Y-Chromosomal Analysis Identifies the Skeletal Remains of Swiss National

Forensic Science International: Genetics 7 (2013) 610–617

Contents lists available at ScienceDirect

Forensic Science International: Genetics

jou rnal homepage: www.elsevier.com/locate/fsig

Y-chromosomal analysis identiﬁes the skeletal remains of Swiss

national hero Jo¨rg Jenatsch (1596–1639)

a, b b c

Cordula Haas *, Natallia Shved , Frank Jakobus Ru¨ hli , Christina Papageorgopoulou ,

d d d d e

Josephine Purps , Maria Geppert , Sascha Willuweit , Lutz Roewer , Michael Krawczak

Institute of Legal Medicine, University of Zurich, Switzerland

Centre for Evolutionary Medicine, Institute of Anatomy, University of Zurich, Switzerland

Laboratory of Anthropology, Department of History and Ethnology, Demokritus University of Thrace, Greece

Department of Forensic Genetics, Institute of Legal Medicine and Forensic Sciences, Charite´-Universita¨tsmedizin, Berlin, Germany

Institute of Medical Informatics and Statistics, Christian-Albrechts University of Kiel, Germany

A R T I C L E I N F O A B S T R A C T

Article history: Jo¨rg Jenatsch was a Swiss defender of independence and a ﬁghter for liberty in the 17th century. With the

Received 15 March 2013

help of three living male members of the Jenatsch family, we successfully identiﬁed a skeleton exhumed

Received in revised form 13 August 2013

from Chur cathedral as the remains of Jo¨rg Jenatsch. Our conclusion was based upon complete Y-STR and

Accepted 14 August 2013

Y-SNP proﬁles that could be generated by replicate analyses of a bone sample available to us. The

skeleton and the three living family members carried the same Y-SNP haplogroup, but were discordant at

Keywords:

three of 23 Y-STR loci. This notwithstanding, conservative biostatistical evaluation of the data suggests

Ancient DNA

that the Chur skeleton is at least 20 times more likely than not to be Jo¨rg Jenatsch.

Y-STR

Identiﬁcation

1. Introduction Italy to the southern Netherlands in the early 17th Century, they

had to pass the Valtellina. Consequently, the Spanish, French and

1.1. History (adapted from a review [1] of the Jenatsch biography by R. Venetians all tried to gain a foothold in the Valtellina, and in

C. Head [2]) Graubu¨ nden as a whole, through patronage, military intervention

and downright bribery. Jenatsch, who as a young man became a

Jo¨rg (or Georg) Jenatsch (Fig. 1) was an important political Calvinist minister, emerged as one of the leaders of the mostly

ﬁgure in Graubu¨ nden (or Grisons, the largest and easternmost Protestant faction allied with Venice. Despite being a man of the

canton of present-day Switzerland) during the Thirty Years’ War cloth, he showed little reluctance to participate in acts of violence,

(1618–1648). At the time, the small federation of the ‘‘Three including assassination and brutal murder. Among his victims

Leagues’’ (German: ‘‘Freistaat der drei Bu¨ nde’’) had become were members of the inﬂuential ‘‘von Planta’’ family, local nobles

strategically important and therefore a focus of wide political who were closely allied with Spain. Keen on taking revenge, they

interests. Wedged between the Swiss Confederation, Habsburg forced Jenatsch into temporary exile. The former clergyman now

Tyrol, Venice and Spanish Milan, the self-governing rural had to live in Venice for some years and, in the end, became a

communities of Graubu¨ nden controlled the important Valtellina professional soldier and military entrepreneur. This position

valley. Whenever Spain wanted to send soldiers from northern turned out an important stepping stone for social advancement,

and Jenatsch tried to persuade Ferdinand II, Emperor of the Holy

Roman Empire, to grant him a title of nobility and a ﬁef in the

1630s. He was about to achieve this goal when he was assassinated

* Corresponding author at: Institute of Legal Medicine, Forensic Genetics,

in a tavern in Chur, in 1639. By the time of his death, Jenatsch had

University of Zu¨ rich, Winterthurerstrasse 190, 8057 Zu¨ rich, Switzerland.

undergone a profound change of identity, both religiously and

Tel.: +41 44 635 56 56; fax: +41 44 635 68 58.

E-mail address: [email protected] (C. Haas). politically, by converting to Catholicism. He had also put an end to

C. Haas et al. / Forensic Science International: Genetics 7 (2013) 610–617 611

1.3. Re-exhumation of the skeleton in 2012

Based upon the rediscovered Hug documents, the exact place of

the Jenatsch grave could be localized inside Chur cathedral. The

documents also contained a blood-soaked piece of fabric,

purportedly Jenatsch’s clothing, which ignited the idea of a kinship

analysis. The fabric was analyzed at the University of Zurich

(Institutes of Anatomy and Legal Medicine) and three male

members of the Jenatsch family were traced. The Jenatsch family

tree was reconstructed (Fig. 3) by historian and genealogist Paul

Eugen Grimm. Unfortunately, no Y-STR proﬁle could be generated

from the blood stain, and the only way out of this deadlock was to

collect new sample material. The bishop of Chur gave permission

to exhume the skeleton again, which was done in March 2012.

The goal of the present study was to clarify whether the three

male family members and the skeleton shared identical Y-

chromosomal markers. This would argue strongly in favor of the

skeleton belonging to the Jenatsch family and therefore, because

no other male relative has ever been connected to the ﬁnd, of being

Jo¨rg Jenatsch himself.

2. Materials and methods

2.1. DNA extraction

Three male descendants of a common ancestor shared with Jo¨rg

(named Anton Jenatsch) gave permission for genetic analysis

aimed at conﬁrming the authenticity of the skeletal remains. DNA

was extracted from buccal swabs of both, the descendants and the

excavator, using the QIAamp DNA Mini Kit (Qiagen).

Initially, an attempt was made to extract DNA from the

bloodstains on the piece of clothing belonging to Jo¨rg Jenatsch. An

expert report from the Institute of Legal Medicine in Berne from

Fig. 1. Presumed contemporary portrait of Jo¨rg Jenatsch (1596–1639). The original

of this painting is thought to have disappeared after it had been returned from the 1959 attested that these spots were most probably blood [6], but at

Raetian Museum Chur to the owner family in 1935. The same year, the then director present no additional blood tests were performed. Samples were

of the Raetian Museum commissioned a copy (Inv. Nr. I. 15; shown here) by painter

taken from at least two different locations using cotton swabs, and

Paul Martig (with kind permission of the Raetian Museum Chur).

DNA was isolated with the QIAamp DNA Mini Kit. The extraction

was performed twice following a DNA puriﬁcation protocol for

dried blood spots provided by the manufacturer, except for an

his close collaboration with France and had sought patronage and increase of the volume of all buffers used before the washing steps,

protection in Innsbruck and Vienna. In the 19th Century, Jenatsch and of the incubation times.

became a sort of local and national (Swiss) hero, particularly after From the historic skeleton, material from a bone (femur,

the famous novel Ju¨rg Jenatsch by Swiss author Conrad Ferdinand diaphysis compacta) and a tooth (ﬁrst right molar, M1/46, lower

Meyer (1825–1898) had been published in 1876 [3]. In 1987, a jaw) was subjected to DNA analysis. These samples were taken

French-Swiss ﬁlm adaptation (Jenatsch) by Daniel Schmid revived during the exhumation by two experienced researchers, with all

the story [4]. necessary precautions. After UV radiation to decontaminate the

surface, the samples were pulverized with a cryogenic mill (6770

1.2. Exhumation of the skeleton in 1959 Freezer/Mill , SPEX SamplePrep). Two DNA extractions (bone B1,

B2, B3 and tooth T1 powder) were performed at a dedicated

According to contemporary reports, Jenatsch was buried in ancient DNA laboratory (Center for Evolutionary Medicine,

the cathedral of Chur [5]. Due to subsequent renovation works Institute of Anatomy, University of Zurich) with adequate

and several rearrangements of the tomb slabs in the cathedral, precautions and negative controls. A third DNA extraction (bone

however, the exact place of the tomb became unknown. The B4 and tooth T2 powder) was performed at a forensic laboratory

presumed Jenatsch grave was found in 1959 by Swiss anthro- (Institute of Legal Medicine, University of Zurich), also taking

pologist Erik Hug who identiﬁed the skeleton as Jo¨ rg Jenatsch on appropriate care. To ensure the highest possible reliability, some of

the basis of its clothing and of injuries to the head (Fig. 2). The the most general and widely accepted guidelines for aDNA work

skeleton was reburied in 1961, though without clothing and were followed [7,8]. These included, for example, the use of

ornaments. Hug regularly reported his ﬁndings in public lectures negative controls and the analysis of multiple extracts per sample.

but he never got round to publishing a scientiﬁc paper about this As was to be expected, an inverse correlation was observed

case. With Hug’s death in 1991, all documents of his Jenatsch between the amplification efficiency and the size of an amplifica-

research disappeared. A long adventurous quest was initiated by tion product, reﬂecting the degradation and damage of the ancient

Manuel Janosa of the Grisons Archeological Service and involved, DNA template. DNA was extracted either with phenol-chloroform

among others, Hug’s lawyer, an anthropologist friend of Hug and and silico-column clean-up [9] (aDNA laboratory) or using an in-

the dean of the Einsiedeln monastery. In 2009, Hug’s documents house method whereby the bone powder is ﬁrst carefully

were eventually detected in a safe inside the monastery shop decalciﬁed [10], then extracted and puriﬁed with the QIAamp

[5,6]. DNA Mini Kit (forensic laboratory).

612 C. Haas et al. / Forensic Science International: Genetics 7 (2013) 610–617

Katharinen- altar

Skelett II

Skelett I Standort Standort Grabplatte Grabplatte seit 1925 1859 –1921 Jörg Jenatsch

Gestühl Gestühl 1845 – 2003 1845 – 1967

0 5 m

Fig. 2. Sectional ﬂoor plan of Chur cathedral (west bay, northern side aisle) [5]. The 1959 excavation area is shaded in light gray. Three skeletons were discovered in the area,

one of which was presumed to be Jo¨rg Jenatsch. The locations of the Jo¨rg Jenatsch tomb slab (‘‘Grabplatte’’) and of the pewage (‘‘Gestu¨ hl’’) are also labeled (copyright:

Archeological Service of Grisons).

2.2. Y-STR analysis [11] and the PowerPlex Y23 kit (Promega) [12], according to the

manufacturers’ instructions. Analysis with the PowerPlex Y23 kit

DNA extracts were ampliﬁed using the AmpFlSTR Yﬁler PCR was performed in two different laboratories, namely at the

ampliﬁcation kit (Applied Biosystems AB, now Life Technologies) Institute of Legal Medicine, University of Zurich, and the Institute

of Legal Medicine, Charite´ Berlin. Amplicons of the PowerPlex Y23

loci were up to 425 bp in length, and 30 ampliﬁcation cycles were

run. PCR products were separated and detected with Genetic

Analyzers 3500 (Zurich) or 3130xl (Berlin). One microliter of the

ampliﬁed sample was added to 10 ml Hi-Di Formamide (AB) and

1 ml CC5 ILS 500 Y23 (Promega). The following electrophoresis

conditions of operating the Genetic Analyzers were adhered to in

Zu¨ rich and in Berlin (in brackets): polymer POP-4, 24 s (10 s)

injection time, 1.2 kV (3 kV) injection voltage, 15 kV run voltage,

60 8C, 1270 s (1800 s) run time, Dye Set G5 (FL, JOE, TMR-ET, CXR-

ET, CC5). Raw data were analyzed with the Genemapper ID-X

Software Versions 1.2 (1.1.1) (AB). A threshold of 50 RFUs was used

for peak detection.

2.3. Y-SNP analysis

The Y-SNP analyses were performed at the Institute of Legal

Medicine, Charite´, Berlin. DNA extracts were ampliﬁed with self-

designed multiplexes based upon the SNaPshot technique (AB).

The three multiplexes comprised 21 Y-SNPs sufﬁcient to deﬁne the

most common European haplogroups. Amplicon lengths of PCR

multiplexes I-III were up to 340 bp, most of them were below

200 bp. The PCR and SBE reactions included 32 and 25 ampliﬁca-

tion cycles, respectively. PCR, SBE and clean-up reactions for

multiplexes I and II were performed according to [13] and for

multiplex III as follows: PCR: 3 ml multiplex Mastermix (Qiagen),

0.8 ml H2O, 1.2 ml Primer mix (Table 1), 1 ml DNA were ampliﬁed

95 8C/15 min, 32 (94 8C/30 s, 57 8C/90 s, 72 8C/60 s), 72 8C/

10 min. PCR cleanup: 2 ml ExoSAP IT and 5 ml PCR product were

Fig. 3. Male part of the Jenatsch pedigree going back 11 generations from living

incubated 37 8C/60 min followed by 75 8C/15 min. SBE reaction:

descendants J1, J2, J3 to Anton Jenatsch, a great-grandfather of Jo¨rg Jenatsch.

Individuals that were tested genetically are highlighted by shading. 1.8 ml H2O, 1.5 ml SNaPshot Reaction mix, 1.2 ml Primer mix

C. Haas et al. / Forensic Science International: Genetics 7 (2013) 610–617 613

Table 1

PCR and SBE primer sequences used for haplogroup R-speciﬁc multiplex III.

PCR primers

0 0

SNP Branch Primers (5 -3 ) Size (bp) Amplicon (bp) SNP Conc. (mM)

M157 R1a1b F: GAGAGAGGATATCAAAAATTGG 22 229 A/C 0.5

R: TAGCTTACAACACAAGGATTC 21

M269 R1b1b2* F: TGGTATCACAATAGAAGGGG 20 152 T/C 0.5

R: AAGGTGCTGGGATTACACGC 20

U198 R1b1b2a1a F: AGAACAAGACATTCCAACCTC 21 119 G/A 0.5

R: TTGAGGCTCAGTTTCAAATGC 21

U152 R1b1b2a2g* F: AACATTCCACGCTTGAGGATAA 22 182 G/A 0.5

R: TTAGGACTGTCTTAGCTATAC 21

M124 R2 F: AACACCAGAATCTAACAAAGC 20 172 C/T 0.5

R: ATCAACTTCTTTCCCTCAACA 21

SBE primers

SNP Primer sequence (5’-3’) target speciﬁc sequence black, neutral sequence gray Size (bp) Orientation typing Conc. (mM)

M157 GACAACACCAAAGGTCATTTGTGGT 25 Reverse 0.18

M269 CTGACAAAAATTGTTTTCAATTTACCAG 28 Reverse 0.18

U198 CGTGAAAGTCTGACAACATTGCATGGGTATAACTG 35 Forward 0.18

U152 AAAGTCTGACAACATTACTTTGAGAAGTATGG 32 Reverse 0.18

M124 ACAAACTCAGTATTATTAAACC 22 Reverse 0.18

(Table 1), 1.5 ml cleaned PCR product were ampliﬁed 25 (96 8C/ 3. Results

10 s, 50 8C/5 s, 60 8C/30 s). SBE cleanup: 1 ml SAP and 6 ml SBE-

product were incubated 37 8C/60 min followed by 85 8C/15 min. 3.1. DNA analysis

Puriﬁed SBE products were separated and detected with a 3130xl

Genetic Analyzer. One microliter of the ampliﬁed sample was No Y-STR proﬁle could be obtained from the bloodstains on the

added to 15 ml Hi-Di Formamide and 0.1 ml of Size Standard LIZ piece of clothing with the Yﬁler kit, because of the low quality of

120 (all from AB). The following electrophoresis conditions were the extracted DNA. The skeletal remains were of archeological

used for the 3130xl Genetic Analyzer: polymer POP-4, 22 s origin so the DNA was degraded and present at low copy number,

injection time, 2 kV injection voltage, 10 kV run voltage, 60 8C, as expected. This notwithstanding, partial Y-STR and complete Y-

2000 s run time, Dye Set E5 (R110, R6G, TAMRA, ROX, LIZ). Raw SNP proﬁles could be generated (Tables 2 and 3).

data were analyzed with the Genemapper ID Software Version 3.2 Since initial tests with the PowerPlex Y23 kit provided better

(AB). A peak detection threshold of 50 RFUs was used for declaring results for the bone samples than the Yﬁler kit (data not shown), all

positive results. subsequent analyses were performed with the former. Fourteen

PCR ampliﬁcations revealed partial proﬁles that could be assem-

2.4. Biostatistics bled into a complete PowerPlex Y23 proﬁle, with reproducible

results for each locus (Table 2). The PowerPlex Y23 proﬁles of the

The goal of the biostatistical analysis was to quantify how much three living family members were concordant but differed from the

more likely than not it was that the exhumed skeleton was Jo¨rg PowerPlex Y23 proﬁle of the skeleton at three loci, DYS456,

Jenatsch. The necessary likelihood calculations were carried out DYS458 and DYS635, all of which are also included in the Yﬁler kit

twice, once following the exact approach of Kayser et al. [14] and (Table 2). The only male involved in the 2012 exhumation was the

once under a systematic reduction of the genotypic information excavator himself, but his PowerPlex Y23 proﬁle was completely

used. Exact likelihood calculations require knowledge of the different from that of the Jenatsch males (Table 2). All other staff

population frequencies of the haplotypes involved [14], and these working with the skeleton was female, thereby obviating the risk

are difﬁcult to obtain for comprehensive, and therefore rare, of contamination. Extraction- and PCR-negative controls were all

haplotypes [15,16]. Moreover, nothing is usually known about the negative, except for one extraction negative control (NB3) that

population frequencies of haplotypes at the time of origin of showed two single peaks (Table 2).

historic specimen. Therefore, only the seven loci deﬁning the so- Y-SNP analysis yielded an identical haplogroup, R1b1b2a2 g, for

called ‘core haplotype’ [17,18] were included in the exact Jo¨rg Jenatsch and the three living family members (Table 3). The

calculations. In a second analysis, we circumvented the problem excavator carried a different Y-SNP haplotype (haplogroup I) of

of inaccurate haplotype frequency estimation by reducing the presumably northern European origin (Table 3). Extraction- and

employed genetic information to mere mismatch counts (see PCR-/SBE- negative controls were all negative.

below). Since, substantially less population data were available in

the Y chromosome Haplotype Reference Database (YHRD) [19,20] 3.2. Biostatistics

for the 23 PowerPlex Y23 loci than for 17 Yﬁler loci, the second

analysis was based upon the Yﬁler loci only. At the time of inquiry We assumed that J0, the grandfather of the three genotyped

(release 42, 1 February 2013), YHRD included 23,445 haplotypes males J1, J2, and J3 carried core haplotype 14-13-29-24-12-13-13

from western Europe for the seven core haplotype loci, 8134 because his grandsons shared this haplotype (Table 2). Since the

entries for the Yﬁler loci, but only 590 full PowerPlex Y23 skeleton carried the same haplotype, the likelihood of the null

haplotypes. Population frequencies of relevant haplotypes were hypothesis that the skeleton does not belong to Jo¨rg Jenatsch’s

estimated from these data by means of the augmented count male lineage equals

estimate (k + 1)/(n + 1), where k denotes the respective haplotype

count and n is the database size. Likelihood calculations were

3 LðH0 : DÞ ¼ g h;

based upon an average mutation rate of 5 10 for all Y-STRs, a

ﬁgure that has been reported as an appropriate approximation in where D denotes the genotype data, g is the current frequency of

the literature before [21–23]. the haplotype in question, and h is its haplotype frequency in the 614

Table 2 Y-STR haplotypes of three living members of the Jenatsch family (J1, J2, J3), the excavator involved in the exhumation at Chur cathedral, and several pieces of bone (B1–B4) and tooth (T1 and T2) from the presumed Jenatsch skeleton. The Y-STR analyses were performed at the Center of Evolutionary Medicine in Zurich (A), the Institute of Legal Medicine in Zurich (Z) and the Institute of Legal Medicine, Charite´, Berlin (B). Alleles in brackets had peak heights below the peak detection threshold of 50 RFUs. N = extraction negative controls.

Sample Extraction PCR Core set Yﬁler PowerPlex Y23

DYS19 DYS389I DYS389II DYS390 DYS391 DYS392 DYS393 DYS385ab DYS437 DYS438 DYS439 DYS448 DYS456 DYS458 GATA DYS635 DYS481 DYS533 DYS549 DYS570 DYS576DYS643

Reference samples J1 A Z 14 13 29 24 12 13 13 11/15 15 12 14 19 15 18 11 24 22 12 13 17 19 10 J1 A B 14 13 29 24 12 13 13 11/15 15 12 14 19 15 18 11 24 22 12 13 17 19 10 J2 A Z 14 13 29 24 12 13 13 11/15 15 12 14 19 15 18 11 24 22 12 13 17 19 10 J2 A B 14 13 29 24 12 13 13 11/15 15 12 14 19 15 18 11 24 22 12 13 17 19 10 J3 A Z 14 13 29 24 12 13 13 11/15 15 12 14 19 15 18 11 24 22 12 13 17 19 10 J3 A B 14 13 29 24 12 13 13 11/15 15 12 14 19 15 18 11 24 22 12 13 17 19 10 C.

J3 A B 14 13 29 24 12 13 13 11/15 15 12 14 19 15 18 11 24 22 12 13 17 19 10 Haas

excavator A Z 15 13 31 25 11 11 13 14/15 15 10 12 19 14 17 11 23 29 13 11 18 17 10 et

excavator A B 15 13 31 25 11 11 13 14/15 15 10 12 19 14 17 11 23 29 13 11 18 17 10 al.

Forensic Extraction 1 (2 pieces of bone) Bone B1 A B 13 (29/30) 12 13 11 14 19 (17) 23 22 17 19

Bone B1 A B No Science results NB1 A B No

results International: Bone B2 A B 13 13 19 23,24 22 13 17,19 19 NB2 A B 13 16

Extraction 2 (bone and tooth)

Bone B3 A B 24 12 13 12 22 11 13 17 Genetics Bone B3 A B 13 12 13 14 19 19 23 22,(26) 12 13 17 19 NB3 A B 13 12 23

NB3 A B No (2013) results Tooth T1 A B No

results 610–617 Tooth T1 A B No results NT1 A B No results NT1 A B No results

Extraction 3 (bone and tooth) Bone B4 Z Z 12 11/15 19 16 19 23 22 17 19 Bone B4 Z Z 14 13 29 12 13 13 11/15 15 14 16 19 23 22 13 17 19 10 Bone B4 Z Z 12 11/15 12 14 23 12 13 17 19 Bone B4 Z Z 13 29 24 12 13 13 11/15 14 16 19 11 23 22 12 13 17 19 Bone B4 Z Z 14 13 29 12 13 13 11/15 19 16 19 11 22 12 17 19 Bone B4 Z B 13 24 13 13 (11)/15 12 19 19 23 22 17 19 Bone B4 Z B (13) 29 12 13 11/15 19 23 2222 12 12 13 17 17 19 19 Bone B4Tooth Z T2 Z B 14 Z No 13 24 12 (13) 13 11/15 19 19 11 23 22 17 19 Bone B4 Z Bresults 13 24 12 13 13 (15) 12 14 19 19 23

C. Haas et al. / Forensic Science International: Genetics 7 (2013) 610–617 615

population of origin of the skeleton. Under the alternative

hypothesis that the skeleton is in fact Jo¨rg Jenatsch, it can be

assumed that Anton Jenatsch, the most recent common ancestor

R1b1b2a2g R1b1b2a2g R1b1b2a2g R1b1b2a2g

(MRCA) of Jo¨rg Jenatsch and J0, carried the same haplotype as the

other males. Otherwise, multiple mutations would have to be

invoked that yield only minor contributions to the overall 1I

likelihood. Thus, the likelihood of the alternative hypothesis

(approximately) equals 1 + + + +

712

LðHA : DÞ ¼ f 0:995 ¼ f 0:656;

where f is the haplotype frequency of interest in the population of

712

origin of the MRCA and factor 0.995 reﬂects the lack of : not determined.

1 mutation at all 7 loci in all 12 meioses separating Jo¨rg Jenatsch and 1

+ + + +

J0 under the alternative hypothesis (Note: 0.995 equals one minus

the average mutation rate of 5 10 ). Haplotype frequencies f

1 and h were unknown but had to be approximated by current

haplotype frequency g, so that the likelihood ratio simpliﬁed to 1

+ + + +

LðHA : DÞ g 0:656 0:656 ¼ 2 ¼ LðH0 : DÞ g g 1

Core haplotype 14-13-29-24-12-13-13 was observed 73 times

among the 23,445 western European entries in YHRD. This yielded ‘: ancestral SNP, ‘ + ’: derived SNP, ‘ 3

1 an augmented count estimate of g = 3.15 10 and a likelihood

ratio of 207.8. In other words, when only the core haplotype

information is taken into account, it is >200 times more likely that 1

++ ++ ++ ++

the skeleton is Jo¨rg Jenatsch than that it belongs to a different male

lineage.

We also tried to make inferential use of the more comprehen- 1

sive Yﬁler data available to us (Table 2). At three of the additional

loci, namely DYS456, DYS458 and DYS635, the skeleton and the 1

(identical) haplotypes of the three grandsons of J0 showed a

mismatch by one repeat. Inspection of YHRD revealed that neither

these two haplotypes nor any of their most parsimonious

intermediates were present in the database, rendering exact

likelihood calculations potentially unreliable. Therefore, we

+ + + +

choose to evaluate only the observed mismatch number and to

disregard the actual haplotype information. Under the alternative

hypothesis, a one-repeat mismatch at exactly three of 17 loci

would arise in 12 meioses with probability +

17 14 3

LðH : DÞ ¼ 0:94 0:06 ¼ 0:06176 A 3

Here, 12 times 5 10 = 0.06 (approximately) equals the locus-

wise probability of a single one-repeat mismatch arising in 12

meioses.

The likelihood of the null hypothesis, L(H0:D), was evaluated

empirically by estimating, from the western European part of

++ + ++ ++ ++

YHRD, the probability that two randomly drawn Yﬁler haplotypes

exhibit exactly three mismatches. Considering all haplotypes, this

probability was found to be 6.44 10 . However, the Yﬁler

haplotype distribution in YHRD is heavily skewed in that the

database contains 7512 singletons (92.4%). When only these

haplotypes were taken into account, the probability of interest was

estimated to be 3.08 10 . Relating the likelihoods of the two

hypotheses to one another therefore implies that, taking the

information for the 17 Yﬁler loci and the three single step

mutations properly into account, the alternative hypothesis is still

20.0 times more likely than the null hypothesis.

MULTIPLEX I MULTIPLEX II MULTIPLEX III

4. Discussion and conclusion

Our goal was to clarify, with the help of three living male Bone B4 + Excavator + J3 + J2 + SampleJ1 M168 M145 M174 + P170 M213 M9 M201 M170 P209 M9 M231 Tat M175 M45 M207 M198 M343 M157 M269 U198 U152 M124 Haplogroup

Table 3 Y-SNP data of three living members of the Jenatsch family (J1, J2, J3), the excavator and the bone from the presumed Jenatsch skeleton. ‘

members of the Jenatsch family, whether the skeleton exhumed

616 C. Haas et al. / Forensic Science International: Genetics 7 (2013) 610–617

from Chur cathedral is that of Jo¨rg Jenatsch. The DNA analysis of an information that Y-STRs can provide in terms of positive male

approximately 400 year old bone is challenging, and the success lineage identiﬁcation will likely obey a ‘‘law of diminishing

prospects clearly depended upon the conditions of the biological return’’.

material. Fortunately, even though DNA from the presumed Jo¨rg The Jenatsch case belongs to a series of cases where particular

Jenatsch skeleton was degraded, a complete PowerPlex Y23 proﬁle historical hypotheses were tested genetically. These include the

could be generated from all three extractions. The novel PowerPlex investigation of skeletal remains of the Romanov family, Russia’s

Y23 kit provided superior results compared to other, more last monarchy (y1918) [26–28] and of Austria’s patron saint

common Y-STR kits. SNP-analysis was a less severe problem Leopold III (12th century) [29], of the putative skulls of Friedrich

because small DNA fragments (mostly below 200 bp) were von Schiller (y1805) [30] and Wolfgang Amadeus Mozart (y1791)

ampliﬁed. [31], and the recent identiﬁcation of King Richard III of England

Contamination, at least from the second exhumation, could (y1485) (press release of February 4 2013 [32]). In addition to

be ruled out because the only male involved in handling the genetic testing, many of these remains were subjected to other

skeleton had completely different Y-STR and Y-SNP proﬁles. We state-of-the-art analyses. In the Jo¨ rg Jenatsch case, these included

were fully aware that the analyzed bones also could have been CT-based investigations, stable isotopes analyses for the recon-

contaminated during the ﬁrst exhumation, because bones used struction of diet and origin, and a re-evaluation of anthropological

to be brushed with bare hands for cleaning and Erik Hug showed and pathological ﬁndings. Although many mysteries of history

the original skull during public lectures and on television. (fortunately) will never be solved, despite all the latest

However, the Y-STR and Y-SNP proﬁles of the skeleton and the technologies available to scientists, the present study undoubt-

three living members of the Jenatsch family were so similar that edly highlights the potential beneﬁts of aDNA analysis for historic

they clearly argued in favor of a blood relationship rather than research.

(random) contamination.

The skeleton and the three living family members carried the Acknowledgements

same Y-SNP-haplogroup, R1b1b2a2g. In YHRD, R1b1b2a2g occurs

in 132 of 2357 western- or middle-Europeans (frequency: The authors thank M. Janosa (Archeological Service of Grisons)

5.6 10 ), meaning that this haplotype is quite common in the for review of the historic and archeological part of the study, S.

target area. Therefore the match on its own did not provide Lo¨sch (Institute of Legal Medicine, University of Berne) for a critical

sufﬁcient evidence to allow reliable identiﬁcation of the skeleton. review of the manuscript and M. Rochat (Institute of Legal

Comparison of the PowerPlex Y23 proﬁles of the skeleton and the Medicine, University of Zurich) for technical assistance. This study

three living family members revealed three discrepancies and 20 was supported by the Ma¨xi Stiftung, Zu¨ rich.

matches. Bearing in mind that, under the hypothesis that the

References

skeleton is that of Jo¨rg Jenatsch, each of these mutations would

have occurred in one of 12 meioses, such an observation may well

[1] R.G. Asch, Book review on: Randolph C. Head. Jenatsch’s Axe: Social Boundaries,

have been compatible with the presumed identity. Indeed,

Identity, and Myth in the Era of the Thirty Years’ War. (Changing Perspectives on

conservative biostatistical evaluation of the data suggested that Early Modern Europe, number 9.) Rochester, N.Y.: University of Rochester Press,

2008, The American Historical Review 115 (2010) 307–308.

it was at least 20 times more likely than not that the Chur skeleton

[2] R.C. Head, Jenatsch’s Axe: Social Boundaries, Identity, and Myth in the Era of the

is Jo¨rg Jenatsch. In addition, our calculations were based upon the

Thirty Years’ War (in Changing Perspectives on Early Modern Europe, number 9),

17 loci of the Yﬁler kit only, due to the scarcity of population data, University of Rochester Press, Rochester, N.Y., 2008.

[3] C.F. Meyer, Ju¨ rg Jenatsch, Insel Verlag, Frankfurt, 1988.

and did not allow for the fact that the proﬁles under study matched

[4] D. Schmid, Jenatsch, Limbo Film AG, Zu¨ rich B.-P.P, 1987.

for six additional STRs. If the conservative assumption were made

[5] M. Janosa, Die Exhumierung des Jo¨rg Jenatsch im Jahre, 19, Bu¨ ndner Monatsblatt,

that the probability of observing exactly three mismatches Chur: Desertina, 2010, pp. 431–450.

[6] E. Hug, Akten Erik Hug (1911-1991) betr. Entdeckung des Grabes von Jo¨rg

between two unrelated western-European Y-chromosomal hap-

Jenatsch in der Kathedrale Chur. Chur: Staatsarchiv Graubu¨ nden, 2011.

lotypes is the same for the PowerPlex Y23 kit as for the 17 Yﬁler

[7] M.T. Gilbert, H.J. Bandelt, M. Hofreiter, I. Barnes, Assessing ancient DNA studies,

loci, a likelihood ratio of 36 would emerge. Finally, two of the Trends Ecol. Evol. 20 (2005) 541–544.

additional markers, DYS570 and DYS576, are rapidly mutating [8] A. Cooper, H.N. Poinar, Ancient DNA: do it right or not at all, Science 289 (2000)

2 1139.

with mutation rates >10 [24,25]. The fact that we did not ﬁnd a

[9] R. Barnett, G. Larson, A phenol-chloroform protocol for extracting DNA from

mutation at any of these loci argues further for the presumed

ancient samples, Methods Mol. Biol. 840 (2012) 13–19.

relationship. Since no other male relative has ever been connected [10] M.N. Hochmeister, B. Budowle, U.V. Borer, U. Eggmann, C.T. Comey, R. Dirnhofer,

Typing of deoxyribonucleic acid (DNA) extracted from compact bone from human

to the ﬁnd, our analysis therefore strongly suggests that the Chur

remains, J. Forensic Sci. 36 (1991) 1649–1661.

skeleton is that of Jo¨rg Jenatsch.

[11] J.J. Mulero, C.W. Chang, L.M. Calandro, R.L. Green, Y. Li, C.L. Johnson, L.K. Hennessy,

Our study highlights the power of Y-chromosomal analysis for Development and validation of the AmpFlSTR Yﬁler PCR ampliﬁcation kit: a male

speciﬁc, single ampliﬁcation 17 Y-STR multiplex system, J. Forensic Sci. 51 (2006)

the identiﬁcation of male lineages, but also revealed some of its

64–75.

limitations. We demonstrated that distant family branches indeed

[12] C. Davis, J.Y. Ge, C. Sprecher, A. Chidambaram, J. Thompson, M. Ewing, P. Fulmer,

can be traced back to common ancestors using Y-chromosomal D. Rabbach, D. Storts, B. Budowle, Prototype PowerPlex, (R) Y23 System: a

concordance study, Forensic Sci. Int. Genet. 7 (2013) 204–208.

data, even if some of the individuals involved lived hundreds of

[13] M. Geppert, L. Roewer, SNaPshot(R) minisequencing analysis of multiple ances-

years ago. However, when it comes to the biostatistical evaluation,

try-informative Y-SNPs using capillary electrophoresis, Methods Mol. Biol. 830

particularly of Y-STR data, the notorious lack of population data (2012) 127–140.

[14] M. Kayser, M. Vermeulen, H. Knoblauch, H. Schuster, M. Krawczak, L. Roewer,

from the time and region of origin of the presumed forebears turns

Relating two deep-rooted pedigrees from Central Germany by high-resolution Y-

out a limiting factor. Marker sets in forensic use undoubtedly will

STR haplotyping, Forensic Sci. Int. Genet. 1 (2007) 125–128.

be expanded in the future because additional markers are always [15] L. Roewer, M. Kayser, P. de Knijff, K. Anslinger, A. Betz, A. Caglia, D. Corach, S.

useful for better discrimination. In addition, slowly mutating Furedi, L. Henke, M. Hidding, H.J. Kargel, R. Lessig, M. Nagy, V.L. Pascali, W. Parson,

B. Rolf, C. Schmitt, R. Szibor, J. Teifel-Greding, M. Krawczak, A new method for the

simple single-copy Y-STRs are advantageous for paternity testing

evaluation of matches in non-recombining genomes: application to Y-chromo-

and anthropological studies [25]. However, analyzing more and

somal short tandem repeat (STR) haplotypes in European males, Forensic Sci. Int.

more loci will not necessarily add to the power of positive male 114 (2000) 31–43.

[16] S. Willuweit, A. Caliebe, M.M. Andersen, L. Roewer, Y-STR frequency surveying

lineage identiﬁcation because the evidential value of matches

method: a critical reappraisal, Forensic Sci. Int. Genet. 5 (2011) 84–90.

becomes increasingly difﬁcult to quantify when the haplotype in

[17] V.L. Pascali, M. Dobosz, B. Brinkmann, Coordinating Y-chromosomal STR research

question gets too rare [15,16]. In this respect, the amount of for the courts, Int. J. Legal Med. 112 (1999) 1.

C. Haas et al. / Forensic Science International: Genetics 7 (2013) 610–617 617

[18] M. Kayser, A. Caglia, D. Corach, N. Fretwell, C. Gehrig, G. Graziosi, F. Heidorn, S. [23] M. Kayser, L. Roewer, M. Hedman, L. Henke, J. Henke, S. Brauer, C. Kruger, M.

Herrmann, B. Herzog, M. Hidding, K. Honda, M. Jobling, M. Krawczak, K. Leim, S. Krawczak, M. Nagy, T. Dobosz, R. Szibor, P. de Knijff, M. Stoneking, A. Sajantila,

Meuser, E. Meyer, W. Oesterreich, A. Pandya, W. Parson, G. Penacino, A. Perez- Characteristics and frequency of germline mutations at microsatellite loci from

Lezaun, A. Piccinini, M. Prinz, C. Schmitt, L. Roewer, et al., Evaluation of Y- the human Y chromosome, as revealed by direct observation in father/son pairs,

chromosomal STRs: a multicenter study, Int. J. Legal Med. 110 (125-133) Am. J. Hum. Genet. 66 (2000) 1580–1588.

(1997), 141-129. [24] K.N. Ballantyne, V. Keerl, A. Wollstein, Y. Choi, S.B. Zuniga, A. Ralf, M. Vermeulen,

[19] L. Roewer, M. Krawczak, S. Willuweit, M. Nagy, C. Alves, A. Amorim, K. Anslinger, P. de Knijff, M. Kayser, A new future of forensic Y-chromosome analysis: rapidly

C. Augustin, A. Betz, E. Bosch, A. Caglia, A. Carracedo, D. Corach, A.F. Dekairelle, T. mutating Y-STRs for differentiating male relatives and paternal lineages, Forensic

Dobosz, B.M. Dupuy, S. Furedi, C. Gehrig, L. Gusmao, J. Henke, L. Henke, M. Sci. Int. Genet. 6 (2012) 208–218.

Hidding, C. Hohoff, B. Hoste, M.A. Jobling, H.J. Kargel, P. de Knijff, R. Lessig, E. [25] M. Vermeulen, A. Wollstein, K. van der Gaag, O. Lao, Y. Xue, Q. Wang, L. Roewer, H.

Liebeherr, M. Lorente, B. Martinez-Jarreta, P. Nievas, M. Nowak, W. Parson, V.L. Knoblauch, C. Tyler-Smith, P. de Knijff, M. Kayser, Improving global and regional

Pascali, G. Penacino, R. Ploski, B. Rolf, A. Sala, U. Schmidt, C. Schmitt, P.M. resolution of male lineage differentiation by simple single-copy Y-chromosomal

Schneider, R. Szibor, J. Teifel-Greding, M. Kayser, Online reference database of short tandem repeat polymorphisms, Forensic Sci. Int. Genet. 3 (2009) 205–213.

European Y-chromosomal short tandem repeat (STR) haplotypes, Forensic Sci. Int. [26] E.I. Rogaev, A.P. Grigorenko, Y.K. Moliaka, G. Faskhutdinova, A. Goltsov, A. Lahti, C.

118 (2001) 106–113. Hildebrandt, E.L. Kittler, I. Morozova, Genomic identiﬁcation in the historical case

[20] S. Willuweit, L. Roewer, International Forensic Y.C.U.G.Y chromosome haplo- of the Nicholas II royal family, Proc. Natl. Acad. Sci. U.S.A. 106 (2009) 5258–5263.

type reference database (YHRD): update, Forensic Sci Int Genet 1 (2007) 83– [27] M.D. Coble, O.M. Loreille, M.J. Wadhams, S.M. Edson, K. Maynard, C.E. Meyer, H.

87. Niederstatter, C. Berger, B. Berger, A.B. Falsetti, P. Gill, W. Parson, L.N. Finelli,

[21] L. Gusmao, P. Sanchez-Diz, F. Calafell, P. Martin, C.A. Alonso, F. Alvarez-Fernandez, Mystery solved: the identiﬁcation of the two missing Romanov children using

C. Alves, L. Borjas-Fajardo, W.R. Bozzo, M.L. Bravo, J.J. Builes, J. Capilla, M. Carvalho, DNA analysis, PloS one 4 (2009) e4838.

C. Castillo, C.I. Catanesi, D. Corach, A.M. Di Lonardo, R. Espinheira, E. Fagundes de [28] P. Gill, P.L. Ivanov, C. Kimpton, R. Piercy, N. Benson, G. Tully, I. Evett, E. Hagelberg,

Carvalho, M.J. Farfan, H.P. Figueiredo, I. Gomes, M.M. Lojo, M. Marino, M.F. K. Sullivan, Identiﬁcation of the remains of the Romanov family by DNA analysis,

Pinheiro, M.L. Pontes, V. Prieto, E. Ramos-Luis, J.A. Riancho, A.C. Souza Goes, Nat. Genet. 6 (1994) 130–135.

O.A. Santapa, D.R. Sumita, G. Vallejo, L. Vidal Rioja, M.C. Vide, C.I. Vieira da Silva, [29] C.M. Bauer, M. Bodner, H. Niederstatter, D. Niederwieser, G. Huber, P. Hatzer-

M.R. Whittle, W. Zabala, M.T. Zarrabeitia, A. Alonso, A. Carracedo, A. Amorim, Grubwieser, K. Holubar, W. Parson, Molecular genetic investigations on Austria’s

Mutation rates at Y chromosome speciﬁc microsatellites, Hum. Mutat. 26 (2005) patron saint Leopold III, Forensic Sci. Int. Genet. (2012).

520–528. [30] U. Gebhardt, Der Friedrich-Schiller-Code, TV documentary, (MDR) M.R., 2008.

[22] B.M. Dupuy, M. Stenersen, T. Egeland, B. Olaisen, Y-chromosomal microsatellite [31] B. Czeitschner, Mozart – Eine Spurensuche, TV documentary, Fernsehen O¨ , 2006.

mutation rates: differences in mutation rate between and within loci, Hum. [32] http://www2.le.ac.uk/ofﬁces/press/press-releases/2013/february/university-of-

Mutat. 23 (2004) 117–124. leicester-announces-discovery-of-king-richard-iii.