Cancer Biol Med 2021. doi: 10.20892/j.issn.2095-3941.2020.0071

ORIGINAL ARTICLE

The cancer-testis , MEIOB, sensitizes triple-negative breast cancer to PARP1 inhibitors by inducing homologous recombination deficiency

Yayun Gu1,2*, Cheng Wang1,2,3*, Rongxuan Zhu4, Jianshui Yang1, Wenwen Yuan1,2, Yanhui Zhu5, Yan Zhou1,2, Na Qin1,2, Hongbing Shen1,2, Hongxia Ma1,2, Hongxia Wang4, Xiaoan Liu5, Zhibin Hu1,2 1State Key Laboratory of Reproductive Medicine, Center for Global Health, School of Public Health, Nanjing Medical University, Nanjing 211166, China; 2Jiangsu Key Lab of Cancer Biomarkers, Prevention and Treatment, Jiangsu Collaborative Innovation Center for Cancer Personalized Medicine, Nanjing Medical University, Nanjing 211116, China; 3Department of Bioinformatics, School of Biomedical Engineering and Informatics, Nanjing Medical University, Nanjing 211166, China; 4Department of Oncology, Shanghai General Hospital, Shanghai Jiao Tong University School of Medicine, Shanghai 200080, China; 5Department of Breast Surgery, The First Affiliated Hospital with Nanjing Medical University, Nanjing 210029, China

ABSTRACT Objective: The newly defined cancer-testis (CT) gene, MEIOB, was previously found to play key roles in DNA double-strand break (DSB) repair. In this study, we aimed to investigate the effects and mechanisms of MEIOB in the carcinogenesis of triple-negative breast cancers (TNBCs). Methods: The Cancer Genome Atlas database was used to quantify the expression of MEIOB. Cox regression analysis was used to evaluate the association between MEIOB expression and the prognosis of human TNBC. The effects of MEIOB on cell proliferation and migration in TNBCs were also assessed in vitro. Patient-derived xenograft (PDX) models were used to assess the sensitivity of breast cancers with active MEIOB to PARP1 inhibitors. Results: We confirmed MEIOB as a CT gene whose expression was restricted to the testes and breast tumors, especially TNBCs. Its activation was significantly associated with poor survival in breast cancer patients [overall, hazard ratio (HR) = 1.90 (1.16–2.06); TNBCs: HR = 7.05 (1.16–41.80)]. In addition, we found that MEIOB was oncogenic and significantly promoted the proliferation of TNBC cells. Further analysis showed that MEIOB participated in DSB repair in TNBCs. However, in contrast to its function in meiosis, it mediated homologous recombination deficiency (HRD) through the activation of polyADP-ribose polymerase (PARP)1 by interacting with YBX1. Furthermore, activated MEIOB was shown to confer sensitivity to PARP inhibitors, which was confirmed in PDX models. Conclusions: MEIOB played an oncogenic role in TNBC through its involvement in HRD. In addition, dysregulation of MEIOB sensitized TNBC cells to PARP inhibitors, so MEIOB may be a therapeutic target of PARP1 inhibitors in TNBC. KEYWORDS Cancer-testis gene; MEIOB; triple-negative breast cancer; PARP1 inhibitor; cell proliferation

Introduction breast cancer that is negative for the estrogen receptor, pro- gesterone receptor, and human epidermal growth factor Triple-negative breast cancer (TNBC) accounts for approx- ­receptor 2 (HER2)1. Due to the absence of these three recep- imately 10%–15% of all breast cancers and is defined as tors in TNBC, chemotherapy remains the standard-of-care for TNBC patients both in early and advanced stages2,3. Although chemotherapy can improve the conditions of patients with *These authors contribute equally to this work. early TNBC, the recurrence and metastasis rate of TNBC Correspondence to: Zhibin Hu and Xiaoan Liu 4-6 E-mail: [email protected] and [email protected] patients is high for patients with advanced disease . Thus, ORCID ID: https://orcid.org/0000-0002-8277-5234 and novel targeted approaches are urgently needed for the treat- https://orcid.org/0000-0001-5716-0740 ment of TNBC. Recently, olaparib, a polyADP-ribose poly- Received February 18, 2020; accepted July 08, 2020. merase (PARP) inhibitor, was approved by the US Food and Available at www.cancerbiomed.org ©2021 Cancer Biology & Medicine. Creative Commons Drug Administration for the treatment of breast cancers Attribution-NonCommercial 4.0 International License with BRCA1/2 mutations7. BRCA1/2 mutations in cancers Cancer Biol Med Vol 18, No 1 February 2021 75 are prototypic molecular alterations that confer homologous Cell culture and cell line authentication recombination deficiency (HRD) and sensitivity to DNA dam- aging therapy8,9. In addition, some studies show that cancers MDA-MB-231 and MDA-MB-468 cells were obtained from with genetic deficiencies involved in homologous recombina- the American Type Culture Collection (Manassas, VA, USA), tion repair other than BRCA mutations, such as deficiencies and the SUM1315MO2 cell line was provided by Stephen in ATM, ATR, PALB2, and FANC, are also highly susceptible Ethier (University of Michigan), as previously described21. to PARP inhibitor treatment10,11. A group of cancer-testis The cells were cultured in Dulbecco’s Minimal Eagle’s Medium (CT) is essential for homologous recombination12,13. (DMEM) (Gibco, Gaithersburg, MD, USA) containing 10% These genes include the meiotic topoisomerase that catalyzes fetal bovine serum (FBS; Gibco) and incubated at 37 °C in 5% 14 DNA double-strand breaks , components of the synaptone- CO2 and saturated humidity. The transient overexpression or mal complex (SYCP1)15,16, and multiple that mediate knockdown of MEIOB was performed using siRNA or MEIOB homologue alignment or recombination (MEIOB)17,18. Luo plasmids. The 3 cell lines were cultured in low glucose DMEM. et al.17 revealed that MEIOB is involved in highly ordered DNA All cell lines were cultured at 37 °C in a humidified cham- doubled-strand break (DSB) repair during meiotic homolo- ber with 5% CO2, tested negative for mycoplasma (Lonza, gous recombination, by forming a complex with its cofactor, Rockville, MD, USA), and were authenticated using short tan- SPATA22. In our previous study, we identified MEIOB as a dem repeat profiling within the last 3 years (FuHeng Biology, new CT gene involved in the carcinogenesis of lung cancer19. Xian, China). Nevertheless, its role and precise mechanism in TNBC remain unknown. We therefore characterized the involvement of RNA isolation and qRT-PCR MEIOB in the DNA repair process in TNBC patients, and fur- ther examined whether dysregulated MEIOB in TNBC con- Total RNA was extracted using TRIzol reagent (Thermo Fisher ferred sensitivity to PARP inhibitors. Scientific, Waltham, MA, USA) and reverse transcribed using the PrimeScript RT Reagent Kit (Takara, Mountain View, CA, Materials and methods USA). Expression of cDNA was quantified using the TaqMan Gene Expression Master Mix (Thermo Fisher Scientific) with Patient data an ABI 7900HT System (Applied Biosystems, Foster City, CA, USA). Primer sequences and their respective amplicon sizes We determined the expression of MEIOB in breast cancer for RT-PCR are summarized in Supplementary Table S1. tissues by reanalyzing the raw RNA sequencing data of 1,058 patients from The Cancer Genome Atlas (TCGA) datasets. A Western blot analysis standard STAR-HTSeq-DESeq2 pipeline was used to quantify gene expression20. We used normalized read counts > 5 as the The cells were washed 3 times with phosphate-buffered saline cutoff to define the expression of MEIOB. The clinical infor- (PBS), and the total was isolated using protein lysis mation was obtained from Firehose Broad GDAC (http://gdac. buffer. After centrifugation at 12,000 × g for 15 min at 4 °C, broadinstitute.org/, version 2016_01_28). To define signature the cell debris was removed, and the supernatant (cell lysate) 3, we converted all mutation data from WGS datasets into a was used for Western blot. Protein concentrations were meas- matrix (M) composed of 96 features comprising mutation ured using a BCA assay (Beyotime, Beijing, China). Equal counts for each mutation type (C>A, C>G, C>T, T>A, T>C, amounts of protein were separated by 10% SDS-PAGE and and T>G) using each possible 5′ and 3′ context for all sam- then transferred to polyvinylidene difluoride membranes ples, and applied the R package deconstructSigs12 to deter- (Millipore, Billerica, MA, USA). The membranes were blocked mine the proportion of each known mutational signature. The in blocking buffer (Tris-buffered saline, pH 7.6, 5% skim milk, ­tissue array used in immunohistochemistry (IHC) analysis was and 0.05% Tween) at room temperature for 1.5 h. Then, the obtained from Shanghai Outdo Biotech, Shanghai, China. This membranes were incubated at 4 °C overnight with primary study was approved by the ethics committee of Nanjing Medical antibody diluted in blocking buffer, followed by incubation University (Approval No. 2015-SRFA-112), and all patients with the corresponding secondary anti-IgG horseradish per- completed the Clinical Sample Informed Consent Form. oxidase conjugate (Santa Cruz Biotechnology, Santa Cruz, 76 Gu et al. MEIOB sensitizes TNBC to PARP1 inhibitors

CA, USA) for 1.5 h. The antibody binding was visualized 3–5 min and counted (9 random fields) by 2 independent inves- with ECL solution (Pierce Biotechnology, Rockford, IL, USA). tigators. The results were normalized to those of the controls. The expression of proteins was assessed by immunoblotting and was normalized to that of glyceraldehyde 3-phosphate Cell cycle analysis of tumor cells ­dehydrogenase (GAPDH). The antibodies were as follows: anti-GAPDH (KC-5G4; Kang Chen Tech, Shanghai, China), The cell cycle was analyzed by flow cytometry. For cell cycle anti-MEIOB (ab178756; Abcam, Cambridge, MA, USA), anti- analysis, transfected lung cancer cells were suspended in 75% green fluorescent protein (GFP; 66002-I-Ig; Proteintech, ethanol overnight and centrifuged at 1,000 rpm. The cell pel- Wuhan, China), anti-RAD51 (ab63801; Abcam), anti- lets were washed twice with PBS and re-suspended in PBS con- YBX1 (ab76149; Abcam), anti-PARP1 (sc-8007; Santa Cruz taining 50 mg/mL propidium iodide and 100 g/mL DNase-free Biotechnology), and anti-PAR (ALX-804-220-R100; Enzo Life RNase A. The cell suspension was incubated for 30 min at 37 °C Sciences, Farmingdale, NY, USA). and analyzed by flow cytometry. Cell cycle distribution was further analyzed with Cell Quest software (Becton Dickinson, Cell Counting Kit (CCK)-8 assay San Jose, CA, USA) and Mod Fit LT (Verity Software House, Topsham, ME, USA). CCK-8 was purchased from Dojindo Molecular Technologies (Kumamoto, Japan). Briefly, 2 h before each indicated time Immunohistochemical staining point, 10 µL of the CCK-8 solution was added to each well in a plate containing 100 µL of DMEM. Then, the absorbance at Xenografts were formalin-fixed for at least 24 h and paraffin-­ 450 nm was recorded using a microplate absorbance reader. embedded. Sections were evaluated by hematoxylin & eosin Each count was determined as an average of 3 repeats, and staining. IHC was performed on additional sections to detect each data point was the average of at least 3 experiments. All MEIOB (ab178756; Abcam), PARP1 (sc-8007; Santa Cruz data were normalized to the control group. Biotechnology), and Ki67 (GB13030-2; Servicebio, Wuhan, China) following the manufacturers’ instructions. Colony formation assay The DSB repair reporter assay for HRD The colony formation assay of MEIOB knockdown or MEIOB-overexpressing MDA-MB-231 cells and MEIOB- DSB repair efficiency was measured using a DSB reporter assay overexpressing SUM1315MO2 cells was performed using as previously described22. We are grateful to Prof. Mansour 6-well dishes (500 cells/well), with 6 wells per condition. The for providing vectors used in the DSB repair reporter assay. number of colonies containing more than 50 cells was counted. The GFP-based repair substrates were cloned using pEG- Cells were fixed and then stained with Crystal Violet. Images FP-N1 (Invitrogen, Carlsbad, CA, USA) and pBluescriptII-KS were captured under a microscope, and 3 wells were counted (Stratagene, Amsterdam, The Netherlands) as backbones, by 2 independent investigators. with pGC for homology-directed GC. For the GC substrate, pGC, the 18-bp I-SceI recognition site was inserted into the Cell migration and invasion assays unique BcgI site of pEGFP-N1, thereby inactivating the GFP- coding sequence. This intermediate, named pGC-intermedI, Migration and invasion assays were performed using Transwell and linked to a modified fragment of pBluescriptII-KS, migration chambers (Corning, Corning, NY, USA). The cells was generated as previously described22. To induce DSBs, 4 were seeded at a density of 4 × 10 cells/well. A volume of 100 µL SUM1315MO2 cells containing the stably integrated reporter of the cells was added to the upper chamber, while 600 µL of construct for gene conversion of pGC were transfected with DMEM containing 10% fetal bovine serum was added to the the I-SceI expression vector, pCMV3xnls-I-SceI (1 µg), using lower chamber and incubated at 37 °C in 5% CO2. The cells Fugene HD (Promega, Madison, WI, USA) as a transfection attaching to the upper surface of the membrane were removed reagent. Forty-eight hours after transfection, the cells were with a cotton swab, and the cells on the under­side were fixed assessed for green fluorescence using Western blot and flow and stained with Giemsa (Dingguo Bio, Shanghai, China) for cytometry (FACScan, BD Bioscience, San Jose, CA, USA). Cancer Biol Med Vol 18, No 1 February 2021 77

Immunofluorescence staining Results

For immunofluorescence staining, tissues were first washed in MEIOB is expressed in TNBCs and is PBS 3 times to remove excess Optimal Cutting Temperature associated with poor survival in TNBC (OCT) buffer, and then they were blocked with goat serum patients for 30 min at room temperature. Then, they were incubated with primary antibodies at 4 °C overnight. Before incubation To thoroughly evaluate the expression pattern of MEIOB, with secondary antibodies, the tissues were washed 3 times in we conducted RT-PCR using cDNA of 16 normal human PBS. The 4′,6-diamidino-2-phenylindole (DAPI) stain was adult tissues, including the testis. The results showed that the simultaneously added with 2 antibodies (Alexa Fluor 488 and expression of MEIOB in the testis was higher than that in any cyanine 3; Thermo Fisher Scientific) from different species for other normal tissue (Figure 1A), which was consistent with 2 h at room temperature. After washing the sections 3 times the results from the GTEx database. Furthermore, we found with PBS and mounting them with mounting medium, the that MEIOB was aberrantly expressed in breast cancer tumor images were acquired by confocal microscopy. The reagents tissues based on TCGA data set analyses (Figure 1B), and were as follows: DAPI stain (G1012; Servicebio), anti-MEIOB the ratio of expression was the highest in TNBCs when com- (ab178756; Abcam), and anti-γ-H2AX (ab26350; Abcam). pared with other subtypes of breast cancer (expression ratio: TNBC, 11.3%; luminal, 4.5%; HER2+, 1.7%; normal-like, Patient-derived xenografts 0%; Figure 1C). The results of IHC analysis of breast cancer tissues confirmed the upregulation of MEIOB protein levels Patient-derived xenografts were generated from primary in TNBCs when compared with both luminal cancers and or metastatic breast tumors using previously described adjacent tissues (N = 52, N = 32, N = 32; ­procedures23. All animal procedures were reviewed and TNBC Luminal Adjacent Figure 1D and 1E). In addition, Kaplan-Meier analysis showed approved by the Institutional Animal Care and Use Committee that high MEIOB expression was positively correlated with and the Ethics Committee of Nanjing Medical University poor overall survival in breast cancer patients, especially in (Approval No. IACUC-1601117). We selected 6 of the estab- TNBC patients from TCGA database [hazard ratio (HR) = lished breast tumor samples, including 3 MEIOB-negative and 1.90 and 7.05, Figure 1F and 1G]. These findings suggested the 3 MEIOB-positive tumors, for further use in xenograft models. tumor-­promoting roles of MEIOB in the tumorigenesis and prognosis of breast cancer, especially TNBC. Statistical analysis

MEIOB gene expression data from TCGA data were analyzed MEIOB alters cell viability in TNBCs for differential expression in tumor tissues vs. adjacent nor- mal tissues. The association between MEIOB expression in To validate the hypothesis that MEIOB affected the viability all tumor tissue samples and survival was analyzed by Cox of breast cancer cells, we first conducted RT-PCR and Western regression. Kaplan-Meier analysis was used to fit the survival blot to examine the mRNA and protein expressions of MEIOB curves, and significance was evaluated using the log-rank test. in various types of breast cancer cell lines. The results showed For experimental data, continuous values are described as the that both mRNA and protein levels of MEIOB were dramat- mean ± SE and tested by analysis of variance. A value of P < ically upregulated in two TNBC cell lines, MDA-MB-231 0.05 was accepted as statistically significant. All statistical anal- and MDA-MB-468, while they were significantly lower in yses of in vitro and in vivo assays were performed using Prism either normal breast epithelium or luminal breast cancer 6.01 (GraphPad, San Diego, CA, USA). cells (Supplementary Figure S1A and S1B), indicating that MEIOB might play an important role in a subset of TNBCs. Data availability Furthermore, immunofluorescence staining showed that MEIOB was localized in the nuclei of MDA-MB-231 cells The data that support the findings of this study are available (Supplementary Figure S1C). To better understand the role from the corresponding author upon reasonable request. of MEIOB in breast cancer, we then knocked down MEIOB 78 Gu et al. MEIOB sensitizes TNBC to PARP1 inhibitors

AB 0.15 600 ** 500 0.10 400 300 100 0.05 80 60

TCGA unpaired tissues 40 Expression of MEIOB in 20 Relative mRNA expression of

MEIOB in multiple normal tissues 0.00 0 y MEIOB-T MEIOB-N Liver Brain Lung Heart Colon Ovar Testis Spleen Kidney Placeta n = 1,058 n = 111 Pancreas Prostate SkeletalThymus Leukocyte Negative Small Intertine C D E Adjacent 15 Basal-like (11/97) 100

Luminal (16/357) B ** 11.3% HER2(+) (1/58) 80 10 Normal-like (0/8) * 60 Luminal 40 5 4.5% 20 in breast cancer tissues all breast cancer tissues 1.7% Percent of MEIOB(+) among 0% Nuclear proportion of MEIO TNBC 0 0 e TNBC Luminal Luminal HER2(+) Adjacent Basal-lik 100 µm Normal-like FG 1.00 1.00

0.90 0.90

0.80 0.80

0.70 HR = 1.90, P = 1.39 × 10–2 0.70 HR = 7.05, P = 3.20 × 10–2

Expression below median Expression below median 0.60 Expression above median 0.60 Expression above median

0.50 0.50 0204060 0204060 Time (month) Time (month)

Figure 1 MEIOB is overexpressed in triple-negative breast cancers (TNBCs) and is associated with poor survival. (A) Expression of MEIOB in human adult normal tissues. RT-PCR was performed using the Human MTC™ Panel I kit. (B) MEIOB expression was higher in breast tumors than in adjacent tissues from The Cancer Genome Atlas (TCGA) database. **P < 0.01; Ntumor = 1,058, Nadjacent = 111. (C) The expression of MEIOB was significantly enriched in TNBC samples from TCGA.N Basal-like = 97, NLuminal = 357, NHer2+ = 58, and NNormal-like = 8. (D and E) The results of immunohistochemical analysis in our breast cancer tissue array showed that the expression of MEIOB protein was significantly enriched in TNBCs. *P < 0.05; **P < 0.01; NTNBC = 52, NLuminal = 32, NAdjacent = 32. (F) A Kaplan-Meier survival curve of breast cancer patients showed that higher expression of MEIOB in patients with breast cancer from TCGA was correlated with poorer overall survival; the Cox proportional hazards regression model of TCGA data was adjusted for tumor stage and menopausal status. (n = 1,050, P < 0.05). (G) Kaplan-Meier survival curve of TNBC patients showed that higher expression of MEIOB in patients with TNBC was correlated with poorer overall survival; the Cox proportional hazards regression model of TCGA data was adjusted for tumor stage and menopausal status (n = 98, P < 0.05). Cancer Biol Med Vol 18, No 1 February 2021 79 by using siRNA in MDA-MB-231 cells (Supplementary S2C and S2D), which significantly increased cell proliferation Figure S2A and S2B) and found that depletion of MEIOB in and migration (Figure 2D–2F). These results were further con- MDA-MB-231 cells led to a significant decrease in both cell firmed in SUM1315MO2 cells (Figure 2G–2I; Supplementary proliferation and migration (Figure 2A–2C). We also overex- Figure S2E and S2F). Thus, we concluded that MEIOB may pressed MEIOB in MDA-MB-231 cells (Supplementary Figure promote tumor proliferation in TNBCs.

MDA-MB-231-SiMEIOB MDA-MB-231-SiMEIOB MDA-MB-231-SiMEIOB A 2.5 B C 150 ** ** ** 400 Control ** ** 2.0 SiMEIOB-1 SiMEIOB-2 Control Control 300 1.5 ** 100

200 1.0 SiMEIOB-1 SiMEIOB-1

Cell numbe r 50 Cell numbe r 100 0.5

Normalized cell index OD450 SiMEIOB-2 SiMEIOB-2 300 μm 0.0 0 0 024487296 Time (h) Control Control SiMEIOB-1SiMEIOB-2 SiMEIOB-1SiMEIOB-2

MDA-MB-231-MEIOB+ MDA-MB-231-MEIOB+ MDA-MB-231-MEIOB+ D 1.5 E F Control ** 250 ** 400 ** MEIOB+ ** 200 300 1.0 Control Control 150 200 100 0.5 Cell numbe r Cell numbe r MEIOB+ 50 MEIOB+ 100 300 μm Normalized cell index OD450 0.0 0 0 024487296 + + Time (h) Control MEIOB Control MEIOB

SUM1315MO2-MEIOB+ SUM1315MO2-MEIOB+ G HISUM1315MO2-MEIOB+ 3.5 Control

** n 150 3.0 + MEIOB ** 250 2.5 ** 200 2.0 ** Control 100 Control 1.5 150 1.0 100

50 Cell number 0.5 MEIOB+ MEIOB+ 50 Normalized cell index OD450 0.0 300 μm Number of colone formatio 0 0 024487296 + + Time (h) B B Control MEIO Control MEIO

Figure 2 MEIOB is critical for triple-negative breast cancer (TNBC) cell proliferation and migration. (A) CCK-8 assays were conducted to determine the viability after knocking down MEIOB in MDA-MB-231 cells. Data are presented as the mean ± SEM, **P < 0.01. (B) Colony for- mation assays were conducted to determine proliferation after knocking down MEIOB in MDA-MB-231 cells. Data are presented as the mean ± SEM, **P < 0.01. (C) Transwell assays were conducted to determine metastasis after knocking down MEIOB in MDA-MB-231 cells. Data are presented as the mean ± SEM, **P < 0.01. (D) CCK-8 assays were conducted to determine the viability of MDA-MB-231 cells overexpressing MEIOB. Data are presented as the mean ± SEM, **P < 0.01. (E) Colony formation assays were performed to determine the proliferation of MEIOB-overexpressing MDA-MB-231 cells. Data are presented as the mean ± SEM, **P < 0.01. (F) Transwell assays were conducted to deter- mine the metastasis of MEIOB-overexpressing MDA-MB-231 cells. Data are presented as the mean ± SEM, **P < 0.01. (G) CCK-8 assays were conducted to determine the viability of MEIOB-overexpressing SUM1315MO2 cells. Data are presented as the mean ± SEM, **P < 0.01. (H) Colony formation assays were performed to determine the proliferation of MEIOB-overexpressing SUM1315MO2 cells. Data are presented as the mean ± SEM, **P < 0.01. (I) Transwell assays were conducted to determine the metastasis of MEIOB-overexpressing SUM1315MO2 cells. Data are presented as the mean ± SEM, **P < 0.01. 80 Gu et al. MEIOB sensitizes TNBC to PARP1 inhibitors

MEIOB induces homologous recombination MEIOB binds with YBX1 and activates deficiencies in TNBCs PARP1-related repair

Cisplatin, a common chemotherapy agent that creates DNA To determine the mechanism by which MEIOB affected the interstrand and intrastrand crosslinks, can lead to DNA DNA damage repair process, we performed liquid chroma- DSBs after its removal in both replicating yeast and mam- tography-tandem mass spectrometry to identify the proteins malian somatic cells, and has been used to treat many breast interacting with MEIOB. The results showed that the YBX1 cancer types, including TNBC24-27. We therefore treated protein, which can physically interact with PARP1 in vitro to SUM1315MO2 cells with cisplatin (20 μmol/L) to induce inhibit PARG24 degradation of its polyADP-ribose, interacted the DNA damage response and then measured the degree with MEIOB (Supplementary Figure S3A, Table S2). This of DNA damage by monitoring anti-γ-H2AX nuclear interaction was further verified by co-immunoprecipitation staining signals28. The accumulation of γ-H2AX was signif- analysis of FLAG-tagged MEIOB (Figure 4A, Supplementary icantly decreased in MEIOB-overexpressing SUM1315MO2 Figure S3B). We also found that the score of signature 3 in cells treated with cisplatin (Figure 3A and 3B), indicating YBX1 high-expressing tumors was significantly higher than that MEIOB promoted the DSB repair response in TNBC that in YBX1 low-expressing tumors in TCGA breast cancer cells. datasets (Figure 4B). Next, we found that MEIOB caused an Homologous recombination is inhibited during the G1 increase in PARP1 polyADP-ribose levels and a decrease in phase of the cell cycle, but is active in both the S and G2 RAD51 expression, which is a key marker of the homologous phases29. Our results further showed that the overexpres- recombination repair process (Figure 4C, Supplementary sion of MEIOB in SUM1315MO2 cells resulted in cell cycle Figure S3C)33. Finally, the activated PAR-related DNA repair arrest at the G1 phase, which indicated that MEIOB might process in MEIOB-overexpressing cells was again silenced after be absent from homologous recombination while being YBX1 was knocked down (Figure 4D, Supplementary Figure involved in the non-homologous end joining (NHEJ) repair S3D). Taken together, our results suggested that MEIOB was process (Figure 3C). As reported in past studies, CDK4 and involved in PARP1-related HRD, probably by interacting with CDK2 are necessary for cells to enter the G1 phase from YBX1. the G0 phase30. In MEIOB-overexpressing SUM1315MO2 Biallelic inactivation of BRCA1/2 is associated with a pat- cells, we observed increased expressions of CDK2 and tern of HRD known as signature 334. According to the results CDK4, which further confirmed that MEIOB induced described above, we hypothesized that MEIOB might result in SUM1315MO2 cells to maintain G1/G0 phase arrest (Figure genomic alterations similar to the loss of BRCA1/2. Notably, 3D). DSBs that occur during G1 phase are mainly repaired we found that the score of signature 3 was correlated with through NHEJ, whereas those formed during S and G2 MEIOB and was significantly higher in patients with high phases are predominantly repaired by homologous recombi- MEIOB expression in TCGA breast cancer datasets (Figure 5A nation mechanisms31. Furthermore, the pHR-GFP reporter and 5B). To exclude the influence of BRCA1/2, we found that vector was used to assess the effect of MEIOB expression MEIOB expression was mutually exclusive with mutations in on DNA damage repair by homologous recombination in BRCA1/2 in both breast cancers and TNBCs (P < 0.01, Figure SUM1315MO2 breast cancer cells32. Homologous recom- 5C and 5D). These results suggested that MEIOB might be a bination activity was assessed by quantifying GFP protein new biomarker of HRD in TNBC patients, except in patients expression and GFP-positive cells 72 h after ­co-transfection with BRCA1/2 mutations. of pHR-GFP and pSce. As a result, we found that GFP intensity was significantly downregulated in MEIOB- MEIOB increases the sensitivity of TNBCs to overexpressing SUM1315MO2 cells when compared with the clinical PARP1 inhibitor, olaparib control cells (Figure 3E). Similar results were observed in GFP-positive cells, as detected by flow cytometry (Figure 3F We hypothesized that TNBC cells overexpressing MEIOB and 3G). Thus, we concluded that MEIOB overexpression in would be more sensitive to PARP inhibitors than MEIOB-null SUM1315MO2 cells resulted in HRD. cells. We evaluated the sensitivity of TNBC cells with different Cancer Biol Med Vol 18, No 1 February 2021 81

A SUM1315MO2-Cisplatin 0 h SUM1315MO2-Cisplatin 12 h B Cisplatin 0 h 120 Cisplatin 12 h DAPI γ-H2AX Merge DAPI γ-H2AX Merge **

80 Control

40 + Intensity of γ -H2A X MEIO B 0

+

Control MEIOB

G1/G0 C 800 D 5 Control 60 Control MEIOB+ 600 ** MEIOB+

Cell count s 400 G2/M 4 ** **

S 200 Control Apoptosis 0 40 030960 0 120 3 Channels (FL2-A) ** G1/G0 2 1000 20 800 +

600

Cyclin related mRNA 1 Cell count s

400 in different treated cells in different treated cells

G2/M

MEIOB 200 S Apoptosis Percentage of G1/G0 and G2/M 0 0 0 030960 0 120 Channels (FL2-A)

G1/G0 G2/M CDK2 CDK4

E F G MEIOB – + 30 + ** pGC ++ Control MEIOB Data.013 Data.010 I-SceI ++ 1,000 1,000 20

GFP

R2R2 R2

MEIOB SSC-Height SSC-Height 10 Ratio of GFP/All cells 0 0 GAPDH 100 101 102 103 104 100 101 102 103 104 0 FL1-H(pGC-GFP) FL1-H(pGC-GFP) + B

Control MEIO

Figure 3 Overexpression of MEIOB induces homologous recombination defects. The formation of γ-H2AX foci decreases in MEIOB- overexpressing SUM1315MO2 cells. An immunofluorescence staining assay was conducted to examine the formation of γ-H2AX foci with 20 μM cisplatin treatment for 0 and 12 h. (A) Representative images of γ-H2AX foci. (B) Quantitative analysis of γ-H2AX foci per cell in each genotype from 3 independent experiments. n = 10 cells/groups. Data are presented as the mean ± SEM, **P < 0.01. (C) Cell cycle distribution in control and MEIOB-overexpressing SUM1315MO2 cells. Data are presented as the mean ± SEM, **P < 0.01. (D) The mRNA expression of key cell cycle regulators (CDK2 and CDK4) in control and MEIOB-overexpressing SUM1315MO2 cells. Data are presented as the mean ± SEM, **P < 0.01; n = 3/group. (E–G) Cells of different groups were transfected with pGC- and I-SceI-expressing vector, and the percentage of GFP+ cells (as an indication of homologous recombination efficiency) was assessed at the 72 h posttransfection time point by Western blot and flow cytometry. Data are presented as the mean ± SEM, **P < 0.01.

MEIOB expression patterns to PARP1 inhibitors, by treat- sensitive to AG-14361 than MEIOB-null SUM1315MO2 cells. ing cells with multiple concentrations of the PARP1 inhibi- Similar results were observed in cells treated with olaparib. tors, AG-14361 and olaparib. Figure 6A shows that MEIOB- We then established a patient-derived xenograft (PDX) expressing MDA-MB-231 and MDA-MB-468 cells were more mouse model of TNBC that had characteristics similar 82 Gu et al. MEIOB sensitizes TNBC to PARP1 inhibitors

A B SUM1315MO2 Cor = 0.31, P = 2.2E-16 3 Empty vector MEIOB+

YBX1 IP Signature

YBX1 input

Normalized YBX1 expression

C D MEIOB ––++ Si-YBX1 – + – + MEIOB ––+ +

Cisplatin 12 h ––++ PAR

PAR MEIOB

RAD51 YBX1

GAPDH GAPDH

Cisplatin 12 h

Figure 4 MEIOB binds with YBX1 and activates the PARP1 pathway. (A) FLAG-tagged MEIOB and vector controls were purified from MEIOB- overexpressing SUM1315MO2 cells and analyzed using mass spectrometry to identify MEIOB-binding proteins. YBX1 was found to bind with MEIOB in SUM1315MO2 cells. (B) The score of signature 3 was correlated with the expression of YBX1 in The Cancer Genome Atlas breast cancer datasets. Cor = 0.31, P < 0.001. (C) The expression of PAR was increased and the expression of RAD51 was decreased in SUM1315MO2- overexpressing cells after 20 μM cisplatin treatment for 12 h. (D) The increase in the expression of PAR in response to MEIOB overexpression was attenuated in SUM1315MO2 cells transfected with Si-YBX1 after 20 μM cisplatin treatment for 12 h.

to those of human primary tumors. A schematic of the In olaparib-treated PDX tumors, IHC labeling was con- PDX model is shown in Supplementary Figure S4A. Fresh ducted using antibodies to cell proliferation markers, Ki67 TNBC tissues were obtained from patients and divided into and PARP1. After treatment with olaparib, the number of two groups according to MEIOB protein expression levels Ki67-positive proliferating cells was dramatically decreased (MEIOB-null and MEIOB-expressing) (Supplementary in the MEIOB-expressing tumors when compared with the Figure S4B). All tumors were implanted subcutaneously MEIOB-null tumors (Figure 6E). In addition, PARP1 was in NOD/SCID mice. Both groups were treated with olap- strongly inhibited by olaparib in MEIOB-expressing tum- arib when the patient-derived tumor volume had reached ors (Figure 6F). These results indicated that tumors that 200 mm3. Tumor volumes were measured once a week expressed elevated levels of MEIOB were more sensitive to after treatment with olaparib (Figure 6B). Six weeks after olaparib. administration, the tumors were harvested and weighed To validate the downstream mechanisms of olaparib (Figure 6C). The results showed that the volumes of tum- treatment, RNA-seq was performed with the olaparib-treated ors expressing MEIOB significantly decreased to less than and untreated MEIOB-expressing tumors. We then selected 30% of MEIOB-null tumors after treatment with olaparib differentially expressed genes for further (GO) (Figure 6D), suggesting that MEIOB-expressing tumors, analysis. The results confirmed that olaparib therapy led to in vivo, were more sensitive to olaparib than MEIOB-null an accumulation of DNA DSBs and cell cycle arrest (Figure tumors. 6G)35,36. Representative gene expression levels involved Cancer Biol Med Vol 18, No 1 February 2021 83

AB0.6 P = 0.02 Cor = 0.47, P = 0.02

0.6

0.4 3

0.4 3 Signature Signature

0.2 0.2

0.0

0.0 MEIOB activated Other patients patients 0 100 200 300 400

Normalized MEIOB expression

C P = 1.62 × 10 MEIOB P = 9.86 × 10

BRCA1 –10

–13

BRCA2

2 G G C 3 4 Q O S L 1 H Z 4 Z G I 5 I U

TCGA−A2−A0TTCGA−E2−A15TTCGA−E2−A15ETCGA−E2−A14X0 TCGA−BH−A0BTCGA−B6−A0XTCGA−B6−A0RUTCGA−B6−A0INTCGA−AO−A0J6 TCGA−AN−A0AJTCGA−A8−A08FTCGA−A8−A07BTCGA−A2−A0YTCGA−C8−A12TJ TCGA−E2−A14ZTCGA−E2−A14NTCGA−D8−A147TCGA−C8−A12KTCGA−BH−A0BTCGA−B6−A0XTCGA−AN−A0FLTCGA−E2−A15S TCGA−BH−A0BTCGA−B6−A0RTCGA−B6−A0I8TCGA−AR−A1A TCGA−A8−A09ATCGA−A8−A097TCGA−A8−A08LTCGA−A8−A08BTCGA−A8−A08TCGA−A8−A07RTCGA−A8−A07TCGA−A2−A0S TCGA−A2−A0D TCGA−C8−A1HTCGA−BH−A18UTCGA−BH−A0BTCGA−BH−A0B TCGA−AR−A1ATCGA−AO−A03OTCGA−AN−A0XWTCGA−AN−A0XTTCGA−A8−A07WTCGA−A8−A07TCGA−A8−A06OTCGA−A2−A0CWTCGA−AO−A124 TCGA−BH−A0WATCGA−BH−A0DTCGA−AN−A0XUTCGA−AN−A0FXTCGA−AN−A0ALTCGA−A1−A0STCGA−E2−A14WTCGA−BH−A18QTCGA−BH−A0BTCGA−BH−A0A TCGA−AO−A03VTCGA−AO−A03TTCGA−AN−A0ATTCGA−A8−A09W

D P = 1.19 × 10 MEIOB P = 5.00 × 10

BRCA1 –4

–3

BRCA2

2 G 3 Q L I

TCGA−A2−A0TTCGA−E2−A14X0 TCGA−AO−A0J6 TCGA−E2−A14NTCGA−D8−A147 TCGA−BH−A0B TCGA−AN−A0FL TCGA−AR−A1A TCGA−A2−A0D TCGA−BH−A0BTCGA−BH−A0BTCGA−B6−A0RUTCGA−AR−A1A TCGA−A8−A07OTCGA−AO−A124 TCGA−BH−A0WA TCGA−AN−A0XUTCGA−AN−A0FX TCGA−AN−A0ALTCGA−BH−A18QTCGA−B6−A0RG TCGA−AN−A0AT

With alteration Without alteration

Figure 5 MEIOB expression is mutually exclusive with BRCA mutations. (A) The proportion of signature 3 was significantly higher in MEIOB- expressing patients than in non-expressing patients in The Cancer Genome Atlas (TCGA) breast cancer datasets. Student’s t-test was con- ducted, P = 0.02. (B) The score of signature 3 was correlated with the expression of MEIOB in TCGA breast cancer datasets. Cor = 0.47, P = 0.02. Red dots represent the BRCA-wildtype samples, and gray dots represent the BRCA-mutant samples. (C and D) Mutually exclusive pattern of MEIOB expression and BRCA1/2 mutation in breast cancer. Noverall = 459, P < 0.001 (C); NTNBC = 75, P < 0.001 (D).

in the DNA repair process were then verified by RT-PCR. Discussion Supplementary Figure S4C shows that expressions of the PARPBP37, POLQ38, and RTEL139 genes, which participate in It has long been acknowledged that the processes of germ cell NHEJ, were inhibited by olaparib. A previous study showed development and tumorigenesis share important similarities, that olaparib monotherapy provided a significant benefit over including meiosis during gametogenesis and aneuploidy dur- standard therapy in breast cancers with BRCA mutations7. ing tumorigenesis12. MEIOB is a newly identified CT gene that Taken together, these results suggested that PARP inhibitors is expressed both in the testes and in tumor tissues from TNBC may have additional applications in the treatment of TNBC. patients19. 84 Gu et al. MEIOB sensitizes TNBC to PARP1 inhibitors

A B 400 AG-14361 – ** 1.0 MEIOB ) SUM1315MO2 BRCA-mut 3 MEIOB+ 0.8 MDA-MB-231 ** BRCA-WT 300 MDA-MB-468 0.6 Olaparib 0.4 SUM1315MO2 BRCA-mut 200 MDA-MB-231 Surviving fraction 0.2 BRCA-WT Tumor volume (m m MDA-MB-468 0.0 MEIOB– SUM1315MO2 MEIOB+ MDA-MB-231 & MDA-MB-468 100 10 20 50 100 200 0246 Concentration (µm) Time (week)

C D 25 E ** ki67–IHC olaparib untreated ki67–IHC olaparib treated 1# 2# 3# 20× 40× 20× 40× 20 ) MEIOB– – 15 MEIO B 10

+ Tumor weight (g MEIOB + 5

0 MEIOB 50 μm

– +

EIOB EIOB M M

F G PARP1–IHC olaparib untreated PARP1–IHC olaparib treated Biologic process 20× 40× 20× 40× segregation

– Sister chromatid segregation Mitotic cell cycle phase transition Regulation of double-strand break repair MEIOB Regulation of chromosome organization Regulation of mitotic metaphase Double-strand break repair

+ Regulation of sister chromatid segregation Chromosome separation Regulation of nuclear division MEIO B 50 μm 0 5 10 15 Enrichment score (–log 10(P value))

Figure 6 MEIOB increases the sensitivity of cancers to PARP1 inhibitors. (A) Dose-response PARP1 inhibitor survival curves for 3 breast tumor cell lines, SUM1315MO2, MDA-MB-231, and MDA-MB-468. The cells were plated in 96-well plates and constantly exposed to inhibitors for 3 days, at which point survival was estimated. (B) Curves showing the development of breast cancer cells from patient-derived xenografts treated with olaparib. Data are presented as the mean ± SEM, **P < 0.01. (C and D) Representative images and weight analyses of tumors harvested at the end point. Data are presented as the mean ± SEM, **P < 0.01. (E and F) Ki67 and PARP1 levels of tumors treated with olaparib were evaluated by immunohistochemical analysis. (G) GO analysis of significantly up/downregulated genes in olaparib-treated tumors.

TNBC is the most aggressive subtype of breast cancer40 inhibitors34. We found that sporadic MEIOB-expressing and has no specific treatment guidelines41. It is generally TNBC patients bear substantial mutation signature 3 thought that some TNBCs are susceptible to DNA damag- expressions, using multi-omics analyses of TCGA data- ing agents due to a dysfunctional DNA repair system. Several base. In addition, its expression was mutually exclusive with studies have shown that PARP inhibitors might be a prom- BRCA1/2 mutations. Furthermore, our results both in vitro ising therapeutic strategy for TNBC patients with BRCA1/2 (cells) and in vivo (PDX models) showed that the overexpres- mutations42,43, which can lead to the failure of double strand sion of MEIOB increased the sensitivity of TNBC to PARP1 break repair, accumulation of genomic instability, and even- inhibitors in patients without BRCA1/2 mutations. Thus, it tual tumor cell death44. However, TNBCs involve a hetero- is possible that MEIOB dysregulation might be considered a geneous group of breast cancers, and many TNBC patients biomarker for the selection of TNBC patients that could be do not have BRCA1/2 mutations45. A growing number of responsive to PARP inhibition. studies have suggested that sporadic TNBCs with genetic In this study, MEIOB was involved in the error-prone deficiencies other than BRCA1/2 generally bear signature NHEJ repair process in TNBCs, which was characterized by an 3, the marker of HRD, and are highly susceptible to PARP increase in PAR and a reduction in RAD5146. In contrast, it was Cancer Biol Med Vol 18, No 1 February 2021 85 reported that MEIOB binds with SPATA2217 and plays key roles 2. Balko JM, Giltnane JM, Wang K, Schwarz LJ, Young CD, Cook in the early repair of the meiotic homologous recombination RS, et al. Molecular profiling of the residual disease of triple- negative breast cancers after neoadjuvant chemotherapy identifies repair process18. This suggested that MEIOB plays different roles actionable therapeutic targets. Cancer Discov. 2014; 4: 232-45. during two biological processes; MEIOB strongly activates the 3. Park JH, Jonas SF, Bataillon G, Criscitiello C, Salgado R, Loi S, et al. 18 homologous recombination repair pathway in meiosis ; and Prognostic value of tumor-infiltrating lymphocytes in patients in a different manner, it induces another major DSB repair with early-stage triple-negative breast cancers (TNBC) who did not pathway, error-prone NHEJ, and results in HRD in TNBC. In receive adjuvant chemotherapy. Ann Oncol. 2019; 30: 1941-9. TNBCs, MEIOB binds to YBX1, a protein that physically inter- 4. Parvani JG, Gujrati MD, Mack MA, Schiemann WP, Lu ZR. Silencing beta3 integrin by targeted Eco/siRNA nanoparticles acts with PARP1 to inhibit its polyADP-ribose degradation47. inhibits EMT and metastasis of triple-negative breast cancer. YBX1 was previously found to interfere with PARP1 activation Cancer Res. 2015; 75: 2316-25. on the damaged DNA by multimerization or interaction with its 5. Boughey JC, Ballman KV, McCall LM, Mittendorf EA, Symmans WF, DNA-binding domain48. Furthermore, we observed an increase Julian TB, et al. Tumor biology and response to chemotherapy impact in PAR caused by MEIOB, which was attenuated after YBX1 was breast cancer-specific survival in node-positive breast cancer patients knocked down. These results led us to hypothesize that YBX1 treated with neoadjuvant chemotherapy: long-term follow-up from ACOSOG Z1071 (alliance). Ann Surg. 2017; 266: 667-76. may function as a cofactor of MEIOB in the synthesis of PAR. 6. Guestini F, McNamara KM, Ishida T, Sasano H. Triple negative breast cancer chemosensitivity and chemoresistance: current Conclusions advances in biomarkers indentification. Expert Opin Ther Targets. 2016; 20: 705-20. Taken together, our study showed that the CT gene, MEIOB, pro- 7. Robson M, Im SA, Senkus E, Xu B, Domchek SM, Masuda N, et al. moted breast cancer cell viability and mediated HRD by activat- Olaparib for metastatic breast cancer in patients with a germline BRCA mutation. N Engl J Med. 2017; 377: 523-33. ing the PARP1-dependent DNA damage response. Additionally, 8. Ottini L, Silvestri V, Rizzolo P, Falchetti M, Zanna I, Saieva C, et al. MEIOB sensitized TNBC to PARP1 inhibitors, which might Clinical and pathologic characteristics of BRCA-positive and BRCA- expand the use of PARP1 inhibitors for the ­treatment of negative male breast cancer patients: results from a collaborative MEIOB-positive TNBCs (Supplementary Figure S4D). multicenter study in Italy. Breast Cancer Res Treat. 2012; 134: 411-8. 9. Telli ML, Timms KM, Reid J, Hennessy B, Mills GB, Jensen KC, Acknowledgements et al. Homologous recombination deficiency (HRD) score predicts response to platinum-containing neoadjuvant chemotherapy in We are grateful to Professor Mansour for providing vectors patients with triple-negative breast cancer. Clin Cancer Res. 2016; used in the DSB repair reporter assay. 22: 3764-73. 10. Lord CJ, Ashworth A. BRCAness revisited. Nat Rev Cancer. 2016; Grant support 16: 110-20. 11. Cancer Genome Atlas Research Network. Integrated genomic analyses of ovarian carcinoma. Nature. 2011; 474: 609-15. This work was supported by the National Natural Science 12. Simpson AJ, Caballero OL, Jungbluth A, Chen YT, Old LJ. Cancer/ Foundation of China (Grant Nos. 81902836 and 81572602) testis antigens, gametogenesis and cancer. Nat Rev Cancer. 2005; 5: and the China Postdoctoral Science Foundation (Grant Nos. 615-25. 2017M610339 and 2018M630584). 13. Meng L, Zhou Y, Ju S, Han J, Song C, Kong J, et al. A cis-eQTL genetic variant in PLK4 confers high risk of hepatocellular carcinoma. Cancer Med. 2019; 8: 6476-84. Conflict of interest statement 14. Choi K, Zhao X, Tock AJ, Lambing C, Underwood CJ, Hardcastle TJ, et al. Nucleosomes and DNA methylation shape meiotic DSB No potential conflicts of interest are disclosed. frequency in arabidopsis thaliana transposons and gene regulatory regions. Genome Res. 2018; 28: 532-46. 15. de Vries FA, de Boer E, van den Bosch M, Baarends WM, Ooms References M, Yuan L, et al. Mouse Sycp1 functions in synaptonemal complex assembly, meiotic recombination, and XY body formation. Genes 1. Cedolini C, Bertozzi S, Londero AP, Bernardi S, Seriau L, Concina Dev. 2005; 19: 1376-89. S, et al. Type of breast cancer diagnosis, screening, and survival. 16. Fraune J, Alsheimer M, Volff JN, Busch K, Fraune S, Bosch TC, Clin Breast Cancer. 2014; 14: 235-40. et al. Hydra meiosis reveals unexpected conservation of structural 86 Gu et al. MEIOB sensitizes TNBC to PARP1 inhibitors

synaptonemal complex proteins across metazoans. Proc Natl Acad 32. Mansour WY, Rhein T, Dahm-Daphi J. The alternative end-joining Sci U S A. 2012; 109: 16588-93. pathway for repair of DNA double-strand breaks requires PARP1 17. Luo M, Yang F, Leu NA, Landaiche J, Handel MA, Benavente R, but is not dependent upon microhomologies. Nucleic Acids Res. et al. Meiob exhibits single-stranded DNA-binding and exonuclease 2010; 38: 6065-77. activities and is essential for meiotic recombination. Nat Commun. 33. Chen JK, Lin WL, Chen Z, Liu HW. PARP-1-dependent 2013; 4: 2788. recruitment of cold-inducible RNA-binding protein promotes 18. Souquet B, Abby E, Herve R, Finsterbusch F, Tourpin S, Le Bouffant double-strand break repair and genome stability. Proc Natl Acad R, et al. Meiob targets single-strand DNA and is necessary for Sci U S A. 2018; 115: E1759-68. meiotic recombination. PLoS Genet. 2013; 9: e1003784. 34. Hastak K, Alli E, Ford JM. Synergistic chemosensitivity of triple- 19. Wang C, Gu Y, Zhang K, Xie K, Zhu M, Dai N, et al. Systematic negative breast cancer cell lines to poly(ADP-ribose) polymerase identification of genes with a cancer-testis expression pattern in 19 inhibition, gemcitabine, and cisplatin. Cancer Res. 2010; 70: cancer types. Nat Commun. 2016; 7: 10499. 7970-80. 20. Anders S, McCarthy DJ, Chen Y, Okoniewski M, Smyth GK, Huber W, 35. Laulier C, Cheng A, Stark JM. The relative efficiency of et al. Count-based differential expression analysis of RNA sequencing homology-directed repair has distinct effects on proper anaphase data using R and bioconductor. Nat Protoc. 2013; 8: 1765-86. chromosome separation. Nucleic Acids Res. 2011; 39: 5935-44. 21. Chen H, Pan H, Qian Y, Zhou W, Liu X. MiR-25-3p promotes the 36. Casafont I, Palanca A, Lafarga V, Berciano MT, Lafarga M. Effect proliferation of triple negative breast cancer by targeting BTG2. of ionizing radiation in sensory ganglion neurons: organization Mol Cancer. 2018; 17: 4. and dynamics of nuclear compartments of DNA damage/repair 22. Mansour WY, Schumacher S, Rosskopf R, Rhein T, Schmidt- and their relationship with transcription and cell cycle. Acta Petersen F, Gatzemeier F, et al. Hierarchy of nonhomologous Neuropathol. 2011; 122: 481-93. end-joining, single-strand annealing and gene conversion at site- 37. Moldovan GL, Dejsuphong D, Petalcorin MI, Hofmann K, Takeda directed DNA double-strand breaks. Nucleic Acids Res. 2008; 36: S, Boulton SJ, et al. Inhibition of homologous recombination by the 4088-98. PCNA-interacting protein PARI. Mol Cell. 2012; 45: 75-86. 23. Yao YM, Donoho GP, Iversen PW, Zhang Y, Van Horn RD, Forest A, 38. Wood RD, Doublie S. DNA polymerase theta (POLQ), double- et al. Mouse pdx trial suggests synergy of concurrent inhibition strand break repair, and cancer. DNA Repair (Amst). 2016; 44: of RAF and EGFR in colorectal cancer with BRAF or KRAS 22-32. mutations. Clin Cancer Res. 2017; 23: 5547-60. 39. Barber LJ, Youds JL, Ward JD, McIlwraith MJ, O’Neil NJ, Petalcorin 24. Wang L, Valiskova B, Forejt J. Cisplatin-induced DNA double- MI, et al. RTEL1 maintains genomic stability by suppressing strand breaks promote meiotic chromosome synapsis in PRDM9- homologous recombination. Cell. 2008; 135: 261-71. controlled mouse hybrid sterility. Elife. 2018; 7: e42511. 40. Sahni JM, Gayle SS, Webb BM, Weber-Bonk KL, Seachrist DD, 25. Wang H, Xiang D, Liu B, He A, Randle HJ, Zhang KX, Singh S, et al. Mitotic vulnerability in triple-negative breast cancer et al. Inadequate DNA damage repair promotes mammary associated with LIN9 is targetable with BET inhibitors. Cancer Res. transdifferentiation, leading to BRCA1 breast cancer. Cell. 2019; 2017; 77: 5395-408. 178: 135-51 e19. 41. Denkert C, von Minckwitz G, Darb-Esfahani S, Lederer B, 26. Eckstein N. Platinum resistance in breast and ovarian cancer cell Heppner BI, Weber KE, et al. Tumour-infiltrating lymphocytes and lines. J Exp Clin Cancer Res. 2011; 30: 91. prognosis in different subtypes of breast cancer: a pooled analysis 27. Torrisi R, Zuradelli M, Agostinetto E, Masci G, Losurdo A, De of 3771 patients treated with neoadjuvant therapy. Lancet Oncol. Sanctis R, et al. Platinum salts in the treatment of BRCA-associated 2018; 19: 40-50. breast cancer: a true targeted chemotherapy? Crit Rev Oncol 42. Du Y, Yamaguchi H, Wei Y, Hsu JL, Wang HL, Hsu YH, et al. Hematol. 2019; 135: 66-75. Blocking c-Met-mediated PARP1 phosphorylation enhances anti- 28. Bakr A, Oing C, Kocher S, Borgmann K, Dornreiter I, Petersen C, tumor effects of PARP inhibitors. Nat Med. 2016; 22: 194-201. et al. Involvement of ATM in homologous recombination after end 43. Pantelidou C, Sonzogni O, De Oliveria Taveira M, Mehta AK, resection and RAD51 nucleofilament formation. Nucleic Acids Res. Kothari A, Wang D, et al. PARP inhibitor efficacy depends 2015; 43: 3154-66. on cd8(+) T-cell recruitment via intratumoral sting pathway 29. Arnoult N, Correia A, Ma J, Merlo A, Garcia-Gomez S, Maric M, activation in BRCA-deficient models of triple-negative breast et al. Regulation of DNA repair pathway choice in S and G2 phases cancer. Cancer Discov. 2019; 9: 722-37. by the NHEJ inhibitor CYREN. Nature. 2017; 549: 548-52. 44. Kotter A, Cornils K, Borgmann K, Dahm-Daphi J, Petersen C, 30. Sun F, Li N, Tong X, Zeng J, He S, Gai T, et al. Ara-c induces cell Dikomey E, et al. Inhibition of PARP1-dependent end-joining cycle G1/S arrest by inducing upregulation of the INK4 family gene contributes to olaparib-mediated radiosensitization in tumor cells. or directly inhibiting the formation of the cell cycle-dependent Mol Oncol. 2014; 8: 1616-25. complex CDK4/cyclin D1. Cell Cycle. 2019; 18: 2293-306. 45. Bianchini G, Balko JM, Mayer IA, Sanders ME, Gianni L. 31. Branzei D, Foiani M. Regulation of DNA repair throughout the cell Triple-negative breast cancer: challenges and opportunities of a cycle. Nat Rev Mol Cell Biol. 2008; 9: 297-308. heterogeneous disease. Nat Rev Clin Oncol. 2016; 13: 674-90. Cancer Biol Med Vol 18, No 1 February 2021 87

46. Ceccaldi R, Liu JC, Amunugama R, Hajdu I, Primack B, Petalcorin 48. Huber A, Bai P, de Murcia JM, de Murcia G. PARP-1, PARP-2 and MI, et al. Homologous-recombination-deficient tumours are ATM in the DNA damage response: functional synergy in mouse dependent on poltheta-mediated repair. Nature. 2015; 518: development. DNA Repair (Amst). 2004; 3: 1103-8. 258-62. 47. Alemasova EE, Moor NA, Naumenko KN, Kutuzov MM, Cite this article as: Gu Y, Wang C, Zhu R, Yang J, Yuan W, Zhu Y, et al. The Sukhanova MV, Pestryakov PE, et al. Y-box-binding protein 1 as a cancer-testis gene, MEIOB, sensitizes triple-negative breast cancer to PARP1 non-canonical factor of base excision repair. Biochim Biophys Acta. inhibitors by inducing homologous recombination deficiency. Cancer Biol 2016; 1864: 1631-40. Med. 2021; 18: 74-87. doi: 10.20892/j.issn.2095-3941.2020.0071 Cancer Biol Med Vol 18, No 1 February 2021 1

Supplementary materials

Table S1 Primers involved in TaqMan and PCR reactions using A 0.005 PCR Normal Luminal TNBC 0.004 Gene name Primer sequence MEIOB-Forward 5′GACTGATCACACAGGCACCC 0.003

MEOB-Reverse 3′-ATTGCAAGAAACTCATGTACCGTG 0.002

CDK2-Forward 5′-TGGCGCTTAAGAAAATCCGC 0.001 mRNA expression of MEIOB normalized to acti n CDK2-Reverse 3′-GCGAGTCACCATCTCAGCAA 0.000

CDK4-Forward 5′-AATGTTGTCCGGCTGATGGA BT474 MCF-7 MB453 MCF-10A HCC1937 CDK4-Reverse 3′-GTGCCATCTGGTAGCTGTAGA SUM1315MO2MDA-MB-231MDA-MB-468 PARPBP-Forward 5′-AAGGCCAAAACAGCAGGGAT B Normal Luminal TNBC PARPBP-Reverse 3′-GCTGCTTCTTCGTCCAAAAGA

POLQ-Forward 5′-CCCTGTACCGCTTTTGGAGT

POLQ-Reverse 3′-TGATATCTGCCAGCTTCTCACA

Marker Marker

MCF-10A BT474 MCF- 7 HCC1937 MB453 SUM1315MO2 MDA-MB-468 MDA-MB-231 RTEL1-Forward 5′-TCCTTTGACCTGACTCCCCA MEIOB RTEL1-Reverse 3′-GCCCTTGGTCTGAAACGTGA GAPDH GAPDH-Forward 5′-TGCACCACCAACTGCTTAGC

GAPDH-Reverse 3′-GTCTTCTGGGTGGCAGTGATG 2.0 Normal LuminalTNBC

1.5

1.0

0.5 relative to GAPDH Expression of MEIOB

0.0

BT474 MCF-7 MB453 MCF-10A HCC1937

SUM1315MO2MDA-MB-231MDA-MB-468 C DAPI MEIOB Merge IF - MEIOB

Figure S1 Expression of MEIOB in multiple breast cancer cell lines. (A and B) The mRNA (A) and protein (B) expressions of MEIOB were significantly higher in MDA-MB-231 and MDA-MB-468 cells than other cell lines. The protein expression of MEIOB relative to glyc- eraldehye 3-phosphate dehydrogenase was quantified by ImageJ software. (C) Immunofluorescence analysis of MEIOB localization in MDA-MB-231 cells (red, MEIOB; blue, nuclei), showed that the MEIOB protein was located in the nucleus. 2 Gu et al. MEIOB sensitizes TNBC to PARP1 inhibitors

A MDA-MB-231-SiMEIOB C 2.5 E 4.0 1.5 Control Control MEIOB+ MEIOB+ 2.0 ** 3.0 ** 1.0 1.5 2.0 0.010 GAPD H

GAPD H 0.008 0.5 0.006 1.0 ** ** 0.004 MEIOB mRNA expression relative to

Downregulation of MEIOB 0.002 through SiRNA in MDA-231 0.0 MEIOB mRNA expression relative to 0.000 0.0 MDA-MB-231 SUM1315MO2 Ctrl

Si1-MEIOB Si2-MEIOB B D F + +

Control Si1-MEIOB Si2-MEIOB Control MEIOB Control MEIOB

MEIOB MEIOB MEIOB

GAPDH GAPDH GAPDH

Figure S2 Validation of MEIOB expression in knockdown and overexpressed cells. (A and B) MEIOB was knocked down in MDA-MB-231 cells by siRNAs and was verified by RT-PCR (A) and Western blot (B). (C–F) MEIOB was overexpressed in MDA-MB-231 cells. The mRNA expression is shown in (C) and protein expression is shown in (D) and SUM1315MO2 cells. The mRNA expression is shown in E and protein expression is shown for all data and are expressed as the mean ± SEM, **P < 0.01. Cancer Biol Med Vol 18, No 1 February 2021 3

AB6 Vector SUM1315MO2 Flag-MEIOB 0.20 S

4 0.15

0.10 2

Unique PepCounts 0.05 of protein by LC-M YBX1 IP : input 0 0.00

Vector Vector MEIOB+ Flag-MEIOB Flag-MEIOB Empty vector MEIOB YBX1 C PAR protein level 2.5 RAD51 protein level

2.0

1.5

1.0

relative to GAPDH 0.5

Expression of PAR and RAD5 1 0.0 MEIOB –+–+–+–+ Cisplatin 12 h ––++––++

D 2.0 PAR protein level MEIOB protein level YBX1 protein level

1.5

1.0

0.5 and YBX1 relative to GAPDH

Expression of PAR and MEIOB 0.0 MEIOB ––++––++––++ Si-YBX1 –+–+–+–+–+–+

Figure S3 MEIOB binds with YBX1 and activates PARP1-related repair. (A) Liquid chromatography-tandem mass spectrometry for MEIOB and YBX1. Unique peptide counts of MEIOB and YBX1 in SUM1315MO2 cells based on co-immunoprecipitation assays and mass spectrometry analyses. (B) The protein expression of YBX1 binding to MEIOB relative to glyceraldehyde 3-phosphate dehydrogenase was quantified by ImageJ software. (C) The quantified protein expression of PAR and RAD51 in overexpressed SUM1315MO2 cells after 20 μM cisplatin treat- ment for 12 h. (D) The quantified protein expression of PAR, MEIOB, and YBX1 in overexpressed SUM1315MO2 cells transfected with Si-YBX1 after 20 μM cisplatin treatment for 12 h. 4 Gu et al. MEIOB sensitizes TNBC to PARP1 inhibitors

Table S2 A list of differential MEIOB-interacting protein candidates involved in DNA repair processes based on co-immunoprecipitation assays and mass spectrometry analyses

UniProt ID Gene name UniquePep Counts Cover percent (%) Length of AA Reference for DNA repair MEIOB-tag Control Q8N635 MEIOB 5 0 11.76% 442 24240703,26520106

B2RDN9 G22P1 2 0 3.94% 609 29247009,28959970

E9PHA6 MSH2 2 0 2.17% 934 27590317,29892060

Q6PKI6 YBX1 2 0 13.53% 324 27667193,14718551 Cancer Biol Med Vol 18, No 1 February 2021 5

Olaparib: Tumor volume Harvest of A 50 mg/kg/day assessed once/week the PDX model

W0 W1 W2 W3 W4 W5 W6

BC207# MEIOB– Tumor: Olaparib: Tumor volume 3 200 mm 50 mg/kg/day assessment

BC039# MEIOB+

B C 1.5 Olaparib untreated cancers MEIOB-IHC Olaparib treated cancers 20× 40× s 1.0 – BC207 MEIO B

0.5 **

mRNA expression ** relative to control ** +

0.0 BC039 MEIOB 50 µm POLQ RTEL1 PARPBP

D MEIO B YBX1 PARP 1 PARP 1 PARP 1 Olaparib sensitive PARP1 MEIOB

HRD TNBC PARP1 activation DNA damage RAD5 1

RAD5 1 Olaparib resistance

MEIOB YBX1

PARP1 less activation HR normal

Figure S4 MEIOB sensitizes TNBC to PARP1 inhibitors in patient-derived xenograft (PDX) models. (A) Schematic of the PDX model. We divided all the tumor tissues into 2 groups according to MEIOB expression levels (MEIOB+ and MEIOB−). Both groups were treated with olap- arib when the tumor volume had reached 200 mm3. Tumor volumes were measured once a week. Six weeks later, the tumors were harvested and weighed. (B) MEIOB protein levels of patient-derived xenografts were evaluated by immunohistochemical analyses. (C) RT-PCR analysis was performed to verify the signaling identified by Gene Ontology analysis. Data are expressed as the mean ± SEM,n = 3/groups, **P < 0.01. (D) Graphic abstract shows the tumor-promoting role of MEIOB binding with YBX1 and sensitizing the triple-negative breast cancers to the PARP1 inhibitor.