Morphological and Molecular Processes of Polyp Formation in Apc@716 Knockout Mice

(CANCER RESEARCH 57. 1644-1649. May 1. 19971

Advances in Brief

Hiroko Oshima, Masanobu Oshima, Masahiko Kobayashi, Masahiro Tsutsumi and Makoto M. Taketo'

Banyu Tsukuba Research Institute (Merck). Tsukuba 3tXJ.26 JH. 0.. M. 0.. M. K., M. M. Ti; Department of Oncologica! Pathology, Cancer Center, Nara Medical College. Kashihara, Nara 634 fM. TI: and Department of Biomedical Genetics, Faculty of Pharmaceutical Sciences. The University of Tokyo. 7-3@I Hongo, Bunkyo-ku, Tokyo 113 IM.M. TI.Japan

Abstract stable, parallel helical dimer (9). Truncated APC proteins can asso ciate with the wild-type protein in vivo as well (10). Accordingly, it Mutations in the human adenomatous polyposis coli (APC) gene are was suggested that the truncated APC protein inactivates the wild responsible for not only familial adenomatous polyposis but also many type protein in a dominant-negative manner. However, such a hypoth sporadic cancers of the digestive tract. Using homologous recombination in embryonicstem cells,we recently constructedApcgeneknockout mice esis was ruled out by experiments using transgenic mice that cx that contained a truncation mutation at codon 716 (Apc@716). The het pressed third copy Apc minigenes with truncation mutations at high erozygous mice developed numerous intestinal polyps. All microadenomas levels in the gut, because not a single polyp developed in any of these dissected from nascent polyps had already lost the wild-type allele, mdi transgenic mice (1 1). Immunostaining studies showed that the wild cating the loss of heterozygosity (M. Oshima et a!., Proc. Natl. Acad. Sci. type, but not mutant, APC protein associates with the microtubule USA, 92: 4482â€”4486, 1995). We also demonstrated that cyclooxygenase 2 cytoskeleton (12, 13). A recent immunocytochemical analysis dem is induced in the polyps at an early stage and plays a key role in polyp onstrated localization of APC protein at filopodia at the leading edges development (M. Oshima et aL, Cell 87: 803â€”809,1996). of migrating cells, indicating that APC protein is involved in cell We have analyzed the process of polyp development in these mice both migration (14). In addition, forced expression of APC protein in at morphological and molecular levels. A small intestinal microadenoma is transgenic mice induces disordered cell migration in the intestinal initiated as an outpocketing pouch in a single crypt and develops into the inner (lacteal) side of a neighboring villas forming a double-layer nascent epithelium (15). Several mouse models of FAP were constructed polyp. The microadenoma then enlarges and gets folded inside the villus. either by chemical mutagenesis of the Apc gene (Mm mouse, a When it fIlls the intravillous space, it expands downward and extends into truncation mutation at codon 850; Refs. 16 and 17) or by homologous adjoining viii, rather than rupturing into the intestinal lumen. During this recombination in embryonic stem cells (Apc1638 at codon 1638, Ref. course of development, the basement membrane remains intact, and the 18; Apc@716at codon 716, Ref. 19). In all of these mice, the homozy labeling index of the microadenoma cells is similar to that of the normal gous mutants die in utero before 8 days postcoitum, whereas het crypt epithelium. As in the crypt cells, neither transforming growth factor erozygotes develop polyps in the small and large intestines. Interest 131nor its receptor type II is expressed in the microadenoma cells. No hot ingly, most polyps are found in the small intestine, although a spot mutations in the K-ras gene are found in the microadenoma tissue relatively small but significant number of polyps develop in the colon, during these early stages of polyp development. Essentially, the same a phenotype different from human FAP. Two genes were reported to results have been obtained for the colonic polyps as well. These results suggest that early adenomas in the Apc@716 polyps are very similar to the affect intestinal polyp formation in Mm mice, i.e., DNA methyltrans normal proliferating cells of the crypt except for the lack of directed ferase and the modifier of Mm-I (Mom-i) genes (20, 21). The clinical migration along the crypt-villus axis. relevance of these genes, however, remains to be investigated further. On the other hand, we recently presented genetic and pharmacological Introduction evidence that the cyclooxygenase-2 gene plays a key role in polyp formation in Apc@716knockout mice (22). Mutations in the APC2 gene on chromosome 5q2 1 (1â€”4)are re In this report, we describe the results of morphological, immuno sponsible for not only FAP but also many sporadic cancers of the histochemical, and genetic analyses of the processes of polyp forma digestive tract such as coborectal axis, stomach, and esophagus (5â€”7). tion in the Apc@716mice and discuss the molecular mechanism behind The gene consists of 15 exons encoding a huge protein of about 2840 them. amino acids and several 5' noncoding exons. Exons 1â€”14are rela tively short, whereas exon 15 occupies three quarters of the whole Materials and Methods coding region. Most FAP patients carry truncation mutations in the NH2-terminal half (8). Approximately 900 residues of the NH2- Apc@716Knockout Mice. Construction and basic characterizationof terminal of the APC protein contain proline-free blocks with heptad Apc@716 knockout mice have been described previously (19). The C57BL/6- repeats of hydrophobic residues. Such a pattern is characteristic of Apc@716 pedigree is maintained at Banyu Tsukuba Research Institute (Merck) a-helical coiled-coils and implicated in protein-protein interactions, by crossing male Apc@716heterozygoteswith C57BLI6N females. suggesting its association with itself and/or with other cellular pro Morphological Analysis of Polyposis. Dissection and analysis of the in teins (I, 3). In fact, a subdomain of the first 55 amino acids forms a testinal/colonic polyps under a dissection microscope and their histological investigation have been described earlier (19, 22â€”24). Briefly, the entire small intestinal tract and colon were filled with 10% formaldehyde-PBS, opened Received 1/14/97; accepted 3/20/97. longitudinally, and examined under a dissection microscope. For histological The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked advertisement in accordance with examinations, fixed intestines were embedded in paraffin and sectioned at 18 U.S.C. Section 1734 solely to indicate this fact. 5-,xm thickness. Sections were stained with H&E or toluidine blue. I To whom requests for reprints should be addressed. Phone and Fax: 8 1-3-5802-8832; Morphological Analysis of ACF. A methylene blue tattoo method (25) E-mail: [email protected]. was used. Briefly, colon samples were opened longitudinally and fixed in 10% 2 The abbreviations used are: Ape. adenomatous polyposis coli; FAP, familial ade nomatous polyposis; ACF. aberrant crypt foci; TGF, transforming growth factor; TGF formaldehyde-PBS. The fixed samples were stained with 0.2% methylene @RII,TBF-@3receptor type II; BrdUrd, bromodeoxyuridine; LOH, loss of heterozygosity. blue-PBS and examined under a dissecting microscope. 1644

Immunohistochemical Analysis. Sample preparation and processing was Results and Discussion essentially the same as described previously (11, 19). Silver staining of the basement membrane was performed as described previously (26). Antibodies We previously constructed and analyzed the Apc@716knockout against TGF-@l and TGF-@ receptor type II, and the control peptides for mice and found nascent polyps that consisted of a layer of microad antibody absorption experiments were purchased from Santa Cruz Biotechnol enoma growing inside the normal epithelium of a single villus (Ref. ogy and used at the final concentration of 10 jtg/ml in 3% normal goat 19; Fig. 1, A, D, and G). When the microadenoma inside such a serum-0.l% BSA-PBS according to the Vectastatin ABC kit protocol (Vector nascent polyp proliferated further, the adenoma tissue was folded with Laboratories, Inc.). an increased surface area inside the normal villous epithelium (Fig. 1, Labeling Index Analysis. A BrdUrd labeling and detection kit (Boehringer B, E, and H). Upon further expansion of the adenoma, however, it did Mannheim Biochemica) was used according to the manufacturer's protocol. Two 17-week-oldmice were inoculated iv. with 300 pJ ofthe BrdUrd solution not rupture into the intestinal lumen but somehow expanded into the and sacrificed 4 h later. Intestine samples were fixed with 70% ethanol at 4Â°C adjoining villi through the inner (i.e., mucosal) side, leaving the overnight, dehydrated, embedded in paraffin wax, and sectioned serially at normal villous epithelium intact. As shown in Fig. 1, C, F, and I, 5-sm thickness. Immunostaining of BrdUrd incorporated into DNA was larger polyps had an appearance of multiple villi stuck together, with performed according to the manufacturer's protocol. Seven independent sec the normal epithelium of several villi still covering the adenoma tions that contained polyps and those that did not were photographed from the tissue. These dissection micrographs and histological pictures are small intestine and colon, respectively. The labeling indices were determined summarized schematically in Fig. 2 (see â€œDiscussionâ€•).Aswe de by dividing the number of the labeled nuclei by the number of the total nuclei scribed earlier, these polyps were histologically classified as adeno for each crypt (small intestine), proliferation zone (colon), or polyp. Molecular Analysis. To genotype the Apc gene in the colonic dysplastic mas (19). As shown in Fig. 3, B and D, the basement membrane was crypts, serially sectioned cryosamples were first stained with H&E. After preserved intact, although the cellular atypism was stronger in mul localizing dysplastic crypts, the corresponding tissue was collected from neigh tivillous polyps than the nascent ones. These tumors did not infiltrate boring cryosections using a fine-tip scalpel, the DNA was extracted in a beyond the muscularis mucosae at this stage of polyp development. In proteinase K solution, and Apc gene LOH was determined as described more advanced tumors often found in moribund mice of 20 weeks or previously (19). PCR and sequence analyses of the K-ras gene (Kras2) were older, some adenomas were invading the muscularis mucosae (Fig. performed for the mutation hot spots according to George et a!. (27), i.e., a 3E). Because most Apc'@716knockout mice die of anemia before 20 segment sandwiching codon 12 of exon 1 was amplified with PCR primers: weeks of age (19), metastasis to other organs such as liver or perito KF1 (sense), ATGACTGAGTATAAACTfGT; and KR1 (antisense), CTC neal lymph nodes was not observed. TATCGTAGGGTCGTACT.Anothersegmentsandwichingcodon 61 of exon 2 was amplified with: KF2 (sense), ACTCCTACAGGAAACAAGTA; and Because of its relevance to human FAP and colon cancer, it is KR2 (antisense), TATAATGGTGAATATC1TC. Each sense primer was end important to investigate the development of colonic polyps in the labeled with [-y-32P]and T4 polynucleotide kinase, amplified by PCR, and Apc@716mice. As shown in Fig. 4, we found histological pictures that directly sequenced using a Taq Cycle sequencmg kit (Takara, Ohtsu, Japan). suggest a similar mechanism of polyp formation to that in the small

@@@ @â€˜::, .â€˜ @: â€˜:@@:

Fig. 1. Three early morphological stages of intestinal polyp formation in Apc@716heterozygotes, i.e., the nascent polyps (A, D, and G); uni-villous polyps (B, E. and H); and multivillous polyps (C. F, and 1). Dissection micrographs: Aâ€”C,viewed from the intestinal lumen; Dâ€”F,viewed from the side of the villi; Gâ€”1,histological sections, stained with toluidine blue (G and H) or H&E (1).Bars: Aâ€”Fand1. 500 j@m;G and H, 100 jsm. 1645

proposed that human colorectal tumorigenesis proceeds though a series of genetic alterations involving oncogenes (ras), DNA hypo methylation, and tumor suppressor genes such as APC, DCC, and/or p53 (28, 29). Accordingly, we determined the K-ras gene (Kras2) sequence in the early stage intestinal polyps from the Apc'@716het erozygotes. Among five microadenoma samples we tested, none of them showed mutations in the hot spots corresponding to codon 12 or 61 of Kras2 (data not shown). Several lines of evidence indicated that some of â€œACF'ofthe colon may be a precancerous lesion. These cryptal lesions, originally ob served in carcinogen-treated mice or rats and later confirmed in humans as well, are distinguished by their increased size, thicker epithelial lining, and increased pericryptal zone (30). Human ACF can be classified as either dysplastic or nondysplastic, with the latter far outnumbering the former (31, 32). Moreover, K-RAS (KRAS2) muta

Fig. 2. Schematic presentation of intestinal polyp formation processes in Apc'@'716 heterozygous mice. A, normal intestinal epithelium. Crypt cells are colored in yellow, whereas the differentiated cells of the villi are blue. B and C, outpocketing pouches (in pink) formed at the proliferative zone of the crypt (yellow) develop into the back (lacteal) side of the neighboring villi. D. a double-layer structure of the nascent polyp that consists of microadenoma tissue (pink) attaching inside the normal villous epithelium (blue). E and F. microadenomas growing further inside single villi form folded layers of the adenoma tissue. Note that they still remain inside the single villi, with the villous epithelium remaining intact. G, a double-villous polyp in which the microadenoma tissue moved from the original villus into an adjoining one. H, a multivillous polyp consisting offour original villi. Note that this is a tracing of an actual histological specimen shown in Fig. 1!. and that the normal villous epithelium still remains almost intact. The layers in pink indicate the adenoma tissue, whereas the blue and yellow indicate the differentiated villous and undifferentiated crypt epithelia, respectively. In D and E. both longitudinal (top) and cross (bottom) sections are shown, whereas in others, only longitudinal sections are drawn.

intestine, i.e., the nascent polyps appeared to start as outpocketing pouches from the proliferative zone of the colonic gland or crypt and grew backward. Because there are no villi in the colon, however, colonic microadenomas developed into the mucosal space between crypts. We provisionally call such colonic microadenomas â€œdysplastic crypts.â€•As in the microadenomas of the small intestine, the colonic @i@' tumors did not infiltrate beyond the muscularis mucosae, and its .5@4.*.. .@ @. S basement membrane was well preserved (data not shown). â€˜@L @ As shown above, colonic polyps in the Apc@'716heterozygotes , @ started as â€œdysplasticcrypts.â€•To determine the Apc genotype in ..@ dysplastic crypts, we prepared DNA from the adenoma tissues of the Fig. 3. Histochemical staining of the Apcâ€•716polypswith silver for the basement sectioned specimens and analyzed them by PCR. Of 20 adenomas, all membrane. A and C, H&E staining. B and D, silver staining of the basement membrane showed the loss of the full-length wild-type Apc allele, with the in two sections of the intestinalpolyps (see â€œMaterialsandMethodsâ€•).E,an intestinal polyp in a more advanced stage, in H&E stain. Note the adenoma tissue invading beyond @ allele remaining unaffected (i.e., LOH; Fig. 4D). It has been the muscularis mucosae (arrow). Bars: Aâ€”D,100 jzm; E, 200 jxm. 1646

(â€˜__

@@ @:@: ,. @ ..@ ,@., . Fig. 4. Early colomc adenomas found in Apc@716heterozygous mice and their LOH. A and B, sections of mi-glandular â€œdysplas @ tic cryptsâ€•(arrows). C, a section of more advanced colonic .,%-@. @, adenoma. Note that its uni-glandular origin is still traced easily (arrow). Bars: A and B, 100 ,.un; C, 200 jsm. D, PCR determi nation of the microadenoma genotype to investigate Apc gene LOH.LanesN1â€”N3,normalcolonicepitheliumsurroundingthe p..-,: adenomas. Lanes PIâ€”P2,adenoma tissues from well-developed

polyps. Lanes A1â€”A6.adenomas isolated from dysplastic crypts â€” S (see â€œMaterialsand Methodsâ€•). D N1N2N3 P1P2A1A2A3A4A5A6 @@@ ApctL .â€˜,., @@@@ Apc@716@1 t

tions were reported to be remarkably common in small nondysplastic polyps showed a marked contrast of the stained normal villus epithe ACF (31â€”33).Accordingly, we made a thorough search for ACF in hum covering the microadenoma cells that remained unstained (Fig. the Apc'@'716miceby the methylene blue tattoo method (25). However, 6, 1 and I). Specificity of these antibodies were confirmed by absorp we could not find even a single ACF in any mice tested (n 15; data tion experiments using synthetic peptide antigens (data not shown; see not shown). â€œMaterialsand Methodsâ€•).In conclusion, not only the crypt cells but To investigate the process of tumorigenesis in Apc'@'716knockout also the polyp microadenomas were negative immunohistochemically mice, we determined the labeling indices for the polyp adenoma cells regarding TGF-(3l and TGF-@RII. and compared them with those in the normal small intestinal crypt or The heterozygous Apc@â€•716knockoutmice develop numerous intes colonic gland proliferation zone. As shown in Fig. 5A, the labeling tinal and colonic polyps (19). Their polyp numbers were three to five index of the small intestinal microadenomas was 28.9% Â±4.8% (SD), times higher than those in the Mm mice (ApcM@; Ref. 16), which and essentially the same as that of the normal crypts (i.e., enabled us to analyze polyps at various stages of development in 27.6% Â±3.3%). On the other hand, the labeling index of the colonic detail. The process of polyp development we have described here is adenomas was 20.6% Â±0.05%, and significantly lower than that of totally consistent with a function of the Apc gene product proposed the normal colonic gland proliferation zone (i.e., 27.9% Â±5.8%). recently. Evidence has been presented that APC protein is involved in Typical histological specimens of the BrdUrd labeling and PCNA cell migration (14), whereas forced expression of APC protein in staining are shown in Fig. 5, Câ€”f. transgenic mice induces disordered cell migration in the intestinal Accumulating evidence indicates that TGF-j3 is induced in the epithelium (15). It is likely that APC protein is needed for the normal intestinal epithelial cells in an autoregulated manner, inhibits their migration of the proliferation zone cells along the crypt-villus axis of proliferative activity, and promotes differentiation (Ref. 34; reviewed the small intestine. When the proliferation zone cells lack the full in Ref. 35). Although malignant colonic adenocarcinomas are resist length wild-type APC protein, they are likely to form an outpocketing ant to TGF-j3, nontumorigenic early adenomas are sensitive to the pouch rather than migrating toward the tip of the villus. In this growth-inhibitory effects of TGF-(3(36). The effects of TGF-@on the context, the APC/Apc gene does not appear to be an antioncogene or intestinal and colonic epithelia are mediated through the TGF-@ tumor suppressor gene, such as the RB or p53 gene. In fact, the receptor type I and type II complex (35). To assess the role of TGF-@ labeling indices for the microadenoma cells are not higher than the and TGF-13receptors in Apc'@716intestinalpolyposis, we determined crypt proliferation zone cells (Fig. 5, A and B). In a thorough study of the expression of TGF-f3l and TGF-f3R11inthe polyp microadenomas rectal biopsies from 400 patients, Risio et a!. (37) presented compel as well as in the normal intestinal epithelium (Fig. 6). In the small ling evidence that proliferation of the epithelial cells is related to the intestine, TGF-@l was expressed only in the villus epithelium but not size and chronology of preneoplastic lesions, and that labeling index in the crypt cells (Fig. 6A), whereas in the colon, TGF-j31 signals were values rose progressively from adenoma to adenocarcinoma. Adeno detected abundantly in the differentiated epithelium on the luminal mas with a diameter of < 1 cm were not accompanied by changes in one-third to one-half of the crypt (Fig. 6C). In the Apc@716polyps,the the mucosal labeling index. Our data are consistent with their report. adenomas remained unstained both in the small intestine and colon Another interesting phenomenon we have found is that the expanding (Fig. 6, E and G, respectively). When specimens were stained for adenoma tissue does not rupture through the covering normal villous TGF-j3RH, essentially the same results were obtained as for TGF-(3l, epithelium into the intestinal lumen, but rather extends into adjoining i.e., only the villus epithelium of the small intestine and luminal villi from the mucosal side. Even in relatively advanced polyps that one-third to one-half of the colonic crypt epithelium were stained in consist of multiple villi, the normal villous epithelium was still con the normal tissues (Fig. 6, B and D, respectively), whereas the polyp served (Figs. 1! and 2H). The molecular mechanism that controls such adenomas of the small intestine and colon remained unstained (Fig. 6, a growth pattern of the adenoma tissue remains to be investigated. F and H, respectively). Immunohistochemical staining of early stage Because the colon lacks villi, it is not easy to locate early colonic 1647

POLYP FORMATION IN Apc@716 KNOCKOUT MICE

A. Small Intestine B Colon sected from sections also showed Apc gene LOH (Fig. 4D), suggest (%) ing that the LOH is important in triggering polyp formation in the colon as in the small intestine (19). Although â€œACFâ€•havebeen reported as preneoplastic lesions, we did not find any ACF in the @ r colon. Accordingly, ACF are not the direct precursors of the @@2C colonic polyps in the Apc@716heterozygous mice. It has been demonstrated that expressions of TGF-(3 and its type II 110 receptor are regulated in a concerted manner, showing the same spatio temporal expression pattern, e.g., in the embryo (40) and skin (41). Here 0 -LI:, Polyp Proll.Z. we have shown their concerted expression in the small and large intestinal mucosa, i.e., the expression of both TGF-@l and TGF-@3Rll in the c;@@ BrdUO@ differentiated epithelium but not in the undifferentiated proliferation zone @ :@@â€˜ . ..,, cells. Moreover, the polyp adenomas do not express either molecules at @ I @ ,. I 4 levels detectable by immunohistochemistry. These results, together with @ @â€˜Â°,c!\jt @â€˜ the above data of labeling indices and lack of K-ras hot spot mutations, strongly suggest that the early adenoma cells have very similar charac

.4@, . TGF II @@@@ @- . \BrdU .@j

.@)- @ @- â€˜ ._â€˜I 4@' â€˜@ ,a.;r@. [email protected]&@/@ @ \-& -. â€˜..@ .4 . . . .,j @ â€˜,@ . @ .@t

..: T@$j D TGF@RII @ G,.,@.. .

@@ ),s.

@ .@â€˜ @:., @:_._@:â€˜.

â€¢1

,. @. , @.:@:;.â€˜â€˜@: @@@ ..@iI @â€˜@1;(f.@I

Fig. 5. Labeling indices of the polyp adenoma cells compared with those of the normal mucosal epithelia of the small intestine and colon in Apc@716knockout mice. A and B, labeling indices for the small intestine and colon, respectively. A, Crypt, normal epithe @. hum of the small intestinal crypt. B, Prolif Z. proliferation zone of the colonic gland. @ Polyp, polyp adenoma epithelium, excluding the interstitial cells. C and E, BrdUrd (BrdU) 0 5 , :@. @â€˜-â€œ@ . labeling of proliferating cells in a small intestinal section containing polyps. D and F, H&E(HE)-stainedserialsectionsadjoiningthosein C and E, respectively.G,BrdUrd (BrdU) labeling of a colonic mucosal section containing an early adenoma. *, an early adenoma. H. an H&E (HE)-stained serial section adjoining that in G. I and J. immuno @:@:@v .@ @ histochemical staining for proliferating cell nuclear antigen (PCNA) in small intestinal .-.@.. @, _____ mucosal sections that contain early polyps. Arrows, PCNA-labeled cells. Bars: Câ€”Fand I,200 j@m;G, H, and J,100 jim.

polyps under a dissection microscope. However, serial sectioning @ analysis enabled us to detect colonic polyps at relatively early stages @&@â€˜.@ ., @; . . @@@@@@@ (Fig. 4, A and B). These polyps showed a morphology that suggests a ; \Â°@â€˜I@,, /@ â€˜A@.,, similar initial mechanism to that in the small intestine: formation of outpocketing pouch or buds. A similar outpocketing pouch has been reported as one of the two initial mechanisms of colon cancer devel Fig. 6. Immunohistochemical staining for TGF-@l and TGF-J3R!I in normal small opment in chemical carcinogen-treated mice (38). Development of an intestinal and colonic epithelia, compared with those in sections containing small mtes tinal polyps and colonic tumors in ApcA7tt heterozygotes. A and B, normal small intestinal outpocketing pouch or a bud into a single-gland adenoma was re epithelium. C and D, normal colonic epithelium. E and F, sections of the small intestine ported in human FAP as well (39), and our observation of colonic containing polyps. G and H. sections of the colon containing adenomas. Arrows, adenoma @ polyp development in the mice is consistent with these tissues negative for TGF-@3l(G)and TGF-@R!I(51).1and J. sections of the small intestine containing a nascent (1) and univillous polyps (I). A, C, E, and G, staining for TGF-@3l. reports. Moreover, DNA extracted from these microadenomas dis B, D, F, H. 1. and J, staining for TGF-(3RH. Bars: 100 jun for all frames. 1648

Downloaded from cancerres.aacrjournals.org on September 28, 2021. © 1997 American Association for Cancer Research. POLYP FORMATION IN Apc@71Â°KNOCKOUTMICE teristics with those of the proliferation zone of the normal mucosa. To adenomatous polyposis coli tumor suppressor protein localizes to plasma membrane investigate the role of TGF-@3RIIin development, we recently knocked sites involved in active cell migration. J. Cell Biol., 134: 165â€”179,1996. 15. Wong, M. H., Hermiston, M. L, Syder, A. J., and Gordon, J. I. Forced expression of the out its gene in the mouse (42). Although the heterozygotes were devel tumor suppressor ndenomatosis polyposis coli protein induces disOrdered cell migration in opmentally normal, all homozygous mutants died in utero around 10.5 the intestinal epitheium. Proc. Nail. Acad. Sci. USA, 93: 9588-9593. 1996. 16. Moser, A. P, Pilot, H. C., and Dove, W. F. A dominant mutation that predisposes to days of gestation because of defects in yolk sac hematopoiesis. To study multiple intestinal neoplasia in the mouse. Science (Washington DC), 247: 322â€”324. the role of TGF-@R1I in the intestinal mucosa, hetemzygous mutation 1990. 17. Su, L-K., Kinzler. K. W., Vogelstein, B., Preisinger, A. C., Moser, A. R., Luongo. C., was introduced into the ApC@716knockout mice, and double heterozy Gould,K.A.,andDove,W.F.Multipleintestinalneoplasiacausedbya mutationinthe gotes were constructed.However,there was no change in the number and murine homolog of the APC gene. Science (WashingtonDC), 256: 668â€”671,1992. the size of the intestinal polyps (data not shown). These data suggest that 18. Fodde, R., Edelmann, W., Yang, K., van Leeuwen. C., Carlson, C., Renault, B.. Breukel,C., Alt, E., Lipkin,M., Khan, P. M., and Kucherlapati,R. Targeted either the haploid amount of TGF-(3R11 protein is sufficient for the chain-termination mutation in the mouse Apc gene results in multiple intestinal normal function ofthe intestinal mucosa, or TGF-@Rll is not playing any tumors. Proc. Nail. Acad. Sci. USA, 91: 8969â€”8973, 1994. 19. Oshima, M., Oshima, H., Kitagawa, K., Kobayashi, M., Itakura, C., and Taketo, M. significant role in polyp formation in Apc'@716 knockout mice. Apc gene lots of heterozygosity and abnormal tissue building found in nascent Recently, overexpression of cyclin Dl and cyclin-dependent kinase intestinal polyps in truncation mutant mice. Proc. NatI. Acad. Sci. USA, 92: 4482â€” 4 has been demonstrated in the intestinal adenomas from the Mm mice 4486, 1995. 20. Laird, P. W., Jackson-Grusby, L., Faseli, A., Dickinson, S. L., Jung, W. E., Li, E., and human FAP (43). Cyclin Dl expression was restricted to the Weinberg, R. A., and Jaenisch, R. Suppression of intestinal neoplasia by DNA adenoma cells and detected even in low-dysplasia adenomas. It is hypomethylation. Cell, 8/: 197â€”205,1995. 21. MacPhee, M., Chepenik, K. P.. Liddell, R. A., Nelson, K. K., Siracusa, L. D., and possible that these may be early intracellular events following Apc Buchberg,A. M. The secretoryphospholipaseA2 is a candidateforthe Mom-I locus, gene LOH. It would be interesting to investigate its relationship to a major modifier of ApcM1@@inducedintestinalneoplasia. Cell, 81: 957â€”966,1995. cyclooxygenase-2 induction (22). 22. Oshima, M., Dinchuk, J. E., Kargman, S. L., Oshima. H., Hancock, B., Kwong, E., Trzaskos, J. M., Evans, J. F., and Taketo, M. M. Suppression of intestinal polyposis in Apc'716 knockout mice by inhibition of cyclooxygenase-2 (COX-2). Cell. 87: Acknowledgments 803â€”809,1996. 23. Oshima, M., Takahashi, M., Oshima, H., Tsutsumi. M., Yazawa, K., Sugimura, 1., We thank Drs. K. Wakabayashi and M. Takahashi for advice on ACF Nishimura. S., Wakabayashi, M., and Taketo, M. M. Effects of docosahexaenoic acid (DHA) on intestinalpolyp developmentin pc@'716knockoutmice. Carcinogenesis detection and Drs. R. D. Beauchamp and R. N. DuBois for providing infor (Lond.), 16: 2605â€”2607,1995. marion before publication and for fruitful discussions. 24. Oshima, M., Oshima, H., Tsutsumi, M., Nishimura, S., Sugimura, T., Nagao, M., and Taketo,M. M. Effectsof 2-amino-I-methyl-6-phenylimidazo[4,5-bjpyiidineonintestinal References polyp development in ApCâ€•716knockoutmice. Mol. Carcinog., 15. 11â€”17,1996. 25. Bird, R. P. Observationand quantificationof aberrantcrypts in the murine colon treated 1. Kinzler, K. W., Nilbert, M. C., Su, L-K., Vogelstein, B., Bryan, 1. M., Levy, D. B., with a colon carcinogen:preliminaryfindings.Cancer 1_ett.,37: 147â€”151,1987. Smith, K. J., Preisinger, A. C., Hedge, P., McKechnie, D., Finniear, R., Markham, A., 26. Sugimon, H., Matsuyama. T.. Kashmura, M.. Kashimura, 1., Nishimura, A.. Groffen, J., Boguski, M. S., Altschul, S. F., Horii, A., Ando, H., Moshi, Y., Miki, Y., Tsukamoto, N., and Taki, I. Histological study of microinvasive carcinoma of the Nishisho, I., and Nakamura, Y. Identification of FAP locus genes from chromosome uterine cervix. Gynecol. Oncol., 7: 153â€”165,1979. 5q21. Science (Washington DC), 253: 661â€”665,1991. 27. George, D. G., Scott, A. F., Trusko, S., Glick, B., Ford, E.. and Gorney, D. J. Structure 2. Nishisho, 1., Nakamura, Y., Miyoshi, Y., Mild, Y., Ando, H., Horii, A., Koyama, K., and expression of amplified cKi-ras gene sequence in Y I mouse adrenal tumor cells. Utsunomiya, J., Baba, S., Hedge, P., Markham, A., Krush, A. J., Petersen, G., Hamilton, EMBOJ., 4: 1199â€”1203,1985. S. R.. Nilbert,M.C., Levy,D. B., Bryan,T.M., Preisinger,A.C., Smith,K.J.,Su,L-K.. 28. Fearon, E. R., and Vogelstein, B. A genetic model for colorectal tumorigenesis. Cell, Kinzler, K. W., and Vogelstein, B. Mutations of chromosome 5q21 genes in FAP and 61:759â€”767,1990. colorectal cancer patients. Science (Washington DC), 253: 665-669, 1991. 29. Kinzler, K. W., and Vogelstein. B. Lessons from hereditary colorectal cancer. Cell, 3. Groden, J., Thliveris, A., Samowitz, W., Carlson, M., Gelbert, L., Albertsen, H., 87: 159â€”170,1996. Joslyn, G., Stevens, J., Spirio, L., Robertson, M., Sargeant, L., Krapcho, K., Wolff, E., 30. McLellan, E. A., and Bird, R. P. Aberrant crypts: potential preneoplastic lesions in the Burt, R., Hughes, J. P., Warrington, J., McPherson, J., Wasmuth, J., Le Paslier, D., murine colon. Cancer Ret., 48: 6184â€”6192, 1988. Abderrahim, H., Cohen, D., Leppert, M., and White, R. Identification and character 31. Smith, A. J., Stern, H. S., Penner, M., Hay, K., Mini. A., Bapat, B. V., and Gallinger. ization of the familial adenomatous polyposis coli gene. Cell, 66: 589â€”600, 1991. S. SomaticAPCand K-ratcodon12mutationsinaberrantcryptfoci formhuman 4. Joslyn. G., Carlson, M., Thliveiis, A., Albertsen, H., Gelbeii, L, Samowitz, W., Groden, colons. Cancer Ret., 54: 5527â€”5530,1994. J., Stevens,J., Spiiio, L, Robertson,M.,Sargeant,L, Krapcho,K.,Wolff,E., Burt,R., 32. Jen, J., Powell, S. M., Papdopoulos, N., Smith, K. J.. Hamilton, S. R., Vogelstein, B., Hughes, J. P., Wanington, J., McPherson, J., Wasmuth, J., Le Paslier, D., Abderrahim, H., and Kinzler, K. W. Molecular determinants of dysplasia in colorectal lesions. Cancer Cohen, D., Leppert,M., and White, R. Identificationofdeletion mutationsand three new Ret.,54:5523â€”5526,1994. genes at the familial polyposis locus. Cell, 66: 601-613, 1991. 33. Yamashita, N., Minamoto, T.. Ochiai, A., Onda, M., and Esumi, H. Frequent and 5. Boynton, R. F., Blout, P. L., Yin, J., Brown, V. L., Huang, Y., Tong, Y., McDaniel, characteristic K-ras activation and absence of p53 protein accumulation in aberrant T., Newkirk, C., Reseau, J. H., Raskind, W. H., Haggitt, R. C., Reid, B. J., and crypt foci of the colon. Gastroenterology. 108: 434â€”440,1995. Meltzer,S. J. Loss of heterozygosityinvolvingtheAPC andMCCgenetic loci occurs 34. Barnard, J. A., Beauchamp. R. D., Coffey. R. J.. and Moses, H. L. Regulation of in the majority of human esophageal cancers. Proc. Natl. Acad. Sci. USA, 89: intestinal epithelial cell growth by transforming growth factor type /3. Proc. NatI. 3385â€”3388, 1992. Acad. Sci. USA, 86: 1578â€”1582,1989. 6. Powell, S. M., Zilz, N., Brazer-Barclay, Y., Bryan, 1. M., Hamilton, S. R., 35. Derynck, R. TGF-f3-receptor-mediated signaling. Trends Biochem. Sci., 19: 548â€” Thibodeau, S. N., Vogelstein, B., and Kinzler, K. W. APC mutations occur early 553, 1994. during colorectal tumorigenesis. Nature (Lund.), 359: 235â€”237,1992. 36. Filmut, J.. and Kerbel, R. S. Development of resistance mechanism to the growth 7. Horii, A., Nakatsuru, S., Miyoshi, Y., Ichii, S., Nagase, H., Kato, K., Yanagisawa, A., inhibitory effects of transforming growth factor-(3 during tumor progression. Curr. and Nakamura, Y. The APC gene, responsible for familial adenomatous polyposis. is Opin. Oncol., 5: 123â€”129,1993. mutated in human gastric cancer. Cancer Res.. 52: 3231â€”3233, 1992. 37. Risio, M., Lipkin, M., Candelaresi, G. L., Bernone. A., Coverlizza, S., and Rossini. 8. Miyoshi, Y., Ando, H., Nagase, H., Hishino, I., Horii, A., Miki, Y., Mon. T., F. P. Correlations between rectal mucosa cell proliferation and the clinical and Utsunomiya, J., Baba, S., Persen, G., Hamilton, S. R., Kinzler, K. W., Vogelstein, B., pathological features of nonfamilial neoplasia of the large intestine. Cancer Ret., 51: and Nakamura, Y. Germ-line mutations of the APC gene in 53 familial adenomatous 1917â€”1921,1991. polyposis patients. Proc. Natl. Acad. Sci. USA, 89: 4452â€”4456, 1992. 38. Chang, W. W. L. Morphological basis of multistep process in experimental colonic 9. Joslyn, G., Richardson,D. S., White, R., and Alter, T. Dimer formationby and carcinogenesis. Virchows Arch. B Cell Pathol., 41: 17â€”37.1982. N-terminal coiled coil in the APC protein. Proc. NatI. Acad. Sci. USA, 90: 11109â€” 39. Nakamura, S., and Kino, I. Morphogenesis of minute adenomas in familial polyposis 11113,1993. coli. J. Natl. Cancer Inst., 73: 41â€”49,1984. 10. Su, L-K.,Johnson,K. A., Smith,K.J., Hill, D. E., Vogelstein,B., andKinzler,K. W. 40. Lawler, S., Candia, A. F., Ebner, R., Shum, L., Lopez, A. R., Moses, H. L.. Wright. Association between wild type and mutant APC gene products. Cancer Ret., 53: C. V. E., and Derynck, R. The murine type II TGF-j3receptorhas a coincident 2778â€”2731, 1993. embryonic expression and binding preference for TGF-f3l . Development (Camb.), 11. Oshima. M., Oshima, H., Kobayashi, M., Tsutsumi, M., and Taketo, M. M. Evidence 120:165â€”175,1994. against dominant negative mechanisms of intestinal polyp formation by Apc gene 41. Cui, W., Fowlis, D. J., Cousins, F. M.. Duffie. E., Bryson, S., Balmain. A., and mutations. Cancer Res., 55: 2719â€”2722, 1995. Akhurst, R. J. Concerted action of TGF-@3l and its type II receptor in control of 12. Munemitsu, S., Souza, B., Muller, 0., Albert, I., Rubinfeld, B., and Polakis, P. The epidermal homeostasis in transgenic mice. Genes Dcv., 9: 945â€”955,1995. APC gene product associates with microtubules in vivo and promotes their assembly 42. Oshima, M., Oshima, H., and Taketo, M. M. TGF43 receptor type II deficiency results in in vitro. Cancer Res., 54: 676â€”681, 1994. defects of yolk sac hematopoiesis and vasculogenesis. Dcv. Biol., 179: 297â€”302,1996. 13. Smith, K. J., Levy, D. B., Maupin, P., Pollard, 1. D., Vogelstein, B., and Kinzler, K. W. 43. Zhang. T., Nanny, L. B., Luongo, C., Lamps, L.. Heppner, K. J., DuBois, R. N., and Wild-typebut not mutantAPC associateswiththe microtubulecytoskeleton.CancerRet., Beauchamp, R. D. Concurrent overexpression of cyclin Dl and Cdk4 in intestinal 54: 3672â€”3675,1994. adenomas from Mm mice and human adenomatous polyposis patients. Cancer Res., 14. Nahthke, I. S., Adams, C. L., Polakis, P., Sellin, J. H., and Nelson, W. J. The 57: 1638â€”1643,1997.

1649

Hiroko Oshima, Masanobu Oshima, Masahiko Kobayashi, et al.

Cancer Res 1997;57:1644-1649.

Updated version Access the most recent version of this article at: http://cancerres.aacrjournals.org/content/57/9/1644

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Subscriptions Department at [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://cancerres.aacrjournals.org/content/57/9/1644. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.