Expression of a Foreign Gene by Stable Recombinant Influenza Viruses

View metadata, citation and similar papers at core.ac.uk brought to you by CORE

provided by Elsevier - Publisher Connector Available online at www.sciencedirect.com

Virology 313 (2003) 235Ð249 www.elsevier.com/locate/yviro

Expression of a foreign gene by stable recombinant inﬂuenza viruses harboring a dicistronic genomic segment with an internal promoter

Alexandre Vieira Machado, Nadia Naffakh, Sylvie van der Werf, and Nicolas Escriou*

Unite´deGe´ne´tique Mole´culaire des Virus Respiratoires, URA 1966 CNRS, Institut Pasteur, 25 rue du Dr Roux, 75724 Paris Cedex 15, France Received 18 November 2002; returned to author for revision 18 December 2002; accepted 18 March 2003

Abstract Based on the observation that an internally located 3Ј promoter sequence can be functional (R. Flick and G. Hobom, Virology, 1999, 262(1), 93Ð103), we generated transfectant influenza A viruses harboring a dicistronic segment containing the CAT gene (660 nt) or a fragment of the Mengo virus VP0 capsid gene (306 nt) under the control of a duplicated 3Ј promoter sequence. Despite slightly reduced NA expression, the transfectant viruses replicated efficiently and proved to be stable upon both serial passage in vitro in MDCK cells and in vivo replication in the pulmonary tissue of infected mice. Internal initiation of replication and transcription from the second, internal, 3Ј promoter directed the synthesis of subgenomic vRNA and mRNA and therefore permitted expression of the foreign gene product, e.g., the CAT enzyme. The design of this vector may prove particularly appropriate for the utilization of influenza virus for the expression of heterologous proteins in their native form. © 2003 Elsevier Science (USA). All rights reserved.

Keywords: Inﬂuenza A virus; Transfectant virus; Viral vector; Dicistronic; Subgenomic RNA; Promoter; Neuraminidase; Chloramphenicol acetyltransferase

Introduction primer-independent fashion during the replication process, the transcription of viral mRNA is initiated by a cap-snatch- Influenza A viruses are enveloped negative-strand RNA ing mechanism (Krug et al., 1979). The nascent mRNA viruses belonging to the family Orthomyxoviridae. Their molecules are elongated by copying the vRNA template genome consists of eight different single-stranded RNA from its 3Ј end to a termination and polyadenylation signal segments (vRNA), of which replication takes place in the consisting of a poly(U) sequence of five to seven residues, nucleus of infected cells. In virions and infected cells, the located close to its 5Ј end (Luo et al., 1991; Poon et al., vRNAs are present in the form of ribonucleoproteins 1999; Pritlove et al., 1998). The RNA signals controlling (RNPs) as they are encapsidated by nucleoprotein (NP) replication and packaging of the vRNAs or transcription and molecules and associated with the viral polymerase com- polyadenylation of the viral mRNAs are known to be lo- plex. The latter is a heterotrimer formed by the PB1, PB2, cated within the 5Ј and 3Ј terminal noncoding regions and PA molecules, which ensures both transcription and (NCR) of the vRNA (Luytjes et al., 1989). At the 5Ј and 3Ј replication of the vRNAs. The replication process involves extremities, the first 13 and 12 conserved nucleotides, re- the synthesis of a full-length RNA copy of positive polarity spectively, are almost identical among all eight vRNA seg- (cRNA), which in turn serves as a template for the synthesis ments. They interact together to form a partially double- of new vRNA molecules. As for vRNA, cRNA is found in stranded “corkscrew” structure, which constitues the vRNA the form of RNPs in the infected cells (for a review, see promoter for cRNA and mRNA synthesis (Flick et al., Lamb and Krug, 2001). 1996). Adjacent to these conserved sequences, noncon- Unlike cRNA or vRNA synthesis, which is initiated in a served noncoding sequences of 7 to 45 nucleotides are believed to be involved in the regulation of the replication * Corresponding author. Fax: ϩ33-1-40-61-32-41. and transcription processes (Bergmann and Muster, 1996; E-mail address: [email protected] (N. Escriou). Zheng et al., 1996). A single mRNA species is produced

0042-6822/03/$ Ð see front matter © 2003 Elsevier Science (USA). All rights reserved. doi:10.1016/S0042-6822(03)00289-7 236 A.V. Machado et al. / Virology 313 (2003) 235–249 from each vRNA segment, allowing the expression of one with higher replication levels allowed this type of nones- viral protein per segment, with the exception of the PB1, M, sential segment to be maintained in the viral progeny for and NS segments. These encode an additional protein either more than 10 passages (Neumann and Hobom, 1995; Zhou through the use of an alternate start codon (PB1-F2 protein) et al., 1998). (Chen et al., 2001) or through an alternate splicing mecha- Flick and Hobom demonstrated the ability of the in- nism (M2 and NS2 proteins, respectively) (Inglis et al., fluenza virus polymerase complex to recognize internally 1979; Lamb and Choppin, 1979; Lamb et al., 1981). located 5Ј and 3Ј promoters (Flick and Hobom, 1999). The segmented nature of the influenza genome and the Using this feature, they introduced a new principle for the essentially monocistronic nature of each segment has construction of dicistronic vRNAs by showing that a hampered the development of influenza viruses as vectors recombinant vRNA-like molecule, which contained two for the expression of foreign sequences. However, during reporter gene ORFs [e.g., chloramphenicol acetyl trans- the last decade, the development of reverse genetics tech- ferase (CAT) and green fluorescent protein (GFP)], and niques (for a review, see Neumann and Kawaoka, 2002) an additional 3Ј promoter sequence located in between, has allowed to explore several approaches for the gener- could be transcribed and replicated following two modes, ation of recombinant influenza viruses and enabled to after interaction of the single 5Ј promoter sequence with express heterologous protein sequences. In a first ap- either of the two 3Ј promoter sequences. Two types of proach, the hemagglutinin (HA) or the neuraminidase (NA) have been used as carriers of short foreign polypep- mRNA molecules were thus produced: genomic mRNA tide sequences in transfectant influenza viruses (Ca- allowed translation of the proximal cistron (e.g., GFP), strucci et al., 1992; Li et al., 1993). This strategy was whereas the shorter subgenomic mRNA drove the trans- limited to the use of small-size epitope inserts, up to 12 lation of the second, distal cistron (e.g., CAT). More amino acids in the antigenic site B or E of the HA (as recently, Azzeh et al. (2001) reported another variation reported in Gonzalo et al., 1999; Rodrigues et al., 1994) for the design of dicistronic vRNA-like molecules: in this and up to 28 amino acids in the stalk of the NA (as last approach, they showed that a recombinant vRNA- reported in Castrucci and Kawaoka, 1993). Also, depend- like molecule could be constructed with two reporter ing on the foreign epitope insert, alterations of the struc- genes arranged in an ambisense genetic organization in ture and hence the function of the carrier protein may such a way that the two gene products were translated prevent the generation of viable recombinant viruses. from two complementary mRNAs. In a second approach, much longer polypeptides were In this article, we explored the possibility of rescuing expressed by means of a fusion protein containing an transfectant influenza A viruses harboring, in a stable autocatalytic cleavage site between an essential viral manner, a dicistronic segment with a foreign gene under gene product and the foreign polypeptide (Ferko et al., the control of a duplicated 3Ј promoter. As a model, we 2001; Percy et al., 1994). However, this approach results constructed a dicistronic segment by inserting a second 3Ј in the expression of altered viral and/or foreign proteins promoter sequence and the sequences encoding the CAT due to the presence of the remaining cleavage site se- enzyme (219 aa), in negative-sense orientation, between quences. Alternatively, vRNA segments with additional the NA-coding sequences and the 5Ј promoter sequence translational units have been engineered by the use of an of vRNA segment 6 of the WSN influenza virus. In this internal ribosome entry site (IRES). Following this ap- construct, the NA coding sequences were located at the proach, the A/WSN/33 (WSN) virus NA segment was 3Ј-proximal position, which ensured that the full-length made dicistronic at the level of mRNA translation by dicistronic vRNA segment would be maintained during insertion of the IRES of the human BiP mRNA between propagation of the recombinant virus because NA expres- a foreign and the NA openreading frames (ORFs) (Gar- sion was essential for its viability. Indeed, a transfectant cia-Sastre et al., 1994a). In this case, a single dicistronic virus with such a dicistronic NA-CAT segment was res- mRNA species directs the translation of the foreign protein from the first ORF by a cap-dependent mechanism, cued and we demonstrated that internal initiation of tran- Ј whereas translation of the NA coding sequences occurs scription from the second 3 promoter directed the syn- via internal binding of the ribosomes to the IRES. thesis of subgenomic vRNA and mRNA, which resulted Yet another approach relied on the replication and pack- in expression of the CAT enzyme. Moreover, this virus aging by wild-type influenza viruses of a ninth synthetic and proved to be stable upon both serial passage in vitro and independent, pseudoviral RNA segment composed of a for- replication in the pulmonary tissue of infected mice. eign ORF, in negative-sense orientation, flanked by the Similar constructs allowed rescue of viruses carrying a terminal 5Ј and 3Ј promoter sequences (Luytjes et al., 1989; shorter reporter gene coding for a fragment of Mengo Neumann et al., 1994). However, the rescue of such a virus VP0 capsid protein (101 aa) but not of viruses synthetic RNA segment by influenza virus was only tran- carrying the longer GFP sequences (239 aa), suggesting sient and the ninth segment is usually lost upon a few the existence of constraints on the size or the nature of passages, although, recently, the use of 3Ј promoter mutants the inserted foreign sequences. A.V. Machado et al. / Virology 313 (2003) 235–249 237

Fig. 1. Schematic representation of transfer plasmids for the synthesis of dicistronic NA vRNA segments derived from the A/WSN/33 inﬂuenza virus. Plasmid pPR-NA35 was derived from plasmid pPR-NA, which contains the full-length NA segment cDNA in negative-sense orientation under the control of a truncated human pol I promoter, as described under Materials and methods. It contains a recombinant NA segment cDNA, in which the NA ORF is followed by a duplicated 3Ј promoter, an XhoI/ NheI linker, and the original 5Ј promoter. The VP0c, CAT, or GFP ORF sequences were inserted between the XhoI and NheI restriction sites, yielding plasmids pPR-NA35-VP0c, -CAT, and -GFP, respectively. The pPR-NA37 plasmid was derived from pPR-NA35 by deletion of the duplicated 3Ј promoter sequence. P-pol1:truncated human polymerase I promoter (Ϫ254 to Ϫ1 nucleotides). HDV-R:hepatitis ␦ virus genomic ribozyme.

Results genes of various sizes were inserted into the MCS: the CAT gene (660 nt), the GFP gene of Aequorea victoria (720 nt), CAT expression by dicistronic recombinant vRNA-like and a sequence coding for a fragment of the VP0 protein of molecules carrying a duplicated 3Ј promoter sequence Mengo virus (VP0c, 306 nt). Thus, the pPR-NA35 plasmid series direct the synthesis of vRNA-like molecules, which Based on the ability of the inﬂuenza polymerase complex contain the NA ORF of WSN downstream of the original 3Ј to recognize an internally located 3Ј promoter (Flick and promoter and a second ORF (CAT, GFP, or Vp0c) down- Hobom, 1999), we explored the possibility of expressing stream of the duplicated 3Ј promoter, followed by the 5Ј foreign sequences by means of a genomic segment contain- promoter of the NA RNA segment of WSN. The control ing a duplicated and internally located 3Ј promoter. We used pPR-NA37 plasmid series, which directs the synthesis of the NA segment of WSN virus since reverse genetics of this dicistronic vRNA-like molecules from which the internal 3Ј segment is simple and very efﬁcient (Pleschka et al., 1996) promoter sequence has been deleted, was constructed in to derive the NA35 series of dicistronic vRNA-like mole- parallel. cules. As described under Materials and methods, the cDNA To determine whether the duplicated 3Ј promoter would of these molecules were cloned, in negative-sense orienta- be recognized in its internal location as could be expected tion, in plasmid pPR7 downstream of the truncated human from previously published work (Flick and Hobom, 1999), RNA polymerase I promoter and upstream of the ribozyme transient expression assays were performed after in vivo sequence of the hepatitis ␦ virus (Crescenzo-Chaigne et al., reconstitution of functional vRNPs. COS-1 cells were trans- 1999). A duplication of the 19 nucleotides of the 3Ј non- fected with the pPR-NA35-CAT plasmid together with the coding region (3Ј promoter sequence) together with an four polymerase II (pol II) expression plasmids pcDNA- XhoI-NheI multiple cloning site (MCS) were inserted be- PB1, pcDNA-PB2, pcDNA-PA, and pcDNA-NP and North- tween the stop codon and the 5Ј promoter sequence of the ern blot analysis was performed on total RNA extracted WSN NA segment (Fig. 1). Subsequently, three reporter 48 h later. After hybridization to a positive-sense riboprobe 238 A.V. Machado et al. / Virology 313 (2003) 235–249

fected cells (120 ng/106 cells). Neither subgenomic RNA molecules nor consistent CAT expression were observed when the internal 3Ј promoter was deleted from the dicistronic molecule (NA37-CAT construct). This proved the absence of internal initiation of subgenomic RNAs from genomic vRNA or cRNA molecules lacking an internal promoter element. Residual CAT protein expressed from NA37-CAT molecules (1.5 ng/106 cells) was interpreted as a read-through of the NA ORF stop codon and was consistent with the fact that the CAT initiating methionine was in-frame with the NA ORF in this construct. Similar results were obtained with pPR-NA35-GFP and pPR-NA35-VP0c plasmids, both at the level of vRNA when Northern blots were performed with appropriate probes and at the level of expression, when GFP expression was measured by cytofluorometry at 530 nm (data not shown). In parallel, NA expression was also revealed for the three NA35, NA35-CAT, and NA35-VP0c constructs by flow cytometry analysis of transfected cells after labeling with monoclonal antibody 10C9 directed against the WSN NA (data not shown). These results suggest that the dicistronic NA35-CAT vRNA molecules were replicated and transcribed by the influenza RNA polymerase complex according to two different modes, a genomic and a subgenomic mode. After interaction of the unique 5Ј promoter with the external 3Ј promoter, the first mode allowed replication of the full- length (genomic) dicistronic RNA molecule, transcription of a full-length mRNA, and therefore, expression of the NA gene product. Alternatively, interaction of the 5Ј promoter with the duplicated internal 3Ј promoter resulted in replication of a subgenomic RNA molecule in which the CAT Fig. 2. Transient expression of the CAT gene from the recombinant Ј Ј dicistronic NA35-CAT RNA. Subconfluent monolayers of COS-1 cells ORF sequences were flanked by the 5 and 3 promoter, and were transfected by a mixture of plasmids pcDNA-NP, pcDNA-PA, in transcription of the corresponding subgenomic mRNA pcDNA-PB1, and pcDNA-PB2, together with each of the pol I expression from which CAT was expressed. plasmids indicated and then incubated at 35¡C, as described under Mate- rials and methods. At 48 h posttransfection, total cellular RNA was prepared and analyzed by Northern blot for the presence of negative-sense Rescue of transfectant WSN viruses with dicistronic NA genomic and subgenomic vRNAs (A) or for the presence of positive-sense segments cRNAs or mRNAs (B) with positive-(A) or negative-(B) sense 32P-labeled riboprobes specific for CAT sequences, prior to exposure on a Storm Reporter gene and NA expression suggested that dicis- phosphorimager (Molecular Dynamics). Positions of genomic (closed ar- tronic molecules of the NA35 series could be used for the rowheads) and subgenomic (open arrowheads) RNAs and of molecular weight markers (kb) are indicated. In parallel, cytosolic cell extracts were construction of transfectant influenza viruses containing a prepared at 48 h post transfection and assayed for CAT levels (C). Levels dicistronic segment. Indeed, following vRNP reconstitution are given in nanograms of CAT protein for 106 transfected cells. in COS cells simultaneously infected with the WSN-HK helper virus as described by Pleshka et al. (1996), the NA35-CAT and NA35-VP0c RNAs could be rescued into specific for CAT sequences, two RNA species could be infectious viruses, which were able to form plaques on detected (Fig. 2A): they corresponded in size to the full- MadinÐDarby bovine kidney (MDBK) cells. It is notewor- length NA35-CAT vRNA-like molecule (2104 nt) and to a thy that the efficiency of rescue of these transfectant viruses shorter subgenomic molecule constituted by the CAT gene harboring a dicistronic NA segment (vNA35-CAT and sequences flanked by 5Ј and 3Ј noncoding sequences (719 vNA35-VP0c) was markedly reduced when compared with nt). Similar analyses performed with a negative-sense ribo- that of a wild-type virus harboring a monocistronic WSN probe allowed the detection of full-length genomic cRNA NA segment. In several independent reverse genetics ex- and mRNA and shorter subgenomic cRNA and mRNA (Fig. periments, using the wild-type NA segment, infectious 2B). As shown in Fig. 2C, high levels of CAT expression WSN (vNA) viruses were rescued up to titers of 105 to 106 were also measured in cytosolic extracts from these trans- PFU/ml, whereas titers of only 101 PFU/ml (vNA35-CAT) A.V. Machado et al. / Virology 313 (2003) 235Ð249 239 or 102 to 103 PFU/ml (vNA35, vNA35-VP0c) were ob- clone 2 which exhibited an A-to-G mutation at position 17Ј tained for transfectant viruses with dicistronic segments. of the genomic 3Ј NCR (data not shown). Despite numerous attempts, the dicistronic NA35-GFP To evaluate the genetic stability of the vNA35-CAT and RNA was never rescued into infectious virus. The transfec- vNA35-VP0c dicistronic viruses, several clones of each tant viruses were plaque purified twice on MDBK cells and virus were serially passaged five or six times on MDCK several independent clones were selected for further char- cells at a low m.o.i. and their NA segment vRNA was acterization. analyzed by RT-PCR as for the first passage (Fig. 3D). No evidence of deletion of the VP0c-inserted sequences could Characterization of vNA35-CAT and vNA35-VP0c be observed for the three vNA35-VP0c clones tested, transfectant viruses whereas a fragment of a slightly smaller size was identified for one of three vNA35-CAT clones (clone 2) at p5. Se- The plaque phenotype of the transfectant viruses was quencing of the corresponding PCR product revealed a evaluated in MadinÐDarby canine kidney (MDCK) cells small in-frame deletion of 30 nucleotides in the CAT ORF. under an agarose overlay in the absence of an exogeneous Sequencing of all the other PCR products revealed only two source of protease, but in the presence of 2% FCS. No more mutations found in the CAT ORF of vNA35-CAT significant differences were observed between the plaque clone 3: a U3 C change at position 602 (Val3 Ala) and a size of wild-type WSN (vNA) virus and vNA35, a trans- G 3 A change at position 652 (Gly3 Arg). To further fectant virus with a duplication of the 3Ј promoter but no evaluate genetic stability, one clone of each virus was fur- insertion of foreign sequences. In contrast, the vNA35- ther passaged up to p10 on MDCK cells. Each of the viruses VP0c virus gave slightly smaller plaques and vNA35-CAT was found to have retained the inserted sequences when definitely gave medium-sized plaques (Fig. 3A). Similar their NA segment was subjected to RT-PCR analysis as results were obtained when plaque assays were performed described above (data not shown). on MDBK cells (data not shown), suggesting that the rep- Since Fodor et al. showed that the impaired growth lication of the dicistronic viruses could be impaired. properties of some mutated WSN viruses were due to re- To determine whether the efficiency of multiplication of duced levels of neuraminidase expression (Fodor et al., the dicistronic viruses was altered, growth kinetics were 1998), we examined NA expression by the dicistronic vi- performed on MDCK cells and compared with those of the ruses described above. MDCK cells were infected with wild-type vNA and the vNA35 viruses. A representative wild-type WSN (vNA) or dicistronic vNA35, vNA35-VP0c, experiment is shown in Fig. 3B, but similar results were or vNA35-CAT viruses at an m.o.i. of 2 and, 8 h later, NA obtained for the other viral clones. The maximum yields of expression at the cell surface was determined by FACS both vNA35 and vNA35-VP0c viruses were reached 48 h analysis, as described under Materials and methods. As after infection with viral titers that were about 0.5 and 1 shown in Fig. 3C, cells infected with dicistronic vNA35- 9 log10 unit lower than that of wild-type vNA virus (10 VP0c or vNA35-CAT viruses showed, respectively, a 54 PFU/ml), respectively. In contrast, the growth rate of the and 71% reduction in NA expression as compared to cells vNA35-CAT virus was significantly lower, with titers infected with vNA, whereas cells infected with vNA35 or reaching the level of 107 PFU/ml only (Fig. 3B). This was vNA expressed similar amounts of NA (not shown). These in agreement with the smaller plaque phenotype of the reduced levels of NA expression could account for the vNA35-CAT virus. Thus, despite an elongated NA segment impaired growth properties of the dicistronic viruses. In and a duplicated 3Ј promoter, dicistronic viruses were ca- addition, we observed that the growth properties of the pable of replicating efficiently in MDCK and MDBK cells. vNA37-CAT virus, similar in design to vNA35-CAT but To confirm the presence of the dicistronic segments in with a deletion of the 3Ј internal promoter, were at least as the rescued transfectant viruses, viral RNA was extracted impaired as those of vNA35-CAT. Indeed vNA37-CAT from working stocks at passage p1 and subjected to RT- grew to low titers (106 PFU/ml) and gave small-to-medium- PCR analysis, as described under Materials and methods. sized plaques on MDCK cells (Fig. 3E). This observation With primers NA/ϩ/1085 and NA/NC/5Ј designed to am- suggested that the impaired growth properties of the dicis- plify the whole region of insertion and located, respectively, tronic virus mainly resulted from the insertion of foreign in the NA ORF and 5Ј promoter, amplified fragments of the sequences into their NA segment rather than from compe- expected size were observed for all clones analyzed (Fig. tition of the duplicated 3Ј internal promoter with the 3Ј 3D). Direct sequencing of all these PCR products demon- external promoter for interaction with the single 5Ј pro- strated that the duplicated 3Ј promoter and the entire CAT moter. or VP0c sequences were present and identical to those of the plasmids from which the viruses were derived. In addition, NA-specific RNA levels in cells infected with the RACE analysis of the 5Ј and 3Ј termini of the NA segment dicistronic viruses vRNAs indicated that external noncoding regions of the rescued dicistronic viruses were identical to those of wild- MDCK cells were infected with wild-type WSN (vNA) type WSN virus (vNA), with the exception of vNA35-CAT or dicistronic vNA35, vNA35-VP0c, or vNA35-CAT vi- 240 A.V. Machado et al. / Virology 313 (2003) 235Ð249 A.V. Machado et al. / Virology 313 (2003) 235Ð249 241 ruses at an m.o.i. of 2 and total RNA was isolated from cells mRNA were also detected with a negative-sense CAT- at 8 h postinfection. NA-specific vRNA and cRNA/mRNA specific riboprobe (Fig. 5B). It is noteworthy that the sub- levels were analyzed by Northern blot using the NP gene as genomic RNAs were far less abundant than the full-length an internal control. Although the amount of NP vRNA was dicistronic genomic RNAs, suggesting that they were less similar in dicistronic and wild-type vNA virus-infected efficiently replicated when the influenza polymerase com- cells, the amount of NA vRNA was about 13 times lower in plex was expressed following infection rather than recon- vNA35-CAT-infected cells and 3 times lower in vNA35- stituted following transfection of the plasmids expressing VP0c-infected cells as determined by phosphorimager anal- the four core proteins (compare with Fig. 2A). ysis (Fig. 4A). Similar results were obtained when cRNA/ Next, the CAT production was examined in extracts of mRNA levels were analyzed (Fig. 4B). Whether these COS-1 cells infected at an m.o.i. of 2 with the dicistronic reduced NA RNA levels resulted from a decrease in NA vNA35 or vNA35-CAT viruses. Expression of CAT was RNA synthesis or from a decrease in RNA stability remains detected in infected cells at 8 h postinfection (1.8 Ϯ 0.7 to be determined. However, as the reduction of RNA levels ng/106 cells) and increased with time up to 24 h postinfec- was most pronounced in the case of vNA35-CAT, it seems tion (11.6 Ϯ 5.0 ng/106 cells), when cells began to show a more likely that the overall efficiency of vRNA, cRNA, and typical cytopathic effect (Fig. 5C). mRNA synthesis of the NA segment might be diminished as Similarly, low ratios of subgenomic-to-genomic RNAs a result of the increased length of the corresponding tem- were observed in cells infected with the vNA35-VP0c virus plates. but, presumably due to the poor sensitivity of poly-histi- dine-tagged protein detection by Western blot, we have Analysis of viral RNA and CAT expression by the been unable to detect expression of the Mengo virus VP0c dicistronic vNA35-CAT virus polypeptide in infected cells.

Since NA expression is required for viral infectivity in Dicistronic vNA35-VP0c virus replicates efficiently in MDBK cells, the viability and genomic characteristics of mice the recombinant dicistronic viruses (see above) demonstrated that the viral polymerase complex expressed in the We next examined the potential of the dicistronic course of influenza virus infection was able to replicate and vNA35-VP0c virus to replicate in the respiratory tract of transcribe the recombinant dicistronic RNA according to the C57BL/6 mice. Male mice were inoculated intranasally genomic mode, which allowed propagation of the genetic under light ketamine anesthesia with 103 PFU of wild-type information of the recombinant virus. WSN (vNA) or dicistronic vNA35 or vNA35-VP0c viruses. To confirm that the polymerase complex expressed in the This dose was selected because, according to preliminary context of infected cells was also able to transcribe and experiments, it corresponded to 0.1 LD50 of the wild-type replicate the dicistronic RNA according to the subgenomic WSN (vNA) virus and was sufficient to induce a nonlethal mode, Northern blot analysis was performed on total RNA viral pneumonia in more than 95% of the infected C57BL/6 extracted from COS-1 cells, infected with recombinant mice, with maximum pulmonary virus titers observed 4 vNA35 or two independant clones of vNA35-CAT. As for days after inoculation. In mice infected with the vNA35 or the transient expression assay, two vRNA-like species could vNA35-VP0c virus, as for mice infected with wild-type be detected with a CAT-specific riboprobe, vRNA-like mol- WSN (vNA) virus, the lungs showed a hepatized aspect, ecules of full-length genomic size, and shorter subgenomic typical of viral pneumonia (data not shown). Pulmonary molecules (Fig. 5A). Genomic and subgenomic cRNA/ viral loads in mice infected with vNA35 (4.7 Ϯ 1.2

Fig. 3. Multiplication and stability of transfectant influenza viruses with dicistronic NA segments. (A) The plaque phenotype of the indicated transfectant viruses was assayed on MDCK cells in a standard plaque assay as described under Materials and methods. Cell monolayers were stained with crystal violet after 3 days of incubation at 35¡C and are shown for several independent clones (Cx). (B) The growth properties of the indicated transfectant viruses were analyzed on MDCK cells. Confluent cell monolayers were infected at an m.o.i. of 0.001. At the indicated time points, the supernatants were collected and virus titers (PFU/ml) were determined on MDCK cells in a standard plaque assay. (C) At 8 h after infection, mock-infected MDCK cells (dotted line), or cells infected with wild-type WSN(vNA) (bold line), vNA35-VP0c (dashed line), and vNA35-CAT (solid line) were detached from the plates with the cell dissociation solution (Sigma) and expression of the NA was determined by labeling the cells with the anti-NA mouse monoclonal antibody 10C9. Bound antibodies were detected with FITC-labeled anti-mouse IgG antibodies and, after fixation of the cells in PBS-PFA, flow cytometry analysis was performed on a FACScalibur fluorospectrometer (BectonÐDickinson). (D) Genetic stability of the transfectant viruses. Independent clones (Cx) of vNA35, vNA35-CAT, and vNA35-VP0c viruses were passaged five to six times on MDCK cells at an m.o.i. of 0.01. The viral RNAs from wild-type vNA or from the first and last passages of the indicated transfectant viruses were analyzed by RT-PCR using the NA/ϩ/1085 and NA/NC/5Ј oligonucleotide primers. The position of the primers is indicated by solid arrows on a schematic drawing of the vNA35-CAT vRNA. Corresponding plasmid DNAs were amplified in parallel. The amplified products were analyzed on a 1% agarose gel and visualized by ethidium bromide staining. MW: molecular weight markers; the size (bp) is indicated in the middle. ¯: amplification of RNA from mock-infected cells. (E) The plaque phenotype of the wild-type WSN (vNA) and recombinant vNA35-CAT and vNA37-CAT viruses was compared on MDCK cells. Cell monolayers were stained with crystal violet after 3 days of incubation at 35¡C and are shown for one representative clone. 242 A.V. Machado et al. / Virology 313 (2003) 235Ð249

from the lung homogenates of infected mice was performed. As shown in Fig. 6B, vNA35 and vNA35-VP0c retained the foreign inserted sequences upon multiplication in the lungs of infected mice. Sequencing of the corresponding PCR products did not reveal any mutation in the duplicated 3Ј promoter, nor in the VP0c ORF, when compared to the inoculated virus, indicating that dicistronic viruses with a duplicated internal 3Ј promoter were genetically stable in vivo. Since the vNA35-CAT replicated less efﬁciently in cell culture than the vNA35-VP0c, we compared their replica-

Fig. 4. Analysis of NA viral RNAs in infected cells. Monolayers of MDCK cells were mock infected or infected with wild-type WSN (vNA) or transfectant vNA35, vNA35-CAT, or vNA35-VP0c viruses at an m.o.i. of 2 and incubated at 35¡C for 8 h. Total cellular RNA was prepared and analyzed by Northern blot for the presence of vRNAs (A) or cRNAs/ mRNAs (B) with 32P-labeled positive-(A) or negative-(B) sense riboprobes specific for NA or NP sequences, prior to exposure on a Storm phosphorimager (Molecular Dynamics). The position of molecular weight markers (kb) is indicated. Fig. 5. Expression of the CAT gene by the dicistronic vNA35-CAT virus. Monolayers of COS-1 cells were mock infected or infected with transfec- Ϯ tant vNA35 or vNA35-CAT viruses at an m.o.i. of 2 and incubated at 35¡C log10PFU) or vNA35-VP0c (4.8 0.3 log10PFU) were for 24 h. Total cellular RNA was prepared and analyzed by Northern blot slightly but significantly lower than those observed for mice for the presence of genomic (closed arrowheads) and subgenomic (open infected with wild-type WSN (vNA) virus (5.9 Ϯ 0.1 arrowheads) vRNAs (A) or cRNAs/mRNAs (B) with 32P-labeled positive- Ͻ (A) or negative-(B) sense riboprobes specific for CAT sequences, prior to log10PFU, P 0.1) (Fig. 6A). These results suggested that recombinant viruses harboring dicistronic NA segments exposure on a Storm phosphorimager (Molecular Dynamics). The position of molecular weight markers (kb) is indicated. (C) Cytosolic cell extracts could efficiently replicate in the lower respiratory tract of were prepared at 8 (hatched bars) and 24 (black bars) h after infection and mice. assayed for CAT levels as described under Materials and methods. Levels Furthermore, RT-PCR analysis of the viruses recovered are given in nanograms of CAT protein for 106 infected cells. A.V. Machado et al. / Virology 313 (2003) 235Ð249 243

tive potential in vivo. Pulmonary viral loads in mice in- Ϯ fected with vNA35-CAT (4.3 0.2 log10PFU) were slightly lower than those observed for mice infected with Ϯ ϭ vNA35-VP0c virus (4.6 0.5 log10PFU, P 0.3) (Fig. 6C). RT-PCR analysis of the recovered viruses conﬁrmed that, despite less efﬁcient replication, the vNA35-CAT virus was also genetically stable in vivo (data not shown).

Discussion

The rescue of influenza viruses harboring a dicistronic segment for the expression of heterologous genes has previously been successful by making use of an IRES which directs the translation of the foreign protein (Garcia-Sastre et al., 1994a). In this article, based on the initial observation from Flick and Hobom (1999), we showed that it is possible to rescue stable transfectant influenza viruses harboring a segment made functionally dicistronic at the level of transcription rather than at the level of translation by means of an internal duplication of the 3Ј promoter sequence. Indeed, a recombinant dicistronic vRNA derived from the NA segment carrying an internal duplication of the 3Ј promoter sequence was shown to be transcribed and replicated along two modes: a genomic mode involving interaction of the 5Ј promoter with the external 3Ј promoter sequence, resulting in the synthesis of full-length genomic mRNA and c/vR- NAs; and a subgenomic mode involving interaction of the 5Ј promoter with the internal 3Ј promoter sequence, resulting in the synthesis of subgenomic c/vRNAs and monocistronic mRNA. In addition, the dicistronic segment was found to be stably maintained upon passage of the recombinant virus in cell culture as well as in vivo in mice and to direct expression of heterologous sequences. Whereas in a transient replication assay similar amounts of genomic and subgenomic RNA molecules were detected, upon infection with the recombinant viruses the genomic RNA molecules were predominant. This suggested that replication and/or transcription from the internal 3Ј promoter was less efficient in the context of the infected cell than

lung homogenates were prepared and titrated for virus by plaque assay on MDCK cells, as described under Materials and methods (A). Viral titers

were expressed as log10 (PFU/lungs) for individual mice. The titration limit is indicated by the dotted line. Viral RNAs from the inoculated viruses (inoc.) or from viruses recovered from the lungs of individual mice (1Ð5) were extracted and analyzed by RT-PCR using the NA/ϩ/1085 and NA/ NC/5Ј oligonucleotide primers (B). The position of the primers is indicated by solid arrows on a schematic drawing of the vNA35-VP0c vRNA. The amplified products were analyzed on a 1% agarose gel and visualized by ethidium bromide staining. MW: molecular weight markers; the size (kb) is indicated on the right. ¯: amplification of RNA from mock-infected mice. Data shown are from one experiment representative of two. In a separate experiment, groups of seven C57BL/6 mice were infected intra- Fig. 6. Multiplication of dicistronic transfectant viruses in mice. Groups of nasally with 103 PFU of wild-type WSN (vNA) or dicistronic vNA35- five C57BL/6 mice were infected intranasally with 103 PFU of the indi- VP0c or vNA35-CAT viruses. Pulmonary viral loads were determined 4 cated viruses. Four days after the inoculation, mice were euthanized and days after the inoculation, as described above (C). 244 A.V. Machado et al. / Virology 313 (2003) 235Ð249 when functional RNPs were reconstituted following trans- suggested that the overall efficiency of RNA syntheses from fection of the four core proteins. This could be due to the NA segment was diminished as a result of the insertion modulation of the properties of the polymerase complex by of the foreign sequences (Fig. 4). This could not be attrib- some viral, or virus-induced, factors in the infected cell that uted to the presence of the 3Ј internal promoter sequence could increase its requirement for interaction with both itself as viruses harboring similar dicistronic segments but termini of the genomic RNA. Another possibility could be lacking the internal 3Ј promoter sequence (NA37 con- that regulatory or packaging sequences are located within structs) had similarly altered growth properties (Fig. 3E). the viral coding sequences, as was shown for several posi- More likely, the altered phenotype could be related to the tive-strand RNA viruses (Fosmire et al., 1992; McKnight increased size of the NA segment. Indeed, reduction in NA and Lemon, 1996; Weiss et al., 1994) or suggested by the RNA levels, plaque size, and virus growth were more pro- analysis of influenza DI RNAs (Duhaut and Dimmock, nounced in the case of vNA35-CAT (2104 nt) than for 2000, 2002; Odagiri and Tashiro, 1997). Such sequences if vNA35-VP0c (1750 nt) as compared to vNA35 (1445 nt) or present on the genomic vRNA but lacking on the sub- wild-type WSN (1409 nt). Such size effect may also account genomic vRNA could account for the observed differences for the fact that a transfectant vNA35-GFP virus (2164 nt) in the relative levels of subgenomic versus genomic RNAs could not be rescued. Rather than the overall size, insertion between transfected and infected cells. This raises the ques- of the foreign sequences may affect the proper assembly of tion of the origin of the subgenomic RNA molecules. These functional RNPs, as it has been shown that model RNAs, could be generated by internal initiation from genomic the length of which is a multiple of 48 nt, are replicated vRNA and could also subsequently result from amplifica- more efficiently (Ortega et al., 2000). In our case, based on tion by the viral polymerase. Similarly, subgenomic mR- the length of the different NA segments no obvious corre- NAs may result from either internal initiation reactions lation of that sort could be made. However, as previously during transcription of the genomic vRNA or transcription suggested by Ortega et al., such effect could be more pro- of subgenomic vRNA. Kinetic studies of the synthesis of the nounced for smaller size RNAs and may not strictly apply to different RNA species in either transfected or infected cells the longer genomic RNAs (Ortega et al., 2000). Improper may help solve this question. In addition, it remains to be encapsidation could therefore contribute to explain why determined whether upon passage of the recombinant vi- replication of subgenomic vRNA is less efficient in infected ruses, subgenomic RNAs arise by internal initiation on the cells than replication of full-length genomic NA vRNA dicistronic vRNA at each viral cycle or alternatively result (Fig. 5). In addition to the size effects, alteration of viral from amplification of subgenomic vRNA molecules that growth and unefficient replication of subgenomic vRNAs could be packaged in the viral particles. Preliminary data may be related to the nature of the inserted sequences. (not shown) indicating that subgenomic vRNAs could be Indeed, it has been shown that the noncoding extremities of detected in purified virions suggested that the subgenomic each vRNA segment are specific to the ORFs they contain RNAs could be replicated and maintained as an additional (Zheng et al., 1996). Therefore, the reconstitution of a fully segment in the virus progeny. functional promoter in the context of the infected cells may The recombinant viruses harboring a dicistronic RNA be dependent on the nature of the inserted sequences. In this segment showed an altered phenotype in terms of plaque respect it is interesting to note that, whereas the GC content size and virus multiplication. This could be correlated with of the NA ORF is 44% the GC content of the CAT and the reduced steady-state levels of NA vRNA and c/mRNA VP0c ORF were in the same range (45 and 48%, respec- and also with the reduced steady-state levels of neuramin- tively), while the GC content of the GFP ORF was notably idase in cells infected with the vNA35-CAT and vNA35- higher (62%), which may contribute to the fact that a VP0c viruses as compared to the wild-type (Fig. 3C and 4). vNA35-GFP virus could not be rescued. The average GC It is likely that the lower levels of the NA vRNA in cells content of the WSN virus genome segments is 43.9 Ϯ 1.5% infected with the dicistronic viruses resulted in a reduced and sequences with notably higher GC content may not be packaging of this segment into budding viral particles and efficiently replicated or transcribed by the viral polymerase. therefore suboptimal yields of infectious particles. In addi- The recombinant dicistronic viruses were found to be tion, since the NA is involved in the release of virus parti- stable as they retained the inserted sequences upon succes- cles from infected cells (Palese and Compans, 1976), re- sive passages in cell culture and the frequency of mutations duced expression of the NA may hamper propagation of the detected within the inserts fell within the expected range of recombinant dicistronic viruses. Viruses expressing reduced the mutational rate of the influenza polymerase (0.68Ð3.2 ϫ NA levels have been shown to have altered growth proper- 10Ϫ5, as measured by Parvin et al., 1986; Stech et al., 1999; ties (Fodor et al., 1998) and to be attenuated in mice (So- Suarez-Lopez and Ortin, 1994). Nevertheless, the possibil- lorzano et al., 2000). In this study, the viral load in the lungs ity that mutations resulting in increased expression of the of mice inoculated with the recombinant vNA35-VP0c or NA could arise upon propagation of the recombinant viruses vNA35-CAT viruses was found to be significantly reduced was investigated. No mutations within the noncoding se- as compared to that of the wild-type (wt) virus. quences could be detected after five passages of the viruses, Reduced steady-state levels of NA vRNA and c/mRNA except for one clone of vNA35-CAT, which harbored an A.V. Machado et al. / Virology 313 (2003) 235Ð249 245

A-to-G mutation at position 17 of the genomic 3, NCR. This shown here expression of the 219-aa-long CAT protein mutation did not seem to result in improved growth prop- could be achieved by this approach. Even greater coding erties nor in increased expression of the NA (data not capacity can be expected from smaller segments such as the shown). The possibility that substitutions in the noncoding M or NS segment. However, it remains to be determined regions of the NA segment could improve transcription whether dicistronic vRNA molecules with a duplicated 3Ј and/or replication of the genomic NA segment and hence NC region and inserted foreign sequences can be engineered result in increased expression of the NA was therefore from these segments without interfering with the alternative considered. Based on the promoter “up” effect of substitu- splicing of the mRNA required for expression of the M2 and tions in the 3, NCR of the HA segment of the A/Victoria/ NS2 proteins, respectively. 3/75 (H3N2) virus for the polymerase complex of the Finally, this novel type of recombinant influenza virus A/FPV/Bratislava virus (Neumann and Hobom, 1995), we could have several potential applications. The possibility of introduced the corresponding mutations, i.e., G3A, U5C, using such dicistronic constructs for an indirect selection of and C8U substitutions, in the external 3Ј promoter of the any foreign or mutated viral gene to be incorporated into dicistronic NA35-CAT segment. No viable transfectant vi- recombinant influenza viruses has been suggested previ- ruses harboring these substitutions could be rescued, which ously (Flick and Hobom, 1999). In that case the gene which could be related to the fact that the promoter up effect was is to be maintained as a subgenomic vRNA should be placed recently shown to depend on the origin of the polymerase under the control of the internal 3Ј promoter sequence, complex (Crescenzo-Chaigne et al., 2002). It will be of whereas the selectable gene that will ultimately be lost interest to determine whether the introduction of other sub- should be located in the 3Ј proximal position of the vRNA. stitutions in the external 3Ј promoter sequence could result The dicistronic viruses described here essentially exhibit the in preferential transcription and/or replication of the opposite arrangement and were designed in such a way that genomic segment over that of the subgenomic segment, and the dicistronic segment will be maintained upon passages. hence improve growth of the dicistronic viruses without Since such recombinant dicistronic viruses were found to be impairing expression of the foreign sequences. Yet other stable both in vitro in cell culture and in vivo in mice, they mutations may potentially compensate for the reduced NA could represent a new way of producing live-recombinant levels produced by the recombinant dicistronic viruses de- vaccines against respiratory or other pathogens for humans. scribed here. These could be located in the NA ORF, re- Attenuated influenza viruses such as the cold-adapted influ- sulting in an increased activity of the NA, or even in the HA enza virus strains that are currently being considered for the gene, resulting in a decreased dependence on NA activity as production of a live-attenuated influenza vaccine (Beyer et shown for instance in the case of viruses resistant to anal., 2002) could prove useful as vectors for that purpose. tineuraminidase inhibitors (Gubareva et al., 1996). In comparison with strategies that rely on the expression of fusion proteins (Ferko et al., 2001; Percy et al., 1994; Materials and methods Takasuka et al., 2002), recombinant dicistronic viruses with an internal 3Ј promoter duplication allow expression of Cells and viruses native proteins devoid of additional sequences and permit a minimal increase in the length of the recombinant segments. MDBK and MDCK cells were grown at 37¡C under 5%

Although expression of foreign proteins in their native form CO2 in complete Dulbecco’s modified Eagle’s medium could also be achieved from a dicistronic segment with an (DMEM) with 1 mM sodium pyruvate, 4.5 mg/ml L-glu- inserted IRES and a second translational unit (Garcia-Sastre cose, 100 U/ml penicillin, and 100 ␮g/ml streptomycin, et al., 1994a), this latter strategy is likely to be hampered by supplemented with 5% heat-inactivated fetal calf serum the highly structured nature of the IRES sequence as well as (FCS) (TechGen). COS-1 cells were grown in complete by size constraints that could limit the replication efficiency DMEM supplemented with 10% FCS. of the recombinant segments. Thus, the largest foreign Influenza virus A/WSN/33 (WSN, H1N1) and the polypeptides reported to be expressed using this approach WSN/HK (H1N2) reassortant were kindly provided by Dr. did not exceed 91 aa when using the human Bip IRES to Peter Palese (Mount Sina¬õ School of Medicine, New York, express the NA (Garcia-Sastre et al., 1994a) or 125 aa when USA). Viral stocks were produced by serial allantoic pas- the foreign ORF was placed under the control of the IRES sage on 11-day-old embryonated hen’s eggs. of the EMCV (Garcia-Sastre et al., 1994b). Similarly, when using the Bip IRES to direct expression of the NA from a Construction of transfer plasmids for reverse genetics dicistronic segment, we were able to rescue transfectant viruses expressing the VP0c fragment (101 aa), but not For the construction of transfer plasmids, cDNAs corre- those expressing the longer CAT or GFP proteins (A. Vieira sponding to wild-type or recombinant NA segments of the Machado and N. Escriou, unpublished observations). As WSN influenza virus were cloned in negative-sense orien- noted earlier, size constraints might also apply to dicistronic tation into the polymerase I (pol I) expression plasmid segments with an internal 3Ј promoter duplication, but as pPR7, which contains a truncated human RNA polymerase 246 A.V. Machado et al. / Virology 313 (2003) 235Ð249

I promoter and the hepatitis ␦ virus ribozyme and allows the Production of recombinant viruses by reverse genetics synthesis of a viral RNA-like transcript in transfected cells (Crescenzo-Chaigne et al., 1999). The procedures used for the production of the recombi- Briefly, the entire NA segment cDNA was amplified by nant influenza viruses by reverse genetics were as described PCR with the PWO polymerase (Roche) using plasmid previously by Pleschka et al. (1996). Briefly, each of the pT3NAM1 (kindly provided by Dr. Peter Palese; Garcia- purified pol I transfer plasmids (1 ␮g) was transfected into Sastre et al., 1994a) as a template and oligonucleotides a subconfluent monolayer of COS-1 cells (3 ϫ 105 cells in 5Ј-AGCAAAAGCAGGAGTTTAAATG-3Ј and 5Ј-AGTA- 35-mm dishes) together with plasmids pHMG-NP (2 ␮g), GAAACAAGGAGTTTTTTGAAC-3Ј. The pPR-NA plas- pHMG-PA (1 ␮g), pHMG-PB1 (1 ␮g), and pHMG-PB2 (1 mid was obtained by insertion of the resulting DNA frag- ␮g) by using 10 ␮l of Fugene6 reagent (Roche) according to ment (in negative-sense polarity) between the two Klenow- the manufacturer’s recommendations. pHMG plasmids treated BbsI sites of plasmid pPR7. were kindly provided by Dr J. Pavlovic (Institute fu¬r Mediz- The pPR-NA35 plasmid was constructed in two steps. inische Virologie, Zurich, Switzerland). After 24 h of incu- First, a recombinant viral cDNA fragment was generated by bation at 35¡C, the cells were infected at an m.o.i. of 1 with PCR with the Expand high fidelity polymerase mix (Roche) the WSN/HK helper virus and incubated at 35¡C for two using plasmid pT3NAM1 as a template and oligonucleo- more days in complete DMEM with 2% FCS. The recov- tides 5ЈAGCAAAAGCAGGAGTTTAAATG-3Ј and 5Ј- ered viruses were amplified once on MDCK cells, and the AGTAGAAACAAGGAGTTTTTT GAACAAAGCTAGC- efficiency of the reverse genetics was evaluated by titration TCTCGAGTTAAACTCCTGCTTTTGCTAGATCTACTT- on MDBK cells after this initial amplification. The forma- GTCAA TGGTGAACGGCAACTCAGC-3Ј and was in- tion of plaques in MDBK cells indicated the presence of serted at the HindII site of plasmid pUC19, yielding plasmid transfectant virus that contained the WSN NA gene, since pUCNA35. The latter plasmid was used as a template for the WSN-HK helper virus cannot form plaques in MDBK a second PCR reaction with oligonucleotides 5Ј- cells in the absence of an exogenous source of protease GACGGTCTCTGGCCAGCAAAAGCAGGAGTTTAAA- (Schulman and Palese, 1977). Next, the transfectant viruses TGAATC-3Ј and 5Ј-GACGGTCTCATATTAGTAGAAA- were plaque purified twice on MDBK cells before final CAAGGAGTTTTTTGAACA-3Ј, which included a BsaI amplification on MDBK cells (viral seed stock p0). Subse- restriction enzyme site (underlined). The amplified product quent passages (p1, p2, . . .) of the recombinant viruses were was digested with BsaI and then cloned between the two performed at an m.o.i. of 0.01 on MDCK cells for 3 days at BbsI sites of plasmid pPR7, yielding plasmid pPR-NA35. 35¡C in complete DMEM with 2% FCS. All viral stocks For cloning purposes, the coding sequences of the were titrated on MDCK cell monolayers, in a standard CAT and GFP, as well as the VP0c fragment encoding aa plaque assay using an agarose overlay in complete DMEM 157Ð249 of the Mengo virus VP0 polypeptide, were am- with 2% FCS. plified by PCR using plasmids pPOL1-CAT-RT (Ple- schka et al., 1996), pEGFP-N1 (Clontech), and pM16.1 Analysis of CAT expression in transfected or infected (Duke and Palmenberg, 1989) as respective templates cells with oligonucleotides designed so that the resulting DNA fragments included a XhoI site before the initiation codon For the transient expression assay, subconfluent mono- and a NheI site after the termination codon, and, for the layers of COS-1 cells (3 ϫ 105 cells in 35-mm dishes) were VP0c fragment, a stretch of six histidines after the initi- transfected using the Fugene6-mediated method (Roche) ating methionine. The resulting amplicons were cloned with a mixture of plasmids pcDNA-NP, pcDNA-PA, between the XhoI and NheI sites of plasmid pPR-NA35, pcDNA-PB1, and pcDNA-PB2 (2, 1, 1, 1 ␮g) together with yielding plasmids pPR-NA35-CAT, pPR-NA35-GFP, 1 ␮g of plasmid pPR-NA35-CAT or pPR-NA37-CAT. and pPR-NA35-VP0c, respectively. pcDNA plasmids were kindly provided by Dr G. Brownlee The pPR-NA37, pPR-NA37-CAT, and pPR-NA37-GFP (Sir William Dunn School of Pathology, Oxford, UK). Cells plasmids were obtained by removing the internal 3Ј viral were incubated at 35¡C in complete DMEM with 10% FCS. promoter from plasmids pPR-NA35, pPR-NA35-CAT, and At 48 h posttransfection, cell extracts were prepared in 500 pPR-NA35-GFP, respectively, by digestion with BglII and ␮l of lysis buffer and tested for CAT levels using the CAT XhoI, Klenow filling, and ligation. The coding sequences of ELISA kit (Roche). The lower limit of CAT detection was the VP0c polypeptide were inserted into the pPR-NA37 0.05 ng/ml. plasmid in the same manner as for plasmid pPR-NA35 (see Alternatively, confluent monolayers of COS-1 cells above), yielding plasmid pPR-NA37-VP0c. were infected with recombinant or wild-type influenza All constructs were verified by the sequencing of posi- viruses at an m.o.i. of 2. At 8 or 24 h after infection, cell tive clones using a Big Dye terminator sequencing kit and extracts were prepared and assayed for CAT levels as an ABI377 automated sequencer (PerkinÐElmer). described above. A.V. Machado et al. / Virology 313 (2003) 235Ð249 247

Analysis of NA expression in transfected or infected cells GCCCTGCAGGCCACAA-3Ј) complementary to the tag together with an oligonucleotide of positive polarity specific MDCK cells grown in 35-mm dishes were infected with of the CAT or NA coding sequences and located around 250 either recombinant or wild-type WSN viruses at an m.o.i. of bp downstream of the 5Ј end. A second round of amplifi- 2. COS-1 cells were transfected as described above. At 8 h cation was performed after a 1:25 dilution step, using more after infection or 48 h after transfection, cells were detached proximal segment-specific primers together with primer using the cell dissociation solution (Sigma) and incubated RC2 (5Ј-GCCCTGCAGGCCACAACAGTC-3Ј) comple- for 30 min at 4¡Cin100␮l of PBS-BSA (PBS with 0.02% mentary to the tag. Sequencing of the amplified products

NaN3 and 1% BSA) containing the mouse monoclonal an- was performed with an internal oligonucleotide, using the tibody 10C9 (1:1000 dilution), which is speciﬁc for the protocol described above. The exact sequences of the prim- WSN-NA protein (kindly provided by Dr. Peter Palese; ers used for ampliﬁcation and sequencing of the 5Ј end of

Percy et al., 1994). After two washes in PBSÐ0.02% NaN3, each recombinant NA segment can be obtained from the the cells were incubated for 30 min at 4¡Cin100␮lof authors upon request. PBSÐBSA containing 2.5 ␮g/ml of FITC-conjugated anti- For sequencing of the 3Ј termini, 10 ␮l of viral RNA was mouse IgG antibodies (Becton Dickinson). Finally, cells polyadenylated using the yeast poly(A) polymerase (Amer- were washed twice in PBS, fixed with 100 ␮l of PBS, and sham Pharmacia Biotech). Complementary DNAs were pre- 1% paraformaldehyde and analyzed for fluorescence inten- pared by reverse transcription of the polyadenylated RNAs sity on a FACScalibur fluorocytometer (Becton Dickinson). using an anchored oligo (dT) primer (5Ј-AGATGAATTCG- Ј GTACC(T)14-3 ). PCR amplification was performed with Viral RNA extraction, RT-PCR analysis, and sequencing the AmpliTaq DNA Polymerase (PerkinÐElmer), using the anchored oligo (dT) primer together with a primer of neg- Viral RNA was extracted with Trizol-LS reagent (Life ative polarity specific for the NA coding sequences and Technologies) from 250 ␮l of cell-free supernatant accord- located about 400 bp (5Ј-CCCTATAAGGGCTTCTGTC- ing to the manufacturer’s recommendations. The RNA was CTT-3Ј) upstream of the 3Ј end of the NA segment vRNA. resuspended in 20 ␮l of RNAse-free water, and 5 ␮l was Forty cycles were performed, each consisting of 30 s at used for reverse transcription by Avian Myeloblastosis Vi- 94¡C,30sat55¡C, and 30 s at 72¡C. For some viruses, a rus (AMV) reverse transcriptase (RT, Promega) using the second round of amplification was performed using a more plus-sense primer uni-1 (5Ј-AGCAAAAGCAGG-3Ј) com- proximal primer (5Ј-GGTCCTGCATTCCAAGTGAGA- plementary to the last 12 conserved bases of the 3Ј terminus ACA-3Ј) again together with the anchored oligo (dT) of all viral genomic segments (Robertson, 1979). These primer. The PCR products were purified using a PCR pu- cDNAs and the corresponding plasmid DNAs were used as rification kit (Qiagen) and sequenced with an internal oli- templates for PCR reactions using the Taq DNA polymerase gonucleotide (5Ј-TTGAGTCCTGCCCAGCAACAAC-3Ј), (Roche) with primers spanning cDNA nucleotides 1085 to using the protocol described above. 1108 (NA/ϩ/1085) and complementary to nucleotides 1385 to 1409 (NA/NC/5Ј) of the NA segment. The RT-PCR Northern blot analysis products were analyzed on a 1% agarose gel and visualized by ethidium bromide staining. For assessing the presence of COS-1 or MDCK cells grown in 35-mm dishes were mutations, they were purified using a QIAquick PCR puri- either infected with recombinant or wild-type WSN viruses fication kit (Qiagen) and the nucleotide sequences were at an m.o.i. of 2 or transfected using the Fugene6-mediated determined using internal oligonucleotides, a Big Dye ter- method (Roche) as described above. At 8 or 22 h postin- minator sequencing kit, and an AB1377 automatic se- fection or 48 h posttransfection, cells were washed twice in quencer (Applied Biosystems). PBS and total cellular RNAs were isolated by Trizol ex- Sequencing of the 5Ј termini of the NA genomic RNA traction (Life Technologies) according to the manufactur- segment was performed using an oligonucleotide/cDNA er’s recommendations. When RNA was prepared from ligation strategy (Kolykhalov et al., 1996; Troutt et al., transfected cells, RNA extraction was followed by digestion 1992). Briefly, viral genomic RNA was subjected to reverse with 8 units of DNase I (Ambion) in 60 ␮lof10mM transcription as described above, using as primers oligonu- TrisÐHCl pH 7.5, 2.5 mM MgCl2, 0.1 mM CaCl2 for 60 min cleotides of positive polarity specific of the CAT or NA at 37¡C, phenol extraction, and isopropanol precipitation. coding sequences and located around 300 bp downstream of After denaturation at 70¡C in 50% formamide, 2.2 M the 5Ј end. The cDNAs were purified using a PCR Purifi- formaldehyde, 1ϫ running buffer (40 mM MOPS, 10 mM cation Kit (Qiagen) and ligated to a phosphorylated oligo- sodium acetate, 2 mM EDTA, pH 7.0), samples (2 ␮g) were nucleotide tag (5Ј-GACTGTTGTGGCCTGCAGGGC- run on a 1.2% agaroseÐ0.6 M formaldehyde gel, blotted CGAATT-3Ј) with an amino group on the 3Ј terminus using onto a nylon membrane (Hybond N, Amersham), and hy- the T4 RNA ligase (Biolabs). One-tenth of this reaction was bridized with a NA-, NP-, or CAT-specific 32P-labeled ri- used for a nested PCR amplification. A first round of am- boprobe allowing the detection of RNAs of either negative plification was performed using primer RC1 (5Ј-AATTCG- (vRNAs) or positive (cRNAs, mRNAs) polarity. Hybridiza- 248 A.V. Machado et al. / Virology 313 (2003) 235Ð249

tions were performed at 65¡C in a 50% formamide, 5ϫ vaccine reactions, local and systemic antibody response, and vaccine SSC, 5ϫ Denhardt, 0.5% SDS solution. The membranes efficacy. A meta-analysis. Vaccine 20 (9Ð10), 1340Ð1353. were washed three times in 2ϫ SSC, 0.1% SDS at room Castrucci, M.R., Bilsel, P., Kawaoka, Y., 1992. Attenuation of influenza A ϫ virus by insertion of a foreign epitope into the neuraminidase. J. Virol. temperature, and another three times in 0.1 SSC, 0.1% 66 (8), 4647Ð4653. SDS at 75¡C. Finally, the membranes were exposed on a Castrucci, M.R., Kawaoka, Y., 1993. Biologic importance of neuramini- STORM 820 phosphorimager (Molecular Dynamics) and dase stalk length in influenza A virus. J. Virol. 67 (2), 759Ð764. analyzed using the Image Quant program (Molecular Dy- Chen, W., Calvo, P.A., Malide, D., Gibbs, J., Schubert, U., Bacik, I., Basta, namics). S., O’Neill, R., Schickli, J., Palese, P., Henklein, P., Bennink, J.R., Yewdell, J.W., 2001. A novel influenza A virus mitochondrial protein that induces cell death. Nat. Med. 7 (12), 1306Ð1312. Infection of mice Crescenzo-Chaigne, B., Naffakh, N., van der Werf, S., 1999. Comparative analysis of the ability of the polymerase complexes of influenza viruses C57BL/6 male mice (IFFA CREDO), 7 to 8 weeks of type A, B and C to assemble into functional RNPs that allow expression age, were lightly anesthetized with 100 mg/kg of ketamine and replication of heterotypic model RNA templates in vivo. Virology 3 265 (2), 342Ð353. (Merial) and inoculated intranasally with 10 PFU of trans- Crescenzo-Chaigne, B., van der Werf, S., Naffakh, N., 2002. Differential ␮ fectant or wild-type WSN virus in 40 l of PBS. Four days effect of nucleotide substitutions in the 3Ј arm of the influenza A virus postinfection, mice were sacrificed and lung homogenates vRNA promoter on transcription/replication by avian and human poly- were prepared in PBS (3 ml) and titrated for virus on merase complexes is related to the nature of PB2 amino acid 627. MDCK cell monolayers, in a standard plaque assay. Statis- Virology 303 (2), 240Ð252. tical analyses were performed on the log of the viral titers Duhaut, S., Dimmock, N.J., 2000. Approximately 150 nucleotides from the 10 5Ј end of an influenza A segment 1 defective virion RNA are needed measured for individual mice using the Student’s indepen- for genome stability during passage of defective virus in infected cells. dent t test, with the assumptions used for small samples Virology 275 (2), 278Ð285. (normal distribution of the variable, same variance for the Duhaut, S.D., Dimmock, N.J., 2002. Defective segment 1 RNAs that populations to be compared). Viral RNA was extracted with interfere with production of infectious influenza A virus require at least Trizol-LS reagent (Life Technologies) from 250 ␮l of lung 150 nucleotides of 5Ј sequence: evidence from a plasmid-driven system. J. Gen. Virol. 83 (Pt.2), 403Ð411. homogenates according to the manufacturer’s recommenda- Duke, G.M., Palmenberg, A.C., 1989. Cloning and synthesis of infectious tions and analyzed by RT-PCR and sequencing as described cardiovirus RNAs containing short, discrete Poly(C) tracts. J. Virol. 63 above. (4), 1822Ð1826. Ferko, B., Stasakova, J., Sereinig, S., Romanova, J., Katinger, D., Niebler, B., Katinger, H., Egorov, A., 2001. Hyperattenuated recombinant influenza A virus nonstructural-protein-encoding vectors induce human Acknowledgments immunodeficiency virus type 1 Nef-specific systemic and mucosal immune responses in mice. J. Virol. 75 (19), 8899Ð8908. We are very grateful to J. Pavlovic (Institut fu¬r Mediz- Flick, R., Hobom, G., 1999. Transient bicistronic vRNA segments for inische Virologie, Zu¬rich, Switzerland) for providing the indirect selection of recombinant influenza viruses. Virology 262 (1), pHMG expression plasmids, G. Brownlee (Sir William 93Ð103. Dunn School of Pathology, Oxford, UK) for providing the Flick, R., Neumann, G., Hoffmann, E., Neumeier, E., Hobom, G., 1996. Promoter elements in the influenza vRNA terminal structure. RNA 2 pcDNA expression plasmids, and P. Palese (Mount Sinai (10), 1046Ð1057. Medical Center, New York, NY) for providing plasmid Fodor, E., Palese, P., Brownlee, G.G., Garcia-Sastre, A., 1998. Attenuation pT3NAM1 and the 10C9 monoclonal antibody. This study of influenza A virus mRNA levels by promoter mutations. J. Virol. 72 was supported in part by the French Ministe`re de (8), 6283Ð6290. l’Education Nationale de la Recherche et de la Technologie Fosmire, J.A., Hwang, K., Makino, S., 1992. Identification and character- (EA 302). We thank Ida Rijks for the production of influ- ization of a coronavirus packaging signal. J. Virol. 66 (6), 3522Ð3530. Garcia-Sastre, A., Muster, T., Barclay, W.S., Percy, N., Palese, P., 1994a. enza A/WSN/33 virus and Annette Martin for helpful sug- Use of a mammalian internal ribosomal entry site element for expres- gestions and discussions. A. Vieira Machado was supported sion of a foreign protein by a transfectant influenza virus. J. Virol. 68 by a fellowship from the Brasilian Conselho Nacional de (10), 6254Ð6261. Desenvolvimento Cient´fiõ co e Tecnolo«gico (CNPq). Garcia-Sastre, A., Percy, N., Barclay, W., Palese, P., 1994b. Introduction of foreign sequences into the genome of influenza A virus. Dev. Biol. Stand. 82, 237Ð246. Gonzalo, R.M., Rodriguez, D., Garcia-Sastre, A., Rodriguez, J.R., Palese, References P., Esteban, M., 1999. Enhanced CD8ϩ T cell response to HIV-1 env by combined immunization with influenza and vaccinia virus recom- Azzeh, M., Flick, R., Hobom, G., 2001. Functional analysis of the influ- binants. Vaccine 17 (7Ð8), 887Ð892. enza A virus cRNA promoter and construction of an ambisense tran- Gubareva, L.V., Bethell, R., Hart, G.J., Murti, K.G., Penn, C.R., Webster, scription system. Virology 289 (2), 400Ð410. R.G., 1996. Characterization of mutants of influenza A virus selected Bergmann, M., Muster, T., 1996. Mutations in the nonconserved noncod- with the neuraminidase inhibitor 4-guanidino-Neu5Ac2en. J. Virol. 70 ing sequences of the influenza A virus segments affect viral vRNA (3), 1818Ð1827. formation. Virus Res. 44 (1), 23Ð31. Inglis, S.C., Barrett, T., Brown, C.M., Almond, J.W., 1979. The smallest Beyer, W.E., Palache, A.M., de Jong, J.C., Osterhaus, A.D., 2002. Cold- genome RNA segment of influenza virus contains two genes that may adapted live influenza vaccine versus inactivated vaccine: systemic overlap. Proc. Natl. Acad. Sci. USA 76 (8), 3790Ð3794. A.V. Machado et al. / Virology 313 (2003) 235Ð249 249

Kolykhalov, A.A., Feinstone, S.M., Rice, C.M., 1996. Identification of a Percy, N., Barclay, W.S., Garcia Sastre, A., Palese, P., 1994. Expression of highly conserved sequence element at the 3Ј terminus of hepatitis C a foreign protein by influenza A virus. J. Virol. 68 (7), 4486Ð4492. virus genome RNA. J. Virol. 70 (6), 3363Ð3371. Pleschka, S., Jaskunas, R., Engelhardt, O.G., Zurcher, T., Palese, P., Krug, R.M., Broni, B.A., Bouloy, M., 1979. Are the 5Ј ends of influenza Garcia-Sastre, A., 1996. A plasmid-based reverse genetics system for viral mRNAs synthesized in vivo donated by host mRNAs? Cell 18 (2), influenza A virus. J. Virol. 70 (6), 4188Ð4192. 329Ð334. Poon, L.L., Pritlove, D.C., Fodor, E., Brownlee, G.G., 1999. Direct evi- Lamb, R.A., Choppin, P.W., 1979. Segment 8 of the influenza virus dence that the poly(A) tail of influenza A virus mRNA is synthesized genome is unique in coding for two polypeptides. Proc. Natl. Acad. Sci. by reiterative copying of a U track in the virion RNA template. J. Virol. USA 76 (10), 4908Ð4912. 73 (4), 3473Ð3476. Lamb, R.A., Krug, R.M., 2001. Orthomyxoviridae: The viruses and their Pritlove, D.C., Poon, L.L., Fodor, E., Sharps, J., Brownlee, G.G., 1998. replication, in: Fields, B.N., Knipe, D.M., Howley, P.M., et al. (Eds.), Polyadenylation of influenza virus mRNA transcribed in vitro from Virology, 3rd ed. Lippincott-Raven, Philadelphia, pp. 1353Ð1395. model virion RNA templates: requirement for 5Ј conserved sequences. Lamb, R.A., Lai, C.J., Choppin, P.W., 1981. Sequences of mRNAs derived J. Virol. 72 (2), 1280Ð1286. from genome RNA segment 7 of influenza virus: colinear and inter- Robertson, J.S., 1979. 5Ј and 3Ј terminal nucleotide sequences of the RNA rupted mRNAs code for overlapping proteins. Proc. Natl. Acad. Sci. genome segments of influenza virus. Nucleic Acids Res. 6 (12), 3745Ð USA 78 (7), 4170Ð4174. 3757. Li, S., Rodrigues, M., Rodriguez, D., Rodriguez, J.R., Esteban, M., Palese, Rodrigues, M., Li, S., Murata, K., Rodriguez, D., Rodriguez, J.R., Bacik, P., Nussenzweig, R.S., Zavala, F., 1993. Priming with recombinant I., Bennink, J.R., Yewdell, J.W., Garcia-Sastre, A., Nussenzweig, R.S., influenza virus followed by administration of recombinant vaccinia 1994. Influenza and vaccinia viruses expressing malaria CD8ϩ T and virus induces CD8ϩ T-cell-mediated protective immunity against ma- B cell epitopes. Comparison of their immunogenicity and capacity to laria. Proc. Natl. Acad. Sci. USA 90 (11), 5214Ð5218. induce protective immunity. J. Immunol. 153 (10), 4636Ð4648. Luo, G.X., Luytjes, W., Enami, M., Palese, P., 1991. The polyadenylation Schulman, J.L., Palese, P., 1977. Virulence factors of influenza A viruses: signal of influenza virus RNA involves a stretch of uridines followed WSN virus neuraminidase required for plaque production in MDBK by the RNA duplex of the panhandle structure. J. Virol. 65 (6), 2861Ð cells. J. Virol. 24 (1), 170Ð176. 2867. Solorzano, A., Zheng, H., Fodor, E., Brownlee, G.G., Palese, P., Garcia- Luytjes, W., Krystal, M., Enami, M., Pavin, J.D., Palese, P., 1989. Am- Sastre, A., 2000. Reduced levels of neuraminidase of influenza A plification, expression, and packaging of foreign gene by influenza viruses correlate with attenuated phenotypes in mice. J. Gen. Virol. 81 virus. Cell 59 (6), 1107Ð1113. (Pt 3), 737Ð742. McKnight, K.L., Lemon, S.M., 1996. Capsid coding sequence is required Stech, J., Xiong, X., Scholtissek, C., Webster, R.G., 1999. Independence of for efficient replication of human rhinovirus 14 RNA. J. Virol. 70 (3), evolutionary and mutational rates after transmission of avian influenza 1941Ð1952. viruses to swine. J. Virol. 73 (3), 1878Ð1884. Neumann, G., Hobom, G., 1995. Mutational analysis of influenza virus Suarez-Lopez, P., Ortin, J., 1994. An estimation of the nucleotide substi- promoter elements in vivo. J. Gen. Virol. 76 (Pt 7), 1709Ð1717. tution rate at defined positions in the influenza virus haemagglutinin Neumann, G., Kawaoka, Y., 2002. Generation of influenza A virus from gene. J. Gen. Virol. 75 (Pt. 2), 389Ð393. cloned cDNAsÐhistorical perspective and outlook for the new mille- Takasuka, N., Enami, M., Itamura, S., Takemori, T., 2002. Intranasal nium. Rev. Med. Virol. 12 (1), 13Ð30. inoculation of a recombinant influenza virus containing exogenous Neumann, G., Zobel, A., Hobom, G., 1994. RNA polymerase I-mediated nucleotides in the NS segment induces mucosal immune response expression of influenza viral RNA molecules. Virology 202 (1), 477Ð against the exogenous gene product in mice. Vaccine 20 (11Ð12), 479. 1579Ð1585. Odagiri, T., Tashiro, M., 1997. Segment-specific noncoding sequences of Troutt, A.B., McHeyzer-Williams, M.G., Pulendran, B., Nossal, G.J., the influenza virus genome RNA are involved in the specific compe- 1992. Ligation-anchored PCR: a simple amplification technique with tition between defective interfering RNA and its progenitor RNA single-sided specificity. Proc. Natl. Acad. Sci. USA 89 (20), 9823Ð segment at the virion assembly step. J. Virol. 71 (3), 2138Ð2145. 9825. Ortega, J., Martin-Benito, J., Zurcher, T., Valpuesta, J.M., Carrascosa, J.L., Weiss, B., Geigenmuller-Gnirke, U., Schlesinger, S., 1994. Interactions Ortin, J., 2000. Ultrastructural and functional analyses of recombinant between Sindbis virus RNAs and a 68 amino acid derivative of the viral influenza virus ribonucleoproteins suggest dimerization of nucleopro- capsid protein further defines the capsid binding site. Nucleic Acids tein during virus amplification. J. Virol. 74 (1), 156Ð163. Res. 22 (5), 780Ð786. Palese, P., Compans, R.W., 1976. Inhibition of influenza virus replication Zheng, H., Palese, P., Garcia-Sastre, A., 1996. Nonconserved nucleotides in tissue culture by 2-deoxy-2,3-dehydro-N-trifluoroacetylneuraminic at the 3Ј and 5Ј ends of an influenza A virus RNA play an important acid (FANA): mechanism of action. J. Gen. Virol. 33 (1), 159Ð163. role in viral RNA replication. Virology 217 (1), 242Ð251. Parvin, J.D., Moscona, A., Pan, W.T., Leider, J.M., Palese, P., 1986. Zhou, Y., Konig, M., Hobom, G., Neumeier, E., 1998. Membrane-an- Measurement of the mutation rates of animal viruses: influenza A virus chored incorporation of a foreign protein in recombinant influenza and poliovirus type 1. J. Virol. 59 (2), 377Ð383. virions. Virology 246 (1), 83Ð94.