DOCSLIB.ORG

Chromatin Structure of Altered Yeast Centromeres

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Chromatin Structure of Altered Yeast Centromeres Proc. Nati. Acad. Sci. USA Vol. 85, pp. 175-179, January 1988 Genetics Chromatin structure of altered yeast centromeres (nuclease chromatin mapping/Dra I sites/sequence-specific structures) MICHAEL SAUNDERS*, MOLLY FITZGERALD-HAYESt, AND KERRY BLOOM* *Department of Biology, University of North Carolina at Chapel Hill, Chapel Hill, NC 27514; and tDepartment of Biochemistry, University of Massachusetts, Amherst, MA 01003 Communicated by John Carbon, August 31, 1987 (receivedfor review June 8, 1987) ABSTRACT We have investigated the chromatin structure meres is, therefore, believed to result from interactions of wild-type and mutationally altered centromere sequences in between CEN DNA, CEN-specific DNA-binding proteins, the yeast Saccharomyces cerevisiae by using an indirect end- and histone proteins. labeling mapping strategy. Wild-type centromere DNA from The relationship between CEN DNA sequence and cen- chromosome III (CEN3) exhibits a nuclease-resistant chroma- tromere function has been investigated by constructing tin structure 220-250 base pairs long, centered around the centromere mutations in vitro and then assaying their segre- conserved centromere DNA element (CDE) III. A point mu- gation capacity in vivo (11-15). These experiments have tation in CDE III that changes a central cytidine to a thymidine indicated that alterations of certain conserved bases, such as and completely disrupts centromere function has lost the the central cytidine residue in CDE III, result in centromere chromatin conformation typically associated with the wild-type dysfunction. Similarly, deletion of CDE III yields a nonfunc- centromere. A second conserved DNA element, CDE I, is tional CEN. However, when CDE I is deleted, the centro- spatially separated from CDE HI by 78.86 A+T-rich base mere retains partial mitotic function (13, 14). Alteration ofthe pairs, which is termed CDE H. The sequence and spatial normal length ofCDE II decreases CEN function in a gradual requirements for CDE II are less stringent; alterations in CDE fashion. II length and sequence can be tolerated to a limited extent. In this report we have investigated the chromatin structure Nuclease-resistant cores are altered in dimension in two CDE of several centromere mutations. We demonstrate that the II CEN3 mutations. Two CDE I deletion mutations that retain nuclease-resistant chromatin core associated with the wild- partial centromere function also show nuclease-resistant re- type centromere is correlated with function. Specifically, gions of reduced size and intensity. The results from a number point mutations in CDE III that destroy centromere function of such altered centromeres indicate a correlation between the also destroy the nuclease-resistant region. The use ofrestric- presence of a protected core and centromere function. tion enzymes as probes for chromatin structure confirms the change in structure associated with loss of centromere The centromere is a specific domain on eukaryotic chromo- function. Centromere mutations that alter the distance be- somes that plays an essential role in the faithful segregation tween CDE I and CDE III alter the overall dimensions of the ofthe chromosomes during mitotic and meiotic cell divisions. nuclease-resistant core. CEN mutations deleted for CDE I Cytologically, the centromere has been defined as the region retain a residual nuclease-resistant structure that is reduced of the chromosome that interacts with the spindle fibers in intensity proportional to their loss of function. during cell division. It has been proposed that centromere- specific DNA-binding proteins mediate the interaction be- tween centromeres and spindle fibers. Following develop- MATERIALS AND METHODS ment of a functional assay for centromeres of the yeast Saccharomyces cerevisiae, the centromeres of 11 of the 16 Strains. S. cerevisiae strain J17 (MATa, his2, adel, trpl, chromosomes have been isolated (1-6). These centromere metl4, ura3-52) was used as the host for the plasmid (CEN) sequences confer stable inheritance on autonomously transformations and for the CEN3 chromosomal substitu- replicating plasmids during mitosis and meiosis (1). Analysis 193-8b containing mutant CEN3 and comparison ofthe DNA sequences ofthe 11 centromeres tions. Substitution strain isolated has allowed description of several conserved se- BS154 substituted in chromosome III is MATa,URA3 (III), quence elements and their spatial organization (3, 6, 7). Each CEN3 BS154 (III), ura3-52(V), adel, metl4 (12). The other centromere has a highly conserved 8-base-pair (bp) region CEN3 substitution strains detailed in Fig. 1B were construct- known as centromere DNA element (CDE) I and a 25-bp ed by transforming the plasmids 303-7, 303-31, 303-42, and region of partial dyad symmetry known as CDE III. These 303-6 (kindly supplied by J. Carbon, University ofCalifornia, elements are separated from one another by a region ofDNA Santa Barbara, CA) in J17 as described (13, 16). that is 78-86 bp long and that is >90o A+T-rich, termed Medium. Cells were grown in synthetic medium [0.67% CDE II. These conserved structural features of yeast yeast nitrogen base, 2% (wt/vol) glucose, and 0.5% Casami- centromeres are suggestive of protein-binding domains. no acids]. Adenine, tryptophan, or uracil (50 ,g/ml) was The centromeric DNA is complexed with chromatin com- added when appropriate. ponents in the cell nucleus such that a 220- to 250-bp core Plasmids. Plasmids pd1314 and pBCT2 were obtained from centered around CDE III is resistant to nuclease digestion of McGrew et al. (11). Plasmid pYe(CEN3)30 has been de- the chromatin DNA (8-10). It has been demonstrated that scribed (3), and plasmids pYe(CEN3)30-C--A and pYe- high-salt washes (0.75-1.25 M NaCI) of the chromatin prior (CEN3)30-C->G are the equivalent plasmids containing CDE to nuclease treatment destroy the nuclease-resistant core. III point mutations described in Fig. 1A. The orientation of The nuclease-resistant core associated with yeast centro- the CEN3 fragment is reversed with respect to that in pYe(CEN3)30. Plasmid 303-6 AR was constructed by insert- ing ARS2 into the unique Xho I site of 303-6 (16). The publication costs of this article were defrayed in part by page charge payment. This article must therefore be hereby marked "advertisement" in accordance with 18 U.S.C. §1734 solely to indicate this fact. Abbreviations: CEN, centromere; CDE, centromere DNA element. Downloaded by guest on September 27, 2021 175 176 Genetics: Saunders et al. Proc. Natl. Acad. Sci. USA 85 (1988) Preparation and Digestion of Yeast Nuclei. This procedure symmetric 25-bp CDE III is conserved in all 11 CEN was as described (8). Yeast cells were always grown in sequences analyzed. This degree ofconservation suggests an selective medium. For the restriction analysis ofcentromeric essential function for this nucleotide. In vitro mutagenesis chromatin structure, nuclei were resuspended in TC buffer has been used to alter this residue in a 624-bp CEN3 fragment (10 mM Tris HCl, pH 7.6/0.1 mM CaCl2/20 mM NaCl/10 creating a series of point mutations with an adenosine or mM MgCI2) and incubated 30 min with Dra I at 150 units/ml. guanosine replacing the wild-type cytidine (R. Ogden and Preparation and Analysis of DNA. Chromatin DNA was K.B., unpublished results). AC -- T mutation at this position extensively deproteinized as described (8). A portion of the in a 211-bp CEN3 derivative has been characterized (pBCT2, total DNA was cleaved with DNase I (50 ng/ml) following ref. 11). Both the wild-type 624-bp and the 211-bp CEN3 deproteinization (see Figs. 2 and 4). All DNA samples were DNAs contain CDE I, II, and III and have been shown to then digested to completion with HindIll. Molecular weight promote accurate chromosome segregation during mitosis markers were constructed from yeast DNA by appropriate and meiosis. When the mutated centromeres were tested for restriction endonuclease digestions. DNA fragments were their ability to stabilize autonomously replicating plasmids in electrophoresed in 1.5% or 1.9% agarose slab gels, trans- yeast, the thymidine mutation (pBCT2, ref. 11) was found to ferred to nitrocellulose sheets, and hybridized to a radiola- be essentially nonfunctional, and the adenosine and guano- beled 346-bp HindIII-BamHI fragment of pBR322 as de- sine mutations [pYE(CEN3)30-C--A and pYE(CEN3)30- scribed (8). The 346-bp fragment of pBR322 is adjacent to all C--G] were severely reduced in function (Fig. LA). The the centromere DNAs mapped. plasmids pBCT2 and pYe(CEN3)30-C-->A and -C-*G were only present in a small percent of the population due to their RESULTS unequal partitioning at each cell division. Their copy number in the plasmid-bearing cells was elevated to 20 copies per cell Chromatin Mapping ofCEN3 CDE m Point Mutations. The (unpublished observations). Thus a single base-pair change in central cytidine residue in the highly conserved, partially the CEN3 sequence could alter the segregation capabilities A. Element m TGTTTRTG * TTTCCGAAA * AAA Consensus 9109 79 910 710910101010106 8 8 6 CEN3 Element m TGTATTTGATTTCCGAAAGTTAAAAAAG Plasmid Loss per Generation pBCT2 C-T 0.35 pYe(CEN3)30 C-A 0.17 pYe(CEN3)30 C -G 0.21 pdl314 C 0.03 B. Spatial Arrangement of CEN3 Mutants Fraction of mated cells Alteration in population I 24 34 14 12 303-6 i . i - - 1.1 x 10 5 (Wild-type) BS154 I GC-rich m 24_34-r 14I -- |* *2 34 14 12 (70bp insertion 1.8 x 10-3 in CDE II ) 22 I m 303-7 24 12 (48bp deletion _ . _. 1.2 x 10-2 in CDE R ) m %.p34-r 14I - 14- 12- 303-42 i i i i 1.1 x 10 3 (74bp CDE ) 303-31 34 12 (46bp CDE I1) _ 4.2 x 10-2 FIG.
Load more

Recommended publications
  • Re-Coding the ‘Corrupt’ Code: CRISPR-Cas9 Interventions in Human Germ Line Editing
    Re-coding the ‘corrupt’ code: CRISPR-Cas9 interventions in human germ line editing CRISPR-Cas9, Germline Intervention, Human Cognition, Human Rights, International Regulation Master Thesis Tilburg University- Law and Technology 2018-19 Tilburg Institute for Law, Technology, and Society (TILT) October 2019 Student: Srishti Tripathy Supervisors: Prof. Dr. Robin Pierce SRN: 2012391 Dr. Emre Bayamlioglu ANR: 659785 Re-coding the ‘corrupt’ code CRISPR-Cas9, Germline Intervention, Human Cognition, Human Rights, International Regulation This page is intentionally left blank 2 Re-coding the ‘corrupt’ code CRISPR-Cas9, Germline Intervention, Human Cognition, Human Rights, International Regulation 3 Re-coding the ‘corrupt’ code CRISPR-Cas9, Germline Intervention, Human Cognition, Human Rights, International Regulation Table of Contents CHAPTER 1: Introduction .............................................................................................................. 6 1.1 Introduction and Review - “I think I’m crazy enough to do it” ......................................................................... 6 1.2 Research Question and Sub Questions .......................................................................................................................... 9 1.4 Methodology ............................................................................................................................................................................. 9 1.4 Thesis structure: .................................................................................................................................................................
    [Show full text]
  • DNA Damage Alters Nuclear Mechanics Through Chromatin Reorganisation
    bioRxiv preprint doi: https://doi.org/10.1101/2020.07.10.197517; this version posted July 11, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. DNA damage alters nuclear mechanics through chromatin reorganisation Ália dos Santos1, Alexander W. Cook1, Rosemarie E Gough1, Martin Schilling2, Nora Aleida Olszok2, Ian Brown3, Lin Wang4, Jesse Aaron5, Marisa L. Martin-Fernandez4, Florian Rehfeldt2,6* and Christopher P. Toseland1* 1Department of Oncology and Metabolism, University of Sheffield, Sheffield, S10 2RX, UK.2University of Göttingen, 3rd Institute of Physics – Biophysics, Göttingen, 37077, Germany. 3School of Biosciences, University of Kent, Canterbury, CT2 7NJ, UK. 4Central Laser Facility, Research Complex at Harwell, Science and Technology Facilities Council, Rutherford Appleton Laboratory, Harwell, Didcot, Oxford OX11 0QX, UK. 5Advanced Imaging Center, HHMI Janelia Research Campus, Ashburn, USA. 6University of Bayreuth, Experimental Physics 1, Bayreuth, 95440, Germany. *Corresponding Authors: Florian Rehfeldt [email protected] & Christopher P. Toseland [email protected] Key words: Mechanics, DNA damage, DNA organisation, Nucleus ABSTRACT Cisplatin, specifically, creates adducts within the DNA double-strand breaks (DSBs) drive genomic double helix, which then lead to double-strand instability. For efficient and accurate repair of breaks (DSBs) in the DNA during replication, these DNA lesions, the cell activates DNA through replication-fork collapse3. damage repair pathways. However, it remains DSBs can result in large genomic aberrations and unknown how these processes may affect the are, therefore, the most deleterious to the cell.
    [Show full text]
  • Staining, and in Situ Digestion with Restriction Endonucleases
    Heredity66 (1991) 403—409 Received 23 August 1990 Genetical Society of Great Britain An analysis of coho salmon chromatin by means of C-banding, AG- and fluorochrome staining, and in situ digestion with restriction endonucleases R. LOZANO, C. RUIZ REJON* & M. RUIZ REJON* Departamento de Biologia Animal, Ecologia y Genética. E. /ngenierIa T. AgrIcola, Campus Universitario de Almeria, 04120 AlmerIa and *Facu/tad de Ciencias, 18071 Granada, Universidad de Granada, Spain Thechromosome complement of the coho salmon (Oncorhynchus kisutch) has been analysed by means of C-banding, silver and fluorochrome staining, and in situ digestion with restriction endo- nucleases. C-banding shows heterochromatic regions in the centromeres of most chromosomes but not in the telomeric areas. The fifteenth metacentric chromosome pair contains a large block of constitutive heterochromatin, which occupies almost all of one chromosome arm. This region is also the site where the ribosomal cistrons are located and it reacts positively to CMA3/DA fluorochrome staining. The NORs are subject to chromosome polymorphism, which might be explicable in terms of an amplification of ribosomal cistrons. The digestion banding patterns produced by four types of restriction endonucleases on the euchromatic and heterochromatic regions are described. Two kinds of highly repetitive DNAs can be distinguished and the role of restriction endonucleases as a valuable tool in chromosome characterization studies, as well as in the analysis of the structure and organization of fish chromatin, are also discussed. Keywords:C-banding,coho salmon, fluorochrome staining, restriction endonuclease banding. (Oncorhynchus kisutch), as well as applying conven- Introduction tional banding techniques, we have analysed the Theuse of restriction endonucleases (REs) is becom- mitotic chromosomes using DNA base-pair-specific ing common not only in molecular biology but also as fluorochromes and in situ digestion with restriction an important tool in molecular cytogenetics.
    [Show full text]
  • Chromatin Assembly
    Chromatin Assembly (version A2) Catalog No. 53500 Active Motif North America 1914 Palomar Oaks Way, Suite 150 Carlsbad, California 92008, USA Toll free: 877 222 9543 Telephone: 760 431 1263 Fax: 760 431 1351 Active Motif Europe Avenue Reine Astrid, 92 B-1310 La Hulpe, Belgium UK Free Phone: 0800 169 31 47 France Free Phone: 0800 90 99 79 Germany Free Phone: 0800 181 99 10 Telephone: +32 (0)2 653 0001 Fax: +32 (0)2 653 0050 Active Motif Japan Azuma Bldg, 7th Floor 2-21 Ageba-Cho, Shinjuku-Ku Tokyo, 162-0824, Japan Telephone: +81 3 5225 3638 Fax: +81 3 5261 8733 Active Motif China 787 Kangqiao Road Building 10, Suite 202, Pudong District Shanghai, 201315, China Telephone: (86)-21-20926090 Hotline: 400-018-8123 Copyright 2018 Active Motif, Inc. www.activemotif.com Information in this manual is subject to change without notice and does not constitute a commit- ment on the part of Active Motif, Inc. It is supplied on an “as is” basis without any warranty of any kind, either explicit or implied. Information may be changed or updated in this manual at any time. This documentation may not be copied, transferred, reproduced, disclosed, or duplicated, in whole or in part, without the prior written consent of Active Motif, Inc. This documentation is proprietary information and protected by the copyright laws of the United States and interna- tional treaties. The manufacturer of this documentation is Active Motif, Inc. © 2018 Active Motif, Inc., 1914 Palomar Oaks Way, Suite 150; Carlsbad, CA 92008. All rights reserved.
    [Show full text]
  • Chromatin Structure
    Chromatin Structure Dr. Carol S. Newlon [email protected] ICPH E250P DNA Packaging Is a Formidable Challenge • Single DNA molecule in human chromosome ca. 5 cm long • Diploid genome contains ca. 2 meters of DNA • Nucleus of human cell ca. 5 µm in diameter • Human metaphase chromosome ca. 2.5 µm in length • 10,000 to 20,000 packaging ratio required Overview of DNA Packaging Packaging in Interphase Nucleus Chromatin Composition • Complex of DNA and histones in 1:1 mass ratio • Histones are small basic proteins – highly conserved during evolution – abundance of positively charged aa’s (lysine and arginine) bind negatively charged DNA • Four core histones: H2A, H2B, H3, H4 in 1:1:1:1 ratio • Linker histone: H1 in variable ratio Chromatin Fibers 11-nm fiber 30-nm fiber • beads = nucleosomes • physiological ionic • compaction = 2.5X strength (0.15 M KCl) • low ionic strength buffer • compaction = 42X • H1 not required • H1 required Micrococcal Nuclease Digestion of Chromatin Stochiometry of Histones and DNA • 146 bp DNA ca. 100 kDa • 8 histones ca 108 kDa • mass ratio of DNA:protein 1:1 Structure of Core Nucleosome 1.65 left handed turns of DNA around histone octamer Histone Structure Assembly of a Histone Octamer Nucleosomes Are Dynamic Chromatin Remodeling Large complexes of ≥ 10 proteins Use energy of ATP hydrolysis to partially disrupt histone-DNA contacts Catalyze nucleosome sliding or nucleosome removal 30-nm Chromatin Fiber Structure ?? Models for H1 and Core Histone Tails in Formation of 30-nm Fiber Histone Tails Covalent Modifications
    [Show full text]
  • Chromatin That Guides Dosage Compensation Is Modulated by the Sirna Pathway in Drosophila Melanogaster
    HIGHLIGHTED ARTICLE | INVESTIGATION Chromatin That Guides Dosage Compensation Is Modulated by the siRNA Pathway in Drosophila melanogaster Nikita Deshpande and Victoria H. Meller1 Department of Biological Sciences, Wayne State University, Detroit, Michigan 48202 ABSTRACT Many heterogametic organisms adjust sex chromosome expression to accommodate differences in gene dosage. This requires selective recruitment of regulatory factors to the modulated chromosome. How these factors are localized to a chromosome with requisite accuracy is poorly understood. Drosophila melanogaster males increase expression from their single X chromosome. Identification of this chromosome involves cooperation between different classes of X-identity elements. The chromatin entry sites (CES) recruit a chromatin-modifying complex that spreads into nearby genes and increases expression. In addition, a family of satellite repeats that is enriched on the X chromosome, the 1.688X repeats, promotes recruitment of the complex to nearby genes. The 1.688X repeats and CES are dissimilar, and appear to operate through different mechanisms. Interestingly, the siRNA pathway and siRNA from a 1.688X repeat also promote X recognition. We postulate that siRNA-dependent modification of 1.688X chromatin contributes to recognition of nearby genes. In accord with this, we found enrichment of the siRNA effector Argonaute2 (Ago2) at some 1.688X repeats. Mutations in several proteins that physically interact with Ago2, including the histone methyltransferase Su(var)3-9, enhance the lethality of males with defective X recognition. Su(var)3-9 deposits H3K9me2 on some 1.688X repeats, and this mark is disrupted upon ectopic expression of 1.688X siRNA. Furthermore, integration of 1.688X DNA on an autosome induces local H3K9me2 de- position, but enhances expression of nearby genes in a siRNA-dependent manner.
    [Show full text]
  • Meiosis I and Meiosis II; Life Cycles
    Meiosis I and Meiosis II; Life Cycles Meiosis functions to reduce the number of chromosomes to one half. Each daughter cell that is produced will have one half as many chromosomes as the parent cell. Meiosis is part of the sexual process because gametes (sperm, eggs) have one half the chromosomes as diploid (2N) individuals. Phases of Meiosis There are two divisions in meiosis; the first division is meiosis I: the number of cells is doubled but the number of chromosomes is not. This results in 1/2 as many chromosomes per cell. The second division is meiosis II: this division is like mitosis; the number of chromosomes does not get reduced. The phases have the same names as those of mitosis. Meiosis I: prophase I (2N), metaphase I (2N), anaphase I (N+N), and telophase I (N+N) Meiosis II: prophase II (N+N), metaphase II (N+N), anaphase II (N+N+N+N), and telophase II (N+N+N+N) (Works Cited See) *3 Meiosis I (Works Cited See) *1 1. Prophase I Events that occur during prophase of mitosis also occur during prophase I of meiosis. The chromosomes coil up, the nuclear membrane begins to disintegrate, and the centrosomes begin moving apart. The two chromosomes may exchange fragments by a process called crossing over. When the chromosomes partially separate in late prophase, until they separate during anaphase resulting in chromosomes that are mixtures of the original two chromosomes. 2. Metaphase I Bivalents (tetrads) become aligned in the center of the cell and are attached to spindle fibers.
    [Show full text]
  • Chromatin Accessibility and the Regulatory Epigenome
    REVIEWS EPIGENETICS Chromatin accessibility and the regulatory epigenome Sandy L. Klemm1,4, Zohar Shipony1,4 and William J. Greenleaf1,2,3* Abstract | Physical access to DNA is a highly dynamic property of chromatin that plays an essential role in establishing and maintaining cellular identity. The organization of accessible chromatin across the genome reflects a network of permissible physical interactions through which enhancers, promoters, insulators and chromatin-binding factors cooperatively regulate gene expression. This landscape of accessibility changes dynamically in response to both external stimuli and developmental cues, and emerging evidence suggests that homeostatic maintenance of accessibility is itself dynamically regulated through a competitive interplay between chromatin- binding factors and nucleosomes. In this Review , we examine how the accessible genome is measured and explore the role of transcription factors in initiating accessibility remodelling; our goal is to illustrate how chromatin accessibility defines regulatory elements within the genome and how these epigenetic features are dynamically established to control gene expression. Chromatin- binding factors Chromatin accessibility is the degree to which nuclear The accessible genome comprises ~2–3% of total Non- histone macromolecules macromolecules are able to physically contact chroma­ DNA sequence yet captures more than 90% of regions that bind either directly or tinized DNA and is determined by the occupancy and bound by TFs (the Encyclopedia of DNA elements indirectly to DNA. topological organization of nucleosomes as well as (ENCODE) project surveyed TFs for Tier 1 ENCODE chromatin- binding factors 13 Transcription factor other that occlude access to lines) . With the exception of a few TFs that are (TF). A non- histone protein that DNA.
    [Show full text]
  • Histone Monoubiquitination in Chromatin Remodelling: Focus on the Histone H2B Interactome and Cancer
    cancers Review Histone Monoubiquitination in Chromatin Remodelling: Focus on the Histone H2B Interactome and Cancer Deborah J. Marsh 1,2,* , Yue Ma 1 and Kristie-Ann Dickson 1 1 Translational Oncology Group, Faculty of Science, School of Life Sciences, University of Technology Sydney, Ultimo, NSW 2007, Australia; [email protected] (Y.M.); [email protected] (K.-A.D.) 2 Kolling Institute, Faculty of Medicine and Health, Northern Clinical School, University of Sydney, Camperdown, NSW 2006, Australia * Correspondence: [email protected]; Tel.: +61-2-9514-7574 Received: 17 October 2020; Accepted: 17 November 2020; Published: 20 November 2020 Simple Summary: Post-translational modifications (PTM) of histone tails represent epigenomic regulation of the chromatin landscape, influencing gene expression and the response to DNA damage. This review focusses on cancer-associated roles of ubiquitin as a histone PTM, specifically in conjunction with an E3 ubiquitin ligase cascade that results in the addition of a single ubiquitin (monoubiquitination) to histone H2B at lysine 120 (H2Bub1). H2Bub1 has roles in chromatin accessibility important for transcriptional elongation, the DNA damage response, cellular proliferation and developmental transitions, including in stem cell plasticity. It has been implicated in inflammation and tumour progression, with examples of its loss associated with a worse prognosis for patients with some cancers. Many factors involved in the H2Bub1 interactome are well known cancer-associated proteins, including p53, BRCA1 and components of the SWI/SNF remodelling complex. Increased knowledge of H2Bub1 and its interactome offers new opportunities for therapeutic targeting of malignancy. Abstract: Chromatin remodelling is a major mechanism by which cells control fundamental processes including gene expression, the DNA damage response (DDR) and ensuring the genomic plasticity required by stem cells to enable differentiation.
    [Show full text]
  • Chromatin and Nucleosome Dynamics in DNA Damage and Repair
    Downloaded from genesdev.cshlp.org on October 3, 2021 - Published by Cold Spring Harbor Laboratory Press REVIEW Chromatin and nucleosome dynamics in DNA damage and repair Michael H. Hauer1,2,3 and Susan M. Gasser1,2 1Friedrich Miescher Institute for Biomedical Research, CH-4058 Basel, Switzerland; 2Faculty of Natural Sciences, University of Basel, CH-4056 Basel, Switzerland Chromatin is organized into higher-order structures that In yeast, nucleosome remodelers indeed promote long- form subcompartments in interphase nuclei. Different range chromatin movement and the relocation of genomic categories of specialized enzymes act on chromatin and loci to specific sites of anchorage or repair (Dion et al. regulate its compaction and biophysical characteristics 2012; Neumann et al. 2012; Seeber et al. 2013a; Horigome in response to physiological conditions. We present an et al. 2014; Strecker et al. 2016). Intriguingly, the subnu- overview of the function of chromatin structure and its clear mobility of chromatin in yeast, as monitored by dynamic changes in response to genotoxic stress, focusing time-lapse microscopy, increases both at sites of induced on both subnuclear organization and the physical mobili- double-strand breaks (DSBs) and genome-wide; that is, at ty of DNA. We review the requirements and mechanisms undamaged sites in response to widespread damage. In that cause chromatin relocation, enhanced mobility, and both cases, the increase depends on both the INO80 chromatin unfolding as a consequence of genotoxic le- remodeler and checkpoint kinase activation (Dion et al. sions. An intriguing link has been established recently be- 2012; Mine-Hattab and Rothstein 2012; Seeber et al. tween enhanced chromatin dynamics and histone loss.
    [Show full text]
  • Regulation of Meiotic Chromatin Loop Size by Chromosomal Position (Synaptonemal Complex/Telomere/Chromatin Packaging/Recombination/In Situ Hybridization) HENRY H
    Proc. Natl. Acad. Sci. USA Vol. 93, pp. 2795-2800, April 1996 Genetics Regulation of meiotic chromatin loop size by chromosomal position (synaptonemal complex/telomere/chromatin packaging/recombination/in situ hybridization) HENRY H. Q. HENG*t, JOHN W. CHAMBERLAINt, XIAO-MEI SHIt, BARBARA SPYROPOULOS*, LAP-CHEE TSUIt, AND PETER B. MOENS* *Department of Biology, York University, 4700 Keele Street, Downsview, ON Canada M3J 1P3; and tDepartment of Genetics, Hospital for Sick Children, 555 University Avenue, Toronto, ON Canada M5G 1X8 Communicated by C. C. Tan, Fudan University, Shanghai, Peoples Republic of China, November 7, 1995 ABSTRACT At meiotic prophase, chromatin loops resumes, albeit at less than normal levels, when bacterial DNA around a proteinaceous core, with the sizes ofthese loops varying is interspersed with mouse sequences (6). between species. Comparison of the morphology of sequence- In nonmeiotic cells, gene behavior varies with chromosomal related inserts at different sites in transgenic mice demonstrates geography. Genes located near the telomeres undergo position that loop size also varies with chromosomal geography. Simi- effect variegation, suggesting the existence of a distinct type of larly, chromatin loop lengths differ dramatically for interstitially chromatin packaging at the chromosome ends, which prevents and terminally located hamster telomeric sequences. Sequences, access to DNA binding proteins, resulting in repression of telomeric or otherwise, located at chromosome termini, closely transcription. Ultrastructural investigations into this phenom- associate with the meiotic proteinaceous core, forming shorter enon have revealed differential chromatin structure at the loops than identical interstitial sequences. Thus, we present extreme tip of the telomeres of rat and human chromosomes evidence that different chromatin packaging mechanisms exist in which telomere-specific nucleosome array patterns indicate for interstitial versus terminal chromosomal regions, which act differential organization at this packaging level (7, 8).
    [Show full text]
  • Single-Cell Lineage Tracing by Endogenous Mutations Enriched In
    SHORT REPORT Single-cell lineage tracing by endogenous mutations enriched in transposase accessible mitochondrial DNA Jin Xu1,2,3, Kevin Nuno4,5, Ulrike M Litzenburger1,2,3, Yanyan Qi1,2,3, M Ryan Corces1,2,3, Ravindra Majeti4,5*, Howard Y Chang1,2,3,6* 1Center for Personal Dynamic Regulomes, Stanford, United States; 2Department of Dermatology, Stanford University School of Medicine, Stanford, United States; 3Department of Genetics, Stanford University School of Medicine, Stanford, United States; 4Institute for Stem Cell Biology and Regenerative Medicine, Stanford University School of Medicine, Stanford, United States; 5Division of Hematology, Department of Medicine, Stanford University School of Medicine, Stanford, United States; 6Howard Hughes Medical Institute, Stanford University, Stanford, United States Abstract Simultaneous measurement of cell lineage and cell fates is a longstanding goal in biomedicine. Here we describe EMBLEM, a strategy to track cell lineage using endogenous mitochondrial DNA variants in ATAC-seq data. We show that somatic mutations in mitochondrial DNA can reconstruct cell lineage relationships at single cell resolution with high sensitivity and specificity. Using EMBLEM, we define the genetic and epigenomic clonal evolution of hematopoietic stem cells and their progenies in patients with acute myeloid leukemia. EMBLEM extends lineage tracing to any eukaryotic organism without genetic engineering. DOI: https://doi.org/10.7554/eLife.45105.001 *For correspondence: [email protected] (RM); Introduction [email protected] (HYC) Resolving lineage relationships between cells is necessary to understand the fundamental mecha- nisms underlying normal development and the progression of disease. In recent years, new methods Competing interest: See have emerged to enable cell lineage tracking with increasing resolution, leading to substantial bio- page 11 logical insights (Woodworth et al., 2017).
    [Show full text]