_ Food Science and Technology Research, 24 (3), 443 453, 2018 Copyright © 2018, Japanese Society for Food Science and Technology http://www.jsfst.or.jp doi: 10.3136/fstr.24.443

Original paper Effects of the Wx Gene on Starch Biosynthesis, Physicochemical Properties, and Dry Noodle Quality

1* 2 1 Peng Qin , Zhiyou Kong and Yeju Liu

1College of Agronomy and Biotechnology, Yunnan Agricultural University, Kunming 650201, China 2College of Resources and Environment, Baoshan University, Baoshan 678000, China.

Received May 24, 2015 ; Accepted October 9, 2015

Wheat starch biosynthesis is influenced by the Wx gene, which may also affect the quality and characteristics of flour and food. In this study, eight near-isogenic Wx wheat lines were bred and used as test materials for analysis of the content and biosynthesis dynamics of starch, and the changes in flour and dry noodle qualities were evaluated. The results showed that the contents and accumulation rates of amylose, amylopectin, and total starch initially increased and then decreased at 20 d after anthesis. Additionally, the three Wx genes examined in this study had varying effects on the amylose content and accumulation rate, in the order of Wx-B1 > Wx-A1 > Wx-D1. Wx genes had only minor effects on amylopectin biosynthesis. Lack of Wx gene expression was expected to affect the physiochemical properties of , with the Wx-B1 gene exhibiting the most dramatic effects. Almost all properties except taste, stickiness, and total score of dry noodles decreased following silencing of the Wx-B1 and Wx-D1 genes. Dry noodle qualities deteriorated to different degrees after silencing of one, two, or three Wx genes, and almost no amylose biosynthesis and very poor dry noodle quality were observed in wheat lacking all three Wx genes.

Keywords: near-isogenic wheat lines, starch biosynthesis, flour physicochemical characteristics, dry noodle quality

Introduction ability of different Wx proteins and the effects of silencing or Starch is the major component in wheat (Triticum aestivum mutation of different Wx proteins on amylose synthesis. For L.) kernels. Wheat starch normally contains 20–30% amylose, example, Miura and colleagues (Mirua et al., 1994; 1999; with the remaining starch content comprised of amylopectin. 2002) found that the presence of a regulator gene that Amylose content plays an important role in the quality of suppresses the activities of Wx genes and the absence of the wheat flour, affecting the texture, stability, and viscosity of Wx-B1 gene or substitution with the corresponding null allele processed foods. Granule-bound starch synthase (GBSS), a key causes dramatic reductions in amylose synthesis. While enzyme involved in the biosynthesis of amylose, is encoded by amylose content is not expected to be increased by double waxy (Wx) genes. Because of its role in amylose biosynthesis, dosages of chromosomes 7A, 4A, and 7D, upregulation of Wx GBSS also influences the texture and quality of wheat flour. proteins is observed in the context of tetrasomic chromosomes. Wx genes include Wx-A1, Wx-B1, and Wx-D1, which are A more comprehensive study of the correlation between located on chromosomes 7AS, 4AL, and 7DS, respectively, amylose content and starch viscosity properties was carried out and mutations in or silencing of one or more Wx genes can using near-isogenic Wx wheat lines (Bhattacharya et al., 2002; cause reduction in amylose content (Anisworth et Zhao et al., 1998). Nakamura et al. (1995) indicated that there al., 1993; Nakamura et al., 1993; Sun et al., 1998; Yamamori were no significant differences in protein content in eight near- and Endo, 1996). isogenic Wx wheat lines. As compared to the normal line, Some researchers have studied the amylose synthesis lower falling number, glucose yield, and ethanol yield and

*To whom correspondence should be addressed. E-mail: [email protected] 444 P. Qin et al. higher grain protein content were observed in double-null flour blend is increased. Moreover, the amylose content of (WxBD) and triple-null (WxABD) near-isogenic lines, starch is positively correlated with hardness and negatively indicating the strong involvement of alleles encoded at Wx-B1 correlated with cohesiveness of cooked white salted noodles and Wx-D1 loci in grain composition (Gadonna-widehem et (Park and Baik, 2004, Baik et al., 2003). Noodles prepared al., 2012). Moreover, waxy wheat starch contains a smaller from waxy wheat flour exhibit the shortest cooking time, proportion of B-type granules, larger average granule diameter, demonstrating the influence of starch amylose content on and higher degree of crystallinity than normal wheat starch; cooking time in noodles (Noda et al., 2001), and have a higher these differences result in higher gelatinization temperature, compressive force than nonwaxy noodles when the strain is transition enthalpy, peak viscosity, breakdown, and swelling greater than 80%, indicating that waxy wheat noodles are soft power and lower peak viscosity temperature and final viscosity, but difficult to cut through completely (Sasakiet al., 2004). suggesting that waxy wheat starch has greater resistance to In this study, we aimed to analyze the influence and retrogradation during cooling and higher water-holding function of all Wx genes. To this end, nonwaxy wheat Ningmai capacity under dry conditions (Zhang et al., 2013; 2014). 14 and waxy wheat Wx 9 were hybridized and continuously Several studies have shown that waxy wheat behaves backcrossed, generating near-isogenic Wx wheat lines by differently from wild-type and partial-waxy wheat in terms of marker-assisted selection. The effects of various Wx genes on physicochemical characteristics. Waxy wheat exhibits wheat starch biosynthesis and the quality of wheat flours and low falling numbers that are independent of α-amylase levels dry noodles were investigated. Our results provide important and lower setback, pasting, and peak temperatures than normal insights into the effects of Wx genes on starch quality, and partial-waxy wheat flour (Graybosch et al., 2000; Kim et agronomic traits, wheat flour properties, and food quality in al., 2003; Park et al., 2001; Sharma et al., 2002). In addition, and may facilitate further studies and applications waxy wheat flour exhibits higher breakdown, peak viscosity, of Wx genes in wheat. gelatinization temperature, protein content, water absorption, SDS-sedimentation volume, starch damage, swelling power, Materials and Methods and alkaline water retention capacity as well as a greater degree Wheat samples The waxy wheat line Yangfan 9, provided of crystallization and an absence of amylose-lipid complex by Professor Shunhe Cheng, Lixiahe Agricultural Research compared with nonwaxy wheat (Chakraborty et al., 2004; Guo Institute, Jiangsu Province, lacking the Wx-A1, Wx-B1 and Wx- et al., 2003; Morita et al., 2002; Park.and Baik, 2004; Sasaki et D1 proteins, was used as the waxy gene donor. The wild-type al., 2004). Furthermore, waxy wheat starches show greater wheat genotype, Ningmai 14, was used as the recurrent parent refrigeration and freeze-thaw stabilities than nonwaxy starches to create sets of NILs with null alleles at one, two, or all three (Abdel-Aal et al., 2002). Thus, it is clear that Wx genes have Wx loci. Both Ningmai 14 and Yangfan 9 are hard red wheat substantial effects on the texture and qualities of wheat flour. cultivars with medium content and good agronomic Dry noodles are widely consumed in China and can be traits. The eight near-isogenic Wx wheat lines with the Ningmai influenced by the physicochemical properties of wheat flour. 14 background were developed after seven backcross Both grain hardness and water absorption are negatively related generations with an individual heterozygous plant at three Wx to the color, appearance, smoothness, and taste of cooked dry loci. Individual plants from backcross progenies were selected noodles (Liu et al., 2003). Flour ash content and polyphenol by microscopic examination after pollen staining with 0.07% oxidase (PPO) have moderate negative effects on noodle color, I2-KI; plants with one-eighth yellow pollens and seven-eighths while protein content is negatively associated with the black pollens were used as male parents, while plants with all appearance and smoothness of noodles. The associations of dry black pollens were eliminated. The BC7F2 populations were noodle score with SDS-sedimentation volume, stability time, obtained by individual plant selfing of BC7F1; the absence of and maximum resistance can be fit to a quadratic regression the waxy protein at various loci was confirmed by sodium model, and the peak viscosity and breakdown contribute dodecyl sulfate polyacrylamide gel electrophoresis (SDS- positively to dry noodle qualities (He et al., 2004). Importantly, PAGE, for Wx-A1) and agarose gel electrophoresis (AGE, for waxy flour has little or no amylose in its starches; thus, Wx-B1 and Wx-D1) (Table 1) (Kim et al., 2003). amylose content will be decreased when waxy flour is added to The results of agarose gel electrophoresis showed that the normal wheat flours. Some studies have described the Wx-A1 and Wx-D1 genes were codominant, whereas the Wx- production of noodles made with waxy flour blends. For B1 gene was dominant. 336 bp (lanes 9, 10 and 11) and 317 bp example, adding 20–30% waxy flour to wild-type flour (lanes 1, 2, 3, and 4) for Wx-A1 (Figure 1), 840 bp (lanes 1, 2, 3, improves the quality of white salted noodles, and the optimal and 4) and 260 bp (lanes 9, 10, 11, and 12) for Wx-D1 (Figure amylose content has been reported to be 21–24% (Noda et al., 3) were indicated dominant and recessive respectively. 259 bp 2001). White salted noodles produced from blends of regular and 217 bp (lanes 1, 2, 3, 4, and 5) were indicated recessive, and waxy wheat flours become softer as the proportion of waxy that 259 bp, 217 bp, and 187 bp were homozygous or wheat flour is increased, even when the protein content of the heterozygous dominant (Figure 2), which should be confirmed Effects of Wx Gene on Starch, Flour Properties, Dry Noodle Quality 445

Table 1. Wx gene primer table

Primer Expected amplified Allele Primer sequence (5’→3’) name product 1 Wx-A1 CCAAAGCAAAGCAGGAAACC Wx-A1a 336bp TACCTCGGAGATGACGCTGG Wx-A1b 317bp 2 Wx-B1 GCTACCTCAAGAGCAACT Wx-B1a 187bp TTGAGCTGCGCGAAGTCGTC Wx-B1b - 3 Wx-D1 ACAGGATCTCTCCTGGAAG Wx-D1a 840bp GCAAGGAAAATAGTGAAGC Wx-D1b 260bp

Fig. 1. Results of Wx-A1 locus detection in the Ningmai 14 background (SDS-PAGE)

Fig. 2. Results of Wx-B1 locus detection in the Ningmai 14 background

Fig. 3. Results of Wx-D1 locus detection in the Ningmai 14 background

Table 2. Eight genotypes of near-isogenic Wx through separate offspring. Eight genotypes are shown in Table lines of wheat 2. During the 2013-10 cropping seasons, the derived genotypes Genotype Absence of three Wx genes were grown in a randomized block design with two replicates, at Wx-A1 Wx-B1 Wx-D1 the research station of Yunnan Agricultural University, Yunnan Wild type + + + Province. Each plot consisted of 10 rows (2.0 m long, 0.25 m WxA ‒ + + apart). Field management was according to local practices, and WxB + ‒ + all samples were free of sprouting. Wheat ears were marked the WxD + + ‒ same day from the blossoming. Five ears from each line were WxAB ‒ ‒ + sampled 10, 20, 30, and 40 d after anthesis, and four central WxAD ‒ + ‒ spikelets of each ear were stripped and frozen with liquid WxBD + ‒ ‒ WxABD ‒ ‒ ‒ 446 P. Qin et al.

Table 3. Variance analysis of content and biosynthesis rate of total starch, amylose and amylopectin (F value)

Biosynthesis Biosynthesis Biosynthesis Source of Amylose Amylopectin Total starch df rate of rate of rate of total Variation content content content amylose amylopectin starch Genotypes 7 12.3* 0.895 14.9* 3.39* 0.169 1.00* Days after 3 44.0* 993* 642* 24.4* 185* 146* anthesis

* indicate difference at P < 0.05. nitrogen for the analysis of grain starch. Wheat was milled into data analyses. flour by a Buhler laboratory mill 3 months after harvest, and dry noodles were produced 3 weeks after milling. Results Biosynthesis dynamics of total starch, amylose, and amylopectin Biosynthesis dynamics of total starch, amylose, and Amylose and total starch contents were determined as described by amylopectin The different genotypes exhibited significant AACC 61-03 and 76-13 with minor modifications (AACC 2000). differences in the content and biosynthesis rates of amylose Amylopectin content was calculated as the difference between total and total starch but not amylopectin (Table 3). Moreover, the starch and amylose contents. Content was expressed as the content and biosynthesis rates of total starch, amylose, and percentage of dry weight, and the biosynthesis rate was expressed as amylopectin varied significantly according to the number of d the percentage of total content each d. after anthesis. Analysis of flour characteristics Zeleny sedimentation Contents of amylose (Figure 4), amylopectin (Figure 5), value, falling number, moisture, protein content, gluten content, and total starch (Figure 6) increased in all Wx genotypes, amylose content, farinograph parameters, and pasting except WxABD, which exhibited almost no amylose properties were determined by AACC 56-60, 44-15A, 56-81B, biosynthesis throughout the study. There were no significant 46-13, 38-12, 61-03, 54-21, and 61-02 (AACC 2000), differences in amylopectin contents among all Wx genotypes respectively. Minolta (CR-410), a colorimeter, was used for on the same day after anthesis. However, lack of the Wx gene determination of L* (whiteness), a* (red and green color), and decreased the biosynthesis of amylose content in wheat, with b* (yellow color) of wheat flour. decreases in the order of Wx-B1 > Wx-A1 > Wx-D1. The wild- Production of dry noodles For production of noodles, type wheat exhibited the highest amylose content when 33 mL water was added to 100 g flour (14%mb), mixed by compared with the Wx mutants on the same day after anthesis. hand for 5 min, and rested for 10 min. The dough was then The biosynthesis rates of amylose (Figure 7), amylopectin passed through the rolls of a noodle machine with a 3-mm gap, (Figure 8), and total starch (Figure 9) increased gradually for folded, and passed through the sheeting rolls two more times. the first 10 days after anthesis and then increased rapidly to a The dough was passed through gap five times to create peak from 10 to 20 d after anthesis. Subsequently, the sheetings that measured 3.0, 2.5, 2.0, 1.5, and 1.0 mm thick. biosynthesis rates decreased sharply from 20 to 30 d after The sheets were then cut into strips measuring 1 mm in width. anthesis, with a gradual decline thereafter. However, there were Noodles were hung at room temperature and 45% RH for 3 d no significant differences in amylose biosynthesis for WxABD until dried. No dry noodles broke in all samples. resulting from the loss of synthesis ability. The biosynthesis Noodle cooking and evaluations Noodles were cooked in rates of amylopectin and total starch were the same for all Wx 500 mL boiling distilled water for 8 min with gentle stirring to genotypes except for the total starch biosynthesis of WxABD, prevent sticking to the bottom of the pan during cooking. After which decreased due to the impaired amylose biosynthesis cooking, the noodles were cooled by immediate immersion into ability. The amylose biosynthesis rate was significantly running tap water (20℃) for 10 s. The color, appearance, different among the various Wx genotypes; that of the wild type hardness, stickiness, elasticity, smoothness, and taste of cooked was far higher than those of other genotypes, particularly when noodles were scored by trained individuals, with 20, 10, 10, 15, high amounts of amylose were synthesized by 20–30 d after 15, 20, and 10 being the highest scores for the above anthesis. The effects of the three Wx genes on the amylose parameters, respectively. The total noodle score was obtained biosynthesis rate followed the order of Wx-B1 > Wx-A1 > Wx- by taking the sum of these points. D1. Statistical analyses All experiments were performed three Physicochemical properties of wheat flour As shown in times for each sample. Analyses of variance (ANOVA) and Table 4, the amylose contents of NILs varied from 0.6% in least square differences (LSD) analyses were performed for all genotype WxABD to 24.1% in the wild-type genotype in the traits with the Statistical Analysis System 9.0 software (SAS Ningmai 14 background. The wild-type genotype had the 9.0). The level of significance was defined at P < 0.05 for all highest amylose content, followed by single null genotypes, Effects of Wx Gene on Starch, Flour Properties, Dry Noodle Quality 447

Fig. 4. Amylose synthesis in Wx near-isogenic wheat lines at the filling stage Fig. 6. Total starch synthesis in Wx near-isogenic wheat lines at the filling stage

Fig. 5. Amylopectin synthesis in Wx near-isogenic wheat lines at Fig. 7. Amylose synthesis rate in Wx near-isogenic wheat lines at the filling stage the filling stage double null genotypes, and the waxy genotype. From double increased when the Wx-B1 gene was disrupted, but decreased null genotypes, the genotype WxAD showed significantly when the Wx-D1 gene was disrupted; however, disruption of higher amylose content than the other two genotypes, and the Wx-A1 gene did not significantly affect these two genotype WxBD had the lowest content. From single null indicators. Breakdown increased in genotypes lacking one or genotypes, the genotype WxB had higher amylose content than two Wx genes, but sharply decreased in the genotype lacking the other two genotypes. Furthermore, WxABD, the waxy all three Wx genes. Thus, lack of only one Wx gene decreased genotype, had the highest sedimentation value and lowest the final viscosity and setback. The peak viscosity, trough falling number, a* value, and b* value. The protein content of viscosity, breakdown, setback, and peak time of WxABD, the wild-type wheat was lesser than those of most all other waxy wheat line, were significantly lower than those of the genotypes except for WxA and WxAB. other genotypes. Additionally, the pasting temperature Pasting properties of near-isogenic Wx wheat lines are increased in the absence of the Wx-A1 gene. There were no shown in Table 5. The peak viscosity and trough viscosity significant differences in peak time among all Wx genotypes, 448 P. Qin et al.

Table 4. Physicochemical properties of near-isogenic wheat line flour

Wet gluten Falling Sedimentation Protein Amylose Genotype L* value a* value b* value content/% number/s value /mL content/% content/% Wild type 45.4 ab 568 bc 64.5 c 12.5 d 24.1 a 93.6 a ‒0.94 b 7.29 bc WxA 42.9 cd 442 d 56.0 d 12.1 d 22.9 b 93.7 a ‒0.97 b 7.22 c WxB 40.4 ef 522 c 44.0 e 14.3 a 22.1 c 93.1 a ‒1.14 a 7.99 a WxD 45.9 a 827 a 68.3 bc 12.6 cd 23.3 b 93.8 a ‒0.86 b 7.04 cd WxAB 40.5 ef 487 d 56.5 d 12.4 cd 18.5 e 94.1 a ‒0.89 b 6.67 ef WxAD 39.9 f 285 e 70.0 ab 13.1 b 20.3 d 93.9 a ‒1.10 a 6.91 de WxBD 39.6 f 546 bc 63.5 c 13.0 b 16.2 f 93.4 a ‒1.11 a 8.03 a WxABD 41.3 de 85 f 74.3 a 13.8 ab 0.600 g 93.1 a ‒0.73 c 6.30 f

Values followed by the same letters in the same column are not significantly different at P < 0.05.

Table 5. Pasting properties of near-isogenic Wx wheat lines Peak Trough Final Pasting Breakdown Setback / Peak time / Genotype Viscosity / Viscosity / Viscosity / Temperature / mPas mPas min mPas mPas mPas /℃ Wild type 2841 c 1828 b 1013 d 3177 a 1349 a 6.27 a 61.9 c WxA 2928 b 1824 b 1104 c 3030 c 1206 b 6.27 a 62.3 bc WxB 3186 a 1977.5 a 1209 b 3106 b 1129 c 6.33 a 61.8 c WxD 2883 bc 1671 cd 1213 b 2683 de 1012 d 6.27 a 63.1 ab WxAB 3155 a 1765 c 1390 a 2760 de 995 e 6.17 a 63.2 ab WxAD 2516 d 1467 e 1049 d 2376 f 909 e 6.13 a 63.7 a WxBD 2816 c 1645 d 1172 c 2651 e 1006 d 6.24 a 62.8 b WxABD 1479 e 880 f 599 e 1455 g 575 f 4.64 b 63.7 a

Values followed by the same letters in the same column are not significantly different at P < 0.05.

Table 6. Farinograph parameters of near-isogenic Wx wheat lines Water Farinograph Development Stability time/ Break time/ Tolerance Genotype absorption/ quality time/min min min index/BU mL number Wild type 63.8 de 1.9 de 3.0 bc 6.7 bc 51.3 f 51.2 e WxA 61.2 e 1.8 ef 3.7 a 7.3 a 75.6 a 37.9 f WxB 67.6 bc 2.1 cd 2.6 d 6.9 b 68.1 bc 61.3 d WxD 66.1 cd 2.2 c 2.9 c 6.4 cd 66.5 cd 77.1 b WxAB 64.7 d 1.7 fg 3.1 b 6.8 bc 55.7 ef 46.6 e WxAD 67.3 bc 1.6 g 2.3 e 4.5 f 46.2 g 63.4 d WxBD 68.9 b 2.5 b 2.8 cd 6.2 d 63.3 d 72.9 c WxABD 75.1 a 3.5 a 1.7 f 5.4 e 53.2 ef 121.0 a

Values followed by the same letters in the same column are not significantly different at P < 0.05. with the exception of WxABD. number, and tolerance index increased, and the stability time The farinograph parameters of near-isogenic Wx wheat decreased in the absence of the Wx-B1 gene. lines are shown in Table 6. Lack of Wx-B1 and Wx-D1 The correlation between farinograph properties, amylase increased the water absorption of wheat flour. Although lack of content, and other physicochemical properties of wheat flour is the Wx-A1 gene did not increase water absorption, lack of all shown in Table 7. Water absorption showed a significant three genes resulted in a sharp increase in this parameter. The negative correlation with wet gluten content, peak viscosity, water absorption, development time, and tolerance index of trough viscosity, peak time, protein content, final viscosity, and WxABD were significantly higher than those of all other setback. Development time showed a significant negative genotypes; however, the stability time was the lowest in this correlation with peak viscosity, trough viscosity, breakdown, mutant. The break time, development time, farinograph quality wet gluten content, and peak time. Stability time showed a Effects of Wx Gene on Starch, Flour Properties, Dry Noodle Quality 449

Table 7. Correlation analysis between physiochemical properties of wheat flour Farinograph Waterabs Development Breaking Tolerance Amylose Stable time Quality orption Time time index content number Wet gluten content ‒0.825* ‒0.889* 0.685 0.249 0.065 ‒0.897* 0.841* Falling number ‒0.56 ‒0.428 0.604 0.547 0.45 ‒0.448 0.745* Peak viscosity ‒0.785* ‒0.787* 0.770* 0.644 0.44 ‒0.853* 0.873* Trough viscosity ‒0.814* ‒0.762* 0.782* 0.701 0.474 ‒0.868* 0.902* Breakdown ‒0.657 ‒0.737* 0.667 0.491 0.344 ‒0.737* 0.735* Final viscosity ‒0.853* ‒0.756* 0.807* 0.704 0.433 ‒0.879* 0.915* Setback ‒0.857* ‒0.699 0.793* 0.665 0.345 ‒0.840* 0.877* Peak time ‒0.811* ‒0.847* 0.745* 0.456 0.348 ‒0.853* 0.952* Pasting temperature 0.536 0.318 ‒0.55 ‒0.760* ‒0.474 0.561 ‒0.587 Protein content 0.731* 0.514 ‒0.753* ‒0.327 ‒0.115 0.578 ‒0.45

* indicate significantly correlation at P < 0.05.

Table 8. Scores for dry noodles of near-isogenic Wx wheat lines

Genotype Dry noodle qualities Color Appearance Hardness Stickiness Elasticity Smoothness Taste Total score Wild type 17.5 a 8.4 a 8.5 a 13.3 cd 13.2 ab 16.7 ab 7.4 a 85.0 a WxA 16.5 b 8.0 ab 7.3 c 14.2 a 13.7 a 17.2 a 7.5 a 84.4 ab WxB 15.7 c 7.7 cd 8.1 ab 14.1 ab 12.8 cd 16.6 bc 7.1 a 82.1 cd WxD 16.0 bc 7.1 e 7.6 bc 13.6 bc 12.4 d 16.3 bc 7.3 a 80.3 d WxAB 17.1 a 7.9 bc 7.2 c 13.3 cd 13.3 ab 16.8 ab 7.0 a 82.6 cd WxAD 17.0 a 8.2 ab 8.1 ab 13.1 d 13.5 ab 16.3 bc 7.9 a 84.1 ab WxBD 16.2 bc 7.6 de 8.4 ab 13.4 cd 13.0 bc 16.1 c 7.7 a 82.4 cd WxABD 13.9 d 6.3 f 6.0 d 12.1 e 12.5 d 16.2 c 7.3 a 74.7 e

Values followed by the same letters in the same column are not significantly different at P < 0.05. significant positive correlation with peak viscosity, trough elasticity, and total score, while amylose content showed a viscosity, setback, and peak time and negative correlation with significant positive correlation with color, appearance, stickiness, protein content. Breaking time was negatively correlated with and total score. There were no significant effects of protein pasting temperature, and tolerance index was significantly content and falling number on individual scores or total scores negatively correlated with all indicators, except falling number, for dry noodles. In addition, the peak viscosity, trough viscosity, pasting temperature, and protein content. Amylose content was final viscosity, setback, peak time, and stability time were positively correlated with all indexes, except pasting significantly positively correlated with the total score, while temperature and protein content. water absorption and development time showed a significant Sensory qualities of dry noodles Dry noodle scores of negative correlation with the total score. near-isogenic Wx wheat lines are shown in Table 8. The color, appearance, hardness, and total score of the wild-type wheat Discussion were the highest, while those of WxABD were the lowest from The mechanism of starch synthesis is complex; sucrose all Wx genotypes. The hardness, appearance, and total score of synthesized in leaves or degraded starch is transported to the WxA were higher than those of the other two single null storage organs through phloem, and amylose and amylopectin genotypes, and that of WxBD were lower in double null are finally synthesized by ADP-glucose pyrophosphorylase, genotypes. The stickiness, elasticity, and smoothness increased starch synthase, and debranching enzymes. The starch synthase in the absence of the Wx-A1 gene. There were no differences in GBSS, encoded by Wx-A1, Wx-B1, and Wx-D1 genes, plays an taste for all Wx genotypes, and the lack of the Wx-A1 gene did important role in amylose synthesis. Lack of the Wx gene not not significantly decrease the total score. only led to decreased amylose biosynthesis and content, but Correlation analysis of dry noodle scores and wheat flour also caused changes in flour and food qualities. Our current qualities is shown in Table 9. Wet gluten content showed a study provided important insights into the biosynthesis and significant positive correlation with color, appearance, hardness, accumulation dynamics of starch and the qualities of wheat 450 P. Qin et al.

Table 9. Correlation analysis between dry noodle scores and physiochemical properties of wheat flour

Dry noodle qualities Color Appearance Hardness Stickiness Elasticity Smoothness Taste Total score WGC 0.917* 0.971* 0.741* 0.648 0.778* 0.477 0.376 0.996* AsC 0.801* 0.785* 0.677 0.830* 0.419 0.478 0.055 0.862* PC ‒0.644 ‒0.448 ‒0.048 ‒0.25 ‒0.524 ‒0.494 ‒0.148 ‒0.514 FN 0.455 0.282 0.504 0.637 ‒0.17 0.109 ‒0.204 0.418 PV 0.709* 0.686 0.575 0.863* 0.354 0.488 ‒0.227 0.761* TV 0.694 0.729* 0.63 0.903* 0.377 0.563 ‒0.205 0.799* BD 0.653 0.547 0.43 0.709* 0.281 0.325 ‒0.236 0.622 FV 0.735* 0.775* 0.665 0.872* 0.419 0.597 ‒0.141 0.839* SB 0.748* 0.794* 0.675 0.772* 0.456 0.612 ‒0.038 0.846* PT 0.803* 0.785* 0.745* 0.845* 0.433 0.376 0.09 0.874* PaT ‒0.336 ‒0.492 ‒0.529 ‒0.692 ‒0.175 ‒0.532 0.274 ‒0.526 WAb ‒0.815* ‒0.787* ‒0.38 ‒0.769* ‒0.658 ‒0.783* 0.019 ‒0.852* DvT ‒0.907* ‒0.896* ‒0.519 ‒0.652 ‒0.706 ‒0.556 ‒0.117 ‒0.906* StT 0.652 0.605 0.268 0.790* 0.552 0.758* ‒0.098 0.714* BrT 0.222 0.228 0.061 0.687 0.105 0.697 ‒0.594 0.31 FQN ‒0.144 ‒0.083 ‒0.057 0.744* ‒0.035 0.423 ‒0.243 0.089 TI ‒0.863* ‒0.893* ‒0.481 ‒0.776* ‒0.759* ‒0.753* 0.01 ‒0.925*

* indicate significantly correlation at P < 0.05. flour and food produced using near-isogenicWx wheat lines. aged and the transformed into fully ripened seeds. Wx Effects of Wx genes on the biosynthesis of total starch, genes have been suggested to act in an epistatic manner (Miura amylose, and amylopectin In this study, substantial differences et al., 1999). Therefore, amylose content is not only influenced in amylose and total starch synthesis rates were observed in the by Wx genes but is also affected by genetic background and different Wx genotypes. The amylose content of waxy genotype growth environments. Further studies are required to determine was the lowest, followed by that of double null genotypes and the molecular mechanism underlying the different effects of single null genotypes; however, that of the wild type genotype three Wx genes on amylose synthesis. was the highest. In single null genotypes, genotype WxB Effects of Wx genes on physicochemical properties of showed significantly lower amylose content than the other two wheat flour The waxy genotypes showed faster peak genotypes, and genotype WxD showed the highest. In double viscosities (Blazek and Copeland, 2008), greater pasting null genotypes, genotype WxAD showed significantly higher degrees (Ma et al., 2013) and resistance to retrogradation, as amylose content than the other two genotypes, and genotype indicated by lower setback viscosities (Blazek and Copeland, WxAB showed the lowest. The results are not entirely 2008; Sasaki et al., 2000), as compared with non-waxy starches consistent with previous studies (Ma et al., 2013). The effect in due to lack of amylose. The Wx-B1 null genotype showed reduction of amylase content due to the null Wx genes in this higher peak viscosity, trough viscosity, final viscosity and study was Wx-B1 > Wx-A1 > Wx-D1. However, lack of Wx setback than the other two single null genotypes and three genes did not affect the amylopectin content or biosynthesis double null lines (Kim et al., 2003; Yamamori and Quynh, rate. Moreover, the content and accumulation rates of amylose 2000), which indicated that the Wx-B1 gene null might result and total starch were higher in wild-type wheat than in the in the alteration of amylopectin structure within starch granules other Wx genotypes because all Wx genes exhibited dominant of this genotype (Ma et al., 2013; Hansen et al., 2010). expression patterns. Importantly, when all three Wx genes were Moreover, the doughs made from waxy wheat flours had absent, amylose synthesis was almost complete abolished, significantly higher water absorption (Morita et al., 2002a), indicating that the three Wx genes may have interactive effects. lower stability during mixing just like the soft wheat flours Based on our data describing the accumulation rates of (Hung et al., 2005b; Morita et al., 2002a), weaker gluten amylose, amylopectin, and total starch, peak wheat grain filling strength (Graybosch et al., 2003), stickier dough, and lesser was achieved at 10–20 d after anthesis, and starch firmness than the non-waxy wheat, which should be attributable accumulation was rapid. However, starch synthesis and to the high amount of protein and dietary fiber (Huang et al., accumulation rates decreased gradually as the leaves gradually 2006). Effects of Wx Gene on Starch, Flour Properties, Dry Noodle Quality 451

The results of this study were basically consistent with increased the individual and total scores, while increased water previous studies (Blazek and Copeland, 2008; Graybosch et al., absorption and development time decreased the total and 2003; Hansen et al., 2010; Hung et al., 2005b; 2006; Kim et individual scores. Additionally, dry noodle quality was al., 2003; Ma et al., 2013; Morita et al., 2002a; Sasaki et al., significantly affected by protein content. 2000; Yamamori and Quynh, 2000). Lack of Wx genes altered The amylose contents of waxy wheat and partial waxy the physiochemical properties of wheat flour. However, wheat decreased to different degrees depending on the lack of absence of different Wx genes did not always cause the same different numbers and types of Wx genes; these parameters changes in these physicochemical properties. Lack of the Wx- were also expected to affect dry noodle quality. Indeed, dry A1 and Wx-B1 genes reduced wheat flour wet gluten content, noodle quality was particularly poor for waxy wheat in which sedimentation value, and falling number significantly, while amylose was almost completely absent. While the ratio of the the opposite effect was noted for the Wx-D1 gene. Lack of the color score was higher in the waxy wheat during evaluation of Wx-B1 and Wx-D1 genes caused an increase in protein content dry noodles, the color could be improved during production and a decrease in amylose content, but a decrease in protein using other methods. Therefore, if the negative effects of waxy content was observed when the Wx-A1 gene was null. Lack of wheat on color were not considered, the absence of Wx genes the Wx-B1 gene increased peak viscosity and trough viscosity, would be expected to have less effect on dry noodle quality. In while lack of the Wx-D1 gene reduced these properties. addition, changes in protein quality did not affect the overall Overall, the Wx-B1 gene exhibited the most dramatic effects on quality of the noodles; however, higher wet gluten content and the physicochemical properties of wheat flour, particularly for stability time were beneficial for dry noodle quality. Therefore, break time, development time, farinograph quality number, these two indicators may be used as important indexes in the tolerance index, stability time, wet gluten content, breeding of new wheat cultivars. sedimentation value, and amylose content, which may affect the strength of the dough. Most importantly, absence of all Conclusion three genes caused dramatic changes in farinograph parameters Although the three Wx genes examined in this study had and pasting properties of wheat flour and content of protein, varying effects on amylose biosynthesis, they had only minor gluten, and amylose, indicating that qualitative changes in effects on amylopectin. Lack of Wx gene expression was wheat flour and products were the result of interactions among expected to affect the physiochemical properties of wheat flour. the three Wx genes. Almost all properties except taste, stickiness, and total score of Effects of Wx genes on the sensory qualities of dry noodles dry noodles showed a decrease following silencing of Wx-B1 Noodles are one of the most important foods in many Asian and Wx-D1 genes, and almost no amylose biosynthesis and countries, and the eating quality should be significantly very poor dry noodle quality were observed in wheat lacking influenced by the quality and characteristics of wheat starches all three Wx genes. The Wx-B1 gene had the most dramatic and flours. Lower amylose contents lead to better white salted effect on starch biosynthesis, physicochemical wheat flour noodle qualities (Jane et al., 1999; Miura and Tanii, 1994; properties, and dry noodle quality from among the three Wx Noda et al., 2001; Wang and Seib, 1996), whereas high paste genes. viscosity, breakdown, low gelatinization temperature and high swelling power of starch were beneficial for the textural Acknowledgments This work was supported by the National properties of white salted noodles (Endo et al., 1988; Crossbie Key Research and Development Program (2017YFD0100902), et al., 1991; Panozzo and McCormick, 1993). Waxy wheat Yunnan Science and Technology Project (2015BB016), flour with high peak paste viscosity and swelling power are Kunming Science and Technology Project (2015-1-H-00308), considerable for producing superior white salted noodles (Hung and National Natural Science Foundation of China (31000712). et al., 2006). Noodles prepared from the reduced amylose We wish to thank Luo Sichuan, Zhang Huijuan, and Wang flours by addition of waxy wheat flour had decreased firmness, Shuo for assistance with the experiments. We would like to gumminess and chewiness, whereas the cohesiveness, thank Editage [http://www.editage.cn/] for English language springiness and resilience of noodles increased (Guo et al., editing. 2003). In this study, most properties of dry noodle scores were References much higher in the wild-type wheat than in the Wx genotypes, AACC 2000. Approved Methods of the AACC (tenthed). American and the absence of all three Wx genes resulted in the most Association of Cereal Chemists, St. Paul, MN. substantial decreases in dry noodle scores. Indeed, dry noodle Abdel-Aal, E.S.M., Hucl, P., Chibbar, R.N., and Han, H.L. (2002). quality deteriorated to different degrees depending on the Physicochemical and structural characteristics of flours and starches absence of one, two, or three Wx genes. Importantly, wet gluten from waxy and nonwaxy . Cereal Chem., 79, 458‒464. content, amylose content, peak viscosity, trough viscosity, final Anisworth, C., Tarvis, M., and Clark, J. (1993). Isolation and analysis viscosity, setback, peak time, and stability time of dry noodles of cDNA clone encoding the small subunit of ADP-glucose 452 P. Qin et al.

pyrophosphorylase from wheat. Plant Mol. Biol., 23, 23‒33. Physicochemical properties and end-use quality of wheat starch as a Baik, B.K., Park, C.S., Paszczynska, B., and Konzak, C.F. (2003). function of waxy protein alleles. J. Cereal Sci., 37, 195‒204. Characteristics of noodles and prepared from double-null Liu, J.J., He, Z.H., Zhao, Z.D., Peña, R.J., and Rajaram S. (2003). partial waxy wheat. Cereal Chem., 80, 627‒633. Wheat quality traits and quality parameters of cooked dry white Bhattacharya, M., Erazo, C.S.V., Doehlert, D.C., and Mcmullen, M. Chinese noodles. Euphytica, 131, 147‒154. (2002). Staling of bread as affected by waxy wheat flour blends. Miura, H., Araki, E., and Tarui, S. (1999). Amylose synthesis capacity Cereal Chem., 79, 178‒182. of the three Wx genes of wheat cv. Chinese Spring. Euphytica, 108, Blazek, J. and Copeland, L. (2008). Pasting and swelling properties of 91‒95. wheat flour and starch in relation to amylose content. Carbohydr. Miura, H. and Tanii, S. (1994). Endosperm starch properties in several Polym., 71, 380‒387. wheat cultivars preferred for Japanese noodles. Euphytica, 72, Chakraborty, M., Matkovic, K., Grier, D.G., Jarabek, E.L., Berzonsky 171‒175. W., and Mcmullen M. (2004). Physicochemical and functional Mirua, H., Tanii, S., and Nakamura, T. (1994). Genetic control of properties of tetraploid and hexaploid waxy wheat starch. Starch- amylose content in wheat endosperm starch and differential effects Starke, 56, 339‒347. of three Wx genes. Theor. Appl. Genet., 89, 276‒280. Crosbie, G.B. (1991). The relationship between starch swelling Miura, H., Wickramasinghe, M.H.A., Subasinghe, R.M., Araki, E., and properties, paste viscosity and boiled noodle quality in wheat flours. Komae, K. (2002). Development of near-isogenic lines of wheat J. Cereal Sci., 13, 145‒150. carrying diferent null Wx alleles and their starch properties. Endo, S., Karobe, S., and Nagao, S. (1988). Factors affecting Euphytica, 123, 353‒359. gelatinization properties of starch. J. Jpn. Soc. Food Sci. Technol. Morita, N., Maeda, T., Miyazaki, M. Yamamori, M., Miura, H., and (Nippon Shokuhin Kogyo Gakkaishi), 35, 7‒14. (in Japanese) Ohtsuka, I. (2002). Dough and baking properties of high-amylose Gadonna-widehem, P., Debiton, C., David, M., Rhazi, L., and Branlard, and waxy wheat flours.Cereal Chem., 79,491‒495. G. (2012). A laboratory protocol for determining glucose and Nakamura, T., Yamamori, M., Hirano, H., and Hidaka, S. (1993). maximum ethanol production from wheat grain: application to a Identification of three waxy proteins in wheat (Triticum aestivum complete genetic set of near-isogenic waxy lines. J. Agric. Food L.). Biochem. Genet., 31, 75‒86. Chem., 60, 985‒990. Nakamura, T., Yamamori, M., Hirano, H., Hidaka, S., and Nagamine, Graybosch, R.A., Gang, G., and Shelton, D.R. (2000). Aberrant falling T. (1995). Production of waxy (amylose-free) wheat. Mol. Gen. numbers of waxy wheats independent of alpha-amylase activity. Genet. , 248, 253‒259. Cereal Chem., 77, 1‒3. Noda, T, Tohnooka, T, Taya, S, and Suda I. (2001). Relationship Graybosch, R.A., Souza, E., Berzonsky, W., Baenziger, P.S., and between physicochemical properties of starches and white salted Chung, O. (2003). Functional properties of waxy wheat flours: noodle quality in Japanese wheat flours.Cereal Chem., 78, 395‒399. Genotypic and environmental effects. J. Cereal Sci., 38,, 69‒76. Panozzo, J.F. and McCormick, K.M. (1993). The rapid viscoanalyser Guo, G., Jackson, D.S., Graybosch, R.A., and Parkurst, A.M. (2003). as a method of testing for noodle quality in a wheat breeding Asian salted noodle quality: impact of amylose content adjustments programme. J. Cereal Sci., 17, 25‒32. using waxy wheat flour.Cereal Chem., 80, 437‒445. Park, C.S. and Baik, B.K. (2004). Cooking time of white salted noodles Hansen, L.E., Jackson, D.S., Wehling, R.L., Wilson, J.D., and and its relationship with protein and amylose contents of wheat. Graybosch, R.A. (2010). Functionality of native tetraploid wheat Cereal Chem., 81, 165‒171. starches: effects of waxy loci alleles and amylose concentration in Park, C.S., Baik, B.K., Ha, Y.W., and Hong, B.H. (2001). Flour quality blends. J. Cereal Sci., 52, 39‒45. characteristics of Korean waxy wheat lines. Korean J. Crop Sci., 46, Hung, P.V., Maed, T., and Morita, N. (2006). Waxy and high-amylose 360‒366. wheat starches and flours characteristics, functionality and Sasaki, T., Kohyama, K., Yasui, T., and Satake, T. (2004). Rheological application. Trends Food Sc. Tech., 17, 448‒456. properties of white salted noodles with different amylose content at Hung, P.V., Yamamori, M., and Morita, N. (2005). Formation of small and large deformation. Cereal Chem., 81, 226‒231. enzyme-resistant starch in bread as affected by high-amylose wheat Sasaki, T., Yasui, T., and Matsuki, J. (2000). Effect of amylose content flour substitutions.Cereal Chem., 82, 690‒694. on gelatinization, retrogradation and pasting properties of starches He, Z.H., Yang, J., Zhang, Y,L., Quail, K.J., and Peña, R.J. (2004). Pan from waxy and nonwaxy wheat and their F1 seeds. Cereal Chem., bread and dry white Chinese noodle quality in Chinese winter 77, 58‒63. wheats. Euphytica. 139, 257‒267. Sharma, R., Sissons, M., Rathjen, A.J., and Jenner C. (2002). The Null- Jane, J.L, Chen, Y.Y., Lee, L.F., McPherson, A.E.,Wong, K.S., and 4A Allele at the waxy locus in wheat affects cooking Radosavljevic, M. (1999). Effects of amylopectin branch chain quality. J. Cereal Sci., 35, 287–297. length and amylose content on the gelatinization and pasting Sun, C., Puthigae, S., Staffan, A., and Jansson, C. (1998). The two properties of starch. Cereal Chem., 76, 629‒637. genes encoding starch-branching enzymes II a and II b are Kim, W., Johnson, J.W., Graybosch, R.A., and Gaines, C.S. (2003). differentially expressed in barley. Plant Physiol., 118, 37‒49. Effects of Wx Gene on Starch, Flour Properties, Dry Noodle Quality 453

Wang, L. and Seib, P.A. (1996). Australian salt-noodle flours and their Zhang, H.X, Zhang W., Xu C.Z., and Zhou X. (2013). Morphological starches compared to US wheat flours and their starches. Cereal features and physicochemical properties of waxy wheat starch. Int. J. Chem., 73, 167‒175. Biol. Macromol, 62, 304‒309. Yamamori, M. and Endo, T.R. (1996). Variation of starch granule Zhang, H.X, Zhang W., Xu C.Z., and Zhou X. (2014). Studies on the proteins and chromosome mapping of their coding genes in common rheological and gelatinization characteristics of waxy wheat flour. wheat. Theor. Appl. Genet., 93, 275‒281. Int. J. Biol. Macromol, 64, 123‒129. Yamamori, M. and Quynh, N.T. (2000). Differential effects of Wx-A1, Zhao, X.C., Batey, I.L., Sharp, P., Crosbie, G., Barclay, I., and Wilson, -B1 and -D1 protein deficiencies on apparent amylose content and R. (1998). A single genetic locus associated with starch granule starch pasting properties in . Theor. Appl. Genet., properties and noodle quality in wheat. Cereal Sci., 27, 7‒13. 100, 32‒38.