DOCSLIB.ORG

Balance Between Acetylation and Methylation of Histone H3 Lysine 9

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Balance Between Acetylation and Methylation of Histone H3 Lysine 9 MOLECULAR AND CELLULAR BIOLOGY, Mar. 2003, p. 1614–1622 Vol. 23, No. 5 0270-7306/03/$08.00ϩ0 DOI: 10.1128/MCB.23.5.1614–1622.2003 Copyright © 2003, American Society for Microbiology. All Rights Reserved. Balance between Acetylation and Methylation of Histone H3 Lysine 9 on the E2F-Responsive Dihydrofolate Reductase Promoter Estelle Nicolas, Christine Roumillac, and Didier Trouche* Laboratoire de Biologie Mole´culaire Eucaryote, UMR 5099 CNRS, IFR 109, Toulouse, France Received 31 October 2002/Accepted 10 December 2002 Epigenetic marks that specify silent heterochromatic domains in eucaryotic genomes include methylation of histone H3 lysine 9. Strikingly, active loci in the vicinity of silent domains are sometimes characterized by acetylation of histone H3 lysine 9, suggesting that the balance between these two competitive modifications is important for the establishment of specific chromatin structures. Some euchromatic genes, targeted by the retinoblastoma protein Rb, are also believed to be regulated by histone H3 lysine 9 methylation. Here, we study the dihydrofolate reductase promoter, which is repressed in G0 and at the beginning of G1 by p107 or p130, two Rb-related proteins. We found that these two pocket proteins share with Rb the ability to associate with the histone methyl transferase SUV39H1. SUV39H1 can be recruited to the E2F transcription factor and functions as a transcriptional corepressor. With ChIP assays followed by real-time PCR, we showed that K9 of histone H3 evolves from a hypermethylated state in G0 to a hyperacetylated state at the G1/S transition. Taken together, these results indicate that the temporal regulation of euchromatic promoters may involve controlling the balance between methylation and acetylation of histone H3 lysine 9, a feature previously described for the spatial regulation of chromatin function. Many genes which encode proteins required for S-phase teins function as transcriptional repressors (11) through a progression are specifically expressed at the end of G1 and at mechanism involving, at least in part, histone deacetylases the G1/S transition. Some of these genes are controlled by the (HDACs) (3, 16, 17). Consistent with that, chromatin immu- E2F transcription factor. This transcription factor, a hetero- noprecipitation (ChIP) experiments have confirmed that his- dimer, is composed of an E2F protein and a DP protein (19). tones are largely deacetylated in G0 on many E2F-regulated So far, six E2F proteins (E2F1 to -6) and two DP proteins promoters (30). Furthermore, cell cycle-dependent recruit- (DP1 and -2) have been described. E2F1 to -5 share a C- ment of HDAC1 to the E2F-regulated dihydrofolate reductase terminal domain which possesses the ability to activate tran- (DHFR) promoter has recently been shown (9). scription. This domain also contains the binding site for a In addition, we and others have shown that transcriptional family of proteins (called pocket proteins) which are critical repression by Rb could also be mediated through the recruit- regulators of E2F activity (20). The founding member of this ment of the histone methyl transferase (HMT) SUV39H1 (24, family is the product of the retinoblastoma susceptibility gene, 31). The cell cycle regulation of some E2F-regulated genes the Rb protein. Rb binds specifically to E2F1, E2F2, E2F3, and could thus involve a complex interplay between histone meth- with lower affinity to E2F4, whereas the two other pocket ylation and acetylation. proteins, p107 and p130, both target E2F4 and E2F5. Strikingly, these two modifications also play a crucial role in Binding of pocket proteins to the E2F transcription factor is the establishment and maintenance of chromatin domains. cell cycle regulated. In resting cells or in cells at the beginning Methylation on lysines is a posttranslational modification of of G1, Rb, p107, and p130 are in an active hypophosphorylated nucleosomal histones which has been known for some time state and are recruited to E2F-regulated promoters through (21; for a recent review, see reference 33) but which has re- their interaction with E2F. When cells progress into S phase, ceived renewed attention since the molecular characterization pocket proteins are gradually phosphorylated by cyclins/cdk’s of the first HMT, SUV39H1 (27). SUV39H1 was known as the (26). These phosphorylation events lead to their inactivation mammalian homologue of Schizosaccharomyces pombe or Dro- and the appearance of some E2F transcription factor not sophila melanogaster proteins required for heterochromatin si- bound by a pocket protein (called free E2F). This free E2F can lencing (1). SUV39H1 methylates specifically K9 of histone H3 thus activate transcription of E2F-regulated genes, thereby (27). This methylation creates a binding site on chromatin for allowing cell progression into S phase. Consequently, E2F the members of the HP1 (heterochromatin protein 1) family binding sites are believed to be occupied in G and at the 0 (2, 14, 22), which are also required for silencing at heterochro- beginning of G by a complex containing the E2F transcription 1 matic loci (reviewed in reference 13). These proteins recognize factor and a pocket protein, and later in G , by free E2F (19). 1 the methylated lysine by use of their chromodomain. Thus, When recruited on E2F-regulated promoters, pocket pro- heterochromatin silencing is believed to involve methylation of lysine 9 of histone H3 by SUV39H1, followed by HP1 recruit- ment and, subsequently, transcriptional repression (13). Ge- * Corresponding author. Mailing address: LBME, UMR 5099 netic experiments indicate that pericentric heterochromatin CNRS, 118 Route de Narbonne, 31062 Toulouse Cedex, France. Phone: 33 5 61 33 59 15. Fax: 33 5 61 33 58 86. E-mail: trouche@ibcg silencing is also dependent on HDACs (7, 10). Furthermore, .biotoul.fr. the specification of silent versus active domains in chromatin 1614 VOL. 23, 2003 HISTONE MODIFICATIONS ON THE DHFR PROMOTER 1615 often involves the balance between two competitive modifica- sequences of the oligonucleotides were as follows: wild-type E2F, 5ЈCCGG Ј tions of histone H3 K9, methylation and acetylation (12, 15). GAATTCGCCGACGCGCTTGGCGGGAGATAGAAAAGT3 ; mutated E2F, 5ЈCCGGGAATTCGCCGACGCGCTTGTATGGAGATAGAAAAGT3Ј. This has led to the proposal that during the propagation of Ten microliters of streptavidin-agarose beads was then added for 1 h. Beads heterochromatin, HDACs function first to deacetylate K9, were washed three times with washing buffer (50 mM Tris [pH 8], 0.4% NP-40, thereby allowing its subsequent methylation by SUV39H1 (33). 150 mM NaCl, 5 mM MgCl2, supplemented with protease inhibitors). A similar mechanism has already been suggested for E2F- Bound proteins were subjected to an HMT assay as described previously (31) regulated promoters (24). However, little is known about the or to Western blotting with anti-Myc 9E10 (Roche Diagnostics), anti-p107 C-18, anti-p130 C20 (Santa Cruz Biotechnology), anti-Flag M2 (Sigma), or anti-hem- cell cycle regulation of histone H3 K9 modifications on E2F- agglutinin (HA) 16B12 (Babco) antibody. responsive promoters. Here we studied the DHFR promoter, Plasmids. pGEMT-DHFR and pGEMT-GAPDH were kind gifts from A. which is controlled by p107 or p130 and which has been the Harel-Bellan (9). pCMVNeoBam p107, pGEX-DP1 59-410, pGEX-E2F1 89- focus of a recent detailed study (9). 437, pCMVNeoBam Rb 379-928, pGEX p107 252-816, pGEX Rb 379-928, pCMVGT-E2F4, pCMV myc-E2F4, and empty vectors were described previ- We found that both p107 and p130 associate with SUV39H1, ously (8, 17, 18). pGEX-E2F4 and pGEX-E2F5 were kind gifts from C. Sardet. as does Rb. Furthermore, we demonstrate that SUV39H1 can pCMV myc-SUV39H1 and pCMV Flag-EMT1 were kind gifts from T. Jenuwein function as a transcriptional corepressor for p107 and p130. (27) and Y. Nakatani (25), respectively. pCMV HA-SUV39H1, pCMV HA- Studies of histone modifications on the DHFR promoter indi- SUV39H1 ⌬SET, pCMVlacZ, and Gal4-luc vectors were described previously cate that methylation of K9 can be detected in serum-starved (31). Details of constructions are available upon request. ChIP assays. ChIP assays were performed essentially as previously described 3T3 cells and decreases in cells at the G1/S transition. Con- (9). Briefly, following formaldehyde cross-linking in living cells, chromatin was versely, acetylation of histone H3 K9 increases from G0 to purified and subjected to sonication to obtain a mean length of DNA fragments G1/S. Taken together, these data indicate that the temporal of about 500 base pairs. Sonicated chromatin was then divided into three samples ␮ regulation of the DHFR promoter involves a shift from the and immunoprecipitated with 10 l of anti-acetyl histone H3 (K9), anti-acetyl histone H3 (K14), or anti-dimethyl histone H3 (Lys9) antibody (all from Upstate methylated to the acetylated isoforms of histone H3 lysine 9. Biotechnology) or without antibody as a control. After cross-link reversion and DNA recovery, samples were analyzed by quantitative PCR (ICyclerQ; Bio-Rad) with Sybr green (Sigma) and Platinum Quantitative PCR Supermix-UDG (In- MATERIALS AND METHODS vitrogen) to detect DHFR promoter or glyceraldehyde-3-phosphate dehydroge- Cell culture and transfection. U2OS, NIH 3T3, and HeLa cells were main- nase (GAPDH) sequences as described previously (9). tained in Dulbecco’s modified Eagle’s medium supplemented with 10% fetal calf The amount of DHFR or GAPDH sequence present at each point was cal- serum (FCS), antibiotics, and 1% sodium pyruvate. 3T3 cells from Suv39H culated relative to a standard curve obtained using serial dilutions of pGEMT- knockout (KO) mice or controls were maintained as described above but in the DHFR or pGEMT-GAPDH vector, respectively. Three different dilutions of presence of 0.2% ␤-mercaptoethanol and 1% nonessential amino acids. Jurkat each sample (immunoprecipitates and inputs) were analyzed in parallel. After cells were maintained in RPMI medium supplemented with 10% FCS and calculating the mean value for these three dilutions, the efficiency of the immu- antibiotics. All media were from Gibco-BRL.
Load more

Recommended publications
  • Insights Into Hp1a-Chromatin Interactions
    cells Review Insights into HP1a-Chromatin Interactions Silvia Meyer-Nava , Victor E. Nieto-Caballero, Mario Zurita and Viviana Valadez-Graham * Instituto de Biotecnología, Departamento de Genética del Desarrollo y Fisiología Molecular, Universidad Nacional Autónoma de México, Cuernavaca Morelos 62210, Mexico; [email protected] (S.M.-N.); [email protected] (V.E.N.-C.); [email protected] (M.Z.) * Correspondence: [email protected]; Tel.: +527773291631 Received: 26 June 2020; Accepted: 21 July 2020; Published: 9 August 2020 Abstract: Understanding the packaging of DNA into chromatin has become a crucial aspect in the study of gene regulatory mechanisms. Heterochromatin establishment and maintenance dynamics have emerged as some of the main features involved in genome stability, cellular development, and diseases. The most extensively studied heterochromatin protein is HP1a. This protein has two main domains, namely the chromoshadow and the chromodomain, separated by a hinge region. Over the years, several works have taken on the task of identifying HP1a partners using different strategies. In this review, we focus on describing these interactions and the possible complexes and subcomplexes associated with this critical protein. Characterization of these complexes will help us to clearly understand the implications of the interactions of HP1a in heterochromatin maintenance, heterochromatin dynamics, and heterochromatin’s direct relationship to gene regulation and chromatin organization. Keywords: heterochromatin; HP1a; genome stability 1. Introduction Chromatin is a complex of DNA and associated proteins in which the genetic material is packed in the interior of the nucleus of eukaryotic cells [1]. To organize this highly compact structure, two categories of proteins are needed: histones [2] and accessory proteins, such as chromatin regulators and histone-modifying proteins.
    [Show full text]
  • H19 Lncrna Controls Gene Expression of the Imprinted Gene Network by Recruiting MBD1
    H19 lncRNA controls gene expression of the Imprinted Gene Network by recruiting MBD1 Paul Monniera,b, Clémence Martineta, Julien Pontisc, Irina Stanchevad, Slimane Ait-Si-Alic, and Luisa Dandoloa,1 aGenetics and Development Department, Institut National de la Santé et de la Recherche Médicale U1016, Centre National de la Recherche Scientifique (CNRS) Unité Mixte de Recherche (UMR) 8104, University Paris Descartes, Institut Cochin, Paris 75014, France; bUniversity Paris Pierre and Marie Curie, Paris 75005, France; cUniversity Paris Diderot, Sorbonne Paris Cité, Laboratoire Epigénétique et Destin Cellulaire, CNRS UMR 7216, Paris 75013, France; and dWellcome Trust Centre for Cell Biology, University of Edinburgh, Edinburgh EH9 3JR, United Kingdom Edited by Marisa Bartolomei, University of Pennsylvania, Philadelphia, PA, and accepted by the Editorial Board November 11, 2013 (received for review May 30, 2013) The H19 gene controls the expression of several genes within the this control is transcriptional or posttranscriptional and whether Imprinted Gene Network (IGN), involved in growth control of the these nine targets are direct or indirect targets remain elusive. embryo. However, the underlying mechanisms of this control re- Several lncRNAs interact with chromatin-modifying com- main elusive. Here, we identified the methyl-CpG–binding domain plexes and appear to exert a transcriptional control by targeting fi protein 1 MBD1 as a physical and functional partner of the H19 local chromatin modi cations at discrete genomic regions (8, 9). long noncoding RNA (lncRNA). The H19 lncRNA–MBD1 complex is In the case of imprinted clusters, the DMRs controlling the ex- fi pression of imprinted genes exhibit parent-of-origin epigenetic required for the control of ve genes of the IGN.
    [Show full text]
  • Gene-Specific Targeting of H3K9 Methylation Is Sufficient for Initiating Repression in Vivo
    Current Biology, Vol. 12, 2159–2166, December 23, 2002, 2002 Elsevier Science Ltd. All rights reserved. PII S0960-9822(02)01391-X Gene-Specific Targeting of H3K9 Methylation Is Sufficient for Initiating Repression In Vivo Andrew W. Snowden, Philip D. Gregory,1 us to use an endogenous chromosomal gene as a tran- Casey C. Case, and Carl O. Pabo scriptional reporter system. All three constructs, G9A Sangamo BioSciences and both SUV39H1 deletion 76 and deletion 149 (re- Point Richmond Tech Center ferred to throughout as Suv Del 76 or Suv Del 149) 501 Canal Boulevard constructs, employed in this study contain the minimal Suite A100 catalytically active portions of the proteins [6, 14] (shown Richmond, California 94804 schematically in Figure 1A). Chimeras of ZFP-A with either G9A or the two SUV39H1 deletions were all able to efficiently repress the amount of VEGF-A protein (Figure Summary 1B) and mRNA (not shown) produced by the endoge- -fold, respectively, de-3ف and -2ف nous VEGF-A locus Covalent modifications of chromatin have emerged spite background VEGF-A gene expression from non- as key determinants of the genome’s transcriptional transfected cells. Fusion of an alternative repression competence [1–3]. Histone H3 lysine 9 (H3K9) methyla- domain encoding the LBD of v-ErbA, a viral relative of tion is an epigenetic signal that is recognized by HP1 avian thyroid hormone receptor protein and a known [4, 5] and correlates with gene silencing in a variety of HDAC3/NCoR recruitment domain, to ZFP-A led to a organisms [3]. Discovery of the enzymes that catalyze similar decrease in transcription from this locus (Figure H3K9 methylation [6–8] has identified a second gene- 1B).
    [Show full text]
  • Interaction with Suv39h1 Is Critical for Snail-Mediated E-Cadherin Repression in Breast Cancer
    Oncogene (2013) 32, 1351–1362 & 2013 Macmillan Publishers Limited All rights reserved 0950-9232/13 www.nature.com/onc ORIGINAL ARTICLE Interaction with Suv39H1 is critical for Snail-mediated E-cadherin repression in breast cancer C Dong1,2,YWu2,3, Y Wang1,2, C Wang2,4, T Kang5, PG Rychahou2,6, Y-I Chi1, BM Evers1,2,6 and BP Zhou1,2 Expression of E-cadherin, a hallmark of epithelial–mesenchymal transition (EMT), is often lost due to promoter DNA methylation in basal-like breast cancer (BLBC), which contributes to the metastatic advantage of this disease; however, the underlying mechanism remains unclear. Here, we identified that Snail interacted with Suv39H1 (suppressor of variegation 3-9 homolog 1), a major methyltransferase responsible for H3K9me3 that intimately links to DNA methylation. We demonstrated that the SNAG domain of Snail and the SET domain of Suv39H1 were required for their mutual interactions. We found that H3K9me3 and DNA methylation on the E-cadherin promoter were higher in BLBC cell lines. We showed that Snail interacted with Suv39H1 and recruited it to the E-cadherin promoter for transcriptional repression. Knockdown of Suv39H1 restored E-cadherin expression by blocking H3K9me3 and DNA methylation and resulted in the inhibition of cell migration, invasion and metastasis of BLBC. Our study not only reveals a critical mechanism underlying the epigenetic regulation of EMT, but also paves a way for the development of new treatment strategies against this disease. Oncogene (2013) 32, 1351–1362; doi:10.1038/onc.2012.169; published
    [Show full text]
  • Macrophage Migration Inhibitory Factor Mediates Peripheral Nerve Injury-Induced Hypersensitivity by Curbing Dopaminergic Descending Inhibition
    OPEN Experimental & Molecular Medicine (2018) 50, e445; doi:10.1038/emm.2017.271 Official journal of the Korean Society for Biochemistry and Molecular Biology www.nature.com/emm ORIGINAL ARTICLE Macrophage migration inhibitory factor mediates peripheral nerve injury-induced hypersensitivity by curbing dopaminergic descending inhibition Xian Wang1,6, Shaolei Ma2,6, Haibo Wu1,6, Xiaofeng Shen1,6, Shiqin Xu1, Xirong Guo3, Maria L Bolick4, Shizheng Wu5 and Fuzhou Wang1,4 Our previous works disclosed the contributing role of macrophage migration inhibitory factor (MIF) and dopaminergic inhibition by lysine dimethyltransferase G9a/Glp complex in peripheral nerve injury-induced hypersensitivity. We herein propose that the proinflammatory cytokine MIF participates in the regulation of neuropathic hypersensitivity by interacting with and suppressing the descending dopaminergic system. The lumbar spinal cord (L-SC) and ventral tegmental area (VTA) are two major locations with significant upregulation of MIF after chronic constriction injury (CCI) of the sciatic nerve, and they display time-dependent changes, along with a behavioral trajectory. Correspondingly, dopamine (DA) content shows the reverse characteristic change to MIF with a time-dependent curve in post-surgical behavior. The levels of both MIF and DA are reversed by the MIF tautomerase inhibitor ISO-1, and a negative relationship exists between MIF and DA. The reversed role of ISO-1 also affects tyrosine hydroxylase expression. Furthermore, CCI induces Th promoter CpG site methylation in the L-SC and VTA areas, and this effect could be abated by ISO-1 administration. G9a/SUV39H1 and H3K9me2/H3K9me3 enrichment within the Th promoter region following CCI in the L-SC and VTA was also decreased by ISO-1.
    [Show full text]
  • Effect of SUV39H1 Histone Methyltransferase Knockout On
    cells Article Effect of SUV39H1 Histone Methyltransferase Knockout on Expression of Differentiation-Associated Genes in HaCaT Keratinocytes Barbara Sobiak and Wiesława Le´sniak* Nencki Institute of Experimental Biology, Polish Academy of Sciences, 3 Pasteur Street, 02-093 Warsaw, Poland; [email protected] * Correspondence: [email protected]; Tel.: +48-22-5892-327; Fax: +48-22-822-5342 Received: 7 September 2020; Accepted: 4 December 2020; Published: 7 December 2020 Abstract: Keratinocytes undergo a complex differentiation process, coupled with extensive changes in gene expression through which they acquire distinctive features indispensable for cells that form the external body barrier—epidermis. Disturbed epidermal differentiation gives rise to multiple skin diseases. The involvement of epigenetic factors, such as DNA methylation or histone modifications, in the regulation of epidermal gene expression and differentiation has not been fully recognized yet. In this work we performed a CRISPR/Cas9-mediated knockout of SUV39H1, a gene-encoding H3K9 histone methyltransferase, in HaCaT cells that originate from spontaneously immortalized human keratinocytes and examined changes in the expression of selected differentiation-specific genes located in the epidermal differentiation complex (EDC) and other genomic locations by RT-qPCR. The studied genes revealed a diverse differentiation state-dependent or -independent response to a lower level of H3K9 methylation. We also show, by means of chromatin immunoprecipitation, that the expression of genes in the LCE1 subcluster of EDC was regulated by the extent of trimethylation of lysine 9 in histone H3 bound to their promoters. Changes in gene expression were accompanied by changes in HaCaT cell morphology and adhesion. Keywords: CRISPR/Cas9; epidermal differentiation; histone modifications; H3K9me3; LCE1 genes; SUV39H1 histone methyltransferase 1.
    [Show full text]
  • Epigenetic DNA Methylation of EBI3 Modulates Human Interleukin-35 Formation Via Nfkb Signaling: a Promising Therapeutic Option in Ulcerative Colitis
    International Journal of Molecular Sciences Article Epigenetic DNA Methylation of EBI3 Modulates Human Interleukin-35 Formation via NFkB Signaling: A Promising Therapeutic Option in Ulcerative Colitis Alexandra Wetzel 1, Bettina Scholtka 1 , Fabian Schumacher 2 , Harshadrai Rawel 1 , Birte Geisendörfer 1 and Burkhard Kleuser 2,* 1 Institute of Nutritional Science, University of Potsdam, 14558 Nuthetal, Germany; [email protected] (A.W.); [email protected] (B.S.); [email protected] (H.R.); [email protected] (B.G.) 2 Institute of Pharmacy, Freie Universität Berlin, 14195 Berlin, Germany; [email protected] * Correspondence: [email protected] Abstract: Ulcerative colitis (UC), a severe chronic disease with unclear etiology that is associated with increased risk for colorectal cancer, is accompanied by dysregulation of cytokines. Epstein–Barr virus- induced gene 3 (EBI3) encodes a subunit in the unique heterodimeric IL-12 cytokine family of either pro- or anti-inflammatory function. After having recently demonstrated that upregulation of EBI3 by histone acetylation alleviates disease symptoms in a dextran sulfate sodium (DSS)-treated mouse model of chronic colitis, we now aimed to examine a possible further epigenetic regulation of EBI3 Citation: Wetzel, A.; Scholtka, B.; by DNA methylation under inflammatory conditions. Treatment with the DNA methyltransferase Schumacher, F.; Rawel, H.; inhibitor (DNMTi) decitabine (DAC) and TNFα led to synergistic upregulation of EBI3 in human Geisendörfer, B.; Kleuser, B. colon epithelial cells (HCEC). Use of different signaling pathway inhibitors indicated NFκB signaling Epigenetic DNA Methylation of EBI3 was necessary and proportional to the synergistic EBI3 induction. MALDI-TOF/MS and HPLC-ESI- Modulates Human Interleukin-35 MS/MS analysis of DAC/TNFα-treated HCEC identified IL-12p35 as the most probable binding Formation via NFkB Signaling: A partner to form a functional protein.
    [Show full text]
  • Methylation of RUNX1 by PRMT1 Abrogates SIN3A Binding and Potentiates Its Transcriptional Activity
    Downloaded from genesdev.cshlp.org on September 30, 2021 - Published by Cold Spring Harbor Laboratory Press Methylation of RUNX1 by PRMT1 abrogates SIN3A binding and potentiates its transcriptional activity Xinyang Zhao,1 Vladimir Jankovic,1 Alexander Gural,1 Gang Huang,1 Animesh Pardanani,1 Silvia Menendez,1 Jin Zhang,1 Richard Dunne,1 Andrew Xiao,2 Hediye Erdjument-Bromage,1 C. David Allis,2 Paul Tempst,1 and Stephen D. Nimer1,3 1Sloan-Kettering Institute, Memorial Sloan-Kettering Cancer Center, New York, New York 10021, USA; 2Rockefeller University, New York, New York 10021, USA RUNX1/AML1 is required for the development of definitive hematopoiesis, and its activity is altered by mutations, deletions, and chromosome translocations in human acute leukemia. RUNX1 function can be regulated by post-translational modifications and protein–protein interactions. We show that RUNX1 is arginine-methylated in vivo by the arginine methyltransferase PRMT1, and that PRMT1 serves as a transcriptional coactivator for RUNX1 function. Using mass spectrometry, and a methyl-arginine-specific antibody, we identified two arginine residues (R206 and R210) within the region of RUNX1 that interact with the corepressor SIN3A and are methylated by PRMT1. PRMT1- dependent methylation of RUNX1 at these arginine residues abrogates its association with SIN3A, whereas shRNA against PRMT1 (or use of a methyltransferase inhibitor) enhances this association. We find arginine-methylated RUNX1 on the promoters of two bona fide RUNX1 target genes, CD41 and PU.1 and show that shRNA against PRMT1 or RUNX1 down-regulates their expression. These arginine methylation sites and the dynamic regulation of corepressor binding are lost in the leukemia-associated RUNX1–ETO fusion protein, which likely contributes to its dominant inhibitory activity.
    [Show full text]
  • CBX5/G9a/H3k9me-Mediated Gene Repression Is Essential to Fibroblast Activation During Lung Fibrosis
    RESEARCH ARTICLE CBX5/G9a/H3K9me-mediated gene repression is essential to fibroblast activation during lung fibrosis Giovanni Ligresti,1 Nunzia Caporarello,1 Jeffrey A. Meridew,1 Dakota L. Jones,1 Qi Tan,1 Kyoung Moo Choi,1 Andrew J. Haak,1 Aja Aravamudhan,1 Anja C. Roden,2 Y.S. Prakash,1,3 Gwen Lomberk,4 Raul A. Urrutia,4 and Daniel J. Tschumperlin1 1Department of Physiology and Biomedical Engineering, 2Laboratory of Medicine and Pathology, and 3Department of Anesthesiology, Mayo Clinic, Rochester, Minnesota, USA. 4Division of Research,Department of Surgery and Genomic Sciences and Precision Medicine Center, Medical College of Wisconsin, Wauwatosa, Wisconsin, USA. Pulmonary fibrosis is a devastating disease characterized by accumulation of activated fibroblasts and scarring in the lung. While fibroblast activation in physiological wound repair reverses spontaneously, fibroblast activation in fibrosis is aberrantly sustained. Here we identified histone 3 lysine 9 methylation (H3K9me) as a critical epigenetic modification that sustains fibroblast activation by repressing the transcription of genes essential to returning lung fibroblasts to an inactive state. We show that the histone methyltransferase G9a (EHMT2) and chromobox homolog 5 (CBX5, also known as HP1α), which deposit H3K9me marks and assemble an associated repressor complex, respectively, are essential to initiation and maintenance of fibroblast activation specifically through epigenetic repression of peroxisome proliferator– activated receptor γ coactivator 1 α gene (PPARGC1A, encoding PGC1α). Both TGF-β and increased matrix stiffness potently inhibit PGC1α expression in lung fibroblasts through engagement of the CBX5/G9a pathway. Inhibition of the CBX5/G9a pathway in fibroblasts elevates PGC1α, attenuates TGF-β– and matrix stiffness–promoted H3K9 methylation, and reduces collagen accumulation in the lungs following bleomycin injury.
    [Show full text]
  • SUV39H1 Regulates the Progression of MLL-AF9-Induced Acute Myeloid Leukemia
    Oncogene (2020) 39:7239–7252 https://doi.org/10.1038/s41388-020-01495-6 ARTICLE SUV39H1 regulates the progression of MLL-AF9-induced acute myeloid leukemia 1 1 1,3 1 1 1 Yajing Chu ● Yangpeng Chen ● Huidong Guo ● Mengke Li ● Bichen Wang ● Deyang Shi ● 1 2 1 2 1 1 1 Xuelian Cheng ● Jinxia Guan ● Xiaomin Wang ● Chenghai Xue ● Tao Cheng ● Jun Shi ● Weiping Yuan Received: 17 February 2020 / Revised: 11 September 2020 / Accepted: 28 September 2020 / Published online: 9 October 2020 © The Author(s) 2020. This article is published with open access Abstract Epigenetic regulations play crucial roles in leukemogenesis and leukemia progression. SUV39H1 is the dominant H3K9 methyltransferase in the hematopoietic system, and its expression declines with aging. However, the role of SUV39H1 via its-mediated repressive modification H3K9me3 in leukemogenesis/leukemia progression remains to be explored. We found that SUV39H1 was down-regulated in a variety of leukemias, including MLL-r AML, as compared with normal individuals. Decreased levels of Suv39h1 expression and genomic H3K9me3 occupancy were observed in LSCs from MLL-r-induced AML mouse models in comparison with that of hematopoietic stem/progenitor cells. Suv39h1 overexpression increased MLL r Suv39h1 1234567890();,: 1234567890();,: leukemia latency and decreased the frequency of LSCs in - AML mouse models, while knockdown accelerated disease progression with increased number of LSCs. Increased Suv39h1 expression led to the inactivation of Hoxb13 and Six1, as well as reversion of Hoxa9/Meis1 downstream target genes, which in turn decelerated leukemia progression. Interestingly, Hoxb13 expression is up-regulated in MLL-AF9-induced AML cells, while knockdown of Hoxb13 in MLL-AF9 leukemic cells significantly prolonged the survival of leukemic mice with reduced LSC frequencies.
    [Show full text]
  • The N-Terminus of Histone H3 Is Required for De Novo DNA Methylation in Chromatin
    The N-terminus of histone H3 is required for de novo DNA methylation in chromatin Jia-Lei Hua,b, Bo O. Zhoua,b, Run-Rui Zhanga,b, Kang-Ling Zhangc, Jin-Qiu Zhoua,1, and Guo-Liang Xua,1 aThe State Key Laboratory of Molecular Biology, Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, 320 Yueyang Road, Shanghai 200031, China; bThe Graduate School, Chinese Academy of Sciences, 320 Yueyang Road, Shanghai 200031, China; and cDepartment of Biochemistry, School of Medicine, Loma Linda University, Loma Linda, CA 92350 Edited by Arthur D. Riggs, Beckman Research Institute of the City of Hope, Duarte, CA, and approved November 3, 2009 (received for review May 28, 2009) DNA methylation and histone modification are two major epige- maintenance methylation. For example, recent studies showed netic pathways that interplay to regulate transcriptional activity that G9a exerts its effect on DNA methylation independently of and other genome functions. Dnmt3L is a regulatory factor for the its enzymatic activity (6–8), and depletion of this protein might de novo DNA methyltransferases Dnmt3a and Dnmt3b. Although have an impact on the maintenance function of Dnmt1 (9, 10). recent biochemical studies have revealed that Dnmt3L binds to the While a repressive mark such as H3K9 methylation can tail of histone H3 with unmethylated lysine 4 in vitro, the require- presumably trigger DNA methylation, the active chromatin mark ment of chromatin components for DNA methylation has not been H3K4 methylation has been implicated as a repulsive signal (11). examined, and functional evidence for the connection of histone Dnmt3L, the regulatory protein that forms a complex with tails to DNA methylation is still lacking.
    [Show full text]
  • Crystal Structure of the Human SUV39H1 Chromodomain and Its Recognition of Histone H3k9me2/3
    Crystal Structure of the Human SUV39H1 Chromodomain and Its Recognition of Histone H3K9me2/3 Tao Wang1., Chao Xu2., Yanli Liu2,3, Kai Fan1, Zhihong Li2, Xing Sun2, Hui Ouyang2, Xuecheng Zhang4, Jiahai Zhang1, Yanjun Li2, Farrell MacKenzie2, Jinrong Min2,3*, Xiaoming Tu1* 1 Hefei National Laboratory for Physical Sciences at Microscale, School of Life Science, University of Science and Technology of China, Hefei, Anhui, People’s Republic of China, 2 Structural Genomics Consortium and Department of Physiology, University of Toronto, Toronto, Ontario, Canada, 3 Hubei Key Laboratory of Genetic Regulation and Integrative Biology, College of Life Science, Huazhong Normal University, Wuhan, People’s Republic of China, 4 School of Life Sciences, Anhui University, Hefei, Anhui, People’s Republic of China Abstract SUV39H1, the first identified histone lysine methyltransferase in human, is involved in chromatin modification and gene regulation. SUV39H1 contains a chromodomain in its N-terminus, which potentially plays a role in methyl-lysine recognition and SUV39H1 targeting. In this study, the structure of the chromodomain of human SUV39H1 was determined by X-ray crystallography. The SUV39H1 chromodomain displays a generally conserved structure fold compared with other solved chromodomains. However, different from other chromodomains, the SUV39H1 chromodomain possesses a much longer helix at its C-terminus. Furthermore, the SUV39H1 chromodomain was shown to recognize histone H3K9me2/3 specifically. Citation: Wang T, Xu C, Liu Y, Fan K, Li Z, et al. (2012) Crystal Structure of the Human SUV39H1 Chromodomain and Its Recognition of Histone H3K9me2/3. PLoS ONE 7(12): e52977. doi:10.1371/journal.pone.0052977 Editor: Esteban Ballestar, Bellvitge Biomedical Research Institute (IDIBELL), Spain Received May 21, 2012; Accepted November 22, 2012; Published December 28, 2012 Copyright: ß 2012 Wang et al.
    [Show full text]