DOCSLIB.ORG

Downloaded from Bioscientifica.Com at 10/02/2021 06:12:51AM Via Free Access

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Downloaded from Bioscientifica.Com at 10/02/2021 06:12:51AM Via Free Access 58:1 E M PRITCHETT and others Chicken pituitary transcriptome 58: 1 43–55 Research Open Access Transcriptomic changes throughout post-hatch development in Gallus gallus pituitary Correspondence 1 2 1 Elizabeth M Pritchett , Susan J Lamont and Carl J Schmidt should be addressed 1Animal and Food Science, University of Delaware, Newark, Delaware, USA to E M Pritchett 2Animal Science, Iowa State University, Ames, Iowa, USA Email [email protected] Abstract The pituitary gland is a neuroendocrine organ that works closely with the hypothalamus to affect multiple processes within the body including the stress response, metabolism, Key Words growth and immune function. Relative tissue expression (rEx) is a transcriptome analysis f chicken method that compares the genes expressed in a particular tissue to the genes expressed f pituitary in all other tissues with available data. Using rEx, the aim of this study was to identify f gene expression genes that are uniquely or more abundantly expressed in the pituitary when compared f development to all other collected chicken tissues. We applied rEx to define genes enriched in the chicken pituitaries at days 21, 22 and 42 post-hatch. rEx analysis identified 25 genes shared between all time points, 295 genes shared between days 21 and 22 and 407 genes unique to day 42. The 25 genes shared by all time points are involved in morphogenesis and general nervous tissue development. The 295 shared genes between days 21 and 22 are involved in neurogenesis and nervous system development and differentiation. Journal of Molecular Endocrinology The 407 unique day 42 genes are involved in pituitary development, endocrine system development and other hormonally related gene ontology terms. Overall, rEx analysis indicates a focus on nervous system/tissue development at days 21 and 22. By day 42, in addition to nervous tissue development, there is expression of genes involved in the endocrine system, possibly for maturation and preparation for reproduction. This study defines the transcriptome of the chicken pituitary gland and aids in understanding the Journal of Molecular expressed genes critical to its function and maturation. Endocrinology (2017) 58, 43–55 Introduction The avian pituitary gland is a neuroendocrine organ that (i.e. adrenocorticotropic hormone (ACTH)). The posterior works closely with the hypothalamus to regulate multiple pituitary gland, or the neurohypophysis, is composed processes within the body including the stress response, of nervous tissue and is connected to the hypothalamus reproduction, metabolism, growth and immune function. via the median eminence. Neurosecretory terminals The hypothalamus receives neuronal and endocrine within the posterior pituitary store and release arginine, signals from the brain and body and synthesizes releasing vasotocin (AVT) and mesotocin that are synthesized in hormones that are sent to the pituitary gland to either the supraoptic nucleus and paraventricular nucleus of inhibit or stimulate the production of several hormones the hypothalamus, respectively. Releasing hormones that will directly affect other tissues (i.e. growth hormone synthesized by the hypothalamus are transported to the (GH)) or stimulate the release of further protein products anterior pituitary gland through the hypophyseal blood http://jme.endocrinology-journals.org © 2017 The authors This work is licensed under a Creative Commons DOI: 10.1530/JME-16-0186 Published by Bioscientifica Ltd. Attribution 3.0 Unported License. Printed in Great Britain Downloaded from Bioscientifica.com at 10/02/2021 06:12:51AM via free access 10.1530/JME-16-0186 Research E M PRITCHETT and others Chicken pituitary transcriptome 58:1 44 portal system and regulate the production and release of Total RNA quantity was measured using a Qubit various endocrine hormones (ACTH, GH, LH, FSH and Fluorometer, and quality was assessed by fragment TSH). Relative tissue expression analysis (rEx) was used analysis. A total of 15 pituitary glands from day 21, 10 to compare the chicken pituitary gland transcriptome to from day 22 and 10 from day 42 were used for individual the transcriptome of all other tissues our laboratory has Rnaseq library preparation using the Illumina Stranded analyzed in the broiler chicken across three time points: RNAseq kit (San Diego, CA, USA). All 35 samples were days 21, 22 and 42 post-hatch. Previous work focusing on sequenced at the Delaware Biotechnology Institute (DBI) the morphometric changes of broiler chickens post-hatch Sequencing and Genotyping center using the Illumina identified two distinct growth periods: one from day of HiSeq 2500 sequencer. All libraries were sequenced to a hatch through day 14, and one from day 14 to day 42 or depth of 20–30 million reads per library. The reads were typical market age (Schmidt et al. 2009). The days discussed aligned to the Gallus gallus, ver 4 genome sequence, fall into the second growth phase. These days were also identified and counted using software packages Bowtie, chosen as part of a larger heat stress study conducted in Tophat and Cufflinks, and expression levels were reported our laboratory. The pituitary gland is a complex tissue in as fragments per kilobase of gene per million mapped reads that it contains many different cell types, and signals are (FPKM) values for further analysis (Trapnell et al. 2009, sent through neural endocrine, paracrine and autocrine Langmead & Salzberg 2012). Three biological replicates networks. The messages received by the pituitary gland for each day (day 21, 22 and 42) were used for cDNA lead to many changes within the tissue and results in synthesis using the SuperScript First-Strand Synthesis tissue plasticity. The results of this analysis identify the System for RT-PCR (Invitrogen). cDNA concentration expression levels of genes in the pituitary gland that are was determined using the Qubit Fluorometer and diluted either more abundant or are unique to this particular to 30 ng/µL for PCR. qRT-PCR was performed using Fast tissue at specific points in development. These data confer SYBR green master mix (Applied Biosystems) on the a better understanding of the genes and pathways that are Applied Biosystems 7500 Fast Real-Time PCR system critical to the function of the pituitary gland. for the following genes: glycoprotein alpha subunit (CGA), follicle-stimulating hormone beta (FSHB), growth hormone (GH), proopiomelanocortin (POMC), prolactin Materials and methods (PRL) and thyroid-stimulating hormone beta (TSHB). Each Animal housing and tissue collection qRT-PCR (Table 1) was performed in triplicate, and analysis was completed using the delta Ct method. All sequencing Journal of Molecular Endocrinology Male Ross 708 broiler chickens (Gallus gallus) were data generated in the current project have been uploaded obtained on the day of hatch from Mountaire Hatchery in the NCBI Gene Expression Omnibus application and (Millsboro, DE, USA) and placed in large-colony houses are accessible through GEO series, accession number on the University of Delaware farm (Newark, DE, USA). GSE89297. Husbandry and management followed all standards and procedures as approved by the Animal Care and Use Committee (AACUC #(27) 03-12-14R). Standard broiler Relative tissue expression analysis feed (corn-soy), which met all NRC requirements (National Research Council 1994), and water were supplied, and The gene expression of the pituitary gland was compared animals had ad libitum access throughout the trial. Birds to the expression of other tissues (abdominal fat pad, were humanely killed and the pituitaries were collected heart fat pad, breast muscle, cerebellum, heart, liver, on 21, 22 and 42 days post-hatch as part of a larger study. duodenum, jejunum, ileum, spleen, retina, pineal and Whole pituitaries were placed into liquid nitrogen and hypothalamus) analyzed by our laboratory following the stored at −80°C until further analysis. relative tissue expression (rEx) protocol outlined by Bailey and coworkers (Bailey et al. 2009). Each day the expression was analyzed independently, and maximum FPKM values RNA isolation, cDNA synthesis, Rnaseq library for each gene in the pituitary gland were compared to the preparation and qRT-PCR validation median FPKM value of each gene in all other collected tissues with the following calculation: Total RNA was extracted from whole pituitary glands (8–20 mg depending on age) from individual birds using Maximum FPKMfor each genein pituitary gland log (1) the Qiagen RNeasy Mini Kit (Germantown, MD, USA). 2 Median FPKMfor eachhgeneinall othercollected tissues http://jme.endocrinology-journals.org © 2017 Society for Endocrinology Published by Bioscientifica Ltd. DOI: 10.1530/JME-16-0186 Printed in Great Britain Downloaded from Bioscientifica.com at 10/02/2021 06:12:51AM via free access Research E M PRITCHETT and others Chicken pituitary transcriptome 58:1 45 Table 1 Primer sequences used for qRT-PCR transcriptome validation. Gene Forward primer Reverse primer CGA 5′ GCAACGTGCTGTGTAGCAAAG 3′ 5′ TGGTTCTCTATCTTCACATTGCCTT 3′ FSHB 5′ CGTACAGGGTAGAGCCAACGA 3′ 5′ GGCCCTCAAAAGGCTGAAC 3′ GH 5′ GCTTCAAGAAGGATCTGCACAA 3′ 5′ GCGCCGGCACTTCATC 3′ POMC 5′ GCTACGGCGGCTTCATGA 3′ 5′ CGATGACGTTTTTGAACAGA 3′ PRL 5′ TTGGGCGGGTTCATTCTG 3′ 5′ GGCCGTCCCAGTGAGAGTAA 3′ TSHB 5′ TGGCCATCAACACCACCAT 3′ 5′ CGTTGCTGTCCCGTGTCA 3′ Primer sequences used in qRT-PCR validation of transcriptomic data comparing expression levels between days 21, 22 and 42. Alpha subunit of glycoproteins (CGA), follicle-stimulating hormone,
Load more

Recommended publications
  • The Transcription Factor Pou3f1 Promotes Neural Fate Commitment
    RESEARCH ARTICLE elifesciences.org The transcription factor Pou3f1 promotes neural fate commitment via activation of neural lineage genes and inhibition of external signaling pathways Qingqing Zhu1,2†, Lu Song1†, Guangdun Peng1, Na Sun3, Jun Chen1, Ting Zhang1, Nengyin Sheng1, Wei Tang1, Cheng Qian1, Yunbo Qiao1, Ke Tang4, Jing-Dong Jackie Han3, Jinsong Li1, Naihe Jing1* 1State Key Laboratory of Cell Biology, Institute of Biochemistry and Cell Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai, China; 2Department of Neurosurgery, West China Hospital, Sichuan University, Sichuan, China; 3Key Laboratory of Computational Biology, CAS-MPG Partner Institute for Computational Biology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai, China; 4Institute of Life Science, Nanchang University, Nanchang, Jiangxi, China Abstract The neural fate commitment of pluripotent stem cells requires the repression of extrinsic inhibitory signals and the activation of intrinsic positive transcription factors. However, how these two events are integrated to ensure appropriate neural conversion remains unclear. In this study, we showed that Pou3f1 is essential for the neural differentiation of mouse embryonic stem cells (ESCs), specifically during the transition from epiblast stem cells (EpiSCs) to neural progenitor cells (NPCs). Chimeric analysis showed that Pou3f1 knockdown leads to a markedly decreased *For correspondence: njing@ incorporation of ESCs in the neuroectoderm. By contrast, Pou3f1-overexpressing ESC derivatives sibcb.ac.cn preferentially contribute to the neuroectoderm. Genome-wide ChIP-seq and RNA-seq analyses †These authors contributed indicated that Pou3f1 is an upstream activator of neural lineage genes, and also is a repressor of equally to this work BMP and Wnt signaling.
    [Show full text]
  • Disruption of the Neuronal PAS3 Gene in a Family Affected with Schizophrenia D Kamnasaran, W J Muir, M a Ferguson-Smith,Dwcox
    325 ORIGINAL ARTICLE J Med Genet: first published as 10.1136/jmg.40.5.325 on 1 May 2003. Downloaded from Disruption of the neuronal PAS3 gene in a family affected with schizophrenia D Kamnasaran, W J Muir, M A Ferguson-Smith,DWCox ............................................................................................................................. J Med Genet 2003;40:325–332 Schizophrenia and its subtypes are part of a complex brain disorder with multiple postulated aetiolo- gies. There is evidence that this common disease is genetically heterogeneous, with many loci involved. See end of article for In this report, we describe a mother and daughter affected with schizophrenia, who are carriers of a authors’ affiliations t(9;14)(q34;q13) chromosome. By mapping on flow sorted aberrant chromosomes isolated from lym- ....................... phoblast cell lines, both subjects were found to have a translocation breakpoint junction between the Correspondence to: markers D14S730 and D14S70, a 683 kb interval on chromosome 14q13. This interval was found to Dr D W Cox, 8-39 Medical contain the neuronal PAS3 gene (NPAS3), by annotating the genomic sequence for ESTs and perform- Sciences Building, ing RACE and cDNA library screenings. The NPAS3 gene was characterised with respect to the University of Alberta, genomic structure, human expression profile, and protein cellular localisation to gain insight into gene Edmonton, Alberta T6G function. The translocation breakpoint junction lies within the third intron of NPAS3, resulting in the dis- 2H7, Canada; [email protected] ruption of the coding potential. The fact that the bHLH and PAS domains are disrupted from the remain- ing parts of the encoded protein suggests that the DNA binding and dimerisation functions of this Revised version received protein are destroyed.
    [Show full text]
  • Hes5 Regulates the Transition Timing of Neurogenesis and Gliogenesis In
    © 2017. Published by The Company of Biologists Ltd | Development (2017) 144, 3156-3167 doi:10.1242/dev.147256 RESEARCH ARTICLE Hes5 regulates the transition timing of neurogenesis and gliogenesis in mammalian neocortical development Shama Bansod1,2, Ryoichiro Kageyama1,2,3,4 and Toshiyuki Ohtsuka1,2,3,* ABSTRACT has been reported that the high mobility group AT-hook (Hgma) During mammalian neocortical development, neural stem/progenitor genes regulate gene expression by modulating chromatin structure cells (NSCs) sequentially give rise to deep layer neurons and (Ozturk et al., 2014), maintain neurogenic NSCs, and inhibit superficial layer neurons through mid- to late-embryonic stages, gliogenesis during early- to mid-embryonic stages through global shifting to gliogenic phase at perinatal stages. Previously, we found opening of the chromatin state (Kishi et al., 2012). However, the that the Hes genes inhibit neuronal differentiation and maintain mechanism by which the expression of these epigenetic factors is NSCs. Here, we generated transgenic mice that overexpress Hes5 in controlled remains to be analyzed. NSCs of the central nervous system, and found that the transition Here, we found that Hes5, a transcriptional repressor acting timing from deep to superficial layer neurogenesis was shifted earlier, as an effector of Notch signaling, regulates the timing of while gliogenesis precociously occurred in the developing neocortex neurogenesis and gliogenesis via alteration in the expression of Hes5-overexpressing mice. By contrast, the transition from deep to levels of epigenetic factors. Notch signaling contributes to the superficial layer neurogenesis and the onset of gliogenesis were elaboration of cellular diversity during the development of various delayed in Hes5 knockout (KO) mice.
    [Show full text]
  • Transcription Factor P73 Regulates Th1 Differentiation
    ARTICLE https://doi.org/10.1038/s41467-020-15172-5 OPEN Transcription factor p73 regulates Th1 differentiation Min Ren1, Majid Kazemian 1,4, Ming Zheng2, JianPing He3, Peng Li1, Jangsuk Oh1, Wei Liao1, Jessica Li1, ✉ Jonathan Rajaseelan1, Brian L. Kelsall 3, Gary Peltz 2 & Warren J. Leonard1 Inter-individual differences in T helper (Th) cell responses affect susceptibility to infectious, allergic and autoimmune diseases. To identify factors contributing to these response differ- 1234567890():,; ences, here we analyze in vitro differentiated Th1 cells from 16 inbred mouse strains. Haplotype-based computational genetic analysis indicates that the p53 family protein, p73, affects Th1 differentiation. In cells differentiated under Th1 conditions in vitro, p73 negatively regulates IFNγ production. p73 binds within, or upstream of, and modulates the expression of Th1 differentiation-related genes such as Ifng and Il12rb2. Furthermore, in mouse experimental autoimmune encephalitis, p73-deficient mice have increased IFNγ production and less dis- ease severity, whereas in an adoptive transfer model of inflammatory bowel disease, transfer of p73-deficient naïve CD4+ T cells increases Th1 responses and augments disease severity. Our results thus identify p73 as a negative regulator of the Th1 immune response, suggesting that p73 dysregulation may contribute to susceptibility to autoimmune disease. 1 Laboratory of Molecular Immunology and the Immunology Center, National Heart, Lung, and Blood Institute, Bethesda, MD 20892-1674, USA. 2 Department of Anesthesia, Stanford University School of Medicine, Stanford, CA 94305, USA. 3 Laboratory of Molecular Immunology, National Institute of Allergy and Infectious Diseases, Bethesda, MD 20892, USA. 4Present address: Department of Biochemistry and Computer Science, Purdue University, West ✉ Lafayette, IN 37906, USA.
    [Show full text]
  • Prospective Isolation of NKX2-1–Expressing Human Lung Progenitors Derived from Pluripotent Stem Cells
    The Journal of Clinical Investigation RESEARCH ARTICLE Prospective isolation of NKX2-1–expressing human lung progenitors derived from pluripotent stem cells Finn Hawkins,1,2 Philipp Kramer,3 Anjali Jacob,1,2 Ian Driver,4 Dylan C. Thomas,1 Katherine B. McCauley,1,2 Nicholas Skvir,1 Ana M. Crane,3 Anita A. Kurmann,1,5 Anthony N. Hollenberg,5 Sinead Nguyen,1 Brandon G. Wong,6 Ahmad S. Khalil,6,7 Sarah X.L. Huang,3,8 Susan Guttentag,9 Jason R. Rock,4 John M. Shannon,10 Brian R. Davis,3 and Darrell N. Kotton1,2 2 1Center for Regenerative Medicine, and The Pulmonary Center and Department of Medicine, Boston University School of Medicine, Boston, Massachusetts, USA. 3Center for Stem Cell and Regenerative Medicine, Brown Foundation Institute of Molecular Medicine, University of Texas Health Science Center, Houston, Texas, USA. 4Department of Anatomy, UCSF, San Francisco, California, USA. 5Division of Endocrinology, Diabetes and Metabolism, Beth Israel Deaconess Medical Center and Harvard Medical School, Boston, Massachusetts, USA. 6Department of Biomedical Engineering and Biological Design Center, Boston University, Boston, Massachusetts, USA. 7Wyss Institute for Biologically Inspired Engineering, Harvard University, Boston, Massachusetts, USA. 8Columbia Center for Translational Immunology & Columbia Center for Human Development, Columbia University Medical Center, New York, New York, USA. 9Department of Pediatrics, Monroe Carell Jr. Children’s Hospital, Vanderbilt University, Nashville, Tennessee, USA. 10Division of Pulmonary Biology, Cincinnati Children’s Hospital, Cincinnati, Ohio, USA. It has been postulated that during human fetal development, all cells of the lung epithelium derive from embryonic, endodermal, NK2 homeobox 1–expressing (NKX2-1+) precursor cells.
    [Show full text]
  • The Title of the Dissertation
    UNIVERSITY OF CALIFORNIA SAN DIEGO Novel network-based integrated analyses of multi-omics data reveal new insights into CD8+ T cell differentiation and mouse embryogenesis A dissertation submitted in partial satisfaction of the requirements for the degree Doctor of Philosophy in Bioinformatics and Systems Biology by Kai Zhang Committee in charge: Professor Wei Wang, Chair Professor Pavel Arkadjevich Pevzner, Co-Chair Professor Vineet Bafna Professor Cornelis Murre Professor Bing Ren 2018 Copyright Kai Zhang, 2018 All rights reserved. The dissertation of Kai Zhang is approved, and it is accept- able in quality and form for publication on microfilm and electronically: Co-Chair Chair University of California San Diego 2018 iii EPIGRAPH The only true wisdom is in knowing you know nothing. —Socrates iv TABLE OF CONTENTS Signature Page ....................................... iii Epigraph ........................................... iv Table of Contents ...................................... v List of Figures ........................................ viii List of Tables ........................................ ix Acknowledgements ..................................... x Vita ............................................. xi Abstract of the Dissertation ................................. xii Chapter 1 General introduction ............................ 1 1.1 The applications of graph theory in bioinformatics ......... 1 1.2 Leveraging graphs to conduct integrated analyses .......... 4 1.3 References .............................. 6 Chapter 2 Systematic
    [Show full text]
  • Integrated and Functional Genomic Approaches to Elucidate Differential Genetic Dependencies in Melanoma
    Integrated and Functional Genomic Approaches to Elucidate Differential Genetic Dependencies in Melanoma The Harvard community has made this article openly available. Please share how this access benefits you. Your story matters Citation Wong, Terence. 2018. Integrated and Functional Genomic Approaches to Elucidate Differential Genetic Dependencies in Melanoma. Doctoral dissertation, Harvard University, Graduate School of Arts & Sciences. Citable link http://nrs.harvard.edu/urn-3:HUL.InstRepos:42014990 Terms of Use This article was downloaded from Harvard University’s DASH repository, and is made available under the terms and conditions applicable to Other Posted Material, as set forth at http:// nrs.harvard.edu/urn-3:HUL.InstRepos:dash.current.terms-of- use#LAA Integrated and Functional Genomic Approaches to Elucidate Differential Genetic Dependencies in Melanoma A dissertation presented by Terence Cheng Wong to The Division of Medical Sciences in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the subject of Biological and Biomedical Sciences Harvard University Cambridge, Massachusetts November 2017 © 2017 Terence Cheng Wong All rights reserved. Dissertation Advisor: Levi Garraway Terence Cheng Wong Integrated and Functional Genomic Approaches to Elucidate Differential Genetic Dependencies in Melanoma ABSTRACT Genomic characterization of human cancers over the past decade has generated comprehensive catalogues of genetic alterations in cancer genomes. Many of these genetic events result in molecular or cellular changes that drive cancer cell phenotypes. In melanoma, a majority of tumors harbor mutations in the BRAF gene, leading to activation of the MAPK pathway and tumor initiation. The development and use of drugs that target the mutant BRAF protein and the MAPK pathway have produced significant clinical benefit in melanoma patients.
    [Show full text]
  • Single-Cell Sequencing of Human Ipsc-Derived Cerebellar Organoids Shows Recapitulation of Cerebellar Development
    bioRxiv preprint doi: https://doi.org/10.1101/2020.07.01.182196; this version posted July 1, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Single-cell sequencing of human iPSC-derived cerebellar organoids shows recapitulation of cerebellar development Samuel Nayler1*, Devika Agarwal3, Fabiola Curion2, Rory Bowden2,4, Esther B.E. Becker1,5* 1Department of Physiology, Anatomy and Genetics; University of Oxford; Oxford, OX1 3PT; United Kingdom 2Wellcome Centre for Human Genetics; University of Oxford; Oxford, OX3 7BN; United Kingdom 3Weatherall Institute for Molecular Medicine; University of Oxford; Oxford, OX3 7BN; United Kingdom 4Present address: Walter and Eliza Hall Institute of Medical Research, Parkville Victoria 3052; Australia 5Lead contact *Correspondence: [email protected], [email protected] Running title: hiPSC-derived cerebellar organoids 1 bioRxiv preprint doi: https://doi.org/10.1101/2020.07.01.182196; this version posted July 1, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. ABSTRACT Current protocols for producing cerebellar neurons from human pluripotent stem cells (hPSCs) are reliant on animal co-culture and mostly exist as monolayers, which have limited capability to recapitulate the complex arrangement of the brain. We developed a method to differentiate hPSCs into cerebellar organoids that display hallmarks of in vivo cerebellar development. Single- cell profiling followed by comparison to an atlas of the developing murine cerebellum revealed transcriptionally-discrete populations encompassing all major cerebellar cell types.
    [Show full text]
  • Regulation of Sex Determination in Mice by a Non-Coding Genomic Region
    HIGHLIGHTED ARTICLE GENETICS OF SEX Regulation of Sex Determination in Mice by a Non-coding Genomic Region Valerie A. Arboleda,* Alice Fleming,* Hayk Barseghyan,* Emmanuèle Délot,*,† Janet S. Sinsheimer,*,‡ and Eric Vilain*,†,§,1 *Department of Human Genetics, †Department of Pediatrics, ‡Department of Biomathematics, and §Department of Urology, David Geffen School of Medicine, University of California, Los Angeles, California 90095-7088 ABSTRACT To identify novel genomic regions that regulate sex determination, we utilized the powerful C57BL/6J-YPOS (B6-YPOS) model of XY sex reversal where mice with autosomes from the B6 strain and a Y chromosome from a wild-derived strain, Mus domesticus poschiavinus (YPOS), show complete sex reversal. In B6-YPOS, the presence of a 55-Mb congenic region on chromosome 11 protects from sex reversal in a dose-dependent manner. Using mouse genetic backcross designs and high-density SNP arrays, we narrowed the congenic region to a 1.62-Mb genomic region on chromosome 11 that confers 80% protection from B6-YPOS sex reversal when one copy is present and complete protection when two copies are present. It was previously believed that the protective congenic region originated from the 129S1/SviMJ (129) strain. However, genomic analysis revealed that this region is not derived from 129 and most likely is derived from the semi-inbred strain POSA. We show that the small 1.62-Mb congenic region that protects against B6-YPOS sex reversal is located within the Sox9 promoter and promotes the expression of Sox9, thereby driving testis de- velopment within the B6-YPOS background. Through 30 years of backcrossing, this congenic region was maintained, as it promoted male sex determination and fertility despite the female-promoting B6-YPOS genetic background.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Supplemental Materials ZNF281 Enhances Cardiac Reprogramming
    Supplemental Materials ZNF281 enhances cardiac reprogramming by modulating cardiac and inflammatory gene expression Huanyu Zhou, Maria Gabriela Morales, Hisayuki Hashimoto, Matthew E. Dickson, Kunhua Song, Wenduo Ye, Min S. Kim, Hanspeter Niederstrasser, Zhaoning Wang, Beibei Chen, Bruce A. Posner, Rhonda Bassel-Duby and Eric N. Olson Supplemental Table 1; related to Figure 1. Supplemental Table 2; related to Figure 1. Supplemental Table 3; related to the “quantitative mRNA measurement” in Materials and Methods section. Supplemental Table 4; related to the “ChIP-seq, gene ontology and pathway analysis” and “RNA-seq” and gene ontology analysis” in Materials and Methods section. Supplemental Figure S1; related to Figure 1. Supplemental Figure S2; related to Figure 2. Supplemental Figure S3; related to Figure 3. Supplemental Figure S4; related to Figure 4. Supplemental Figure S5; related to Figure 6. Supplemental Table S1. Genes included in human retroviral ORF cDNA library. Gene Gene Gene Gene Gene Gene Gene Gene Symbol Symbol Symbol Symbol Symbol Symbol Symbol Symbol AATF BMP8A CEBPE CTNNB1 ESR2 GDF3 HOXA5 IL17D ADIPOQ BRPF1 CEBPG CUX1 ESRRA GDF6 HOXA6 IL17F ADNP BRPF3 CERS1 CX3CL1 ETS1 GIN1 HOXA7 IL18 AEBP1 BUD31 CERS2 CXCL10 ETS2 GLIS3 HOXB1 IL19 AFF4 C17ORF77 CERS4 CXCL11 ETV3 GMEB1 HOXB13 IL1A AHR C1QTNF4 CFL2 CXCL12 ETV7 GPBP1 HOXB5 IL1B AIMP1 C21ORF66 CHIA CXCL13 FAM3B GPER HOXB6 IL1F3 ALS2CR8 CBFA2T2 CIR1 CXCL14 FAM3D GPI HOXB7 IL1F5 ALX1 CBFA2T3 CITED1 CXCL16 FASLG GREM1 HOXB9 IL1F6 ARGFX CBFB CITED2 CXCL3 FBLN1 GREM2 HOXC4 IL1F7
    [Show full text]
  • Olig1 and Sox10 Interact Synergistically to Drivemyelin Basic
    The Journal of Neuroscience, December 26, 2007 • 27(52):14375–14382 • 14375 Cellular/Molecular Olig1 and Sox10 Interact Synergistically to Drive Myelin Basic Protein Transcription in Oligodendrocytes Huiliang Li,1 Yan Lu,2 Hazel K. Smith,1 and William D. Richardson1 1Wolfson Institute for Biomedical Research and Department of Biology, University College London, London WC1E 6BT, United Kingdom, and 2Medical Research Council, Clinical Sciences Centre, Imperial College London, London W12 0NN, United Kingdom The oligodendrocyte lineage genes (Olig1/2), encoding basic helix-loop-helix transcription factors, were first identified in screens for master regulators of oligodendrocyte development. OLIG1 is important for differentiation of oligodendrocyte precursors into myelin- forming oligodendrocytes during development and is thought to play a crucial role in remyelination during multiple sclerosis. However, itisstillunclearhowOLIG1interactswithitstranscriptionalcofactorsandDNAtargets.OLIG1wasreportedlyrestrictedtomammals,but we demonstrate here that zebrafish and other teleosts also possess an OLIG1 homolog. In zebrafish, as in mammals, Olig1 is expressed in the oligodendrocyte lineage. Olig1 associates physically with another myelin-associated transcription factor, Sox10, and the Olig1/Sox10 complex activates mbp (myelin basic protein) transcription via conserved DNA sequence motifs in the mbp promoter region. In contrast, Olig2 does not bind to Sox10 in zebrafish, although both OLIG1 and OLIG2 bind SOX10 in mouse. Key words: Olig1; Olig2; Sox10; Mbp; oligodendrocyte; myelin; zebrafish; mouse; evolution; development Introduction directly regulates Mbp transcription (Stolt et al., 2002), and over- Myelin, the multilayered glial sheath around axons, is one of the expression of SOX10 alone is sufficient to induce myelin gene defining features of jawed vertebrates (gnathostomes). It is expression in embryonic chick spinal cord (Liu et al., 2007).
    [Show full text]