs (S413 and S424, Figure 5.9), suggesting that IRF6 may be phosphorylated by kinases downstream of TLR signalling (Honda and Taniguchi 2006). Co-immunoprecipitation studies from the laboratory of A/Prof. Glen Scholz have shown that IRF6 transiently interacts with IRAK-1 (A/Prof. Glen Scholz, personal communication), a key serine/threonine kinase required for MyD88- dependent signalling (Cao, Henzel et al. 1996, Takeda and Akira 2004). Thus, MyD88-dependent TLR signalling may activate IRF6 via IRAK-1. Whereas IRF5 and IRF7 have been reported to directly interact with MyD88 (Kawai, Sato et al. 2004, Balkhi, Fitzgerald et al. 2008), IRF6 did not interact with MyD88 in co-immunoprecipitation studies (A/Prof. Glen Scholz, personal communication). Mutational analysis of S413 and S424 in IRF6 suggest that both residues are

118

Final Discussion important for trans-activator function, with S424 being the likely target for phosphorylation by IRAK-1 (A/Prof. Glen Scholz, personal communication). However, more detailed biochemical analysis is required to validate this model.

6.3.3 The roles of TLR7 in skin pathology The TLR7 agonist imiquimod is a potent immunomodulator that has been used to treat several skin disorders, including SCC, basal cell carcinoma and even malignant melanoma (Bong, Bonnekoh et al. 2002, Geisse, Rich et al. 2002, Novak, Yu et al. 2008). It is presumed that TLR7-driven inflammatory responses enable the recruitment of key inflammatory cells, particularly T-cells, which then elicit cellular responses against cancerous cells (Panelli, Stashower et al. 2007, Clark, Huang et al. 2008, Huang, Hijnen et al. 2009, Yokogawa, Takaishi et al. 2013). The leukocyte recruitment profile of imiquimod also results in the dilution of the percentage of Treg cells in the skin, thus restoring effective T-cell responses that are usually inhibited by Treg cells (Clark, Huang et al. 2008). Imiquimod also regulates the functions of recruited cells. It upregulates expression of genes associated with cytotoxic T-cell functions, such as perforin and granzyme, which aids in killing of cancerous cells (Huang, Hijnen et al. 2009), and drives the production of IL-12 and IL-23 that mediate Th1 and Th17 development and activation (Yokogawa, Takaishi et al. 2013). In mouse models, imiquimod treatment enabled Th17 cell-mediated elimination of melanoma cells via IFN-γ production (Muranski, Boni et al. 2008). Interestingly, topical imiquimod application also aggravated psoriasis in humans (Gilliet, Conrad et al. 2004, Wu, Siller et al. 2004), and induced psoriasis-like lesions in mice through IL-23/Th17 axis (van der Fits, Mourits et al. 2009). Therefore, TLR7 appears to have a protective role against SCC development, while excessive activation through this receptor may predispose to the development of psoriasis.

6.3.4 The role of IRF6 in TLR7 signalling Downregulation of IRF6 expression in SCC has been reported to correlate with tumour invasiveness (Botti, Spallone et al. 2011). The decrease in IRF6 expression correlated with methylation at a specific CpG dinucleotide island within the IRF6 promoter (Botti, Spallone et al. 2011). Another study in keratinocytes has also linked IRF6 to the pro-differentiation and tumour suppressive functions of Notch signalling (Restivo, Nguyen et al. 2011). Finally, IRF6 was shown to be downstream of p63, a known tumour suppression protein (Moretti, Marinari et al. 2010). These studies thus suggest that loss of IRF6 expression could predispose to tumour development and/or progression. IRF6 functions in tumour suppression is not limited to just keratinocytes. IRF6 119

Final Discussion downregulation was also associated with more progressive and invasive breast cancer (Bailey, Khalkhali-Ellis et al. 2005). In mammary epithelial cells, phosphorylation status of IRF6 may be a key determinant of its own expression. Phosphorylation of IRF6 led to its proteosomal degradation resulting in cell proliferation, whereas non-phosphorylated IRF6 triggered cell cycle arrest and cellular differentiation (Bailey, Abbott et al. 2008). Thus, hyper-phosphorylation of IRF6 may result in loss of IRF6 expression and tumour progression, particularly since one study has provided evidence that IRF6 positively regulates its own expression (Botti, Spallone et al. 2011). This is interesting in light of the likely role of IRF6 phosphorylation in relaying MyD88-dependent signalling (see Section 6.3.2) and thus possible therapeutic effects against SCCs. It suggests that IRF6 phosphorylation may have differential roles in regulating tumour cell survival. On the one hand, TLR7-mediated IRAK-1-dependent IRF6 phosphorylation may elicit inflammatory responses to promote tumour clearance, while IRF6 phosphorylation by an unknown kinase may result in IRF6 degradation, uncontrolled cell proliferation and tumour development. An understanding of which specific kinases target IRF6 will undoubtedly provide further insights into these processes.

6.3.5 Role of TLR2/6 signalling in keratinocytes The skin is exposed to many commensal bacteria, some of which can cause mild to serious skin and soft tissue infections upon invasion into basal layers (Cogen, Nizet et al. 2008, Grice and Segre 2011). For example, S. aureus commonly causes folliculitis, impetigo and skin abscesses of the skin (Lowy 1998, Cogen, Nizet et al. 2008). Patients with AD, a Th2-driven inflammatory condition of the skin, are predisposed to S. aureus infections (Leyden, Marples et al. 1974, Hanifin and Rogge 1977, White and Noble 1986, Lubbe 2003). Patients with AD show reduced TLR2 expression and weakened barrier structure, which presumably allows opportunistic pathogens such as S. aureus to invade and cause pathology (Murata, Ogata et al. 1996, Pilgram, Vissers et al. 2001, Palmer, Irvine et al. 2006, Niebuhr, Lutat et al. 2009, De Benedetto, Rafaels et al. 2011, Kuo, Carpenter-Mendini et al. 2013). Interestingly, TLR2 has been shown to enhance tight junction barriers in both mouse and human epidermis, thereby permitting epidermal barrier defence (Kuo, Carpenter-Mendini et al. 2013). This suggests an additional role for TLR2 in epithelial function, in addition to direct recognition of Gram-positive pathogens such as S. aureus (Kuo, Carpenter-Mendini et al. 2013). Topical immunomodulators, such as pimecrolimus, have been used as an effective treatment for AD (Reitamo, Remitz et al. 2002, Stuetz, Baumann et al. 2006). Pimecrolimus is a calcineurin pathway inhibitor, and thus inhibits T cell activation and subsequent inflammatory responses (Grassberger, Baumruker et al. 1999, Kalthoff, Chung et al. 2002, Winiski, Wang et al. 2002, Winiski, Wang et al. 2007, Ehrchen, Sunderkotter et al. 2008). However, a recent study showed the pimecrolimus 120

Final Discussion enhanced anti-microbial peptide expression via the TLR2/6 pathway in keratinocytes (Buchau, Schauber et al. 2008). Pimecrolimus-mediated TLR2/6 activation also aided in the clearance of S. aureus and decreased the expression of IL-10 and IL-1β (Buchau, Schauber et al. 2008). This suggests that pimecrolimus may elicit both anti-microbial and anti-inflammatory responses via TLR2/6 signalling.

6.3.6 Role of IRF6 in anti-bacterial responses of keratinocytes In light of the above studies, it would have been interesting to examine the role of the TLR2/6-IRF6 axis in promoting anti-bacterial responses against S. aureus. Such experiments were not performed because of time constraints, however I did perform some very preliminary studies with another Gram-positive pathogen, Group A Streptococcus (GAS). GAS is also a common skin commensal, which can cause mild to serious infections, such as Necrotizing fasciitis and impetigo, upon invasion (Cogen, Nizet et al. 2008). GAS infection of HaCaT cells was reported to upregulate mRNA expression of IL-1α, IL-1β, IL-6 and IL-8 (Wang, Ruiz et al. 1997). Initially, I examined whether primary keratinocytes are able to clear intracellular GAS, which would suggest activation of anti-microbial pathways. I infected primary keratinocytes with the GAS strain JRS4 at an multiplicity of infection (MOI) of 30 and monitored intracellular bacterial loads at 4 and 8 h post infection. I found that JRS4 was able to survive in keratinocytes, and by 8 h post infection, the bacterial loads were reduced ~4 fold (Figure 6.3A). To determine whether IRF6 was involved in the clearance of JRS4, I knocked IRF6 expression down in these cells and then infected them with JRS4 for 4 and 8 h. IRF6 or IRF3 knock down did not affect JRS4 survival in keratinocytes (Figure 6.3B). This suggests that IRF6 is not required for JRS4 clearance from keratinocytes. However, IRF6 may be involved in initiating inflammatory responses (e.g. CCL5 expression) in response to Gram-positive pathogens such as GAS and S. aureus to enable appropriate leukocyte recruitment, and this requires further investigation.

121

Final Discussion

Figure 6.3. IRF6 does not affect intracellular survival of GAS within primary keratinocytes. Primary keratinocytes were infected with the GAS strain JRS4 at an MOI of 30 for 2 h. Extracellular bacteria exclusion was performed by adding gentamicin in media. (A) Cell-lysates were harvested 4 and 8 h post-infection, plated overnight on THY agar plates and intra-cellular bacterial loads were determined by colony counting. Data represents mean ± SD of experimental triplicates and is representative of 3 independent experiments. (B) IRF6 and IRF3 expression in primary human keratinocytes were knocked down using transfection with specific siRNA. These cells were then infected with the GAS strain JRS4 at an MOI of 30 for 4 and 8 h. Intracellular bacterial loads were determined as in (A). Data represents mean ± SD of experimental triplicates.

6.3.7 A proposed model for the role of IRF6 in MyD88-dependent TLR signalling A proposed model for IRF6 involvement in MyD88-dependent TLR responses in keratinocytes is summarised in Figure 6.4. In brief, imiquimod signalling via TLR7 or Gram-positive bacteria signalling via TLR2/6 engages the MyD88-IRF6 axis to drive expression of specific target genes such as IFN-β and CCL5. This may contribute to leukocyte recruitment and inflammation to enable either anti-tumour responses (TLR7) or pathogen clearance (TLR2/6).

122

Final Discussion

Figure 6.4. A proposed model for IRF6 involvement in MyD88-dependent TLR signalling. (1) TLR7, activated by ssRNA viruses or by topical application of imiquimod, engages MyD88- dependent signalling (Kawai and Akira 2006); (2) TLR2/6, activated by Gram-positive bacteria such as S. aureus, also engages MyD88-dependent signalling (Kawai and Akira 2006, Vu, Baba et al. 2010); (3) MyD88-dependent signalling activates the serine/threonine IRAK-1, which interacts with IRF6 (A/Prof. Glen Scholz, personal communication); (4) IRF6 is phosphorylated by IRAK-1 at S424 (A/Prof. Glen Scholz, personal communication); (5) IRF6 may translocate into the nucleus in response to these stimuli (Figure 5.8). (6) IRF6 promotes TLR7-mediated IFN-β and CCL5 mRNA expression (Figure 5.2), as well as (7) TLR2/6-dependent CCL5 expression (Figure 5.7, A/Prof. Glen Scholz, personal communication).

6.4 Comparison of TRIF- and MyD88-dependent TLR responses in keratinocytes

6.4.1 IRF6 expression in proliferating versus differentiated keratinocytes As mentioned in Section 6.3.1, keratinocytes may employ specific tolerance mechanisms to prevent excessive MyD88-driven inflammation. One reported mechanism by which this occurs is via 123

Final Discussion differential expression of TLRs in the outer differentiated cells versus inner proliferating cells (Miller, Sorensen et al. 2005, Begon, Michel et al. 2007, Li, Sohn et al. 2013). That is, the more differentiated cells in the outer layers of skin have been reported to express higher levels of TLRs recognizing viral components, for example TLR7 (Miller, Sorensen et al. 2005, Begon, Michel et al. 2007, Li, Sohn et al. 2013). In contrast, TLRs detecting bacterial components were reported to be more highly expressed in cells within the basal layers, thus enabling initiation of inflammatory responses upon bacterial invasion of the skin (Baker, Ovigne et al. 2003, Pivarcsi, Bodai et al. 2003, Miller, Sorensen et al. 2005, Begon, Michel et al. 2007). However, my data suggested that TLR expression in differentiated and proliferating cells were mostly comparable, at least at the mRNA level (Figure 3.8). In contrast, IRF6 expression was higher in differentiated cells as compared to proliferating cells (Figure 3.7), which is consistent with existing literature (Richardson, Dixon et al. 2006, Moretti, Marinari et al. 2010, Botti, Spallone et al. 2011, Restivo, Nguyen et al. 2011, Biggs, Rhea et al. 2012). This regulated expression of IRF6 may help to fine-tune TLR-driven inflammatory responses. Interestingly, I found that the keratinocyte differentiation state did not affect TLR3 responses (Figures 3.9 and 4.10), whereas TLR7 responses were stronger in differentiated cells as compared to proliferating cells (Figure 5.3). This suggests that keratinocyte differentiation may selectively permit MyD88-dependent TLR signalling. In a preliminary experiment further examining this hypothesis, I observed that the TLR1/2 agonist Pam3Cys, which did not activate inflammatory gene expression in keratinocytes (Figures 3.3-3.4), did upregulate CCL5 expression in keratinocytes after differentiation (data not shown). It is tempting to speculate that the enhanced responsiveness of differentiated keratinocytes to MyD88-dependent TLR agonist is mediated through enhanced IRF6 expression.

6.4.2 Interplay between IFN-γ priming and differentiation status on TLR responses Since primary keratinocytes were largely unresponsive to most MyD88-dependent TLR ligands, I considered the possibility that priming these cells with an additional pro-inflammatory stimulus such as IFN- would permit responsiveness. IFN-γ priming itself had little effect on MyD88- dependent TLR responses (Figure 5.4), and I therefore examined the effect of IFN-γ priming after keratinocytes had been differentiated. Although differentiated keratinocytes responded strongly to imiquimod (Figure 5.3), IFN-γ priming did not further enhance TLR7 responses in these cells (Figure 5.5). However, IFN-γ priming did differentially regulate TLR3-dependent IFN-β and IL- 23p19 induction upon differentiation. Whereas poly(IC)-inducible IFN-β and IL-23p19 expression was not greatly affected by differentiation status in unprimed cells (Figure 4.10A and B), these responses were affected when cells were primed with IFN-γ. That is, IFN-γ primed, differentiated 124

Final Discussion keratinocytes showed decreased IFN-β and increased IL-23p19 gene expression when compared to IFN-γ primed, proliferating keratinocytes (Figure 4.10A and B). Given that poly(IC)-inducible IFN-β and IL-23p19 mRNA expression was differentially affected by IRF6 (Figures 4.3D and E, 4.4C and D), it is tempting to speculate that IFN-γ priming selectively enhances IRF6 function in differentiated keratinocytes. Overall, my data suggests that there are key differences in MyD88- versus TRIF-dependent TLR signalling in keratinocytes upon differentiation (Figure 6.5). Since TLR mRNA expression in proliferating and differentiated keratinocytes were similar (Figure 3.8), downstream signalling molecules, such as IRF6, may contribute to these effects.

Figure 6.5. A proposed model for IRF6 involvement TLR signalling during keratinocyte differentiation. (1) IRF6 expression is increased during differentiation (Figure 3.7), while TLR mRNA expression is unaffected (Figure 3.8); (2) In proliferating cells, TLR2 expression is higher (Baker, Ovigne et al. 2003, Pivarcsi, Bodai et al. 2003, Begon, Michel et al. 2007), and therefore they are more responsive to the TLR2/6 agonist FSL-1 (compared to differentiated cells) (Figures 5.6 and 5.7); (3) In contrast to TLR2, TLR7 expression is higher in differentiated cells (Li, Sohn et al. 2013), and TLR7-mediated responses are enhanced (compared to proliferating cells) (Figures 5.1-5.3); (4) In response to poly(IC), IFN-γ primed, differentiated keratinocytes showed decreased IFN-β and increased IL-23p19 gene expression when compared to IFN-γ primed, proliferating keratinocytes (Figure 4.10).

125

Final Discussion 6.5 Future Directions

6.5.1 Limitations of this thesis and future experiments In this section, I outline some of the major limitations of this thesis, and also highlight additional experiments that are required to further test hypotheses proposed in this chapter.

One key deficiency of my studies is that, although I characterized TLR-regulated gene expression in keratinocytes, I did not perform complementary studies examining proximal TLR signalling events, for example NF-κB and MAPK activation. From gene knockdown studies, I found that IRF6 only partially controls poly(IC)-inducible IL-23p19 expression in keratinocytes. The IL-23p19 promoter contains binding sites for both IRF and NF-κB (Figure 4.6A), and NF-κB has previously been shown to regulate IL-23p19 expression in macrophages and DCs (Carmody, Ruan et al. 2007, Mise- Omata, Kuroda et al. 2007). Therefore, it is possible that IRF6 cooperates with NF-κB to regulate poly(IC)-inducible IL-23p19 expression. Thus, poly(IC)-mediated NF-κB activation in keratinocytes could have been assessed by gel shift assays and/or immunoblotting (IB degradation and/or p65 phosphorylation). Moreover, inhibitors of the NF-κB pathway could have been used to determine whether this affected poly(IC)-inducible IL-23p19 gene expression, either alone or in combination with IRF6 knock-down. Interestingly, MyD88-dependent ligands did trigger robust mRNA expression of IL-8 and subsequent release of this chemokine, whereas induction of IFN-β, CCL5 and IL-23p19 was modest by comparison (Figures 5.1, 5.6). This would suggest that MyD88 ligands do efficiently activate NF-κB in these cells, since IL-8 is a classic NF-κB target gene (Mukaida, Mahe et al. 1990, Kunsch and Rosen 1993, Matsusaka, Fujikawa et al. 1993, Stein and Baldwin 1993, Kunsch, Lang et al. 1994), whereas IRF-dependent signalling may be somehow constrained. This could have also been assessed through direct monitoring of proximal signalling pathways in response to MyD88-dependent TLR agonists.

There are several outstanding issues regarding the involvement of IRF6 in TLR3 signalling. Firstly, the mechanism by which TRIF signalling activates IRF6 is unknown. TBK1 is a central kinase in TRIF signalling, yet this kinase did not synergize with IRF6 in activating the IFN- promoter (A/Prof Glen Scholz, personal communication). Notably however, I found that IRF6 did not positively regulate poly(IC)-inducible IFN- expression (Figures 4.3D and 4.4C), so the effect of co-transfection of TBK1 and IRF6 on IL-23p19 promoter activity could be examined in the future. It is also possible that IRF6 regulates IL-23p19 through secondary mechanisms, for example via autocrine IFN-. In this case, other kinases may be involved in regulating IRF6 function. Since S413 and S424 within IRF6 have already been identified as key aa regulating the function of this transcription factor (A/Prof Glen Scholz, personal communication), it is quite likely that 126

Final Discussion phosphorylation of one or both of these residues is required for activation of the IL-23p19 promoter. Hence, specific IRF6 mutants predicted to abolish function (S413A, S424A, S413A/S424A) or to be constitutively active (S413E, S424E, S413E/S424E) could be used to examine effects on the endogenous IL-23p19 gene (e.g. overexpression in T24 cells, see Figure 4.5) or the IL-23p19 promoter (e.g. promoter-reporter studies in RAW264.7 cells, see Figure 4.6). IL-23p19 promoter- reporter studies in RAW264 cells could also be used to screen for upstream kinases regulating IRF6. Another outstanding issue relating to the studies on poly(IC) responses in keratinocytes concerns the selective regulation of IL-23p19 and EBI3. Since EBI3 and IL-23p19 encode α and β sub-units of the IL-12 family, it is possible that IL-23p19 and EBI3 can interact to form a functional heterodimer. Co-immunoprecipitation studies in cells transfected with IL-23p19 and EBI3 expression constructs represent a logical first step in examining this hypothesis. If an interaction could be confirmed, it would certainly be interesting to determine whether this heterodimer regulates cell repair and wound healing in an in vivo model.

With respect to MyD88-dependent TLR signalling, I showed that keratinocytes respond to both TLR7 and TLR2/6 agonists. A link between this TLR signalling arm and IRF6 is also supported by the observation that IRAK-1 interacts transiently with IRF6 (A/Prof. Glen Scholz, personal communication). Interestingly, I found that the differentiation status of keratinocytes appeared to affect TLR7-inducible gene expression. A detailed time-course of IRF6 and TLR7 expression during differentiation would enable a better understanding of the molecular mechanisms contributing to this effect. The reverse phenomenon may be true for TLR2 responsiveness, since the expression of this receptor is reportedly higher in keratinocytes in the basal layer, as compared to differentiated cells (Baker, Ovigne et al. 2003, Pivarcsi, Bodai et al. 2003, Begon, Michel et al. 2007). Thus, it would be of interest to examine the effect of keratinocyte differentiation on TLR2/6 responses, and to compare and contrast these findings with TLR7 responsiveness. If proliferative cells do indeed respond better to FSL-1, IRF6 gene knockdown studies could be performed by adding Y27632 to the media of transfecting keratinocytes to maintain them in a proliferative state. This may provide a more robust system to examine TLR2/6 responses in keratinocytes, as well as the specific involvement of IRF6. Additionally, whether TLR2/6 and/or TLR7 signalling promote IRF6 nuclear translocation in proliferating and differentiated keratinocytes requires careful examination. Finally, the roles of IRF6 in regulating both inflammatory and antimicrobial responses against Gram-positive pathogens such as S. aureus and GAS should be investigated to gain an understanding of what role, if any, this transcription factor plays in host responses to pathogens of the skin.

127

Final Discussion 6.5.2 Conclusion In summary, I have shown that IRF6 is an epithelial cell-specific member of the IRF family, and that it is particularly highly expressed in keratinocytes. I have identified putative roles for IRF6 in both MyD88-dependent and TRIF-dependent TLR signalling in these cells. My data thus posit IRF6 as an important signalling component of pro-inflammatory responses in keratinocytes. Ultimately, the findings from this project should enhance our understanding of the molecular mechanisms contributing to both effective host defence and dysregulated inflammation in the skin.

128

References

7 References

129

References Abbott, D. W., A. Wilkins, J. M. Asara and L. C. Cantley (2004). "The Crohn's disease protein, NOD2, requires RIP2 in order to induce ubiquitinylation of a novel site on NEMO." Curr Biol 14(24): 2217-2227.

Abeyama, K., W. Eng, J. V. Jester, A. A. Vink, D. Edelbaum, C. J. Cockerell, P. R. Bergstresser and A. Takashima (2000). "A role for NF-kappaB-dependent gene transactivation in sunburn." J Clin Invest 105(12): 1751-1759.

Acheson, D. W. and S. Luccioli (2004). "Microbial-gut interactions in health and disease. Mucosal immune responses." Best Pract Res Clin Gastroenterol 18(2): 387-404.

Adamo, R., S. Sokol, G. Soong, M. I. Gomez and A. Prince (2004). "Pseudomonas aeruginosa flagella activate airway epithelial cells through asialoGM1 and toll-like receptor 2 as well as toll- like receptor 5." Am J Respir Cell Mol Biol 30(5): 627-634.

Agostini, L., F. Martinon, K. Burns, M. F. McDermott, P. N. Hawkins and J. Tschopp (2004). "NALP3 forms an IL-1beta-processing inflammasome with increased activity in Muckle-Wells autoinflammatory disorder." Immunity 20(3): 319-325.

Akira, S. (2006). "TLR signaling." Curr Top Microbiol Immunol 311: 1-16.

Akira, S., S. Uematsu and O. Takeuchi (2006). "Pathogen recognition and innate immunity." Cell 124(4): 783-801.

Aksoy, E., W. Vanden Berghe, S. Detienne, Z. Amraoui, K. A. Fitzgerald, G. Haegeman, M. Goldman and F. Willems (2005). "Inhibition of phosphoinositide 3-kinase enhances TRIF- dependent NF-kappa B activation and IFN-beta synthesis downstream of Toll-like receptor 3 and 4." Eur J Immunol 35(7): 2200-2209.

Al-Salleeh, F. and T. M. Petro (2008). "Promoter analysis reveals critical roles for SMAD-3 and ATF-2 in expression of IL-23 p19 in macrophages." J Immunol 181(7): 4523-4533.

Albanesi, C., C. Scarponi, S. Sebastiani, A. Cavani, M. Federici, S. Sozzani and G. Girolomoni (2001). "A cytokine-to-chemokine axis between T lymphocytes and keratinocytes can favor Th1 cell accumulation in chronic inflammatory skin diseases." J Leukoc Biol 70(4): 617-623.

Albright, A. V., J. T. Shieh, T. Itoh, B. Lee, D. Pleasure, M. J. O'Connor, R. W. Doms and F. Gonzalez-Scarano (1999). "Microglia express CCR5, CXCR4, and CCR3, but of these, CCR5 is the principal coreceptor for human immunodeficiency virus type 1 dementia isolates." J Virol 73(1): 205-213. 130

References Albright, C. D., R. T. Jones, E. A. Hudson, J. A. Fontana, B. F. Trump and J. H. Resau (1990). "Transformed human bronchial epithelial cells (BEAS-2B) alter the growth and morphology of normal human bronchial epithelial cells in vitro." Cell Biol Toxicol 6(4): 379-398.

Alexopoulou, L., A. C. Holt, R. Medzhitov and R. A. Flavell (2001). "Recognition of double- stranded RNA and activation of NF-kappaB by Toll-like receptor 3." Nature 413(6857): 732-738.

Altenburger, R. and T. Kissel (1999). "The human keratinocyte cell line HaCaT: an in vitro cell culture model for keratinocyte testosterone metabolism." Pharm Res 16(5): 766-771.

Amieva, M. R., N. R. Salama, L. S. Tompkins and S. Falkow (2002). "Helicobacter pylori enter and survive within multivesicular vacuoles of epithelial cells." Cell Microbiol 4(10): 677-690.

Anders, H. J. and D. Schlondorff (2007). "Toll-like receptors: emerging concepts in kidney disease." Curr Opin Nephrol Hypertens 16(3): 177-183.

Anders, H. J., V. Vielhauer, V. Eis, Y. Linde, M. Kretzler, G. Perez de Lema, F. Strutz, S. Bauer, M. Rutz, H. Wagner, H. J. Grone and D. Schlondorff (2004). "Activation of toll-like receptor-9 induces progression of renal disease in MRL-Fas(lpr) mice." FASEB J 18(3): 534-536.

Anderson, K. V., G. Jurgens and C. Nusslein-Volhard (1985). "Establishment of dorsal-ventral polarity in the Drosophila embryo: genetic studies on the role of the Toll gene product." Cell 42(3): 779-789.

Ariizumi, K., G. L. Shen, S. Shikano, S. Xu, R. Ritter, 3rd, T. Kumamoto, D. Edelbaum, A. Morita, P. R. Bergstresser and A. Takashima (2000). "Identification of a novel, dendritic cell-associated molecule, dectin-1, by subtractive cDNA cloning." J Biol Chem 275(26): 20157-20167.

Armstrong, L., A. R. Medford, K. M. Uppington, J. Robertson, I. R. Witherden, T. D. Tetley and A. B. Millar (2004). "Expression of functional toll-like receptor-2 and -4 on alveolar epithelial cells." Am J Respir Cell Mol Biol 31(2): 241-245.

Au, W. C., P. A. Moore, D. W. LaFleur, B. Tombal and P. M. Pitha (1998). "Characterization of the interferon regulatory factor-7 and its potential role in the transcription activation of interferon A genes." J Biol Chem 273(44): 29210-29217.

Au, W. C., P. A. Moore, W. Lowther, Y. T. Juang and P. M. Pitha (1995). "Identification of a member of the interferon regulatory factor family that binds to the interferon-stimulated response element and activates expression of interferon-induced genes." Proc Natl Acad Sci U S A 92(25): 11657-11661. 131

References Aufiero, B., M. Guo, C. Young, Z. Duanmu, H. Talwar, H. K. Lee and G. J. Murakawa (2007). "Staphylococcus aureus induces the expression of tumor necrosis factor-alpha in primary human keratinocytes." Int J Dermatol 46(7): 687-694.

Awasthi, A., Y. Carrier, J. P. Peron, E. Bettelli, M. Kamanaka, R. A. Flavell, V. K. Kuchroo, M. Oukka and H. L. Weiner (2007). "A dominant function for interleukin 27 in generating interleukin 10-producing anti-inflammatory T cells." Nat Immunol 8(12): 1380-1389.

Baccala, R., R. Gonzalez-Quintial, B. R. Lawson, M. E. Stern, D. H. Kono, B. Beutler and A. N. Theofilopoulos (2009). "Sensors of the innate immune system: their mode of action." Nat Rev Rheumatol 5(8): 448-456.

Backhed, F., M. Soderhall, P. Ekman, S. Normark and A. Richter-Dahlfors (2001). "Induction of innate immune responses by Escherichia coli and purified lipopolysaccharide correlate with organ- and cell-specific expression of Toll-like receptors within the human urinary tract." Cell Microbiol 3(3): 153-158.

Bacon, C. M., E. F. Petricoin, 3rd, J. R. Ortaldo, R. C. Rees, A. C. Larner, J. A. Johnston and J. J. O'Shea (1995). "Interleukin 12 induces tyrosine phosphorylation and activation of STAT4 in human lymphocytes." Proc Natl Acad Sci U S A 92(16): 7307-7311.

Baghestani, S., N. Sadeghi, M. Yavarian and H. Alghasi (2010). "Lower Lip Pits in a Patient With van der Woude Syndrome." J Craniofac Surg 21(5): 1380-1381.

Bailey, C. M., D. E. Abbott, N. V. Margaryan, Z. Khalkhali-Ellis and M. J. C. Hendrix (2008). "Interferon regulatory factor 6 promotes cell cycle arrest and is regulated by the proteasome in a cell cycle-dependent manner." Mol Cell Biol 28(7): 2235-2243.

Bailey, C. M. and M. J. C. Hendrix (2008). "IRF6 in development and disease - A mediator of quiescence and differentiation." Cell Cycle 7(13): 1925-1930.

Bailey, C. M., Z. Khalkhali-Ellis, S. Kondo, N. V. Margaryan, R. E. B. Seftor, W. W. Wheaton, S. Amir, M. R. Pins, B. C. Schutte and M. J. C. Hendrix (2005). "Mammary serine protease inhibitor (maspin) binds directly to interferon regulatory factor 6 - Identification of a novel serpin partnership." J Biol Chem 280(40): 34210-34217.

Bailey, C. M., Z. Khalkhali-Ellis, E. A. Seftor and M. J. Hendrix (2006). "Biological functions of maspin." J Cell Physiol 209(3): 617-624.

132

References Bailey, C. M., N. V. Margaryan, D. E. Abbott, B. C. Schutte, B. L. Yang, Z. Khalkhali-Ellis and M. J. C. Hendrix (2009). "Temporal and spatial expression patterns for the tumor suppressor Maspin and its binding partner interferon regulatory factor 6 during breast development." Dev Growth Differ 51(5): 473-481.

Baker, B. S., J. M. Ovigne, A. V. Powles, S. Corcoran and L. Fry (2003). "Normal keratinocytes express Toll-like receptors (TLRs) 1, 2 and 5: modulation of TLR expression in chronic plaque psoriasis." Br J Dermatol 148(4): 670-679.

Baker, B. S., A. V. Powles, H. Valdimarsson and L. Fry (1988). "An altered response by psoriatic keratinocytes to gamma interferon." Scand J Immunol 28(6): 735-740.

Balashov, K. E., D. R. Smith, S. J. Khoury, D. A. Hafler and H. L. Weiner (1997). "Increased interleukin 12 production in progressive multiple sclerosis: induction by activated CD4+ T cells via CD40 ligand." Proc Natl Acad Sci U S A 94(2): 599-603.

Balkhi, M. Y., K. A. Fitzgerald and P. M. Pitha (2008). "Functional regulation of MyD88-activated interferon regulatory factor 5 by K63-linked polyubiquitination." Mol Cell Biol 28(24): 7296-7308.

Bambou, J. C., A. Giraud, S. Menard, B. Begue, S. Rakotobe, M. Heyman, F. Taddei, N. Cerf- Bensussan and V. Gaboriau-Routhiau (2004). "In vitro and ex vivo activation of the TLR5 signaling pathway in intestinal epithelial cells by a commensal Escherichia coli strain." J Biol Chem 279(41): 42984-42992.

Banchereau, J., V. Pascual and A. O'Garra (2012). "From IL-2 to IL-37: the expanding spectrum of anti-inflammatory cytokines." Nat Immunol 13(10): 925-931.

Banerjee, A., R. Gugasyan, M. McMahon and S. Gerondakis (2006). "Diverse Toll-like receptors utilize Tpl2 to activate extracellular signal-regulated kinase (ERK) in hemopoietic cells." Proc Natl Acad Sci U S A 103(9): 3274-3279.

Bari, L., S. Bacsa, E. Sonkoly, Z. Bata-Csorgo, L. Kemeny, A. Dobozy and M. Szell (2011). "Comparison of stress-induced PRINS gene expression in normal human keratinocytes and HaCaT cells." Arch Dermatol Res 303(10): 745-752.

Barker, C. L., M. T. McHale, A. K. Gillies, J. Waller, D. M. Pearce, J. Osborne, P. E. Hutchinson, G. M. Smith and J. H. Pringle (2004). "The development and characterization of an in vitro model of psoriasis." J Invest Dermatol 123(5): 892-901.

133

References Barker, J. N., J. R. Goodlad, E. L. Ross, C. C. Yu, R. W. Groves and D. M. MacDonald (1993). "Increased epidermal cell proliferation in normal human skin in vivo following local administration of interferon-gamma." Am J Pathol 142(4): 1091-1097.

Barker, J. N., M. L. Jones, R. S. Mitra, E. Crockett-Torabe, J. C. Fantone, S. L. Kunkel, J. S. Warren, V. M. Dixit and B. J. Nickoloff (1991). "Modulation of keratinocyte-derived interleukin-8 which is chemotactic for neutrophils and T lymphocytes." Am J Pathol 139(4): 869-876.

Barker, J. N., R. S. Mitra, C. E. Griffiths, V. M. Dixit and B. J. Nickoloff (1991). "Keratinocytes as initiators of inflammation." Lancet 337(8735): 211-214.

Barker, J. N., V. Sarma, R. S. Mitra, V. M. Dixit and B. J. Nickoloff (1990). "Marked synergism between tumor necrosis factor-alpha and interferon-gamma in regulation of keratinocyte-derived adhesion molecules and chemotactic factors." J Clin Invest 85(2): 605-608.

Barnes, B. J., A. E. Field and P. M. Pitha-Rowe (2003). "Virus-induced heterodimer formation between IRF-5 and IRF-7 modulates assembly of the IFNA enhanceosome in vivo and transcriptional activity of IFNA genes." J Biol Chem 278(19): 16630-16641.

Barnes, B. J., M. J. Kellum, K. E. Pinder, J. A. Frisancho and P. M. Pitha (2003). "Interferon regulatory factor 5, a novel mediator of cell cycle arrest and cell death." Cancer Res 63(19): 6424- 6431.

Barnes, B. J., P. A. Moore and P. M. Pitha (2001). "Virus-specific activation of a novel interferon regulatory factor, IRF-5, results in the induction of distinct interferon alpha genes." J Biol Chem 276(26): 23382-23390.

Barnes, B. J., J. Richards, M. Mancl, S. Hanash, L. Beretta and P. M. Pitha (2004). "Global and distinct targets of IRF-5 and IRF-7 during innate response to viral infection." J Biol Chem 279(43): 45194-45207.

Barton, G. M., J. C. Kagan and R. Medzhitov (2006). "Intracellular localization of Toll-like receptor 9 prevents recognition of self DNA but facilitates access to viral DNA." Nat Immunol 7(1): 49-56.

Bauer, S., C. J. Kirschning, H. Hacker, V. Redecke, S. Hausmann, S. Akira, H. Wagner and G. B. Lipford (2001). "Human TLR9 confers responsiveness to bacterial DNA via species-specific CpG motif recognition." Proc Natl Acad Sci U S A 98(16): 9237-9242.

134

References Bazer, F. W., T. E. Spencer and T. L. Ott (1997). "Interferon tau: a novel pregnancy recognition signal." Am J Reprod Immunol 37(6): 412-420.

Becker, M. N., G. Diamond, M. W. Verghese and S. H. Randell (2000). "CD14-dependent lipopolysaccharide-induced beta-defensin-2 expression in human tracheobronchial epithelium." J Biol Chem 275(38): 29731-29736.

Begon, E., L. Michel, B. Flageul, I. Beaudoin, F. Jean-Louis, H. Bachelez, L. Dubertret and P. Musette (2007). "Expression, subcellular localization and cytokinic modulation of Toll-like receptors (TLRs) in normal human keratinocytes: TLR2 up-regulation in psoriatic skin." Eur J Dermatol 17(6): 497-506.

Bekisz, J., S. Baron, C. Balinsky, A. Morrow and K. C. Zoon (2010). "Antiproliferative Properties of Type I and Type II Interferon." Pharmaceuticals (Basel) 3(4): 994-1015.

Ben, J., E. W. Jabs and S. S. Chong (2005). "Genomic, cDNA and embryonic expression analysis of zebrafish IRF6, the gene mutated in the human oral clefting disorders Van der Woude and popliteal pterygium syndromes." Gene Expr Patterns 5(5): 629-638.

Bernard, J. J., C. Cowing-Zitron, T. Nakatsuji, B. Muehleisen, J. Muto, A. W. Borkowski, L. Martinez, E. L. Greidinger, B. D. Yu and R. L. Gallo (2012). "Ultraviolet radiation damages self noncoding RNA and is detected by TLR3." Nat Med 18(8): 1286-1290.

Bernstein, D. I. and C. J. Harrison (1989). "Effects of the immunomodulating agent R837 on acute and latent herpes simplex virus type 2 infections." Antimicrob Agents Chemother 33(9): 1511- 1515.

Bettelli, E. and V. K. Kuchroo (2005). "IL-12- and IL-23-induced T helper cell subsets: birds of the same feather flock together." J Exp Med 201(2): 169-171.

Beutler, B. (2004). "Inferences, questions and possibilities in Toll-like receptor signalling." Nature 430(6996): 257-263.

Bielenberg, D. R., M. F. McCarty, C. D. Bucana, S. H. Yuspa, D. Morgan, J. M. Arbeit, L. M. Ellis, K. R. Cleary and I. J. Fidler (1999). "Expression of interferon-beta is associated with growth arrest of murine and human epidermal cells." J Invest Dermatol 112(5): 802-809.

Biggs, L. C., L. Rhea, B. C. Schutte and M. Dunnwald (2012). "Interferon regulatory factor 6 is necessary, but not sufficient, for keratinocyte differentiation." J Invest Dermatol 132(1): 50-58.

135

References Blanpain, C., R. Buser, C. A. Power, M. Edgerton, C. Buchanan, M. Mack, G. Simmons, P. R. Clapham, M. Parmentier and A. E. Proudfoot (2001). "A chimeric MIP-1alpha/RANTES protein demonstrates the use of different regions of the RANTES protein to bind and activate its receptors." J Leukoc Biol 69(6): 977-985.

Blanton, S. H., A. Cortez, S. Stal, J. B. Mulliken, R. H. Finnell and J. T. Hecht (2005). "Variation in IRF6 contributes to nonsyndromic cleft lip and palate." American Journal of Medical Genetics Part A 137A(3): 259-262.

Blauvelt, A. (2008). "T-helper 17 cells in psoriatic plaques and additional genetic links between IL- 23 and psoriasis." J Invest Dermatol 128(5): 1064-1067.

Bong, A. B., B. Bonnekoh, I. Franke, M. Schon, J. Ulrich and H. Gollnick (2002). "Imiquimod, a topical immune response modifier, in the treatment of cutaneous metastases of malignant melanoma." Dermatology 205(2): 135-138.

Bonjardim, C. A., P. C. Ferreira and E. G. Kroon (2009). "Interferons: signaling, antiviral and viral evasion." Immunol Lett 122(1): 1-11.

Borkowski, A. W., K. Park, Y. Uchida and R. L. Gallo (2013). "Activation of TLR3 in keratinocytes increases expression of genes involved in formation of the epidermis, lipid accumulation, and epidermal organelles." J Invest Dermatol 133(8): 2031-2040.

Botti, E., G. Spallone, F. Moretti, B. Marinari, V. Pinetti, S. Galanti, P. D. De Meo, F. De Nicola, F. Ganci, T. Castrignano, G. Pesole, S. Chimenti, L. Guerrini, M. Fanciulli, G. Blandino, M. Karin and A. Costanzo (2011). "Developmental factor IRF6 exhibits tumor suppressor activity in squamous cell carcinomas." Proc Natl Acad Sci U S A 108(33): 13710-13715.

Boukamp, P. (2005). "UV-induced skin cancer: similarities--variations." J Dtsch Dermatol Ges 3(7): 493-503.

Boukamp, P., R. T. Petrussevska, D. Breitkreutz, J. Hornung, A. Markham and N. E. Fusenig (1988). "Normal keratinization in a spontaneously immortalized aneuploid human keratinocyte cell line." J Cell Biol 106(3): 761-771.

Boyce, S. T. and R. G. Ham (1983). "Calcium-regulated differentiation of normal human epidermal keratinocytes in chemically defined clonal culture and serum-free serial culture." J Invest Dermatol 81(1 Suppl): 33s-40s.

136

References Boyden, E. D. and W. F. Dietrich (2006). "Nalp1b controls mouse macrophage susceptibility to anthrax lethal toxin." Nat Genet 38(2): 240-244.

Brahmachari, S. and K. Pahan (2009). "Suppression of regulatory T cells by IL-12p40 homodimer via nitric oxide." J Immunol 183(3): 2045-2058.

Brentano, F., C. Ospelt, J. Stanczyk, R. E. Gay, S. Gay and D. Kyburz (2009). "Abundant expression of the interleukin (IL)23 subunit p19, but low levels of bioactive IL23 in the rheumatoid synovium: differential expression and Toll-like receptor-(TLR) dependent regulation of the IL23 subunits, p19 and p40, in rheumatoid arthritis." Ann Rheum Dis 68(1): 143-150.

Brown, G. D., P. R. Taylor, D. M. Reid, J. A. Willment, D. L. Williams, L. Martinez-Pomares, S. Y. Wong and S. Gordon (2002). "Dectin-1 is a major beta-glucan receptor on macrophages." J Exp Med 196(3): 407-412.

Bubenik, J., M. Baresova, V. Viklicky, J. Jakoubkova, H. Sainerova and J. Donner (1973). "Established cell line of urinary bladder carcinoma (T24) containing tumour-specific antigen." Int J Cancer 11(3): 765-773.

Buchau, A. S., J. Schauber, T. Hultsch, A. Stuetz and R. L. Gallo (2008). "Pimecrolimus enhances TLR2/6-induced expression of antimicrobial peptides in keratinocytes." J Invest Dermatol 128(11): 2646-2654.

Bunk, S., S. Sigel, D. Metzdorf, O. Sharif, K. Triantafilou, M. Triantafilou, T. Hartung, S. Knapp and S. von Aulock (2010). "Internalization and coreceptor expression are critical for TLR2- mediated recognition of lipoteichoic acid in human peripheral blood." J Immunol 185(6): 3708- 3717.

Burns, K., F. Martinon, C. Esslinger, H. Pahl, P. Schneider, J. L. Bodmer, F. Di Marco, L. French and J. Tschopp (1998). "MyD88, an adapter protein involved in interleukin-1 signaling." J Biol Chem 273(20): 12203-12209.

Caillaud, A., A. Prakash, E. Smith, A. Masumi, A. G. Hovanessian, D. E. Levy and I. Marie (2002). "Acetylation of interferon regulatory factor-7 by p300/CREB-binding protein (CBP)-associated factor (PCAF) impairs its DNA binding." J Biol Chem 277(51): 49417-49421.

Callewaert, L. and C. W. Michiels (2010). "Lysozymes in the animal kingdom." J Biosci 35(1): 127-160.

137

References Cao, Z., W. J. Henzel and X. Gao (1996). "IRAK: a kinase associated with the interleukin-1 receptor." Science 271(5252): 1128-1131.

Cao, Z., J. Xiong, M. Takeuchi, T. Kurama and D. V. Goeddel (1996). "TRAF6 is a signal transducer for interleukin-1." Nature 383(6599): 443-446.

Capon, F., P. Di Meglio, J. Szaub, N. J. Prescott, C. Dunster, L. Baumber, K. Timms, A. Gutin, V. Abkevic, A. D. Burden, J. Lanchbury, J. N. Barker, R. C. Trembath and F. O. Nestle (2007). "Sequence variants in the genes for the interleukin-23 receptor (IL23R) and its ligand (IL12B) confer protection against psoriasis." Hum Genet 122(2): 201-206.

Cargill, M., S. J. Schrodi, M. Chang, V. E. Garcia, R. Brandon, K. P. Callis, N. Matsunami, K. G. Ardlie, D. Civello, J. J. Catanese, D. U. Leong, J. M. Panko, L. B. McAllister, C. B. Hansen, J. Papenfuss, S. M. Prescott, T. J. White, M. F. Leppert, G. G. Krueger and A. B. Begovich (2007). "A large-scale genetic association study confirms IL12B and leads to the identification of IL23R as psoriasis-risk genes." Am J Hum Genet 80(2): 273-290.

Cario, E. and D. K. Podolsky (2000). "Differential alteration in intestinal epithelial cell expression of toll-like receptor 3 (TLR3) and TLR4 in inflammatory bowel disease." Infect Immun 68(12): 7010-7017.

Cario, E., I. M. Rosenberg, S. L. Brandwein, P. L. Beck, H. C. Reinecker and D. K. Podolsky (2000). "Lipopolysaccharide activates distinct signaling pathways in intestinal epithelial cell lines expressing Toll-like receptors." J Immunol 164(2): 966-972.

Carmody, R. J., Q. Ruan, H. C. Liou and Y. H. Chen (2007). "Essential roles of c-Rel in TLR- induced IL-23 p19 gene expression in dendritic cells." J Immunol 178(1): 186-191.

Chabot, S., J. S. Wagner, S. Farrant and M. R. Neutra (2006). "TLRs regulate the gatekeeping functions of the intestinal follicle-associated epithelium." J Immunol 176(7): 4275-4283.

Chamaillard, M., M. Hashimoto, Y. Horie, J. Masumoto, S. Qiu, L. Saab, Y. Ogura, A. Kawasaki, K. Fukase, S. Kusumoto, M. A. Valvano, S. J. Foster, T. W. Mak, G. Nunez and N. Inohara (2003). "An essential role for NOD1 in host recognition of bacterial peptidoglycan containing diaminopimelic acid." Nat Immunol 4(7): 702-707.

Chassin, C., J. M. Goujon, S. Darche, L. du Merle, M. Bens, F. Cluzeaud, C. Werts, E. Ogier-Denis, C. Le Bouguenec, D. Buzoni-Gatel and A. Vandewalle (2006). "Renal collecting duct epithelial

138

References cells react to pyelonephritis-associated Escherichia coli by activating distinct TLR4-dependent and - independent inflammatory pathways." J Immunol 177(7): 4773-4784.

Chaturvedi, V., L. W. Collison, C. S. Guy, C. J. Workman and D. A. Vignali (2011). "Cutting edge: Human regulatory T cells require IL-35 to mediate suppression and infectious tolerance." J Immunol 186(12): 6661-6666.

Cheng, T. F., S. Brzostek, O. Ando, S. Van Scoy, K. P. Kumar and N. C. Reich (2006). "Differential activation of IFN regulatory factor (IRF)-3 and IRF-5 transcription factors during viral infection." J Immunol 176(12): 7462-7470.

Chew, T., K. E. Taylor and K. L. Mossman (2009). "Innate and adaptive immune responses to herpes simplex virus." Viruses 1(3): 979-1002.

Chiller, K., B. A. Selkin and G. J. Murakawa (2001). "Skin microflora and bacterial infections of the skin." J Investig Dermatol Symp Proc 6(3): 170-174.

Cho, J., M. Melnick, G. P. Solidakis and P. N. Tsichlis (2005). "Tpl2 (tumor progression locus 2) phosphorylation at Thr290 is induced by lipopolysaccharide via an Ikappa-B Kinase-beta-dependent pathway and is required for Tpl2 activation by external signals." J Biol Chem 280(21): 20442- 20448.

Choi, Y. J., J. Jung, H. K. Chung, E. Im and S. H. Rhee (2013). "PTEN regulates TLR5-induced intestinal inflammation by controlling Mal/TIRAP recruitment." FASEB J 27(1): 243-254.

Chouinard, N., K. Valerie, M. Rouabhia and J. Huot (2002). "UVB-mediated activation of p38 mitogen-activated protein kinase enhances resistance of normal human keratinocytes to apoptosis by stabilizing cytoplasmic p53." Biochem J 365(Pt 1): 133-145.

Chu, Y. T., Y. H. Wang, J. J. Wu and H. Y. Lei (2010). "Invasion and multiplication of Helicobacter pylori in gastric epithelial cells and implications for antibiotic resistance." Infect Immun 78(10): 4157-4165.

Chua, A. O., R. Chizzonite, B. B. Desai, T. P. Truitt, P. Nunes, L. J. Minetti, R. R. Warrier, D. H. Presky, J. F. Levine, M. K. Gately and et al. (1994). "Expression cloning of a human IL-12 receptor component. A new member of the cytokine receptor superfamily with strong homology to gp130." J Immunol 153(1): 128-136.

Chuang, T. and R. J. Ulevitch (2001). "Identification of hTLR10: a novel human Toll-like receptor preferentially expressed in immune cells." Biochim Biophys Acta 1518(1-2): 157-161. 139

References Clark, R. A., S. J. Huang, G. F. Murphy, I. G. Mollet, D. Hijnen, M. Muthukuru, C. F. Schanbacher, V. Edwards, D. M. Miller, J. E. Kim, J. Lambert and T. S. Kupper (2008). "Human squamous cell carcinomas evade the immune response by down-regulation of vascular E-selectin and recruitment of regulatory T cells." J Exp Med 205(10): 2221-2234.

Clifford, J. L., D. G. Menter, X. Yang, E. Walch, C. Zou, G. L. Clayman, T. S. Schaefer, A. K. El- Naggar, R. Lotan and S. M. Lippman (2000). "Expression of protein mediators of type I interferon signaling in human squamous cell carcinoma of the skin." Cancer Epidemiol Biomarkers Prev 9(9): 993-997.

Cocchi, F., A. L. DeVico, A. Garzino-Demo, S. K. Arya, R. C. Gallo and P. Lusso (1995). "Identification of RANTES, MIP-1 alpha, and MIP-1 beta as the major HIV-suppressive factors produced by CD8+ T cells." Science 270(5243): 1811-1815.

Coccia, E. M., M. Severa, E. Giacomini, D. Monneron, M. E. Remoli, I. Julkunen, M. Cella, R. Lande and G. Uze (2004). "Viral infection and Toll-like receptor agonists induce a differential expression of type I and lambda interferons in human plasmacytoid and monocyte-derived dendritic cells." Eur J Immunol 34(3): 796-805.

Cogen, A. L., V. Nizet and R. L. Gallo (2008). "Skin microbiota: a source of disease or defence?" Br J Dermatol 158(3): 442-455.

Collison, L. W., V. Chaturvedi, A. L. Henderson, P. R. Giacomin, C. Guy, J. Bankoti, D. Finkelstein, K. Forbes, C. J. Workman, S. A. Brown, J. E. Rehg, M. L. Jones, H. T. Ni, D. Artis, M. J. Turk and D. A. Vignali (2010). "IL-35-mediated induction of a potent regulatory T cell population." Nat Immunol 11(12): 1093-1101.

Collison, L. W., C. J. Workman, T. T. Kuo, K. Boyd, Y. Wang, K. M. Vignali, R. Cross, D. Sehy, R. S. Blumberg and D. A. Vignali (2007). "The inhibitory cytokine IL-35 contributes to regulatory T-cell function." Nature 450(7169): 566-569.

Colonna, M., A. Krug and M. Cella (2002). "Interferon-producing cells: on the front line in immune responses against pathogens." Curr Opin Immunol 14(3): 373-379.

Cowland, J. B., A. H. Johnsen and N. Borregaard (1995). "hCAP-18, a cathelin/pro-bactenecin-like protein of human neutrophil specific granules." FEBS Lett 368(1): 173-176.

Cue, D., S. O. Southern, P. J. Southern, J. Prabhakar, W. Lorelli, J. M. Smallheer, S. A. Mousa and P. P. Cleary (2000). "A nonpeptide integrin antagonist can inhibit epithelial cell ingestion of

140

References Streptococcus pyogenes by blocking formation of integrin alpha 5beta 1-fibronectin-M1 protein complexes." Proc Natl Acad Sci U S A 97(6): 2858-2863.

Cuervo, R., C. Valencia, R. A. Chandraratna and L. Covarrubias (2002). "Programmed cell death is required for palate shelf fusion and is regulated by retinoic acid." Dev Biol 245(1): 145-156.

Cusson-Hermance, N., S. Khurana, T. H. Lee, K. A. Fitzgerald and M. A. Kelliher (2005). "Rip1 mediates the Trif-dependent toll-like receptor 3- and 4-induced NF-{kappa}B activation but does not contribute to interferon regulatory factor 3 activation." J Biol Chem 280(44): 36560-36566.

Dahlberg, A., M. R. Auble and T. M. Petro (2006). "Reduced expression of IL-12 p35 by SJL/J macrophages responding to Theiler's virus infection is associated with constitutive activation of IRF-3." Virology 353(2): 422-432.

Dai, X., K. Sayama, K. Yamasaki, M. Tohyama, Y. Shirakata, Y. Hanakawa, S. Tokumaru, Y. Yahata, L. Yang, A. Yoshimura and K. Hashimoto (2006). "SOCS1-negative feedback of STAT1 activation is a key pathway in the dsRNA-induced innate immune response of human keratinocytes." J Invest Dermatol 126(7): 1574-1581.

De Benedetto, A., N. M. Rafaels, L. Y. McGirt, A. I. Ivanov, S. N. Georas, C. Cheadle, A. E. Berger, K. Zhang, S. Vidyasagar, T. Yoshida, M. Boguniewicz, T. Hata, L. C. Schneider, J. M. Hanifin, R. L. Gallo, N. Novak, S. Weidinger, T. H. Beaty, D. Y. Leung, K. C. Barnes and L. A. Beck (2011). "Tight junction defects in patients with atopic dermatitis." J Allergy Clin Immunol 127(3): 773-786 e771-777. de Lima, R., S. A. Hoper, M. Ghassibe, M. E. Cooper, N. K. Rorick, S. Kondo, L. Katz, M. L. Marazita, J. Compton, S. Bale, U. Hehr, M. J. Dixon, S. Daack-Hirsch, O. Boute, B. Bayet, N. Revencu, C. Verellen-Dumoulin, M. Vikkula, A. Richieri-Costa, D. Moretti-Ferreira, J. C. Murray and B. C. Schutte (2009). "Prevalence and nonrandom distribution of exonic mutations in interferon regulatory factor 6 in 307 families with Van der Woude syndrome and 37 families with popliteal pterygium syndrome." Genet Med 11(4): 241-247.

Deng, L., C. Wang, E. Spencer, L. Yang, A. Braun, J. You, C. Slaughter, C. Pickart and Z. J. Chen (2000). "Activation of the IkappaB kinase complex by TRAF6 requires a dimeric ubiquitin- conjugating enzyme complex and a unique polyubiquitin chain." Cell 103(2): 351-361.

Desai, B. B., P. M. Quinn, A. G. Wolitzky, P. K. Mongini, R. Chizzonite and M. K. Gately (1992). "IL-12 receptor. II. Distribution and regulation of receptor expression." J Immunol 148(10): 3125- 3132. 141

References Devergne, O., M. Birkenbach and E. Kieff (1997). "Epstein-Barr virus-induced gene 3 and the p35 subunit of interleukin 12 form a novel heterodimeric hematopoietin." Proc Natl Acad Sci U S A 94(22): 12041-12046.

Devergne, O., M. Hummel, H. Koeppen, M. M. Le Beau, E. C. Nathanson, E. Kieff and M. Birkenbach (1996). "A novel interleukin-12 p40-related protein induced by latent Epstein-Barr virus infection in B lymphocytes." J Virol 70(2): 1143-1153.

Deyrieux, A. F. and V. G. Wilson (2007). "In vitro culture conditions to study keratinocyte differentiation using the HaCaT cell line." Cytotechnology 54(2): 77-83.

Diamond, G., N. Beckloff, A. Weinberg and K. O. Kisich (2009). "The roles of antimicrobial peptides in innate host defense." Curr Pharm Des 15(21): 2377-2392.

Dibra, D., J. Cutrera, X. Xia, B. Kallakury, L. Mishra and S. Li (2012). "Interleukin-30: a novel antiinflammatory cytokine candidate for prevention and treatment of inflammatory cytokine- induced liver injury." Hepatology 55(4): 1204-1214.

Diebold, S. S., T. Kaisho, H. Hemmi, S. Akira and C. Reis e Sousa (2004). "Innate antiviral responses by means of TLR7-mediated recognition of single-stranded RNA." Science 303(5663): 1529-1531.

Dommett, R., M. Zilbauer, J. T. George and M. Bajaj-Elliott (2005). "Innate immune defence in the human gastrointestinal tract." Mol Immunol 42(8): 903-912.

Dornan, D., M. Eckert, M. Wallace, H. Shimizu, E. Ramsay, T. R. Hupp and K. L. Ball (2004). "Interferon regulatory factor 1 binding to p300 stimulates DNA-dependent acetylation of p53." Mol Cell Biol 24(22): 10083-10098.

Dorschner, R. A., V. K. Pestonjamasp, S. Tamakuwala, T. Ohtake, J. Rudisill, V. Nizet, B. Agerberth, G. H. Gudmundsson and R. L. Gallo (2001). "Cutaneous injury induces the release of cathelicidin anti-microbial peptides active against group A Streptococcus." J Invest Dermatol 117(1): 91-97.

Doyle, S., S. Vaidya, R. O'Connell, H. Dadgostar, P. Dempsey, T. Wu, G. Rao, R. Sun, M. Haberland, R. Modlin and G. Cheng (2002). "IRF3 mediates a TLR3/TLR4-specific antiviral gene program." Immunity 17(3): 251-263.

142

References Doyle, S. E., R. O'Connell, S. A. Vaidya, E. K. Chow, K. Yee and G. Cheng (2003). "Toll-like receptor 3 mediates a more potent antiviral response than Toll-like receptor 4." J Immunol 170(7): 3565-3571.

Droemann, D., D. Albrecht, J. Gerdes, A. J. Ulmer, D. Branscheid, E. Vollmer, K. Dalhoff, P. Zabel and T. Goldmann (2005). "Human lung cancer cells express functionally active Toll-like receptor 9." Respir Res 6: 1.

Du, X., A. Poltorak, Y. Wei and B. Beutler (2000). "Three novel mammalian toll-like receptors: gene structure, expression, and evolution." Eur Cytokine Netw 11(3): 362-371.

Dumitru, C. D., J. D. Ceci, C. Tsatsanis, D. Kontoyiannis, K. Stamatakis, J. H. Lin, C. Patriotis, N. A. Jenkins, N. G. Copeland, G. Kollias and P. N. Tsichlis (2000). "TNF-alpha induction by LPS is regulated posttranscriptionally via a Tpl2/ERK-dependent pathway." Cell 103(7): 1071-1083.

Ea, C. K., L. Deng, Z. P. Xia, G. Pineda and Z. J. Chen (2006). "Activation of IKK by TNFalpha requires site-specific ubiquitination of RIP1 and polyubiquitin binding by NEMO." Mol Cell 22(2): 245-257.

Eckmann, L., M. F. Kagnoff and J. Fierer (1993). "Epithelial cells secrete the chemokine interleukin-8 in response to bacterial entry." Infect Immun 61(11): 4569-4574.

Ehrchen, J., C. Sunderkotter, T. Luger and M. Steinhoff (2008). "Calcineurin inhibitors for the treatment of atopic dermatitis." Expert Opin Pharmacother 9(17): 3009-3023.

Eidenschenk, C., K. Crozat, P. Krebs, R. Arens, D. Popkin, C. N. Arnold, A. L. Blasius, C. A. Benedict, E. M. Moresco, Y. Xia and B. Beutler (2010). "Flt3 permits survival during infection by rendering dendritic cells competent to activate NK cells." Proc Natl Acad Sci U S A 107(21): 9759- 9764.

Eroshkin, A. and A. Mushegian (1999). "Conserved transactivation domain shared by interferon regulatory factors and Smad morphogens." J Mol Med 77(5): 403-405.

Escalante, C. R., E. Nistal-Villan, L. Shen, A. Garcia-Sastre and A. K. Aggarwal (2007). "Structure of IRF-3 bound to the PRDIII-I regulatory element of the human interferon-beta enhancer." Mol Cell 26(5): 703-716.

Ewaschuk, J. B., J. L. Backer, T. A. Churchill, F. Obermeier, D. O. Krause and K. L. Madsen (2007). "Surface expression of Toll-like receptor 9 is upregulated on intestinal epithelial cells in response to pathogenic bacterial DNA." Infect Immun 75(5): 2572-2579. 143

References Eyerich, S., J. Wagener, V. Wenzel, C. Scarponi, D. Pennino, C. Albanesi, M. Schaller, H. Behrendt, J. Ring, C. B. Schmidt-Weber, A. Cavani, M. Mempel, C. Traidl-Hoffmann and K. Eyerich (2011). "IL-22 and TNF-alpha represent a key cytokine combination for epidermal integrity during infection with Candida albicans." Eur J Immunol 41(7): 1894-1901.

Fan, C. M. and T. Maniatis (1989). "Two different virus-inducible elements are required for human beta-interferon gene regulation." EMBO J 8(1): 101-110.

Feldmeyer, L., S. Werner, L. E. French and H. D. Beer (2010). "Interleukin-1, inflammasomes and the skin." Eur J Cell Biol 89(9): 638-644.

Felgner, P. L., T. R. Gadek, M. Holm, R. Roman, H. W. Chan, M. Wenz, J. P. Northrop, G. M. Ringold and M. Danielsen (1987). "Lipofection: a highly efficient, lipid-mediated DNA- transfection procedure." Proc Natl Acad Sci U S A 84(21): 7413-7417.

Ferretti, E., B. Li, R. Zewdu, V. Wells, J. M. Hebert, C. Karner, M. J. Anderson, T. Williams, J. Dixon, M. J. Dixon, M. J. Depew and L. Selleri (2011). "A conserved Pbx-Wnt-p63-Irf6 regulatory module controls face morphogenesis by promoting epithelial apoptosis." Dev Cell 21(4): 627-641.

Fierlbeck, G., G. Rassner and C. Muller (1990). "Psoriasis induced at the injection site of recombinant interferon gamma. Results of immunohistologic investigations." Arch Dermatol 126(3): 351-355.

Fitsialos, G., A. A. Chassot, L. Turchi, M. A. Dayem, K. LeBrigand, C. Moreilhon, G. Meneguzzi, R. Busca, B. Mari, P. Barbry and G. Ponzio (2007). "Transcriptional signature of epidermal keratinocytes subjected to in vitro scratch wounding reveals selective roles for ERK1/2, p38, and phosphatidylinositol 3-kinase signaling pathways." J Biol Chem 282(20): 15090-15102.

Fitzgerald, D. C., G. X. Zhang, M. El-Behi, Z. Fonseca-Kelly, H. Li, S. Yu, C. J. Saris, B. Gran, B. Ciric and A. Rostami (2007). "Suppression of autoimmune inflammation of the central nervous system by interleukin 10 secreted by interleukin 27-stimulated T cells." Nat Immunol 8(12): 1372- 1379.

Fitzgerald, K. A., S. M. McWhirter, K. L. Faia, D. C. Rowe, E. Latz, D. T. Golenbock, A. J. Coyle, S. M. Liao and T. Maniatis (2003). "IKKepsilon and TBK1 are essential components of the IRF3 signaling pathway." Nat Immunol 4(5): 491-496.

Fitzgerald, K. A., E. M. Palsson-McDermott, A. G. Bowie, C. A. Jefferies, A. S. Mansell, G. Brady, E. Brint, A. Dunne, P. Gray, M. T. Harte, D. McMurray, D. E. Smith, J. E. Sims, T. A. Bird and L.

144

References A. O'Neill (2001). "Mal (MyD88-adapter-like) is required for Toll-like receptor-4 signal transduction." Nature 413(6851): 78-83.

Fitzgerald, K. A., D. C. Rowe, B. J. Barnes, D. R. Caffrey, A. Visintin, E. Latz, B. Monks, P. M. Pitha and D. T. Golenbock (2003). "LPS-TLR4 signaling to IRF-3/7 and NF-kappaB involves the toll adapters TRAM and TRIF." J Exp Med 198(7): 1043-1055.

Frischknecht, F. (2007). "The skin as interface in the transmission of arthropod-borne pathogens." Cell Microbiol 9(7): 1630-1640.

Frohm, M., B. Agerberth, G. Ahangari, M. Stahle-Backdahl, S. Liden, H. Wigzell and G. H. Gudmundsson (1997). "The expression of the gene coding for the antibacterial peptide LL-37 is induced in human keratinocytes during inflammatory disorders." J Biol Chem 272(24): 15258- 15263.

Frost, A. J., A. P. Bland and T. S. Wallis (1997). "The early dynamic response of the calf ileal epithelium to Salmonella typhimurium." Vet Pathol 34(5): 369-386.

Fujii, Y., T. Shimizu, M. Kusumoto, Y. Kyogoku, T. Taniguchi and T. Hakoshima (1999). "Crystal structure of an IRF-DNA complex reveals novel DNA recognition and cooperative binding to a tandem repeat of core sequences." EMBO J 18(18): 5028-5041.

Fukuoka, M., Y. Ogino, H. Sato, T. Ohta, K. Komoriya, K. Nishioka and I. Katayama (1998). "RANTES expression in psoriatic skin, and regulation of RANTES and IL-8 production in cultured epidermal keratinocytes by active vitamin D3 (tacalcitol)." Br J Dermatol 138(1): 63-70.

Furrie, E., S. Macfarlane, G. Thomson and G. T. Macfarlane (2005). "Toll-like receptors-2, -3 and - 4 expression patterns on human colon and their regulation by mucosal-associated bacteria." Immunology 115(4): 565-574.

Ganchi, P. A., S. C. Sun, W. C. Greene and D. W. Ballard (1992). "I kappa B/MAD-3 masks the nuclear localization signal of NF-kappa B p65 and requires the transactivation domain to inhibit NF-kappa B p65 DNA binding." Mol Biol Cell 3(12): 1339-1352.

Gantke, T., S. Sriskantharajah and S. C. Ley (2011). "Regulation and function of TPL-2, an IkappaB kinase-regulated MAP kinase kinase kinase." Cell Res 21(1): 131-145.

Gantner, B. N., R. M. Simmons, S. J. Canavera, S. Akira and D. M. Underhill (2003). "Collaborative induction of inflammatory responses by dectin-1 and Toll-like receptor 2." J Exp Med 197(9): 1107-1117. 145

References Ganz, T. (2003). "Defensins: antimicrobial peptides of innate immunity." Nat Rev Immunol 3(9): 710-720.

Garbers, C., B. Spudy, S. Aparicio-Siegmund, G. H. Waetzig, J. Sommer, C. Holscher, S. Rose- John, J. Grotzinger, I. Lorenzen and J. Scheller (2013). "An interleukin-6 receptor-dependent molecular switch mediates signal transduction of the IL-27 cytokine subunit p28 (IL-30) via a gp130 protein receptor homodimer." J Biol Chem 288(6): 4346-4354.

Garcia-Garcia, E. and C. Rosales (2002). "Signal transduction during Fc receptor-mediated phagocytosis." J Leukoc Biol 72(6): 1092-1108.

Gately, M. K., D. M. Carvajal, S. E. Connaughton, S. Gillessen, R. R. Warrier, K. D. Kolinsky, V. L. Wilkinson, C. M. Dwyer, G. F. Higgins, Jr., F. J. Podlaski, D. A. Faherty, P. C. Familletti, A. S. Stern and D. H. Presky (1996). "Interleukin-12 antagonist activity of mouse interleukin-12 p40 homodimer in vitro and in vivo." Ann N Y Acad Sci 795: 1-12.

Gately, M. K., L. M. Renzetti, J. Magram, A. S. Stern, L. Adorini, U. Gubler and D. H. Presky (1998). "The interleukin-12/interleukin-12-receptor system: role in normal and pathologic immune responses." Annu Rev Immunol 16: 495-521.

Gay, N. J. and F. J. Keith (1991). "Drosophila Toll and IL-1 receptor." Nature 351(6325): 355-356.

Gee, K., C. Guzzo, N. F. Che Mat, W. Ma and A. Kumar (2009). "The IL-12 family of cytokines in infection, inflammation and autoimmune disorders." Inflamm Allergy Drug Targets 8(1): 40-52.

Geijtenbeek, T. B. and S. I. Gringhuis (2009). "Signalling through C-type lectin receptors: shaping immune responses." Nat Rev Immunol 9(7): 465-479.

Geisse, J. K., P. Rich, A. Pandya, K. Gross, K. Andres, A. Ginkel and M. Owens (2002). "Imiquimod 5% cream for the treatment of superficial basal cell carcinoma: a double-blind, randomized, vehicle-controlled study." J Am Acad Dermatol 47(3): 390-398.

Genin, P., M. Algarte, P. Roof, R. Lin and J. Hiscott (2000). "Regulation of RANTES chemokine gene expression requires cooperativity between NF-kappa B and IFN-regulatory factor transcription factors." J Immunol 164(10): 5352-5361.

Ghassibe, M., B. Bayet, N. Revencu, C. Verellen-Drumoulin, Y. Gillerot, R. Vanwijck and M. Vikkula (2005). "Interferon regulatory factor-6: a gene predisposing to isolated cleft lip with or without cleft palate in the Belgian population." Eur J Hum Genet 13(11): 1239-1242.

146

References Ghilardi, N., N. Kljavin, Q. Chen, S. Lucas, A. L. Gurney and F. J. De Sauvage (2004). "Compromised humoral and delayed-type hypersensitivity responses in IL-23-deficient mice." J Immunol 172(5): 2827-2833.

Giard, D. J., S. A. Aaronson, G. J. Todaro, P. Arnstein, J. H. Kersey, H. Dosik and W. P. Parks (1973). "In vitro cultivation of human tumors: establishment of cell lines derived from a series of solid tumors." J Natl Cancer Inst 51(5): 1417-1423.

Gilliet, M., C. Conrad, M. Geiges, A. Cozzio, W. Thurlimann, G. Burg, F. O. Nestle and R. Dummer (2004). "Psoriasis triggered by toll-like receptor 7 agonist imiquimod in the presence of dermal plasmacytoid dendritic cell precursors." Arch Dermatol 140(12): 1490-1495.

Giustizieri, M. L., F. Mascia, A. Frezzolini, O. De Pita, L. M. Chinni, A. Giannetti, G. Girolomoni and S. Pastore (2001). "Keratinocytes from patients with atopic dermatitis and psoriasis show a distinct chemokine production profile in response to T cell-derived cytokines." J Allergy Clin Immunol 107(5): 871-877.

Goubau, D., J. Rehwinkel and C. Reis e Sousa (2010). "PYHIN proteins: center stage in DNA sensing." Nat Immunol 11(11): 984-986.

Graham, F. L., J. Smiley, W. C. Russell and R. Nairn (1977). "Characteristics of a human cell line transformed by DNA from human adenovirus type 5." J Gen Virol 36(1): 59-74.

Grandjean-Laquerriere, A., S. C. Gangloff, R. Le Naour, C. Trentesaux, W. Hornebeck and M. Guenounou (2002). "Relative contribution of NF-kappaB and AP-1 in the modulation by curcumin and pyrrolidine dithiocarbamate of the UVB-induced cytokine expression by keratinocytes." Cytokine 18(3): 168-177.

Granelli-Piperno, A., B. Moser, M. Pope, D. Chen, Y. Wei, F. Isdell, U. O'Doherty, W. Paxton, R. Koup, S. Mojsov, N. Bhardwaj, I. Clark-Lewis, M. Baggiolini and R. M. Steinman (1996). "Efficient interaction of HIV-1 with purified dendritic cells via multiple chemokine coreceptors." J Exp Med 184(6): 2433-2438.

Grassberger, Baumruker, Enz, Hiestand, Hultsch, Kalthoff, Schuler, Schulz, Werner, Winiski, Wolff and Zenke (1999). "A novel anti-inflammatory drug, SDZ ASM 981, for the treatment of skin diseases: in vitro pharmacology." Br J Dermatol 141(2): 264-273.

Grayson, M. H. and M. J. Holtzman (2006). "Chemokine complexity: the case for CCL5." Am J Respir Cell Mol Biol 35(2): 143-146.

147

References Greene, C. M., T. P. Carroll, S. G. Smith, C. C. Taggart, J. Devaney, S. Griffin, J. O'Neill S and N. G. McElvaney (2005). "TLR-induced inflammation in cystic fibrosis and non-cystic fibrosis airway epithelial cells." J Immunol 174(3): 1638-1646.

Greeneltch, K. M., M. Schneider, S. M. Steinberg, D. J. Liewehr, T. J. Stewart, K. Liu and S. I. Abrams (2007). "Host immunosurveillance controls tumor growth via IFN regulatory factor-8 dependent mechanisms." Cancer Res 67(21): 10406-10416.

Gribar, S. C., R. J. Anand, C. P. Sodhi and D. J. Hackam (2008). "The role of epithelial Toll-like receptor signaling in the pathogenesis of intestinal inflammation." J Leukoc Biol 83(3): 493-498.

Grice, E. A. and J. A. Segre (2011). "The skin microbiome." Nat Rev Microbiol 9(4): 244-253.

Grinde, B. (2013). "Herpesviruses: latency and reactivation - viral strategies and host response." J Oral Microbiol 5.

Grohmann, U., M. L. Belladonna, R. Bianchi, C. Orabona, E. Ayroldi, M. C. Fioretti and P. Puccetti (1998). "IL-12 acts directly on DC to promote nuclear localization of NF-kappaB and primes DC for IL-12 production." Immunity 9(3): 315-323.

Gross, N. D., J. O. Boyle, B. Du, V. D. Kekatpure, A. Lantowski, H. T. Thaler, B. B. Weksler, K. Subbaramaiah and A. J. Dannenberg (2007). "Inhibition of Jun NH2-terminal kinases suppresses the growth of experimental head and neck squamous cell carcinoma." Clin Cancer Res 13(19): 5910-5917.

Groves, R. W., E. L. Ross, J. N. Barker and D. M. MacDonald (1993). "Vascular cell adhesion molecule-1: expression in normal and diseased skin and regulation in vivo by interferon gamma." J Am Acad Dermatol 29(1): 67-72.

Guan, Y., D. R. Ranoa, S. Jiang, S. K. Mutha, X. Li, J. Baudry and R. I. Tapping (2010). "Human TLRs 10 and 1 share common mechanisms of innate immune sensing but not signaling." J Immunol 184(9): 5094-5103.

Guani-Guerra, E., T. Santos-Mendoza, S. O. Lugo-Reyes and L. M. Teran (2010). "Antimicrobial peptides: general overview and clinical implications in human health and disease." Clin Immunol 135(1): 1-11.

Gubler, U., A. O. Chua, D. S. Schoenhaut, C. M. Dwyer, W. McComas, R. Motyka, N. Nabavi, A. G. Wolitzky, P. M. Quinn, P. C. Familletti and et al. (1991). "Coexpression of two distinct genes is

148

References required to generate secreted bioactive cytotoxic lymphocyte maturation factor." Proc Natl Acad Sci U S A 88(10): 4143-4147.

Gudjonsson, J. E., A. Johnston, H. Sigmundsdottir and H. Valdimarsson (2004). "Immunopathogenic mechanisms in psoriasis." Clin Exp Immunol 135(1): 1-8.

Guillot, L., S. Medjane, K. Le-Barillec, V. Balloy, C. Danel, M. Chignard and M. Si-Tahar (2004). "Response of human pulmonary epithelial cells to lipopolysaccharide involves Toll-like receptor 4 (TLR4)-dependent signaling pathways: evidence for an intracellular compartmentalization of TLR4." J Biol Chem 279(4): 2712-2718.

Gunther, C., N. Carballido-Perrig, S. Kaesler, J. M. Carballido and T. Biedermann (2012). "CXCL16 and CXCR6 are upregulated in psoriasis and mediate cutaneous recruitment of human CD8+ T cells." J Invest Dermatol 132(3 Pt 1): 626-634.

Guo, Y., M. Audry, M. Ciancanelli, L. Alsina, J. Azevedo, M. Herman, E. Anguiano, V. Sancho- Shimizu, L. Lorenzo, E. Pauwels, P. B. Philippe, R. Perez de Diego, A. Cardon, G. Vogt, C. Picard, Z. Z. Andrianirina, F. Rozenberg, P. Lebon, S. Plancoulaine, M. Tardieu, D. Valerie, E. Jouanguy, D. Chaussabel, F. Geissmann, L. Abel, J. L. Casanova and S. Y. Zhang (2011). "Herpes simplex virus encephalitis in a patient with complete TLR3 deficiency: TLR3 is otherwise redundant in protective immunity." J Exp Med 208(10): 2083-2098.

Hamano, S., K. Himeno, Y. Miyazaki, K. Ishii, A. Yamanaka, A. Takeda, M. Zhang, H. Hisaeda, T. W. Mak, A. Yoshimura and H. Yoshida (2003). "WSX-1 is required for resistance to Trypanosoma cruzi infection by regulation of proinflammatory cytokine production." Immunity 19(5): 657-667.

Hanifin, J. M. and J. L. Rogge (1977). "Staphylococcal infections in patients with atopic dermatitis." Arch Dermatol 113(10): 1383-1386.

Hansen-Wester, I. and M. Hensel (2001). "Salmonella pathogenicity islands encoding type III secretion systems." Microbes Infect 3(7): 549-559.

Happel, K. I., M. Zheng, E. Young, L. J. Quinton, E. Lockhart, A. J. Ramsay, J. E. Shellito, J. R. Schurr, G. J. Bagby, S. Nelson and J. K. Kolls (2003). "Cutting edge: roles of Toll-like receptor 4 and IL-23 in IL-17 expression in response to Klebsiella pneumoniae infection." J Immunol 170(9): 4432-4436.

149

References Harder, J., U. Meyer-Hoffert, L. M. Teran, L. Schwichtenberg, J. Bartels, S. Maune and J. M. Schroder (2000). "Mucoid Pseudomonas aeruginosa, TNF-alpha, and IL-1beta, but not IL-6, induce human beta-defensin-2 in respiratory epithelia." Am J Respir Cell Mol Biol 22(6): 714-721.

Harper, E. G., C. Guo, H. Rizzo, J. V. Lillis, S. E. Kurtz, I. Skorcheva, D. Purdy, E. Fitch, M. Iordanov and A. Blauvelt (2009). "Th17 cytokines stimulate CCL20 expression in keratinocytes in vitro and in vivo: implications for psoriasis pathogenesis." J Invest Dermatol 129(9): 2175-2183.

Harrison, C. J., L. Jenski, T. Voychehovski and D. I. Bernstein (1988). "Modification of immunological responses and clinical disease during topical R-837 treatment of genital HSV-2 infection." Antiviral Res 10(4-5): 209-223.

Harrison, C. J., L. R. Stanberry and D. I. Bernstein (1991). "Effects of cytokines and R-837, a cytokine inducer, on UV-irradiation augmented recurrent genital herpes in guinea pigs." Antiviral Res 15(4): 315-322.

Hasan, U., C. Chaffois, C. Gaillard, V. Saulnier, E. Merck, S. Tancredi, C. Guiet, F. Briere, J. Vlach, S. Lebecque, G. Trinchieri and E. E. Bates (2005). "Human TLR10 is a functional receptor, expressed by B cells and plasmacytoid dendritic cells, which activates gene transcription through MyD88." J Immunol 174(5): 2942-2950.

Hashimoto, C., K. L. Hudson and K. V. Anderson (1988). "The Toll gene of Drosophila, required for dorsal-ventral embryonic polarity, appears to encode a transmembrane protein." Cell 52(2): 269- 279.

Hauber, H. P., M. K. Tulic, A. Tsicopoulos, B. Wallaert, R. Olivenstein, P. Daigneault and Q. Hamid (2005). "Toll-like receptors 4 and 2 expression in the bronchial mucosa of patients with cystic fibrosis." Can Respir J 12(1): 13-18.

Hayashi, F., K. D. Smith, A. Ozinsky, T. R. Hawn, E. C. Yi, D. R. Goodlett, J. K. Eng, S. Akira, D. M. Underhill and A. Aderem (2001). "The innate immune response to bacterial flagellin is mediated by Toll-like receptor 5." Nature 410(6832): 1099-1103.

Hebbar, P. B. and T. K. Archer (2008). "Altered histone H1 stoichiometry and an absence of nucleosome positioning on transfected DNA." J Biol Chem 283(8): 4595-4601.

Heil, F., H. Hemmi, H. Hochrein, F. Ampenberger, C. Kirschning, S. Akira, G. Lipford, H. Wagner and S. Bauer (2004). "Species-specific recognition of single-stranded RNA via toll-like receptor 7 and 8." Science 303(5663): 1526-1529.

150

References Hemmi, H., O. Takeuchi, T. Kawai, T. Kaisho, S. Sato, H. Sanjo, M. Matsumoto, K. Hoshino, H. Wagner, K. Takeda and S. Akira (2000). "A Toll-like receptor recognizes bacterial DNA." Nature 408(6813): 740-745.

Henkel, T., T. Machleidt, I. Alkalay, M. Kronke, Y. Ben-Neriah and P. A. Baeuerle (1993). "Rapid proteolysis of I kappa B-alpha is necessary for activation of transcription factor NF-kappa B." Nature 365(6442): 182-185.

Henkel, T., U. Zabel, K. van Zee, J. M. Muller, E. Fanning and P. A. Baeuerle (1992). "Intramolecular masking of the nuclear location signal and dimerization domain in the precursor for the p50 NF-kappa B subunit." Cell 68(6): 1121-1133.

Hennings, H., K. Holbrook, P. Steinert and S. Yuspa (1980). "Growth and differentiation of mouse epidermal cells in culture: effects of extracellular calcium." Curr Probl Dermatol 10: 3-25.

Hennings, H., D. Michael, C. Cheng, P. Steinert, K. Holbrook and S. H. Yuspa (1980). "Calcium regulation of growth and differentiation of mouse epidermal cells in culture." Cell 19(1): 245-254.

Hertz, C. J., Q. Wu, E. M. Porter, Y. J. Zhang, K. H. Weismuller, P. J. Godowski, T. Ganz, S. H. Randell and R. L. Modlin (2003). "Activation of Toll-like receptor 2 on human tracheobronchial epithelial cells induces the antimicrobial peptide human beta defensin-2." J Immunol 171(12): 6820-6826.

Hibbert, L., S. Pflanz, R. De Waal Malefyt and R. A. Kastelein (2003). "IL-27 and IFN-alpha signal via Stat1 and Stat3 and induce T-Bet and IL-12Rbeta2 in naive T cells." J Interferon Cytokine Res 23(9): 513-522.

Hida, S., K. Ogasawara, K. Sato, M. Abe, H. Takayanagi, T. Yokochi, T. Sato, S. Hirose, T. Shirai, S. Taki and T. Taniguchi (2000). "CD8(+) T cell-mediated skin disease in mice lacking IRF-2, the transcriptional attenuator of interferon-alpha/beta signaling." Immunity 13(5): 643-655.

Hidmark, A., A. von Saint Paul and A. H. Dalpke (2012). "Cutting edge: TLR13 is a receptor for bacterial RNA." J Immunol 189(6): 2717-2721.

Hildesheim, J., R. T. Awwad and A. J. Fornace, Jr. (2004). "p38 Mitogen-activated protein kinase inhibitor protects the epidermis against the acute damaging effects of ultraviolet irradiation by blocking apoptosis and inflammatory responses." J Invest Dermatol 122(2): 497-502.

151

References Hippenstiel, S., B. Opitz, B. Schmeck and N. Suttorp (2006). "Lung epithelium as a sentinel and effector system in pneumonia--molecular mechanisms of pathogen recognition and signal transduction." Respir Res 7: 97.

Hoebe, K., P. Georgel, S. Rutschmann, X. Du, S. Mudd, K. Crozat, S. Sovath, L. Shamel, T. Hartung, U. Zahringer and B. Beutler (2005). "CD36 is a sensor of diacylglycerides." Nature 433(7025): 523-527.

Holtschke, T., J. Lohler, Y. Kanno, T. Fehr, N. Giese, F. Rosenbauer, J. Lou, K. P. Knobeloch, L. Gabriele, J. F. Waring, M. F. Bachmann, R. M. Zinkernagel, H. C. Morse, 3rd, K. Ozato and I. Horak (1996). "Immunodeficiency and chronic myelogenous leukemia-like syndrome in mice with a targeted mutation of the ICSBP gene." Cell 87(2): 307-317.

Homma, T., S. Matsukura, T. Hirose, T. Ohnishi, T. Kimura, M. Kurokawa, K. Ieki, M. Odaka, S. Suzuki, S. Watanabe, M. Sato, M. Kawaguchi, R. P. Schleimer and M. Adachi (2010). "Cooperative activation of CCL5 expression by TLR3 and tumor necrosis factor-alpha or interferon-gamma through nuclear factor-kappaB or STAT-1 in airway epithelial cells." Int Arch Allergy Immunol 152 Suppl 1: 9-17.

Honda, K., Y. Ohba, H. Yanai, H. Negishi, T. Mizutani, A. Takaoka, C. Taya and T. Taniguchi (2005). "Spatiotemporal regulation of MyD88-IRF-7 signalling for robust type-I interferon induction." Nature 434(7036): 1035-1040.

Honda, K. and T. Taniguchi (2006). "IRFs: master regulators of signalling by Toll-like receptors and cytosolic pattern-recognition receptors." Nat Rev Immunol 6(9): 644-658.

Honda, K., H. Yanai, T. Mizutani, H. Negishi, N. Shimada, N. Suzuki, Y. Ohba, A. Takaoka, W. C. Yeh and T. Taniguchi (2004). "Role of a transductional-transcriptional processor complex involving MyD88 and IRF-7 in Toll-like receptor signaling." Proc Natl Acad Sci U S A 101(43): 15416- 15421.

Honda, K., H. Yanai, H. Negishi, M. Asagiri, M. Sato, T. Mizutani, N. Shimada, Y. Ohba, A. Takaoka, N. Yoshida and T. Taniguchi (2005). "IRF-7 is the master regulator of type-I interferon- dependent immune responses." Nature 434(7034): 772-777.

Hornef, M. W. and C. Bogdan (2005). "The role of epithelial Toll-like receptor expression in host defense and microbial tolerance." J Endotoxin Res 11(2): 124-128.

152

References Hornef, M. W., T. Frisan, A. Vandewalle, S. Normark and A. Richter-Dahlfors (2002). "Toll-like receptor 4 resides in the Golgi apparatus and colocalizes with internalized lipopolysaccharide in intestinal epithelial cells." J Exp Med 195(5): 559-570.

Hornef, M. W., B. H. Normark, A. Vandewalle and S. Normark (2003). "Intracellular recognition of lipopolysaccharide by toll-like receptor 4 in intestinal epithelial cells." J Exp Med 198(8): 1225- 1235.

Hornung, V., A. Ablasser, M. Charrel-Dennis, F. Bauernfeind, G. Horvath, D. R. Caffrey, E. Latz and K. A. Fitzgerald (2009). "AIM2 recognizes cytosolic dsDNA and forms a caspase-1-activating inflammasome with ASC." Nature 458(7237): 514-518.

Hoshino, K., I. Sasaki, T. Sugiyama, T. Yano, C. Yamazaki, T. Yasui, H. Kikutani and T. Kaisho (2010). "Critical role of IkappaB Kinase alpha in TLR7/9-induced type I IFN production by conventional dendritic cells." J Immunol 184(7): 3341-3345.

Hoshino, K., O. Takeuchi, T. Kawai, H. Sanjo, T. Ogawa, Y. Takeda, K. Takeda and S. Akira (1999). "Cutting edge: Toll-like receptor 4 (TLR4)-deficient mice are hyporesponsive to lipopolysaccharide: evidence for TLR4 as the Lps gene product." J Immunol 162(7): 3749-3752.

Hsieh, C. S., S. E. Macatonia, C. S. Tripp, S. F. Wolf, A. O'Garra and K. M. Murphy (1993). "Development of TH1 CD4+ T cells through IL-12 produced by Listeria-induced macrophages." Science 260(5107): 547-549.

Huang, S. J., D. Hijnen, G. F. Murphy, T. S. Kupper, A. W. Calarese, I. G. Mollet, C. F. Schanbacher, D. M. Miller, C. D. Schmults and R. A. Clark (2009). "Imiquimod enhances IFN- gamma production and effector function of T cells infiltrating human squamous cell carcinomas of the skin." J Invest Dermatol 129(11): 2676-2685.

Huang, S. W., K. T. Liu, C. C. Chang, Y. J. Chen, C. Y. Wu, J. J. Tsai, W. C. Lu, Y. T. Wang, C. M. Liu and J. J. Shieh (2010). "Imiquimod simultaneously induces autophagy and apoptosis in human basal cell carcinoma cells." Br J Dermatol 163(2): 310-320.

Huang, W., C. Zhu, H. Wang, E. Horvath and E. A. Eklund (2008). "The interferon consensus sequence-binding protein (ICSBP/IRF8) represses PTPN13 gene transcription in differentiating myeloid cells." J Biol Chem 283(12): 7921-7935.

Hultmark, D. (1994). "Macrophage differentiation marker MyD88 is a member of the Toll/IL-1 receptor family." Biochem Biophys Res Commun 199(1): 144-146.

153

References Ingraham, C. R., A. Kinoshita, S. Kondo, B. Yang, S. Sajan, K. J. Trout, M. I. Malik, M. Dunnwald, S. L. Goudy, M. Lovett, J. C. Murray and B. C. Schutte (2006). "Abnormal skin, limb and craniofacial morphogenesis in mice deficient for interferon regulatory factor 6 (Irf6)." Nat Genet 38(11): 1335-1340.

Iram, N., M. Mildner, M. Prior, P. Petzelbauer, C. Fiala, S. Hacker, A. Schoppl, E. Tschachler and A. Elbe-Burger (2012). "Age-related changes in expression and function of Toll-like receptors in human skin." Development 139(22): 4210-4219.

Isaacs, A. and J. Lindenmann (1957). "Virus interference. I. The interferon." Proc R Soc Lond B Biol Sci 147(927): 258-267.

Ismail, A. and N. Yusuf (2014). "Type I Interferons: Key Players in Normal Skin and Select Cutaneous Malignancies." Dermatology Research and Practice 2014: 11.

Ito, T., W. F. t. Carson, K. A. Cavassani, J. M. Connett and S. L. Kunkel (2011). "CCR6 as a mediator of immunity in the lung and gut." Exp Cell Res 317(5): 613-619.

Ito, Y., A. Yoshikawa, T. Hotani, S. Fukuda, K. Sugimura and T. Imoto (1999). "Amino acid sequences of lysozymes newly purified from invertebrates imply wide distribution of a novel class in the lysozyme family." Eur J Biochem 259(1-2): 456-461.

Jacobson, N. G., S. J. Szabo, R. M. Weber-Nordt, Z. Zhong, R. D. Schreiber, J. E. Darnell, Jr. and K. M. Murphy (1995). "Interleukin 12 signaling in T helper type 1 (Th1) cells involves tyrosine phosphorylation of signal transducer and activator of transcription (Stat)3 and Stat4." J Exp Med 181(5): 1755-1762.

Jiang, R., Y. Lan, H. D. Chapman, C. Shawber, C. R. Norton, D. V. Serreze, G. Weinmaster and T. Gridley (1998). "Defects in limb, craniofacial, and thymic development in Jagged2 mutant mice." Genes Dev 12(7): 1046-1057.

Jiang, Z., T. W. Mak, G. Sen and X. Li (2004). "Toll-like receptor 3-mediated activation of NF- kappaB and IRF3 diverges at Toll-IL-1 receptor domain-containing adapter inducing IFN-beta." Proc Natl Acad Sci U S A 101(10): 3533-3538.

Jilling, T., D. Simon, J. Lu, F. J. Meng, D. Li, R. Schy, R. B. Thomson, A. Soliman, M. Arditi and M. S. Caplan (2006). "The roles of bacteria and TLR4 in rat and murine models of necrotizing enterocolitis." J Immunol 177(5): 3273-3282.

154

References Johnston, J. B., M. M. Rahman and G. McFadden (2007). "Strategies that modulate inflammasomes: insights from host-pathogen interactions." Semin Immunopathol 29(3): 261-274.

Jones, H. W., Jr., V. A. McKusick, P. S. Harper and K. D. Wuu (1971). "George Otto Gey. (1899- 1970). The HeLa cell and a reappraisal of its origin." Obstet Gynecol 38(6): 945-949.

Jones, J. L., J. W. Canady, J. T. Brookes, G. L. Wehby, J. L'Heureux, B. C. Schutte, J. C. Murray and M. Dunnwald (2010). "Wound complications after cleft repair in children with Van der Woude syndrome." J Craniofac Surg 21(5): 1350-1353.

Jones, L. L., V. Chaturvedi, C. Uyttenhove, J. Van Snick and D. A. Vignali (2012). "Distinct subunit pairing criteria within the heterodimeric IL-12 cytokine family." Mol Immunol 51(2): 234- 244.

Jugessur, A., M. Shi, H. K. Gjessing, R. T. Lie, A. J. Wilcox, C. R. Weinberg, K. Christensen, A. L. Boyles, S. Daack-Hirsch, T. N. Trung, C. Bille, A. C. Lidral and J. C. Murray (2009). "Genetic Determinants of Facial Clefting: Analysis of 357 Candidate Genes Using Two National Cleft Studies from Scandinavia." PLoS ONE 4(4).

Junttila, M. R., R. Ala-Aho, T. Jokilehto, J. Peltonen, M. Kallajoki, R. Grenman, P. Jaakkola, J. Westermarck and V. M. Kahari (2007). "p38alpha and p38delta mitogen-activated protein kinase isoforms regulate invasion and growth of head and neck squamous carcinoma cells." Oncogene 26(36): 5267-5279.

Kaartinen, V., J. W. Voncken, C. Shuler, D. Warburton, D. Bu, N. Heisterkamp and J. Groffen (1995). "Abnormal lung development and cleft palate in mice lacking TGF-beta 3 indicates defects of epithelial-mesenchymal interaction." Nat Genet 11(4): 415-421.

Kaburagi, Y., Y. Shimada, T. Nagaoka, M. Hasegawa, K. Takehara and S. Sato (2001). "Enhanced production of CC-chemokines (RANTES, MCP-1, MIP-1alpha, MIP-1beta, and eotaxin) in patients with atopic dermatitis." Arch Dermatol Res 293(7): 350-355.

Kagan, J. C., T. Su, T. Horng, A. Chow, S. Akira and R. Medzhitov (2008). "TRAM couples endocytosis of Toll-like receptor 4 to the induction of interferon-beta." Nat Immunol 9(4): 361-368.

Kaiser, W. J. and M. K. Offermann (2005). "Apoptosis induced by the toll-like receptor adaptor TRIF is dependent on its receptor interacting protein homotypic interaction motif." J Immunol 174(8): 4942-4952.

155

References Kalish, R. S. (1989). "Non-specifically activated human peripheral blood mononuclear cells are cytotoxic for human keratinocytes in vitro." J Immunol 142(1): 74-80.

Kalthoff, F. S., J. Chung and A. Stuetz (2002). "Pimecrolimus inhibits up-regulation of OX40 and synthesis of inflammatory cytokines upon secondary T cell activation by allogeneic dendritic cells." Clin Exp Immunol 130(1): 85-92.

Kaneko, F., M. Suzuki, Y. Takiguchi, N. Itoh and T. Minagawa (1990). "Immunohistopathologic studies in the development of psoriatic lesion influenced by gamma-interferon and the producing cells." J Dermatol Sci 1(6): 425-434.

Kaplan, M. H., Y. L. Sun, T. Hoey and M. J. Grusby (1996). "Impaired IL-12 responses and enhanced development of Th2 cells in Stat4-deficient mice." Nature 382(6587): 174-177.

Kato, H., O. Takeuchi, E. Mikamo-Satoh, R. Hirai, T. Kawai, K. Matsushita, A. Hiiragi, T. S. Dermody, T. Fujita and S. Akira (2008). "Length-dependent recognition of double-stranded ribonucleic acids by retinoic acid-inducible gene-I and melanoma differentiation-associated gene 5." J Exp Med 205(7): 1601-1610.

Katsounas, A., J. F. Schlaak and R. A. Lempicki (2011). "CCL5: a double-edged sword in host defense against the hepatitis C virus." Int Rev Immunol 30(5-6): 366-378.

Kawai, K., H. Shimura, M. Minagawa, A. Ito, K. Tomiyama and M. Ito (2002). "Expression of functional Toll-like receptor 2 on human epidermal keratinocytes." J Dermatol Sci 30(3): 185-194.

Kawai, T. and S. Akira (2006). "TLR signaling." Cell Death Differ 13(5): 816-825.

Kawai, T. and S. Akira (2007). "TLR signaling." Semin Immunol 19(1): 24-32.

Kawai, T., S. Sato, K. J. Ishii, C. Coban, H. Hemmi, M. Yamamoto, K. Terai, M. Matsuda, J. Inoue, S. Uematsu, O. Takeuchi and S. Akira (2004). "Interferon-alpha induction through Toll-like receptors involves a direct interaction of IRF7 with MyD88 and TRAF6." Nat Immunol 5(10): 1061-1068.

Kawai, T., K. Takahashi, S. Sato, C. Coban, H. Kumar, H. Kato, K. J. Ishii, O. Takeuchi and S. Akira (2005). "IPS-1, an adaptor triggering RIG-I- and Mda5-mediated type I interferon induction." Nat Immunol 6(10): 981-988.

Keith, F. J. and N. J. Gay (1990). "The Drosophila membrane receptor Toll can function to promote cellular adhesion." EMBO J 9(13): 4299-4306.

156

References Kennedy-Crispin, M., E. Billick, H. Mitsui, N. Gulati, H. Fujita, P. Gilleaudeau, M. Sullivan- Whalen, L. M. Johnson-Huang, M. Suarez-Farinas and J. G. Krueger (2012). "Human keratinocytes' response to injury upregulates CCL20 and other genes linking innate and adaptive immunity." J Invest Dermatol 132(1): 105-113.

Kerrigan, A. M. and G. D. Brown (2009). "C-type lectins and phagocytosis." Immunobiology 214(7): 562-575.

Kerrigan, A. M. and G. D. Brown (2011). "Syk-coupled C-type lectins in immunity." Trends Immunol 32(4): 151-156.

Kim, T. K. and T. Maniatis (1997). "The mechanism of transcriptional synergy of an in vitro assembled interferon-beta enhanceosome." Mol Cell 1(1): 119-129.

Kimball, A. B., K. B. Gordon, R. G. Langley, A. Menter, E. K. Chartash and J. Valdes (2008). "Safety and efficacy of ABT-874, a fully human interleukin 12/23 monoclonal antibody, in the treatment of moderate to severe chronic plaque psoriasis: results of a randomized, placebo- controlled, phase 2 trial." Arch Dermatol 144(2): 200-207.

Kimball, A. B., K. B. Gordon, R. G. Langley, A. Menter, R. J. Perdok and J. Valdes (2011). "Efficacy and safety of ABT-874, a monoclonal anti-interleukin 12/23 antibody, for the treatment of chronic plaque psoriasis: 36-week observation/retreatment and 60-week open-label extension phases of a randomized phase II trial." J Am Acad Dermatol 64(2): 263-274.

Kisich, K. O., M. D. Howell, M. Boguniewicz, H. R. Heizer, N. U. Watson and D. Y. Leung (2007). "The constitutive capacity of human keratinocytes to kill Staphylococcus aureus is dependent on beta-defensin 3." J Invest Dermatol 127(10): 2368-2380.

Klotman, M. E. and T. L. Chang (2006). "Defensins in innate antiviral immunity." Nat Rev Immunol 6(6): 447-456.

Knight, A. S., B. C. Schutte, R. Jiang and M. J. Dixon (2006). "Developmental expression analysis of the mouse and chick orthologues of IRF6: the gene mutated in Van der Woude syndrome." Dev Dyn 235(5): 1441-1447.

Knight, A. S., B. C. Schutte, R. L. Jiang and M. J. Dixon (2006). "Developmental expression analysis of the mouse and chick orthologues of IRF6: The gene mutated in Van der Woude syndrome." Dev Dyn 235(5): 1441-1447.

157

References Koblansky, A. A., D. Jankovic, H. Oh, S. Hieny, W. Sungnak, R. Mathur, M. S. Hayden, S. Akira, A. Sher and S. Ghosh (2013). "Recognition of profilin by Toll-like receptor 12 is critical for host resistance to Toxoplasma gondii." Immunity 38(1): 119-130.

Koillinen, H., F. K. Wong, J. Rautio, V. Ollikainen, A. Karsten, O. Larson, B. T. Teh, J. Huggare, P. Lahermo, C. Larsson and J. Kere (2001). "Mapping of the second locus for the Van der Woude syndrome to chromosome 1p34." Eur J Hum Genet 9(10): 747-752.

Kollisch, G., B. N. Kalali, V. Voelcker, R. Wallich, H. Behrendt, J. Ring, S. Bauer, T. Jakob, M. Mempel and M. Ollert (2005). "Various members of the Toll-like receptor family contribute to the innate immune response of human epidermal keratinocytes." Immunology 114(4): 531-541.

Kondo, S., B. C. Schutte, R. J. Richardson, B. C. Bjork, A. S. Knight, Y. Watanabe, E. Howard, R. de Lima, S. Daack-Hirsch, A. Sander, D. M. McDonald-McGinn, E. H. Zackai, E. J. Lammer, A. S. Aylsworth, H. H. Ardinger, A. C. Lidral, B. R. Pober, L. Moreno, M. Arcos-Burgos, C. Valencia, C. Houdayer, M. Bahuau, D. Moretti-Ferreira, A. Richieri-Costa, M. J. Dixon and J. C. Murray (2002). "Mutations in IRF6 cause Van der Woude and popliteal pterygium syndromes." Nat Genet 32(2): 285-289.

Kono, T., S. Kondo, S. Pastore, G. M. Shivji, M. A. Tomai, R. C. McKenzie and D. N. Sauder (1994). "Effects of a novel topical immunomodulator, imiquimod, on keratinocyte cytokine gene expression." Lymphokine Cytokine Res 13(2): 71-76.

Krishna, S. and L. S. Miller (2012). "Host-pathogen interactions between the skin and Staphylococcus aureus." Curr Opin Microbiol 15(1): 28-35.

Krueger, G. G., R. G. Langley, C. Leonardi, N. Yeilding, C. Guzzo, Y. Wang, L. T. Dooley and M. Lebwohl (2007). "A human interleukin-12/23 monoclonal antibody for the treatment of psoriasis." N Engl J Med 356(6): 580-592.

Kumar, S., P. C. McDonnell, R. Lehr, L. Tierney, M. N. Tzimas, D. E. Griswold, E. A. Capper, R. Tal-Singer, G. I. Wells, M. L. Doyle and P. R. Young (2000). "Identification and initial characterization of four novel members of the interleukin-1 family." J Biol Chem 275(14): 10308- 10314.

Kunsch, C., R. K. Lang, C. A. Rosen and M. F. Shannon (1994). "Synergistic transcriptional activation of the IL-8 gene by NF-kappa B p65 (RelA) and NF-IL-6." J Immunol 153(1): 153-164.

158

References Kunsch, C. and C. A. Rosen (1993). "NF-kappa B subunit-specific regulation of the interleukin-8 promoter." Mol Cell Biol 13(10): 6137-6146.

Kuo, I. H., A. Carpenter-Mendini, T. Yoshida, L. Y. McGirt, A. I. Ivanov, K. C. Barnes, R. L. Gallo, A. W. Borkowski, K. Yamasaki, D. Y. Leung, S. N. Georas, A. De Benedetto and L. A. Beck (2013). "Activation of epidermal toll-like receptor 2 enhances tight junction function: implications for atopic dermatitis and skin barrier repair." J Invest Dermatol 133(4): 988-998.

Kurokawa, K., M. S. Kim, R. Ichikawa, K. H. Ryu, N. Dohmae, H. Nakayama and B. L. Lee (2012). "Environment-mediated accumulation of diacyl lipoproteins over their triacyl counterparts in Staphylococcus aureus." J Bacteriol 194(13): 3299-3306.

Kurokawa, K., H. Lee, K. B. Roh, M. Asanuma, Y. S. Kim, H. Nakayama, A. Shiratsuchi, Y. Choi, O. Takeuchi, H. J. Kang, N. Dohmae, Y. Nakanishi, S. Akira, K. Sekimizu and B. L. Lee (2009). "The Triacylated ATP Binding Cluster Transporter Substrate-binding Lipoprotein of Staphylococcus aureus Functions as a Native Ligand for Toll-like Receptor 2." J Biol Chem 284(13): 8406-8411.

Kurzeja, M., L. Rudnicka and M. Olszewska (2011). "New interleukin-23 pathway inhibitors in dermatology: ustekinumab, briakinumab, and secukinumab." Am J Clin Dermatol 12(2): 113-125.

Lafaille, F. G., I. M. Pessach, S. Y. Zhang, M. J. Ciancanelli, M. Herman, A. Abhyankar, S. W. Ying, S. Keros, P. A. Goldstein, G. Mostoslavsky, J. Ordovas-Montanes, E. Jouanguy, S. Plancoulaine, E. Tu, Y. Elkabetz, S. Al-Muhsen, M. Tardieu, T. M. Schlaeger, G. Q. Daley, L. Abel, J. L. Casanova, L. Studer and L. D. Notarangelo (2012). "Impaired intrinsic immunity to HSV-1 in human iPSC-derived TLR3-deficient CNS cells." Nature 491(7426): 769-773.

Lai, Y., A. L. Cogen, K. A. Radek, H. J. Park, D. T. Macleod, A. Leichtle, A. F. Ryan, A. Di Nardo and R. L. Gallo (2010). "Activation of TLR2 by a small molecule produced by Staphylococcus epidermidis increases antimicrobial defense against bacterial skin infections." J Invest Dermatol 130(9): 2211-2221.

Lai, Y., A. Di Nardo, T. Nakatsuji, A. Leichtle, Y. Yang, A. L. Cogen, Z. R. Wu, L. V. Hooper, R. R. Schmidt, S. von Aulock, K. A. Radek, C. M. Huang, A. F. Ryan and R. L. Gallo (2009). "Commensal bacteria regulate Toll-like receptor 3-dependent inflammation after skin injury." Nat Med 15(12): 1377-1382.

Lai, Y. and R. L. Gallo (2008). "Toll-like receptors in skin infections and inflammatory diseases." Infect Disord Drug Targets 8(3): 144-155. 159

References Langrish, C. L., B. S. McKenzie, N. J. Wilson, R. de Waal Malefyt, R. A. Kastelein and D. J. Cua (2004). "IL-12 and IL-23: master regulators of innate and adaptive immunity." Immunol Rev 202: 96-105.

LaPenta, D., C. Rubens, E. Chi and P. P. Cleary (1994). "Group A streptococci efficiently invade human respiratory epithelial cells." Proc Natl Acad Sci U S A 91(25): 12115-12119.

Lapteva, N. and X. F. Huang (2010). "CCL5 as an adjuvant for cancer immunotherapy." Expert Opin Biol Ther 10(5): 725-733.

Larousserie, F., S. Pflanz, A. Coulomb-L'Hermine, N. Brousse, R. Kastelein and O. Devergne (2004). "Expression of IL-27 in human Th1-associated granulomatous diseases." J Pathol 202(2): 164-171.

Lau, J. F., J. P. Parisien and C. M. Horvath (2000). "Interferon regulatory factor subcellular localization is determined by a bipartite nuclear localization signal in the DNA-binding domain and interaction with cytoplasmic retention factors." Proc Natl Acad Sci U S A 97(13): 7278-7283.

Lauw, F. N., D. R. Caffrey and D. T. Golenbock (2005). "Of mice and man: TLR11 (finally) finds profilin." Trends Immunol 26(10): 509-511.

Le, T. A., T. Takai, A. T. Vu, H. Kinoshita, X. Chen, S. Ikeda, H. Ogawa and K. Okumura (2011). "Flagellin induces the expression of thymic stromal lymphopoietin in human keratinocytes via toll- like receptor 5." Int Arch Allergy Immunol 155(1): 31-37.

Leaphart, C. L., J. Cavallo, S. C. Gribar, S. Cetin, J. Li, M. F. Branca, T. D. Dubowski, C. P. Sodhi and D. J. Hackam (2007). "A critical role for TLR4 in the pathogenesis of necrotizing enterocolitis by modulating intestinal injury and repair." J Immunol 179(7): 4808-4820.

Leblanc, J. F., L. Cohen, M. Rodrigues and J. Hiscott (1990). "Synergism between distinct enhanson domains in viral induction of the human beta interferon gene." Mol Cell Biol 10(8): 3987- 3993.

Lebre, M. C., A. M. van der Aar, L. van Baarsen, T. M. van Capel, J. H. Schuitemaker, M. L. Kapsenberg and E. C. de Jong (2007). "Human keratinocytes express functional Toll-like receptor 3, 4, 5, and 9." J Invest Dermatol 127(2): 331-341.

Lee, E., W. L. Trepicchio, J. L. Oestreicher, D. Pittman, F. Wang, F. Chamian, M. Dhodapkar and J. G. Krueger (2004). "Increased expression of interleukin 23 p19 and p40 in lesional skin of patients with psoriasis vulgaris." J Exp Med 199(1): 125-130. 160

References Lehmann, B. (1997). "HaCaT cell line as a model system for vitamin D3 metabolism in human skin." J Invest Dermatol 108(1): 78-82.

Lemaitre, B., E. Nicolas, L. Michaut, J. M. Reichhart and J. A. Hoffmann (1996). "The dorsoventral regulatory gene cassette spatzle/Toll/cactus controls the potent antifungal response in Drosophila adults." Cell 86(6): 973-983.

Leonardi, C. L., A. B. Kimball, K. A. Papp, N. Yeilding, C. Guzzo, Y. Wang, S. Li, L. T. Dooley and K. B. Gordon (2008). "Efficacy and safety of ustekinumab, a human interleukin-12/23 monoclonal antibody, in patients with psoriasis: 76-week results from a randomised, double-blind, placebo-controlled trial (PHOENIX 1)." Lancet 371(9625): 1665-1674.

Levy, J. A. (2009). "The unexpected pleiotropic activities of RANTES." J Immunol 182(7): 3945- 3946.

Lewis, D. A. and D. F. Spandau (2007). "UVB activation of NF-kappaB in normal human keratinocytes occurs via a unique mechanism." Arch Dermatol Res 299(2): 93-101.

Leyden, J. J., R. R. Marples and A. M. Kligman (1974). "Staphylococcus aureus in the lesions of atopic dermatitis." Br J Dermatol 90(5): 525-530.

Li, H., M. Kobayashi, M. Blonska, Y. You and X. Lin (2006). "Ubiquitination of RIP is required for tumor necrosis factor alpha-induced NF-kappaB activation." J Biol Chem 281(19): 13636-13643.

Li, H., J. Zhang, A. Kumar, M. Zheng, S. S. Atherton and F. S. Yu (2006). "Herpes simplex virus 1 infection induces the expression of proinflammatory cytokines, interferons and TLR7 in human corneal epithelial cells." Immunology 117(2): 167-176.

Li, J., G. W. Ireland, P. M. Farthing and M. H. Thornhill (1996). "Epidermal and oral keratinocytes are induced to produce RANTES and IL-8 by cytokine stimulation." J Invest Dermatol 106(4): 661- 666.

Li, Q., Q. Lu, G. Estepa and I. M. Verma (2005). "Identification of 14-3-3sigma mutation causing cutaneous abnormality in repeated-epilation mutant mouse." Proc Natl Acad Sci U S A 102(44): 15977-15982.

Li, S., A. Strelow, E. J. Fontana and H. Wesche (2002). "IRAK-4: a novel member of the IRAK family with the properties of an IRAK-kinase." Proc Natl Acad Sci U S A 99(8): 5567-5572.

161

References Li, S., L. Wang, M. Berman, Y. Y. Kong and M. E. Dorf (2011). "Mapping a dynamic innate immunity protein interaction network regulating type I interferon production." Immunity 35(3): 426-440.

Li, X., S. Leung, S. Qureshi, J. E. Darnell, Jr. and G. R. Stark (1996). "Formation of STAT1- STAT2 heterodimers and their role in the activation of IRF-1 gene transcription by interferon- alpha." J Biol Chem 271(10): 5790-5794.

Li, Z. J., K. C. Sohn, D. K. Choi, G. Shi, D. Hong, H. E. Lee, K. U. Whang, Y. H. Lee, M. Im, Y. Lee, Y. J. Seo, C. D. Kim and J. H. Lee (2013). "Roles of TLR7 in Activation of NF-kappaB Signaling of Keratinocytes by Imiquimod." PLoS ONE 8(10): e77159.

Lian, L. H., K. A. Milora, K. K. Manupipatpong and L. E. Jensen (2012). "The double-stranded RNA analogue polyinosinic-polycytidylic acid induces keratinocyte pyroptosis and release of IL- 36gamma." J Invest Dermatol 132(5): 1346-1353.

Lin, Q., D. Fang, J. Fang, X. Ren, X. Yang, F. Wen and S. B. Su (2011). "Impaired wound healing with defective expression of chemokines and recruitment of myeloid cells in TLR3-deficient mice." J Immunol 186(6): 3710-3717.

Lin, Q., L. Wang, Y. Lin, X. Liu, X. Ren, S. Wen, X. Du, T. Lu, S. Y. Su, X. Yang, W. Huang, S. Zhou, F. Wen and S. B. Su (2012). "Toll-like receptor 3 ligand polyinosinic:polycytidylic acid promotes wound healing in human and murine skin." J Invest Dermatol 132(8): 2085-2092.

Lin, R., C. Heylbroeck, P. Genin, P. M. Pitha and J. Hiscott (1999). "Essential role of interferon regulatory factor 3 in direct activation of RANTES chemokine transcription." Mol Cell Biol 19(2): 959-966.

Lin, R., C. Heylbroeck, P. M. Pitha and J. Hiscott (1998). "Virus-dependent phosphorylation of the IRF-3 transcription factor regulates nuclear translocation, transactivation potential, and proteasome- mediated degradation." Mol Cell Biol 18(5): 2986-2996.

Ling, P., M. K. Gately, U. Gubler, A. S. Stern, P. Lin, K. Hollfelder, C. Su, Y. C. Pan and J. Hakimi (1995). "Human IL-12 p40 homodimer binds to the IL-12 receptor but does not mediate biologic activity." J Immunol 154(1): 116-127.

Little, H. J., N. K. Rorick, L. I. Su, C. Baldock, S. Malhotra, T. Jowitt, L. Gakhar, R. Subramanian, B. C. Schutte, M. J. Dixon and P. Shore (2009). "Missense mutations that cause Van der Woude

162

References syndrome and popliteal pterygium syndrome affect the DNA-binding and transcriptional activation functions of IRF6 (vol 18, pg 535, 2009)." Hum Mol Genet 18(8): 1544-1544.

Lomaga, M. A., W. C. Yeh, I. Sarosi, G. S. Duncan, C. Furlonger, A. Ho, S. Morony, C. Capparelli, G. Van, S. Kaufman, A. van der Heiden, A. Itie, A. Wakeham, W. Khoo, T. Sasaki, Z. Cao, J. M. Penninger, C. J. Paige, D. L. Lacey, C. R. Dunstan, W. J. Boyle, D. V. Goeddel and T. W. Mak (1999). "TRAF6 deficiency results in osteopetrosis and defective interleukin-1, CD40, and LPS signaling." Genes Dev 13(8): 1015-1024.

Lowy, F. D. (1998). "Staphylococcus aureus infections." N Engl J Med 339(8): 520-532.

Lubbe, J. (2003). "Secondary infections in patients with atopic dermatitis." Am J Clin Dermatol 4(9): 641-654.

Lucas, S., N. Ghilardi, J. Li and F. J. de Sauvage (2003). "IL-27 regulates IL-12 responsiveness of naive CD4+ T cells through Stat1-dependent and -independent mechanisms." Proc Natl Acad Sci U S A 100(25): 15047-15052.

Ludlow, L. E., R. W. Johnstone and C. J. Clarke (2005). "The HIN-200 family: more than interferon-inducible genes?" Exp Cell Res 308(1): 1-17.

Lund, J. M., L. Alexopoulou, A. Sato, M. Karow, N. C. Adams, N. W. Gale, A. Iwasaki and R. A. Flavell (2004). "Recognition of single-stranded RNA viruses by Toll-like receptor 7." Proc Natl Acad Sci U S A 101(15): 5598-5603.

Lupardus, P. J. and K. C. Garcia (2008). "The structure of interleukin-23 reveals the molecular basis of p40 subunit sharing with interleukin-12." J Mol Biol 382(4): 931-941.

Maaser, C., L. J. Egan, M. P. Birkenbach, L. Eckmann and M. F. Kagnoff (2004). "Expression of Epstein-Barr virus-induced gene 3 and other interleukin-12-related molecules by human intestinal epithelium." Immunology 112(3): 437-445.

Macatonia, S. E., N. A. Hosken, M. Litton, P. Vieira, C. S. Hsieh, J. A. Culpepper, M. Wysocka, G. Trinchieri, K. M. Murphy and A. O'Garra (1995). "Dendritic cells produce IL-12 and direct the development of Th1 cells from naive CD4+ T cells." J Immunol 154(10): 5071-5079.

Magcwebeba, T., S. Riedel, S. Swanevelder, P. Bouic, P. Swart and W. Gelderblom (2012). "Interleukin-1alpha Induction in Human Keratinocytes (HaCaT): An In Vitro Model for Chemoprevention in Skin." J Skin Cancer 2012: 393681.

163

References Makino, Y., D. N. Cook, O. Smithies, O. Y. Hwang, E. G. Neilson, L. A. Turka, H. Sato, A. D. Wells and T. M. Danoff (2002). "Impaired T cell function in RANTES-deficient mice." Clin Immunol 102(3): 302-309.

Mancuso, G., M. Gambuzza, A. Midiri, C. Biondo, S. Papasergi, S. Akira, G. Teti and C. Beninati (2009). "Bacterial recognition by TLR7 in the lysosomes of conventional dendritic cells." Nat Immunol 10(6): 587-594.

Manel, N., D. Unutmaz and D. R. Littman (2008). "The differentiation of human T(H)-17 cells requires transforming growth factor-beta and induction of the nuclear receptor RORgammat." Nat Immunol 9(6): 641-649.

Manetti, R., P. Parronchi, M. G. Giudizi, M. P. Piccinni, E. Maggi, G. Trinchieri and S. Romagnani (1993). "Natural killer cell stimulatory factor (interleukin 12 [IL-12]) induces T helper type 1 (Th1)-specific immune responses and inhibits the development of IL-4-producing Th cells." J Exp Med 177(4): 1199-1204.

Maniatis, T., J. V. Falvo, T. H. Kim, T. K. Kim, C. H. Lin, B. S. Parekh and M. G. Wathelet (1998). "Structure and function of the interferon-beta enhanceosome." Cold Spring Harb Symp Quant Biol 63: 609-620.

Marcinkowska, E., A. Wiedlocha and C. Radzikowski (1997). "1,25-Dihydroxyvitamin D3 induced activation and subsequent nuclear translocation of MAPK is upstream regulated by PKC in HL-60 cells." Biochem Biophys Res Commun 241(2): 419-426.

Marie, I., E. Smith, A. Prakash and D. E. Levy (2000). "Phosphorylation-induced dimerization of interferon regulatory factor 7 unmasks DNA binding and a bipartite transactivation domain." Mol Cell Biol 20(23): 8803-8814.

Martinez-Alvarez, C., C. Tudela, J. Perez-Miguelsanz, S. O'Kane, J. Puerta and M. W. Ferguson (2000). "Medial edge epithelial cell fate during palatal fusion." Dev Biol 220(2): 343-357.

Martinon, F., K. Burns and J. Tschopp (2002). "The inflammasome: a molecular platform triggering activation of inflammatory caspases and processing of proIL-beta." Mol Cell 10(2): 417-426.

Masumi, A., S. Tamaoki, I. M. Wang, K. Ozato and K. Komuro (2002). "IRF-8/ICSBP and IRF-1 cooperatively stimulate mouse IL-12 promoter activity in macrophages." FEBS Lett 531(2): 348- 353.

164

References Matias, M. A., J. M. Saunus, S. Ivanovski, L. J. Walsh and C. S. Farah (2011). "Accelerated wound healing phenotype in Interleukin 12/23 deficient mice." J Inflamm (Lond) 8: 39.

Matloubian, M., A. David, S. Engel, J. E. Ryan and J. G. Cyster (2000). "A transmembrane CXC chemokine is a ligand for HIV-coreceptor Bonzo." Nat Immunol 1(4): 298-304.

Matsui, K., M. Wirotesangthong and A. Nishikawa (2007). "Percutaneous application of peptidoglycan from Staphylococcus aureus induces eosinophil infiltration in mouse skin." Clin Exp Allergy 37(4): 615-622.

Matsumoto, M., S. Kikkawa, M. Kohase, K. Miyake and T. Seya (2002). "Establishment of a monoclonal antibody against human Toll-like receptor 3 that blocks double-stranded RNA- mediated signaling." Biochem Biophys Res Commun 293(5): 1364-1369.

Matsusaka, T., K. Fujikawa, Y. Nishio, N. Mukaida, K. Matsushima, T. Kishimoto and S. Akira (1993). "Transcription factors NF-IL6 and NF-kappa B synergistically activate transcription of the inflammatory cytokines, interleukin 6 and interleukin 8." Proc Natl Acad Sci U S A 90(21): 10193- 10197.

McGough, J. M., D. Yang, S. Huang, D. Georgi, S. M. Hewitt, C. Rocken, M. Tanzer, M. P. Ebert and K. Liu (2008). "DNA methylation represses IFN-gamma-induced and signal transducer and activator of transcription 1-mediated IFN regulatory factor 8 activation in colon carcinoma cells." Mol Cancer Res 6(12): 1841-1851.

McNamee, E. N., J. C. Masterson, P. Jedlicka, M. McManus, A. Grenz, C. B. Collins, M. F. Nold, C. Nold-Petry, P. Bufler, C. A. Dinarello and J. Rivera-Nieves (2011). "Interleukin 37 expression protects mice from colitis." Proc Natl Acad Sci U S A 108(40): 16711-16716.

McNeilly, A. D., J. A. Woods, S. H. Ibbotson, C. R. Wolf and G. Smith (2012). "Characterization of a human keratinocyte HaCaT cell line model to study the regulation of CYP2S1." Drug Metab Dispos 40(2): 283-289.

Medzhitov, R., P. Preston-Hurlburt and C. A. Janeway, Jr. (1997). "A human homologue of the Drosophila Toll protein signals activation of adaptive immunity." Nature 388(6640): 394-397.

Medzhitov, R., P. Preston-Hurlburt, E. Kopp, A. Stadlen, C. Chen, S. Ghosh and C. A. Janeway, Jr. (1998). "MyD88 is an adaptor protein in the hToll/IL-1 receptor family signaling pathways." Mol Cell 2(2): 253-258.

165

References Melchjorsen, J. and S. R. Paludan (2003). "Induction of RANTES/CCL5 by herpes simplex virus is regulated by nuclear factor kappa B and interferon regulatory factor 3." J Gen Virol 84(Pt 9): 2491- 2495.

Melmed, G., L. S. Thomas, N. Lee, S. Y. Tesfay, K. Lukasek, K. S. Michelsen, Y. Zhou, B. Hu, M. Arditi and M. T. Abreu (2003). "Human intestinal epithelial cells are broadly unresponsive to Toll- like receptor 2-dependent bacterial ligands: implications for host-microbial interactions in the gut." J Immunol 170(3): 1406-1415.

Mempel, M., V. Voelcker, G. Kollisch, C. Plank, R. Rad, M. Gerhard, C. Schnopp, P. Fraunberger, A. K. Walli, J. Ring, D. Abeck and M. Ollert (2003). "Toll-like receptor expression in human keratinocytes: nuclear factor kappaB controlled gene activation by Staphylococcus aureus is toll- like receptor 2 but not toll-like receptor 4 or platelet activating factor receptor dependent." J Invest Dermatol 121(6): 1389-1396.

Meraro, D., S. Hashmueli, B. Koren, A. Azriel, A. Oumard, S. Kirchhoff, H. Hauser, S. Nagulapalli, M. L. Atchison and B. Z. Levi (1999). "Protein-protein and DNA-protein interactions affect the activity of lymphoid-specific IFN regulatory factors." J Immunol 163(12): 6468-6478.

Merika, M. and D. Thanos (2001). "Enhanceosomes." Curr Opin Genet Dev 11(2): 205-208.

Meylan, E., K. Burns, K. Hofmann, V. Blancheteau, F. Martinon, M. Kelliher and J. Tschopp (2004). "RIP1 is an essential mediator of Toll-like receptor 3-induced NF-kappa B activation." Nat Immunol 5(5): 503-507.

Midorikawa, K., K. Ouhara, H. Komatsuzawa, T. Kawai, S. Yamada, T. Fujiwara, K. Yamazaki, K. Sayama, M. A. Taubman, H. Kurihara, K. Hashimoto and M. Sugai (2003). "Staphylococcus aureus susceptibility to innate antimicrobial peptides, beta-defensins and CAP18, expressed by human keratinocytes." Infect Immun 71(7): 3730-3739.

Miller, L. S. (2008). "Toll-like receptors in skin." Adv Dermatol 24: 71-87.

Miller, L. S. and R. L. Modlin (2007). "Human keratinocyte Toll-like receptors promote distinct immune responses." J Invest Dermatol 127(2): 262-263.

Miller, L. S., R. M. O'Connell, M. A. Gutierrez, E. M. Pietras, A. Shahangian, C. E. Gross, A. Thirumala, A. L. Cheung, G. Cheng and R. L. Modlin (2006). "MyD88 mediates neutrophil recruitment initiated by IL-1R but not TLR2 activation in immunity against Staphylococcus aureus." Immunity 24(1): 79-91.

166

References Miller, L. S., O. E. Sorensen, P. T. Liu, H. R. Jalian, D. Eshtiaghpour, B. E. Behmanesh, W. Chung, T. D. Starner, J. Kim, P. A. Sieling, T. Ganz and R. L. Modlin (2005). "TGF-alpha regulates TLR expression and function on epidermal keratinocytes." J Immunol 174(10): 6137-6143.

Mise-Omata, S., E. Kuroda, J. Niikura, U. Yamashita, Y. Obata and T. S. Doi (2007). "A proximal kappaB site in the IL-23 p19 promoter is responsible for RelA- and c-Rel-dependent transcription." J Immunol 179(10): 6596-6603.

Mitev, V. and L. Miteva (1999). "Signal transduction in keratinocytes." Exp Dermatol 8(2): 96-108.

Mittrucker, H. W., T. Matsuyama, A. Grossman, T. M. Kundig, J. Potter, A. Shahinian, A. Wakeham, B. Patterson, P. S. Ohashi and T. W. Mak (1997). "Requirement for the transcription factor LSIRF/IRF4 for mature B and T lymphocyte function." Science 275(5299): 540-543.

Molinari, G. and G. S. Chhatwal (1999). "Streptococcal invasion." Curr Opin Microbiol 2(1): 56- 61.

Monteleone, G., L. Biancone, R. Marasco, G. Morrone, O. Marasco, F. Luzza and F. Pallone (1997). "Interleukin 12 is expressed and actively released by Crohn's disease intestinal lamina propria mononuclear cells." Gastroenterology 112(4): 1169-1178.

Moretti, F., B. Marinari, N. Lo Iacono, E. Botti, A. Giunta, G. Spallone, G. Garaffo, E. Vernersson- Lindahl, G. Merlo, A. A. Mills, C. Ballaro, S. Alema, S. Chimenti, L. Guerrini and A. Costanzo (2010). "A regulatory feedback loop involving p63 and IRF6 links the pathogenesis of 2 genetically different human ectodermal dysplasias." J Clin Invest 120(5): 1570-1577.

Morr, M., O. Takeuchi, S. Akira, M. M. Simon and P. F. Muhlradt (2002). "Differential recognition of structural details of bacterial lipopeptides by toll-like receptors." Eur J Immunol 32(12): 3337- 3347.

Moynagh, P. N. (2005). "TLR signalling and activation of IRFs: revisiting old friends from the NF- kappaB pathway." Trends Immunol 26(9): 469-476.

Mudigonda, P., T. Mudigonda, A. N. Feneran, H. S. Alamdari, L. Sandoval and S. R. Feldman (2012). "Interleukin-23 and interleukin-17: importance in pathogenesis and therapy of psoriasis." Dermatol Online J 18(10): 1.

Muir, A., G. Soong, S. Sokol, B. Reddy, M. I. Gomez, A. Van Heeckeren and A. Prince (2004). "Toll-like receptors in normal and cystic fibrosis airway epithelial cells." Am J Respir Cell Mol Biol 30(6): 777-783. 167

References Mukaida, N., Y. Mahe and K. Matsushima (1990). "Cooperative interaction of nuclear factor-kappa B- and cis-regulatory enhancer binding protein-like factor binding elements in activating the interleukin-8 gene by pro-inflammatory cytokines." J Biol Chem 265(34): 21128-21133.

Muller, P., M. Muller-Anstett, J. Wagener, Q. Gao, S. Kaesler, M. Schaller, T. Biedermann and F. Gotz (2010). "The Staphylococcus aureus lipoprotein SitC colocalizes with Toll-like receptor 2 (TLR2) in murine keratinocytes and elicits intracellular TLR2 accumulation." Infect Immun 78(10): 4243-4250.

Mulvey, M. A. (2002). "Adhesion and entry of uropathogenic Escherichia coli." Cell Microbiol 4(5): 257-271.

Mulvey, M. A., J. D. Schilling and S. J. Hultgren (2001). "Establishment of a persistent Escherichia coli reservoir during the acute phase of a bladder infection." Infect Immun 69(7): 4572-4579.

Munshi, N., Y. Yie, M. Merika, K. Senger, S. Lomvardas, T. Agalioti and D. Thanos (1999). "The IFN-beta enhancer: a paradigm for understanding activation and repression of inducible gene expression." Cold Spring Harb Symp Quant Biol 64: 149-159.

Muranski, P., A. Boni, P. A. Antony, L. Cassard, K. R. Irvine, A. Kaiser, C. M. Paulos, D. C. Palmer, C. E. Touloukian, K. Ptak, L. Gattinoni, C. Wrzesinski, C. S. Hinrichs, K. W. Kerstann, L. Feigenbaum, C. C. Chan and N. P. Restifo (2008). "Tumor-specific Th17-polarized cells eradicate large established melanoma." Blood 112(2): 362-373.

Murata, Y., J. Ogata, Y. Higaki, M. Kawashima, Y. Yada, K. Higuchi, T. Tsuchiya, S. Kawainami and G. Imokawa (1996). "Abnormal expression of sphingomyelin acylase in atopic dermatitis: an etiologic factor for ceramide deficiency?" J Invest Dermatol 106(6): 1242-1249.

Murphy, C. A., C. L. Langrish, Y. Chen, W. Blumenschein, T. McClanahan, R. A. Kastelein, J. D. Sedgwick and D. J. Cua (2003). "Divergent pro- and antiinflammatory roles for IL-23 and IL-12 in joint autoimmune inflammation." J Exp Med 198(12): 1951-1957.

Murphy, G. F., T. C. Flynn, R. H. Rice and G. S. Pinkus (1984). "Involucrin expression in normal and neoplastic human skin: a marker for keratinocyte differentiation." J Invest Dermatol 82(5): 453- 457.

Murray, J. C., D. Y. Nishimura, K. H. Buetow, H. H. Ardinger, M. A. Spence, R. S. Sparkes, R. E. Falk, P. M. Falk, R. J. Gardner, E. M. Harkness and et al. (1990). "Linkage of an autosomal

168

References dominant clefting syndrome (Van der Woude) to loci on chromosome Iq." Am J Hum Genet 46(3): 486-491.

Muthusamy, V. and T. J. Piva (2010). "The UV response of the skin: a review of the MAPK, NFkappaB and TNFalpha signal transduction pathways." Arch Dermatol Res 302(1): 5-17.

Muthusamy, V. and T. J. Piva (2013). "A comparative study of UV-induced cell signalling pathways in human keratinocyte-derived cell lines." Arch Dermatol Res 305(9): 817-833.

Muzio, M., J. Ni, P. Feng and V. M. Dixit (1997). "IRAK (Pelle) family member IRAK-2 and MyD88 as proximal mediators of IL-1 signaling." Science 278(5343): 1612-1615.

Naik, S., E. J. Kelly, L. Meijer, S. Pettersson and I. R. Sanderson (2001). "Absence of Toll-like receptor 4 explains endotoxin hyporesponsiveness in human intestinal epithelium." J Pediatr Gastroenterol Nutr 32(4): 449-453.

Nair, R. P., K. C. Duffin, C. Helms, J. Ding, P. E. Stuart, D. Goldgar, J. E. Gudjonsson, Y. Li, T. Tejasvi, B. J. Feng, A. Ruether, S. Schreiber, M. Weichenthal, D. Gladman, P. Rahman, S. J. Schrodi, S. Prahalad, S. L. Guthery, J. Fischer, W. Liao, P. Y. Kwok, A. Menter, G. M. Lathrop, C. A. Wise, A. B. Begovich, J. J. Voorhees, J. T. Elder, G. G. Krueger, A. M. Bowcock and G. R. Abecasis (2009). "Genome-wide scan reveals association of psoriasis with IL-23 and NF-kappaB pathways." Nat Genet 41(2): 199-204.

Naito, Y., T. Baba, H. Suzuki and K. Uyeno (1992). "The antagonistic effect of interferon-beta on the interferon-gamma-induced expression of HLA-DR antigen in a squamous cell carcinoma line." J Exp Pathol 6(1-2): 75-87.

Nakagawa, I., A. Amano, N. Mizushima, A. Yamamoto, H. Yamaguchi, T. Kamimoto, A. Nara, J. Funao, M. Nakata, K. Tsuda, S. Hamada and T. Yoshimori (2004). "Autophagy defends cells against invading group A Streptococcus." Science 306(5698): 1037-1040.

Nakamura, K., H. Okamura, M. Wada, K. Nagata and T. Tamura (1989). "Endotoxin-induced serum factor that stimulates gamma interferon production." Infect Immun 57(2): 590-595.

Neal, M. D., C. Leaphart, R. Levy, J. Prince, T. R. Billiar, S. Watkins, J. Li, S. Cetin, H. Ford, A. Schreiber and D. J. Hackam (2006). "Enterocyte TLR4 mediates phagocytosis and translocation of bacteria across the intestinal barrier." J Immunol 176(5): 3070-3079.

Negishi, H., Y. Fujita, H. Yanai, S. Sakaguchi, X. Ouyang, M. Shinohara, H. Takayanagi, Y. Ohba, T. Taniguchi and K. Honda (2006). "Evidence for licensing of IFN-gamma-induced IFN regulatory 169

References factor 1 transcription factor by MyD88 in Toll-like receptor-dependent gene induction program." Proc Natl Acad Sci U S A 103(41): 15136-15141.

Ng, D. C., M. J. Su, R. Kim and D. D. Bikle (1996). "Regulation of involucrin gene expression by calcium in normal human keratinocytes." Front Biosci 1: a16-24.

Nickoloff, B. J., T. Y. Basham, T. C. Merigan and V. B. Morhenn (1984). "Antiproliferative effects of recombinant alpha- and gamma-interferons on cultured human keratinocytes." Lab Invest 51(6): 697-701.

Nickoloff, B. J., T. Y. Basham, T. C. Merigan and V. B. Morhenn (1985). "Immunomodulatory and antiproliferative effect of recombinant alpha, beta, and gamma interferons on cultured human malignant squamous cell lines, SCL-1 and SW-1271." J Invest Dermatol 84(6): 487-490.

Nickoloff, B. J., R. S. Mitra, J. Green, X. G. Zheng, Y. Shimizu, C. Thompson and L. A. Turka (1993). "Accessory cell function of keratinocytes for superantigens. Dependence on lymphocyte function-associated antigen-1/intercellular adhesion molecule-1 interaction." J Immunol 150(6): 2148-2159.

Nicoletti, F., F. Patti, C. Cocuzza, P. Zaccone, A. Nicoletti, R. Di Marco and A. Reggio (1996). "Elevated serum levels of interleukin-12 in chronic progressive multiple sclerosis." J Neuroimmunol 70(1): 87-90.

Niebuhr, M., K. Baumert and T. Werfel (2010). "TLR-2-mediated cytokine and chemokine secretion in human keratinocytes." Exp Dermatol 19(10): 873-877.

Niebuhr, M., C. Lutat, S. Sigel and T. Werfel (2009). "Impaired TLR-2 expression and TLR-2- mediated cytokine secretion in macrophages from patients with atopic dermatitis." Allergy 64(11): 1580-1587.

Nielubowicz, G. R. and H. L. Mobley (2010). "Host-pathogen interactions in urinary tract infection." Nat Rev Urol 7(8): 430-441.

Nold, M. F., C. A. Nold-Petry, J. A. Zepp, B. E. Palmer, P. Bufler and C. A. Dinarello (2010). "IL- 37 is a fundamental inhibitor of innate immunity." Nat Immunol 11(11): 1014-1022.

Novak, N., C. F. Yu, T. Bieber and J. P. Allam (2008). "Toll-like receptor 7 agonists and skin." Drug News Perspect 21(3): 158-165.

170

References Oh, S. T., A. Schramme, W. Tilgen, P. Gutwein and J. Reichrath (2009). "Overexpression of CXCL16 in lesional psoriatic skin." Dermatoendocrinol 1(2): 114-118.

Okusawa, T., M. Fujita, J. Nakamura, T. Into, M. Yasuda, A. Yoshimura, Y. Hara, A. Hasebe, D. T. Golenbock, M. Morita, Y. Kuroki, T. Ogawa and K. Shibata (2004). "Relationship between structures and biological activities of mycoplasmal diacylated lipopeptides and their recognition by toll-like receptors 2 and 6." Infect Immun 72(3): 1657-1665.

Olaru, F. and L. E. Jensen (2010). "Chemokine expression by human keratinocyte cell lines after activation of Toll-like receptors." Exp Dermatol 19(8): e314-316.

Oldenburg, M., A. Kruger, R. Ferstl, A. Kaufmann, G. Nees, A. Sigmund, B. Bathke, H. Lauterbach, M. Suter, S. Dreher, U. Koedel, S. Akira, T. Kawai, J. Buer, H. Wagner, S. Bauer, H. Hochrein and C. J. Kirschning (2012). "TLR13 recognizes bacterial 23S rRNA devoid of erythromycin resistance-forming modification." Science 337(6098): 1111-1115.

Olszewska-Pazdrak, B., A. Casola, T. Saito, R. Alam, S. E. Crowe, F. Mei, P. L. Ogra and R. P. Garofalo (1998). "Cell-specific expression of RANTES, MCP-1, and MIP-1alpha by lower airway epithelial cells and eosinophils infected with respiratory syncytial virus." J Virol 72(6): 4756-4764.

Ommori, R., N. Ouji, F. Mizuno, E. Kita, Y. Ikada and H. Asada (2013). "Selective induction of antimicrobial peptides from keratinocytes by staphylococcal bacteria." Microb Pathog 56: 35-39.

Oppmann, B., R. Lesley, B. Blom, J. C. Timans, Y. Xu, B. Hunte, F. Vega, N. Yu, J. Wang, K. Singh, F. Zonin, E. Vaisberg, T. Churakova, M. Liu, D. Gorman, J. Wagner, S. Zurawski, Y. Liu, J. S. Abrams, K. W. Moore, D. Rennick, R. de Waal-Malefyt, C. Hannum, J. F. Bazan and R. A. Kastelein (2000). "Novel p19 protein engages IL-12p40 to form a cytokine, IL-23, with biological activities similar as well as distinct from IL-12." Immunity 13(5): 715-725.

Ortega-Cava, C. F., S. Ishihara, M. A. Rumi, M. M. Aziz, H. Kazumori, T. Yuki, Y. Mishima, I. Moriyama, C. Kadota, N. Oshima, Y. Amano, Y. Kadowaki, N. Ishimura and Y. Kinoshita (2006). "Epithelial toll-like receptor 5 is constitutively localized in the mouse cecum and exhibits distinctive down-regulation during experimental colitis." Clin Vaccine Immunol 13(1): 132-138.

Ortega-Cava, C. F., S. Ishihara, M. A. Rumi, K. Kawashima, N. Ishimura, H. Kazumori, J. Udagawa, Y. Kadowaki and Y. Kinoshita (2003). "Strategic compartmentalization of Toll-like receptor 4 in the mouse gut." J Immunol 170(8): 3977-3985.

171

References Oshiumi, H., M. Matsumoto, K. Funami, T. Akazawa and T. Seya (2003). "TICAM-1, an adaptor molecule that participates in Toll-like receptor 3-mediated interferon-beta induction." Nat Immunol 4(2): 161-167.

Otte, J. M., E. Cario and D. K. Podolsky (2004). "Mechanisms of cross hyporesponsiveness to Toll- like receptor bacterial ligands in intestinal epithelial cells." Gastroenterology 126(4): 1054-1070.

Ouellette, A. J. (2004). "Defensin-mediated innate immunity in the small intestine." Best Pract Res Clin Gastroenterol 18(2): 405-419.

Ouyang, X., H. Negishi, R. Takeda, Y. Fujita, T. Taniguchi and K. Honda (2007). "Cooperation between MyD88 and TRIF pathways in TLR synergy via IRF5 activation." Biochem Biophys Res Commun 354(4): 1045-1051.

Ozato, K., P. Tailor and T. Kubota (2007). "The interferon regulatory factor family in host defense: mechanism of action." J Biol Chem 282(28): 20065-20069.

Ozinsky, A., D. M. Underhill, J. D. Fontenot, A. M. Hajjar, K. D. Smith, C. B. Wilson, L. Schroeder and A. Aderem (2000). "The repertoire for pattern recognition of pathogens by the innate immune system is defined by cooperation between toll-like receptors." Proc Natl Acad Sci U S A 97(25): 13766-13771.

Palmer, C. N., A. D. Irvine, A. Terron-Kwiatkowski, Y. Zhao, H. Liao, S. P. Lee, D. R. Goudie, A. Sandilands, L. E. Campbell, F. J. Smith, G. M. O'Regan, R. M. Watson, J. E. Cecil, S. J. Bale, J. G. Compton, J. J. DiGiovanna, P. Fleckman, S. Lewis-Jones, G. Arseculeratne, A. Sergeant, C. S. Munro, B. El Houate, K. McElreavey, L. B. Halkjaer, H. Bisgaard, S. Mukhopadhyay and W. H. McLean (2006). "Common loss-of-function variants of the epidermal barrier protein filaggrin are a major predisposing factor for atopic dermatitis." Nat Genet 38(4): 441-446.

Palombella, V. J. and T. Maniatis (1992). "Inducible processing of interferon regulatory factor-2." Mol Cell Biol 12(8): 3325-3336.

Panelli, M. C., M. E. Stashower, H. B. Slade, K. Smith, C. Norwood, A. Abati, P. Fetsch, A. Filie, S. A. Walters, C. Astry, E. Arico, Y. Zhao, S. Selleri, E. Wang and F. M. Marincola (2007). "Sequential gene profiling of basal cell carcinomas treated with imiquimod in a placebo-controlled study defines the requirements for tissue rejection." Genome Biol 8(1): R8.

Panne, D., T. Maniatis and S. C. Harrison (2007). "An atomic model of the interferon-beta enhanceosome." Cell 129(6): 1111-1123.

172

References Parham, C., M. Chirica, J. Timans, E. Vaisberg, M. Travis, J. Cheung, S. Pflanz, R. Zhang, K. P. Singh, F. Vega, W. To, J. Wagner, A. M. O'Farrell, T. McClanahan, S. Zurawski, C. Hannum, D. Gorman, D. M. Rennick, R. A. Kastelein, R. de Waal Malefyt and K. W. Moore (2002). "A receptor for the heterodimeric cytokine IL-23 is composed of IL-12Rbeta1 and a novel cytokine receptor subunit, IL-23R." J Immunol 168(11): 5699-5708.

Parisien, J. P., D. Bamming, A. Komuro, A. Ramachandran, J. J. Rodriguez, G. Barber, R. D. Wojahn and C. M. Horvath (2009). "A shared interface mediates paramyxovirus interference with antiviral RNA helicases MDA5 and LGP2." J Virol 83(14): 7252-7260.

Park, J. H., Y. G. Kim, C. McDonald, T. D. Kanneganti, M. Hasegawa, M. Body-Malapel, N. Inohara and G. Nunez (2007). "RICK/RIP2 mediates innate immune responses induced through Nod1 and Nod2 but not TLRs." J Immunol 178(4): 2380-2386.

Park, J. W., I. McIntosh, J. B. Hetmanski, E. W. Jabs, C. A. Vander Kolk, Y. H. Wu-Chou, P. K. Chen, S. S. Chong, V. Yeow, S. H. Jee, B. Y. Park, M. D. Fallin, R. Ingersoll, A. F. Scott and T. H. Beaty (2007). "Association between IRF6 and nonsyndromic cleft lip with or without cleft palate in four populations." Genet Med 9(4): 219-227.

Parronchi, P., P. Romagnani, F. Annunziato, S. Sampognaro, A. Becchio, L. Giannarini, E. Maggi, C. Pupilli, F. Tonelli and S. Romagnani (1997). "Type 1 T-helper cell predominance and interleukin-12 expression in the gut of patients with Crohn's disease." Am J Pathol 150(3): 823-832.

Pastore, S., S. Corinti, M. La Placa, B. Didona and G. Girolomoni (1998). "Interferon-gamma promotes exaggerated cytokine production in keratinocytes cultured from patients with atopic dermatitis." J Allergy Clin Immunol 101(4 Pt 1): 538-544.

Pawar, R. D., P. S. Patole, D. Zecher, S. Segerer, M. Kretzler, D. Schlondorff and H. J. Anders (2006). "Toll-like receptor-7 modulates immune complex glomerulonephritis." J Am Soc Nephrol 17(1): 141-149.

Pearce, E. L. and H. Shen (2007). "Generation of CD8 T cell memory is regulated by IL-12." J Immunol 179(4): 2074-2081.

Pedersen, G., L. Andresen, M. W. Matthiessen, J. Rask-Madsen and J. Brynskov (2005). "Expression of Toll-like receptor 9 and response to bacterial CpG oligodeoxynucleotides in human intestinal epithelium." Clin Exp Immunol 141(2): 298-306.

173

References Pflanz, S., L. Hibbert, J. Mattson, R. Rosales, E. Vaisberg, J. F. Bazan, J. H. Phillips, T. K. McClanahan, R. de Waal Malefyt and R. A. Kastelein (2004). "WSX-1 and glycoprotein 130 constitute a signal-transducing receptor for IL-27." J Immunol 172(4): 2225-2231.

Pflanz, S., J. C. Timans, J. Cheung, R. Rosales, H. Kanzler, J. Gilbert, L. Hibbert, T. Churakova, M. Travis, E. Vaisberg, W. M. Blumenschein, J. D. Mattson, J. L. Wagner, W. To, S. Zurawski, T. K. McClanahan, D. M. Gorman, J. F. Bazan, R. de Waal Malefyt, D. Rennick and R. A. Kastelein (2002). "IL-27, a heterodimeric cytokine composed of EBI3 and p28 protein, induces proliferation of naive CD4(+) T cells." Immunity 16(6): 779-790.

Pilgram, G. S., D. C. Vissers, H. van der Meulen, S. Pavel, S. P. Lavrijsen, J. A. Bouwstra and H. K. Koerten (2001). "Aberrant lipid organization in stratum corneum of patients with atopic dermatitis and lamellar ichthyosis." J Invest Dermatol 117(3): 710-717.

Piskin, G., R. M. Sylva-Steenland, J. D. Bos and M. B. Teunissen (2006). "In vitro and in situ expression of IL-23 by keratinocytes in healthy skin and psoriasis lesions: enhanced expression in psoriatic skin." J Immunol 176(3): 1908-1915.

Pivarcsi, A., L. Bodai, B. Rethi, A. Kenderessy-Szabo, A. Koreck, M. Szell, Z. Beer, Z. Bata- Csorgoo, M. Magocsi, E. Rajnavolgyi, A. Dobozy and L. Kemeny (2003). "Expression and function of Toll-like receptors 2 and 4 in human keratinocytes." Int Immunol 15(6): 721-730.

Pivarcsi, A., A. Koreck, L. Bodai, M. Szell, C. Szeg, N. Belso, A. Kenderessy-Szabo, Z. Bata- Csorgo, A. Dobozy and L. Kemeny (2004). "Differentiation-regulated expression of Toll-like receptors 2 and 4 in HaCaT keratinocytes." Arch Dermatol Res 296(3): 120-124.

Platanias, L. C. (2005). "Mechanisms of type-I- and type-II-interferon-mediated signalling." Nat Rev Immunol 5(5): 375-386.

Poleganov, M. A., M. Bachmann, J. Pfeilschifter and H. Muhl (2008). "Genome-wide analysis displays marked induction of EBI3/IL-27B in IL-18-activated AML-derived KG1 cells: critical role of two kappaB binding sites in the human EBI3 promotor." Mol Immunol 45(10): 2869-2880.

Poltorak, A., X. He, I. Smirnova, M. Y. Liu, C. Van Huffel, X. Du, D. Birdwell, E. Alejos, M. Silva, C. Galanos, M. Freudenberg, P. Ricciardi-Castagnoli, B. Layton and B. Beutler (1998). "Defective LPS signaling in C3H/HeJ and C57BL/10ScCr mice: mutations in Tlr4 gene." Science 282(5396): 2085-2088.

174

References Potempa, J. and R. N. Pike (2009). "Corruption of innate immunity by bacterial proteases." J Innate Immun 1(2): 70-87.

Poyet, J. L., S. M. Srinivasula, M. Tnani, M. Razmara, T. Fernandes-Alnemri and E. S. Alnemri (2001). "Identification of Ipaf, a human caspase-1-activating protein related to Apaf-1." J Biol Chem 276(30): 28309-28313.

Prens, E. P., M. Kant, G. van Dijk, L. I. van der Wel, S. Mourits and L. van der Fits (2008). "IFN- alpha enhances poly-IC responses in human keratinocytes by inducing expression of cytosolic innate RNA receptors: relevance for psoriasis." J Invest Dermatol 128(4): 932-938.

Presky, D. H., H. Yang, L. J. Minetti, A. O. Chua, N. Nabavi, C. Y. Wu, M. K. Gately and U. Gubler (1996). "A functional interleukin 12 receptor complex is composed of two beta-type cytokine receptor subunits." Proc Natl Acad Sci U S A 93(24): 14002-14007.

Proetzel, G., S. A. Pawlowski, M. V. Wiles, M. Yin, G. P. Boivin, P. N. Howles, J. Ding, M. W. Ferguson and T. Doetschman (1995). "Transforming growth factor-beta 3 is required for secondary palate fusion." Nat Genet 11(4): 409-414.

Qin, B., S. S. Lam and K. Lin (1999). "Crystal structure of a transcriptionally active Smad4 fragment." Structure 7(12): 1493-1503.

Qin, B. Y., C. Liu, S. S. Lam, H. Srinath, R. Delston, J. J. Correia, R. Derynck and K. Lin (2003). "Crystal structure of IRF-3 reveals mechanism of autoinhibition and virus-induced phosphoactivation." Nat Struct Biol 10(11): 913-921.

Quayle, A. J., E. M. Porter, A. A. Nussbaum, Y. M. Wang, C. Brabec, K. P. Yip and S. C. Mok (1998). "Gene expression, immunolocalization, and secretion of human defensin-5 in human female reproductive tract." Am J Pathol 152(5): 1247-1258.

Raetz, M., A. Kibardin, C. R. Sturge, R. Pifer, H. Li, E. Burstein, K. Ozato, S. Larin and F. Yarovinsky (2013). "Cooperation of TLR12 and TLR11 in the IRF8-dependent IL-12 response to Toxoplasma gondii profilin." J Immunol 191(9): 4818-4827.

Rahimov, F., M. L. Marazita, A. Visel, M. E. Cooper, M. J. Hitchler, M. Rubini, F. E. Domann, M. Govil, K. Christensen, C. Bille, M. Melbye, A. Jugessur, R. T. Lie, A. J. Wilcox, D. R. Fitzpatrick, E. D. Green, P. A. Mossey, J. Little, R. P. Steegers-Theunissen, L. A. Pennacchio, B. C. Schutte, J. C. Murray and N. C. S. Pr (2008). "Disruption of an AP-2 alpha binding site in an IRF6 enhancer is associated with cleft lip." Nat Genet 40(11): 1341-1347.

175

References Raj, P. A. and A. R. Dentino (2002). "Current status of defensins and their role in innate and adaptive immunity." FEMS Microbiol Lett 206(1): 9-18.

Raport, C. J., J. Gosling, V. L. Schweickart, P. W. Gray and I. F. Charo (1996). "Molecular cloning and functional characterization of a novel human CC chemokine receptor (CCR5) for RANTES, MIP-1beta, and MIP-1alpha." J Biol Chem 271(29): 17161-17166.

Raschke, W. C., S. Baird, P. Ralph and I. Nakoinz (1978). "Functional macrophage cell lines transformed by Abelson leukemia virus." Cell 15(1): 261-267.

Raychaudhuri, S. P., W. Y. Jiang, E. M. Farber, T. J. Schall, M. R. Ruff and C. B. Pert (1999). "Upregulation of RANTES in psoriatic keratinocytes: a possible pathogenic mechanism for psoriasis." Acta Derm Venereol 79(1): 9-11.

Reeves, R., C. M. Gorman and B. Howard (1985). "Minichromosome assembly of non-integrated plasmid DNA transfected into mammalian cells." Nucleic Acids Res 13(10): 3599-3615.

Regan, T., K. Nally, R. Carmody, A. Houston, F. Shanahan, J. Macsharry and E. Brint (2013). "Identification of TLR10 as a Key Mediator of the Inflammatory Response to Listeria monocytogenes in Intestinal Epithelial Cells and Macrophages." J Immunol 191(12): 6084-6092.

Reis, L. F., H. Harada, J. D. Wolchok, T. Taniguchi and J. Vilcek (1992). "Critical role of a common transcription factor, IRF-1, in the regulation of IFN-beta and IFN-inducible genes." EMBO J 11(1): 185-193.

Reitamo, S., A. Remitz, H. Kyllonen and J. Saarikko (2002). "Topical noncorticosteroid immunomodulation in the treatment of atopic dermatitis." Am J Clin Dermatol 3(6): 381-388.

Restivo, G., B. C. Nguyen, P. Dziunycz, E. Ristorcelli, R. J. Ryan, O. Y. Ozuysal, M. Di Piazza, F. Radtke, M. J. Dixon, G. F. Hofbauer, K. Lefort and G. P. Dotto (2011). "IRF6 is a mediator of Notch pro-differentiation and tumour suppressive function in keratinocytes." EMBO J 30(22): 4571-4585.

Richardson, R. J., J. Dixon, R. Jiang and M. J. Dixon (2009). "Integration of IRF6 and Jagged2 signalling is essential for controlling palatal adhesion and fusion competence." Hum Mol Genet 18(14): 2632-2642.

Richardson, R. J., J. Dixon, R. L. Jiang and M. J. Dixon (2009). "Integration of IRF6 and Jagged2 signalling is essential for controlling palatal adhesion and fusion competence." Hum Mol Genet 18(14): 2632-2642. 176

References Richardson, R. J., J. Dixon, S. Malhotra, M. J. Hardman, L. Knowles, R. P. Boot-Handford, P. Shore, A. Whitmarsh and M. J. Dixon (2006). "Irf6 is a key determinant of the keratinocyte proliferation-differentiation switch." Nat Genet 38(11): 1329-1334.

Ridd, K., S. Dhir, A. G. Smith and T. W. Gant (2010). "Defective TPA signalling compromises HaCat cells as a human in vitro skin carcinogenesis model." Toxicol In Vitro 24(3): 910-915.

Riegler, M., R. Sedivy, C. Pothoulakis, G. Hamilton, J. Zacherl, G. Bischof, E. Cosentini, W. Feil, R. Schiessel, J. T. LaMont and et al. (1995). "Clostridium difficile toxin B is more potent than toxin A in damaging human colonic epithelium in vitro." J Clin Invest 95(5): 2004-2011.

Riego, E., A. Perez, R. Martinez, F. O. Castro, R. Lleonart and J. de la Fuente (1995). "Differential constitutive expression of interferon genes in early mouse embryos." Mol Reprod Dev 41(2): 157- 166.

Riol-Blanco, L., V. Lazarevic, A. Awasthi, M. Mitsdoerffer, B. S. Wilson, A. Croxford, A. Waisman, V. K. Kuchroo, L. H. Glimcher and M. Oukka (2010). "IL-23 receptor regulates unconventional IL-17-producing T cells that control bacterial infections." J Immunol 184(4): 1710- 1720.

Robinson, M. J., S. Beinke, A. Kouroumalis, P. N. Tsichlis and S. C. Ley (2007). "Phosphorylation of TPL-2 on serine 400 is essential for lipopolysaccharide activation of extracellular signal- regulated kinase in macrophages." Mol Cell Biol 27(21): 7355-7364.

Rock, F. L., G. Hardiman, J. C. Timans, R. A. Kastelein and J. F. Bazan (1998). "A family of human receptors structurally related to Drosophila Toll." Proc Natl Acad Sci U S A 95(2): 588-593.

Rodero, M. P., S. S. Hodgson, B. Hollier, C. Combadiere and K. Khosrotehrani (2013). "Reduced Il17a expression distinguishes a Ly6c(lo)MHCII(hi) macrophage population promoting wound healing." J Invest Dermatol 133(3): 783-792.

Rogers, N. C., E. C. Slack, A. D. Edwards, M. A. Nolte, O. Schulz, E. Schweighoffer, D. L. Williams, S. Gordon, V. L. Tybulewicz, G. D. Brown and C. Reis e Sousa (2005). "Syk-dependent cytokine induction by Dectin-1 reveals a novel pattern recognition pathway for C type lectins." Immunity 22(4): 507-517.

Roget, K., A. Ben-Addi, A. Mambole-Dema, T. Gantke, H. T. Yang, J. Janzen, N. Morrice, D. Abbott and S. C. Ley (2012). "IkappaB kinase 2 regulates TPL-2 activation of extracellular signal-

177

References regulated kinases 1 and 2 by direct phosphorylation of TPL-2 serine 400." Mol Cell Biol 32(22): 4684-4690.

Rumio, C., D. Besusso, M. Palazzo, S. Selleri, L. Sfondrini, F. Dubini, S. Menard and A. Balsari (2004). "Degranulation of paneth cells via toll-like receptor 9." Am J Pathol 165(2): 373-381.

Sabel, J. L., C. d'Alencon, E. K. O'Brien, E. Van Otterloo, K. Lutz, T. N. Cuylendall, B. C. Schutte, D. W. Houston and R. A. Cornell (2009). "Maternal Interferon Regulatory Factor 6 is required for the differentiation of primary superficial epithelia in Danio and Xenopus embryos." Dev Biol 325(1): 249-262.

Samuelsson, P., L. Hang, B. Wullt, H. Irjala and C. Svanborg (2004). "Toll-like receptor 4 expression and cytokine responses in the human urinary tract mucosa." Infect Immun 72(6): 3179- 3186.

Sancho-Shimizu, V., R. Perez de Diego, L. Lorenzo, R. Halwani, A. Alangari, E. Israelsson, S. Fabrega, A. Cardon, J. Maluenda, M. Tatematsu, F. Mahvelati, M. Herman, M. Ciancanelli, Y. Guo, Z. AlSum, N. Alkhamis, A. S. Al-Makadma, A. Ghadiri, S. Boucherit, S. Plancoulaine, C. Picard, F. Rozenberg, M. Tardieu, P. Lebon, E. Jouanguy, N. Rezaei, T. Seya, M. Matsumoto, D. Chaussabel, A. Puel, S. Y. Zhang, L. Abel, S. Al-Muhsen and J. L. Casanova (2011). "Herpes simplex encephalitis in children with autosomal recessive and dominant TRIF deficiency." J Clin Invest 121(12): 4889-4902.

Sander, A., R. Schmelzle and J. Murray (1994). "Evidence for a microdeletion in 1q32-41 involving the gene responsible for Van der Woude syndrome." Hum Mol Genet 3(4): 575-578.

Sankar, S., H. Chan, W. J. Romanow, J. Li and R. J. Bates (2006). "IKK-i signals through IRF3 and NFkappaB to mediate the production of inflammatory cytokines." Cell Signal 18(7): 982-993.

Sasai, M., M. Matsumoto and T. Seya (2006). "The kinase complex responsible for IRF-3-mediated IFN-beta production in myeloid dendritic cells (mDC)." J Biochem 139(2): 171-175.

Sasai, M., H. Oshiumi, M. Matsumoto, N. Inoue, F. Fujita, M. Nakanishi and T. Seya (2005). "Cutting Edge: NF-kappaB-activating kinase-associated protein 1 participates in TLR3/Toll-IL-1 homology domain-containing adapter molecule-1-mediated IFN regulatory factor 3 activation." J Immunol 174(1): 27-30.

178

References Sato, M., N. Hata, M. Asagiri, T. Nakaya, T. Taniguchi and N. Tanaka (1998). "Positive feedback regulation of type I IFN genes by the IFN-inducible transcription factor IRF-7." FEBS Lett 441(1): 106-110.

Sato, M., H. Suemori, N. Hata, M. Asagiri, K. Ogasawara, K. Nakao, T. Nakaya, M. Katsuki, S. Noguchi, N. Tanaka and T. Taniguchi (2000). "Distinct and essential roles of transcription factors IRF-3 and IRF-7 in response to viruses for IFN-alpha/beta gene induction." Immunity 13(4): 539- 548.

Sato, M., N. Tanaka, N. Hata, E. Oda and T. Taniguchi (1998). "Involvement of the IRF family transcription factor IRF-3 in virus-induced activation of the IFN-beta gene." FEBS Lett 425(1): 112-116.

Sato, S., M. Sugiyama, M. Yamamoto, Y. Watanabe, T. Kawai, K. Takeda and S. Akira (2003). "Toll/IL-1 receptor domain-containing adaptor inducing IFN-beta (TRIF) associates with TNF receptor-associated factor 6 and TANK-binding kinase 1, and activates two distinct transcription factors, NF-kappa B and IFN-regulatory factor-3, in the Toll-like receptor signaling." J Immunol 171(8): 4304-4310.

Satoh, T., H. Kato, Y. Kumagai, M. Yoneyama, S. Sato, K. Matsushita, T. Tsujimura, T. Fujita, S. Akira and O. Takeuchi (2010). "LGP2 is a positive regulator of RIG-I- and MDA5-mediated antiviral responses." Proc Natl Acad Sci U S A 107(4): 1512-1517.

Saunders, N. A. and A. M. Jetten (1994). "Control of growth regulatory and differentiation-specific genes in human epidermal keratinocytes by interferon gamma. Antagonism by retinoic acid and transforming growth factor beta 1." J Biol Chem 269(3): 2016-2022.

Savvatis, K., K. Pappritz, P. M. Becher, D. Lindner, C. Zietsch, H. D. Volk, D. Westermann, H. P. Schultheiss and C. Tschope (2013). "Interleukin-23 Deficiency Leads to Impaired Wound Healing and Adverse Prognosis after Myocardial Infarction." Circ Heart Fail.

Scapoli, L., A. Palmieri, M. Martinelli, F. Pezzetti, P. Carinci, M. Tognon and F. Carinci (2005). "Strong evidence of linkage disequilibrium between polymorphisms at the IRF6 locus and nonsyndromic cleft lip with or without cleft palate, in an Italian population." Am J Hum Genet 76(1): 180-183.

Schafer, S. L., R. Lin, P. A. Moore, J. Hiscott and P. M. Pitha (1998). "Regulation of type I interferon gene expression by interferon regulatory factor-3." J Biol Chem 273(5): 2714-2720.

179

References Schieke, S. M., K. Ruwiedel, H. Gers-Barlag, S. Grether-Beck and J. Krutmann (2005). "Molecular crosstalk of the ultraviolet a and ultraviolet B signaling responses at the level of mitogen-activated protein kinases." J Invest Dermatol 124(4): 857-859.

Schmeck, B., S. Huber, K. Moog, J. Zahlten, A. C. Hocke, B. Opitz, S. Hammerschmidt, T. J. Mitchell, M. Kracht, S. Rosseau, N. Suttorp and S. Hippenstiel (2006). "Pneumococci induced TLR- and Rac1-dependent NF-kappaB-recruitment to the IL-8 promoter in lung epithelial cells." Am J Physiol Lung Cell Mol Physiol 290(4): L730-L737.

Schmitz, F., A. Heit, S. Guggemoos, A. Krug, J. Mages, M. Schiemann, H. Adler, I. Drexler, T. Haas, R. Lang and H. Wagner (2007). "Interferon-regulatory-factor 1 controls Toll-like receptor 9- mediated IFN-beta production in myeloid dendritic cells." Eur J Immunol 37(2): 315-327.

Schnipper, L. E., M. Levin, C. S. Crumpacker and B. A. Gilchrest (1984). "Virus replication and induction of interferon in human epidermal keratinocytes following infection with herpes simplex virus." J Invest Dermatol 82(1): 94-96.

Schoenemeyer, A., B. J. Barnes, M. E. Mancl, E. Latz, N. Goutagny, P. M. Pitha, K. A. Fitzgerald and D. T. Golenbock (2005). "The interferon regulatory factor, IRF5, is a central mediator of toll- like receptor 7 signaling." J Biol Chem 280(17): 17005-17012.

Schroder, K., K. M. Irvine, M. S. Taylor, N. J. Bokil, K. A. Le Cao, K. A. Masterman, L. I. Labzin, C. A. Semple, R. Kapetanovic, L. Fairbairn, A. Akalin, G. J. Faulkner, J. K. Baillie, M. Gongora, C. O. Daub, H. Kawaji, G. J. McLachlan, N. Goldman, S. M. Grimmond, P. Carninci, H. Suzuki, Y. Hayashizaki, B. Lenhard, D. A. Hume and M. J. Sweet (2012). "Conservation and divergence in Toll-like receptor 4-regulated gene expression in primary human versus mouse macrophages." Proc Natl Acad Sci U S A 109(16): E944-953.

Schroder, K., M. Spille, A. Pilz, J. Lattin, K. A. Bode, K. M. Irvine, A. D. Burrows, T. Ravasi, H. Weighardt, K. J. Stacey, T. Decker, D. A. Hume, A. H. Dalpke and M. J. Sweet (2007). "Differential effects of CpG DNA on IFN-beta induction and STAT1 activation in murine macrophages versus dendritic cells: alternatively activated STAT1 negatively regulates TLR signaling in macrophages." J Immunol 179(6): 3495-3503.

Schroder, K., M. J. Sweet and D. A. Hume (2006). "Signal integration between IFNgamma and TLR signalling pathways in macrophages." Immunobiology 211(6-8): 511-524.

Schroder, N. W., S. Morath, C. Alexander, L. Hamann, T. Hartung, U. Zahringer, U. B. Gobel, J. R. Weber and R. R. Schumann (2003). "Lipoteichoic acid (LTA) of Streptococcus pneumoniae and 180

References Staphylococcus aureus activates immune cells via Toll-like receptor (TLR)-2, lipopolysaccharide- binding protein (LBP), and CD14, whereas TLR-4 and MD-2 are not involved." J Biol Chem 278(18): 15587-15594.

Schulte, R., P. Wattiau, E. L. Hartland, R. M. Robins-Browne and G. R. Cornelis (1996). "Differential secretion of interleukin-8 by human epithelial cell lines upon entry of virulent or nonvirulent Yersinia enterocolitica." Infect Immun 64(6): 2106-2113.

Schulz, S. M., G. Kohler, N. Schutze, J. Knauer, R. K. Straubinger, A. A. Chackerian, E. Witte, K. Wolk, R. Sabat, Y. Iwakura, C. Holscher, U. Muller, R. A. Kastelein and G. Alber (2008). "Protective immunity to systemic infection with attenuated Salmonella enterica serovar enteritidis in the absence of IL-12 is associated with IL-23-dependent IL-22, but not IL-17." J Immunol 181(11): 7891-7901.

Schurer, N., A. Kohne, V. Schliep, K. Barlag and G. Goerz (1993). "Lipid composition and synthesis of HaCaT cells, an immortalized human keratinocyte line, in comparison with normal human adult keratinocytes." Exp Dermatol 2(4): 179-185.

Schutte, B. C., A. M. Basart, Y. Watanabe, J. J. Laffin, K. Coppage, B. C. Bjork, S. Daack-Hirsch, S. Patil, M. J. Dixon and J. C. Murray (1999). "Microdeletions at chromosome bands 1q32-q41 as a cause of Van der Woude syndrome." Am J Med Genet 84(2): 145-150.

Schutte, B. C. and P. B. McCray, Jr. (2002). "[beta]-defensins in lung host defense." Annu Rev Physiol 64: 709-748.

Shao, Y., W. Zhang, X. Dong, W. Liu, C. Zhang, J. Zhang, Q. Zhong, Q. Wu, H. Yang, Y. Chen, J. Wan and B. Yu (2010). "Keratinocytes play a role in the immunity to Herpes simplex virus type 2 infection." Acta Virol 54(4): 261-267.

Sheng, S., J. Carey, E. A. Seftor, L. Dias, M. J. Hendrix and R. Sager (1996). "Maspin acts at the cell membrane to inhibit invasion and motility of mammary and prostatic cancer cells." Proc Natl Acad Sci U S A 93(21): 11669-11674.

Shigeoka, A. A., T. D. Holscher, A. J. King, F. W. Hall, W. B. Kiosses, P. S. Tobias, N. Mackman and D. B. McKay (2007). "TLR2 is constitutively expressed within the kidney and participates in ischemic renal injury through both MyD88-dependent and -independent pathways." J Immunol 178(10): 6252-6258.

181

References Shipley, G. D. and M. R. Pittelkow (1987). "Control of growth and differentiation in vitro of human keratinocytes cultured in serum-free medium." Arch Dermatol 123(11): 1541a-1544a.

Skiba, B., B. Neill and T. J. Piva (2005). "Gene expression profiles of TNF-alpha, TACE, furin, IL- 1beta and matrilysin in UVA- and UVB-irradiated HaCat cells." Photodermatol Photoimmunol Photomed 21(4): 173-182.

Slade, H. B., M. L. Owens, M. A. Tomai and R. L. Miller (1998). "Imiquimod 5% cream (Aldara)." Expert Opin Investig Drugs 7(3): 437-449.

Snijders, A., C. M. Hilkens, T. C. van der Pouw Kraan, M. Engel, L. A. Aarden and M. L. Kapsenberg (1996). "Regulation of bioactive IL-12 production in lipopolysaccharide-stimulated human monocytes is determined by the expression of the p35 subunit." J Immunol 156(3): 1207- 1212.

Song, P. I., Y. M. Park, T. Abraham, B. Harten, A. Zivony, N. Neparidze, C. A. Armstrong and J. C. Ansel (2002). "Human keratinocytes express functional CD14 and toll-like receptor 4." J Invest Dermatol 119(2): 424-432.

Soule, H. D., J. Vazguez, A. Long, S. Albert and M. Brennan (1973). "A human cell line from a pleural effusion derived from a breast carcinoma." J Natl Cancer Inst 51(5): 1409-1416.

Srichomthong, C., P. Siriwan and V. Shotelersuk (2005). "Significant association between IRF6 820G -> A and non-syndromic cleft lip with or without cleft palate in the Thai population." J Med Genet 42(7).

Stacey, K. J., G. R. Young, F. Clark, D. P. Sester, T. L. Roberts, S. Naik, M. J. Sweet and D. A. Hume (2003). "The molecular basis for the lack of immunostimulatory activity of vertebrate DNA." J Immunol 170(7): 3614-3620.

Stanford, M. M. and T. B. Issekutz (2003). "The relative activity of CXCR3 and CCR5 ligands in T lymphocyte migration: concordant and disparate activities in vitro and in vivo." J Leukoc Biol 74(5): 791-799.

Stannard, W. and C. O'Callaghan (2006). "Ciliary function and the role of cilia in clearance." J Aerosol Med 19(1): 110-115.

Stein, B. and A. S. Baldwin, Jr. (1993). "Distinct mechanisms for regulation of the interleukin-8 gene involve synergism and cooperativity between C/EBP and NF-kappa B." Mol Cell Biol 13(11): 7191-7198. 182

References Stuetz, A., K. Baumann, M. Grassberger, K. Wolff and J. G. Meingassner (2006). "Discovery of topical calcineurin inhibitors and pharmacological profile of pimecrolimus." Int Arch Allergy Immunol 141(3): 199-212.

Stumhofer, J. S. and C. A. Hunter (2008). "Advances in understanding the anti-inflammatory properties of IL-27." Immunol Lett 117(2): 123-130.

Stumhofer, J. S., J. S. Silver, A. Laurence, P. M. Porrett, T. H. Harris, L. A. Turka, M. Ernst, C. J. Saris, J. J. O'Shea and C. A. Hunter (2007). "Interleukins 27 and 6 induce STAT3-mediated T cell production of interleukin 10." Nat Immunol 8(12): 1363-1371.

Su, L. and M. David (2000). "Distinct mechanisms of STAT phosphorylation via the interferon- alpha/beta receptor. Selective inhibition of STAT3 and STAT5 by piceatannol." J Biol Chem 275(17): 12661-12666.

Sugihara, T. M., E. I. Kudryavtseva, V. Kumar, J. J. Horridge and B. Andersen (2001). "The POU domain factor Skin-1a represses the keratin 14 promoter independent of DNA binding. A possible role for interactions between Skn-1a and CREB-binding protein/p300." J Biol Chem 276(35): 33036-33044.

Suhara, W., M. Yoneyama, T. Iwamura, S. Yoshimura, K. Tamura, H. Namiki, S. Aimoto and T. Fujita (2000). "Analyses of virus-induced homomeric and heteromeric protein associations between IRF-3 and coactivator CBP/p300." J Biochem 128(2): 301-307.

Sumikawa, Y., H. Asada, K. Hoshino, H. Azukizawa, I. Katayama, S. Akira and S. Itami (2006). "Induction of beta-defensin 3 in keratinocytes stimulated by bacterial lipopeptides through toll-like receptor 2." Microbes Infect 8(6): 1513-1521.

Suzuki, T., L. Franchi, C. Toma, H. Ashida, M. Ogawa, Y. Yoshikawa, H. Mimuro, N. Inohara, C. Sasakawa and G. Nunez (2007). "Differential regulation of caspase-1 activation, pyroptosis, and autophagy via Ipaf and ASC in Shigella-infected macrophages." PLoS Pathog 3(8): e111.

Szebeni, B., G. Veres, A. Dezsofi, K. Rusai, A. Vannay, G. Bokodi, B. Vasarhelyi, I. R. Korponay- Szabo, T. Tulassay and A. Arato (2007). "Increased mucosal expression of Toll-like receptor (TLR)2 and TLR4 in coeliac disease." J Pediatr Gastroenterol Nutr 45(2): 187-193.

Taga, T. and T. Kishimoto (1997). "Gp130 and the interleukin-6 family of cytokines." Annu Rev Immunol 15: 797-819.

183

References Takahashi, H., K. Asano, S. Nakamura, A. Ishida-Yamamoto and H. Iizuka (1999). "Interferon- gamma-dependent stimulation of human involucrin gene expression: STAT1 (signal transduction and activators of transcription 1) protein activates involucrin promoter activity." Biochem J 344 Pt 3: 797-802.

Takahasi, K., N. N. Suzuki, M. Horiuchi, M. Mori, W. Suhara, Y. Okabe, Y. Fukuhara, H. Terasawa, S. Akira, T. Fujita and F. Inagaki (2003). "X-ray crystal structure of IRF-3 and its functional implications." Nat Struct Biol 10(11): 922-927.

Takaoka, A., T. Tamura and T. Taniguchi (2008). "Interferon regulatory factor family of transcription factors and regulation of oncogenesis." Cancer Sci 99(3): 467-478.

Takaoka, A., H. Yanai, S. Kondo, G. Duncan, H. Negishi, T. Mizutani, S. Kano, K. Honda, Y. Ohba, T. W. Mak and T. Taniguchi (2005). "Integral role of IRF-5 in the gene induction programme activated by Toll-like receptors." Nature 434(7030): 243-249.

Takeda, A., S. Hamano, A. Yamanaka, T. Hanada, T. Ishibashi, T. W. Mak, A. Yoshimura and H. Yoshida (2003). "Cutting edge: role of IL-27/WSX-1 signaling for induction of T-bet through activation of STAT1 during initial Th1 commitment." J Immunol 170(10): 4886-4890.

Takeda, K. and S. Akira (2004). "TLR signaling pathways." Semin Immunol 16(1): 3-9.

Takeda, K., O. Takeuchi, T. Tsujimura, S. Itami, O. Adachi, T. Kawai, H. Sanjo, K. Yoshikawa, N. Terada and S. Akira (1999). "Limb and skin abnormalities in mice lacking IKKalpha." Science 284(5412): 313-316.

Takeshita, F., C. A. Leifer, I. Gursel, K. J. Ishii, S. Takeshita, M. Gursel and D. M. Klinman (2001). "Cutting edge: Role of Toll-like receptor 9 in CpG DNA-induced activation of human cells." J Immunol 167(7): 3555-3558.

Takeuchi, A. (1982). "Early colonic lesions in experimental Shigella infection in rhesus monkeys: revisited." Vet Pathol Suppl 19 Suppl 7: 1-8.

Takeuchi, O., K. Hoshino and S. Akira (2000). "Cutting edge: TLR2-deficient and MyD88- deficient mice are highly susceptible to Staphylococcus aureus infection." J Immunol 165(10): 5392-5396.

Takeuchi, O., T. Kawai, P. F. Muhlradt, M. Morr, J. D. Radolf, A. Zychlinsky, K. Takeda and S. Akira (2001). "Discrimination of bacterial lipoproteins by Toll-like receptor 6." Int Immunol 13(7): 933-940. 184

References Takeuchi, O., S. Sato, T. Horiuchi, K. Hoshino, K. Takeda, Z. Dong, R. L. Modlin and S. Akira (2002). "Cutting edge: role of Toll-like receptor 1 in mediating immune response to microbial lipoproteins." J Immunol 169(1): 10-14.

Taki, S., T. Sato, K. Ogasawara, T. Fukuda, M. Sato, S. Hida, G. Suzuki, M. Mitsuyama, E. H. Shin, S. Kojima, T. Taniguchi and Y. Asano (1997). "Multistage regulation of Th1-type immune responses by the transcription factor IRF-1." Immunity 6(6): 673-679.

Tamura, T. and K. Ozato (2002). "ICSBP/IRF-8: its regulatory roles in the development of myeloid cells." J Interferon Cytokine Res 22(1): 145-152.

Tamura, T., H. Yanai, D. Savitsky and T. Taniguchi (2008). "The IRF family transcription factors in immunity and oncogenesis." Annu Rev Immunol 26: 535-584.

Tanaka, N., T. Kawakami and T. Taniguchi (1993). "Recognition DNA sequences of interferon regulatory factor 1 (IRF-1) and IRF-2, regulators of cell growth and the interferon system." Mol Cell Biol 13(8): 4531-4538.

Taniguchi, S. and J. Sagara (2007). "Regulatory molecules involved in inflammasome formation with special reference to a key mediator protein, ASC." Semin Immunopathol 29(3): 231-238.

Taniguchi, T., K. Ogasawara, A. Takaoka and N. Tanaka (2001). "IRF family of transcription factors as regulators of host defense." Annu Rev Immunol 19: 623-655.

Taub, D. D., S. M. Turcovski-Corrales, M. L. Key, D. L. Longo and W. J. Murphy (1996). "Chemokines and T lymphocyte activation: I. Beta chemokines costimulate human T lymphocyte activation in vitro." J Immunol 156(6): 2095-2103.

Tawaratsumida, K., M. Furuyashiki, M. Katsumoto, Y. Fujimoto, K. Fukase, Y. Suda and M. Hashimoto (2009). "Characterization of N-terminal structure of TLR2-activating lipoprotein in Staphylococcus aureus." J Biol Chem 284(14): 9147-9152.

Tecle, T., S. Tripathi and K. L. Hartshorn (2010). "Review: Defensins and cathelicidins in lung immunity." Innate Immun 16(3): 151-159.

Terhorst, D., B. N. Kalali, M. Ollert, J. Ring and M. Mempel (2010). "The role of toll-like receptors in host defenses and their relevance to dermatologic diseases." Am J Clin Dermatol 11(1): 1-10.

185

References Terunuma, A., R. P. Limgala, C. J. Park, I. Choudhary and J. C. Vogel (2010). "Efficient procurement of epithelial stem cells from human tissue specimens using a Rho-associated protein kinase inhibitor Y-27632." Tissue Eng Part A 16(4): 1363-1368.

Thanos, D. and T. Maniatis (1995). "Virus induction of human IFN beta gene expression requires the assembly of an enhanceosome." Cell 83(7): 1091-1100.

Thomason, H. A., H. Zhou, E. N. Kouwenhoven, G. P. Dotto, G. Restivo, B. C. Nguyen, H. Little, M. J. Dixon, H. van Bokhoven and J. Dixon (2010). "Cooperation between the transcription factors p63 and IRF6 is essential to prevent cleft palate in mice." J Clin Invest 120(5): 1561-1569.

Ting, J. P., R. C. Lovering, E. S. Alnemri, J. Bertin, J. M. Boss, B. K. Davis, R. A. Flavell, S. E. Girardin, A. Godzik, J. A. Harton, H. M. Hoffman, J. P. Hugot, N. Inohara, A. Mackenzie, L. J. Maltais, G. Nunez, Y. Ogura, L. A. Otten, D. Philpott, J. C. Reed, W. Reith, S. Schreiber, V. Steimle and P. A. Ward (2008). "The NLR gene family: a standard nomenclature." Immunity 28(3): 285-287.

Tohyama, M., K. Sayama, H. Komatsuzawa, Y. Hanakawa, Y. Shirakata, X. Dai, L. Yang, S. Tokumaru, H. Nagai, S. Hirakawa, M. Sugai and K. Hashimoto (2007). "CXCL16 is a novel mediator of the innate immunity of epidermal keratinocytes." Int Immunol 19(9): 1095-1102.

Tonel, G., C. Conrad, U. Laggner, P. Di Meglio, K. Grys, T. K. McClanahan, W. M. Blumenschein, J. Z. Qin, H. Xin, E. Oldham, R. Kastelein, B. J. Nickoloff and F. O. Nestle (2010). "Cutting edge: A critical functional role for IL-23 in psoriasis." J Immunol 185(10): 5688-5691.

Trinchieri, G. (1993). "Interleukin-12 and its role in the generation of TH1 cells." Immunol Today 14(7): 335-338.

Trinchieri, G. (2003). "Interleukin-12 and the regulation of innate resistance and adaptive immunity." Nat Rev Immunol 3(2): 133-146.

Trinchieri, G., M. Wysocka, A. D'Andrea, M. Rengaraju, M. Aste-Amezaga, M. Kubin, N. M. Valiante and J. Chehimi (1992). "Natural killer cell stimulatory factor (NKSF) or interleukin-12 is a key regulator of immune response and inflammation." Prog Growth Factor Res 4(4): 355-368.

Tsang, D. K. and D. L. Crowe (1999). "The mitogen activated protein kinase pathway is required for proliferation but not invasion of human squamous cell carcinoma lines." Int J Oncol 15(3): 519- 523.

186

References Tschopp, J., F. Martinon and K. Burns (2003). "NALPs: a novel protein family involved in inflammation." Nat Rev Mol Cell Biol 4(2): 95-104.

Tsuboi, N., Y. Yoshikai, S. Matsuo, T. Kikuchi, K. Iwami, Y. Nagai, O. Takeuchi, S. Akira and T. Matsuguchi (2002). "Roles of toll-like receptors in C-C chemokine production by renal tubular epithelial cells." J Immunol 169(4): 2026-2033.

Tsuchiya, S., M. Yamabe, Y. Yamaguchi, Y. Kobayashi, T. Konno and K. Tada (1980). "Establishment and characterization of a human acute monocytic leukemia cell line (THP-1)." Int J Cancer 26(2): 171-176.

Tsujimura, H., T. Nagamura-Inoue, T. Tamura and K. Ozato (2002). "IFN consensus sequence binding protein/IFN regulatory factor-8 guides bone marrow progenitor cells toward the macrophage lineage." J Immunol 169(3): 1261-1269.

Turcotte, K., S. Gauthier, A. Tuite, A. Mullick, D. Malo and P. Gros (2005). "A mutation in the Icsbp1 gene causes susceptibility to infection and a chronic myeloid leukemia-like syndrome in BXH-2 mice." J Exp Med 201(6): 881-890.

Uematsu, S., S. Sato, M. Yamamoto, T. Hirotani, H. Kato, F. Takeshita, M. Matsuda, C. Coban, K. J. Ishii, T. Kawai, O. Takeuchi and S. Akira (2005). "Interleukin-1 receptor-associated kinase-1 plays an essential role for Toll-like receptor (TLR)7- and TLR9-mediated interferon-{alpha} induction." J Exp Med 201(6): 915-923.

Underhill, D. M., E. Rossnagle, C. A. Lowell and R. M. Simmons (2005). "Dectin-1 activates Syk tyrosine kinase in a dynamic subset of macrophages for reactive oxygen production." Blood 106(7): 2543-2550.

Unterholzner, L., S. E. Keating, M. Baran, K. A. Horan, S. B. Jensen, S. Sharma, C. M. Sirois, T. Jin, E. Latz, T. S. Xiao, K. A. Fitzgerald, S. R. Paludan and A. G. Bowie (2010). "IFI16 is an innate immune sensor for intracellular DNA." Nat Immunol 11(11): 997-1004. van de Veerdonk, F. L., M. S. Gresnigt, B. J. Kullberg, J. W. van der Meer, L. A. Joosten and M. G. Netea (2009). "Th17 responses and host defense against microorganisms: an overview." BMB Rep 42(12): 776-787. van der Fits, L., S. Mourits, J. S. Voerman, M. Kant, L. Boon, J. D. Laman, F. Cornelissen, A. M. Mus, E. Florencia, E. P. Prens and E. Lubberts (2009). "Imiquimod-induced psoriasis-like skin inflammation in mice is mediated via the IL-23/IL-17 axis." J Immunol 182(9): 5836-5845.

187

References Verreck, F. A., T. de Boer, D. M. Langenberg, M. A. Hoeve, M. Kramer, E. Vaisberg, R. Kastelein, A. Kolk, R. de Waal-Malefyt and T. H. Ottenhoff (2004). "Human IL-23-producing type 1 macrophages promote but IL-10-producing type 2 macrophages subvert immunity to (myco)bacteria." Proc Natl Acad Sci U S A 101(13): 4560-4565.

Vieira, A. R., J. R. Avila, S. Daack-Hirsch, E. Dragan, T. M. Felix, F. Rahimov, J. Harrington, R. R. Schultz, Y. Watanabe, M. Johnson, J. Fang, S. E. O'Brien, I. M. Orioli, E. E. Castilla, D. R. Fitzpatrick, R. Jiang, M. L. Marazita and J. C. Murray (2005). "Medical sequencing of candidate genes for nonsyndromic cleft lip and palate." PLoS Genet 1(6): e64.

Vignali, D. A. and V. K. Kuchroo (2012). "IL-12 family cytokines: immunological playmakers." Nat Immunol 13(8): 722-728.

Villarino, A., L. Hibbert, L. Lieberman, E. Wilson, T. Mak, H. Yoshida, R. A. Kastelein, C. Saris and C. A. Hunter (2003). "The IL-27R (WSX-1) is required to suppress T cell hyperactivity during infection." Immunity 19(5): 645-655. von Aulock, S., S. Morath, L. Hareng, S. Knapp, K. P. van Kessel, J. A. van Strijp and T. Hartung (2003). "Lipoteichoic acid from Staphylococcus aureus is a potent stimulus for neutrophil recruitment." Immunobiology 208(4): 413-422.

Vu, A. T., T. Baba, X. Chen, T. A. Le, H. Kinoshita, Y. Xie, S. Kamijo, K. Hiramatsu, S. Ikeda, H. Ogawa, K. Okumura and T. Takai (2010). "Staphylococcus aureus membrane and diacylated lipopeptide induce thymic stromal lymphopoietin in keratinocytes through the Toll-like receptor 2- Toll-like receptor 6 pathway." J Allergy Clin Immunol 126(5): 985-993, 993 e981-983.

Vu, A. T., X. Chen, Y. Xie, S. Kamijo, H. Ushio, J. Kawasaki, M. Hara, S. Ikeda, K. Okumura, H. Ogawa and T. Takai (2011). "Extracellular double-stranded RNA induces TSLP via an endosomal acidification- and NF-kappaB-dependent pathway in human keratinocytes." J Invest Dermatol 131(11): 2205-2212.

Waite, J. C. and D. Skokos (2012). "Th17 response and inflammatory autoimmune diseases." Int J Inflam 2012: 819467.

Walter, A., M. Schafer, V. Cecconi, C. Matter, M. Urosevic-Maiwald, B. Belloni, N. Schonewolf, R. Dummer, W. Bloch, S. Werner, H. D. Beer, A. Knuth and M. van den Broek (2013). "Aldara activates TLR7-independent immune defence." Nat Commun 4: 1560.

188

References Walter, M. J., N. Kajiwara, P. Karanja, M. Castro and M. J. Holtzman (2001). "Interleukin 12 p40 production by barrier epithelial cells during airway inflammation." J Exp Med 193(3): 339-351.

Wang, B., N. Ruiz, A. Pentland and M. Caparon (1997). "Keratinocyte proinflammatory responses to adherent and nonadherent group A streptococci." Infect Immun 65(6): 2119-2126.

Wang, C., L. Deng, M. Hong, G. R. Akkaraju, J. Inoue and Z. J. Chen (2001). "TAK1 is a ubiquitin-dependent kinase of MKK and IKK." Nature 412(6844): 346-351.

Wathelet, M. G., C. H. Lin, B. S. Parekh, L. V. Ronco, P. M. Howley and T. Maniatis (1998). "Virus infection induces the assembly of coordinately activated transcription factors on the IFN- beta enhancer in vivo." Mol Cell 1(4): 507-518.

Watt, F. M. (1983). "Involucrin and other markers of keratinocyte terminal differentiation." J Invest Dermatol 81(1 Suppl): 100s-103s.

Watts, C. (2008). "Location, location, location: identifying the neighborhoods of LPS signaling." Nat Immunol 9(4): 343-345.

Weaver, B. K., K. P. Kumar and N. C. Reich (1998). "Interferon regulatory factor 3 and CREB- binding protein/p300 are subunits of double-stranded RNA-activated transcription factor DRAF1." Mol Cell Biol 18(3): 1359-1368.

Wesche, H., W. J. Henzel, W. Shillinglaw, S. Li and Z. Cao (1997). "MyD88: an adapter that recruits IRAK to the IL-1 receptor complex." Immunity 7(6): 837-847.

White, M. I. and W. C. Noble (1986). "Consequences of colonization and infection by Staphylococcus aureus in atopic dermatitis." Clin Exp Dermatol 11(1): 34-40.

White, S. H., W. C. Wimley and M. E. Selsted (1995). "Structure, function, and membrane integration of defensins." Curr Opin Struct Biol 5(4): 521-527.

Wiegand, C., M. Abel, P. Ruth and U. C. Hipler (2009). "HaCaT keratinocytes in co-culture with Staphylococcus aureus can be protected from bacterial damage by polihexanide." Wound Repair Regen 17(5): 730-738.

Wilbanks, A., S. C. Zondlo, K. Murphy, S. Mak, D. Soler, P. Langdon, D. P. Andrew, L. Wu and M. Briskin (2001). "Expression cloning of the STRL33/BONZO/TYMSTRligand reveals elements of CC, CXC, and CX3C chemokines." J Immunol 166(8): 5145-5154.

189

References Williams, I. R. (2006). "CCR6 and CCL20: partners in intestinal immunity and lymphorganogenesis." Ann N Y Acad Sci 1072: 52-61.

Wilson, N. J., K. Boniface, J. R. Chan, B. S. McKenzie, W. M. Blumenschein, J. D. Mattson, B. Basham, K. Smith, T. Chen, F. Morel, J. C. Lecron, R. A. Kastelein, D. J. Cua, T. K. McClanahan, E. P. Bowman and R. de Waal Malefyt (2007). "Development, cytokine profile and function of human interleukin 17-producing helper T cells." Nat Immunol 8(9): 950-957.

Winiski, A., S. Wang, B. Schwendinger and A. Stuetz (2002). "Inhibitory activity of pimecrolimus and tacrolimus on induced cytokine mRNA and protein expression in a human T cell line (Jurkat) measured via RT-PCR and ELISA." J Invest Dermatol 119(1): 347-347.

Winiski, A., S. Wang, B. Schwendinger and A. Stuetz (2007). "Inhibition of T-cell activation in vitro in human peripheral blood mononuclear cells by pimecrolimus and glucocorticosteroids and combinations thereof." Exp Dermatol 16(8): 699-704.

Wirtz, S., C. Becker, M. C. Fantini, E. E. Nieuwenhuis, I. Tubbe, P. R. Galle, H. J. Schild, M. Birkenbach, R. S. Blumberg and M. F. Neurath (2005). "EBV-induced gene 3 transcription is induced by TLR signaling in primary dendritic cells via NF-kappa B activation." J Immunol 174(5): 2814-2824.

Wolff, B., J. J. Sanglier and Y. Wang (1997). "Leptomycin B is an inhibitor of nuclear export: inhibition of nucleo-cytoplasmic translocation of the human immunodeficiency virus type 1 (HIV- 1) Rev protein and Rev-dependent mRNA." Chem Biol 4(2): 139-147.

Wolfs, T. G., W. A. Buurman, A. van Schadewijk, B. de Vries, M. A. Daemen, P. S. Hiemstra and C. van 't Veer (2002). "In vivo expression of Toll-like receptor 2 and 4 by renal epithelial cells: IFN-gamma and TNF-alpha mediated up-regulation during inflammation." J Immunol 168(3): 1286-1293.

Wollina, U., W. Kunkel, L. Bulling, C. Funfstuck, B. Knoll, I. Vennewald and U. C. Hipler (2004). "Candida albicans-induced inflammatory response in human keratinocytes." Mycoses 47(5-6): 193- 199.

Wright, K. M. and J. S. Friedland (2004). "Regulation of chemokine gene expression and secretion in Staphylococcus aureus-infected osteoblasts." Microbes Infect 6(9): 844-852.

190

References Wu, G., Y. G. Chen, B. Ozdamar, C. A. Gyuricza, P. A. Chong, J. L. Wrana, J. Massague and Y. Shi (2000). "Structural basis of Smad2 recognition by the Smad anchor for receptor activation." Science 287(5450): 92-97.

Wu, J. K., G. Siller and G. Strutton (2004). "Psoriasis induced by topical imiquimod." Australas J Dermatol 45(1): 47-50.

Xie, Y., T. Takai, X. Chen, K. Okumura and H. Ogawa (2012). "Long TSLP transcript expression and release of TSLP induced by TLR ligands and cytokines in human keratinocytes." J Dermatol Sci 66(3): 233-237.

Yaar, M., R. L. Karassik, L. E. Schnipper and B. A. Gilchrest (1985). "Effects of alpha and beta interferons on cultured human keratinocytes." J Invest Dermatol 85(1): 70-74.

Yamada, H., R. Izutani, J. Chihara, T. Yudate, M. Matsukura and T. Tezuka (1996). "RANTES mRNA expression in skin and colon of patients with atopic dermatitis." Int Arch Allergy Immunol 111 Suppl 1: 19-21.

Yamamoto, M., S. Sato, H. Hemmi, K. Hoshino, T. Kaisho, H. Sanjo, O. Takeuchi, M. Sugiyama, M. Okabe, K. Takeda and S. Akira (2003). "Role of adaptor TRIF in the MyD88-independent toll- like receptor signaling pathway." Science 301(5633): 640-643.

Yamamoto, M., S. Sato, K. Mori, K. Hoshino, O. Takeuchi, K. Takeda and S. Akira (2002). "Cutting edge: a novel Toll/IL-1 receptor domain-containing adapter that preferentially activates the IFN-beta promoter in the Toll-like receptor signaling." J Immunol 169(12): 6668-6672.

Yamin, T. T. and D. K. Miller (1997). "The interleukin-1 receptor-associated kinase is degraded by proteasomes following its phosphorylation." J Biol Chem 272(34): 21540-21547.

Yang, D., M. Thangaraju, K. Greeneltch, D. D. Browning, P. V. Schoenlein, T. Tamura, K. Ozato, V. Ganapathy, S. I. Abrams and K. Liu (2007). "Repression of IFN regulatory factor 8 by DNA methylation is a molecular determinant of apoptotic resistance and metastatic phenotype in metastatic tumor cells." Cancer Res 67(7): 3301-3309.

Yang, H., C. H. Lin, G. Ma, M. O. Baffi and M. G. Wathelet (2003). "Interferon regulatory factor-7 synergizes with other transcription factors through multiple interactions with p300/CBP coactivators." J Biol Chem 278(18): 15495-15504.

191

References Yarovinsky, F., D. Zhang, J. F. Andersen, G. L. Bannenberg, C. N. Serhan, M. S. Hayden, S. Hieny, F. S. Sutterwala, R. A. Flavell, S. Ghosh and A. Sher (2005). "TLR11 activation of dendritic cells by a protozoan profilin-like protein." Science 308(5728): 1626-1629.

Yokogawa, M., M. Takaishi, K. Nakajima, R. Kamijima, J. Digiovanni and S. Sano (2013). "Imiquimod attenuates the growth of UVB-induced SCC in mice through Th1/Th17 cells." Mol Carcinog 52(10): 760-769.

Yokota, K., A. Takashima, P. R. Bergstresser and K. Ariizumi (2001). "Identification of a human homologue of the dendritic cell-associated C-type lectin-1, dectin-1." Gene 272(1-2): 51-60.

Yoneyama, M., M. Kikuchi, K. Matsumoto, T. Imaizumi, M. Miyagishi, K. Taira, E. Foy, Y. M. Loo, M. Gale, Jr., S. Akira, S. Yonehara, A. Kato and T. Fujita (2005). "Shared and unique functions of the DExD/H-box helicases RIG-I, MDA5, and LGP2 in antiviral innate immunity." J Immunol 175(5): 2851-2858.

Yoneyama, M., W. Suhara, Y. Fukuhara, M. Fukuda, E. Nishida and T. Fujita (1998). "Direct triggering of the type I interferon system by virus infection: activation of a transcription factor complex containing IRF-3 and CBP/p300." EMBO J 17(4): 1087-1095.

Zanetti, M., R. Gennaro and D. Romeo (1995). "Cathelicidins: a novel protein family with a common proregion and a variable C-terminal antimicrobial domain." FEBS Lett 374(1): 1-5.

Zarember, K. A. and P. J. Godowski (2002). "Tissue expression of human Toll-like receptors and differential regulation of Toll-like receptor mRNAs in leukocytes in response to microbes, their products, and cytokines." J Immunol 168(2): 554-561.

Zelensky, A. N. and J. E. Gready (2004). "C-type lectin-like domains in Fugu rubripes." BMC Genomics 5(1): 51.

Zelensky, A. N. and J. E. Gready (2005). "The C-type lectin-like domain superfamily." FEBS J 272(24): 6179-6217.

Zhang, D., G. Zhang, M. S. Hayden, M. B. Greenblatt, C. Bussey, R. A. Flavell and S. Ghosh (2004). "A toll-like receptor that prevents infection by uropathogenic bacteria." Science 303(5663): 1522-1526.

Zhang, L., S. L. Pelech, D. Mayrand, D. Grenier, J. Heino and V. J. Uitto (2001). "Bacterial heat shock protein-60 increases epithelial cell proliferation through the ERK1/2 MAP kinases." Exp Cell Res 266(1): 11-20. 192

References Zhang, M., D. Magit, F. Botteri, H. Y. Shi, K. He, M. Li, P. Furth and R. Sager (1999). "Maspin plays an important role in mammary gland development." Dev Biol 215(2): 278-287.

Zhang, S. Y., E. Jouanguy, S. Ugolini, A. Smahi, G. Elain, P. Romero, D. Segal, V. Sancho- Shimizu, L. Lorenzo, A. Puel, C. Picard, A. Chapgier, S. Plancoulaine, M. Titeux, C. Cognet, H. von Bernuth, C. L. Ku, A. Casrouge, X. X. Zhang, L. Barreiro, J. Leonard, C. Hamilton, P. Lebon, B. Heron, L. Vallee, L. Quintana-Murci, A. Hovnanian, F. Rozenberg, E. Vivier, F. Geissmann, M. Tardieu, L. Abel and J. L. Casanova (2007). "TLR3 deficiency in patients with herpes simplex encephalitis." Science 317(5844): 1522-1527.

Zhang, Z., J. P. Louboutin, D. J. Weiner, J. B. Goldberg and J. M. Wilson (2005). "Human airway epithelial cells sense Pseudomonas aeruginosa infection via recognition of flagellin by Toll-like receptor 5." Infect Immun 73(11): 7151-7160.

Zhao, D. D., S. Watarai, J. T. Lee, S. Kouchi, H. Ohmori and T. Yasuda (1997). "Gene transfection by cationic liposomes: comparison of the transfection efficiency of liposomes prepared from various positively charged lipids." Acta Med Okayama 51(3): 149-154.

Zhao, J., H. J. Kong, H. Li, B. Huang, M. Yang, C. Zhu, M. Bogunovic, F. Zheng, L. Mayer, K. Ozato, J. Unkeless and H. Xiong (2006). "IRF-8/interferon (IFN) consensus sequence-binding protein is involved in Toll-like receptor (TLR) signaling and contributes to the cross-talk between TLR and IFN-gamma signaling pathways." J Biol Chem 281(15): 10073-10080.

Zhao, J., L. Song, C. Li, H. Zou, D. Ni, W. Wang and W. Xu (2007). "Molecular cloning of an invertebrate goose-type lysozyme gene from Chlamys farreri, and lytic activity of the recombinant protein." Mol Immunol 44(6): 1198-1208.

Zhou, D. and J. Galan (2001). "Salmonella entry into host cells: the work in concert of type III secreted effector proteins." Microbes Infect 3(14-15): 1293-1298.

Zou, Z., A. Anisowicz, M. J. Hendrix, A. Thor, M. Neveu, S. Sheng, K. Rafidi, E. Seftor and R. Sager (1994). "Maspin, a serpin with tumor-suppressing activity in human mammary epithelial cells." Science 263(5146): 526-529.

Zucchero, M., M. Cooper, D. Caprau, L. Ribiero, Y. Suzuki, K. Yoshiura, K. Christensen, L. Moreno, M. Johnson, L. Field, Y. Liu, A. Ray, B. Maher, T. Goldstein, A. Lidral, S. Kondo, B. Schutte, M. Marazita and J. C. Murray (2003). "IRF6 is a major modifier for nonsyndromic cleft with or without cleft palate." Am J Hum Genet 73(5): 4.

193

References Zucchero, T. M., M. E. Cooper, B. S. Maher, S. Daack-Hirsch, B. Nepomuceno, L. Ribeiro, D. Caprau, K. Christensen, Y. Suzuki, J. Machida, N. Natsume, K. I. Yoshiura, A. R. Vieira, I. M. Orioli, E. E. Castilla, L. Moreno, M. Arcos-Burgos, A. C. Lidral, L. L. Field, Y. E. Liu, A. Ray, T. H. Goldstein, R. E. Schultz, M. Shi, M. K. Johnson, S. Kondo, B. C. Schutte, M. L. Marazita and J. C. Murray (2004). "Interferon regulatory factor 6 (IRF6) gene variants and the risk of isolated cleft lip or palate." N Engl J Med 351(8): 769-780.

194