Balance Between Acetylation and Methylation of Histone H3 Lysine 9

MOLECULAR AND CELLULAR BIOLOGY, Mar. 2003, p. 1614–1622 Vol. 23, No. 5 0270-7306/03/$08.00ϩ0 DOI: 10.1128/MCB.23.5.1614–1622.2003 Copyright © 2003, American Society for Microbiology. All Rights Reserved.

Balance between Acetylation and Methylation of Histone H3 Lysine 9 on the E2F-Responsive Dihydrofolate Reductase Promoter Estelle Nicolas, Christine Roumillac, and Didier Trouche* Laboratoire de Biologie Mole´culaire Eucaryote, UMR 5099 CNRS, IFR 109, Toulouse, France

Received 31 October 2002/Accepted 10 December 2002

Epigenetic marks that specify silent heterochromatic domains in eucaryotic genomes include methylation of histone H3 lysine 9. Strikingly, active loci in the vicinity of silent domains are sometimes characterized by acetylation of histone H3 lysine 9, suggesting that the balance between these two competitive modiﬁcations is important for the establishment of speciﬁc chromatin structures. Some euchromatic genes, targeted by the retinoblastoma protein Rb, are also believed to be regulated by histone H3 lysine 9 methylation. Here, we study

the dihydrofolate reductase promoter, which is repressed in G0 and at the beginning of G1 by p107 or p130, two Rb-related proteins. We found that these two pocket proteins share with Rb the ability to associate with the histone methyl transferase SUV39H1. SUV39H1 can be recruited to the E2F transcription factor and functions as a transcriptional corepressor. With ChIP assays followed by real-time PCR, we showed that K9 of histone

H3 evolves from a hypermethylated state in G0 to a hyperacetylated state at the G1/S transition. Taken together, these results indicate that the temporal regulation of euchromatic promoters may involve controlling the balance between methylation and acetylation of histone H3 lysine 9, a feature previously described for the spatial regulation of chromatin function.

Many genes which encode proteins required for S-phase teins function as transcriptional repressors (11) through a progression are specifically expressed at the end of G1 and at mechanism involving, at least in part, histone deacetylases the G1/S transition. Some of these genes are controlled by the (HDACs) (3, 16, 17). Consistent with that, chromatin immu- E2F transcription factor. This transcription factor, a hetero- noprecipitation (ChIP) experiments have confirmed that his- dimer, is composed of an E2F protein and a DP protein (19). tones are largely deacetylated in G0 on many E2F-regulated So far, six E2F proteins (E2F1 to -6) and two DP proteins promoters (30). Furthermore, cell cycle-dependent recruit- (DP1 and -2) have been described. E2F1 to -5 share a C- ment of HDAC1 to the E2F-regulated dihydrofolate reductase terminal domain which possesses the ability to activate tran- (DHFR) promoter has recently been shown (9). scription. This domain also contains the binding site for a In addition, we and others have shown that transcriptional family of proteins (called pocket proteins) which are critical repression by Rb could also be mediated through the recruit- regulators of E2F activity (20). The founding member of this ment of the histone methyl transferase (HMT) SUV39H1 (24, family is the product of the retinoblastoma susceptibility gene, 31). The cell cycle regulation of some E2F-regulated genes the Rb protein. Rb binds specifically to E2F1, E2F2, E2F3, and could thus involve a complex interplay between histone meth- with lower affinity to E2F4, whereas the two other pocket ylation and acetylation. proteins, p107 and p130, both target E2F4 and E2F5. Strikingly, these two modifications also play a crucial role in Binding of pocket proteins to the E2F transcription factor is the establishment and maintenance of chromatin domains. cell cycle regulated. In resting cells or in cells at the beginning Methylation on lysines is a posttranslational modification of of G1, Rb, p107, and p130 are in an active hypophosphorylated nucleosomal histones which has been known for some time state and are recruited to E2F-regulated promoters through (21; for a recent review, see reference 33) but which has re- their interaction with E2F. When cells progress into S phase, ceived renewed attention since the molecular characterization pocket proteins are gradually phosphorylated by cyclins/cdk’s of the first HMT, SUV39H1 (27). SUV39H1 was known as the (26). These phosphorylation events lead to their inactivation mammalian homologue of Schizosaccharomyces pombe or Dro- and the appearance of some E2F transcription factor not sophila melanogaster proteins required for heterochromatin si- bound by a pocket protein (called free E2F). This free E2F can lencing (1). SUV39H1 methylates specifically K9 of histone H3 thus activate transcription of E2F-regulated genes, thereby (27). This methylation creates a binding site on chromatin for allowing cell progression into S phase. Consequently, E2F the members of the HP1 (heterochromatin protein 1) family binding sites are believed to be occupied in G and at the 0 (2, 14, 22), which are also required for silencing at heterochro- beginning of G by a complex containing the E2F transcription 1 matic loci (reviewed in reference 13). These proteins recognize factor and a pocket protein, and later in G , by free E2F (19). 1 the methylated lysine by use of their chromodomain. Thus, When recruited on E2F-regulated promoters, pocket pro- heterochromatin silencing is believed to involve methylation of lysine 9 of histone H3 by SUV39H1, followed by HP1 recruitment and, subsequently, transcriptional repression (13). Ge- * Corresponding author. Mailing address: LBME, UMR 5099 netic experiments indicate that pericentric heterochromatin CNRS, 118 Route de Narbonne, 31062 Toulouse Cedex, France. Phone: 33 5 61 33 59 15. Fax: 33 5 61 33 58 86. E-mail: trouche@ibcg silencing is also dependent on HDACs (7, 10). Furthermore, .biotoul.fr. the specification of silent versus active domains in chromatin

1614 VOL. 23, 2003 HISTONE MODIFICATIONS ON THE DHFR PROMOTER 1615

often involves the balance between two competitive modiﬁca- sequences of the oligonucleotides were as follows: wild-type E2F, 5ЈCCGG Ј tions of histone H3 K9, methylation and acetylation (12, 15). GAATTCGCCGACGCGCTTGGCGGGAGATAGAAAAGT3 ; mutated E2F, 5ЈCCGGGAATTCGCCGACGCGCTTGTATGGAGATAGAAAAGT3Ј. This has led to the proposal that during the propagation of Ten microliters of streptavidin-agarose beads was then added for 1 h. Beads heterochromatin, HDACs function ﬁrst to deacetylate K9, were washed three times with washing buffer (50 mM Tris [pH 8], 0.4% NP-40,

thereby allowing its subsequent methylation by SUV39H1 (33). 150 mM NaCl, 5 mM MgCl2, supplemented with protease inhibitors). A similar mechanism has already been suggested for E2F- Bound proteins were subjected to an HMT assay as described previously (31) regulated promoters (24). However, little is known about the or to Western blotting with anti-Myc 9E10 (Roche Diagnostics), anti-p107 C-18, anti-p130 C20 (Santa Cruz Biotechnology), anti-Flag M2 (Sigma), or anti-hem- cell cycle regulation of histone H3 K9 modifications on E2F- agglutinin (HA) 16B12 (Babco) antibody. responsive promoters. Here we studied the DHFR promoter, Plasmids. pGEMT-DHFR and pGEMT-GAPDH were kind gifts from A. which is controlled by p107 or p130 and which has been the Harel-Bellan (9). pCMVNeoBam p107, pGEX-DP1 59-410, pGEX-E2F1 89- focus of a recent detailed study (9). 437, pCMVNeoBam Rb 379-928, pGEX p107 252-816, pGEX Rb 379-928, pCMVGT-E2F4, pCMV myc-E2F4, and empty vectors were described previ- We found that both p107 and p130 associate with SUV39H1, ously (8, 17, 18). pGEX-E2F4 and pGEX-E2F5 were kind gifts from C. Sardet. as does Rb. Furthermore, we demonstrate that SUV39H1 can pCMV myc-SUV39H1 and pCMV Flag-EMT1 were kind gifts from T. Jenuwein function as a transcriptional corepressor for p107 and p130. (27) and Y. Nakatani (25), respectively. pCMV HA-SUV39H1, pCMV HA- Studies of histone modifications on the DHFR promoter indi- SUV39H1 ⌬SET, pCMVlacZ, and Gal4-luc vectors were described previously cate that methylation of K9 can be detected in serum-starved (31). Details of constructions are available upon request. ChIP assays. ChIP assays were performed essentially as previously described 3T3 cells and decreases in cells at the G1/S transition. Con- (9). Briefly, following formaldehyde cross-linking in living cells, chromatin was versely, acetylation of histone H3 K9 increases from G0 to purified and subjected to sonication to obtain a mean length of DNA fragments

G1/S. Taken together, these data indicate that the temporal of about 500 base pairs. Sonicated chromatin was then divided into three samples ␮ regulation of the DHFR promoter involves a shift from the and immunoprecipitated with 10 l of anti-acetyl histone H3 (K9), anti-acetyl histone H3 (K14), or anti-dimethyl histone H3 (Lys9) antibody (all from Upstate methylated to the acetylated isoforms of histone H3 lysine 9. Biotechnology) or without antibody as a control. After cross-link reversion and DNA recovery, samples were analyzed by quantitative PCR (ICyclerQ; Bio-Rad) with Sybr green (Sigma) and Platinum Quantitative PCR Supermix-UDG (In- MATERIALS AND METHODS vitrogen) to detect DHFR promoter or glyceraldehyde-3-phosphate dehydroge- Cell culture and transfection. U2OS, NIH 3T3, and HeLa cells were main- nase (GAPDH) sequences as described previously (9). tained in Dulbecco’s modified Eagle’s medium supplemented with 10% fetal calf The amount of DHFR or GAPDH sequence present at each point was cal- serum (FCS), antibiotics, and 1% sodium pyruvate. 3T3 cells from Suv39H culated relative to a standard curve obtained using serial dilutions of pGEMT- knockout (KO) mice or controls were maintained as described above but in the DHFR or pGEMT-GAPDH vector, respectively. Three different dilutions of presence of 0.2% ␤-mercaptoethanol and 1% nonessential amino acids. Jurkat each sample (immunoprecipitates and inputs) were analyzed in parallel. After cells were maintained in RPMI medium supplemented with 10% FCS and calculating the mean value for these three dilutions, the efficiency of the immu- antibiotics. All media were from Gibco-BRL. noprecipitation was calculated by dividing the amount of sequence present in the U2OS cells were transfected at a density of 2 ϫ 106 cells/10-cm-diameter dish immunoprecipitates by the amount of input material. The background was then by calcium phosphate coprecipitation and were harvested 48 h later. HeLa cells subtracted to obtain the quantifications shown in Fig. 7. For each experiment, were transfected at a density of 4 ϫ 104 cells/2-cm-diameter dish using Fugene two independent real-time PCRs were performed. The amount of DHFR pro- (Roche Diagnostics) and were harvested 60 h later. The amount of cytomega- moter present in the Met K9 (from G0 cells), Ac K9, and Ac K14 (from G1/S lovirus (CMV) promoter in the transfections was kept constant by use of empty cells) immunoprecipitates was around 0.3, 8, and 0.1% of the input, respectively, vectors. Luciferase and ␤-galactosidase activities were measured using Promega whereas the amount of GAPDH sequence in the same immunoprecipitates was and Tropix kits, respectively. NIH 3T3 cells were synchronized by serum starva- about 2, 0.3, and 0.3% of the input, respectively. 6 tion for 48 h (G0) and reinduced or not with 20% FCS. For cell cycle analysis, 10 cells were harvested, washed in phosphate-buffered saline (PBS), and resus- RESULTS pended in 300 ␮l of cold PBS. Cells were fixed and permeabilized by the addition ␮ of 900 l of cold ethanol (95%). After centrifugation, cells were resuspended in Endogenous p107 and p130 associate with an HMT. Since 1 ml of PBS supplemented with RNase (100 ␮g/ml) and propidium iodide (10 ␮g/ml), incubated for 30 min at 37°C, and subsequently analyzed by fluorescence- Rb interacts with the HMT SUV39H1 (24, 31), we predicted activated cell sorting (Becton Dickinson). that the two related p107 and p130 proteins could also associ- Immunoprecipitations, pull-down experiments, Western blots, and HMT as- ate with the HMT SUV39H1. To test this hypothesis, we im- says. Glutathione S-transferase (GST) fusion proteins were expressed and pu- munoprecipitated endogenous p107 or p130 from Jurkat cell rified as described previously (23). Methylation reactions using recombinant nuclear extracts. Immunoprecipitates were then assayed for GST-SUV39H1 were performed as described by Rea et al. (27). 3 Immunoprecipitations and GST pull-down experiments were performed as HMT activity by adding S-adenosyl [ H]methyl methionine described previously (23). Briefly, transfected cells (10-cm-diameter dishes) were (SAM) as the methyl donor group and a peptide corresponding directly lysed in 500 ␮l of lysis buffer (50 mM Tris [pH 8], 300 mM NaCl, 0.4% to the first 24 amino acids of the histone H3, which is a good NP-40, 10 mM MgCl2, supplemented with protease inhibitors [Complete; Roche substrate for SUV39H1. We found that immunoprecipitation Diagnostics]). Lysates were then diluted with 500 ␮l of dilution buffer (50 mM of endogenous p107 and p130 led to the coimmunoprecipita- Tris [pH 8], 0.4% NP-40, supplemented with protease inhibitors, 5 mM CaCl2, and DNase I), precleared, and subjected to immunoprecipitation. Immunopre- tion of HMT activity specific for the histone H3 N-terminal tail cipitations of endogenous proteins were performed with 200 ␮l of Jurkat cell (Fig. 1A). This coimmunoprecipitation was specific, since no nuclear extracts diluted twice with IPH buffer (50 mM Tris [pH 8], 150 mM NaCl, activity was detected in control immunoprecipitates, indicating 0.5% NP-40, 5 mM EDTA, 5 mM CaCl2, DNase I, supplemented with protease that p107 and p130 are physically associated with an HMT. inhibitors [Complete; Roche Diagnostics]) or 50 ␮l of W8 or D5 nuclear extracts diluted 20 times in IPH buffer. For pull-down experiments using transfected cell To identify the specificity of the HMT coimmunoprecipi- extracts, 40 ␮l of transfected cell extracts were diluted 10 times in IPH buffer. In tated with p107 and p130, we used peptides derived from the the case of pull-down experiments using biotinylated oligonucleotides, trans- histone H3 N-terminal tail mutated either at lysine 4, lysine 9, ␮ fected cell extracts were precleared with 20 l of streptavidin-agarose beads or lysine 14 (Fig. 1B). Both K4- and K14-mutated peptides (Sigma) in the presence of 20 ␮g of herring sperm DNA (Roche Diagnostics). After centrifugation (20 min, 20,000 ϫ g,4°C), 1.5 ␮g of biotinylated double- (K4Mut and K14Mut, respectively) were methylated by the stranded oligonucleotides was added to the supernatant for 1 h. The sequence of p107- and p130-associated enzyme with an efficiency compa- the wild-type E2F oligonucleotide was derived from the b-Myb promoter. The rable to that of the wild-type peptide [wt (1-24)]. In contrast, 1616 NICOLAS ET AL. MOL.CELL.BIOL.

Ϫ Ϫ levels of HMT activity in Suv39H / cells, indicating that p107 interacts with an HMT other than SUV39H1, at least in these cells. However, a much lower HMT activity was found associ- Ϫ Ϫ ated with p130 in extracts from Suv39H / cells, although p130 expression was higher (Fig. 2C). This result indicates that a large part of the HMT activity that associates with p130 in normal cells is indeed due to the presence of SUV39H1 or SUV39H2 and is consistent with the possibility that SUV39H1 plays a major role in the regulation of the E2F-responsive promoters. EMT1 could associate with p107. Since p107 readily associates with a K9-specific methyl transferase other than SUV39H1 (see above), we investigated whether p107 could interact with the recently described EMT1 enzyme. Indeed, this methyl transferase is specific for K9 of histone H3 and has already been proposed to participate in the control of E2F- regulated genes through its interaction with E2F6 (25). We found that immunoprecipitation of exogenous p107 led to the coimmunoprecipitation of exogenous EMT1 from transfected cell extracts (Fig. 3, upper panel, lane 1). This coimmunoprecipitation was specific, since in the absence of exogenous p107, coimmunoprecipitation of EMT1 was not detected (lane 3), although it was expressed at high levels (lower panel, lane 3). This result indicates that p107 physically associates with EMT1 FIG. 1. p107 and p130 associate with a histone H3 K9-specific and that this enzyme is likely to be responsible for the p107- ␮ Ϫ Ϫ HMT. (A) Jurkat nuclear extracts (200 l) were immunoprecipitated associated HMT activity that is detected in SUV39H1 / cells. with the indicated antibody (anti-p107 C-18, anti-p130 C-20, or anti-HA Y-11 [Santa-Cruz Biotechnology]), and immunoprecipitates Taken together, our data indicate that multiple K9-specific were tested for HMT activity by the filter binding assay using a peptide HMTs can associate with proteins of the Rb family, highlight- derived from the first 24 amino acids of the histone H3 N-terminal tail. ing the functional importance of K9 methylation for the regu- (B) The same experiment as that shown in panel A, except that the lation of E2F-responsive promoters. immunoprecipitate was divided into four samples and subjected to an SUV39H1 could be targeted to E2F sites. Our attempts to HMT assay using the indicated peptide as substrate (K4Mut, K9Mut, and K14Mut contain the first 24 amino acids of the histone H3 N- directly detect binding of the K9-specific HMT SUV39H1 to terminal tail with K4, K9, or K14, respectively, replaced by alanine). the DHFR promoter by ChIP analysis have been unsuccessful so far, most likely because of the low efficiency of cross-linking or immunoprecipitation. We therefore investigated whether a the peptide mutated at K9 (K9Mut) was a very poor substrate, K9-specific HMT could be targeted to E2F binding sites thereby indicating that the HMT associated with p107 and through its interaction with pocket proteins. We transfected p130 specifically methylates lysine 9 of histone H3. U2OS cells with expression vectors for Myc-tagged SUV39H1, SUV39H1 could interact with p107 and p130. This strict p107, and Myc-tagged E2F4 and DP1, and we incubated trans- specificity is consistent with the possibility that the p107- and fected cell extracts with biotinylated oligonucleotides harbor- p130-associated HMT is SUV39H1. To test directly whether ing either a wild-type or mutated E2F site. Proteins bound to p107 has the ability to associate with SUV39H1, we performed these oligonucleotides were then collected by use of streptavi- coimmunoprecipitation experiments. We transiently expressed din beads and analyzed by Western blotting (Fig. 4). We found p107 and SUV39H1 tagged with a Myc epitope in U2OS cells. that in the presence of all four proteins, SUV39H1 was able to Immunoprecipitation of myc-SUV39H1 led to the strong co- bind to the wild-type oligonucleotide but not to the mutated immunoprecipitation of p107 (Fig. 2A). This coimmunopre- one (upper panel, compare lanes 1 and 2). This binding was cipitation was specific, since no p107 could be detected in Myc dependent on the presence of exogenous E2F4 (upper panel, immunoprecipitates in the absence of exogenous p107 or in the compare lanes 1 and 3). Unfortunately, we could not test absence of myc-SUV39H1. Similarly, we found that myc- whether it was also dependent on the presence of exogenous SUV39H1 could be specifically coimmunoprecipitated with p107, because in the absence of exogenous p107, binding of p130 (Fig. 2B). Taken together, these data indicate that p107 exogenous E2F4 to E2F sites was very weak (data not shown), and p130 interact with SUV39H1 in living cells and suggest probably reflecting a higher affinity of E2F4-p107 complexes that the p107- and p130-associated HMT is SUV39H1. than of free E2F4 for E2F sites. Taken together, these data To demonstrate this possibility further, we analyzed the suggest that the K9-specific HMT SUV39H1 can be recruited HMT activity associated with p107 and p130 in 3T3 cells de- to E2F sites through a physical interaction with the E2F4-p107 rived from the Suv39H KO mice (cells deficient for SUV39H1 repressor complex. and for the related protein Suv39H2) (Fig. 2C). Immunopre- SUV39H1 cooperates with p107 and p130 to repress tran- cipitation of p130 and p107 from control cell extracts led to the scription. To determine what could be the functional conse- coimmunoprecipitation of significant levels of HMT activity. quence of K9 methylation, we decided to investigate the effect Surprisingly, we found that p107 was still associated with high of SUV39H1 binding on p107 and p130 activity. We first VOL. 23, 2003 HISTONE MODIFICATIONS ON THE DHFR PROMOTER 1617

FIG. 3. p107 could interact with EMT1. Total cell extracts of U2OS cells transfected as indicated with expression vectors for p107 (10 ␮g) and/or Flag-EMT1 (30 ␮g) were immunoprecipitated using the anti- p107 antibody. Immunoprecipitates were then tested by Western blotting for the presence of Flag-EMT1 (using the anti-Flag M2 antibody [Sigma]). For the lower panels, 10 ␮l (1/100th of the immunoprecipitation volume) of total cell lysates was directly loaded and subjected to p107 (middle panel) and Flag (lower panel) Western blotting. The star indicates a band derived from the immunoglobulin heavy chain of the immunoprecipitating antibody.

mapped the p107 domain responsible for interacting with SUV39H1. We expressed in bacteria and purified a fusion protein of GST and the p107 pocket domain, which is sufficient for E2F interaction and transcriptional repression. Using GST pull-down experiments with transfected cell extracts expressing myc-SUV39H1, we found that the pocket domain of p107 (p107 365-937) is sufficient for myc-SUV39H1 binding (Fig. 5A). Moreover, a peptide derived from the SV40 T antigen and containing an LXCXE motif (a pocket protein-binding motif found in many proteins of viral or cellular origin) could FIG. 2. p107 and p130 physically interact with SUV39H1. (A) Total cell extracts of U2OS cells transfected with expression vectors for p107 specifically interfere with the interaction between p107 and (10 ␮g) and/or myc-SUV39H1 (20 ␮g) were immunoprecipitated using SUV39H1 (Fig. 5A). p107, therefore, interacts with SUV39H1 the anti-Myc antibody. Immunoprecipitates were then tested for the pres- through its LXCXE-binding domain. ence of p107 by Western blotting (upper panel). For the lower panels, 10 ␮ Since this domain is involved in transcriptional repression by l (1/100th of the immunoprecipitation volume) of total cell lysates was p107 (28), we tested whether SUV39H1 was involved in tran- directly loaded and subjected to p107 (middle panel) or Myc (lower panel) Western blotting. (B) Total cell extracts of U2OS cells trans- scriptional repression by p107 or p130. HeLa cells, which ex- fected with expression vectors for p130 (10 ␮g) and/or HA-SUV39H1 press low levels of endogenous SUV39H1 (1), were transiently (20 ␮g) were immunoprecipitated using the anti-p130 antibody (P) or transfected with a reporter construct containing Gal4 sites anirrelevantantibody(I).ImmunoprecipitateswerethentestedbyWest- upstream of the luciferase reporter gene, in the presence or ern blotting for the presence of HA-SUV39H1 (upper panel) and p130 (middle panel). For the lower panel, 10 ␮l (1/100th of the immunopre- absence of a fusion protein (Gal4-E2F4) comprising the het- cipitation volume) of total cell lysates was directly loaded and sub- erologous Gal4 DNA-binding domain and the activation do- jected to HA Western blotting. The star indicates a band derived from main of E2F4, a major target of p107 and p130. As expected, the immunoglobulin heavy chain of the immunoprecipitating antibody. Ϫ/Ϫ the presence of Gal4-E2F4 increased the promoter activity (C) Nuclear extracts from 3T3 cells derived from Suv39H mice (D5) or (Fig. 5B and C), whereas cotransfection of an expression vec- controls (W8) were subjected to an immunoprecipitation using either an anti-p107 or an anti-p130 antibody as indicated. Immunoprecipitates were tor for p107 (Fig. 5B) or p130 (Fig. 5C) repressed E2F4 activity then assayed for HMT activity using a peptide derived from the first 24 in a dose-dependent manner. In the absence of exogenous amino acids of the histone H3 N-terminal tail. After subtraction of the pocket protein, cotransfection of an expression vector for background activity found in control immunoprecipitates, HMT activ- SUV39H1 led to a small increase, if anything, in Gal4-E2F4 ity was calculated relative to 100% for immunoprecipitation from W8 cells. The mean of three independent experiments is shown. For the low- activity. However, in the presence of exogenous p107 (Fig. 5B) er panels, immunoprecipitates were subjected to p107 or p130 Western or p130 (Fig. 5C), coexpression of exogenous SUV39H1 led to blotting (as indicated). A representative Western blot is shown. the repression of E2F4 activity. Consequently, the efficiency of 1618 NICOLAS ET AL. MOL.CELL.BIOL.

whether the repressive effects of SUV39H1 could be due to methylation of another protein other than histones. Indeed, the effect of many histone acetyltransferases and HDACs on transcription relies in part on acetylation of sequence-speciﬁc

FIG. 4. SUV39H1 is targeted to E2F sites. Total cell extracts of U2OS cells transfected with 10 ␮g of the indicated expression vector and 10 ␮g of DP1 expression vector were subjected to a pull-down analysis using biotinylated oligonucleotides harboring either a wild- type E2F site (w) or a mutated E2F site (m). Bound proteins were then analyzed by Western blotting using an anti-Myc antibody or a p107 antibody, as indicated. For the lower panel, the expression levels of exogenous myc-E2F4 and myc-SUV39H1 or p107 were analyzed by Western blotting using the anti-Myc antibody or the anti-p107 antibody, respectively.

transcriptional repression by pocket proteins increased in the presence of SUV39H1. For example, transcriptional repression of Gal4-E2F4 activity using 5 ␮g of the p107 expression vector went from about 2-fold in the absence of exogenous SUV39H1 up to about 15-fold in the presence of exogenous FIG. 5. SUV39H1 functions as a corepressor for p107 and p130. ␮ SUV39H1 (Fig. 5B). This was unlikely to be due to any change (A) Total cell extracts of U2OS cells transfected with 20 gofthe myc-SUV39H1 expression vector were subjected to a GST pull-down in cotransfected protein expression, since Gal4-E2F4, p107, or analysis using beads harboring the indicated GST fusion protein. Prior p130 expression was driven from a CMV promoter that was to the pull-down assay, beads were preincubated with 10 ␮gofan unaffected by SUV39H1 (data not shown). Thus, this result LXCXE-containing peptide derived from the SV40 T antigen (SV40) indicates that SUV39H1 can act as a transcriptional corepres- or of an irrelevant peptide (Irr), as indicated. Bound proteins were then analyzed by Western blotting using the anti-Myc antibody. For sor of p107 and p130. In a similar assay, we found that a mutant lane 4, 10 ␮l of transfected cell extracts was directly loaded (Inp). of SUV39H1 with a deletion of the amino acids critical for its (B) HeLa cells were transiently transfected with 2 ␮g of the GAL4 enzymatic activity was not able to cooperate with p107 and luciferase reporter vector (which contains five GAL4 binding sites p130 to repress E2F4 activity (data not shown), suggesting that cloned upstream of a minimal promoter controlling luciferase expres- ␤ the HMT activity is required for SUV39H1 to work as a core- sion), 100 ng of pCMV- Gal as a transfection efficiency control, and the indicated amount of pCMVGT E2F4 (which expresses the E2F4 pressor for p107 and p130. activation domain fused to the GAL4 DNA binding domain), pCMV Recombinant proteins involved in E2F regulation are not SUV39H1, and pCMV p107. The amount of CMV promoter in the methylated in vitro by SUV39H1. Results from the above ex- transfection was kept constant using empty vectors. Sixty hours after periments were obtained with a transiently transfected re- transfection, cells were harvested and extracts were tested for luciferase and ␤-galactosidase activities. ␤-Galactosidase activity did not porter vector. Although it is well known that under such con- vary significantly within the experiment. (C) The same experiment is ditions histones are deposited on the vector, its chromatin shown as that in panel A, except that pCMV p130 was used instead of structure is not likely to be canonical. This led us to test pCMV p107. RLUs, relative light units. VOL. 23, 2003 HISTONE MODIFICATIONS ON THE DHFR PROMOTER 1619

HDAC1 is recruited to this promoter in G0, concomitantly with a global histone deacetylation. Thus, together with our data, this result suggests that the DHFR promoter could be regulated by a complex interplay between histone acetylation and histone H3 K9 methylation. To gain insight into the mechanism of this interplay, we studied the cell cycle regulation of K9 histone H3 methylation on the DHFR promoter by use of a ChIP assay. In parallel, we also investigated acetylation of histone H3 on K9 and on K14, two acetylation sites already known to affect K9 methylation (22, 27). We decided to couple ChIP with quantitative real-time PCR to precisely monitor histone modiﬁcation changes during the cell cycle (9). 3T3 cells were synchronized by serum starvation and reinduced or not reinduced by serum. Fluorescence-activated cell sorter analysis of a typical experiment conﬁrmed that upon serum addition, these cells reenter the cell cycle synchronously (Fig. 7A), reaching the beginning of S phase about 12 h after serum addition. Therefore, for subsequent experiments we com-

pared noninduced cells (referred to as G0 cells) to cells that were stimulated for 12 h with serum (referred to as G1/S cells). When compared to the GAPDH control, we found that acetylation on K9 and K14 speciﬁcally increased 4-fold and

2.5-fold, respectively, from G0 to G1/S on the DHFR promoter (Fig. 7B), consistent with the global increase of histone H4 acetylation observed under similar conditions (9). Interest- ingly, methylation on lysine 9 varied in an opposite way (Fig. FIG. 6. Recombinant SUV39H1 does not methylate various factors 7B). Thus, these data indicate that lysine 9 of histone H3 of E2F regulation in vitro. Four micrograms of core histones (corresponding to 1 ␮g of histone H3; lane 1) or 1 ␮g of the indicated GST evolves during the cell cycle from a methylated to an acetylated fusion protein (produced in Escherichia coli and purified on glutathi- state and suggest that this balance could be important for the one-agarose beads; lanes 2 to 8) was tested for methylation using temporal regulation of the DHFR promoter. bacterially produced recombinant GST-SUV39H1 in the presence of radiolabeled SAM. Reaction products were then analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (10% acrylamide DISCUSSION for GST fusion proteins and 15% acrylamide for histones) followed by fluorography (top panel). The bottom panel shows Coomassie staining In this manuscript, we demonstrate that p107 and p130, two of the GST fusion proteins and histones used as substrates in the Rb-related proteins, associate with an HMT which could be methylation reaction. Note the presence in most lanes of truncated the SUV39H1 enzyme. We found that on the DHFR pro- protein products, which most likely reflects premature termination and/or protein degradation during the production of GST fusion promoter, which is targeted by p107 and p130, K9 of histone H3 is teins in bacteria. methylated when these pocket proteins repress the promoter (Fig. 7). This result suggests that transcriptional repression by pocket proteins is mediated, at least in part, through K9 meth- transcription factors, such as E2F1 and Rb. To test this hy- ylation. Consistent with this hypothesis, SUV39H1 functions as pothesis, we investigated whether recombinant SUV39H1 a corepressor for all three pocket proteins (24, 31) (Fig. 5) could methylate factors involved in the control of E2F-respon- through a molecular mechanism involving its enzymatic do- sive genes. We tested bacterially produced recombinant E2F1, main. However, it must be noted that we do not have any proof E2F4, E2F5, DP1, Rb, and p107, and we found that none of that histone methylation is involved in the corepressor effects these proteins was significantly methylated by SUV39H1 in of SUV39H1. Such proof would require the use of point- vitro, whereas an equivalent amount of histones was very effi- mutated histones, which is not possible in mammalian cells. ciently methylated in a parallel experiment (Fig. 6). Although Our results (Fig. 5) were obtained using a transiently trans- we cannot rule out the possibility that these proteins are real fected reporter vector on which chromatin structure is likely to substrates of SUV39H1 in vivo or that SUV39H1 methylates be noncanonical (although Rb is already known to target his- other proteins such as general transcription factors, this result tone modifications on such templates [16]). This suggests that suggests that the repressive effects of SUV39H1 are due to transcriptional repression by SUV39H1 is due to methylation histone methylation. of a nonhistone protein. We tested several actors of E2F reg- The histone H3 K9 present on the DHFR promoter shifts ulation and none of them was found to be methylated in vitro from a methylated to an acetylated state during G1 progres- by recombinant SUV39H1 (Fig. 6). However, we cannot rule sion. To investigate histone methylation on an E2F-regulated out the possibility that these proteins are in vivo substrates of promoter, we studied the DHFR promoter, which is bound by SUV39H1 or that SUV39H1 methylates proteins from the E2F4 (a target of p107 and p130) and for which histone mod- transcription machinery. This is clearly a very interesting di- ifications and the recruitment of histone-modifying enzymes rection for future research. have already been studied (9). In particular, it was shown that Our results also suggest that the temporal regulation of the 1620 NICOLAS ET AL. MOL.CELL.BIOL.

FIG. 7. Specific variations in histone H3 modification on the DHFR promoter during G1 phase progression. (A) Cell cycle analysis of NIH 3T3 cells starved for serum for 48 h and then reinduced with serum for the indicated time. (B) Chromatin from NIH 3T3 cells in G0 or G1/S was immunoprecipitated using antibodies specific for histone H3 acetylated on K9 (K9 Ac), histone H3 acetylated on K14 (K14 Ac), or histone H3 methylated on K9 (K9 Met). The amount of the DHFR and GAPDH promoters present in immunoprecipitations from G0 (d0 or g0, respectively) or G1/S cells (d1 or g1, respectively) was calculated relative to the input (as described in Materials and Methods). The relative enrichment was obtained by the following formula: relative enrichment ϭ (dx/d0)/(gx/g0) (x is 0 or 1). The means of two (K9 Ac and K14 Ac) or three (K9 Met) entirely independent experiments are shown.

DHFR promoter involves a complex interplay between various Our results suggest that DHFR promoter transcriptional histone modiﬁcations. Transcriptional repression in G0 and G1 repression by p107 or p130 involves the concerted action of correlates with deacetylation of histones (9; this study) and HDACs and the K9-speciﬁc HMT SUV39H1. Interesting- methylation of histone H3 K9, whereas activation at the G1/S ly, many recent studies have indicated that HDACs and transition is associated with increased acetylation of histones SUV39H1 are functionally linked. First, silencing at pericen- and decreased histone H3 K9 methylation. tric loci in S. pombe requires the S. pombe orthologue of VOL. 23, 2003 HISTONE MODIFICATIONS ON THE DHFR PROMOTER 1621

SUV39H1, the Clr4 enzyme, and the HDACs Clr3 and Clr6 of methylated histones by neosynthesized histones. Whether (10). Second, recruitment of HP1 proteins to heterochromatic demethylation is targeted to E2F-regulated promoters and foci in mammalian cells is dependent on the SUV39H1 enzyme how it could be targeted are undoubtedly areas for an inter- and the activity of HDACs (14, 29). Finally, two recent studies esting future direction of research. have shown that SUV39H1 and HDAC1 physically interact in living cells and cooperate in the formation of pericentric het- ACKNOWLEDGMENTS erochromatin in Drosophila (7) and in the transcriptional re- We thank L. Vandel, L. Daury, and C. Monod for critical reading of pression of heterologous promoters in mammals (32). What the manuscript; C. Chailleux and O. Fayet for help with real-time could be the molecular basis for this cooperation? Our results PCR; R. Ferreira for help with the chromatin immunoprecipitation are entirely consistent with a model in which HDACs function experiments; and T. Jenuwein, C. Sardet, and Y. Nakatani for materials. to deacetylate K9 of histone H3 before its methylation by This work was supported by a grant from La Ligue Nationale Contre SUV39H1, since methylation and acetylation of this K9 are le Cancer to D.T., as an´ equipe labelliseé. E.N. is supported by a mutually exclusive. Indeed, K9 is a major acetylation site on studentship from the ARC (Association de Recherche contre le Can- the DHFR promoter, since up to 10% of the DHFR promoter cer). can be immunoprecipitated by the anti-AcK9 antibody using REFERENCES chromatin from G1/S cells (data not shown). 1. Aagaard, L., G. Laible, P. Selenko, M. Schmid, R. Dorn, G. Schotta, S. The balance between K9 acetylation and methylation that Kuhfittig, A. Wolf, A. Lebersorger, P. B. Singh, G. Reuter, and T. Jenuwein. we describe for the DHFR promoter is reminiscent of the 1999. Functional mammalian homologues of the Drosophila PEV-modifier Su(var)3-9 encode centromere-associated proteins which complex with the establishment of chromatin domains, for which an anticorre- heterochromatin component M31. EMBO J. 18:1923–1938. lation between K9 acetylation and methylation was shown. For 2. Bannister, A. J., P. Zegerman, J. F. Partridge, E. A. Miska, J. O. Thomas, example, K9 methylation was found associated with the silent R. C. Allshire, and T. Kouzarides. 2001. Selective recognition of methylated ␤ lysine 9 on histone H3 by the HP1 chromo domain. Nature 410:120–124. domains of the -globin locus in chicken, whereas adjacent 3. Brehm, A., E. A. Miska, D. J. McCance, J. L. Reid, A. J. Bannister, and T. active domains harbored a hyperacetylated histone H3 K9 Kouzarides. 1998. Retinoblastoma protein recruits histone deacetylase to repress transcription. Nature 391:597–601. (15). Our results suggest that the DHFR promoter is regulated 4. Chinenov, Y. 2002. A second catalytic domain in the Elp3 histone acetyl- during the cell cycle by similar antagonistic molecular marks. transferases: a candidate for histone demethylase activity? Trends Biochem. However, in this case, they would specify temporal instead of Sci. 27:115–117. 5. Chu, D. S., H. E. Dawes, J. D. Lieb, R. C. Chan, A. F. Kuo, and B. J. Meyer. spatial regulation. Strikingly, the establishment of facultative 2002. A molecular link between gene-specific and chromosome-wide tran- heterochromatin in mammals (X chromosome inactivation) is scriptional repression. Genes Dev. 16:796–805. also associated with a shift from hyperacetylation to hyper- 6. Clayton, A. L., S. Rose, M. J. Barratt, and L. C. Mahadevan. 2000. Phos- phoacetylation of histone H3 on c-fos- and c-jun-associated nucleosomes methylation of histone H3 lysine 9 (12). Thus, our data under- upon gene activation. EMBO J. 19:3714–3726. line once again the parallel that can be drawn between the 7. Czermin, B., G. Schotta, B. B. Hulsmann, A. Brehm, P. B. Becker, G. Reuter, and A. Imhof. 2001. Physical and functional association of SU(VAR)3-9 and molecular mechanisms of transcriptional repression of E2F- HDAC1 in Drosophila. EMBO Rep. 2:915–919. responsive promoters and of heterochromatin silencing. Inter- 8. Ferreira, R., L. Magnaghi-Jaulin, P. Robin, A. Harel-Bellan, and D. estingly, it has recently been proposed that transcriptional re- Trouche. 1998. The three members of the pocket proteins family share the ability to repress E2F activity through recruitment of a histone deacetylase. pression of a specific promoter in Candida elegans could also Proc. Natl. Acad. Sci. USA 95:10493–10498. be mediated by the machinery responsible for X chromosome 9. Ferreira, R., I. Naguibneva, M. Mathieu, S. Ait-Si-Ali, P. Robin, L. L. inactivation (5). Pritchard, and A. Harel-Bellan. 2001. Cell cycle-dependent recruitment of HDAC-1 correlates with deacetylation of histone H4 on an Rb-E2F target Our results also raise the question of histone demethylation. promoter. EMBO Rep. 2:794–799. Indeed, by using a ChIP assay we detected methylation of 10. Grewal, S. I. 2000. Transcriptional silencing in fission yeast. J. Cell Physiol. 184:311–318. histone H3 K9 in resting cells but not in cells that had been 11. Harbour, J. W., and D. C. Dean. 2000. Chromatin remodeling and Rb reinduced with serum for 12 h (Fig. 7). Most importantly, this activity. Curr. Opin. Cell Biol. 12:685–689. decrease was apparently concomitant with an increase in K9 12. Heard, E., C. Rougeulle, D. Arnaud, P. Avner, C. D. Allis, and D. L. Spector. 2001. Methylation of histone H3 at Lys-9 is an early mark on the X chro- acetylation. So far, we cannot rule out the possibility that these mosome during X inactivation. Cell 107:727–738. modifications occur on different histones on the DHFR pro- 13. Jenuwein, T. 2001. Re-SET-ting heterochromatin by histone methyltrans- moter and that the reactivity of the methylated K9-specific ferases. Trends Cell Biol. 11:266–273. 14. Lachner, M., D. O’Carrol, S. Rea, K. Mechtler, and T. Jenuwein. 2001. antibody is altered during the cell cycle for reason other than Methylation of histone H3 lysine 9 creates a binding site for HP1 proteins. an actual change in methylation. For example, some antibodies Nature 410:116–120. 15. Litt, M. D., M. Simpson, M. Gaszner, C. D. Allis, and G. Felsenfeld. 2001. against histone H3 phosphorylated on serine 10 do not recog- Correlation between histone lysine methylation and developmental changes nize the phosphorylated histone if phosphorylation is associ- at the chicken beta-globin locus. Science 293:2453–2455. ated with acetylation at K14 (6). Nevertheless, our results 16. Luo, R. X., A. A. Postigo, and D. C. Dean. 1998. Rb interacts with histone deacetylase to repress transcription. Cell 92:463–473. suggest the possibility of histone demethylation on the DHFR 17. Magnaghi-Jaulin, L., R. Groisman, I. Naguibneva, P. Robin, S. Lorain, J. P. promoter. This demethylation could be due to the activity of an Le Villain, F. Troalen, D. Trouche, and A. Harel-Bellan. 1998. Retinoblas- enzyme which removes the methyl group from nucleosomes. toma protein represses transcription by recruiting a histone deacetylase. Nature 391:601–605. Such an enzymatic activity has recently been proposed (4). 18. Martin, K., D. Trouche, C. Hagemeier, T. S. Sorensen, N. B. La Thangue, Most importantly, this putative enzymatic activity was found in and T. Kouzarides. 1995. Stimulation of E2F1/DP1 transcriptional activity by MDM2 oncoprotein. Nature 375:691–694. proteins harboring histone acetyltransferase activity, providing 19. Muller, H., and K. Helin. 2000. The E2F transcription factors: key regulators a potential molecular basis for the functional link between the of cell proliferation. Biochim. Biophys. Acta 1470:M1–M12. histone demethylation and acetylation that we detected on the 20. Mulligan, G., and T. Jacks. 1998. The retinoblastoma gene family: cousins with overlapping interests. Trends Genet. 14:223–229. DHFR promoter during G1 phase progression (Fig. 7). Alter- 21. Murray, K. 1964. The occurrence of e-N-methyl lysine in histones. Biochem- natively, demethylation could occur through the replacement istry 3:10–15. 1622 NICOLAS ET AL. MOL.CELL.BIOL.

22. Nakayama, J., J. C. Rice, B. D. Strahl, C. D. Allis, and S. I. Grewal. 2001. 28. Starostik, P., K. N. Chow, and D. C. Dean. 1996. Transcriptional repression Role of histone H3 lysine 9 methylation in epigenetic control of heterochro- and growth suppression by the p107 pocket protein. Mol. Cell. Biol. 16:3606– matin assembly. Science 292:110–113. 3614. 23. Nicolas, E., V. Morales, L. Magnaghi-Jaulin, A. Harel-Bellan, H. Richard- 29. Taddei, A., C. Maison, D. Roche, and G. Almouzni. 2001. Reversible disrup- Foy, and D. Trouche. 2000. RbAp48 belongs to the histone deacetylase tion of pericentric heterochromatin and centromere function by inhibiting complex that associates with the retinoblastoma protein. J. Biol. Chem. deacetylases. Nat. Cell. Biol. 3:114–120. 275:9797–9804. 30. Takahashi, Y., J. B. Rayman, and B. D. Dynlacht. 2000. Analysis of promoter 24. Nielsen, S. J., R. Schneider, U. M. Bauer, A. J. Bannister, A. Morrison, D. binding by the E2F and pRB families in vivo: distinct E2F proteins mediate O’Carroll, R. Firestein, M. Cleary, T. Jenuwein, R. E. Herrera, and T. activation and repression. Genes Dev. 14:804–816. Kouzarides. 2001. Rb targets histone H3 methylation and HP1 to promoters. 31. Vandel, L., E. Nicolas, O. Vaute, R. Ferreira, S. Ait-Si-Ali, and D. Trouche. Nature 412:561–565. 25. Ogawa, H., K. Ishiguro, S. Gaubatz, D. M. Livingston, and Y. Nakatani. 2001. Transcriptional repression by the retinoblastoma protein through 2002. A complex with chromatin modifiers that occupies E2F- and Myc- the recruitment of a histone methyltransferase. Mol. Cell. Biol. 21:6484– responsive genes in G0 cells. Science 296:1132–1136. 6494. 26. Planassilva, M. D., and R. A. Weinberg. 1997. The restriction point and 32. Vaute, O., E. Nicolas, L. Vandel, and D. Trouche. 2002. Functional and control of cell proliferation. Curr. Opin. Cell Biol. 9:768–772. physical interaction between the histone methyl transferase Suv39H1 and 27. Rea, S., F. Eisenhaber, D. O’Carroll, B. D. Strahl, Z. W. Sun, M. Schmid, S. histone deacetylases. Nucleic Acids Res. 30:475–481. Opravil, K. Mechtler, C. P. Ponting, C. D. Allis, and T. Jenuwein. 2000. 33. Zhang, Y., and D. Reinberg. 2001. Transcription regulation by histone meth- Regulation of chromatin structure by site-specific histone H3 methyltrans- ylation: interplay between different covalent modifications of the core his- ferases. Nature 406:593–599. tone tails. Genes Dev. 15:2343–2360.