ASSOCIATION ANALYSIS OF SINGLE NUCLEOTIDE POLYMORPHISM OF OPIOID DEPENDENCE GENES AMONG MALAY MALES IN MALAYSIA
by
DEVAKI NAGAYA
Thesis submitted in fulfilment of the requirements for the degree of Doctor of Philosophy
September 2018 ACKNOWLEDGEMENT
I would like to express my utmost gratitude and sincere appreciation to my thesis supervisor, Associate Prof. Dr. Badrul Hisham Yahaya for his advice and encouragement throughout the entire thesis.
I would like to acknowledge Prof Dr Narazah Mohd Yusoff my co-supervisor, for constant support and encouragement. I am also extremely grateful to Dr Saleem, The
General Manager of Genomix Lab Sdn Bhd and Prof. Tan Soo Choon from Institute for
Research in Molecular Medicine, USM for their constructive suggestions and for all their helps.
I would like to take this opportunity to thank all the staffs from Regenerative Medicine
Laboratory, Advanced Medical and Dental Institute (AMDI) and INFORMM, Kubang
Kerian, Kelantan for their invaluable technical contribution.
Finally, my deepest gratitude to my parents and my dearest husband Sandrasekaran
Murugaiah and my son Deveshwar Shekar for their love, concern and never- ending support. A special thanks to senior management team and my colleagues of Penang
Medical College for their encouragement. I would say this splendid course of research would not be completed without all these people.
This study was also supported by a grant from the Universiti Sains Malaysia (USM)
Research University (Cluster) grant 1001/PSK/8620013. Thank you.
ii TABLE OF CONTENTS
ACKNOWLEDGEMENT ...... ii
TABLE OF CONTENTS ...... iii
LIST OF TABLES ...... viii
LIST OF FIGURES ...... x
LIST OF ABBREVIATIONS ...... xi
LIST OF SYMBOLS ...... xv
ABSTRAK...... xvii
ABSTRACT ...... xix
CHAPTER 1:INTRODUCTION ...... 21
1.1 Drug Addiction ...... 21
1.2 Global Epidemiological Data of Drug Addiction ...... 23
1.2.1 America ...... 23
1.2.2 Europe ...... 23
1.2.3 Africa ...... 24
1.2.4 Asia...... 25
1.2.5 Drug addiction in Malaysia ...... 29
1.3 Molecular Basis of Addiction ...... 31
1.3.1 Molecular basis of alcoholism...... 33
1.3.2 Molecular basis of smoking ...... 36
1.3.3 Molecular basis and drug addiction ...... 38
1.4 Drug Addiction Genes ...... 40
iii 1.4.1 OPRK1 ...... 40
1.4.2 OPRD1 ...... 41
1.4.3 PDYN ...... 43
1.4.4 COMT ...... 44
1.4.5 DRD4 ...... 46
1.4.7 ABCB1 ...... 47
1.4.8 DUSP ...... 50
1.4.9 rs10494334 ...... 50
1.5 Rationale of the study ...... 51
1.6 General objective...... 52
1.7 Objectives ...... 52
CHAPTER 2:METHODOLOGY ...... 53
2.1 Experimental Design ...... 53
2.2 Demographic Studies ...... 54
2.2.1 Location of study ...... 54
2.2.2 Subject recruitments ...... 54
2.2.3 Inclusion Criteria ...... 55
2.2.4 Exclusion Criteria ...... 55
2.3 Registration ...... 56
2.3.1 Registration procedures ...... 56
2.4 Study Schedules ...... 57
2.4.1 Collection of whole blood for genetic studies ...... 57
iv
2.4.2 Monitoring of studies ...... 57
2.5 Ethical and legal consideration ...... 57
2.6 PCR Genotyping (DNA Extraction) ...... 58
2.6.1 Equipment & Materials ...... 58
2.6.2 DNA purification procedure...... 58
2.7 Estimation of DNA quantity and purity (NANODROP) ...... 59
2.8 TaqMan SNP Genotyping Assay ...... 59
2.8.1 STEP ONE PLUS ...... 62
2.8.2 SNP Genotyping Assay ...... 62
2.8.3 DNA preparation ...... 62
2.8.4 Preparation of reaction mix ...... 62
2.8.5 Procedure for PCR reaction...... 65
2.8.6 Allelic discrimination TaqMan assay ...... 65
2.9 Statistical Analysis ...... 67
2.9.1 General ...... 67
2.9.2 Hardy Weinberg ...... 67
2.9.3 Linkage Disequilibrium (LD ...... 68
2.9.4 SNP – SNP interaction ...... 68
2.10 Database development...... 68
CHAPTER 3:RESULTS ...... 71
3.1 Demographic Background...... 71
3.2 PCR Results ...... 75
v 3.2.1 Real Time PCR amplification ...... 75
3.2.2 Quality control...... 77
3.2.3 Genotype Frequency ...... 80
3.2.4 Allele frequency ...... 83
3.2.5 Allele and Genotype Association Stud...... 87
3.2.6 SNP – SNP Interaction ...... 91
3.3 Database ...... 96
CHAPTER 4:DISCUSSION ...... 100
4.1 Demographic Factors ...... 100
4.2 Association study of SNPs and opiate addiction in Malay population ...... 103
4.2.1 OPRD1 variant and opioid addiction ...... 104
4.2.2 OPRK1 variant and opioid addiction ...... 106
4.2.3 PDYN variant and opioid addiction ...... 106
4.2.4 rs10494334 variant and opioid addiction ...... 108
4.2.5 COMT variant and opioid addiction ...... 109
4.2.6 DRD4 variant and opioid addiction ...... 110
4.2.7 ABCB1 variant and opioid addiction ...... 111
4.2.8 DUSP variant and opioid addiction ...... 116
4.3 SNP-SNP interaction ...... 116
4.4 Database Development ...... 122
4.5 Limitation ...... 124
CONCLUSION AND FUTURE STUDIES ...... 125
REFERENCES ...... 128
vi APPENDICES
LIST OF PUBLICATIONS
vii LIST OF TABLES Page
Table 1.1 Number of drug addicts reported i 2015 and 2016 31
Table 2.1 Material and equipment of DNA extraction 58
Table 2.2 Summary table of SNP TaqMan 60
Table 2.3 Preparation of reaction mix 63
Table 2.4 List of genotyping assay sequence 64
Table 2.5 Thermal Cycling Conditions 65
Table 3.1 Age group of addicts and controls 71
Table 3.2 Educational background of addicts and controls 72
Table 3.3 Occupation status of addicts and controls 72
Table 3.4 Cross tabulation between occupation status and education 72
Table 3.5 Smoking habits of addicts and control 73
Table 3.6 Smoking duration of addict and control group 73
Table 3.7 Smoking and age cross tabulation 74
Table 3.8 Drinking habit among drug addicts 74
Table 3.9 Family members who smoke 74
viii Table 3.10 Cross tabulation of smoking habit and family member 75
Table 3.11 Hardy Weinberg Equilibrium Case study 78
Table 3.12 Hardy Weinberg Equilibrium Control study 79
Table 3.13 Genotype frequency between drug addicts and control 80
Table 3.14 Allele frequency between drug addict and control group 83
Table 3.15 Hapmap project allele frequency 86
Table 3.16 Genotype and association 89
Table 3.17 Allele and association 91
ix LIST OF FIGURES
Page
Figure 2.1 Variation in clustering graph 67
Figure 2.2 Structure of database 70
Figure 3.1 Allelic discrimination plot 76
Figure 3.2 Amplification graph for homozygous CC 77
Figure 3.3 Amplification graph for homozygous TT 77
Figure 3.4 Display of genes in the database 97
Figure 3.5 List of mutations 98
Figure 3.6 Detail of mutation 99
Figure 3.7 Haplotype structure presented for each populations 100
LIST OF ABBREVIATIONS
5-HTT The Serotonin Transporter
A Adenine
AADK Agensi Anti Dadah Kebangsaan
ABCB1 P glycoprotein Gene
ADH Anti-Diuretic Hormone
Ala Alanine
AD Allelic Discrimination
AIDS Acquired Immune Deficiency Syndrome
ALDH Aldehyde dehydrogenase
ANKK1 Ankyrin repeat and kinase domain
Arg Arginine
ASW African ancestry in South West USA
Asn Asparagine
Asp Aspartic acid
ATS Amphetamine type stimulant
Bp Base pair
C Cytosine
CEU European
CHB Han Chinese Beijing
CHD Chinese in Metropoliton Denver
CHRNA Neuronal Acetycholine receptor subunit Cm Centimeter
COMT Catechol O Methyltranferase
CYP Cytochromes P450 dH2O Distilled water
DNA Deoxyribonucleic acid dNTPs Deoxynucleotide triphosphate
DOR Delta Opioid Recptor
DRD2 D2 subtype dopamine receptor
DRD4 D2 subtype dopamine receptor
DSP Dual Specific Phosphates
EDTA Ethylenediamine tetraacetic acid
EU European Unions
F Forward
G Guanine
GABRA Gamma aminobutyric acid receptor subunit
GCP Good Clinical Practice
GIH Gujarati in Houston
GWAS Genome Wide Association Study
HCB Han Chinese Beijing
HCl Hydrochloric Acid
HIV Human Immunodeficiency Virus
HTR3A 5 Hydroxytryptamine Receptor 3A
HTR3B 5 Hydroxytryptamine Receptor 3B
xii HW Hardy Weinberg
IDU Injection Drug Users
JPT Japanese in Tokyo
KOR Kappa Opioid Receptor
LD Linkage Disequilibrium
LWK Luhya in Webuye, Kenya
MAOA Monoamine Oxidase A Gene
Mex Mexican in Los Angeles
MOR Mu Opioid Receptor
NA Not applicable
NCBI National Centre of Biotechnology
NCAM1 Neural Cell Adhesion Molecule 1
MDMA 3,4-Methylenedioxymethamphetamine
OD Optical density
PCR Polymerase chain reaction
OPRM1 Opioid Receptor Mu Gene
OPRD1 Opioid Receptor Delta Gene
OPRK1 Opioid Receptor Kappa Gene
RNA Ribonucleic Acid
SNP Single Nucleotide Polymorphism
SPM Sijil Pelajaran Malaysia
SRP Sijil Rendah Pelajaran Malaysia
STPM Sijil Tinggi Pelajaran Malaysia
xiii SUD Substance Use Disorder
T Thymine
Taq Thermus aquaticus
TBE Tris Borate - EDTA Buffer
Tet Tetracycline
U Unit
UPSR Ujian Pencapaian Sekolah Rendah
UNODC United Office on Drug & Crime
U.S.A United States of America
Val Valine
xiv LIST OF SYMBOLS
µ Mu
β Beta
α Alpha
~ Approximately
Micro gram
Micro liter
Micro Molar e.g. for example
Hr Hour
Kb Kilobase
Kg Kilogram
L Liter
Mg Milligram
Min Minute
Ml Milliliter
Mm Millimeter mM Millimolar
Nm Nanometer
MT Metric Tonne
oC Degree Celsius
Pg Pico gram Pmole Pico mole
R Reverse
Sec Seconds
Ta Annealing temperature
U Unit
V Volt
Vol Volume
xvi ANALISIS HUBUNG KAIT POLIMORFISME NUKLEOTIDA TUNGGAL
PADA GEN-GEN KEBERGANTUNGAN OPIOID DALAM KALANGAN
LELAKI MELAYU DI MALAYSIA
ABSTRAK
Ketagihan dadah ialah gangguan kronik dan berulang yang dikaitkan dengan genetik.
Banyak kajian telah melaporkan peranan polimorfisme nukleotida tunggal (SNP) terhadap pergantungan pada dadah. Antara kesemua gen tersebut, sejumlah dua belas
(12) gen kandidat yang mempunyai kaitan dengan pergantungan pada dadah akan diselidiki dalam kajian ini. Gen kandidat ini ialah OPRD1 (Delta Opioid Receptor),
OPRK1 (Kappa Opioid Receptor), COMT (Catechol – O-Methyltransferase gene),
PDYN (Prodynorphin), DRD4 (Dopamine receptor D4), ABCB1(P glycoprotein), DUSP
(Dual Specificity Phosphatase 27) dan rs10494334.Matlamat kajian ini adalah untuk menentukan kekerapan SNP rs1042114, rs702764, rs199774, rs1022563, rs910080, rs737866, rs10494334, rs1800955, rs1128503, rs1045642 dan rs2032582, selain mengkaji hubungannya dengan pergantungan pada opioid dalam kalangan lelaki Melayu di Malaysia. Pangkalan data genetik ini akan dibangunkan untuk rawatan berasaskan farmakogenetik. Peserta kajian terdiri daripada 459 orang lelaki Melayu dengan pergantungan pada opioid dan 543 orang lelaki Melayu yang sihat sebagai kumpulan kawalan. SNP digenotipkan dengan menggunakan cerakin penjenisan gen SNPTaqMan.
Analisis statistik dilakukan dengan menggunakan perisian Golden Helix SVS untuk mengenal pasti pengagihan frekuensi alel dan genotip serta interaksi SNP-SNP.
Pangkalan data dibangunkan menggunakan MySQL - iaitu pangkalan data piawai de- facto yang dijalankan pada pelayan yang dilindungi. SNP rs1042114 OPRD1, rs910080
PDYN, r1800955 DRD4, rs1128503, rs1045642, dan rs2032582 ABCB1 didapati mempunyai perkaitan kuat dengan ketagihan opioid pada tahap alel dengan p <0.05.
Interaksi signifikan secara statistik juga dikenal pasti antara kebanyakan alel risiko bagi kesemua SNP yang dikaitkan dengan ketagihan dadah dengan polimorfisme lain yang diselidiki dalam kajian ini. Pangkalan data yang dihasilkan daripada penyelidikan ini mengenai SNP ketagihan dadah boleh digunakan oleh pegawai perubatan bagi memahami kesan SNP dan interaksi SNP-SNP terhadap pergantungan pada opioid untuk merawat pesakit ketagihan dadah dengan berkesan tanpa tindak balas ubat-ubatan yang buruk.
xviii
ASSOCIATION ANALYSIS OF SINGLE NUCLEOTIDE POLYMORPHISMS
OF OPIOID DEPENDENCE GENES AMONG MALAY MALES IN MALAYSIA
ABSTRACT
Drug addiction is a chronic and relapsing disorder is associated with genetics.
There are many studies have been reported the roles of single nucleotide polymorphisms
(SNPs) with drug dependence and among those, twelve (12) candidate genes that were associated with drug dependence will be investigated in this study. The candidate genes are OPRD1 (Delta Opioid Receptor), OPRK1 (Kappa Opioid Receptor), COMT
(Catechol – O-Methyltransferase gene), PDYN (Prodynorphin), DRD4 (Dopamine receptor D4), ABCB1(P glycoprotein), DUSP (Dual Specificity Phosphatase 27) and rs10494334. The goal of this study was to determine the frequencies of these SNPs rs1042114, rs702764, rs199774, rs1022563, rs910080, rs737866, rs10494334, rs1800955, rs1128503, rs1045642, and rs2032582 and to study their association with opioid dependence in Malay males in Malaysian population. This genetic database will be established for pharmacogenetics-based treatment. Research participants were 459
Malay males with opioid dependence and 543 healthy Malay males as controls. SNPs were genotyped using TaqMan SNP genotyping assay. Statistical analysis was performed using Golden Helix SVS software suite to identify the distribution of allele and genotype frequencies and SNP–SNP interactions. Database was developed using
MySQL - the de-facto standard database that runs on a protected server. SNPs rs1042114 of OPRD1, rs910080 of PDYN, r1800955 of DRD4, rs1128503, rs1045642,
xix and rs2032582 of ABCB1 were strongly associated with opioid addiction at allelic level with p<0.05. A statistically significant interaction was also identified between most of the risk alleles of all the SNPs associated with drug addictions with other polymorphism studied in this research. The database established on drug addiction SNPs from this research will be useful for clinicians in the understanding of the effects of SNPs and the
SNP–SNP interaction on opioid dependence to treat the drug dependence patients effectively without adverse drug responses.
xx CHAPTER 1: INTRODUCTION
1.1 Drug Addiction
Drug addiction is a chronic, relapsing brain disease, characterized by compulsive drug seeking behavior with strong genetic, sociocultural and neurodevelopment component. Despite the harmful consequences (Kreek et al., 2005b) and a major contributor to the global burden of disease worldwide (Degenhardt et al., 2013) an estimated 17 million people are afflicted with drug use disorder. Brain images from drug addicts have shown physical changes especially in the areas of decision making, judgment, learning, memory and behavioral control, which explains the compulsive drug seeking behavior among addicts (Fowler et al., 2007). Each drug binds to its protein target in the brain and elicits a combination of behavioral and physiological effects once it is administrated. Current evidence shows drug abuse exerts their reinforcing effects by activating, reward circuits that promote repeated drug use which eventually leads to addiction (Nestler, 2005). Drug addiction affects all segments of society in many countries, most importantly it destroys the world‘s most valuable asset, the youth. It destroys lives, communities, stability of nations and finally the dignity and hope of millions of people around the globe.
According to The World Drug Report (2017), published by United Nations
Office on Drug and Crime (UNODC), in 2015 the global estimate of annual illicit drug use prevalence was at 5% of the global adult population. Amongst them, almost 12 million people inject drugs and out of this number, over 13% of people (or 1.6 million) who inject drugs are living with AIDS and 50% (6.1 million) are with hepatitis C.
21 Higher percentage of death were reported from Hepatitis C than HIV. According to the report, opioid was the top most common drug associated with fatal and non-fatal over dose (World Drug Report., 2017).
Many individuals are self-exposed to drug and many continue to use them on an occasional or even on regular basis. However, only some individuals develop specific addictions and vulnerability to addiction differs from person to person (Gerrits et al.,
2003). Even after a prolonged period of abstinence, an individual can return to use drugs due to cravings and a desire to experience the enhancing effects of substance abuse
(Markou et al., 1993, McLellan et al., 2000).
No single factor determines an individual tendency to be addicted to drugs, however, it is postulated that at least three different categories of factors may contribute to the vulnerability of developing a specific addiction. The first category is the environmental factors which include events during childhood and adolescence, peer pressure and self-exposure to the drug. The second category is drug induced factors, leading to a variety of molecular neurobiological changes, which cause altered behaviour
(Kreek et al., 2005a, Kreek & LaForge, 2007).
The third category is genetics; several studies have suggested that illicit drug abuse and dependence are also under a significant genetic influence. Heritability studies put the estimated range at 45% – 79% among drug dependence (Tsuang et al., 1998,
Kendler et al., 2003, Agrawal et al., 2006).
22 1.2 Global Epidemiological Data of Drug Addiction
1.2.1 America
It is estimated around 47.7 million people in the US, aged 12 years or older used illicit drugs or misused prescription drugs, which includes the use of marijuana, cocaine, heroin, hallucinogens, inhalants, or methamphetamine, and the misuse of prescription drugs. Estimated rates of use of illicit drugs in the past year by drug type were: 0.3 per
100 persons for heroin, 1.8 for cocaine, and 0.6 for methamphetamine (International
Narcotic Control Strategy., 2017). Estimated rates for prescription drug misuse by drug type were: 4.7 per 100 persons for prescription pain relievers, 2.3 for tranquilizers, 2.0 for stimulants, and 0.6 for sedatives (Matsson et al., 2017, CL et al., 2017).
Marijuana is the most commonly used illicit drug, however 11.8 million people misuse opioid that is about 4.4% of the total population. It was reported that the number of opioid use increased 2.35 fold from 2002 – 2016, similarly number of deaths due to higher dosage opioid increased 6.33 fold (533%) from 2001 – 2016 (SAMHSA., 2017).
Most of the opioid addicts were aged 45- 54 years (2016). Another study also reported that usage of heroin steadily is increasing since 2007 (Merikangas & McClair, 2012) in the US, this is due to the increase in misuse of heroin as pain reliever which is easily available and cheaper (Cicero et al., 2012).
1.2.2 Europe
More than 4% of the population is affected by alcohol or drug dependence
(Wittchen et al., 2011). European Drug Report issued by European Monitoring Centre
23 for Drugs and Drug Addiction indicated that one quarter of European Unions (EU) populations had used illegal drugs. About 23.5 million people in the age group of 15-64 years old were involved in cannabis abuse, cocaine 3.5 million, MDMA 2.7 million and
Amphetamine 1.8 million. The opioid abuse is only 1.3 million and 79% of deaths due to the drug over dose are caused by opioid abuse, with the mean age of 38 years. Heroin is the most common opioid in the European Drug Market, originating from Iran or Pakistan
(European Drug Report., 2017)
1.2.3 Africa
Drug abuse is a major problem in South Africa, and shows an increase in 2016, where South Africa is the largest market for illicit drugs within sub-Saharan Africa and a trans-shipment point for cocaine and heroin (International Narcotic Control Strategy.,
2017).
Large quantities of heroin started arriving on the eastern coast of Africa in the late 1990s when smugglers switched from their traditional overland routes from Asia to the sea route across the Indian Ocean (2013).
Cannabis is the most commonly used illicit drug in South Africa, it is also a large source of herbal cannabis for the United Kingdom and continental Europe. Recently,
South African police seized approximately $4.8 million worth of heroin from a Pakistani national believed to be part of an international syndicate (World Drug Report., 2017).
Drug abuse is currently costing around 20 billion a year for the South African government and in future, it can be the biggest threat to the government. It is also
24 reported that 60% of the crime is related to drug abuse (World Drug Report., 2017). In
2014, South Africa initiated a long-term project with U.S. support to further professionalize all substance use treatment staff in the country through the dissemination of U.S.-developed curriculum and international credentialing through the Colombo
Plan‘s International Centre for Certification and Education of Addiction Professionals
(International Narcotic Control Strategy., 2017).
1.2.4 Asia
In many Asian countries, the increased availability and variety of drugs such as heroin, cannabis, cocaine and amphetamines has led to a high prevalence of drug abuse.
It is noted that India‘s geographic location makes it an attractive transhipment area for narcotics and there is evidence that in the northern part of India opium poppy is grown illicitly. The National Household Survey reported alcohol (21.4%) as the primary substance used followed by cannabis (3.0%) and opioids (0.7%) (Dhawan et al., 2017b).
However, it is reported that India is authorized by the international community and the
United Nations to produce licit opium for pharmaceutical uses, and these pharmaceutical items and precursor chemicals are vulnerable to diversion for illicit use. There is a high demand for methamphetamine, the increased profitability from the manufacturing and distribution of methamphetamine has transformed India into a significant precursor chemical source and supply warehouse (World Drug Report., 2017). According to the
Indian Ministry of Home Affairs Annual Report 2013-2014, the Government of India seized 1,412 kilograms (kg) of heroin; 2,372 kg of opium; 47 kg of cocaine; 3,205 kg of
Methaqualone; 68 kg of Amphetamines; 37,466,812 tablets of Psychotropic Substances;
1,356 kg of Ketamine; and 6,935 kg of Ephedrine and Pseudo-Ephedrine(World Drug
25 Report., 2017). India has one of the highest proportions of children and adolescents involved in substance abuse aged <18 years which is about 45% of the population and
5–19 years 35.3% of the population (Dhawan et al., 2017a). It is reported that the estimated number of 177,000 adults are injection drug users (IDUs) (Dhawan et al.,
2016). It is also reported that abuse onset of IDU typically occurs in adulthood after 20 years of age, with a gradual progression from licit, gateway drugs in early adolescence to illicit substances (Solomon et al., 2010). India observed the United Nations sponsored
International Day Against Drug Abuse and Illicit Trafficking on June 26, 2014, with programs focusing on raising awareness of the harmful effects of drug abuse. India had enhanced its law enforcement capacity through training to enforcement officers
(International Narcotic Control Strategy., 2017).
Indonesia is also a destination country for illegal drugs especially for cannabis, methamphetamine, and heroin. It is reported that trafficking of methamphetamine and other synthetic drugs into Indonesia had increased in 2014 and heroin trafficking remained the same throughout the years. Cannabis is the most widely used drug in
Indonesia and second highest is methamphetamine which is smuggled in through Iran, whereas heroin smuggled from Southwest Asia. There are estimated 4.7 million of drug users in Indonesia, the statistical analysis showed that 22% of the users are students and the most widely used narcotics are cannabis, methamphetamine and ecstasy. There is an increase in the drug use in the year 2014 although National Narcotics Board had a lot of outreach programs for the community (International Narcotic Control Strategy., 2017).
The current government response to the ‗national drug emergency‘ is dominated by
26 criminalizing substance use disorders (SUDs) which is ineffective. Interventions are now focusing more evidenced-based approaches to SUDs in Indonesia (Ayu et al., 2016).
It is well known that Pakistan is one of the world‘s top transit corridors for opiates and cannabis, which is trafficked through the countries from borders with
Afghanistan. It is reported that around 40% of drugs like heroin and marijuana from
Afghanistan are routed through Pakistan to China, Africa and Europe. Poppy cultivation had also increased in Pakistan in 2014. Pakistan also a major transit country for precursor chemicals used to produce heroin and methamphetamine. In 2013, UNODC released the results that Pakistan is a home to 6.5 million drug users who consume 59 metric ton of heroin and cannabis annually. In 2014 it was estimated that there are actually 6.7 million drug users, more than 3% of the country‘s population and most of the drug users are aged 15 to 64 (World Drug Report., 2017). A recent study conducted in Pakistan showed that out of 119 participants, around 71.4% were 15-35 years, 68.1% below secondary education and single (51.3%) and unemployed (44.5%) participants were at the greatest risk of using drugs. The data showed that majority of the drug dependence started as recreation (37%), curiosity (34.5%), and due to life changing events (14.3%) (Batool et al., 2017). It is reported that Pakistan lacks the capacity to treat drug addiction and educate the community. In 2014, Pakistan intensified efforts to raise public awareness about drug abuse (International Narcotic Control Strategy., 2017).
Methamphetamine or locally known as ―shabu,‖ in Philippines has been the primary drug consumed by the locals. Philippine authorities conducted several drug seizures and seized 660 kilograms (kg) of methamphetamine. It is reported that Chinese
27 drug trafficking organizations dominate the methamphetamine trade in the Philippines.
The Philippine government conducting a lot of education programs aimed at promoting self-awareness (International Narcotic Control Strategy., 2017).
The national household survey showed that 3.5 million people had experienced at least one kind of illicit drug use in their lifetime and most of them aged between 12 and 65 years (National Survey., 2012). The country is mainly used as a trans-shipment point for trafficking to the international market. In 2014, Thai authorities seized large quantities of heroin, cocaine, MDMA (ecstasy), crystal methamphetamine, and methamphetamine tablets (―yaa-baa‖). It is noted that in Thailand, there are no significant quantities of opiates, synthetic or other drugs cultivated or produced in 2014.
However, in 2014 the authorities seized 210.22 kilograms (kg) of heroin, but there was a decline from 2013 (784.6 kg of heroin for the year) but an increase in comparison to
2012 (127.5 kg for the year). Thailand conducts demand reduction programs, which includes drug addiction prevention programs with treatment for addicts. It is also noted various therapeutic camps have been provided throughout the country (National Survey.,
2012). It is reported that early adolescent sexual debut is linked to substance abuse, suggesting that associated factors need to be targeted to prevent early sexual initiation.
These behaviours, along with drug use might persist into young adulthood, bringing the additional risk of contracting and transmitting HIV. However, further research is warranted which examines these factors to provide in-depth understanding (Thepthien et al., 2016). In Thailand, the drug treatment programs have gained over 700,000 drug addicts since the government announced its counter-narcotics priorities in September
28 2011 (International Narcotic Control Strategy., 2017). Therefore, they are in urgent need of more intensive and targeted interventions.
China is a major producer of synthetic drugs and drug precursor chemicals; it is considered a significant destination and transit country for illicit drugs. According to
China‘s National Narcotics Control Commission 2014 Annual Report on Drug Control in China, heroin is the most abused drug in China followed by synthetic drugs such as ketamine, methamphetamine, and other amphetamine-type stimulants (ATS). Heroin is smuggled into China from Burma, Laos, Vietnam, Afghanistan, Tajikistan, and Pakistan.
Methamphetamine and other ATS drugs manufactured in Burma also enter China from the ―Golden Triangle‖ region (Burma, Laos, Thailand), and Vietnam(World Drug
Report., 2017).The government has a lot of outreach program to raise awareness of the negative health effects of drug abuse and reduce the demand for drugs (International
Narcotic Control Strategy., 2017).
1.2.5 Drug addiction in Malaysia
Drug addiction has been prevalent in Malaysia since the 19th century, and in the early 20th century, the main drug of abuse was opium, which was abused by Chinese and Indian immigrant laborers who were introduced by British colonialists to work in
Malaya (Noorzurani et al., 2008). In 1970s heroin became the most abused substance of among Malays who is the main ethnic group in Malaysia compared to other ethnic groups and by 1980s heroin abuse among Malaysian youth was a national crisis (Rusdi
A, 2008, Noorzurani et al., 2008). Illicit drugs are smuggled into Malaysia from the golden triangle area (borders of Thailand, Laos and Myanmar) as well as Iran, Nigeria
29 and India. Most of these countries use Malaysia as a drug trafficking hub. There is no notable cultivation of illicit drug crops in Malaysia (International Narcotic Control
Strategy., 2017).
It was reported that the cumulative number of registered people who experienced problems with substance use in Malaysia between 1988 and 2006 was 300%, 241%, and
60.7% of these were opioid misusers and an increase in HIV cases due to needle sharing
(MyHealth., 2016). Studies have shown that between 2010 and 2015, there were 127606 registered drug addicts in Malaysia. In 2015, 26668 drug addicts were reported and there were only 21777 in 2014 (Table 1.1). In 2015, new addicts comprised 77% of the total addicts registered while 23% were relapse cases. Majority of the registered addicts were male (98%). Statistics also indicated that 80% of the addicts are Malays, 8% Chinese,
8% Indian and 4% were others. Most of them fall in the 20 – 39 age group, about
69.09%, majority of drug abusers were labourers (21%) and part time worker (27%) and followed by jobless 14%.
Drug addiction also correlates with the education background. The data showed that 20% of addicts were either not educated or having only primary level school education or were SRP/PMR dropouts. Around 84.1% of them were SRP/PMR or SPM leavers and only 4% have got tertiary education. It is reported that 61% of drug addicts were influenced by friends and in terms of type of drug being abused in the country.
Heroin continues to be the main drug being abused by Malaysian; constituting 61%, followed by Methamphetamine 30%, Ganja 5% and Ecstasy and Amphetamine 5%. The usage of heroin had increased from 49% in 2010 to 75% in 2013, 68% in 2014 and drop
30 to 60% in 2015. It is also noted that in 2014, RM 26.405 billion heroin was seized by the
Malaysian authority, it shows that there is a drastic change in the demand of heroin among Malaysia addicts (World Drug Report., 2017).
Since its implementation, methadone treatment has successfully reduced the prevalence of drug dependence and HIV infection among drug users in Malaysia from
74.7% in 2000 to 19.3% by December 2014 (Annual Report., 2014). Latest report demonstrated the effectiveness of methadone treatment in reducing heroin dependence and HIV infections as well as in improving social dependence (Ali et al., 2017)
Table 1.1: Number of drug addicts reported in 2015 and 2016 Difference Status 2014 2015 2014/2015 New addicts 13605 20289 +32.9%
Relapse 8172 6379 +21.9%
Total addicts 21777 26668 +18.3% Adapted from: Agensi Anti Dadah Kebangsaan (AADK) report 2017
1.3 Molecular Basis of Addiction
Heredity is a major risk of addiction; research had shown that 40-60% of addiction risk is attributable to the genetic factor, addiction genes and biological differences that make someone more or less vulnerable to addiction (Nestler, 2000).
Several methods were used to study the influence of genetic on addiction, such as family, twin and animal studies. Twin studies revealed that familial aggregation of addiction was influenced by genetic factors (Agrawal & Lynskey, 2008), due to the
31 segregating genes that are shared by the twins. It is also influenced by age and other exposure (Agrawal et al., 2012). Substance related addiction is ranked very low at a young age and increases during adolescence and adulthood (Kendler et al., 2008). The latest report by corroborating previous findings found substance use is moderately high from early adolescences into young adulthood (Waaktaar et al., 2017) and it is supported by genetic studies (Palmer et al., 2015). Animal study is crucial in understanding the biology and pathophysiology of addiction. Knockout mice targeting each gene of a system have been created two decades ago, mutant mice represent a unique tool to test specific role of each addiction gene. In contrast to clinical studies, the subjects can be controlled according to the study need (Becker et al., 2002, Charbogne et al., 2014).
Behavioural testing in mice is limited, however new methods or models are being improvised to characterize the addiction studies better. This is because addiction is a complex trait and thus a single gene defect might produce a relatively small effect which would be difficult to be detected experimentally (Nestler, 2000).
Although a hereditary basis for addiction has been established, the specific gene involved in the etiology of these disorders has not been well defined. Researchers have hypothesized that specific combinations of alleles of specific genes may result in innate differences in phenotypic expression of cellular or physiological systems known to be important in mediating the responses of drugs abuse (Kreek, 2000). Other studies have shown that opiates, cocaine, cannabis, amphetamine, alcohol and nicotine, profoundly alter physiological and cellular systems. These changes are specific to the route and pattern of administration and length of time exposure (LaForge et al., 2000, Agrawal &
Lynskey, 2008, Kendler & Myers, 2015).
32 Some of the induced alterations in the gene may be long lasting or even permanent. Therefore, cellular or physiological systems that show alterations in response to substances of abuse might show higher or lower expression of the receptor which is postulated by genetic differences from polymorphisms (LaForge et al., 2000, Sagheddu
& Melis, 2015). These may also underlie the development of substance abuse susceptibility (Kreek et al., 2005a, Sweatt, 2016).
A growing number of genes are significantly associated with addiction. In fact, research shows that few selected genes from various populations are likely to be involved in contributing to vulnerability to drugs, alcohol and nicotine addiction (Kreek et al., 2002, Volkow et al., 2012, Pandey et al., 2017).
1.3.1 Molecular basis of alcoholism
Alcohol is unique among substance abuse drugs, as it is a natural by-product of fermentation (Marugame et al., 2007), it has an estimated heritability of 50 % -70% varies with diagnostic criteria, population and gender (Tyndale, 2003, Ducci &
Goldman, 2012). Researchers have investigated the genetic components by studying population of a family and inheritance of alcoholism among twins. Family and twin studies have supported the conclusion that the proportions of risk for this disorder are explained by genes which are the heritability. Twin studies are expected to have a similar history for developing alcoholism between the twins due to the similar genetic expression. Thus, it is concluded that genetic makeup of each individual can accelerate to addiction (Heath et al., 1997, Prescott & Kendler, 1999, Kendler et al., 2003).
33 Alcohol metabolism and the rate of its degradation products are important to determine its physiological effects. The primary pathway involves the conversion of ethanol to acetaldehyde plays a major role in mediating aversive and rewarding effects of ethanol. Acetaldehyde is oxidized further to acetate by aldehyde dehydrogenase. The key enzymes involved in alcohol metabolism are ADH and ALDH (Thomasson et al.,
1995, Chen et al., 1999).
It is reported that alcoholism is less common in East Asian and Polynesian populations than in European populations, due to protective ADH and ALDH alleles
(Chambers et al., 2002, Gelernter et al., 2014, Galinsky et al., 2016). ADH1B*3 allele reveals a higher activity of ethanol oxidation and also reported to have a protective effect against the risk of alcohol dependence (Edenberg & Foroud, 2006). Similarly,
ADH1B*2 is a proactive allele, it is reported to be lower among alcohol dependence
(Whitfield, 2002, Konishi et al., 2004, Higuchi et al., 2004, Bierut et al., 2012), this is a result of faster aldehyde production which might lead to unpleasant alcohol reaction. It is also recognized that ADH1B locus is under strong selection in East Asians and a study showed an independent evolution of the same locus also in Europeans (Galinsky et al.,
2016). This functional variant is negatively associated with drinking behaviours, mainly in European populations (Gelernter et al., 2014).
Allele ADH1C*2 of ADH1C gene was reported to have a higher risk of alcohol dependence (Mulligan et al., 2003, Konishi et al., 2004, Zintzaras et al., 2006, Li et al.,
2012a). Allele ALDH2*2 from ALDH gene also lacks of activity to catalyse acetaldehyde, it is found in East Asian population it causes high concentration of
34 acetaldehyde after drinking alcohol and serious adverse effect reaction facial flushing, hypotension, headaches and nausea (Yoshida, 1992, Chen et al., 1999) An alcoholic with inactive ALDH2*2 have higher novelty seeking (Marugame et al., 2007).
Polymorphisms in two other enzymes, ALDH1A1 (Lind et al., 2008, Sherva et al., 2009) and ALDH1B1 (Linneberg et al., 2010,), have also been associated with alcohol consumption in Finnish, European American, European, Indo Trinidadian and
Danish populations, respectively. Minor alleles at ADH1B (i.e., rs1229984 and rs2066702) are associated with lower levels of drinking (Xu et al, 2015). Consistent with the genetic associations, these variants increase the alcohol oxidization rate, raising acetaldehyde levels and its related aversive symptoms, including facial flushing, nausea, headache, and tachycardia (Edenberg, 2007).
It is also noted that ALDH rs672 another variant which very rare or absent in non-Asian population is negatively associated with alcohol use behaviours in Asian
(Quillen et al., 2014). This variant causes a lack of acetaldehyde metabolism (Peng et al.,
2014), which will produce an accumulation of acetaldehyde which will cause adverse effect reaction.
Human genetic studies have identified many other polymorphisms associated with alcohol dependence in genes that comprise various neurotransmitter-signalling pathways. This is including dopaminergic including Monoamine Oxidase A (MAOA)
Catechol – O- Methyltranferase (COMT), Dopamine Receptor D2 (DRD2), Ankyrin
Repeat and Kinase Domain 1(ANKK1) Tetratricopeptide Repeat Domain(TTC12) and
35 Neural Cell Adhesion Molecule 1 (NCAM1) (Köhnke et al., 2005, Tikkanen et al., 2009,
Hendershot, 2011).
Serotonin Transporter Protein (5-HTT), Solute Carrier Family 6 Member 4
(SLC6A4) 5 Hydroxtryptamine Receptor 3A (HTR3A), 5 Hydroxtryptamine Receptor 3B
(HTR3B and 5 Hydroxtryptamine Receptor 1B (HTR1B); (Cao et al., 2011, Seneviratne et al., 2013). GABAergic gene (Gamma Aminobutyric) (e.g., Gamma Aminobutyric
Acid Type A Receptor Alpha 1 (GABRA1), Gamma Aminobutyric Acid Type A
Receptor Alpha 2 (GABRA2) and Gamma Aminobutyric Acid Type A Receptor Gamma
1 (GABRG1); (Covault et al., 2004, Lappalainen et al., 2005, Agrawal & Lynskey, 2006,
Dick et al., 2006b, Dick et al., 2006a, Covault et al., 2008, Enoch, 2008, Ittiwut et al.,
2012). The opioid receptors Opioid Receptor Mu 1 (OPRM1), Opioid Receptor Delta
1(OPRD1) and Opioid Receptor Kappa 1 (OPRK1) (Ray & Hutchison, 2004, Zhang et al., 2008a, Xuei et al., 2006) and tachykinin receptor 3 (Foroud et al., 2008).
1.3.2 Molecular basis of smoking
It is estimated around 7 million smokers in the world today and most of them start smoking before the age of 18. Around 47.5% were male smokers compared to female. It is the cause of 6 million deaths around the world today(WHO report., 2017).
Studies had shown that genetic factors do contribute to smoking from initiation to dependence to smoking (Bierut, 2011). Heritability estimates vary in each study, adolescent twins smoking behaviour ranges from 15% to 86%, population based twin studies provided evidence that genetic plays a larger role in smoking behaviour by late adolescence (Karp et al., 2005, Kendler et al., 2008, Do et al., 2015).
36 Several large Genome Wide Association Study (GWAS) of smoking quantity identified associations with genetic variants in the nicotinic acetylcholine receptor
CHRNA5-CHRNA3-CHRNB4 subunit cluster on chromosome 15q25.1 in populations of
European ancestry (Thorgeirsson et al., 2010, Furberg et al., 2010). A study by Saccone and colleagues observed that the non-synonymous SNP rs16969968 in exon 5 of
CHRNA5 has consistent effects on the risk for nicotine dependence in both European and
African populations, despite a large difference in allele frequency for the SNP (Saccone et al., 2009a). Some studies identified few other SNPs from this cluster, rs578776 in the
3′ untranslated region of CHRNA3 that has low linkage disequilibrium with rs16969968 is associated with smoking dependence in European Americans but not in African
Americans (Chen et al., 2012).The SNP in CHRNA5, rs588765, confers a protective effect for smoking dependence in populations of European descent (Saccone et al.,
2009b, Wang et al., 2009). A comprehensive meta-analysis confirmed that these loci in nicotinic receptor gene affect smoking dependence (Wang et al., 2009).
The main enzyme implicated in nicotine metabolism is CYP2A6 a polymorphic enzyme gene (Hukkanen et al., 2005). Single nucleotide polymorphism (SNP) in this gene highly polymorphic and generate isoforms. It causes variation in enzymatic activity therefore the concentration of nicotine also varies among individuals (Malaiyandi et al.,
2005). A number of studies have reported the association between reduced or absent
CYP2A6 enzyme activity and lower risk of smoking, including decreased cigarette consumption, smoking intensity, and withdrawal symptoms; shorter smoking duration; and increased cessation (Malaiyandi et al., 2006, Thorgeirsson et al., 2010, Liu et al.,
2011, Pan et al., 2015). However, some studies have failed to detect any association
37 between CYP2A6 variation and smoking addiction, which is an active smoking (London et al., 1999, Schulz et al., 2001, Tanner et al., 2017).
Some genetic studies of smoking dependence have successfully identified risk factor for addiction using both GWAS and candidate gene approaches. However, these associated genetic factors explain only a small percentage of the variance in smoking dependence, indicating that further research to detect other genetic factors influencing smoking is warranted.
1.3.3 Molecular basis and drug addiction
Drug addiction is a chronic relapsing disease of the brain caused by drug-induced direct effects and persisting neuroadaptations at the epigenetic, mRNA, neuropeptide, neurotransmitter, or protein levels (Kreek et al., 2005a, Kreek et al., 2012). The identification of specific genes and functional loci moderating vulnerability has been challenging because it involves changes in anatomy, function, cellular and molecular neuroadaptations (Hyman & Malenka, 2001).
Many genes show significant association or display evidence of linkage with drug addiction for several decades using specific molecular genetic approaches like genetic animal model, candidate gene screening, genome wide association and genome wide linkage analysis (Li & Burmeister, 2009). Significant progress has been made to identify susceptibility genes for addiction however, only a small subset of these genes has a polymorphism for which an alteration in function has been involved in susceptibility (Tsuang et al., 1998, Kendler et al., 1999, Kendler et al., 2003, Kendler &
38 Myers, 2015). The implication of epistatic factors, epigenetic changes and gene– environment interactions make this task even more challenging. Translational and reverse translational research methods will be useful tools for a better understanding of the impact of gene variants on biological networks involved in addiction (Bühler et al.,
2015). Other than that it is always difficult to collect larger sample size for substance abuse, it is noted that large sample will achieve the level of statistical power required and will provide needed results on genetic influence on addiction (Kalsi et al., 2016).
Identification of specific genes conveying increased risks not only for understanding the causes and potential treatments for disease, but also for increasing our understanding of how genetic and environmental risks interact to shape liability to addiction. It is noted that addiction involves a wide range of genes; there is more than one gene responsible for addiction. It is complicated mechanisms, any individual technology platform or study may be limited or biased (Goldman et al., 2005). There is a need to combine data across technology platforms and studies that may complement one another. The resultant gene list, in a database with additional functional information, definitely will be a valuable resource for the community. Systematic and statistical analysis of the genes and the underlying pathways may provide a complete picture of the molecular mechanism underlying drug addiction.
39 1.4 Drug Addiction Genes
1.4.1 OPRK1
The Kappa opioid receptor OPRK1 gene encodes KOP-r and is located on chromosome 8q11.2. It is found in the mesolimbic pathway, the binding ligand is dynorphin derived from prodynorphin were reported to inhibit dopamine neurons of the mesolimbic system, reduces dopaminergic tone in the striatum causes dysphoric and adverse effect (Shippenberg & Herz, 1986, Herz, 1998, Yuferov et al., 2010). It plays an interesting role in addiction of drug abuse and other rewarding stimuli because it is considered counter the modulatory mechanism of the brain, it directly or indirectly induced dopaminergic stimulation (Kreek et al., 2005a, Kreek & LaForge, 2007).
Therefore KOR agonist may be potential therapeutic agents for the treatment of drug addiction (Shippenberg & Rea, 1997). Several SNPs in the human OPRK1 gene have been reported, which are associated with drug addiction. In Western European, heroin dependent was genotyped for rs1051660, there was a significant association with drug dependent (Gerra et al., 2007). Similar results were reported among African American,
Caucasian, Hispanic and Asian American (Yuferov et al., 2010). However, in contrary a large haplotype study by Zhang et al, 2008 showed no significant association among
European American opioid dependence and control group (Zhang et al., 2008a). A study by Xu.S and colleagues proved that rs6989250 of OPRK1 gene also associated with greater subsequent cocaine relapse risk (Xu et al., 2013) it is suggesting inter population variation. There is also an association with drug withdrawal symptoms from the variants of OPRK1 such as rs7832417, rs1698853, rs702764 and rs7817710 (Wang et al., 2014) and also with variant rs6473797 (Jones et al., 2016). There may a significant influence of
40 genetic and drug withdrawal biochemical mechanism which needs further investigation.
The ability to predict which individual may experience greater drug withdrawal symptoms may increase the success rate of a treatment.
1.4.2 OPRD1
The OPRD1 gene encodes the δ-opioid receptor (DOR) is located on chromosome 1p34, a G-protein-coupled receptor that regulates reward effects in the brain through activation of downstream MAP kinase pathways (Herz, 1998), which has enkephalins as its endogenous ligands. The Delta Opioid Receptor (DOR) functions in nociceptive responses but has also been shown to be involved in modulating the effects of Mu opioid receptor (MOR) directed compounds. Mice with targeted deletion of the OPRD1 gene do not develop tolerance to the analgesic effects of morphine, although still becoming physically dependent on the drug (Zhu et al., 1999, Filliol et al.,
2000). DOR plays an important role in the development of opioid tolerance (Daniels et al. 2005) and is involved in the rewarding and analgesic effects of opioids (Le Merrer et al., 2009). The Delta opioid receptor also becomes functional in the maintenance of opioid rewarding properties after prolonged exposure to opiates (Hack et al., 2005, Ma et al., 2006). Many SNPs in the OPRD1 gene have been defined (Mayer et al., 1997,
Gelernter & Kranzler, 2000) however only a few association studies on substance dependence were conducted between variations of OPRD1 SNPs. A study was conducted among German Caucasians with heroin addiction, a significant association was reported for C921T (rs2234918) (Mayer et al., 1997).
41 Latest research provided an evidence implicating OPRD1 SNPs (rs2236857 and rs581111) in liability for heroin dependence (Nelson et al., 2014). In another study, the opioid substance dependence among European American observed significant opioid dependence risk associated with rs1042114, a coding SNP in OPRD1, but not with other
OPRD1 SNPs. Another investigation (Levran et al., 2008a) that had a larger sample of heroin dependent cases reported a putative association with three SNPs in OPRD1. The haplotype association study among African American between rs1042114 and rs2234918 also showed a nominally significant association with opioid and cocaine addiction (Crist et al., 2013b). In association and family study of OPRD1 with drug dependence, Franke and colleagues failed to find an association for rs2234918 among the German origins (Franke et al., 1999).
Similarly, a recent research conducted for SNP rs2236861 showed a significant association with drug addiction with control group compared to drug dependents
(Randesi et al., 2016). Although earlier research showed significant association with drug dependence (Levran et al., 2008a, Beer et al., 2013). There was also no significant evidence for the role of variant rs1042114 among subjects from China, the G allele was totally absent from both substance dependent and control subjects (Xu et al., 2002). This report supported by another study, which showed no significant association with drug dependence among the Chinese population (Xuei et al., 2007). In this current study, we will be able to provide data on the minor allele G in Malaysian population, the absence of variant G will confirm the non-existence of the variant among the Asian population.
42 1.4.3 PDYN
The human prodynorphin gene (PDYN) is located at chromosome 20. It consists of four exons, exon 1 and exon 2 contain the 5′-untranslated region, exon 3 encodes a signal peptide, and exon 4 encodes dynorphin peptides, including α-neoendorphin, β- neoendorphin, dynorphin A and dynorphin B (Cox, 1982, Nikoshkov et al., 2005).
Dynorphin peptides and prodynorphin mRNA are particularly abundant in the nucleus accumbens, caudate, amygdala, hippocampus, and hypothalamus (Mansour et al., 1994,
Hurd, 1996, Akil et al., 1998).
PDYN precursor (Schwarzer, 2009), bind to all three opiate receptors, but it shows a preference for the kappa opioid receptor. Dynorphins are believed to mediate the aversive effects of drugs of abuse as experimental administration of KOR agonists in animals produces place aversion (Mucha & Herz, 1986, Shippenberg & Herz, 1986,
Land et al., 2008, Chartoff et al., 2012, Koob, 2017) and dysphoria (Shippenberg et al.,
2007). This is believed to be due, in part, to a reduction in dopaminergic neurotransmission on KOR stimulation and increased PDYN gene expression (Nestler,
2004). Exposure to cocaine upregulates dynorphin immunoreactivity in the brain regions in the caudate and ventral palladium (Hurd & Herkenham, 1995, Staley et al., 1997), it is noted that a chronic exposure to heroin increases PDYN mRNA in the central amygdala and nucleus accumbens shell (Solecki et al., 2009). A Naloxone-precipitated withdrawal was found to accentuate the increase in morphine-induced dynorphin expression in the striatum and accumbens in rats (Nylander et al., 1995). Such studies have led researchers to hypothesize that dynorphin may contribute to the negative emotional states
43 experienced during withdrawal from drugs of abuse and motivate continued drug use as a consequence of negative reinforcement (Koob & Le Moal, 2008, Wee & Koob, 2010).
Variants of the prodynorphin gene have been studied in addiction for opiates, cocaine, and alcohol, as well as in in vitro functional studies. Many of the variants in the
PDYN were associated with increased risk for drug addiction (Ray et al., 2005,
Nikoshkov et al., 2008). In China, it was reported that rs35286281, rs1022563, rs2235749 and rs910080 associated with heroin addicts (Wei et al., 2011) and in the
United States the researchers identified an increased risk of developing opioid dependence in the female for the SNP rs1022563 (Clarke et al., 2009). Another study that was conducted by a similar group and the findings showed that the OR for rs910080, rs199774 and rs1022563 were increased in the female opioid dependent among European Americans; however there was no association for female African
American population (Clarke, 2012). In another association study, rs910080 was associated with cocaine addiction among European American and African American
(Yuferov et al., 2009). The results show that there is a difference in the genetic profile between male and female. Future studies should be focusing on both genders; such differences have implication on drug dependence recovery therapy.
1.4.4 COMT
The catechol-O-methyltransferase (COMT) enzyme metabolizes the catecholamines dopamine, epinephrine and norepinephrine, and is a key modulator of dopaminergic and adrenergic neurotransmission. Catechol-O-methyltransferase (COMT) plays a major role in brain catecholamine metabolism by catalyzing the transfer of a
44 methyl group from S-adenosyl-methionine (SAM) to catecholamines (Chen et al., 2004).
COMT is in the chromosome 22q11.21–q11.23, it is frequently included in the velocardiofacial syndrome (VCFS) deletion region (Grossman et al., 1992). Numerous genetic associations have been reported for several SNPs or haplotypes at the COMT locus. These include VCFS-related traits (Lachman et al., 1996, Shifman et al., 2002,
Bearden et al., 2004, Gothelf et al., 2005), schizophrenia (Lachman et al., 1996, Shifman et al., 2002), anxiety-related personality traits (Stein et al., 2005), pain sensitivity
(Diatchenko et al., 2005, Nackley et al., 2006), psychological stress response (Jabbi et al., 2007), and nicotine dependence (Beuten et al., 2006).
Variant rs737866 SNP was associated with cocaine and heroin addiction, haplotype association between AAT of rs737866, rs4680 and rs174696 were conducted among European American and African American, this haplotype was significantly associated with cocaine in this two populations. It was concluded that the association was due to its role in the metabolism of dopamine and norepinephrine, cocaine interferes the process between dopamine and the receptor by binding to it which is the reward pathway for drug dependence (Ittiwut et al., 2011, Baik, 2013). Another study in China with heroin dependents proved that TT genotype of rs737866 has a higher association with addiction compared to CT and CC. It is noted that individuals with COMT variant gene increase the enzymatic activity with substance abuse. They may experience long lasting excitement and may increase the severity of drug dependence. However, in this study, wild type genotype TT was associated with heroin; it is noted in this report that study was not compared with control group, which might be the limitation (Li et al.,
2011).
45 1.4.5 DRD4
The dopamine system is a candidate for analysis for drug dependence because it is involved in the reward and reinforcing mechanism in the brain. The DRD4 receptor gene belongs to dopamine receptor D2 like family, it‘s a transmembrane G-protein coupled receptor which is located near the telomere of chromosome 11 p (Van Tol et al.,
1992). Increasing evidence suggests that the dopamine D4 receptor (DRD4), which is highly abundant in cortical and subcortical neural regions, is associated with mediating emotional processing and memory encoding. Several clinical genetic linkage studies have highlighted the possible correlations between DRD4 expression and neuropsychiatric disorders, including schizophrenia, addiction, and depression (Lauzon
& Laviolette, 2010). DRD4 which is expressed in the limbic region of the brain contains a SNP (-521T>C) in the promoter that affects transcriptional activity of the gene
(Okuyama et al., 2000, Ronai et al., 2001).
Studies have proven that the T allele from variant -521C/T associated with reduced efficiency compared to C allele (Okuyama et al., 2000), it has been reported to affect the individual differences in novelty seeking behaviour which is closely related to drug use. The homozygote CC significantly over presented in heroin addicts and enhanced by 5HTTLPR gene (Szilagyi et al., 2005) but another similar study showed that there was no association among Chinese population (Li et al., 2000). However, another data among Chinese population suggested a significant association of T allele with heroin dependence but the results deviated from Hardy Weinberg Equilibrium due to a small population number. In the same study, it was reported that TT individual may
46 prefer opioid use because they have less pain sensitive to pain pressure test (Ho et al.,
2008). This result was supported by the latest research which has proven an association between allele T and drug dependence (Baker et al., 2016). The polymorphism the
DRD4 gene promoter region might change the affinity of mRNA polymerase and effect the protein expression and its function.
1.4.7 ABCB1 gene
Human P-glycoprotein (P-gp) is encoded by ABCB1 (7q21) (ATP-binding cassette, sub-family B member 1) or alternatively referred to as multidrug resistance polypeptide 1 (MDR1). P-gp is a 1280 amino acid transporter expressed in the blood brain barrier and protects the brain from many drugs or neurotoxic substances such as glucocorticoids and amyloid-beta as an efflux pump (Chen et al., 1986, Ambudkar et al.,
1999).
Development of addictions can be influenced by personality traits, early consumption onset, anxiety and depressive disorder (Kendler, 2005), additionally the effect of psychotropic substances together with pharmacodynamics and pharmacokinetics of these substances may also play an important role in substance abuse and dependence (Koob & Nestler, 1997, Koob & Le Moal, 1997).
It has been identified more than 50 single nucleotide polymorphisms in this highly polymorphic gene, and amongst those the rs1128503, rs1045642 and rs2032582 are the variants that were found to be associated with P-gp expression, drug responses and disease susceptibility (Marzolini et al., 2004, Ho et al., 2006, Kerb, 2006).
47 The rs1045642 variant or the C3435T SNP was identified by Hoffmeyer and the team (Hoffmeyer et al., 2000), it is an exchange of nucleotide C to T in exon 26 which will not affect the protein of P-gp (Kimchi-Sarfaty et al., 2007). However, the TT genotype has been associated decreased ABCB1 expression or with a lower P-gp level.
This variant is associated with neurological and psychiatric disorder (Tishler et al.,
1995), psychosis (Alenius et al., 2008) and depression (Kato, 2008) and their treatment outcomes. The variant rs1128503 is in exon 12, which is also the changes of nucleotide
C to T without the change of amino acid, but associated with variability in toxicity and its response to the drug (Xing et al., 2006, Aarnoudse et al., 2006). The non-synonymous variant rs2032582 (G2677T/A) is located in exon 21 (Mickley et al., 1998). The change in the nucleotide, results into the change of amino acid (Ala) to Ser/Thr, which will alter the P-gp expression, ATPase activity and drug bioavailability (Kim et al., 2001, Tanabe et al., 2001, Horinouchi et al., 2002).
The C3435T polymorphism showed a significant association with cannabis genotype CC, it was higher between substance user, and this polymorphism also showed strong linkage disequilibrium with synonymous C1236T and no synonymous T2677A
(Benyamina et al., 2009). In another study, morphine usage was significantly had a higher frequency of the rs1045642 CT genotype and a lower frequency of CC genotypes among drug dependence group compared to the controls (Sterjev et al., 2012, Beer et al.,
2013). It is reported a trend towards a higher frequency of the 2-locus genotype pattern
(rs2032582 - rs1045642) GT-CT and significantly less GG-CC genotypes (linked to a
―normal‖ p-gp activity) were observed among the addicts (Beer et al., 2013). The role of the p-gp as susceptibility factor has already been proved with psychiatric disorders. The
48 impaired functionality of the p-gp may lead to an increased accumulation of endogenous compounds cortisol in the brain, which can cause damage to the brain cells. (De Klerk et al., 2011, Fujii et al., 2012). Principally, a similar mechanism could also underlie opioid addiction susceptibility because P-gp is a drug transporter which determines uptake and efflux of a range of drugs including substance abuse (Fujii et al., 2012).
In Caucasian populations, subjects carrying 3435TT genotypes were associated with lower methadone plasma concentrations (Crettol et al., 2006) whilst others had reported that CC and CT to be a moderate responder to methadone and TT was a good responder (Fonseca et al., 2010). (Fonseca et al., 2010). The haplotype combinations of polymorphism C1236T, G2677T/A and C3435T were also been studied (Levran et al.,
2008b, Hung et al., 2011), in which (Levran et al., 2008b) has shown that the 1236TT-
2677TT-3435TT haplotype combination requires a higher methadone doses during methadone maintenance therapy in Caucasians (Hung et al., 2011).
The three variants rs1128503, rs1045642 and rs2032582 from ABCB1 gene are known to modify drug pharmacokinetics and clinical effect due to its function as a gate keeper on drug absorption, distribution and elimination. It is a drug transporter including for substance abuse but yet to be studied for their role in contributing to the individual susceptibility to drug addiction.
49 1.4.8 DUSP
Reversible protein tyrosine phosphorylation plays an important role in the regulation of multiple processes within the living cell and in its interactions with an extracellular factor. It is mediated by protein tyrosine kinases (PTKs) and protein tyrosine phosphatases (PTPs) (Alonso et al., 2004). The unexpected PTP functions are still being studied, including mitochondrial tasks, which affect insulin secretion and apoptosis, as well as control of vesicle fusion and regulation of potassium channels
(Huynh et al., 2004, Pagliarini et al., 2005, Lv et al., 2006). There are hundreds of PTP genes present in the human genome and around 60 classified as dual specific phosphates
(DSPs), one of them is DUPD1 contains 446 amino acid residue and it is officially called the DUSP27 (Alonso et al., 2004). It is suggested that phosphatase kinesis is important for cell fated decision; it operates as an immediate and delayed regulator of signal transduction. It is important to understand the biological mechanism such as cellular signalling network, predict the outcome of a drug mechanism(Nguyen et al.,
2013). The variant rs950302 was shown to be associated with drug addiction, a single study conducted amongst Caucasians. Since this variant was identified from a large cohort from New York and was studied using genome wide association study, it might lead to new targets and strategies (Nielsen et al., 2010)
1.4.9 rs10494334
The variant rs10494334 is an unannotated region of the genome located in chromosome 1q23.This variant rs10494334 has been associated with heroin addiction among the Caucasian group (Nielsen et al., 2010). No other study has been reported on
50 drug dependence but it was identified from genome wide association study in a large population.
1.5 Rationale of the study
The major aim of the present study was to identify genetic polymorphisms contributing to the individual susceptibility to opioid addiction and to replicate earlier findings in this regard, respectively. Therefore, a candidate gene case-control association study with 7 different genes and 12 SNPs was performed. A particular focus was put on pharmacogenetic candidate genes, which may contribute to inter-individual variations in opioid effects and opioid-induced behaviours (i.e. genes encoding proteins directly involved in the pharmacokinetic and pharmacodynamics action of commonly abused opioids) (Kreek et al., 2005a, Kreek et al., 2005b, Ho et al., 2006). It can be a basic platform to identify candidate gene which will be able to assist us to understand the genetic profile associated with drug dependence among Malaysian population. Genetic profile was assessed in some of the developed countries for treatments and therapies for drug dependence patients, currently in Malaysia it was not assessed and this might affect the success rate of the treatment. The developed database will provide pharmacogenetics information on variants associated with drug dependence which will give a better understanding of the role of genetic factors and eventually contribute to the optimal use of current therapies and development of more effective therapeutic strategies in the Care
Cure Clinics in Malaysia. It will support the argument for personalized treatment.
51 1.6 General objective
To study the prevalence of single nucleotide polymorphisms of the OPRD1 (Delta
Opioid Receptor), OPRK1 (Kappa Opioid Receptor), COMT (Catechol – O-
Methyltransferase gene), the PDYN (Prodynorphin), DRD4 (Dopamine receptor D4),
ABCB1(P glycoprotein), DUSP (Dual Specificity Phosphatase 27) genes and rs10494334 among Malay males in Malaysia and to develop SNP database for all the studied genes
1.7 Specific Objectives
a) To determine the demographic data association with opioid dependence.
b) To evaluate the association between opioid dependence and genetic
polymorphisms of the OPRD1, OPRK1, COMT, PDYN, DRD4, ABCB1, DUSP
genes and rs10494334.
c) To determine the epistatic effects between studied SNPs that will have a potential
association with opioid dependence.
d) To establish a pharmacogenetics database for all the studied SNPs
polymorphisms.
52 CHAPTER 2: METHODOLOGY
2.1 Experimental Design
This study included 459 of drug addicts and 543 of healthy individuals with no history of drug addiction (control) with the mean age of 34.7±SD. All recruited subjects for both drug dependence and controls were ethnically Malay male subjects (a subject with intermarriage was not included in the study to maintain the ethnicity). The drug dependents were enrolled from the Drug Rehabilitation Centre, Malaysia, and control subjects were blood donors recruited through voluntary blood donation camps organized by Hospital Kepala Batas, Penang and Hospital Universiti Sains Malaysia, Kubang
Kerian, Kelantan. The demographic profiles, as well as the drug abuse patterns of the addicts, were gathered through a validated questionnaire and the study protocols had been approved by the Human Research Ethics Committee Universiti Sains Malaysia
(USMKK/PPP/JePem (249-3(190)(Appendix A). Whole blood samples (5 ml) were drawn from the subjects after informed consent was obtained. Genomic DNA was extracted from each blood sample using the Qiagen Blood DNA Mini Kit (Qiagen,
Valencia, CA). The SNPs rs702764, rs1042114, rs1997794, rs1022563 rs910080, rs737866 , rs10494334, rs1800955, rs1128503, rs1045642, rs2032582 and rs950302 were genotyped using TaqMan SNP genotyping assays (Applied Biosystems, Foster
City, CA, USA) on a Step One Plus real-time PCR 7900 system (Applied Biosystems,
Foster City, CA, USA). The technique used two allele-specific TaqMan with minor groove binding probes obtained from ThermoFisher Scientific, Waltham, Massachusetts,
United States.
53 Chi squared test was carried out to analyze for an association between the drug addicts and control group. Odds ratios and its 95% confidence intervals (CI) were also calculated to estimate risk effects for heterozygous and homozygous marker alleles.
Hardy-Weinberg equilibrium (HWE) of each SNP in control and drug dependents was also examined using a Fisher‘s exact test, all as implemented on the Golden Helix SVS software suite 7 (Golden Helix, Bozeman, MT). Homozygous wild type genotype for all the loci was taken as a reference while heterozygous and homozygous mutant genotypes are pooled for SNP-SNP interaction study. The interactions were used to study the risk of addiction using the SPSS statistical package version 22. SNP-SNP interactions were investigated assuming multiplicative interactive effect on the logit scale, p-values less than 0.05 were considered significant.
2.2 Demographic Studies
2.2.1 Location of study
The study was conducted at the Drug Rehabilitation Centre Kelantan, Hospital
Universiti Sains Malaysia, Kubang Kerian, Kelantan and Hospital Kepala Batas, Penang.
2.2.2 Subject recruitments
There were 459 male drug addicts who were long - term drug addicts and 543 healthy volunteers (male) subjects in the study. The demographic profiles, as well as the drug abuse patterns of the addicts, were gathered through a questionnaire (Appendix B).
All study subjects were interviewed extensively with respect to drug abuse individuals
54 with psychiatric disorders was excluded. Information about the family background with regards to the family origin and ethnic background were also collected.
2.2.3 Inclusion Criteria
Volunteers met all the following criteria:
Age 18 – 65 years.
Able to give information on ethnic history up to three (3)
generations.
Written consent given after reading the information leaflet.
Participation must be voluntary.
Addicts met all the following criteria:
Age 18 – 65 years.
Able to give information of ethnic history up to 3 generations
Drug Addicts.
Written consent given after reading the information leaflet.
Participation must be voluntary.
2.2.4 Exclusion Criteria
Volunteers
Aged less than 18 and more than 65 years old.
Refusal Consent.
Not able to understand study protocol and to follow simple instructions.
55 Clinically significant physical signs (High Blood Pressure)
Not able to give information about history up to 3 generations.
Presence of acute or chronic secondary infection.
Addicts
Aged less than 18 and more than 65 years old.
Refusal Consent.
Not able to understand study protocol and to follow simple instructions.
Clinically significant physical signs (High Blood Pressure)
Not able to give information on ethnic history up to 3 generations.
2.3 Registration
2.3.1 Registration
A total of 1002 subjects who passes the eligibility criteria and given informed consent (Appendix C) were recruited for the study. A total of 459 drug addicts and 543 control subjects were recruited based on the sample calculation with 95% confidence level with margin of error 5%. The reported Malay population size was 21,149,100 people in 2013 with the ideal sample size of 385 subjects.
All volunteers were registered before entering the study. They were assigned a study number from 0001 – 1003 individually.
56 2.4 Study Schedules
2.4.1 Collection of whole blood for genetic studies
About five (5) ml of whole blood samples were drawn from the subjects by clinician via vacutainer system directly into heparinized tubes for further processing.
Immediately after collection of blood, the samples were transferred into labelled plastic cryotubes and kept at – 20º C.
2.4.2 Monitoring of studies
Independent monitors were assigned to inspect all case report forms, all medical records, and laboratory work sheets and to assess the status of drug storage, and their dispensing and retrieval throughout the study. The inspection was for the purpose of verifying adherence to the approved protocols by Human Research Ethics Committee
Universiti Sains Malaysia (USMKK/PPP/JePem(249-3(190)
2.5 Ethical and legal consideration
This clinical study was conducted in accordance with the principles laid down by the World Health Assembly of 1975 on Ethics in Human Experimentation and those as stipulated by the Helsinki Declaration. The study also adhered to standards established for Good Clinical Practices (GCP). The protocol used in this study was approved by the
Human Research Ethics Committee Universiti Sains Malaysia
(USMKK/PPP/JePem(249-3(190). The subject was informed that it is his/her liberty to abstain from participation in the study and that he/she is free to withdraw the consent of participation at any time. After the initial screening procedures, a code number was recorded to identify the volunteers.
57 2.6 PCR Genotyping (DNA Extraction)
2.6.1 Equipment & Materials
Materials and equipments used for the DNA extraction method is listed in the Table 2.1.
Table 2.1: Materials and equipment of DNA extraction Material/Equipment Type QIAamp Mini Spin Columns Qiagen QIAamp DNA kit Collection Tubes Qiagen QIAamp DNA kit Buffer AL Qiagen QIAamp DNA kit Buffer AW1 Qiagen QIAamp DNA kit Buffer AW2 Qiagen QIAamp DNA kit Buffer AE Qiagen QIAamp DNA kit QIAGEN® Protease Qiagen QIAamp DNA kit Protease Solvent Qiagen QIAamp DNA kit Ethanol (96–100%) 1.5 ml microcentrifuge tubes Pipette tips with aerosol barrier Microcentrifuge Rotor for 2 ml tubes Vortexer Water bath or heating block at 56°C
2.6.2 DNA purification procedure
About 200 μl whole blood was added to 200 μl Buffer AL and 20 μl QIAGEN
Proteinase K solution in a sterile 1.5 ml microcentrifuge tube. The mixture was then vortexed and incubated for 10 minutes at 56°C. The 1.5 ml microcentrifuge tubes were then pulse centrifuged briefly to remove condensation from the lid. About 200 μl 98% of ethanol was added followed by vortexing to thoroughly mix. The 1.5 ml microcentrifuge tubes were again pulse centrifuged to remove residual liquid from the lid. The entire mixture (620 μl) was then transferred into a QIAamp Spin Column and was centrifuged at 8000 rpm for 1 minute. The QIAamp Spin Column was then transferred into a clean
2ml collection tube and the used collection tube containing the filtrate was discarded.
Buffer AW1 (500 μl) was added to the QIAamp Spin Column, followed by
58 centrifugation at 8,000 rpm for 1 minute. The QIAamp Spin Column was again transferred to a clean 2ml collection and the filtrate was again discarded. About 500 μl
Buffer AW2 was added to the QIAamp Spin Column followed by centrifugation at
14,000 rpm for 3minutes. The used collection tube containing the filtrate was again discarded and the QIAamp Spin Column was transferred into a sterile, labelled 1.5 ml microcentrifuge tube. About 200 μl Buffer AE was transferred directly to the silica membrane of the QIAamp Spin Column, this was incubated at room temperature for 5 minutes before elution of DNA by centrifugation at 8,000 rpm for 1 minute. The second elution step with the 200 μl Buffer AE increased yields by up to 15%. The DNA was stored at – 20 º C before use.
2.7 Estimation of DNA quantity and purity (NANODROP)
Nanodrop spectrophotometer was used to measure DNA concentration. Thus, the
260/280 ratio was used to define the purity of DNA and RNA, highly purified DNA result was in values of 1.8 to 2.0. The presence of protein or other contaminants in the samples will result in a lower ratio (Glasel, 1995).
2.8 TaqMan SNP Genotyping Assay
SNPs have emerged as genetic markers of choice because of their high-density and relatively even distribution in the human genomes. They have been used by many groups for fine mapping disease loci and for candidate gene association studies
(Kruglyak, 1999, Sachidanandam et al., 2001). The summary table of Taqman
(Thermofisher Waltham Massachusetts United States) SNPs is listed in Table 2.2
59 Table 2.2: Summary table of SNP TaqMan Chromosome SNP Assay ID Gene Amino Acid Change Polymorphism Location
G/T, Transversion rs1042114 C___8861910_30 OPRD1 Chr.1: 28812463 Cys27Phe Substitution
C/T, Transition rs702764 C___7480505_10 OPRK1 Chr.8: 53229597 Ala281Ala Substitution A/G, Transition rs910080 C___2507541_1 PDYN Chr.20: 1979580 No Change Substitution
Chr.20: 22404679 A/G, Transition rs199774 C____610890_10 PDYN No Change Substitution
C/T, Transition rs1022513 C___2507533_10 PDYN Chr.20: 1973693 No Change Substitution C/T, Transition rs737866 C___2255419_10 COMT Chr.22: 19942586 No Change Substitution Chr.11: 636784 C/T, Transition rs1800955 C___7470700_30 DRD4 No Change 636784 Substitution A/G, Transition rs1128503 C___7586657_20 ABCB1 Chr.7: 87509329 Ile1145Ile Substitution A/G, Transition rs1045642 C___7586662_10 ABCB1 Chr.7: 87550285 Gly412Gly Substitution
60 Table 2.2: Continued C/A, Transversion rs2032502 C_11711720C_30 ABCB1 Chr.7: 87531302 No Change Substitution C/T, Transition C_11711720D_40 ABCB1 Chr.7: 87531302 Ser893Thr Substitution A/G, Transition rs10494334 C__30084696_20 None Chr.1: 163535374 No Change Substitution
A/G, Transition rs950302 C___2017214_10 DUSP Chr.1: 167114567 No Change Substitution
61 2.8.1 STEP ONE PLUS
The StepOnePlus systemuse the fluorescent-based polymerase chain reaction
(PCR)(Biosystem., 2010).
2.8.2 SNP Genotyping Assay
The assay was stored in the dark, because excessive exposure to the light may affect the fluorescent probes. The assay was sub aliquoted to minimize the freeze thaw cycle. The 40✕assay was diluted to a 20X working stock with 1X TE buffer for the best stability and it will be stable up to a year. The aliquots were stored -15 °C to -25 °C.
Note: The 1✕TE buffer should be 10 mM Tris-HCl, 1 mM EDTA, pH 8.0, and made using DNase-free, sterile-filtered water.
2.8.3 DNA preparation
DNA was diluted with DNase-free water to deliver a final DNA mass in the range of 1 to 20 ng per well. The volume of DNA sample and DNAase free water per reaction was 11.25 µl for 96 well reactions.
2.8.4 Preparation of reaction mix
The number of reactions calculated for each assay including to NTCs (No template Control) on each plate. Extra reactions included to compensate for the volumes loss during pipetting as indicated in Table 2.3.
62 Table 2.3 Preparation of reaction mix Component µl/well (96 well plate)
DNA 2 µl (20 ng)
TaqMan Universal PCR master mix (2X) 5 µl
20X working stock SNP genotyping assay 0.5 µl
DNAase Free 2.5 µl
Total Volume 10 µl
The bottle of TaqMan Universal PCR master mix was gently swirled. The 20X
SNP Genotyping Assay was vortexed and centrifuged briefly. SNP Genotyping assay sequence listed below in Table 2.4.
63 Table 2.4 List of genotyping assay sequence SNP ID Gene Context Sequence (VIC/FAM) rs1042114 OPRD1 5‘GCCTCGGACGCCTACCCTAGCGCCT[G/T]CCCCAG CGCTGGCGCCAATGCGTCG3‘ rs702764 OPRK1 5‘TGGGAGTCCAGCAGACGACGAAGAC[C/T]GCCACC ACCACCAGGACCAGTCTGG3‘ rs910080 PDYN 5‘TTTTCACTCCCTTCTGTAAGGAGTT[A/G]GGCACTG TCCAGGGTACCAACATGA3‘ rs199774 PDYN 5‘ACCCACAAATCTTGAAGCCTCCTCT[A/G]TTGTGAG TGGAGGTTGCAATACCTT3‘ rs1022563 PDYN 5‘CATCCACCACTACCACTGGCAGTGT[C/T]TGAGAG TCCTGATGCCTGTGGCTGT3‘ rs737866 COMT 5‘GCTAACAGACCTGCTTTTTGGATTT[C/T]TCCAGCC AGGGATTTTTGTGTCCTG3‘ rs1800955 DRD4 5‘GGGCAGGGGGAGCGGGCGTGGAGGG[C/T]GCGCA CGAGGTCGAGGCGAGTCCGC3‘ rs1045642 ABCB1 5‘TGTTGGCCTCCTTTGCTGCCCTCAC[A/G]ATCTCTT CCTGTGACACCACCCGGC3‘ rs1128503 ABCB1 5‘GCCCACTCTGCACCTTCAGGTTCAG[A/G]CCCTTCA AGATCTACCAGGACGAGT3‘ rs2032582 ABCB1 TATTTAGTTTGACTCACCTTCCCAG[C/A]ACCTTCTA GTTCTTTCTTATCTTTC3‘ rs2032582 ABCB1 5‘TATTTAGTTTGACTCACCTTCCCAG[C/T]ACCTTCT AGTTCTTTCTTATCTTTC3‘ rs10494334 None 5‘TTAGTAGACTTGAATTATAGATGCC[A/G]CAACTCT CATTCATGTGCATTTCTG3‘ rs950302 DUSP 5‘TCCTTGGTCTTTCATTATTAGAATC[A/G]CATGCTA CTCTTTGTCCATTCTAAC3‘
64 The required amount of 20X SNP genotyping assay was pipetted into a sterile microcentrifuge tube. The tube was capped and inverted several times to mix. The tube was centrifuged briefly to spin down the contents and to eliminate any air bubbles from the reaction mix. A total of 13.75 µl of the reaction mix was added to 11.25 µl DNA. It was done carefully to avoid cross contamination between well to well during the pipetting process. The entire well was inspected for uniformity of volume and then the plate was sealed with a proper cover. The mix was vortexed well and centrifuged briefly to spin down the contents and to eliminate any air bubbles.
2.8.5 PCR reaction
Thermal Cycling conditions are stated in table 2.5.
Table 2.5 Thermal Cycling Conditions Standard Protocol PCR (40 Cycles) Hold Denature Anneal/Extend 10 min at 95 ºC 15 Sec at 92 ºC 1 min at 60 ºC
2.8.6 Allelic discrimination TaqMan assay
An Allelic Discrimination (AD) assay consists of multiplexed primer or probe for each reaction which allows genotyping of two possible variants at the single nucleic polymorphisms in the target template sequence. The Allelic Discrimination assay will have homozygotes samples with only allele 1 or allele 2 or the heterozygotes samples with both allele 1 and allele 2. The AD assay measures the change in fluorescence of the dyes associated with the probes (Livak et al., 1995).
65 The SDS software is linked to allelic fluorescence detection system, which plots the results of the allelic discrimination run on a scatter plot of Allele X versus Allele Y, and each well of the 96-well reaction plate is represented with an (Undetermined) on the plot. The clustering of points can vary along the horizontal axis (Allele X) represent homozygous allele XX, vertical axis (Allele Y) represent homozygous allele YY, or diagonal (Allele X/Allele Y) represent heterozygous XY. This variation is due to differences in the extent of reporter dye fluorescent intensity after PCR amplification.
The Figure 2.1 below shows variation in clustering due to the genotype of the target allele. The homozygous allele 1 is clustered in red will be labelled with VIC dye and homozygous allele 2 is clustered in blue will be labelled with FAM dye. The heterozygous will appear midway of allele 1 and allele 2 clusters will be in green.
Undetermined will be anywhere outside the region.
66
Figure 2.1: Variation in clustering graph
2.9 Statistical Analysis
2.9.1 General
Statistical analysis was performed using SNP and Variation Suite program package by the Golden Helix (Bozeman MT USA) to identify the distribution of allele and genotype frequencies, Fisher's exact test, odds ratios, and to check Hardy Weinberg equilibrium. SNP – SNP interactions were also analysed in this study.
2.9.2 Hardy Weinberg
Hardy-Weinberg testing was conducted in the drug dependents and controls p- values were estimated based on observed genotype frequency. SNPs with genotypes that
67 deviate significantly from Hardy-Weinberg with HWE test values of P<0.05 were omitted from association in control group.
2.9.3 Linkage Disequilibrium (LD)
In this study, LD association was analysed between SNPs in PDYN gene and
ABCB1 genes only. The analysis of LD blocks and haplotype was done combining drug addicts and control using Haploview V4.1
2.9.4 SNP – SNP interaction
In SNP–SNP interaction studies, homozygous wild type in both genes was taken as reference group while the heterozygous and homozygous mutant genotypes are pooled. A multiplicative interaction was performed and all the possible interactions were used to find out the risk of addiction employing the SPSS statistical package. The significance level was set at P<0.05.
2.10 Database development
This database is devoted to the collection of mutations in the genes for the local
Malaysian sub-populations and international pharmacogenomics research communities.
The database was a part of the project established under the aegis of the Advance
Medical and Dental Institute (AMDI) in close collaboration with Pharmacogenomics
Research Cluster of the Institute for Research in Molecular Medicine (INFORMM).
Currently, the database has genotypes and haplotypes data for at least 16 different genes. Their genotypes and related information were accumulation of data
68 gathered from the main project that was fully funded by the Universiti Sains Malaysia under Research University Grant Scheme Cluster . Alleles and haplotype details for each gene could be viewed separately through the selectable gene names.
The haplotype nomenclatures used in the website for CYP 450 genes are sourced from the naming convention used by the CYP nomenclature group. Haplotype designations for other genes are from various published work harmonized in the literature. Haplotypes were computationally deduced using various algorithms from genotypic data.
PHP (PHP: hypertext Preprocessor) as a server side scripting language that is embedded in HTML (Hypertext Markup Language) used to create webpages with
MySQL as a database solution. The pharmacogenetic database was developed using advanced techniques such as jQuery, PHP scripting language, MySQL database package and Twitter Bootstrap for responsive web-based database system. It is freely accessible to public MySQL - the de-facto standard database system for growing data needs that will run on a protected server. The backend data in MySQL database are stored in categories formatted as tables depicting genes studied, population types, loci and their alleles, genotypes and haplotypes as shown in the Figure 2.2. To reduce redundancy and easy access to tabulated data, sequence variant data are stored in separate tables for each gene.
69
Figure 2.2: Structure of database
70 CHAPTER 3: RESULTS
3.1 Demographic Background
Table 3.1 shows that 56.7% of the respondents in drug addicts and 74% in control group were aged between 18 – 40 years while the remaining were between 41 years and above. Majority (52.6%) of the respondents were between 31 -40 age groups in drug addicts whereas the majority in the control group (46.0%) were between 18-30 years. The study sought to find out the link between age and their drug abuse and it was revealed that a reduction in the risk of drug abuse with the increase of age. The proportions (X2=70.46, df= 2, p<0.05), indicate that there was a significant statistical difference between drug abuse and age. This implies that there was a relationship between age and drug abuse amongst drug addicts.
Table 3.1: Age group of addicts and controls. X2 Age Drug Addicts Control statistics Frequency Percentage (%) Frequency Percentage (%)
18-30 19 4.1 250 46.0 X2=70.46 31-40 241 52.6 180 34.0 df=2 41-50 174 37.9 78 14.0 51-65 25 5.4 35 6.0 p<0.05 Total 459 100 543 100
Table 3.2 and Table 3.3 illustrate the educational background and occupation of the respondents both the drug addicts and control group. About 90% of subjects from drug addicts possessed secondary qualification while 73% of control group graduated from college or University. Majority of the drug addicts were labourer or unemployed about 65.8%. Cross tabulation was done between education and occupation status among
71 drug addicts in Table 3.4. It shows that there was a significant association between education and job status (X2 = 57.88, df= 6, p<0.05).
Table 3.2: Educational background of addicts and controls Education Drug Addicts Control Frequency Percentage % Frequency Percentage %
Primary 39 8.5 2 0.3 Secondary 417 90.9 117 21.5 College 1 0.2 296 54.5 University 2 0.4 128 23.6 Total 459 100 543 100 Table 3.3: Occupation status of addicts and control Occupation Drug Addicts Control Status Frequency Percentage % Frequency Percentage %
Professional - - 10 1.8 Non Professional 157 34.2 383 70.5 Labourer 245 54.4 142 26.2 Un employed 57 12.4 8 1.5 Total 459 100 543 100
Table 3.4: Cross Tabulation between occupation status and education X2 Occupation Primary Secondary College University Total statistical analysis Non 6 149 1 1 157 Professional X2= 57.88 Laborer 14 231 0 0 245 df=6 Unemployed 19 37 0 1 57 p<0.05 Total 39 417 1 2 459
The smoking habit of the respondents was also studied in this survey. Table 3.5 presents the data of addicts and control group who smokes. Table 3.6 shows the duration of smoking. Chi Square analysis also was done to study the significant association of smoking habit between control and drug addicts study, and the results showed that there
72 was a significant association between drug addicts and control group (X2 = 362.7, p<0.05). Cross tabulation analysis was done between smoking habit and duration among drug addicts, it shows that there was no significant association between smoking habit and duration (X2 = 31.44, df= 6, p>0.05).
Table 3.5 Smoking habits of addict and control group X2 Drug Addicts Control statistical Smoking Frequency Percentage Frequency Percentage analysis Never 3 0.7 308 56.7 2 Before 4 0.9 80 14.8 X = 362.7 Current 452 98.4 155 28.5 p<0.005 Total 459 100 543 100
Table 3.6: Smoking duration of addicts and control group Drug Addicts Control Age Frequency Percentage Frequency Percentage None - - 309 57 1-5 45 9.8 52 9.6 6-15 239 52.1 146 26.8 15- 25 138 30.1 31 5.7 >26 37 8.1 5 0.92 Total 459 98.7 543 100
Table 3.7 outlines the cross tabulation between smoking habit and age group.
Although it shows that smoking habit is prevalent among the age group of 31-40 years old and it had increased gradually from teenage to adult, there was no significant association between the age group and smoking habit (X2= 5.91, df=6, p>0.05).
73 Table: 3.7 Smoking and Age cross tabulation Age X2 Smoking Total statistical Habit 18-30 31-40 41-50 51-65 analysis Never 0 3 0 0 3 X2=5.91 Before 0 2 1 1 4 df=6 Current 19 236 173 24 452 p>0.05 Total 19 241 174 25 459
As shown in Table 3.8, the data clearly shows that the percentage of drinking habit is higher among drug addicts with 22.7% compared to control group (2.4%), there was no significant association reported (X2=498.87,df=2, p>0.05).
Table 3.8: Drinking habit among drug addicts Drug Addicts Control Drinking Habit Frequency Percentage Frequency Percentage Never 355 77.3 530 97.6 Before 98 21.4 12 2.2 Current 5 1.3 1 0.2 Total 459 100 543 100
About 100% of the addicts have a family member who is also smokers, whereas only 60.4% of control group have a family member who smokes (Table 3.9).
Table 3.9: Family member who smokes Drug Addicts Control Smoking family Percentage Percentage member Frequency Frequency (%) (%) No One Smokes 215 39.6 Father 293 63.8 184 33.9 Mother 1 0.2 1 0.2 Brother 86 18.7 79 14.5 brother/father 79 17.3 64 11.8 Total 459 100 543 100
74 Table 3.10 presents the cross tabulation of smoking habit and family members, who smoke among drug addicts, the data showed that current smokers have got siblings or father who has got the smoking habit, however no significant association was reported
(X2= 4.02, df=3, p>0.05).
Table 3.10: Cross tabulation of smoking habit and family member Smoker X2 Frequency Total statistical father mother brother brother/father analysis Never 3 0 0 0 3 X2=4.02 Before 4 0 0 0 4 df=6 Current 286 1 86 79 452 p>0.05 Total 293 1 86 79 459
3.2 PCR Results
3.2.1 Real Time PCR amplification
The obtained individual genotype results for all the 12 polymorphisms for 543 controls and 459 opiate addicts are shown in (Appendix D and E). Figure 3.1 shows an example of allelic discrimination plot of OPRK1 SNP and Figure 3.2 shows the amplification graph for allele C and Figure 3.3 for allele T. The homozygous allele C is clustered in red and homozygous allele T is clustered in blue. The heterozygous will be in green which will have allele C and T. The amplification graph of homozygous CC and homozygous TT shown in the figure 3.2 and 3.3.
75 Fig
Figure 3.1: Allelic Discrimination Plot
76
Figure 3.2: Amplification graph for homozygous CC
Figure 3.3: Amplification graph for homozygous TT
3.2.2 Quality control
All genotyped SNPs were checked for Hardy Weinberg Equilibrium and medallion errors, due to the complexity of the genotyping process, some statistical quality analyses. Table 3.11 and Table 3.12 show the HWE for the drug dependents and control. Control steps required to ensure that genotyping quality is adequate for statistical.
77 Table 3.11: Hardy Weinberg Equilibrium Case Study p Gene Variant Genotype Observed Expected X2 Value TT 416 398.2 169.68 0.000 OPRD1 rs1042114 TG 23 58.7 GG 20 2.2 TT 416 415.1 0.8067 0.369 OPRK1 rs702764 CT 41 42.8 CC 2 1.1 GG 327 322.9 1.9732 0.160 PDYN rs910080 AG 116 124.1 AA 16 11.9 AA 120 122.9 0.2917 0.589 PDYN rs199774 AG 235 229.2 GG 104 106.9 TT 313 309.6 0.286 1.136 PDYN rs1022563 CT 128 134.7 CC 18 14.6 GG 382 384.3 1.929 0.164 rs10494334 AG 76 71.4
AA 1 3.3 TT 254 251.9 0.272 0.601 COMT rs737866 CT 172 176.3 TT 33 30.9 TT 195 177.6 11.950 0.0005 DRD4 rs1800955 CT 181 215.8 CC 83 65.6 AA 146 147.8 0.122 0.725 ABCB1 rs1128503 AG 229 225.3 GG 84 85.8 GG 175 173.3 0.118 0.730 ABCB1 rs1045642 AG 214 217.5 AA 70 68.3 ABCB1 rs2032582 CC 142 143.4 0.084 0.771 AC+AT 198 195.2 AA 65 66.4 ABCB1 rs2032582 CC 142 145.0 1.524 0.216 TC+AT 58 72.1 TT 6 9 GG 202 199.4 0.300 0.583 DUSP rs950302 AG 201 206.3 AA 56 53.4
78 Table 3.12: Hardy Weinberg Equilibrium for Control Study Gene Variant Genotype Observed Expected X2 p Value OPRD1 rs1042114 TT 520 506.2 172.31 0.000 TG 22 49.6 GG 15 1.2 OPRK1 rs702764 TT 485 483.7 1.085 0.297 CT 55 57.6 CC 3 1.7 PDYN rs910080 GG 421 416.4 3.3 0.069 AG 109 118.2 AA 13 8.4 PDYN rs199774 AA 131 130.8 0.001 0.972 AG 271 271.4 GG 141 140.8 PDYN rs1022563 TT 370 368.8 0.127 0.721 CT 155 157.4 CC 18 16.8 rs10494334 GG 454 454.9 0.246 0.610 Unidentified AG 86 84.2 AA 3 3.9 COMT rs737866 TT 293 285.2 2.84 0.091 CT 201 216.7 CC 49 41.2 DRD4 rs1800955 TT 251 241.3 3.484 0.061 CT 222 241.3 CC 70 60.3 ABCB1 rs1128503 AA 210 212.9 0.280 0.596 AG 260 254.2 GG 73 75.9 ABCB1 rs1045642 GG 153 157.6 0.620 0.430 AG 279 269.9 AA 111 115.6 ABCB1 rs2032582 CC 162 156.9 0.872 0.350 AC+AT 235 245.3 AA 101 95.9 ABCB1 rs2032582 CC 162 160.2 0.885 0.346 TC+AT 54 57.6 TT 7 5.2 DUSP27 rs950302 GG 229 230.1 0.045 0.830 AG 249 246.7 AA 65 66.1
79 3.2.3 Genotype Frequency
The drug dependent and control groups were compared for genotype frequency and (Table 3.13) shows genotype frequency between drug addicts and control groups.
Table 3.13: Genotype frequency between drug addict and control groups. Gene Genotype Drug Addicts (%) Control TT 416 (91.0) 520(95.8) OPRD1(rs1042114) TG 23 (5.0) 22 (4.1) GG 20 (4.0) 1 (0.2) TT 416(90.6) 485(89.3) OPRK1(rs702764) CT 41 (8.9) 55 (10.1) CC 2 (0.4) 3 (0.6) GG 327(71.2) 421(77.5) PDYN rs910080 AG 116(25.3) 109(20.1) AA 16(3.5) 13(2.4) AA 120 (26.1) 131(24.1) PDYN rs199774 AG 235(51.2) 271(49.9) GG 104(22.7) 141(26.0) TT 313(68.2) 370(68.1) PDYN3 rs1022563 CT 128(27.9) 155(28.5) CC 18(3.9) 18(3.3) GG 382(83.2) 454(83.6) rs10494334 AG 76(16.6) 86(15.8) AA 1(0.2) 3(0.6) TT 254(55.3) 293(54.0) COMT rs737866 CT 172(37.5) 201(37.0) CC 33(7.2) 49(9.0) TT 195(42.5) 251(46.2) DRD4 rs1800955 CT 181(39.4) 222(40.9) CC 83(18.1) 70(12.9) AA 146(31.8) 210(38.7) ABCB1 rs1128503 AG 229(49.9) 260(47.9)
GG 84(18.3) 73(13.4)
80 Table 3.13: Continued GG 175(38.1) 153(28.2) ABCB1 rs1045642 AG 214(46.6) 279(51.4)
AA 70(15.3) 111(20.4)
AA 65 (14.1) 101 (18.7) AC 168 (36.6) 216(40.0) ABCB1 rs2032582 AT 30 (6.5) 19(3.5) CC 142 (30.9) 162(36.0) CT 48 (10.4) 35(7.7) TT 6 (1.30) 7(1.3)
GG 202(44) 229(42.2) DUSP27 rs950302 AG 201(43.8) 249(45.9)
AA 56(12.2) 65(12)
The percentage of genotype frequency of OPRD1 gene (rs1042114) showed a higher percentage in drug dependence group of GG genotype compared to the control group (4% versus 0.2%). There was only 1% difference between homozygous wild, heterozygous and homozygous mutant in OPRK1 gene between control and the addict group.
Homozygous mutant AA of PDYN rs9100800 was 3.5% in the drug dependent group and 2.4% in the control group. Homozygous wild was 71.2% in the drug dependence group and as predicted it was 6% higher in the control group. PDYN rs199774 homozygous mutant AA is 2% higher among addicts group compared to control, which was 24%, as expected percentage of wild type homozygous GG was higher in the control group (22.7% versus 26%). There is no difference in the percentage between the drug dependence and the control group for PDYN rs1022563 and for rs10494334 the percentage was quite similar between genotypes.
81 The rs737866 showed homozygous CC (7.2% versus 9%) between drug dependence and the control group. There was only 1%-2% difference between both groups for heterozygous and homozygous wild.
The variant rs1800955, homozygous CC was higher in addict group compared to the control group; it was 18.1% in drug dependence and only 12.9% in control, there was
1% - 5% difference between the homozygous wild TT and the heterozygous CT between both groups.
The polymorphisms rs1128503, rs1045642 and rs2032582 were studied, homozygous GG in rs1128503 was higher in the drug dependence group compared to control (18.3% versus 13.4%). The study also reported that the frequency for homozygous AA was also higher in drug dependence group compared to control. The variant rs1045642 also showed a higher frequency of homozygous wild GG, it was higher with a difference of 10% among addicts (38%) compared to only 28% in controls.
The homozygous mutant AA was higher among the control group (20.4%) compared to addict group which was only 15.3%. There was no significant difference among the genotypes for rs2032582.
The polymorphism rs950302 of DUSP27 only showed 1% - 2% difference in the genotype frequency between both groups.
82 3.2.4 Allele frequency
Allele frequency distributions of the studied genes are presented in Table 3.14.
All the allele frequencies of the SNPs were compared with minor allele frequency reported in PubMed and HapMap project. The comparison table is shown in Table 3.15.
Table 3.14: Allele frequency among the drug addict and the control group. SNP Allele Drug Addicts (%) Control (%) T 855 (93.1) 1062 (97.8) OPRD1 rs1042114) G 63 (6.86) 24 (2.2) T 877 (95.1) 1025 (94.4) OPRK1 rs702764) C 45 (4.9) 61 (5.6) G 770 (83.9) 135 (12.4) PDYN rs910080 A 148 (16.1) 951 (87.6) A 475 (51.7) 533 (49.1) PDYN rs199774 G 443 (48.3) 553 (50.9) T 754 (82.2) 895 (82.4) PDYN rs1022563 C 164 (17.8) 191 (17.6) G 840 (91.5) 994 (91.5) rs10494334 A 78 (8.5) 92 (8.5) T 680 (74.1) 787 (72.0) COMT rs737866 C 238 (25.9) 299 (28.0) T 571(62.2) 724 (66.7) DRD4 rs1800955 C 347(37.8) 362 (33.3) A 354 (38.5) 501(46.1) ABCB1 rs1128503 G 564 (61.5) 585(53.9) G 564 (61.5) 585(53.9) ABCB1 rs1045642 A 354 (38.5) 501(46.1) C 500 (54.5) 575(53.2) ABCB1 rs2032582 A 328 (35.7) 437(40.5) T 90 (9.8) 68 (6.3) G 605 (65.6) 707 (65.1) DUSP rs95030 A 313 (34.1) 379 (34.9)
83
OPRD1 rs1042114, Minor Allele Frequency (MAF) G is 6.86% in drug dependence and 2.2% among the control group. It was reported in Pubmed that allele A is the ancestral allele and G as the minor allele. G allele frequency varies substantially among populations, this non synonymous allele in HapMap populations showed similar results. The minor allele C frequency in OPRK1 rs702764 was higher in control group
5.6% compared to addicts 4.9%. The T allele was reported to be the minor allele and the
HapMap project showed similar results for almost all populations
The minor allele for the rs910080 SNP from PDYN gene is A allele, the allele frequency for drug dependence study was 16.1% and 12.4%. MAF was slightly higher among addicts. The MAF for rs199774 of PDYN gene is A, Another SNP from the same gene rs1022563 reported minor allele is C; both groups allele frequency is similar,
17.8% in drug dependence and 17.6% in control. SNP rs10494334 in this study has got allele A as the minor allele with the frequency of 8.5% both in the addicts and the control groups.
In this study, reported minor allele for rs737866 is C, with the allele frequency of
(25% versus 27%) for the drug addicts and the control group, the minor allele frequency for these both groups similar to the other reported minor allele frequency in the HapMap project. The reported minor allele for SNP rs1800955 is C in this study, the frequency for C allele among drug addicts is 37.8%, and it is lower in control group with 33.3%.
In total 3 SNPs were studied from ABCB1 gene, allele G is reported minor allele for rs1128503 which was reported higher among drug addicts compared to control group
84 (61.5% Vs 53.9 %). Minor allele is A for SNP rs1045642, however exceptionally the minor allele was higher in the control group (46.1%) and only (38.5%) among addicts.
Triallelic SNP rs2032582 was also studied, the minor allele for this SNP is A/T, the A allele was higher in control group and in the other hand T allele was higher in the drug addict group which is 9.8% compared to control group which was only 6.3%. The minor allele for rs950302 was A, both the drug addicts and the control group allele frequencies were 34%. The HapMap project also reported similar allele frequency among other population.
85 Table 3.15: Hapmap project allele frequency (Adapted from HapMap project from Pubmed) rs1049433 rs112850 DbSNP rs1042114 rs702764 rs910080 rs197794 rs1022563 rs737866 rs1800955 rs1045642 rs2032582 rs950302 4 3 Gene OPRD1 OPRK1 PDYN PDYN PDYN None COMT DRD4 ABCB1 ABCB1 ABCB1 DUSP Pubmed Allele G/T C/T A/G C/T C/T C/G A/G C/T C/T C/T A/G/T C/T Alleles G/T C/T A/G A/G C/T A/G T/C C/T A/G A/G T/C/A A/G Ancestral T C G T C C A C C C G T MAF G C A A C A C C G A A/T A OD 0.06 0.04 0.16 0.51 0.17 0.08 0.25 0.37 0.43 0.38 0.35 0.34 MAF Control 0.02 0.05 0.12 0.49 0.17 0.08 0.28 0.33 0.37 0.46 0.4 0.34 CEU 0.11 0.16 0.73 0.16 0.89 0.08 0.32 None 0.54 0.57 0.46 0.54 HCB None 0.14 0.12 0.63 0.13 0.02 0.33 None 0.29 0.41 0.61 0.31 JPT None 0.06 0.24 0.73 0.31 0.01 0.33 None 0.41 0.45 0.55 0.23 YRI 0.02 0.06 0.51 0.7 0.85 0.21 0.11 None 0.87 0.11 None 0.49 ASW MAF (Hap 0.05 0.63 0.5 0.59 None 0.22 0.13 None 0.26 0.18 0.07 0.45 Map) CHB None 0.51 0.11 0.75 None 0.03 0.26 None 0.29 0.38 0.56 0.24 CHD None 0.07 0.1 0.72 None 0.05 0.27 None 0.31 0.36 0.51 0.22 GIH 0.05 0.04 0.45 0.39 None 0.1 0.25 None 0.4 0.59 0.65 0.59 LWK 0.02 0.06 0.51 0.63 None 0.23 0.13 None 0.43 None 0.01 0.56 MEX 0.04 0.51 0.67 0.31 None 0.14 0.17 None 0.44 0.4 0.43 0.56 Legend
MAF: Minor allele frequency CHB: Han Chinese Beijing CEU: Utah residents‘ European ancestry CHD: Chinese Denver USA HCB: Han Chinese Beijing GIH: Gujarati in Houstan JPT: Japanese in Tokyo LWK: Luhya Webuye Kenya YRI: Yoruba Nigeria Mex: Mexico ancestry Los Angeles ASW: African ancestry USA
86 3.2.5 Allele and Genotype Association Study
The Table 3.16 and Table 3.17 show the genotype association with drug dependence, the SNP rs1042114 showed significant association with drug dependence with genotype GG (p=0.0017), with an OR of 25(3.341-187.05). Combination of heterozygous and homozygous genotype (TG + GG) also showed a significant association with p= 0.0015 with an OR of 2.33(1.385-3.940). Allele frequency also showed a significant association between addicts and control (p=0.0001), with OR of
3.260 (95% Cl, 2.0202-5.2624). No significant associations were observed for rs702764
OPRK1 gene at allelic and genotype level.
The rs910080, rs199774 and rs1022563 were studied for association with drug dependence. Heterozygous genotype AG and genotype AG + AA of rs910080 showed a significant association with OR 1.370(95% Cl, 1.016-1.847) (p=0.0388) and OR
1.393(95% Cl, 1.047- 1.853) with p<0.05. However, genotype AA did not show any significant association with drug dependence. There was also no significant allelic association between drug addicts and drug dependence. Both genotype AG and GG of rs199774 were not associated with drug dependence, similar results with allelic association study for rs1022563 shows no significant association at allelic and genotype level.
Genotype AG and AA showed no significant association with drug dependence for SNP rs10494334. Similar results were recorded for association study for the genotype of AG+AA. Allelic association between drug addicts and drug dependence showed no significant association (p=0.9839) with OR 1.003 (95%Cl 0.7319-1.3752). 87
The variant rs1800955 showed a significant association with homozygous mutant
CC (p=0.0088) with OR 1.367 (95%Cl 0.9545-1.9599). However, there were no significant association with combination genotype of heterozygous CT and the risk genotype CC with (p=0.8093). However, allele frequency C showed significant association with drug dependence (p=0.0373) with OR 1.215 (95%Cl, 1.011-1.460).
In total 3 SNPs were studied from ABCB1 gene, rs1128503 genotype GG and
AG + GG showed a significant association with drug dependence (p=0.0090) and
(p=0.0001). The OR for genotype GG was 1.655 (95% Cl 1.1340-2.4156) and the odd ratio for genotype (AG+GG) was 0.454 (95% Cl 0.3554 – 0.5819). The G allele strongly associated with drug dependence with p=0.0077; OR 1.276 (1.067-1.527).
The rs1045642 polymorphism was also associated with drug dependence with genotype and allelic level. Genotype AG had p-value 0.0053, with an OR 0.670(0.506-
0.887) and genotype AA had a p-value 0.0016 and combination of AG+AA had an OR
0.636(0.488-0.803), p=0.0009.
The rs2032582 triallelic SNP from ABCB1 gene is with two homozygous mutant
AA and TT, however both genotypes were not associated with drug dependence with
(p>0.05). Similar results were recorded for the association study with allele A and T.
No significant associations with drug dependence were observed for rs950302 at genotype and allelic level. Homozygous AA had (p=0.9090) with OR 0.976 (95%Cl
0.652 – 1.463) and allele A had (p=0.7065), OR 0.965 (95%Cl 0.802-1.161). 88
Table 3.16: Genotype and Association
OD p SNPs Genotype Case Control 95% CI Ratio Value TT 416 520 Reference OPRD1 TG 23 22 1.31 0.718 – 2.377 0.3809 rs1042114 GG 20 1 25 3.341-187.05 0.0017 TG +GG 43 23 2.33 1.385-3.940 0.0015 TT 416 485 Reference OPRK1 CT 41 55 0.869 0.568-1.329 0.5177 rs702764 CC 2 3 0.777 0.129-4.674 0.7831 CT+CC 43 58 0.864 0.570-1.309 0.4918 GG 327 421 Reference PDYN AG 116 109 1.370 1.016-1.847 0.0388 rs910080 AA 16 13 1.584 0.751-3.341 0.2265 AG+AA 132 122 1.393 1.047-1.853 0.0228 AA 120 131 Reference PDYN AG 235 271 0.946 0.699-1.282 0.7229 rs199774 GG 104 141 0.805 0.565-1.148 0.2307 AG+GG 339 412 0.898 0.675-1.197 0.4626 TT 313 370 Reference PDYN CT 128 155 0.976 0.739-1.290 0.8653 rs1022563 CC 18 18 1.182 0.605-2.311 0.6248 CT+CC 146 173 0.997 0.764-1.303 0.9860 GG 382 454 Reference AG 76 86 rs10494334 1.050 0.749-1.472 0.7755 AA 1 3 0.396 0.041-3.824 0.4235 AG+AA 77 89 1.028 0.736-1.436 TT 195 251 Reference COMT CT 172 201 1.101 0.835 1.4523 rs737866 CC 33 49 0.866 0.536-1.400 0.5500 CT+TT 367 452 1.045 0.828-1.318 0.7096 TT 254 293 Reference DRD4 CT 181 222 0.940 0.726-1.217 0.6417 rs1800955 CC 83 70 1.367 0.954-1.959 0.0088 CT+CC 435 515 0.974 0.789-1.203 0.8093 AA 146 210 Reference ABCB1 AG 229 260 1.266 0.961-1.669 0.0930 rs1128503 GG 84 73 1.655 1.134-2.415 0.0090 AG+GG 313 990 0.454 0.355-0.581 0.0001
89
Table 3.16: Continued GG 175 153 Reference ABCB1 AG 214 279 0.670 0.506-0.887 0.0053 rs1045642 AA 70 111 0.551 0.381-0.798 0.0016 AG+AA 284 390 0.636 0.488-0.830 0.0009 CC Reference 142 162 CT 48 35 TT 0.965 0.958-2.555 0.0730 6 7 ABCB1 AA 0.977 0.321-2.978 0.9686 65 101 rs2032582 AC 0.734 0.4998-1.0786 0.1153 168 216 AT 0.887 0.656-1.200 0.4384 30 19 CT+TT+A 1.801 0.972-3.339 0.0617 394 439 1.023 0.787-1.332 0.8604 A+AC+AT GG 202 229 Reference DUSP27 AG 201 249 0.915 0.702-1.193 0.5122 rs950302 AA 56 65 0.976 0.652-1.463 0.9090 AG+AA 257 314 0.927 0.722-1.197 0.5587
90
Table 3.17: Allele and association SNP Allele Case Control OD Ratio 95% Cl P value OPRD1 T 855 1062 Reference rs1042114 G 63 24 3.260 2.020-5.262 0.0001 OPRK1 C 873 1025 Reference rs702764) T 45 61 0.866 0.583-1.286 0.4765 PDYN G 770 951 Reference rs910080 A 148 135 1.354 1.052-1.742 0.0180 PDYN A 475 533 Reference rs199774 G 443 553 0.898 0.754-1.072 0.2348 PDYN T 754 895 Reference rs1022563 C 164 191 1.019 0.809-1.282 0.8712 A 78 92 Reference rs10494334 G 840 994 1.003 0.732-1.375 0.9839 COMT T 680 787 Reference rs737866 C 238 299 0.921 0.755-1.123 0.4186 DRD4 T 571 724 Reference rs1800955 C 347 362 1.215 1.011-1.460 0.0373 ABCB1 A 521 680 Reference rs1128503 G 397 406 1.276 1.067-1.527 0.0077 ABCB1 G 564 585 Reference rs1045642 A 354 501 0.732 0.613-0.876 0.0006 C 500 575 Reference ABCB1 A 328 437 0.863 0.716-1.040 0.1224 rs2032582 T 90 68 1.522 1.087-2.132 0.0146 DUSP27 G 605 707 Reference rs950302 A 313 379 0.965 0.802-1.161 0.7065
3.2.6 SNP – SNP Interaction
SNP – SNP interaction between rs1042114 of OPRD1 and other SNPs were studied, as depicted in Appendix E. There was a marked risk of addiction (p=0.004) in subjects when risk genotype GG/GT and homozygous wild TT of rs702764 of OPRK1 gene inherited together, with an OR of 2.22(95% Cl, 1.281 – 3.849). Similarly, when risk genotype GG/GT of rs1042114 appears together with homozygous TT of rs737866 of COMT gene, there was a significant association with a p=0.003, and an OR 2.92
91
(95% Cl, 1.414-6.043). Interaction of rs1042114 and rs199722 PDYN gene revealed a substantial risk of addiction (p=0.01), when the risk genotypes GG/GT of rs1042114 and homozygous wild GG were present together, with an OR 3.88 (95% Cl, 1.330 – 11.27).
Risk of addiction was revealed when both risk genotype of rs1042114 and rs199722 inherited together with an OR 2.49 (95%Cl, 1.311-4.732) (p=0.005). The results also showed a marked risk of addiction when both risk genotype of rs1042114 GG/GT and
CT/CC rs1022563 of PDYN gene inherited together with a p=0.001, OR 6.08(95%Cl,
2.057-18.00). Similar result was reported when GG/GT of rs1022563 was present together with homozygous mutant GG (p=0.0002), OR 3.11(95%Cl 1.71-5.66). SNP of
DRD4 gene, rs1800955 showed a significant association with addiction when both risk genotype of rs1800955 and rs1042114 inherited together with (p=0.002) with an OR
3.01(95% Cl, 1.48-6.11). Interaction of rs1042114 with rs1128503 of ABCB1 gene showed a significant association with addiction with all genotype interaction. There was a marked risk of addiction (p=0.017) when homozygous wild TT rs1042114 inherited together with AG/GG of rs1128503, with OR 1.38 (1.05-1.82). Combination of risk genotype of rs1042114 GG/GT with homozygous AA and GG of rs1128503 showed significant association with addiction with a p value 0.010 and 0.0029.
SNP – SNP interaction of OPRK1 and the other SNPs were conducted, there was only few significant association was reported, as stated earlier there was a significant association with OPRD1 gene homozygous wild genotype (p=0.004). Combination risk genotype AG/AA of PDYN rs910080 and homozygous wild TT of rs70764 shows a significant risk factor for addiction (p=0.023), with an OR 1.41(95%Cl, 1.047-1.910).
Other than that, there was a significant association when homozygous wild TT of 92 rs702764 inherited together with risk genotype of rs1045642 (p=0.0017); OR
0.639(95%Cl, 0.483-0.845). Similar results reported when risk genotype of both SNPs appears together with p=0.041.
PDYN gene, rs910080 was studied for SNP-SNP interaction with OPRK1, rs702764. As stated earlier, there was a significant association with p=0.023 when
AG/AA of rs910080 appeared together with TT. An interaction study with rs1042114 of
OPRD1 and rs910080 showed that when risk genotype for addiction AG/AA and
GT/GG inherited together, there were significant associations (p=0.002), with an OR 10
(95%Cl, 2.277-44.20). Combination of risk genotype AG/AA of rs910080 and risk genotype AG/AA of rs199774 gives a significant association with addiction with
(p=0.01) with an OR 1.68 (95%Cl, 1.114-2.538). Whereas, a combination of genotype, homozygous wild GG (rs910080) and risk genotype rs1022563 of PDYN gene showed a significant association (p=0.03) and with an OR 0.67.
When rs910080 was studied together with rs1045642 of ABCB1 gene, there was a significant association with addiction when risk genotype AG/GG of rs1045642 was together with homozygous wild GG of rs910080 (p=0.018), with an OR 1.44(95%Cl,
1.060-1.968). Interaction of risk genotype of both SNPs AG/GG (rs910080) and AG/GG
(rs1128503) revealed a substantial risk of addiction (p=0.001), with an OR 1.89(95%Cl,
1.260-2.820). As for the interaction between rs910080 and ABCB1 gene (rs1045642), there was a significant association when AG/AA of rs910080 inherited together with homozygous wild rs1045642 GG with p=0.002.
93
There was a significant association when SNP rs199774 homozygous wild genotype GG appeared together with risk genotype of rs2032582 (p=0.048) and OD of
2.378 (95%Cl 1.004-5.628). There was also a significant association with drug dependence when a risk genotype of rs199774 inherited together with homozygous CC
(p=0.014) and risk genotype TC/TT (p=0.007) of rs2032582.
Interaction of rs1022563 with rs1045642 of ABCB1 gene shows a significant addiction with genotype CT/CC of rs1022563 and AG/AA of rs1045642 (p=0.017), with an OR 0.63 (95%Cl 0.432-0.921).
Combination of risk genotype CT/CC DRD4 gene rs1800955 and AG/GG rs1045642 ABCB1 gene showed a significant risk factor for addiction (p= 0.03), with an
OR of 1.45(0.999-2.114).
SNP – SNP interaction of rs10494334 with rs1128503 and rs1045642 of ABCB1 gene showed a significant association with drug dependence. There were significant interactions of homozygous wild GG of rs1045642 with risk genotype AG/GG of rs112853 (p=0.033) with an OR 1.36 (95%Cl 1.025- 1.818), and when risk genotype of rs10494334 AG/AA and AG/AA of rs1045642 were inherited together (p=0.0027), with an OR 0.63 (95% 0.432-0.921).
There was a risk of addiction when TT homozygous wild of rs737866 of COMT gene inherited together with risk genotype of rs1045642 with a p value of 0.006, with an
94 and AG/GG from rs737866 and rs1045642 appeared together with (p=0.006) with an OR
0.59(95% Cl 0.409-0.862).
When risk genotype AG/GG of rs1128503 and CT/TT of rs2032582 were inherited together, there was a significant association with a p-value 0.029, with an OR
2.04 (95%Cl, 1.075 -3.908). There was also marked risk of addiction for a combination of homozygous wild AA rs112503 and risk genotype AG/AA with a p value 0.042 with an OR 0.643 (95%Cl 0.420-0.985).
There was an increased risk of addiction when risk genotype of ABCB1 gene rs10445642 AG/AA with homozygous wild GG of rs950302 appeared together with a p
=0.003, with an OR 0.54 (95%Cl 0.363-0.814) and with risk genotype AG/AA with
(p=0.003), OR 0.55 (95%Cl 0.300-0.382). Combination of risk genotype of ABCB1 gene for rs1045642 AG/AA showed a significant association with addiction with a p value 0.02, with an OR 0.65 (95%Cl 0.450—0.956).
95
3.3 Database
The content of the database represents the genotype and haplotype frequencies for genes that are involved in the absorption, distribution, metabolism and excretion
(ADME) processes including information on human Cytochrome P450 genes (CYP2A6,
CYP2B6, CYP2C8, CYP2C9, CYP2C19, CYP2D6 and CYP3A4), and genes that encode opioid receptors and peptides in human (OPRK1, OPRD1 and
PDYN). Population based information on GABRA1, HLA-B*3505, HTR5A and
CHRNA1 genes are also included.
The database structure supports fast queries of gene list studied, mutations genotyped and sub-population based haplotype, as shown below (Figure 3.4). Mutation page populates and displays the various mutations entered against each gene in the database with detail to the nature of the substitution and drugs associated with the mutation (Figure 3.5 and Figure 3.6). Individual SNPs could be queried to populate and display the allele and genotype frequencies for different Malaysian subpopulations
(Figure 3.7).
Authorized users are allowed to modify and add new records without having to change the physical database schema. PHP (Personal Home Page Tool) is used as a server scripting language to connect, manipulate and display data for end-users. The database is made publicly accessible on public domain on www.pharmacogenomics.my.
96
Figure 3.4: Display of genes in the database
Figure 3.5: List of mutations
97
Figure 3.6: Detail of mutation
98
Figure 3.7: Haplotype structure presented for each population
99
CHAPTER 4:DISCUSSION
4.1 Demographic Factors
A multitude of demographic factors has been identified to be strongly linked across a range of illicit drug use. Addicts are often young males, unemployed, less educated, unmarried and from the lower socioeconomic background. In the present study, the drug habits and the socio - demographic status of 459 drug dependent and control group in Malaysia have been compared. In this study, the stratified sampling method was used, where the population was divided into groups. The most common approach to the demographic study of drug addiction is through a self - administered questionnaire survey. Self-administered questionnaire is used on the assumption that the respondents will be honest in answering because they are anonymous. This validated questionnaire is prepared based on whether the questions had been placed in best order and whether the respondents would understand them.
Well-defined 459 drug dependents and 543 control subjects who fulfilled the inclusion criteria and gave a written consent form were enrolled in the study. The official statistics on the prevalence illicit drug use reported by National Anti-Drug Centre reports
(AADK Report, 2015) showed that 80% of drug users in Malaysia are Malays and 70% are between 18 and 40 years old. A similar observation was made from the current study which showed over 56% amongst addicts studied were aged between 20 and 39 years confirming that most Malay addicts are young adults. This suggests that most who became addicts had their first introduction to opioids during schooling. In Sweden, the mean age for drug dependent is 34 years (Blom Nilsson et al., 2015) and in Taiwan, the
100 average mean age is 23.9. Similar age group also reported in most of the middle eastern countries, in Tunisia with the mean age of 33.3 years (Sellami et al., 2016), 33.9 years in
Saudi (Alshomrani, 2016), 32.12 in Turkey (Yazici et al., 2015) and 35.6 years in Iran
(Ahmadi & Motamed, 2003). This concludes that young adults with age group 20-39 years are getting more involved in substance use all over the nation.
Among the socio – economic indicators, income and education are the most important factors for substance abuse. The majority of substances dependent in this study were secondary school leavers (90.5%), with 53% labourers and 34% of non- professional workers. A higher percentage of Malaysian drug dependents were either not educated or secondary school dropouts and mostly unemployed (14%) and labourers
(20%), similar results were reported in the overall Malaysian substance use study by
National Anti-Drug Agency (ADK Report 2015,). Similarly, in Bosnia and Iran significant number of addicts are not employed and only had secondary school education
(Alshomrani, 2016).
However, in Bangladesh 80% of drug addicts were found to be literate, it was also stated that free cash flow could contribute to such a habit indulgence which makes it affordable for them to buy drugs for long run (Maruf et al., 2016). However the latest study in Bangladesh had reported that 68.1% of drug dependent had below than secondary school education and around 44.5% unemployed (Batool et al., 2017).
In Arunachal Pradesh, India, the majority of drug addicts were illiterate, similarly in Tunisia, Taiwan and Sweden, the percentage of unemployed substance dependent is 101 higher (Chaturvedi et al., 2004; Chen et al., 2015 (Sellami et al., 2016). However, studies reported in Turkey showed 59.6% of substance dependent held regular jobs
(Yazici et al., 2015, Chen et al., 2015). It can be concluded that early use of substance abuse can cause a major impact on the school performances which lead to early school dropout. Majority of them will be jobless or laborers with lower income.
The current study revealed that there was an association between smoking and addictions, where 97% of addicts are smokers. Smoking and its association with substance dependent has been reported in previous studies in other populations (Frosch et al., 2000, Frosch et al., 2002, Pajusco et al., 2012). Higher smoking rate with drug dependents with Methadone treatment was also reported in the US, similarly, another report showed that those who had smoked cigarettes are more likely to use drugs
(Richter et al., 2007). Our study was also investigated whether the smoking patterns amongst family members associated with addiction, and it showed that 99.8% of substance users have family members that are smokers. These findings are in agreement with the report published by Shamsuddin and Haris in 2000 where the family factor was significantly associated with smoking habit in Malaysian population (Shamsuddin &
Haris, 2000). The results supported by other studies from the different population that indicated that adolescent peer smoking mediated the relationship between a history of parental and sibling smoking during adolescence (Brook et al., 2009).
Smoking is regarded as a gateway to substance abuse and rapidly first substance tried by most of the drug dependents (Torabi et al., 1993, Lai et al., 2000). It is proven in the latest study in Iran and Bangladesh that over 90% of drug dependents smoked before 102 starting other drugs (Zolala et al., 2016, Maruf et al., 2016). Research also showed that drug dependents that started smoking behavior in early age, have a higher chance to be drug dependents in a very early age (DiFranza, 2016, Maruf et al., 2016) .
4.2 Association study of SNPs and opiate addiction in Malay population
Several cellular and molecular neuroadaptation and changes in the gene from the brain system been related to drug abuse (Hyman & Malenka, 2001). The genetic mechanism involved in the complex physiological behavioural process in the drug addiction explored using the most abundant genetic variant called SNP (Levran et al.,
2012, Palmer et al., 2015). Risk variant in drug addiction research identified using the candidate gene, linkage and genome wide study.
Candidate gene analysis focus on the selection of genes that were previously linked to the addiction, and the selected SNPs that have a functional consequence on the gene, for instance, affecting its regulation or protein product (Patnala et al., 2013).
Genome wide study directly assesses hundreds of thousands of tag-SNPs throughout the genome to detect differences in SNP allele frequencies between a series of cases and unaffected controls it is hypothesis-free, meaning that no specific candidate gene is being tested. As a result, most genes identified through GWAS have not been previously related to the disease under investigation (Frazer et al., 2009).
Genetic variations in the receptor genes are involved in the drug reward pathway and have the potential to influence the risk of addiction. The goal of this study was to identify genetic variations that contribute to drug dependence in the Malaysian Malay 103 population. We examined 12 polymorphisms, which were rs1042114 in the OPRD1, rs702764 in the OPRK1, rs910080, rs199774, and rs1022563 in the PDYN, rs737866 in
COMT, rs10494334, rs1800955 in DRD4, rs1128503, rs1045642 and rs2032582 in
ABCB1 and rs950302 in DUSP27, and their association with opioid addiction.
4.2.1 OPRD1 variant and opioid addiction
The principal finding of this study showed that SNP rs1042114 was significantly associated with opioid dependents in the Malaysian Malay subjects. This transverse G>T substitution alters the amino acid sequence (Cys27Phe). The functional studies revealed that these two variants (27Phe and 27Cys) have identical pharmacological properties, but differ in maturation efficiency, stability at the plasma membrane, and Ca2+ signalling regulation in N terminus of the receptor have been linked to various addictions (Zhang et al., 2008b, Tuusa & Petäjä-Repo, 2011). It exhibited a deviation from HWE in the addicts group but was normal in drug dependents related studies. In a cohort of European
American populations from Connecticut in USA, the rs1042114 G allele was more frequent in opioid dependent subjects (than in the control group) demonstrating a statistical significance at the genotypic and allelic levels between the groups (p = 0.08 and p = 0.005, respectively) (Zhang et al., 2008a). However, different results were reported for many other populations. A study of the homogeneous Han Chinese population was reported that rs1042114 was not polymorphic (100% TT) in either opioid dependent patients or control subjects, hence no association was reported (Xu et al.,
2002). In studies of apparently more admixed populations, including European
Americans, Europeans, and Australians, there were no significant association between
104 opioid dependence and the rs1042114 variant was reported (Franke et al., 1999, Nelson et al., 2012, Crist et al., 2013a, Beer et al., 2013).
Moreover, the MAF of rs1042114 G varies substantially among populations.
This non-synonymous allele was reported at an incidence of 0.09 in European
Americans and Ashkenazi Jews, 0.03 in African Americans (Gelernter & Kranzler,
2000) and was absent in Chinese (Xu et al., 2002) and Japanese populations (Gelernter
& Kranzler, 2000). The HapMap populations showed similar results: the MAF for minor allele G in Yoruba population in Ibadan, Nigeria and Luhya Webuye, Kenya populations was 0.022 each, and it was consistently low (0.051) in the Gujarati Indians in Houston population as well. The absence of this variant in Japanese and Han Chinese populations was further validated its geographic heterogeneity (Xu et al., 2002). The G allele is the minor allele and it is absent in Asian, rare in African and European, however we have shown the presence of the G allele and its association with drug dependence in the
Malaysian Malay population.
Differences such as ethnicity, epistatic (gene–gene) effects, and the gene– environment interaction may explain this inconsistency among populations. It is noted that drug dependence behaviour variable is not influenced by one gene but by many other factors. We need to study the potential interactions between other factors like environment and gene networks to understand drug dependence behaviour.
105
4.2.2 OPRK1 variant and opioid addiction
The second locus that was investigated in the present study, the rs702764 on
OPRK1, showed no association to opioid addiction suggesting that there is no biological effect of the variant to the phenotype. It is noted that there is no change in the protein structure which will change the affinity of the receptor due to the mutation. This could explain why there is no association between the drug dependence and the variant.
Nevertheless, an epistatic effect of OPRK1 gene in among Indian population showed a significant association when SNP-SNP interactions between 118A>G (rs1799971 in exon 1 of the OPRM1) and rs702764 were studied (Kumar et al., 2012). A large haplotype study by Zhang and colleagues also showed no significant association among
European American opioid dependence and control group (Zhang et al., 2008a). The allelic frequency of minor allele C among Malaysian population is similar to the reported allelic frequency in HapMap project in Japanese 0.06, Han Chinese 0.070, Chinese in
Metropolitan Denver Colorado 0.041 and Gujarati Indians from Houston 0.068 (Table
3)except for population from Nigeria and Kenya. The allele frequency of the C allele was 0.51 and 0.63 for both population.
4.2.3 PDYN variant and opioid addiction
The minor allele A at SNP rs910080 showed a statistically significant association with opioid dependence in this study. Clarke et al. (2012) reported that this SNP had a female-specific association in their sample of European American opioid dependents, and they failed to generalize the association across the sample (Clarke et al., 2012). A sample represented by both male and female addicts from Chinese, however, revealed a
106 significant association between the rs910080 SNP and opioid dependence irrespective of gender (Chu et al., 2011, Yuferov et al., 2009) It is reported that this locus was associated with cocaine addiction in Caucasians but was not among African Americans
(Yuferov et al., 2009). The current study showed that the minor allele for SNP rs910080 is A, which is similar to what was reported for HapMap samples from Japanese, Chinese and Gujarati Indians. In the other HapMap populations, the MAF was higher, especially in Utah residence from European ancestry population where it was 0.73 (73%) and in
Nigerian population which was 0.67 (67%). Other studies reported the G allele as a minor allele (Yuferov et al., 2009, Wei et al., 2011, Clarke et al., 2012). Although some of the HapMap data and the current study showed allele A as a minor allele at this locus, its frequency varies with the level of risk to addiction. Comparison of the results of this study with HapMap data clearly showed that there is genetic diversity in the SNP rs910800 among African American, European American, and Asian populations. Allelic frequencies of most of the SNPs are similar around the globe, but some alleles are favoured significantly in different ethnic and population groups. This inter-ethnic variation maybe due to genetic drift or natural selection.
Our data demonstrated that the intronic variants rs199774 and rs1022563 showed no difference between the control and opioid dependent groups. Clarke et al. (2012) The reported minor allele is A for rs199774, however this allele reported to be higher among
Han Chinese, Beijing (0.63 and 0.75), Japanese from Tokyo (0.73), Han Chinese from
Colorado (0.72) and reported lower in European and African populations. The A allele at rs199774 is associated with increased risk of addiction and that a more significant
107 association was found among female European American and Chinese opioid dependents (Clarke et al., 2009, Clarke et al., 2012).
The minor allele is C for rs1022563 in this study, this allele frequency was very much higher in Utah residence from European ancestry and Nigerian populations from the HapMap project and lower among the Asian population reported in Han Chinese
(0.13) and in the Japanese population (0.30). However, the same group studied rs199774 reported a similar female preponderance of rs1022563 among Chinese (p = 0.006) and
European American (p = 0.004) opioid addicts (Clarke et al., 2009, Clarke et al., 2012).
The minor allele of rs1997794 eliminates a putative binding site for the AP-1 transcription factor complex and modulates PDYN expression (Taqi et al., 2011). This illustrates sex as a further stratification variable that may affect the impact of genetic variation of PDYN gene on this complex disease (Butelman et al., 2012). Studies have proven that genetic makeup is different between the male and female, this warrant a different respond to the substance abuse. Male and female will differ in response to the drug rehabilitation treatment due to its impact on pharmacokinetics and pharmacodynamics (Soldin & Mattison, 2009). A more specific study in future will help to determine the extend which these differences will help on clinical management.
4.2.4 rs10494334 variant and opioid addiction
This region is rich in predicted transcription factor binding sites and could be a region controlling the expression of many genes (Morley et al., 2004). In 2010, strongest association with vulnerability to develop heroin addiction was reported among 108
Caucasians (Nielsen et al., 2010) and that is the only study reported for this SNP.
However, in this study, rs10494334 showed no any significant association with drug addiction. All the reported minor allele frequency in HapMAp project from Asia, Africa and European populations is also reported allele A with a similar allele frequency with the current study.
4.2.5 COMT variant and opioid addiction
The variant rs737866 showed no association to opioid addiction among the
Malaysian Malay population both in allelic and genotype level. The minor allele C frequency reported in this study quite close to other population from HapMap project.
However, the minor allele percentage was higher in control group compared to drug dependents. Earlier studies reported that there were nominally significant associations among African American population (Ittiwut et al., 2011) and in China, there were significant association of rs737866 with substance dependent among Chinese heroin dependent (Li et al., 2011). It was also reported that TT genotype in this variant showed early onset heroin use in China compared to CT and the CC genotype. However, the study showed that drug dependency influenced by gene and environment factors, in this study it was significantly correlated with childhood trauma (Li et al., 2012b). This variant also showed an association with African ancestry and cocaine, only when rs4680 and rs737865 haplotype of the COMT gene inherited together (Lohoff et al., 2008). In contrast, there was no significant association with addiction in Arab population (Al-
Eitan et al., 2012). Minor allele C in this variant was not associated with drug dependence, and it is not the major genetic risk factor for drug addiction among
Malaysian Malay population. However, the results presented in this study might differ if 109 haplotype study conducted with rs4680 and rs737865, candidate gene study failed to show any association.
4.2.6 DRD4 variant and opioid addiction
The −521C/T polymorphism was discovered by Mitsuyasu et al. in the promoter region of the DRD4 gene in Japanese individuals (Mitsuyasu et al., 1999). The T variant reduced transcription efficiency compared with the C allele (Okuyama et al., 2000). The
T allele is associated with personality traits such as lower novelty-seeking behaviour (Okuyama et al., 2000, Ronai et al., 2001) which are closely related to illegal drug use.
Li and his group (Li et al., 2000) examined whether genetic variation of the dopaminergic neurotransmitter system was a possible risk factor for heroin abuse. They studied variant -521T>C in 387 Chinese heroin abusers, and found no significant association of frequency of the C allele and the CC genotype in the drug user group. A study conducted in Japan showed that subjects with the CC genotype exhibited the highest drug dependence behaviour compared to those with the TT genotype (Okuyama et al., 2000). Another study also reported the association between the -521 C/T SNP of the DRD4 promoter region and substance dependence in the subgroup of heroin dependents (Szilagyi et al., 2005). Thus the result of these two studies are in a good agreement with our current finding of an association between the -521T>C polymorphism and opiate dependence for genotype CC and for allele C. On the contrary,
Lai and co-workers demonstrated a higher T allele frequency among heroin dependents
(Lai et al., 2010). However, there was a deviation from HWE with the (p=0.0005) in the 110 addicts‘ group which predicated in case related studies with mutations. The increased activity level with C allele in the promoter region of the DRD4 gene, increases the drug dependence behaviour (Okuyama et al., 2000), although there were reports proved that there is no difference between both allele transcription activity (Kereszturi et al., 2006).
4.2.7 ABCB1 variant and opioid addiction
The transporter proteins, p-gp encoded by ABCB1 gene, have been studied extensively in relation to the dose required for methadone maintenance therapy for drug dependent patients. Methadone is a substrate of the efflux transporter p-gp (encoded by the ABCB1 gene). A very few studies conducted on the effect of the gene variants on drug addictions. In this current study, the focus will be on the effect of polymorphisms of rs1128503, rs1045642 and rs2032582 with drug dependence.
The variant rs1128503 was associated with variability and response to different drugs in various studies (Aarnoudse et al., 2006, Xing et al., 2006, Yin et al., 2009). In the current study, we have shown that the allele frequency of rs1128503 in the studied population different from other Asian population with a minor allele A. Other populations reported A as a minor allele were Russia (0.48) (Gaikovitch et al., 2003),
French (0.43) (Jeannesson et al., 2007), Polish (0.45) (Wasilewska et al., 2007) and
Portuguese (0.46) (Pechandová et al., 2006). HapMap project also reported that other than Asian population, European, Nigerian, African and Kenya population reported allele A as a minor allele.
111
The other populations which showed G allele as a minor allele are in China
(Zhang et al., 2008c), Japan (Komoto et al., 2006), India (Ghodke et al., 2011), in
Turkey (Gümüş-Akay et al., 2008) and also in another study among Malay populations
(Chowbay et al., 2003). Hapmap project also showed that Asian populations such as the
Chinese and Japanese with allele G as a minor allele. Comparison of the results of this study with other studies and HapMap data clearly indicated that there is a genetic diversity in this SNP with major differences among Caucasians, Asians and Africans, due to this there are no positive findings linking this SNP to variable opioid pharmacokinetic, dose requirement or adverse effects. In future, family studies in ethnically diverse populations will provide evidence in the support of genetic difference in drug dependence prevalence study.
The SNP rs1128503 in this study showed a significant association with substance abuse, G allele and genotype GG were strongly associated with drug addiction. In 2008,
Levran and the group found that homozygous AA combination requires higher methadone in Caucasian drug dependence population (Levran et al., 2008a) and it was supported by another study among drug dependence in China (Hung et al., 2013).
Previous studies were conducted to observe the inter-individual variability of dosage requirement for methadone maintenance therapy for opioid addicts. There is no other study reported about the allele and genotype frequency association with substance dependence. The study has provided evidence that the minor allele and genotype are significantly associated with drug addiction among Malaysian Malay population.
Although this is a synonymous variant which does not change the protein sequence, it might affect the translation regulation. This mutation generates a ribosome pause site, 112 which will affect the co translational folding within its substrate binding site and might modulate the drug efficiency mechanism (Zhou et al., 1999).
The SNP of rs1045642 affects the bioavailability of many drugs including certain opioid (Fellay et al., 2002) and been associated with different P-gp expression levels
(Hoffmeyer et al., 2000), the A variant of the this polymorphism has been associated with lower P-gp expression or function in both in vitro and in vivo. In this study, the minor allele frequency is A.The genotype distribution of this polymorphism in the control population was in accordance with HWE. The allele frequency of minor allele A is consistent with those reported in Asian population in HapMap project but reported minor allele in European and Africa population is allele G. Similar results were also reported in allele frequency analysis in Russia (Gaikovitch et al., 2003) and Poland
(Jamroziak et al., 2006).
Previous studies have shown that a higher prevalence of AG and lower GG genotype in opioid dependent subjects were recorded among European populations
(Beer et al., 2013) and genotype GG with cannabis dependency in French population
(Benyamina et al., 2009).
An earlier study had shown that despite that there are no changes in the protein structure; the polymorphism might lead to variability in protein folding which may impact the protein structure. It is reported that the genotype GG might have a greater
Δ9THC efflux with the blood barrier which may lead to frequent or more consumption of the substance (Kimchi-Sarfaty et al., 2007). However, genotype GG association with 113 substance abuse not reflected in our population, the minor genotype AA was associated with drug dependence compared to GG.
The variant rs1045642 was also associated with methadone maintenance therapy;
Hung and the colleagues reported that genotype AA requires higher methadone dosage
(Vereczkei et al., 2013, Hung et al., 2011, Hung et al., 2013). However, another study reported that lower methadone dosage required for the drug dependence with variant AA genotype (Crettol et al., 2006), this is supported by a study in Malaysia (Zahari et al.,
2016b).
Next variant was rs2032582, it is a triallelic SNP. Minor allele reported in this study is A and T. European and African population reported minor allele is T. Similar allele frequency was also reported in Jordan (Khabour et al., 2013) and in Japanese
(Fujii et al., 2012) but it was different from what was observed in HapMap project. It was reported all Asian population has got C as their minor allele, which is contradictory from our results. However, this study was supported by another study among Malaysian population which showed T allele as a minor allele (Zahari et al., 2017, Zahari et al.,
2016a) and Hapmap populations in European, African, Kenyan and Mexican.
There was only one reported study of this variant with substance dependent. It showed that genotype CC was comparatively lower among opioid dependent (Beer et al.,
2013) and our current study also showed similar results compared to control group. . The
No significant association was also reported for rs2032582 variant but when the variant was included with rs1045642 and rs112853, patients with AA will need more 114 methadone dose than the wild type (Bart et al., 2014), another study in Israel reported similar methadone requirement when 3 locus genotype AA-AA-AA of rs1045642, rs20132582 and rs1128503 appear together (Levran et al., 2008b). In contradictory, patients with homozygous CC require higher methadone dosage in another study (Coller et al., 2006).
It was reported that CC genotype need lower Ondosetron compared to other genotypes in the post-operative treatment (Coulbault et al., 2006) and another study reported carriers of variant A allele had a less adverse reaction on Oxycodone than the wild type genotype (Zwisler et al., 2011). These alleles were also reported not related to the variability of the analgesic response for fentanyl (Kim et al., 2013) in Korea. A meta- analysis study was conducted to analyse the significant association of CC genotype among patients who are on opioid treatment after post-operative, it showed that there is no significant association between homozygous CC genotype and consumption of
Opioid among patients (Ren et al., 2015). The minor allele A showed a statistically significant association with opioid dependent in this study; however, no association was reported for the genotype analysis.
However, it is unclear whether substance like cocaine and opioid are substrates of P-gp, there were no much investigations on the influence of ABCB1 variant on the brain disposition to cocaine and opioid. However it is a key transporter in the disposition of drugs in the central nerve system, some polymorphisms of ABCB1 gene, which encodes P-gp, produce a poor transporter that modifies the distribution of psychoactive drugs in the CNS and other tissues (Levran et al., 2008a). 115
Increased efficiency of the P-gp transporter between the wild genotype of the drug dependents can cause an euphoric effect of shorter duration which increases the compulsion to abuse the substance (Isaza et al., 2013) .
4.2.8 DUSP variant and opioid addiction
The minor allele for the rs950302 variant is allele A in this study, with, however the dSNP data reported minor allele is G. Hapmap project showed variability in the allele frequency distribution among population even between Asians. There were no significant associations reported with drug dependency for allele and genotype analysis.
It is noted that DUSP gene functions as a signalling regulator, mutations might cause multiple functional changes of its substrate which can be targeted for pharmacological study and substance abuse. But there is no evidence to support these findings due to its late identification as a signalling regulator (Huang & Tan, 2012). However, there was only one study reported an association of this variant among opioid addict in Caucasian group (Nielsen et al., 2010). Further study required to understand the variants and its mechanism with drug dependency.
4.3 SNP-SNP interaction
Based on knowledge about the physiological and biochemical roles of OPRD1 and OPRK1 products, the opioid dependent phenotype is believed to be complex and multigenic. The current study has shown that the wild type (TT) genotype at locus rs702764 inherited either the TG or GG genotype at locus rs1042114, was associated with opioid addiction, which demonstrates a significant link of OPRK1 and OPRD1 with addiction. Similar epistatic effects between OPRK1 and OPRD1 were reported to 116 increase susceptibility to addiction in an Indian population (Kumar et al., 2012). Both
OPRK1 and OPRD1 encode a class of G-protein coupled receptors belonging to the endogenous opioid system pathway (Iismaa & Shine, 1992). They are structurally and functionally related to each other, differing only in the affinity for various opioid ligands. The structural pleomorphism due to the SNPs may affect their heterodimerisation (Shen et al., 1999) and hence may explain their association with opioid dependence.
The rs702764 variant with homozygous GG/GT was associated with drug dependent when it is inherited together with TT homozygous wild type of rs737866.
Studies had shown that there were significant haplotype associations with substance dependent with European American and American African population (Ittiwut et al.,
2011). Similar associations were observed between GG/GT of rs702764 and GG homozygous wild type genotype of rs10494334. There is a significant association to drug dependent when these genotypes appear to together. The G allele is a risk allele associated with drug addiction, there was only one reported association with allele A, it was exceptional to have significant association when both genotypes inherited together.
There was also a significant association that was reported when risk genotype of rs1042114 appeared together with wild genotype of rs199774. The associations were more significant when both risk genotypes inherited together. PDYN gene variant rs1022563 and rs1042114 also had showed significant association when both risk genotypes present together. Although OPRD1 is not a receptor for PDYN peptides but it belongs to the same G protein coupled family with OPRK1 receptor, but it is also an 117 opioid peptide which present in the areas related to rewards, motivation, learning and stress (Le Merrer et al., 2009), therefore it plays an important role in addictive behaviour
(Lutz & Kieffer, 2013).
Variant rs1800955 risk genotype CC/CT of DRD4 gene was significantly associated with GG/GT rs1042114, although there is no evidence suggesting that appearance of both risk genotypes increase the drug susceptibility but it had showed a significant association in this study. There is a fundamental overlap between opioidergic and dopaminergic effects (Nestler, 1996), dopamine release could be facilitated by the activity of opiodergic neurons (Koob & Volkow, 2010). The latest study also proved that there is an interaction between both systems (Reisi et al., 2014).
The opioid receptors variant rs1042114 and rs702764 both showed a significant association with drug addiction when inherited together with ABCB1 variant risk genotype of rs1128503, rs10445642 and rs2032582. Similar results showed when wild type genotype of rs1042114 TT inherited together with risk genotype of rs1045642.
Presence of risk genotype rs1042114 with wild genotype AC/AA and risk genotype of rs2032582 was also significantly associated with drug dependence.
Another variant of opioid receptor gene rs7027564 also showed a presence of wild type genotype TT with risk genotype AG/AA of rs1045642 or appearance of risk genotype from both variants are significantly associated with drug addiction in this population.
118
It clearly shows that in opioid receptor variant (rs1042114, rs702764) and drug metabolizing enzyme variant (rs1128503, rs1045642, rs2032582) of this study, needs only one risk genotype to be significantly associated with drug addictions. It shows that one risk genotype from variant ABCB1 gene contributes to addiction with the presence of any opioid receptor variant. Since P-gp is the gene product of ABCB1 gene and it is involved in the trans membrane transport of opioid, there is an opioid and P-gp structure activity relationship (Dagenais et al., 2004). Gene-gene interaction between these variants may contribute to the greater drug susceptibility, it is noted that genetic factor may contribute to the variable response to opioid by effecting the pharmacokinetics
(drug metabolizing enzyme and transporter) or pharmacodynamics (receptors and transduction) (Bartošová et al., 2015) .
The present study of the rs702764 polymorphism and its interactions with the three SNPs of the PDYN gene revealed a significant association only when the wild type homozygous of rs702764 was present together with GA/AA of rs910080. The OPRK1 and PDYN genes code for receptor and ligand, respectively; therefore, functional mutations on these genes may hamper the downstream biological pathway and may affect the overall signalling system. An exposure to substance abuse has been shown to induce neuroadaptive upregulation of OPRK1 and PDYN gene expression (Solecki et al., 2009). Genetic polymorphisms in PDYN and OPRK1 may be associated with vulnerability by conferring relative risk or protection. Therefore, the genetic epidemiology may provide a substantial contribution to identifying individuals with greater susceptibility to different conditions. Selective KOPr antagonists and partial agonists, administered either sequentially, or based on the neuro-behavioural and 119 neurogenetic profile of individual patients, are now thought to be a potential strategy in the treatment of specific addictive diseases which may have positive implications for a successful treatment (Butelman et al., 2012).
The results showed there was no pairwise linkage disequilibrium between the three SNPs from the PDYN gene (rs910080, rs199774 and rs1022563), this finding revealed that these alleles had no association and segregated at random. However, significant association with drug dependence was observed when risk genotypes of rs910080 AG/AA and rs199774 AG/AA present together, similar results were reported when risk genotypes rs910080 and AG/AA of rs10494334 inherited together. It was noted earlier that SNP rs199774 and rs10494334 both showed no association with drug dependence allelic and genotype level expect for variant rs910080. However, it was reported in earlier studies that A allele in rs1997794 associated with lower expression of the gene and might be the risk allele and the G allele of rs910080 confer protection against opioid addiction (Babbitt et al., 2010). The only exceptional combination was the presence of wild type GG of rs910080 and risk genotype of rs1022563 together which is significantly associated with addiction. It was proved in a study that PDYN gene variant expressions is different across the brain regions and transcriptional control also shown to vary according to genotype, cell type and sex (Babbitt et al., 2010). Association of variant rs199774 and rs1022563 in this study only proven through SNP-SNP association analysis, there is no any association through linkage disequilibrium (LD) reported
(Babbitt et al., 2010, Rouault et al., 2011).
120
The variant -521C/T rs1800955 from DRD4 gene was associated with drug addiction when risk genotype of this variant appear together with PDYN rs910080 risk genotype CT/CC. It is proven that there is an association between the opiodergic and dopaminergic system, it is reported that repeated stimulation in the dynorphin system via drug exposure effects the overall function in the dopamine signalling either reducing or increasing the dopamine transporter function (Karkhanis et al., 2017).
Although PDYN peptide genes (rs199774, rs910080) and ABCB1 gene variant rs2032582 were not inter related but an appearance of any risk genotype combination from these genes was associated with drug addiction.
PDYN variant rs1022563 and ABCB1 variant rs1045642, rs10494334, COMT variant rs737866 and DUSP variant rs950302 were associated with drug dependence only when both risk genotypes inherited together. However, wild type genotype rs737866 TT even showed an association with rs1022563 risk genotype AG/GG.
As for PDYN variant rs1128503, the presence of risk genotype with wild genotypes of rs10494334, rs737866 and rs2032582 give a significant association with drug dependence. However, different results were reflected when wild genotype AA of rs1128503 presence together with the risk allele of rs2032582, these combinations showed an association with drug addiction.
Our approach of evaluating the epistasis (SNP-SNP interaction) is the first effort among Malaysian population which might be helpful to improve assessing an individual 121 with addiction risk factor. Identification and interpretation key epistasis interactions will be essential to understand the underlying etiology and to characterize the functional role in drug addiction. The epistasis interaction database will be bridging the gap between drug dependency and developing an effective treatment based on genetic the network.
4.4 Database
The primary goal of database development is for a better understanding of genetic variations in the risk of drug dependence. It is noted that not a single gene variant accounts for major portion of the risk but variation of few genes. The information on pharmacogenetic can advance the development of personalized treatment revealing genetic variations that predict individual responses to the therapeutic treatment which will be called pharmacotherapy (Mroziewicz & Tyndale, 2010).
The content of the database represents the genotype and haplotype frequencies for genes that are involved in the ADME processes including information on human
Cytochrome P450 genes (CYP2A6, CYP2B6, CYP2C8, CYP2C9, CYP2C19, CYP2D6 and CYP3A4), and genes that encode opioid receptors and peptides in human (OPRK1,
OPRD1 and PDYN). Population based information on GABRA1, HLA-B*3505,
HTR5A and CHRNA1 genes are also included.
The haplotype nomenclatures used in the website for CYP 450 genes are sourced from the naming convention used by the CYP nomenclature group. Haplotype designations for other genes are from various published work harmonized in the
122 literature. Haplotypes were computationally deduced using various algorithms from genotypic data.
One of the main objectives of this database is to gather and curate mutation data related to pharmacogenomics that represents Southeast Asia, allowing the development of accurate prevalence data for disease-causing mutations, providing a catalogue of polymorphisms, and potentially allowing more accurate phenotype-genotype correlations to be drawn. All variant information is manually curated before published in the database.
In addition, an on-line process for the submission of new mutations has been added to encourage input from researchers and clinicians to strengthen the database.
Pharmacogenomics database is published on a public domain that would serve as a freely-available resource for mutation and polymorphism data pertaining pharmacogenomics.
The allele, genotype and haplotype frequencies stratified to ethnic level are accessible through www.pharmacogenomics.my. This ready access to pharmacogenetic information on a public domain promises to transform medicine by making it easier for clinicians to predict correct medicine and dose to avoid adverse drug responses. As more published pharmacogenetic data become available, the curated data will be added to enrich the database.
123
4.5 Study Limitations
This study had several limitations that must be considered. First, it evaluated the association of five polymorphic markers in the OPRD1, OPRK1, PDYN, ABCB1, COMT and DUSP with opioid addiction, and it did not attempt to assess the role of other high frequency polymorphic markers in the genes. A further comprehensive study to characterize the prevalence of polymorphic SNP markers in these 7 genes in the population and their association with opioid addiction would be a major contribution to understanding how this genetic polymorphism contributes to vulnerability to addiction.
Second, we only enrolled male subjects, which may have introduced a gender bias, due to the gender bias association, reported results only can be related to male subjects, genetic and drug respond of a female might be different. Third, ancestry informative markers were not used to define the population and detect stratification; we are unable to collect the details of ancestry from all the subjects. It is proven that ancestry informative marker is important to candidate gene studies. It is effectively used to ascertain population genetic structure especially to control admixture in a population in association study (Nassir et al., 2009). Lastly, a multiple testing correction test was not performed because the SNPs studied on PDYN gene and ABCB1 gene showed no linkage disequilibrium and hence null hypothesis was tested separately for each SNP.
Therefore some significant associations reported here may be limited to the nominal significant association.
124
CONCLUSION AND FUTURE STUDIES
The twin and adoption studies have been conducted to allow a better understanding of heritability and drug dependence; research have been conducted over the last few decades to determine the neurobiological mechanisms underlying addiction creating properties. SNPs at rs1042114, rs702764, rs910080, rs199774, rs1022563, rs737866, rs10494334, rs1800955, rs1128503, rs1045642, rs2032582 and rs950302 were selected as potential candidates for drug dependence and heritability study using the candidate gene approach.
As a conclusion, this study provides results of polymorphism associations and demographics characteristics on drug dependence in Malaysian Malay populations. We have shown that SNPs rs1042114 of OPRD1, rs910080 of PDYN, rs1800955 of DRD4, rs1128503 and rs1045642 are associated with opioid addiction in Malaysian Malays but that SNPs rs702764, rs199774, rs1022563, rs10494334, rs737866, rs2032582 and rs950302 are not. This study also provides evidence of SNP-SNP interaction (epistasis) mostly between rs702764, rs910080, rs1128503 and rs2032582 and other studied SNPs which can contribute to the risk of addictions which otherwise will be missed in the absence of the interaction of known risk allele. Focusing research effort on epistasis will be critical for bridging the gap between drug dependency and effective treatment.
The demographic study also showed that majority of drug dependents were 18-
40 years and social economy factors like income and education most important factor for drug abuse. This study had indicated that most of the drug dependents were secondary
125 school leavers, unemployed or labourers who might have very limited knowledge of drug abuse awareness. Smoking recorded to be significantly associated with drug dependence and parental and siblings smoking in the family increase the risk of smoking. This proves that environmental factors do play an important role in the development of addiction.
Evidence of the involvement of specific genetic variants has been replicated in some studies whereas others remain uncertain. We need more of replication studies of variants of the genes accountable for addiction in different populations with a larger sample to allow identification of functional variants. The conflicting result some of the studied SNPs in this research may be due to a difference in the ethnicity of the population, since in populations of different ethnic origins the frequency allele can range from less than 2 % to 48 %. Social and environmental factors have been acknowledged of contributing to the risk of addiction.
Variants associated with drug dependency will help to define the possible risk group who are at increased susceptibility for drug abuse and its particular need for prevention strategy. Identification of the target gene and its pharmacogenetics properties will optimize the treatment for drug abuse patients.
Ultimately, the genetic database which is established will provide population specific information that ensures the best opportunity for the susceptibility treatment to avoid serious adverse effect to the drug abuse patients in Care and Cure Clinics, in Drug
Rehabilitation Centers in Malaysia. 126
Further studies are required to understand how genetic polymorphism effects can contribute to aggravating one‘s vulnerability to addiction. Genetics is not the sole contributor to the development of addiction. Environmental factors also play an important role. Studies on the interplay of genes, the environment and the specific drug abused for all the identified alleles which contribute to addictions will be necessary to further our understanding of the pathophysiology of addiction.
New analyses techniques such as haplotype analyses should aid to achieve this goal. The roles of genes, their variants and the environment in which they are expressed, play an important role in the development of personalized pharmacotherapy treatments.
This strategy will provide improved treatments to drug dependents in the Rehabilitation
Centers in Malaysia.
127
REFERENCES
(2013). New treatment gives hope to East Africa's drug users. Bull World Health Organ, 91(2), 89-90.
(2016). US drug overdose deaths: a global challenge. Lancet, 387(10017), 404.
Aarnoudse, A. L., van Schaik, R. H., Dieleman, J., Molokhia, M., van Riemsdijk, M. M., Ligthelm, R. J., Overbosch, D., van der Heiden, I. P. & Stricker, B. H. (2006).
MDR1 gene polymorphisms are associated with neuropsychiatric adverse effects of mefloquine. Clin Pharmacol Ther, 80(4), 367-74.
Agrawal, A., Grant, J. D., Waldron, M., Duncan, A. E., Scherrer, J. F., Lynskey, M. T., Madden, P. A., Bucholz, K. K. & Heath, A. C. (2006). Risk for initiation of substance use as a function of age of onset of cigarette, alcohol and cannabis use: findings in a Midwestern female twin cohort. Prev Med, 43(2), 125-8.
Agrawal, A. & Lynskey, M. T. (2006). The genetic epidemiology of cannabis use, abuse and dependence. Addiction, 101(6), 801-12.
Agrawal, A. & Lynskey, M. T. (2008). Are there genetic influences on addiction: evidence from family, adoption and twin studies. Addiction, 103(7), 1069-81.
Agrawal, A., Verweij, K. J., Gillespie, N. A., Heath, A. C., Lessov-Schlaggar, C. N., Martin, N. G., Nelson, E. C., Slutske, W. S., Whitfield, J. B. & Lynskey, M. T. (2012). The genetics of addiction-a translational perspective. Transl Psychiatry, 2, e140.
Ahmadi, J. & Motamed, F. (2003). Treatment success rate among Iranian opioid dependents. Subst Use Misuse, 38(1), 151-63.
Akil, H., Owens, C., Gutstein, H., Taylor, L., Curran, E. & Watson, S. (1998). Endogenous opioids: overview and current issues. Drug Alcohol Depend, 51(1- 2), 127-40.
128
Al-Eitan, L. N., Jaradat, S. A., Hulse, G. K. & Tay, G. K. (2012). Custom genotyping for substance addiction susceptibility genes in Jordanians of Arab descent. BMC Res Notes, 5, 497.
Alenius, M., Wadelius, M., Dahl, M. L., Hartvig, P., Lindström, L. & Hammarlund- Udenaes, M. (2008). Gene polymorphism influencing treatment response in psychotic patients in a naturalistic setting. J Psychiatr Res, 42(11), 884-93.
Ali, N., Aziz, S. A., Nordin, S., Mi, N. C., Abdullah, N., Paranthaman, V., Mahmud, M., Yee, A. & Danaee, M. (2017). Evaluation of Methadone Treatment in Malaysia: Findings from the Malaysian Methadone Treatment Outcome Study (MyTOS). Subst Use Misuse, 1-10.
Alonso, A., Sasin, J., Bottini, N., Friedberg, I., Osterman, A., Godzik, A., Hunter, T., Dixon, J. & Mustelin, T. (2004). Protein tyrosine phosphatases in the human genome. Cell, 117(6), 699-711.
Alshomrani, A. T. (2016). Saudi addiction therapeutic communities:Are they implementing the essential elements of addiction therapeutic communities. Neurosciences (Riyadh), 21(3), 227-31.
Ambudkar, S. V., Dey, S., Hrycyna, C. A., Ramachandra, M., Pastan, I. & Gottesman, M. M. (1999). Biochemical, cellular, and pharmacological aspects of the multidrug transporter. Annu Rev Pharmacol Toxicol, 39, 361-98.
Ayu, A. P., Iskandar, S., Siste, K., De Jong, C. & Schellekens, A. (2016). Addiction training for health professionals as an antidote to the addiction health burden in Indonesia. Addiction, 111(8), 1498-9.
Babbitt, C. C., Silverman, J. S., Haygood, R., Reininga, J. M., Rockman, M. V. & Wray, G. A. (2010). Multiple Functional Variants in cis Modulate PDYN Expression. Mol Biol Evol, 27(2), 465-79.
Baik, J. H. (2013). Dopamine signaling in reward-related behaviors. Front Neural Circuits, 7, 152.
Baker, T. E., Stockwell, T., Barnes, G., Haesevoets, R. & Holroyd, C. B. (2016). Reward Sensitivity of ACC as an Intermediate Phenotype between DRD4-521T and Substance Misuse. J Cogn Neurosci, 28(3), 460-71.
129
Bart, G., Lenz, S., Straka, R. J. & Brundage, R. C. (2014). Ethnic and genetic factors in methadone pharmacokinetics: a population pharmacokinetic study. Drug Alcohol Depend, 145, 185-93.
Bartošová, O., Polanecký, O., Perlík, F., Adámek, S. & Slanař, O. (2015). OPRM1 and ABCB1 polymorphisms and their effect on postoperative pain relief with piritramide. Physiol Res, 64 Suppl 4, S521-7.
Batool, S., Manzoor, I., Hassnain, S., Bajwa, A., Abbas, M., Mahmood, M. & Sohail, H. (2017). Pattern of addiction and its relapse among habitual drug abusers in Lahore, Pakistan. East Mediterr Health J, 23(3), 168-172.
Bearden, C. E., Jawad, A. F., Lynch, D. R., Sokol, S., Kanes, S. J., McDonald-McGinn, D. M., Saitta, S. C., Harris, S. E., Moss, E., Wang, P. P., Zackai, E., Emanuel, B. S. & Simon, T. J. (2004). Effects of a functional COMT polymorphism on prefrontal cognitive function in patients with 22q11.2 deletion syndrome. Am J Psychiatry, 161(9), 1700-2.
Becker, A., Grecksch, G., Brödemann, R., Kraus, J., Peters, B., Schroeder, H., Thiemann, W., Loh, H. H. & Höllt, V. (2000). Morphine self-administration in mu-opioid receptor-deficient mice. Naunyn Schmiedebergs Arch Pharmacol, 361(6), 584-9.
Becker, A., Grecksch, G., Kraus, J., Loh, H. H., Schroeder, H. & Höllt, V. (2002). Rewarding effects of ethanol and cocaine in mu opioid receptor-deficient mice. Naunyn Schmiedebergs Arch Pharmacol, 365(4), 296-302.
Beer, B., Erb, R., Pavlic, M., Ulmer, H., Giacomuzzi, S., Riemer, Y. & Oberacher, H. (2013). Association of polymorphisms in pharmacogenetic candidate genes (OPRD1, GAL, ABCB1, OPRM1) with opioid dependence in European population: a case-control study. PLoS One, 8(9), e75359.
Benyamina, A., Bonhomme-Faivre, L., Picard, V., Sabbagh, A., Richard, D., Blecha, L., Rahioui, H., Karila, L., Lukasiewicz, M., Farinotti, R., Marill, C. & Reynaud, M. (2009). Association between ABCB1 C3435T polymorphism and increased risk of cannabis dependence. Prog Neuropsychopharmacol Biol Psychiatry, 33(7), 1270-4.
Beuten, J., Payne, T. J., Ma, J. Z. & Li, M. D. (2006). Significant association of catechol-O-methyltransferase (COMT) haplotypes with nicotine dependence in male and female smokers of two ethnic populations. Neuropsychopharmacology, 31(3), 675-84.
130
Bierut, L. J. (2011). Genetic vulnerability and susceptibility to substance dependence. Neuron, 69(4), 618-27.
Bierut, L. J., Goate, A. M., Breslau, N., Johnson, E. O., Bertelsen, S., Fox, L., Agrawal, A., Bucholz, K. K., Grucza, R., Hesselbrock, V., Kramer, J., Kuperman, S., Nurnberger, J., Porjesz, B., Saccone, N. L., Schuckit, M., Tischfield, J., Wang, J. C., Foroud, T., Rice, J. P. & Edenberg, H. J. (2012). ADH1B is associated with alcohol dependence and alcohol consumption in populations of European and African ancestry. Mol Psychiatry, 17(4), 445-50.
Biosystem (2014)[Online], [Accessed 18th February 2016],Available from World Wide Web: http://www.assets.thermofisher.com/TFS-Assets/LGS/manual.htm
Blom Nilsson, M., Chassler, D. & Lundgren, L. M. (2015). Factors associated with work and taking prescribed methadone or buprenorphine among Swedish opiate addicts. Eval Program Plann, 49, 172-7.
Brook, J. S., Saar, N. S., Zhang, C. & Brook, D. W. (2009). Familial and non-familial smoking: effects on smoking and nicotine dependence. Drug Alcohol Depend, 101(1-2), 62-8.
Bühler, K. M., Giné, E., Echeverry-Alzate, V., Calleja-Conde, J., de Fonseca, F. R. & López-Moreno, J. A. (2015). Common single nucleotide variants underlying drug addiction: more than a decade of research. Addict Biol, 20(5), 845-71.
Butelman, E. R., Yuferov, V. & Kreek, M. J. (2012). κ-opioid receptor/dynorphin system: genetic and pharmacotherapeutic implications for addiction. Trends Neurosci, 35(10), 587-96.
Cao, J. X., Hu, J., Ye, X. M., Xia, Y., Haile, C. A., Kosten, T. R. & Zhang, X. Y. (2011). Association between the 5-HTR1B gene polymorphisms and alcohol dependence in a Han Chinese population. Brain Res, 1376, 1-9.
Chambers, G. K., Marshall, S. J., Robinson, G. M., Maguire, S., Newton-Howes, J. & Chong, N. L. (2002). The genetics of alcoholism in Polynesians: alcohol and aldehyde dehydrogenase genotypes in young men. Alcohol Clin Exp Res, 26(7), 949-55.
Charbogne, P., Kieffer, B. L. & Befort, K. (2014). 15 years of genetic approaches in vivo for addiction research: Opioid receptor and peptide gene knockout in mouse models of drug abuse. Neuropharmacology, 76 Pt B, 204-17.
131
Chartoff, E., Sawyer, A., Rachlin, A., Potter, D., Pliakas, A. & Carlezon, W. A. (2012). Blockade of kappa opioid receptors attenuates the development of depressive- like behaviors induced by cocaine withdrawal in rats. Neuropharmacology, 62(1), 167-76.
Chen, C. J., Chin, J. E., Ueda, K., Clark, D. P., Pastan, I., Gottesman, M. M. & Roninson, I. B. (1986). Internal duplication and homology with bacterial transport proteins in the mdr1 (P-glycoprotein) gene from multidrug-resistant human cells. Cell, 47(3), 381-9.
Chen, J., Lipska, B. K., Halim, N., Ma, Q. D., Matsumoto, M., Melhem, S., Kolachana, B. S., Hyde, T. M., Herman, M. M., Apud, J., Egan, M. F., Kleinman, J. E. & Weinberger, D. R. (2004). Functional analysis of genetic variation in catechol-O- methyltransferase (COMT): effects on mRNA, protein, and enzyme activity in postmortem human brain. Am J Hum Genet, 75(5), 807-21.
Chen, L. S., Saccone, N. L., Culverhouse, R. C., Bracci, P. M., Chen, C. H., Dueker, N., Han, Y., Huang, H., Jin, G., Kohno, T., Ma, J. Z., Przybeck, T. R., Sanders, A. R., Smith, J. A., Sung, Y. J., Wenzlaff, A. S., Wu, C., Yoon, D., Chen, Y. T., Cheng, Y. C., Cho, Y. S., David, S. P., Duan, J., Eaton, C. B., Furberg, H., Goate, A. M., Gu, D., Hansen, H. M., Hartz, S., Hu, Z., Kim, Y. J., Kittner, S. J., Levinson, D. F., Mosley, T. H., Payne, T. J., Rao, D. C., Rice, J. P., Rice, T. K., Schwantes-An, T. H., Shete, S. S., Shi, J., Spitz, M. R., Sun, Y. V., Tsai, F. J., Wang, J. C., Wrensch, M. R., Xian, H., Gejman, P. V., He, J., Hunt, S. C., Kardia, S. L., Li, M. D., Lin, D., Mitchell, B. D., Park, T., Schwartz, A. G., Shen, H., Wiencke, J. K., Wu, J. Y., Yokota, J., Amos, C. I. & Bierut, L. J. (2012). Smoking and genetic risk variation across populations of European, Asian, and African American ancestry--a meta-analysis of chromosome 15q25. Genet Epidemiol, 36(4), 340-51.
Chen, V. C., Wu, M. H., Lin, T. Y., Ho, Y. F., Wang, H. Y. & Gossop, M. (2015). Comparison of socio-demographic characteristics, substance, and depression among male heroin users attending therapeutic community and methadone maintenance treatment program in Nantou, Taiwan. Subst Abuse Treat Prev Policy, 10, 41.
Chen, Y. C., Lu, R. B., Peng, G. S., Wang, M. F., Wang, H. K., Ko, H. C., Chang, Y. C., Lu, J. J., Li, T. K. & Yin, S. J. (1999). Alcohol metabolism and cardiovascular response in an alcoholic patient homozygous for the ALDH2*2 variant gene allele. Alcohol Clin Exp Res, 23(12), 1853-60.
132
Chowbay, B., Cumaraswamy, S., Cheung, Y. B., Zhou, Q. & Lee, E. J. (2003). Genetic polymorphisms in MDR1 and CYP3A4 genes in Asians and the influence of MDR1 haplotypes on cyclosporin disposition in heart transplant recipients. Pharmacogenetics, 13(2), 89-95.
Chu, C. J., Yang, Y. C., Wei, J. X. & Zhang, L. (2011). Association of nicotinic acetylcholine receptor subunit alpha-4 polymorphisms with smoking behaviors in Chinese male smokers. Chin Med J (Engl), 124(11), 1634-8.
Cicero, T. J., Ellis, M. S. & Surratt, H. L. (2012). Effect of abuse-deterrent formulation of OxyContin. N Engl J Med, 367(2), 187-9.
CL, M., L, S., L, S., RA, R., P, S., L, X., NO, W. & L, P. (2017). Annual Surveillance Report of Drug Related Risks and Outcomes. USA: CDC National Center for Injury Prevention and Control.
Clarke, T. K., Ambrose-Lanci, L., Ferraro, T. N., Berrettini, W. H., Kampman, K. M., Dackis, C. A., Pettinati, H. M., O'Brien, C. P., Oslin, D. W. & Lohoff, F. W. (2012). Genetic association analyses of PDYN polymorphisms with heroin and cocaine addiction. Genes Brain Behav, 11(4), 415-23.
Clarke, T. K., Krause, K., Li, T. & Schumann, G. (2009). An association of prodynorphin polymorphisms and opioid dependence in females in a Chinese population. Addict Biol, 14(3), 366-70.
Coller, J. K., Barratt, D. T., Dahlen, K., Loennechen, M. H. & Somogyi, A. A. (2006). ABCB1 genetic variability and methadone dosage requirements in opioid- dependent individuals. Clin Pharmacol Ther, 80(6), 682-90.
Coulbault, L., Beaussier, M., Verstuyft, C., Weickmans, H., Dubert, L., Trégouet, D., Descot, C., Parc, Y., Lienhart, A., Jaillon, P. & Becquemont, L. (2006). Environmental and genetic factors associated with morphine response in the postoperative period. Clin Pharmacol Ther, 79(4), 316-24.
Covault, J., Gelernter, J., Hesselbrock, V., Nellissery, M. & Kranzler, H. R. (2004). Allelic and haplotypic association of GABRA2 with alcohol dependence. Am J Med Genet B Neuropsychiatr Genet, 129B(1), 104-9.
Covault, J., Gelernter, J., Jensen, K., Anton, R. & Kranzler, H. R. (2008). Markers in the 5'-region of GABRG1 associate to alcohol dependence and are in linkage disequilibrium with markers in the adjacent GABRA2 gene. Neuropsychopharmacology, 33(4), 837-48.
133
Cox, B. M. (1982). Endogenous opioid peptides: a guide to structures and terminology. Life Sci, 31(16-17), 1645-58.
Crettol, S., Déglon, J. J., Besson, J., Croquette-Krokar, M., Hämmig, R., Gothuey, I., Monnat, M. & Eap, C. B. (2006). ABCB1 and cytochrome P450 genotypes and phenotypes: influence on methadone plasma levels and response to treatment. Clin Pharmacol Ther, 80(6), 668-81.
Crist, R. C., Ambrose-Lanci, L. M., Vaswani, M., Clarke, T. K., Zeng, A., Yuan, C., Ferraro, T. N., Hakonarson, H., Kampman, K. M., Dackis, C. A., Pettinati, H. M., O'Brien, C. P., Oslin, D. W., Doyle, G. A., Lohoff, F. W. & Berrettini, W. H. (2013a). Case-control association analysis of polymorphisms in the delta-opioid receptor, OPRD1, with cocaine and opioid addicted populations. Drug Alcohol Depend, 127(1-3), 122-8.
Crist, R. C., Ambrose-Lanci, L. M., Vaswani, M., Clarke, T. K., Zeng, A., Yuan, C., Ferraro, T. N., Hakonarson, H., Kampman, K. M., Dackis, C. A., Pettinati, H. M., O'Brien, C. P., Oslin, D. W., Doyle, G. A., Lohoff, F. W. & Berrettini, W. H. (2013b). Case-control association analysis of polymorphisms in the δ-opioid receptor, OPRD1, with cocaine and opioid addicted populations. Drug Alcohol Depend, 127(1-3), 122-8.
Dagenais, C., Graff, C. L. & Pollack, G. M. (2004). Variable modulation of opioid brain uptake by P-glycoprotein in mice. Biochem Pharmacol, 67(2), 269-76.
De Klerk, O. L., Bosker, F. J., Luurtsema, G., Nolte, I. M., Dierckx, R., Den Boer, J. A. & Potschka, H. (2011). The role of p-glycoprotein in psychiatric disorders: a reliable guard of the brain? Cent Nerv Syst Agents Med Chem, 11(3), 197-209.
Degenhardt, L., Whiteford, H. A., Ferrari, A. J., Baxter, A. J., Charlson, F. J., Hall, W. D., Freedman, G., Burstein, R., Johns, N., Engell, R. E., Flaxman, A., Murray, C. J. & Vos, T. (2013). Global burden of disease attributable to illicit drug use and dependence: findings from the Global Burden of Disease Study 2010. Lancet, 382(9904), 1564-74.
Dhawan, A., Pattanayak, R. D., Chopra, A., Tikoo, V. K. & Kumar, R. (2016). Injection drug use among children and adolescents in India: Ringing the alarm bells. Indian J Psychiatry, 58(4), 387-393.
Dhawan, A., Pattanayak, R. D., Chopra, A., Tikoo, V. K. & Kumar, R. (2017a). Pattern and profile of children using substances in India: Insights and recommendations. Natl Med J India, 30(4), 224-229.
134
Dhawan, A., Rao, R., Ambekar, A., Pusp, A. & Ray, R. (2017b). Treatment of substance use disorders through the government health facilities: Developments in the "Drug De-addiction Programme" of Ministry of Health and Family Welfare, Government of India. Indian J Psychiatry, 59(3), 380-384.
Diatchenko, L., Slade, G. D., Nackley, A. G., Bhalang, K., Sigurdsson, A., Belfer, I., Goldman, D., Xu, K., Shabalina, S. A., Shagin, D., Max, M. B., Makarov, S. S. & Maixner, W. (2005). Genetic basis for individual variations in pain perception and the development of a chronic pain condition. Hum Mol Genet, 14(1), 135-43.
Dick, D. M., Agrawal, A., Schuckit, M. A., Bierut, L., Hinrichs, A., Fox, L., Mullaney, J., Cloninger, C. R., Hesselbrock, V., Nurnberger, J. I., Almasy, L., Foroud, T., Porjesz, B., Edenberg, H. & Begleiter, H. (2006a). Marital status, alcohol dependence, and GABRA2: evidence for gene-environment correlation and interaction. J Stud Alcohol, 67(2), 185-94.
Dick, D. M., Bierut, L., Hinrichs, A., Fox, L., Bucholz, K. K., Kramer, J., Kuperman, S., Hesselbrock, V., Schuckit, M., Almasy, L., Tischfield, J., Porjesz, B., Begleiter, H., Nurnberger, J., Xuei, X., Edenberg, H. J. & Foroud, T. (2006b). The role of GABRA2 in risk for conduct disorder and alcohol and drug dependence across developmental stages. Behav Genet, 36(4), 577-90.
DiFranza, J. R. (2016). Can tobacco dependence provide insights into other drug addictions? BMC Psychiatry, 16(1), 365.
Do, E. K., Prom-Wormley, E. C., Eaves, L. J., Silberg, J. L., Miles, D. R. & Maes, H. H. (2015). Genetic and Environmental Influences on Smoking Behavior across Adolescence and Young Adulthood in the Virginia Twin Study of Adolescent Behavioral Development and the Transitions to Substance Abuse Follow-Up. Twin Res Hum Genet, 18(1), 43-51.
Ducci, F. & Goldman, D. (2012). The genetic basis of addictive disorders. Psychiatr Clin North Am, 35(2), 495-519.
Edenberg, H. J. (2007). The genetics of alcohol metabolism: role of alcohol dehydrogenase and aldehyde dehydrogenase variants. Alcohol Res Health, 30(1), 5-13.
Edenberg, H. J. & Foroud, T. (2006). The genetics of alcoholism: identifying specific genes through family studies. Addict Biol, 11(3-4), 386-96.
135
Enoch, M. A. (2008). The role of GABA(A) receptors in the development of alcoholism. Pharmacol Biochem Behav, 90(1), 95-104.
European.Drug Report (2017)[Online], [Accessed 22nd January 2017],Available from World Wide Web: http://www.emcdda.europa.eu/edr 2017 htm
Fellay, J., Marzolini, C., Meaden, E. R., Back, D. J., Buclin, T., Chave, J. P., Decosterd, L. A., Furrer, H., Opravil, M., Pantaleo, G., Retelska, D., Ruiz, L., Schinkel, A. H., Vernazza, P., Eap, C. B., Telenti, A. & Study, S. H. C. (2002). Response to antiretroviral treatment in HIV-1-infected individuals with allelic variants of the multidrug resistance transporter 1: a pharmacogenetics study. Lancet, 359(9300), 30-6.
Filliol, D., Ghozland, S., Chluba, J., Martin, M., Matthes, H. W., Simonin, F., Befort, K., Gavériaux-Ruff, C., Dierich, A., LeMeur, M., Valverde, O., Maldonado, R. & Kieffer, B. L. (2000). Mice deficient for delta- and mu-opioid receptors exhibit opposing alterations of emotional responses. Nat Genet, 25(2), 195-200.
Fonseca, F., Gratacòs, M., Escaramís, G., De Cid, R., Martín-Santos, R., Fernández- Espejo, E., Estivill, X. & Torrens, M. (2010). Response to methadone maintenance treatment is associated with the MYOCD and GRM6 genes. Mol Diagn Ther, 14(3), 171-8.
Foroud, T., Wetherill, L. F., Kramer, J., Tischfield, J. A., Nurnberger, J. I., Schuckit, M. A., Xuei, X. & Edenberg, H. J. (2008). The tachykinin receptor 3 is associated with alcohol and cocaine dependence. Alcohol Clin Exp Res, 32(6), 1023-30.
Fowler, J. S., Volkow, N. D., Kassed, C. A. & Chang, L. (2007). Imaging the addicted human brain. Sci Pract Perspect, 3(2), 4-16.
Franke, P., Nöthen, M. M., Wang, T., Neidt, H., Knapp, M., Lichtermann, D., Weiffenbach, O., Mayer, P., Höllt, V., Propping, P. & Maier, W. (1999). Human delta-opioid receptor gene and susceptibility to heroin and alcohol dependence. Am J Med Genet, 88(5), 462-4.
Frazer, K. A., Murray, S. S., Schork, N. J. & Topol, E. J. (2009). Human genetic variation and its contribution to complex traits. Nat Rev Genet, 10(4), 241-51.
Frosch, D. L., Nahom, D. & Shoptaw, S. (2002). Optimizing smoking cessation outcomes among the methadone maintained. J Subst Abuse Treat, 23(4), 425-30.
136
Frosch, D. L., Shoptaw, S., Nahom, D. & Jarvik, M. E. (2000). Associations between tobacco smoking and illicit drug use among methadone-maintained opiate- dependent individuals. Exp Clin Psychopharmacol, 8(1), 97-103.
Fujii, T., Ota, M., Hori, H., Sasayama, D., Hattori, K., Teraishi, T., Yamamoto, N., Hashikura, M., Tatsumi, M., Higuchi, T. & Kunugi, H. (2012). Association between the functional polymorphism (C3435T) of the gene encoding P- glycoprotein (ABCB1) and major depressive disorder in the Japanese population. J Psychiatr Res, 46(4), 555-9.
Furberg, H., Ostroff, J., Lerman, C. & Sullivan, P. F. (2010). The public health utility of genome-wide association study results for smoking behavior. Genome Med, 2(4), 26.
Gaikovitch, E. A., Cascorbi, I., Mrozikiewicz, P. M., Brockmöller, J., Frötschl, R., Köpke, K., Gerloff, T., Chernov, J. N. & Roots, I. (2003). Polymorphisms of drug-metabolizing enzymes CYP2C9, CYP2C19, CYP2D6, CYP1A1, NAT2 and of P-glycoprotein in a Russian population. Eur J Clin Pharmacol, 59(4), 303-12.
Galinsky, K. J., Bhatia, G., Loh, P. R., Georgiev, S., Mukherjee, S., Patterson, N. J. & Price, A. L. (2016). Fast Principal-Component Analysis Reveals Convergent Evolution of ADH1B in Europe and East Asia. Am J Hum Genet, 98(3), 456-472.
Gelernter, J. & Kranzler, H. R. (2000). Variant detection at the delta opioid receptor (OPRD1) locus and population genetics of a novel variant affecting protein sequence. Hum Genet, 107(1), 86-8.
Gelernter, J., Kranzler, H. R., Sherva, R., Almasy, L., Koesterer, R., Smith, A. H., Anton, R., Preuss, U. W., Ridinger, M., Rujescu, D., Wodarz, N., Zill, P., Zhao, H. & Farrer, L. A. (2014). Genome-wide association study of alcohol dependence:significant findings in African- and European-Americans including novel risk loci. Mol Psychiatry, 19(1), 41-9.
Gerra, G., Leonardi, C., Cortese, E., D'Amore, A., Lucchini, A., Strepparola, G., Serio, G., Farina, G., Magnelli, F., Zaimovic, A., Mancini, A., Turci, M., Manfredini, M. & Donnini, C. (2007). Human kappa opioid receptor gene (OPRK1) polymorphism is associated with opiate addiction. Am J Med Genet B Neuropsychiatr Genet, 144B(6), 771-5.
Gerrits, M. A., Lesscher, H. B. & van Ree, J. M. (2003). Drug dependence and the endogenous opioid system. Eur Neuropsychopharmacol, 13(6), 424-34.
137
Ghodke, Y., Chopra, A., Shintre, P., Puranik, A., Joshi, K. & Patwardhan, B. (2011). Profiling single nucleotide polymorphisms (SNPs) across intracellular folate metabolic pathway in healthy Indians. Indian J Med Res, 133, 274-9.
Glasel, J. A. (1995). Validity of nucleic acid purities monitored by 260nm/280nm absorbance ratios. Biotechniques, 18(1), 62-3.
Goldman, D., Oroszi, G. & Ducci, F. (2005). The genetics of addictions: uncovering the genes. Nat Rev Genet, 6(7), 521-32.
Gothelf, D., Eliez, S., Thompson, T., Hinard, C., Penniman, L., Feinstein, C., Kwon, H., Jin, S., Jo, B., Antonarakis, S. E., Morris, M. A. & Reiss, A. L. (2005). COMT genotype predicts longitudinal cognitive decline and psychosis in 22q11.2 deletion syndrome. Nat Neurosci, 8(11), 1500-2.
Grossman, M. H., Emanuel, B. S. & Budarf, M. L. (1992). Chromosomal mapping of the human catechol-O-methyltransferase gene to 22q11.1----q11.2. Genomics, 12(4), 822-5.
Gümüş-Akay, G., Rüstemoğlu, A., Karadağ, A. & Sunguroğlu, A. (2008). Genotype and allele frequencies of MDR1 gene C1236T polymorphism in a Turkish population. Genet Mol Res, 7(4), 1193-9.
Hack, S. P., Bagley, E. E., Chieng, B. C. & Christie, M. J. (2005). Induction of delta- opioid receptor function in the midbrain after chronic morphine treatment. J Neurosci, 25(12), 3192-8.
Heath, A. C., Bucholz, K. K., Madden, P. A., Dinwiddie, S. H., Slutske, W. S., Bierut, L. J., Statham, D. J., Dunne, M. P., Whitfield, J. B. & Martin, N. G. (1997). Genetic and environmental contributions to alcohol dependence risk in a national twin sample: consistency of findings in women and men. Psychol Med, 27(6), 1381- 96.
Hendershot, C. S. (2011). Genetic testing for aldehyde dehydrogenase 2 deficiency in young adults. Pharmacogenomics J, 11(4), 247-50.
Herz, R. S. (1998). Are odors the best cues to memory? A cross-modal comparison of associative memory stimuli. Ann N Y Acad Sci, 855, 670-4.
Higuchi, S., Matsushita, S., Masaki, T., Yokoyama, A., Kimura, M., Suzuki, G. & Mochizuki, H. (2004). Influence of genetic variations of ethanol-metabolizing
138
enzymes on phenotypes of alcohol-related disorders. Ann N Y Acad Sci, 1025, 472-80.
Ho, A. M., Tang, N. L., Cheung, B. K. & Stadlin, A. (2008). Dopamine receptor D4 gene -521C/T polymorphism is associated with opioid dependence through cold- pain responses. Ann N Y Acad Sci, 1139, 20-6.
Ho, G. T., Soranzo, N., Nimmo, E. R., Tenesa, A., Goldstein, D. B. & Satsangi, J. (2006). ABCB1/MDR1 gene determines susceptibility and phenotype in ulcerative colitis: discrimination of critical variants using a gene-wide haplotype tagging approach. Hum Mol Genet, 15(5), 797-805.
Hoffmeyer, S., Burk, O., von Richter, O., Arnold, H. P., Brockmöller, J., Johne, A., Cascorbi, I., Gerloff, T., Roots, I., Eichelbaum, M. & Brinkmann, U. (2000). Functional polymorphisms of the human multidrug-resistance gene: multiple sequence variations and correlation of one allele with P-glycoprotein expression and activity in vivo. Proc Natl Acad Sci U S A, 97(7), 3473-8.
Horinouchi, M., Sakaeda, T., Nakamura, T., Morita, Y., Tamura, T., Aoyama, N., Kasuga, M. & Okumura, K. (2002). Significant genetic linkage of MDR1 polymorphisms at positions 3435 and 2677: functional relevance to pharmacokinetics of digoxin. Pharm Res, 19(10), 1581-5.
Huang, C. Y. & Tan, T. H. (2012). DUSPs, to MAP kinases and beyond. Cell Biosci, 2(1), 24.
Hukkanen, J., Jacob, P. & Benowitz, N. L. (2005). Metabolism and disposition kinetics of nicotine. Pharmacol Rev, 57(1), 79-115.
Hung, C. C., Chiou, M. H., Huang, B. H., Hsieh, Y. W., Hsieh, T. J., Huang, C. L. & Lane, H. Y. (2011). Impact of genetic polymorphisms in ABCB1, CYP2B6, OPRM1, ANKK1 and DRD2 genes on methadone therapy in Han Chinese patients. Pharmacogenomics, 12(11), 1525-33.
Hung, C. C., Chiou, M. H., Teng, Y. N., Hsieh, Y. W., Huang, C. L. & Lane, H. Y. (2013). Functional impact of ABCB1 variants on interactions between P- glycoprotein and methadone. PLoS One, 8(3), e59419.
Hurd, Y. L. (1996). Differential messenger RNA expression of prodynorphin and proenkephalin in the human brain. Neuroscience, 72(3), 767-83.
139
Hurd, Y. L. & Herkenham, M. (1995). The human neostriatum shows compartmentalization of neuropeptide gene expression in dorsal and ventral regions: an in situ hybridization histochemical analysis. Neuroscience, 64(3), 571-86.
Husemoen, L. L., Fenger, M., Friedrich, N., Tolstrup, J. S., Beenfeldt Fredriksen, S. & Linneberg, A. (2008). The association of ADH and ALDH gene variants with alcohol drinking habits and cardiovascular disease risk factors. Alcohol Clin Exp Res, 32(11), 1984-91.
Huynh, H., Bottini, N., Williams, S., Cherepanov, V., Musumeci, L., Saito, K., Bruckner, S., Vachon, E., Wang, X., Kruger, J., Chow, C. W., Pellecchia, M., Monosov, E., Greer, P. A., Trimble, W., Downey, G. P. & Mustelin, T. (2004). Control of vesicle fusion by a tyrosine phosphatase. Nat Cell Biol, 6(9), 831-9.
Hyman, S. E. & Malenka, R. C. (2001). Addiction and the brain: the neurobiology of compulsion and its persistence. Nat Rev Neurosci, 2(10), 695-703.
Iismaa, T. P. & Shine, J. (1992). G protein-coupled receptors. Curr Opin Cell Biol, 4(2), 195-202.
International Narcotic Control Strategy (2017) [Online], [Accessed 18th January 2018],Available from World Wide Web: http://www.state.gov./i/inl/rls/nrcrpt/2017.htm
Isaza, C., Henao, J., Beltrán, L., Porras, L., Gonzalez, M., Cruz, R. & Carracedo, A. (2013). Genetic variants associated with addictive behavior in Colombian addicted and non-addicted to heroin or cocaine. Colomb Med (Cali), 44(1), 19- 25.
Ittiwut, C., Yang, B. Z., Kranzler, H. R., Anton, R. F., Hirunsatit, R., Weiss, R. D., Covault, J., Farrer, L. A. & Gelernter, J. (2012). GABRG1 and GABRA2 variation associated with alcohol dependence in African Americans. Alcohol Clin Exp Res, 36(4), 588-93.
Ittiwut, R., Listman, J. B., Ittiwut, C., Cubells, J. F., Weiss, R. D., Brady, K., Oslin, D., Farrer, L. A., Kranzler, H. R. & Gelernter, J. (2011). Association between polymorphisms in catechol-O-methyltransferase (COMT) and cocaine-induced paranoia in European-American and African-American populations. Am J Med Genet B Neuropsychiatr Genet, 156B(6), 651-60.
140
Jabbi, M., Kema, I. P., van der Pompe, G., te Meerman, G. J., Ormel, J. & den Boer, J. A. (2007). Catechol-o-methyltransferase polymorphism and susceptibility to major depressive disorder modulates psychological stress response. Psychiatr Genet, 17(3), 183-93.
Jamroziak, K., Balcerczak, E., Smolewski, P., Robey, R. W., Cebula, B., Panczyk, M., Kowalczyk, M., Szmigielska-Kapłon, A., Mirowski, M., Bates, S. E. & Robak, T. (2006). MDR1 (ABCB1) gene polymorphism C3435T is associated with P- glycoprotein activity in B-cell chronic lymphocytic leukemia. Pharmacol Rep, 58(5), 720-8.
Jeannesson, E., Albertini, L., Siest, G., Gomes, A. M., Ribeiro, V., Aslanidis, C., Schmitz, G. & Visvikis-Siest, S. (2007). Determination of ABCB1 polymorphisms and haplotypes frequencies in a French population. Fundam Clin Pharmacol, 21(4), 411-8.
Jones, J. D., Luba, R. R., Vogelman, J. L. & Comer, S. D. (2016). Searching for evidence of genetic mediation of opioid withdrawal by opioid receptor gene polymorphisms. Am J Addict, 25(1), 41-8.
Kalsi, G., Euesden, J., Coleman, J. R., Ducci, F., Aliev, F., Newhouse, S. J., Liu, X., Ma, X., Wang, Y., Collier, D. A., Asherson, P., Li, T. & Breen, G. (2016). Genome- Wide Association of Heroin Dependence in Han Chinese. PLoS One, 11(12), e0167388.
Karkhanis, A., Holleran, K. M. & Jones, S. R. (2017). Dynorphin/Kappa Opioid Receptor Signaling in Preclinical Models of Alcohol, Drug, and Food Addiction. Int Rev Neurobiol, 136, 53-88.
Karp, I., O'Loughlin, J., Paradis, G., Hanley, J. & Difranza, J. (2005). Smoking trajectories of adolescent novice smokers in a longitudinal study of tobacco use. Ann Epidemiol, 15(6), 445-52.
Kato, M., Fukuda, T., Serretti, A., (2008). ABCB1 (MDR1) gene polymorphisms are associated with the clinical response to paroxetine in patients with major depressive disorder. Biol. Psychiatry, 32, 398-404.
Kendler, K. S. (2005). "A gene for...": the nature of gene action in psychiatric disorders. Am J Psychiatry, 162(7), 1243-52.
Kendler, K. S., Jacobson, K. C., Prescott, C. A. & Neale, M. C. (2003). Specificity of genetic and environmental risk factors for use and abuse/dependence of cannabis,
141
cocaine, hallucinogens, sedatives, stimulants, and opiates in male twins. Am J Psychiatry, 160(4), 687-95.
Kendler, K. S., Karkowski, L. M., Corey, L. A., Prescott, C. A. & Neale, M. C. (1999). Genetic and environmental risk factors in the aetiology of illicit drug initiation and subsequent misuse in women. Br J Psychiatry, 175, 351-6.
Kendler, K. S. & Myers, J. (2015). Addiction resistance: Definition, validation and association with mastery. Drug Alcohol Depend, 154, 236-42.
Kendler, K. S., Schmitt, E., Aggen, S. H. & Prescott, C. A. (2008). Genetic and environmental influences on alcohol, caffeine, cannabis, and nicotine use from early adolescence to middle adulthood. Arch Gen Psychiatry, 65(6), 674-82.
Kerb, R. (2006). Implications of genetic polymorphisms in drug transporters for pharmacotherapy. Cancer Lett, 234(1), 4-33.
Kereszturi, E., Kiraly, O., Barta, C., Molnar, N., Sasvari-Szekely, M. & Csapo, Z. (2006). No direct effect of the -521 C/T polymorphism in the human dopamine D4 receptor gene promoter on transcriptional activity. BMC Mol Biol, 7, 18.
Khabour, O. F., Alzoubi, K. H., Al-Azzam, S. I. & Mhaidat, N. M. (2013). Frequency of MDR1 single nucleotide polymorphisms in a Jordanian population, including a novel variant. Genet Mol Res, 12(1), 801-8.
Kim, K. M., Kim, H. S., Lim, S. H., Cheong, S. H., Choi, E. J., Kang, H., Choi, H. R., Jeon, J. W., Yon, J. H., Oh, M. & Shin, J. G. (2013). Effects of genetic polymorphisms of OPRM1, ABCB1, CYP3A4/5 on postoperative fentanyl consumption in Korean gynecologic patients. Int J Clin Pharmacol Ther, 51(5), 383-92.
Kim, R. B., Leake, B. F., Choo, E. F., Dresser, G. K., Kubba, S. V., Schwarz, U. I., Taylor, A., Xie, H. G., McKinsey, J., Zhou, S., Lan, L. B., Schuetz, J. D., Schuetz, E. G. & Wilkinson, G. R. (2001). Identification of functionally variant MDR1 alleles among European Americans and African Americans. Clin Pharmacol Ther, 70(2), 189-99.
Kimchi-Sarfaty, C., Oh, J. M., Kim, I. W., Sauna, Z. E., Calcagno, A. M., Ambudkar, S. V. & Gottesman, M. M. (2007). A "silent" polymorphism in the MDR1 gene changes substrate specificity. Science, 315(5811), 525-8.
142
Köhnke, M. D., Batra, A., Kolb, W., Köhnke, A. M., Lutz, U., Schick, S. & Gaertner, I. (2005). Association of the dopamine transporter gene with alcoholism. Alcohol Alcohol, 40(5), 339-42.
Komoto, C., Nakamura, T., Sakaeda, T., Kroetz, D. L., Yamada, T., Omatsu, H., Koyama, T., Okamura, N., Miki, I., Tamura, T., Aoyama, N., Kasuga, M. & Okumura, K. (2006). MDR1 haplotype frequencies in Japanese and Caucasian, and in Japanese patients with colorectal cancer and esophageal cancer. Drug Metab Pharmacokinet, 21(2), 126-32.
Konishi, T., Luo, H. R., Calvillo, M., Mayo, M. S., Lin, K. M. & Wan, Y. J. (2004). ADH1B*1, ADH1C*2, DRD2 (-141C Ins), and 5-HTTLPR are associated with alcoholism in Mexican American men living in Los Angeles. Alcohol Clin Exp Res, 28(8), 1145-52.
Koob, G. F. (2017). Antireward, compulsivity, and addiction: seminal contributions of Dr. Athina Markou to motivational dysregulation in addiction. Psychopharmacology (Berl), 234(9-10), 1315-1332.
Koob, G. F. & Le Moal, M. (1997). Drug abuse: hedonic homeostatic dysregulation. Science, 278(5335), 52-8.
Koob, G. F. & Le Moal, M. (2008). Addiction and the brain antireward system. Annu Rev Psychol, 59, 29-53.
Koob, G. F. & Nestler, E. J. (1997). The neurobiology of drug addiction. J Neuropsychiatry Clin Neurosci, 9(3), 482-97.
Koob, G. F. & Volkow, N. D. (2010). Neurocircuitry of addiction. Neuropsychopharmacology, 35(1), 217-38.
Kreek, M. J. (2000). Methadone-related opioid agonist pharmacotherapy for heroin addiction. History, recent molecular and neurochemical research and future in mainstream medicine. Ann N Y Acad Sci, 909, 186-216.
Kreek, M. J., Bart, G., Lilly, C., LaForge, K. S. & Nielsen, D. A. (2005a). Pharmacogenetics and human molecular genetics of opiate and cocaine addictions and their treatments. Pharmacol Rev, 57(1), 1-26.
Kreek, M. J. & LaForge, K. S. (2007). Stress responsivity, addiction, and a functional variant of the human mu-opioid receptor gene. Mol Interv, 7(2), 74-8.
143
Kreek, M. J., LaForge, K. S. & Butelman, E. (2002). Pharmacotherapy of addictions. Nat Rev Drug Discov, 1(9), 710-26.
Kreek, M. J., Levran, O., Reed, B., Schlussman, S. D., Zhou, Y. & Butelman, E. R. (2012). Opiate addiction and cocaine addiction: underlying molecular neurobiology and genetics. J Clin Invest, 122(10), 3387-93.
Kreek, M. J., Nielsen, D. A., Butelman, E. R. & LaForge, K. S. (2005b). Genetic influences on impulsivity, risk taking, stress responsivity and vulnerability to drug abuse and addiction. Nat Neurosci, 8(11), 1450-7.
Kruglyak, L. (1999). Prospects for whole-genome linkage disequilibrium mapping of common disease genes. Nat Genet, 22(2), 139-44.
Kumar, D., Chakraborty, J. & Das, S. (2012). Epistatic effects between variants of kappa-opioid receptor gene and A118G of mu-opioid receptor gene increase susceptibility to addiction in Indian population. Prog Neuropsychopharmacol Biol Psychiatry, 36(2), 225-30.
Lachman, H. M., Papolos, D. F., Saito, T., Yu, Y. M., Szumlanski, C. L. & Weinshilboum, R. M. (1996). Human catechol-O-methyltransferase pharmacogenetics: description of a functional polymorphism and its potential application to neuropsychiatric disorders. Pharmacogenetics, 6(3), 243-50.
LaForge, K. S., Yuferov, V. & Kreek, M. J. (2000). Opioid receptor and peptide gene polymorphisms: potential implications for addictions. Eur J Pharmacol, 410(2- 3), 249-268.
Lai, J. H., Zhu, Y. S., Huo, Z. H., Sun, R. F., Yu, B., Wang, Y. P., Chai, Z. Q. & Li, S. B. (2010). Association study of polymorphisms in the promoter region of DRD4 with schizophrenia, depression, and heroin addiction. Brain Res, 1359, 227-32.
Lai, S., Lai, H., Page, J. B. & McCoy, C. B. (2000). The association between cigarette smoking and drug abuse in the United States. J Addict Dis, 19(4), 11-24.
Land, B. B., Bruchas, M. R., Lemos, J. C., Xu, M., Melief, E. J. & Chavkin, C. (2008). The dysphoric component of stress is encoded by activation of the dynorphin kappa-opioid system. J Neurosci, 28(2), 407-14.
Lappalainen, J., Krupitsky, E., Remizov, M., Pchelina, S., Taraskina, A., Zvartau, E., Somberg, L. K., Covault, J., Kranzler, H. R., Krystal, J. H. & Gelernter, J.
144
(2005). Association between alcoholism and gamma-amino butyric acid alpha2 receptor subtype in a Russian population. Alcohol Clin Exp Res, 29(4), 493-8.
Lauzon, N. M. & Laviolette, S. R. (2010). Dopamine D4-receptor modulation of cortical neuronal network activity and emotional processing: Implications for neuropsychiatric disorders. Behav Brain Res, 208(1), 12-22.
Le Merrer, J., Becker, J. A., Befort, K. & Kieffer, B. L. (2009). Reward processing by the opioid system in the brain. Physiol Rev, 89(4), 1379-412.
Levran, O., Londono, D., O'Hara, K., Nielsen, D. A., Peles, E., Rotrosen, J., Casadonte, P., Linzy, S., Randesi, M., Ott, J., Adelson, M. & Kreek, M. J. (2008a). Genetic susceptibility to heroin addiction: a candidate gene association study. Genes Brain Behav, 7(7), 720-9.
Levran, O., O'Hara, K., Peles, E., Li, D., Barral, S., Ray, B., Borg, L., Ott, J., Adelson, M. & Kreek, M. J. (2008b). ABCB1 (MDR1) genetic variants are associated with methadone doses required for effective treatment of heroin dependence. Hum Mol Genet, 17(14), 2219-27.
Levran, O., Yuferov, V. & Kreek, M. J. (2012). The genetics of the opioid system and specific drug addictions. Hum Genet, 131(6), 823-42.
Li, D., Zhao, H. & Gelernter, J. (2012a). Strong protective effect of the aldehyde dehydrogenase gene (ALDH2) 504lys (*2) allele against alcoholism and alcohol- induced medical diseases in Asians. Hum Genet, 131(5), 725-37.
Li, M. D. & Burmeister, M. (2009). New insights into the genetics of addiction. Nat Rev Genet, 10(4), 225-31.
Li, T., Du, J., Yu, S., Jiang, H., Fu, Y., Wang, D., Sun, H., Chen, H. & Zhao, M. (2012b). Pathways to age of onset of heroin use: a structural model approach exploring the relationship of the COMT gene, impulsivity and childhood trauma. PLoS One, 7(11), e48735.
Li, T., Yu, S., Du, J., Chen, H., Jiang, H., Xu, K., Fu, Y., Wang, D. & Zhao, M. (2011). Role of novelty seeking personality traits as mediator of the association between COMT and onset age of drug use in Chinese heroin dependent patients. PLoS One, 6(8), e22923.
145
Li, T., Zhu, Z. H., Liu, X., Hu, X., Zhao, J., Sham, P. C. & Collier, D. A. (2000). Association analysis of polymorphisms in the DRD4 gene and heroin abuse in Chinese subjects. Am J Med Genet, 96(5), 616-21.
Lind, P. A., Eriksson, C. J. & Wilhelmsen, K. C. (2008). The role of aldehyde dehydrogenase-1 (ALDH1A1) polymorphisms in harmful alcohol consumption in a Finnish population. Hum Genomics, 3(1), 24-35.
Linneberg, A., Fenger, R. V., Husemoen, L. L., Vidal, C., Vizcaino, L. & Gonzalez- Quintela, A. (2010). Immunoglobulin E sensitization to cross-reactive carbohydrate determinants: epidemiological study of clinical relevance and role of alcohol consumption. Int Arch Allergy Immunol, 153(1), 86-94.
Liu, T., David, S. P., Tyndale, R. F., Wang, H., Zhou, Q., Ding, P., He, Y. H., Yu, X. Q., Chen, W., Crump, C., Wen, X. Z. & Chen, W. Q. (2011). Associations of CYP2A6 genotype with smoking behaviors in southern China. Addiction, 106(5), 985-94.
Livak, K. J., Flood, S. J., Marmaro, J., Giusti, W. & Deetz, K. (1995). Oligonucleotides with fluorescent dyes at opposite ends provide a quenched probe system useful for detecting PCR product and nucleic acid hybridization. PCR Methods Appl, 4(6), 357-62.
Lohoff, F. W., Weller, A. E., Bloch, P. J., Nall, A. H., Ferraro, T. N., Kampman, K. M., Pettinati, H. M., Oslin, D. W., Dackis, C. A., O'Brien, C. P. & Berrettini, W. H. (2008). Association between the catechol-O-methyltransferase Val158Met polymorphism and cocaine dependence. Neuropsychopharmacology, 33(13), 3078-84.
London, S. J., Idle, J. R., Daly, A. K. & Coetzee, G. A. (1999). Genetic variation of CYP2A6, smoking, and risk of cancer. Lancet, 353(9156), 898-9.
Lutz, P. E. & Kieffer, B. L. (2013). The multiple facets of opioid receptor function: implications for addiction. Curr Opin Neurobiol, 23(4), 473-9.
Lv, B. F., Yu, C. F., Chen, Y. Y., Lu, Y., Guo, J. H., Song, Q. S., Ma, D. L., Shi, T. P. & Wang, L. (2006). Protein tyrosine phosphatase interacting protein 51 (PTPIP51) is a novel mitochondria protein with an N-terminal mitochondrial targeting sequence and induces apoptosis. Apoptosis, 11(9), 1489-501.
146
Ma, J., Zhang, Y., Kalyuzhny, A. E. & Pan, Z. Z. (2006). Emergence of functional delta- opioid receptors induced by long-term treatment with morphine. Mol Pharmacol, 69(4), 1137-45.
Malaiyandi, V., Goodz, S. D., Sellers, E. M. & Tyndale, R. F. (2006). CYP2A6 genotype, phenotype, and the use of nicotine metabolites as biomarkers during ad libitum smoking. Cancer Epidemiol Biomarkers Prev, 15(10), 1812-9.
Malaiyandi, V., Sellers, E. M. & Tyndale, R. F. (2005). Implications of CYP2A6 genetic variation for smoking behaviors and nicotine dependence. Clin Pharmacol Ther, 77(3), 145-58.
Mansour, A., Fox, C. A., Meng, F., Akil, H. & Watson, S. J. (1994). Kappa 1 receptor mRNA distribution in the rat CNS: comparison to kappa receptor binding and prodynorphin mRNA. Mol Cell Neurosci, 5(2), 124-44. Markou, A., Weiss, F., Gold, L. H., Caine, S. B., Schulteis, G. & Koob, G. F. (1993). Animal models of drug craving. Psychopharmacology (Berl), 112(2-3), 163-82.
Maruf, M. M., Khan, M. Z. & Jahan, N. (2016). Pattern of Substance Use: Study in a De-addiction Clinic. Oman Med J, 31(5), 327-31.
Marugame, T., Yamamoto, S., Yoshimi, I., Sobue, T., Inoue, M., Tsugane, S. & Group, J. P. H. C.-b. P. S. (2007). Patterns of alcohol drinking and all-cause mortality: results from a large-scale population-based cohort study in Japan. Am J Epidemiol, 165(9), 1039-46.
Marzolini, C., Paus, E., Buclin, T. & Kim, R. B. (2004). Polymorphisms in human MDR1 (P-glycoprotein): recent advances and clinical relevance. Clin Pharmacol Ther, 75(1), 13-33.
Matsson, C., Scieber, L., Scholl, L., Rude, R., Seth, P., Xu, L., Wilson, N. & Paulozzi, L. (2017). Annual Surveillance Report of Drug Related Risks and Outcomes. USA: CDC National Center for Injury Prevention and Control.
Mayer, P., Rochlitz, H., Rauch, E., Rommelspacher, H., Hasse, H. E., Schmidt, S. & Höllt, V. (1997). Association between a delta opioid receptor gene polymorphism and heroin dependence in man. Neuroreport, 8(11), 2547-50.
McLellan, A. T., Lewis, D. C., O'Brien, C. P. & Kleber, H. D. (2000). Drug dependence, a chronic medical illness: implications for treatment, insurance, and outcomes evaluation. JAMA, 284(13), 1689-95.
147
Merikangas, K. R. & McClair, V. L. (2012). Epidemiology of substance use disorders. Hum Genet, 131(6), 779-89.
Mickley, L. A., Lee, J. S., Weng, Z., Zhan, Z., Alvarez, M., Wilson, W., Bates, S. E. & Fojo, T. (1998). Genetic polymorphism in MDR-1: a tool for examining allelic expression in normal cells, unselected and drug-selected cell lines, and human tumors. Blood, 91(5), 1749-56.
Mitsuyasu, H., Ozawa, H., Takeda, Y. & Fukumaki, Y. (1999). Novel polymorphisms in the upstream region of the human dopamine D4 receptor (DRD4) gene. J Hum Genet, 44(6), 416-8.
Morley, M., Molony, C. M., Weber, T. M., Devlin, J. L., Ewens, K. G., Spielman, R. S. & Cheung, V. G. (2004). Genetic analysis of genome-wide variation in human gene expression. Nature, 430(7001), 743-7.
Mroziewicz, M. & Tyndale, R. F. (2010). Pharmacogenetics: a tool for identifying genetic factors in drug dependence and response to treatment. Addict Sci Clin Pract, 5(2), 17-29.
Mucha, R. F. & Herz, A. (1986). Preference conditioning produced by opioid active and inactive isomers of levorphanol and morphine in rat. Life Sci, 38(3), 241-9.
Mulligan, C. J., Robin, R. W., Osier, M. V., Sambuughin, N., Goldfarb, L. G., Kittles, R. A., Hesselbrock, D., Goldman, D. & Long, J. C. (2003). Allelic variation at alcohol metabolism genes ( ADH1B, ADH1C, ALDH2) and alcohol dependence in an American Indian population. Hum Genet, 113(4), 325-36.
MyHealth Methadone Kaedah Rawatan Terapi Gantian Penagihan Dadah (2016)[Online], [Accessed 18th June 2017],Available from World Wide Web: http://www.myhealth.gov.my/panduan.htm
Nackley, A. G., Shabalina, S. A., Tchivileva, I. E., Satterfield, K., Korchynskyi, O., Makarov, S. S., Maixner, W. & Diatchenko, L. (2006). Human catechol-O- methyltransferase haplotypes modulate protein expression by altering mRNA secondary structure. Science, 314(5807), 1930-3.
National House Survey (2011)[Online], [Accessed 28th April 2016],Available from World Wide Web: http://www.nsduh.rti.org.htm
Nassir, R., Kosoy, R., Tian, C., White, P. A., Butler, L. M., Silva, G., Kittles, R., Alarcon-Riquelme, M. E., Gregersen, P. K., Belmont, J. W., De La Vega, F. M.
148
& Seldin, M. F. (2009). An ancestry informative marker set for determining continental origin: validation and extension using human genome diversity panels. BMC Genet, 10, 39.
Nelson, E. C., Lynskey, M. T., Heath, A. C., Wray, N., Agrawal, A., Shand, F. L., Henders, A. K., Wallace, L., Todorov, A. A., Schrage, A. J., Madden, P. A., Degenhardt, L., Martin, N. G. & Montgomery, G. W. (2012). Association of OPRD1 polymorphisms with heroin dependence in a large case-control series. Addict Biol.
Nelson, E. C., Lynskey, M. T., Heath, A. C., Wray, N., Agrawal, A., Shand, F. L., Henders, A. K., Wallace, L., Todorov, A. A., Schrage, A. J., Madden, P. A., Degenhardt, L., Martin, N. G. & Montgomery, G. W. (2014). Association of OPRD1 polymorphisms with heroin dependence in a large case-control series. Addict Biol, 19(1), 111-21.
Nestler, E. J. (1996). Under siege: The brain on opiates. Neuron, 16(5), 897-900.
Nestler, E. J. (2000). Genes and addiction. Nat Genet, 26(3), 277-81.
Nestler, E. J. (2004). Molecular mechanisms of drug addiction. Neuropharmacology, 47 Suppl 1, 24-32. Nestler, E. J. (2005). Is there a common molecular pathway for addiction? Nat Neurosci, 8(11), 1445-9.
Nguyen, L. K., Matallanas, D., Croucher, D. R., von Kriegsheim, A. & Kholodenko, B. N. (2013). Signalling by protein phosphatases and drug development: a systems- centred view. FEBS J, 280(2), 751-65.
Nielsen, D. A., Ji, F., Yuferov, V., Ho, A., He, C., Ott, J. & Kreek, M. J. (2010). Genome-wide association study identifies genes that may contribute to risk for developing heroin addiction. Psychiatr Genet, 20(5), 207-14.
Nikoshkov, A., Drakenberg, K., Wang, X., Horvath, M. C., Keller, E. & Hurd, Y. L. (2008). Opioid neuropeptide genotypes in relation to heroin abuse: dopamine tone contributes to reversed mesolimbic proenkephalin expression. Proc Natl Acad Sci U S A, 105(2), 786-91.
Nikoshkov, A., Hurd, Y. L., Yakovleva, T., Bazov, I., Marinova, Z., Cebers, G., Pasikova, N., Gharibyan, A., Terenius, L. & Bakalkin, G. (2005). Prodynorphin transcripts and proteins differentially expressed and regulated in the adult human brain. FASEB J, 19(11), 1543-5.
149
Noorzurani, M., Hussain, H., Rusdi, A. & Muhammad, M. (2008). Heroin Addiction: the past and the future. Malays Journal Psychiatry, 17(2), 1-4.
Nylander, I., Vlaskovska, M. & Terenius, L. (1995). The effects of morphine treatment and morphine withdrawal on the dynorphin and enkephalin systems in Sprague- Dawley rats. Psychopharmacology (Berl), 118(4), 391-400.
Okuyama, Y., Ishiguro, H., Nankai, M., Shibuya, H., Watanabe, A. & Arinami, T. (2000). Identification of a polymorphism in the promoter region of DRD4 associated with the human novelty seeking personality trait. Mol Psychiatry, 5(1), 64-9.
Pagliarini, D. J., Wiley, S. E., Kimple, M. E., Dixon, J. R., Kelly, P., Worby, C. A., Casey, P. J. & Dixon, J. E. (2005). Involvement of a mitochondrial phosphatase in the regulation of ATP production and insulin secretion in pancreatic beta cells. Mol Cell, 19(2), 197-207.
Pajusco, B., Chiamulera, C., Quaglio, G., Moro, L., Casari, R., Amen, G., Faccini, M. & Lugoboni, F. (2012). Tobacco addiction and smoking status in heroin addicts under methadone vs. buprenorphine therapy. Int J Environ Res Public Health, 9(3), 932-42.
Palmer, R. H., Brick, L., Nugent, N. R., Bidwell, L. C., McGeary, J. E., Knopik, V. S. & Keller, M. C. (2015). Examining the role of common genetic variants on alcohol, tobacco, cannabis and illicit drug dependence: genetics of vulnerability to drug dependence. Addiction, 110(3), 530-7.
Pan, L., Yang, X., Li, S. & Jia, C. (2015). Association of CYP2A6 gene polymorphisms with cigarette consumption: a meta-analysis. Drug Alcohol Depend, 149, 268-71.
Pandey, S. C., Kyzar, E. J. & Zhang, H. (2017). Epigenetic basis of the dark side of alcohol addiction. Neuropharmacology, 122, 74-84.
Patnala, R., Clements, J. & Batra, J. (2013). Candidate gene association studies: a comprehensive guide to useful in silico tools. BMC Genet, 14, 39.
Pechandová, K., Buzková, H., Slanar, O. & Perlík, F. (2006). Polymorphisms of the MDR1 gene in the Czech population. Folia Biol (Praha), 52(6), 184-9.
Peng, Q., Gizer, I. R., Libiger, O., Bizon, C., Wilhelmsen, K. C., Schork, N. J. & Ehlers, C. L. (2014). Association and ancestry analysis of sequence variants in ADH and
150
ALDH using alcohol-related phenotypes in a Native American community sample. Am J Med Genet B Neuropsychiatr Genet, 165B(8), 673-83.
Prescott, C. A. & Kendler, K. S. (1999). Genetic and environmental contributions to alcohol abuse and dependence in a population-based sample of male twins. Am J Psychiatry, 156(1), 34-40.
Quillen, E. E., Chen, X. D., Almasy, L., Yang, F., He, H., Li, X., Wang, X. Y., Liu, T. Q., Hao, W., Deng, H. W., Kranzler, H. R. & Gelernter, J. (2014). ALDH2 is associated to alcohol dependence and is the major genetic determinant of "daily maximum drinks" in a GWAS study of an isolated rural Chinese sample. Am J Med Genet B Neuropsychiatr Genet, 165B(2), 103-10.
Randesi, M., van den Brink, W., Levran, O., Blanken, P., Butelman, E. R., Yuferov, V., da Rosa, J. C., Ott, J., van Ree, J. M. & Kreek, M. J. (2016). Variants of opioid system genes are associated with non-dependent opioid use and heroin dependence. Drug Alcohol Depend, 168, 164-169.
Ray, L. A. & Hutchison, K. E. (2004). A polymorphism of the mu-opioid receptor gene (OPRM1) and sensitivity to the effects of alcohol in humans. Alcohol Clin Exp Res, 28(12), 1789-95.
Ray, R., Doyle, G. A., Crowley, J. J., Buono, R. J., Oslin, D. W., Patkar, A. A., Mannelli, P., DeMaria, P. A., O'Brien, C. P. & Berrettini, W. H. (2005). A functional prodynorphin promoter polymorphism and opioid dependence. Psychiatr Genet, 15(4), 295-8.
Reisi, Z., Haghparast, A., Pahlevani, P. & Shamsizadeh, A. (2014). Interaction between the dopaminergic and opioidergic systems in dorsal hippocampus in modulation of formalin-induced orofacial pain in rats. Pharmacol Biochem Behav, 124, 220- 5.
Ren, Z. Y., Xu, X. Q., Bao, Y. P., He, J., Shi, L., Deng, J. H., Gao, X. J., Tang, H. L., Wang, Y. M. & Lu, L. (2015). The impact of genetic variation on sensitivity to opioid analgesics in patients with postoperative pain: a systematic review and meta-analysis. Pain Physician, 18(2), 131-52.
Richter, K. P., Hamilton, A. K., Hall, S., Catley, D., Cox, L. S. & Grobe, J. (2007). Patterns of smoking and methadone dose in drug treatment patients. Exp Clin Psychopharmacol, 15(2), 144-53.
151
Ronai, Z., Barta, C., Guttman, A., Lakatos, K., Gervai, J., Staub, M. & Sasvari-Szekely, M. (2001). Genotyping the -521C/T functional polymorphism in the promoter region of dopamine D4 receptor (DRD4) gene. Electrophoresis, 22(6), 1102-5.
Rouault, M., Nielsen, D. A., Ho, A., Kreek, M. J. & Yuferov, V. (2011). Cell-specific effects of variants of the 68-base pair tandem repeat on prodynorphin gene promoter activity. Addict Biol, 16(2), 334-46.
Rusdi A, N. M., Muhammad MAZ and Mohammad HH (2008). A Fifty year challenge in managing drug addiction in Malaysia. JUMMEC, 11(1), 3-6.
Saccone, N. L., Saccone, S. F., Hinrichs, A. L., Stitzel, J. A., Duan, W., Pergadia, M. L., Agrawal, A., Breslau, N., Grucza, R. A., Hatsukami, D., Johnson, E. O., Madden, P. A., Swan, G. E., Wang, J. C., Goate, A. M., Rice, J. P. & Bierut, L. J. (2009a). Multiple distinct risk loci for nicotine dependence identified by dense coverage of the complete family of nicotinic receptor subunit (CHRN) genes. Am J Med Genet B Neuropsychiatr Genet, 150B(4), 453-66.
Saccone, N. L., Wang, J. C., Breslau, N., Johnson, E. O., Hatsukami, D., Saccone, S. F., Grucza, R. A., Sun, L., Duan, W., Budde, J., Culverhouse, R. C., Fox, L., Hinrichs, A. L., Steinbach, J. H., Wu, M., Rice, J. P., Goate, A. M. & Bierut, L. J. (2009b). The CHRNA5-CHRNA3-CHRNB4 nicotinic receptor subunit gene cluster affects risk for nicotine dependence in African-Americans and in European-Americans. Cancer Res, 69(17), 6848-56.
Sachidanandam, R., Weissman, D., Schmidt, S. C., Kakol, J. M., Stein, L. D., Marth, G., Sherry, S., Mullikin, J. C., Mortimore, B. J., Willey, D. L., Hunt, S. E., Cole, C. G., Coggill, P. C., Rice, C. M., Ning, Z., Rogers, J., Bentley, D. R., Kwok, P. Y., Mardis, E. R., Yeh, R. T., Schultz, B., Cook, L., Davenport, R., Dante, M., Fulton, L., Hillier, L., Waterston, R. H., McPherson, J. D., Gilman, B., Schaffner, S., Van Etten, W. J., Reich, D., Higgins, J., Daly, M. J., Blumenstiel, B., Baldwin, J., Stange-Thomann, N., Zody, M. C., Linton, L., Lander, E. S., Altshuler, D. & Group, I. S. M. W. (2001). A map of human genome sequence variation containing 1.42 million single nucleotide polymorphisms. Nature, 409(6822), 928-33.
Sagheddu, C. & Melis, M. (2015). Individual differences and vulnerability to drug addiction: a focus on the endocannabinoid system. CNS Neurol Disord Drug Targets, 14(4), 502-17.
SAMHSA (2017)[Online], [Accessed 2nd January 2018],Available from World Wide Web: http://www.samsha.gov/preventation-week/about/2017.htm
152
Schulz, T. G., Ruhnau, P. & Hallier, E. (2001). Lack of correlation between CYP2A6 genotype and smoking habits. Adv Exp Med Biol, 500, 213-5.
Schwarzer, C. (2009). 30 years of dynorphins--new insights on their functions in neuropsychiatric diseases. Pharmacol Ther, 123(3), 353-70.
Sellami, R., Feki, I., Zahaf, A. & Masmoudi, J. (2016). The profile of drug users in Tunisia: Implications for prevention. Tunis Med, 94(8-9), 531-534.
Seneviratne, C., Franklin, J., Beckett, K., Ma, J. Z., Ait-Daoud, N., Payne, T. J., Johnson, B. A. & Li, M. D. (2013). Association, interaction, and replication analysis of genes encoding serotonin transporter and 5-HT3 receptor subunits A and B in alcohol dependence. Hum Genet, 132(10), 1165-76.
Shamsuddin, K. & Haris, M. A. (2000). Family influence on current smoking habits among secondary school children in Kota Bharu, Kelantan. Singapore Med J, 41(4), 167-71.
Shen, L. X., Basilion, J. P. & Stanton, V. P. (1999). Single-nucleotide polymorphisms can cause different structural folds of mRNA. Proc Natl Acad Sci U S A, 96(14), 7871-6.
Sherva, R., Rice, J. P., Neuman, R. J., Rochberg, N., Saccone, N. L. & Bierut, L. J. (2009). Associations and interactions between SNPs in the alcohol metabolizing genes and alcoholism phenotypes in European Americans. Alcohol Clin Exp Res, 33(5), 848-57.
Shifman, S., Bronstein, M., Sternfeld, M., Pisanté-Shalom, A., Lev-Lehman, E., Weizman, A., Reznik, I., Spivak, B., Grisaru, N., Karp, L., Schiffer, R., Kotler, M., Strous, R. D., Swartz-Vanetik, M., Knobler, H. Y., Shinar, E., Beckmann, J. S., Yakir, B., Risch, N., Zak, N. B. & Darvasi, A. (2002). A highly significant association between a COMT haplotype and schizophrenia. Am J Hum Genet, 71(6), 1296-302.
Shippenberg, T. S. & Herz, A. (1986). Differential effects of mu and kappa opioid systems on motivational processes. NIDA Res Monogr, 75, 563-66.
Shippenberg, T. S. & Rea, W. (1997). Sensitization to the behavioral effects of cocaine: modulation by dynorphin and kappa-opioid receptor agonists. Pharmacol Biochem Behav, 57(3), 449-55.
153
Shippenberg, T. S., Zapata, A. & Chefer, V. I. (2007). Dynorphin and the pathophysiology of drug addiction. Pharmacol Ther, 116(2), 306-21.
Soldin, O. P. & Mattison, D. R. (2009). Sex differences in pharmacokinetics and pharmacodynamics. Clin Pharmacokinet, 48(3), 143-57.
Solecki, W., Ziolkowska, B., Krowka, T., Gieryk, A., Filip, M. & Przewlocki, R. (2009). Alterations of prodynorphin gene expression in the rat mesocorticolimbic system during heroin self-administration. Brain Res, 1255, 113-21.
Solomon, S. S., Desai, M., Srikrishnan, A. K., Thamburaj, E., Vasudevan, C. K., Kumar, M. S., Solomon, S., Celentano, D. D. & Mehta, S. H. (2010). The profile of injection drug users in Chennai, India: identification of risk behaviours and implications for interventions. Subst Use Misuse, 45(3), 354-67.
Staley, J. K., Talbot, J. Z., Ciliax, B. J., Miller, G. W., Levey, A. I., Kung, M. P., Kung, H. F. & Mash, D. C. (1997). Radioligand binding and immunoautoradiographic evidence for a lack of toxicity to dopaminergic nerve terminals in human cocaine overdose victims. Brain Res, 747(2), 219-29.
Stein, M. B., Fallin, M. D., Schork, N. J. & Gelernter, J. (2005). COMT polymorphisms and anxiety-related personality traits. Neuropsychopharmacology, 30(11), 2092- 102.
Sterjev, Z., Trencevska, G. K., Cvetkovska, E., Petrov, I., Kuzmanovski, I., Ribarska, J. T., Nestorovska, A. K., Matevska, N., Naumovska, Z., Jolevska-Trajkovic, S., Dimovski, A. & Suturkova, L. (2012). The association of C3435T single- nucleotide polymorphism, Pgp-glycoprotein gene expression levels and carbamazepine maintenance dose in patients with epilepsy. Neuropsychiatr Dis Treat, 8, 191-6.
Sweatt, J. D. (2016). Neural plasticity and behavior - sixty years of conceptual advances. J Neurochem, 139 Suppl 2, 179-199.
Szilagyi, A., Boór, K., Székely, A., Gaszner, P., Kalász, H., Sasvári-Székely, M. & Barta, C. (2005). Combined effect of promoter polymorphisms in the dopamine D4 receptor and the serotonin transporter genes in heroin dependence. Neuropsychopharmacol Hung, 7(1), 28-33.
Tanabe, M., Ieiri, I., Nagata, N., Inoue, K., Ito, S., Kanamori, Y., Takahashi, M., Kurata, Y., Kigawa, J., Higuchi, S., Terakawa, N. & Otsubo, K. (2001). Expression of P-
154
glycoprotein in human placenta: relation to genetic polymorphism of the multidrug resistance (MDR)-1 gene. J Pharmacol Exp Ther, 297(3), 1137-43.
Tanner, J. A., Henderson, J. A., Buchwald, D., Howard, B. V., Nez Henderson, P. & Tyndale, R. F. (2017). Variation in CYP2A6 and nicotine metabolism among two American Indian tribal groups differing in smoking patterns and risk for tobacco- related cancer. Pharmacogenet Genomics, 27(5), 169-178.
Taqi, M. M., Bazov, I., Watanabe, H., Nyberg, F., Yakovleva, T. & Bakalkin, G. (2011). Prodynorphin promoter SNP associated with alcohol dependence forms noncanonical AP-1 binding site that may influence gene expression in human brain. Brain Res, 1385, 18-25.
Thepthien, B., Altaf, L., Chuchareon, P. & Srivanichakron, S. (2016). Substance abuse in early adolescents and HIV preventive behaviors: findings from a school-based cross-sectional survey for the period from 2009 to 2013, Bangkok Thailand. AIDS Care, 28(10), 1327-31.
Thomasson, H. R., Beard, J. D. & Li, T. K. (1995). ADH2 gene polymorphisms are determinants of alcohol pharmacokinetics. Alcohol Clin Exp Res, 19(6), 1494-9.
Thorgeirsson, T. E., Gudbjartsson, D. F., Surakka, I., Vink, J. M., Amin, N., Geller, F., Sulem, P., Rafnar, T., Esko, T., Walter, S., Gieger, C., Rawal, R., Mangino, M., Prokopenko, I., Mägi, R., Keskitalo, K., Gudjonsdottir, I. H., Gretarsdottir, S., Stefansson, H., Thompson, J. R., Aulchenko, Y. S., Nelis, M., Aben, K. K., den Heijer, M., Dirksen, A., Ashraf, H., Soranzo, N., Valdes, A. M., Steves, C., Uitterlinden, A. G., Hofman, A., Tönjes, A., Kovacs, P., Hottenga, J. J., Willemsen, G., Vogelzangs, N., Döring, A., Dahmen, N., Nitz, B., Pergadia, M. L., Saez, B., De Diego, V., Lezcano, V., Garcia-Prats, M. D., Ripatti, S., Perola, M., Kettunen, J., Hartikainen, A. L., Pouta, A., Laitinen, J., Isohanni, M., Huei- Yi, S., Allen, M., Krestyaninova, M., Hall, A. S., Jones, G. T., van Rij, A. M., Mueller, T., Dieplinger, B., Haltmayer, M., Jonsson, S., Matthiasson, S. E., Oskarsson, H., Tyrfingsson, T., Kiemeney, L. A., Mayordomo, J. I., Lindholt, J. S., Pedersen, J. H., Franklin, W. A., Wolf, H., Montgomery, G. W., Heath, A. C., Martin, N. G., Madden, P. A., Giegling, I., Rujescu, D., Järvelin, M. R., Salomaa, V., Stumvoll, M., Spector, T. D., Wichmann, H. E., Metspalu, A., Samani, N. J., Penninx, B. W., Oostra, B. A., Boomsma, D. I., Tiemeier, H., van Duijn, C. M., Kaprio, J., Gulcher, J. R., McCarthy, M. I., Peltonen, L., Thorsteinsdottir, U., Stefansson, K. & Consortium, E. (2010). Sequence variants at CHRNB3- CHRNA6 and CYP2A6 affect smoking behavior. Nat Genet, 42(5), 448-53.
155
Tikkanen, R., Holi, M., Lindberg, N., Tiihonen, J. & Virkkunen, M. (2009). Recidivistic offending and mortality in alcoholic violent offenders: a prospective follow-up study. Psychiatry Res, 168(1), 18-25.
Tishler, D. M., Weinberg, K. I., Hinton, D. R., Barbaro, N., Annett, G. M. & Raffel, C. (1995). MDR1 gene expression in brain of patients with medically intractable epilepsy. Epilepsia, 36(1), 1-6.
Torabi, M. R., Bailey, W. J. & Majd-Jabbari, M. (1993). Cigarette smoking as a predictor of alcohol and other drug use by children and adolescents: evidence of the "gateway drug effect". J Sch Health, 63(7), 302-6.
Tsuang, M. T., Lyons, M. J., Meyer, J. M., Doyle, T., Eisen, S. A., Goldberg, J., True, W., Lin, N., Toomey, R. & Eaves, L. (1998). Co-occurrence of abuse of different drugs in men: the role of drug-specific and shared vulnerabilities. Arch Gen Psychiatry, 55(11), 967-72.
Tuusa, J. T. & Petäjä-Repo, U. E. (2011). Phe27Cys polymorphism of the human delta opioid receptor predisposes cells to compromised calcium signaling. Mol Cell Biochem, 351(1-2), 173-81.
Tyndale, R. F. (2003). Genetics of alcohol and tobacco use in humans. Ann Med, 35(2), 94-121.
Van Tol, H. H., Wu, C. M., Guan, H. C., Ohara, K., Bunzow, J. R., Civelli, O., Kennedy, J., Seeman, P., Niznik, H. B. & Jovanovic, V. (1992). Multiple dopamine D4 receptor variants in the human population. Nature, 358(6382), 149-52.
Vereczkei, A., Demetrovics, Z., Szekely, A., Sarkozy, P., Antal, P., Szilagyi, A., Sasvari-Szekely, M. & Barta, C. (2013). Multivariate analysis of dopaminergic gene variants as risk factors of heroin dependence. PLoS One, 8(6), e66592.
Volkow, N. D., Wang, G. J., Fowler, J. S. & Tomasi, D. (2012). Addiction circuitry in the human brain. Annu Rev Pharmacol Toxicol, 52, 321-36.
Waaktaar, T., Kan, K. J. & Torgersen, S. (2017). The Genetic and Environmental Architecture of Substance Use Development from Early Adolescence into Young Adulthood: A Longitudinal Twin Study of Comorbidity of Alcohol, Tobacco and Illicit Drugs Use. Addiction.
Wang, J. C., Cruchaga, C., Saccone, N. L., Bertelsen, S., Liu, P., Budde, J. P., Duan, W., Fox, L., Grucza, R. A., Kern, J., Mayo, K., Reyes, O., Rice, J., Saccone, S. F.,
156
Spiegel, N., Steinbach, J. H., Stitzel, J. A., Anderson, M. W., You, M., Stevens, V. L., Bierut, L. J., Goate, A. M. & collaborators, C. c. a. G. (2009). Risk for nicotine dependence and lung cancer is conferred by mRNA expression levels and amino acid change in CHRNA5. Hum Mol Genet, 18(16), 3125-35.
Wang, S. C., Tsou, H. H., Chung, R. H., Chang, Y. S., Fang, C. P., Chen, C. H., Ho, I. K., Kuo, H. W., Liu, S. C., Shih, Y. H., Wu, H. Y., Huang, B. H., Lin, K. M., Chen, A. C., Hsiao, C. F. & Liu, Y. L. (2014). The association of genetic polymorphisms in the κ-opioid receptor 1 gene with body weight, alcohol use, and withdrawal symptoms in patients with methadone maintenance. J Clin Psychopharmacol, 34(2), 205-11.
Wasilewska, A., Zalewski, G., Chyczewski, L. & Zoch-Zwierz, W. (2007). MDR-1 gene polymorphisms and clinical course of steroid-responsive nephrotic syndrome in children. Pediatr Nephrol, 22(1), 44-51.
Wee, S. & Koob, G. F. (2010). The role of the dynorphin-kappa opioid system in the reinforcing effects of drugs of abuse. Psychopharmacology (Berl), 210(2), 121- 35.
Wei, S. G., Zhu, Y. S., Lai, J. H., Xue, H. X., Chai, Z. Q. & Li, S. B. (2011). Association between heroin dependence and prodynorphin gene polymorphisms. Brain Res Bull, 85(3-4), 238-42. Whitfield, J. B. (2002). Alcohol dehydrogenase and alcohol dependence: variation in genotype-associated risk between populations. Am J Hum Genet, 71(5), 1247-50; author reply 1250-1.
Wittchen, H. U., Jacobi, F., Rehm, J., Gustavsson, A., Svensson, M., Jönsson, B., Olesen, J., Allgulander, C., Alonso, J., Faravelli, C., Fratiglioni, L., Jennum, P., Lieb, R., Maercker, A., van Os, J., Preisig, M., Salvador-Carulla, L., Simon, R. & Steinhausen, H. C. (2011). The size and burden of mental disorders and other disorders of the brain in Europe 2010. Eur Neuropsychopharmacol, 21(9), 655- 79.
World Drug Report (2017)[Online], [Accessed 11th January 2018],Available from World Wide Web: http://www.unodc.org/wdr2017.htm
Xing, Q., Gao, R., Li, H., Feng, G., Xu, M., Duan, S., Meng, J., Zhang, A., Qin, S. & He, L. (2006). Polymorphisms of the ABCB1 gene are associated with the therapeutic response to risperidone in Chinese schizophrenia patients. Pharmacogenomics, 7(7), 987-93.
157
Xu, K., Liu, X. H., Nagarajan, S., Gu, X. Y. & Goldman, D. (2002). Relationship of the delta-opioid receptor gene to heroin abuse in a large Chinese case/control sample. Am J Med Genet, 110(1), 45-50.
Xu, K., Seo, D., Hodgkinson, C., Hu, Y., Goldman, D. & Sinha, R. (2013). A variant on the kappa opioid receptor gene (OPRK1) is associated with stress response and related drug craving, limbic brain activation and cocaine relapse risk. Transl Psychiatry, 3, e292.
Xuei, X., Dick, D., Flury-Wetherill, L., Tian, H. J., Agrawal, A., Bierut, L., Goate, A., Bucholz, K., Schuckit, M., Nurnberger, J., Tischfield, J., Kuperman, S., Porjesz, B., Begleiter, H., Foroud, T. & Edenberg, H. J. (2006). Association of the kappa- opioid system with alcohol dependence. Mol Psychiatry, 11(11), 1016-24.
Xuei, X., Flury-Wetherill, L., Bierut, L., Dick, D., Nurnberger, J., Foroud, T. & Edenberg, H. J. (2007). The opioid system in alcohol and drug dependence: family-based association study. Am J Med Genet B Neuropsychiatr Genet, 144B(7), 877-84.
Yazici, A. B., Yazici, E., Akkisi Kumsar, N. & Erol, A. (2015). Addiction profile in probation practices in Turkey: 5-year data analysis. Neuropsychiatr Dis Treat, 11, 2259-63.
Yin, O. Q., Tomlinson, B. & Chow, M. S. (2009). Effect of multidrug resistance gene-1 (ABCB1) polymorphisms on the single-dose pharmacokinetics of cloxacillin in healthy adult Chinese men. Clin Ther, 31(5), 999-1006. Yoshida, A. (1992). Molecular genetics of human aldehyde dehydrogenase. Pharmacogenetics, 2(4), 139-47.
Yuferov, V., Ji, F., Nielsen, D. A., Levran, O., Ho, A., Morgello, S., Shi, R., Ott, J. & Kreek, M. J. (2009). A functional haplotype implicated in vulnerability to develop cocaine dependence is associated with reduced PDYN expression in human brain. Neuropsychopharmacology, 34(5), 1185-97.
Yuferov, V., Levran, O., Proudnikov, D., Nielsen, D. A. & Kreek, M. J. (2010). Search for genetic markers and functional variants involved in the development of opiate and cocaine addiction and treatment. Ann N Y Acad Sci, 1187, 184-207.
Zahari, Z., Lee, C. S., Ibrahim, M. A., Musa, N., Mohd Yasin, M. A., Lee, Y. Y., Tan, S. C., Mohamad, N. & Ismail, R. (2016a). Relationship Between ABCB1 Polymorphisms and Cold Pain Sensitivity Among Healthy Opioid-naive Malay Males. Pain Pract.
158
Zahari, Z., Lee, C. S., Ibrahim, M. A., Musa, N., Mohd Yasin, M. A., Lee, Y. Y., Tan, S. C., Mohamad, N. & Ismail, R. (2016b). Relationship between ABCB1 polymorphisms and serum methadone concentration in patients undergoing methadone maintenance therapy (MMT). Am J Drug Alcohol Abuse, 42(5), 587- 596.
Zahari, Z., Lee, C. S., Ibrahim, M. A., Musa, N., Mohd Yasin, M. A., Lee, Y. Y., Tan, S. C., Mohamad, N. & Ismail, R. (2017). ABCB1 Polymorphisms and Cold Pressor Pain Responses: Opioid-Dependent Patients on Methadone Maintenance Therapy. Nurs Res, 66(2), 134-144.
Zhang, H., Kranzler, H. R., Yang, B. Z., Luo, X. & Gelernter, J. (2008a). The OPRD1 and OPRK1 loci in alcohol or drug dependence: OPRD1 variation modulates substance dependence risk. Mol Psychiatry, 13(5), 531-43.
Zhang, J., Shen, Y., He, G., Li, X., Meng, J., Guo, S., Li, H., Gu, N., Feng, G. & He, L. (2008b). Lack of association between three serotonin genes and suicidal behavior in Chinese psychiatric patients. Prog Neuropsychopharmacol Biol Psychiatry, 32(2), 467-71.
Zhang, Y., Jiang, X. H., Hu, Y. Q., Li, Z. R., Su, L., Wang, Z. G. & Ma, G. (2008c). MDR1 genotypes do not influence the absorption of a single oral dose of 600 mg valacyclovir in healthy Chinese Han ethnic males. Br J Clin Pharmacol, 66(2), 247-54. Zhou, Y., Gottesman, M. M. & Pastan, I. (1999). The extracellular loop between TM5 and TM6 of P-glycoprotein is required for reactivity with monoclonal antibody UIC2. Arch Biochem Biophys, 367(1), 74-80.
Zhu, Y., King, M. A., Schuller, A. G., Nitsche, J. F., Reidl, M., Elde, R. P., Unterwald, E., Pasternak, G. W. & Pintar, J. E. (1999). Retention of supraspinal delta-like analgesia and loss of morphine tolerance in delta opioid receptor knockout mice. Neuron, 24(1), 243-52.
Zintzaras, E., Stefanidis, I., Santos, M. & Vidal, F. (2006). Do alcohol-metabolizing enzyme gene polymorphisms increase the risk of alcoholism and alcoholic liver disease? Hepatology, 43(2), 352-61.
Zolala, F., Mahdavian, M., Haghdoost, A. A. & Karamouzian, M. (2016). Pathways to Addiction: A Gender-Based Study on Drug Use in a Triangular Clinic and Drop- in Center, Kerman, Iran. Int J High Risk Behav Addict, 5(2), e22320.
159
Zwisler, S. T., Enggaard, T. P., Mikkelsen, S., Verstuyft, C., Becquemont, L., Sindrup, S. H. & Brosen, K. (2011). Lack of Association of OPRM1 and ABCB1 Single- Nucleotide Polymorphisms to Oxycodone Response in Postoperative Pain. J Clin Pharmacol.
160
APPENDICES Appendix A: Human Research Ethics Committee USM approval letter
Appendix B: Approved Questionnaire
DEVELOPMENT OF ETHNO-PHARMACOGENETICS RELATEDNESS AND PERSONALISED MEDICINE
Protocol no: PGx-003/11
Subject‘s ID:
3
GENERAL INSTRUCTION
Please write legibly. Block printing is preferred. All entries must be made in black ink with a ballpoint pen. For missing information, please enter: N/A if data is not applicable. UNK if information is unknown or not available. ND if procedure was not done. Header Information : must be completed on each CRF form
Project no. Project heading Project No Development of ethno-pharmacogenetics relatedness 3 and personalised medicine. Application of personalised methadone therapy for 4 methadone maintenance therapy (PMT for MMT) Development of personalised medicine therapy for 5 HIV/AIDS using HAART
Center no This is a 2-digit number given to the site. This number should be the same on all CRF pages. Centers No. Hospital Alor Setar 01 Hospital Sungai Buluh 02 Hospital Raja Perempuan Zainab II 03 Hospital Seberang Jaya 04 Hospital Pulau Pinang 05 Hospital Universiti Sains Malaysia 06 University Malaya Medical Centre 07 Penjara Kajang 08 Penjara Pengkalan Chepa 09 Jabatan Hal-Ehwal Orang Asli, Gombak 10 Perkampungan Orang Asli, Perak 11 Lain-lain 12 Year This is 2-digit number given to which year the subject has been enrolled Subject no This is a unique 4-digit number given to every subject during visit 1. Subject‘s ID This is a subject specific code that identifies the project under which he is studied, the centre at which the subject is studied, the year and his personal subject number. Thus the first subject enrolled for ―Development of personalised medicine therapy for HIV/AIDS using HAART‖ at Penjara Kajang in 2011 will be identified as 508110001. If you make Draw a single line through the entry, reenter the data correctly, and initial and date an error the correction. Never use white-out or obliterate information. Confidentialit All references to subjects must be made by Subject ID number and NOT BY y NAME. If reports or hospital records are attached to the CRF, the subject name must be blocked over completely with a black marker and the subject number and initials entered. Signatures / All CRF pages must be reviewed and approved by the principal Investigator or Initials on sub-investigator. CRFs
DETAILED INSTRUCTIONS
Step 1: Obtain Informed Consent Before conduction any trial related procedures, please ensure proper completion of Patient‘s Informed Consent.
Step 2: Check inclusion and exclusion criteria Tick the corresponding ―YES‖ or ―NO‖ box next to each inclusion and exclusion criteria.
INCLUSION CRITERIA YES NO
1. Adults aged between 18-65 years.
2. Able to give information of your ethnic history up to 3 generations. 3. Able to understand the procedures of the research and to follow simple instruction. 4. Willing to sign written informed consent form
EXCLUSION CRITERIA
1. Excluded by the Blood Bank Officers
2. Not able to give information of your ethnic history up to 3 generations 3. Have previously participated in or withdraw from such study
4. Not able to understand study protocol and to follow simple instructions. Blood for 5. Not willing to sign written informed consent genotyping
Step 3: Check Demographic Data
Date of Birth: Record the patient‘s date of birth. (All dates must be entered in the format DD / MM / YYYY e.g. 25 / 09 / 2002).
Sex: Tick the box corresponding to the patient‘s sex. Tick only one.
Ethnic Origin: Tick the box corresponding to the patient‘s ethnic origin. (Chinese, Malays, Indians or Orang Asli). Tick ―other‖ & specify if patients belong to other ethnic origin. REPEAT the same for the patient‘s parents and grandparents.
Weight: Enter the weight of the patient. (one decimal point, e.g.: 56.5kg)
Height: Enter the height to the nearest centimeters. (e.g. : 150cm).
Step 4: Check Vital Signs
Please conduct vital signs examination after 5 minutes sitting & record the following details.
Systolic Blood Pressure (in mmHg) to the nearest 2 mmHg Diastolic Blood Pressure (in mmHg) to the nearest 2 mmHg Pulse (in Beats per Minute)
Blood pressure must be measured on both right and left upper limb and record only the highest reading.
For vital signs, an observation is abnormal: if systolic BP > 190 mmHg and/or diastolic BP > 105 mmHg
Demography
Date of Birth :
Day Month Year
Sex : Male
Female
Ethnic Origin : Malay Chinese
Indian Orang Asli ______
Others (Please specify) ______
Parents : Father Mother Malay Chinese Malay Chinese Ethnic Origin Indian Orang Asli Indian Orang Asli
Others (Please specify) Others (Please specify) ______
Father-Grandparents: Malay Chinese Malay Chinese Ethnic Origin Indian Orang Asli Indian Orang Asli
Others (Please specify) Others (Please specify) ______
Mother-Grandparents: Malay Chinese Malay Chinese Ethnic Origin Indian Orang Asli Indian Orang Asli
Others (Please specify) Others (Please specify) ______
Weight: . kg
Height: cm
Vital Signs*
Systolic Blood Pressure : mmHg
Diastolic Blood Pressure : mmHg
Pulse : bpm
*After +5 minutes rest
Abnormal vital signs: If systolic BP > 190 mmHg And/or diastolic BP > 105 mmHg
Step 5: Review Relevant Medical History/ Current Medical Conditions/ Smoking/ Drinking Status
► Please list all relevant medical history, current medical conditions, smoking and drinking status
► Indicate the date of onset & state whether the illness is still an active problem, the amount of cigarettes and alcohol drinks consumed.
Relevant Medical History/Current Medical Conditions
Clinically significant finding must be recorded below. Is a volunteer currently suffering from or has he/she ever suffered in the past from any significant medical or surgical conditions?
Yes No If ‗Yes‘, please list down the diagnosis per line. Please give diagnosis rather than symptoms
Diagnosis Date of onset Is it still an active (please use precise medical problem now? terminology) 1. Yes No day month year 2. Yes No day month year 3. Yes No day month year 4. Yes No day month year 5. Yes No day month year 6. Yes No day month year
Relevant Smoking and Drinking Habits
Does volunteer smoke or drink alcohol? If yes please state the amount consumed and the duration.
Smoking Never Before Current
Date of first smoking day month year
Duration ______years
Before Current Number of cigarettes per day per day per per week week
Drink Alcohol Never Before Current
Date of first alcohol drinking day month year
Duration ______years
Before Current Number of glass per day per day per per week week
Mula Tamat Background: (tahun) (tahun) What is your occupation? State what and the duration
What is the highest level of Primary Secondary College University your education? Who else in your family Father Mother Brothers Sisters smokers?
Address (& Phone):
Appendix C: Patients Consent Form
Patient Information and Consent Form
(Signature Page)
Research Title: Development of Ethno-Pharmacogenetics Relatedness and Personalised Medicine Researcher’s Name: AP Nazarah Mohd Yusoff / Prof Rusli Ismail
To become a part this study, you or your legal representative must sign this page. By signing this page, I am confirming the following: I have read all of the information in this Patient Information and Consent Form including any information regarding the risk in this study and I have had time to think about it. All of my questions have been answered to my satisfaction. I voluntarily agree to be part of this research study, to follow the study procedures, and to provide necessary information researcher as requested. I may freely choose to stop being a part of this study at anytime. I have receives a copy of this Patient Information and Consent Form to keep for myself.
Patient Name(Print or type) Patient InitialsandNumber
Patient I.C No.(New) Patient I.C No.(Old)
Signature of Patientor Legal Representative Date(dd/MM/yy) (Add time if applicable)
Name of IndividualConducting Consent Discussion (Print or Type)
Signature of IndividualConducting Consent Discussion) Date(dd/MM/yy)
Name & Signature of Witness Date(dd/MM/yy) .
Appendix D: Genotyping results of drug addicts ID rs1042114 rs702764 rs910080 rs199774 rs1022563 rs10494334 rs737866 rs1800955 rs2032582 rs1128503 rs1045642 rs950302 OPRD1 OPRK1 PDYN PDYN PDYN COMT DRD4 ABCB1 ABCB1 ABCB1 DUSP 1 T_T T_T G_G A_A C_T G_G T_T C_T C_C A_G G_G G_G 2 T_T T_T G_G A_G C_T G_G T_T C_C C_C A_G G_G A_G 3 T_T T_T G_G A_A T_T G_G T_T T_T A_A A_A G_G G_G 4 T_T T_T G_G A_A T_T G_G C_T C_T A_A A_G G_G G_G 5 T_T T_T G_G A_A T_T G_G T_T C_T C_C G_G A_G A_G 6 T_T T_T G_G A_A T_T G_G C_T T_T C_C G_G A_G G_G 7 T_T T_T G_G A_A C_T G_G T_T C_C C_C A_A G_G A_G 8 T_T T_T G_G A_G T_T G_G C_T T_T C_C A_G A_G A_G 9 T_T T_T G_G G_G C_C G_G T_T C_C C_T A_G G_G A_G 10 G_G T_T A_G A_G T_T G_G C_T T_T A_A A_A G_G G_G 11 T_T C_T G_G A_G T_T G_G T_T C_T C_C A_G A_G G_G 12 T_T T_T G_G G_G C_T G_G T_T C_T C_C G_G A_A G_G 13 T_T T_T G_G A_A T_T A_G C_T C_T A_A A_A A_A A_G 14 T_T T_T G_G A_G C_T G_G C_T C_C A_C A_G A_A A_G 15 G_G T_T G_G A_A T_T G_G C_T C_C C_C G_G A_A A_A 16 T_T T_T G_G A_G T_T A_G C_T C_C A_C A_G G_G G_G 17 T_T T_T G_G G_G T_T A_G C_T T_T A_C A_G G_G A_A 18 T_T T_T G_G A_G T_T G_G C_T T_T A_C A_G G_G A_G 19 T_T T_T G_G A_G T_T G_G C_T C_C A_A A_G A_G G_G 20 G_T T_T G_G A_G C_T G_G T_T C_C A_C A_G A_G A_G 21 T_T T_T G_G A_G C_T A_G T_T C_C A_C A_A A_G G_G 22 T_T T_T A_A A_A T_T G_G C_T T_T A_T A_G A_G G_G 23 G_G T_T A_A A_A C_C G_G T_T C_T A_T A_G A_G A_G 24 T_T T_T G_G G_G T_T G_G T_T C_C A_C G_G G_G A_G
25 T_T T_T G_G A_G T_T G_G C_T T_T C_T G_G A_G A_G 26 T_T T_T G_G G_G T_T G_G C_T C_T C_C A_A A_G G_G 27 T_T T_T G_G A_A T_T G_G T_T C_C C_C G_G A_A A_A 28 T_T T_T G_G G_G C_T G_G C_C C_T A_C A_G A_G A_G 29 G_G T_T G_G G_G C_T G_G T_T C_C C_C G_G A_G A_G 30 T_T T_T G_G A_G C_T G_G T_T T_T A_A G_G G_G G_G 31 T_T T_T G_G A_A C_T G_G T_T C_T A_T A_G G_G A_A 32 T_T T_T G_G A_G T_T G_G C_T C_C A_C A_A A_G A_G 33 T_T C_T G_G A_A T_T G_G C_T T_T A_C A_G A_G A_G 34 T_T T_T G_G A_A T_T G_G T_T C_C A_C A_A G_G A_A 35 G_G T_T A_G A_G C_T G_G T_T C_C C_T G_G G_G A_G 36 G_G T_T G_G A_G C_T G_G C_C C_T A_C A_G A_G G_G 37 T_T T_T G_G G_G T_T G_G T_T T_T A_C A_A A_G G_G 38 T_T T_T A_G A_A C_T G_G T_T C_C A_C A_G A_A A_A 39 T_T C_T A_G A_A C_T G_G C_T C_C C_C A_A A_A G_G 40 T_T T_T G_G G_G T_T G_G T_T C_C C_T A_G G_G G_G 41 T_T T_T G_G A_A T_T G_G T_T C_T C_C A_G G_G G_G 42 T_T T_T G_G A_A C_T G_G T_T T_T A_A A_A A_A A_A 43 T_T T_T A_G G_G T_T G_G C_T C_T C_T A_G G_G G_G 44 T_T C_T G_G A_A T_T G_G T_T C_C A_C A_G A_A A_G 45 T_T T_T G_G A_G T_T G_G T_T C_C C_C A_G A_A A_A 46 T_T T_T G_G A_A T_T G_G T_T C_C A_C A_G A_G A_G 47 T_T T_T G_G A_G T_T G_G C_C C_T C_T A_G A_A G_G 48 T_T T_T G_G A_A T_T G_G T_T T_T C_C A_G G_G A_G 49 T_T T_T A_G A_A C_T G_G T_T C_C C_C A_G A_G G_G 50 T_T T_T G_G A_A C_T G_G C_T C_C A_C A_G G_G A_A 51 T_T T_T G_G G_G C_T G_G T_T T_T A_C A_G A_G A_G
52 T_T T_T G_G A_G T_T G_G T_T T_T A_C A_G G_G G_G 53 T_T T_T G_G A_A T_T G_G C_T C_T A_A A_A G_G G_G 54 T_T T_T G_G A_A T_T A_G T_T T_T C_C G_G A_A A_A 55 T_T T_T G_G A_A T_T A_G T_T C_T A_C A_G G_G G_G 56 T_T T_T G_G A_A T_T G_G T_T T_T A_C A_G A_G A_A 57 T_T C_C A_G A_G C_T G_G T_T T_T A_T A_G G_G A_G 58 T_T T_T G_G A_A T_T G_G T_T C_T A_C A_A A_G G_G 59 T_T T_T G_G A_A T_T G_G T_T C_T C_C A_G A_A A_G 60 T_T T_T G_G A_A T_T A_G C_T C_C A_C A_G A_G G_G 61 T_T T_T A_G G_G T_T G_G T_T T_T C_C A_G G_G G_G 62 T_T T_T G_G A_A C_T A_G T_T T_T A_C A_G G_G A_G 63 T_T C_T A_G A_A T_T G_G C_T T_T A_C A_A A_G A_A 64 T_T T_T G_G A_A T_T G_G T_T T_T C_C A_G G_G G_G 65 T_T T_T A_G A_G C_T G_G T_T C_C C_C G_G A_G A_A 66 T_T T_T G_G A_G C_T G_G C_T C_T C_T A_G G_G A_G 67 T_T T_T G_G A_G T_T G_G C_T T_T A_T A_G A_G G_G 68 T_T T_T A_G A_G T_T G_G T_T T_T A_C A_G G_G A_G 69 T_T T_T G_G A_G T_T A_G T_T C_T A_C A_A A_G A_G 70 T_T T_T G_G A_G T_T G_G C_C T_T A_C A_A A_G G_G 71 T_T T_T G_G A_G T_T G_G T_T T_T A_C A_G A_G A_G 72 T_T C_T A_G A_A C_C G_G T_T T_T C_C A_G G_G G_G 73 T_T T_T G_G A_G T_T G_G T_T C_T A_C A_A A_G G_G 74 T_T T_T G_G A_G T_T G_G C_T T_T C_C G_G A_G A_G 75 T_T T_T G_G A_A C_T A_G C_T T_T A_C A_G A_G G_G 76 T_T T_T A_G A_A T_T G_G T_T C_C C_T G_G G_G A_A 77 T_T T_T G_G A_A T_T G_G C_T C_T C_C G_G G_G G_G 78 T_T T_T A_A G_G T_T A_G C_T T_T A_C A_G A_G G_G
79 T_T T_T G_G A_G T_T G_G T_T T_T A_A A_A A_G G_G 80 G_T T_T G_G A_G T_T G_G C_C T_T A_A A_A A_A G_G 81 T_T T_T G_G A_G C_C A_G C_C C_C C_T A_A G_G G_G 82 T_T T_T G_G A_G C_C G_G T_T T_T A_A A_A A_A A_G 83 T_T T_T A_G A_A C_T A_G T_T C_C A_C A_G A_A A_G 84 T_T C_T G_G A_G T_T G_G T_T T_T A_C A_G G_G A_G 85 T_T T_T G_G A_G T_T G_G T_T C_T C_C G_G G_G A_A 86 T_T T_T G_G A_G T_T G_G T_T T_T A_C A_G G_G A_G 87 T_T T_T G_G A_G T_T A_G C_T C_T C_C G_G G_G A_A 88 T_T T_T G_G A_G T_T G_G T_T C_C A_C A_A A_G G_G 89 T_T T_T G_G A_A C_T G_G C_T T_T A_C A_G G_G G_G 90 T_T T_T G_G A_G T_T G_G T_T T_T C_C A_A A_A A_A 91 T_T T_T G_G A_G C_T G_G T_T C_T A_C A_G A_A G_G 92 G_G T_T A_G G_G C_T G_G T_T C_T C_C G_G G_G G_G 93 T_T C_T A_G A_G T_T G_G C_T C_C C_C G_G G_G A_A 94 T_T T_T A_G A_G C_T G_G C_T C_T A_A A_A G_G A_A 95 G_T C_T G_G A_G C_T G_G T_T T_T C_C A_G A_A A_G 96 T_T T_T G_G A_G T_T G_G T_T C_T C_C A_G G_G G_G 97 T_T T_T G_G A_G C_T A_G C_T C_T C_C A_G G_G A_G 98 T_T T_T G_G A_G T_T A_G T_T C_T C_C G_G G_G G_G 99 T_T T_T A_G G_G T_T A_G C_T C_T A_C A_G G_G A_G 100 T_T T_T G_G G_G T_T G_G T_T T_T A_C A_A A_G G_G 101 G_T T_T G_G A_A T_T A_G T_T C_T C_C A_G G_G A_G 102 T_T T_T G_G A_G T_T G_G T_T C_T A_A A_A A_A A_G 103 G_G T_T G_G A_A C_T G_G T_T C_C A_C G_G A_G G_G 104 T_T T_T G_G G_G T_T G_G T_T C_C A_A G_G G_G G_G 105 T_T C_T G_G A_G T_T G_G C_T C_T A_C A_A A_G A_G
106 T_T C_T G_G A_A T_T G_G T_T C_T A_A A_A A_A G_G 107 T_T T_T G_G G_G T_T G_G T_T C_T A_A A_A G_G A_A 108 T_T T_T G_G A_G T_T G_G C_C T_T A_C G_G G_G G_G 109 T_T T_T A_G A_G C_C G_G C_T T_T A_C A_A A_G G_G 110 T_T C_T G_G A_G C_T G_G T_T C_T A_C A_G G_G G_G 111 T_T T_T G_G A_G T_T G_G T_T C_T C_C A_G G_G G_G 112 T_T T_T A_G A_A C_T A_G T_T T_T C_C A_A G_G G_G 113 T_T T_T G_G A_G T_T G_G T_T T_T C_C G_G G_G G_G 114 G_T T_T A_G G_G C_T A_G T_T T_T C_C A_A A_G A_A 115 T_T T_T A_G A_G T_T G_G C_T C_T A_C A_G A_G A_G 116 T_T T_T A_G A_A C_T A_G T_T C_C C_C G_G A_G G_G 117 G_T T_T A_A A_G C_C G_G C_T C_C A_C A_A A_G A_G 118 T_T T_T A_G A_A C_T G_G T_T C_C C_C A_G G_G A_G 119 G_G T_T A_G A_G C_T G_G C_T T_T A_A G_G A_A G_G 120 T_T T_T G_G A_G T_T G_G T_T C_T C_C A_G G_G G_G 121 T_T T_T G_G G_G C_T G_G T_T C_C C_T A_G G_G A_G 122 T_T T_T G_G A_A C_T G_G C_T T_T C_C G_G A_G G_G 123 T_T T_T G_G A_G T_T G_G T_T T_T A_C A_A A_A G_G 124 T_T T_T G_G A_G T_T G_G T_T C_T C_C G_G A_G A_G 125 T_T T_T G_G A_G T_T G_G T_T C_T C_C G_G A_G A_G 126 T_T T_T G_G A_G T_T G_G T_T C_T C_C G_G A_G A_G 127 T_T T_T G_G A_G T_T G_G T_T C_T C_C G_G A_G A_G 128 T_T T_T G_G A_G T_T G_G T_T C_T C_C G_G A_G A_G 129 T_T T_T G_G A_G T_T G_G T_T C_T T_T A_G G_G G_G 130 T_T T_T G_G A_G T_T G_G C_T C_T C_T G_G G_G G_G 131 T_T T_T A_G A_G C_T G_G C_T C_T A_T A_G A_G A_A 132 G_G C_T G_G A_G C_T G_G T_T C_C C_C A_A A_G A_G
133 T_T T_T A_A G_G T_T A_G C_T T_T A_A A_A A_A G_G 134 T_T T_T G_G A_A T_T A_G C_T C_T A_C G_G G_G A_G 135 G_G T_T G_G G_G T_T G_G T_T T_T A_A A_A A_G G_G 136 T_T T_T A_G A_A C_C G_G T_T T_T A_A A_A G_G A_G 137 T_T T_T A_G A_A C_T G_G C_T T_T C_C G_G G_G G_G 138 T_T T_T A_G A_G T_T G_G T_T T_T A_A A_A A_G A_A 139 T_T T_T G_G A_A T_T G_G T_T T_T A_C A_G A_A A_G 140 T_T T_T G_G A_G T_T G_G T_T C_T A_A A_A A_A A_G 141 T_T T_T G_G A_A T_T G_G C_T C_T A_C A_A A_G A_A 142 T_T T_T G_G A_A T_T G_G C_T C_T C_C A_G A_G A_G 143 T_T T_T G_G A_A T_T G_G C_T C_C C_C A_G G_G A_G 144 T_T T_T G_G A_G T_T G_G T_T C_T C_C A_A A_A A_G 145 T_T C_C G_G G_G T_T A_G C_C T_T A_C A_G A_G A_G 146 T_T C_T G_G G_G C_T G_G C_T T_T C_C A_G A_G A_A 147 T_T T_T A_G A_A T_T G_G C_T T_T A_C A_G A_G A_G 148 T_T T_T G_G A_G T_T G_G T_T C_T A_C A_A A_G A_G 149 T_T T_T G_G A_G T_T G_G C_C C_C C_T A_G A_G G_G 150 T_T T_T G_G A_G T_T G_G T_T T_T C_C G_G G_G A_A 151 T_T T_T A_G A_G C_T G_G T_T C_C A_C A_A A_G G_G 152 T_T T_T A_G G_G C_T A_G T_T C_C A_A A_G A_A A_G 153 T_T T_T G_G A_G C_T G_G C_T T_T A_C A_G G_G A_G 154 T_T C_T G_G G_G T_T G_G T_T C_T A_C A_G A_G A_G 155 T_T T_T G_G A_G T_T G_G C_C C_T A_A A_A A_A G_G 156 T_T T_T G_G G_G T_T G_G C_T T_T A_C A_G A_G A_G 157 T_T T_T A_G A_G T_T G_G T_T C_T C_C A_A A_G G_G 158 T_T T_T G_G A_G T_T G_G T_T C_C C_C A_G A_A G_G 159 T_T T_T G_G A_A C_T G_G C_T C_T C_C G_G G_G G_G
160 T_T T_T A_G A_G T_T G_G T_T T_T A_C A_A A_G G_G 161 T_T C_T G_G A_G T_T G_G T_T T_T A_C A_G G_G A_A 162 T_T T_T G_G A_G T_T G_G C_T T_T A_T A_G A_G G_G 163 T_T T_T A_G A_G C_T A_G C_C T_T A_A A_A A_G A_G 164 T_T T_T A_A G_G T_T G_G T_T T_T C_C A_G G_G A_A 165 T_T T_T G_G A_G T_T G_G C_T T_T C_C A_G G_G A_G 166 T_T T_T G_G A_G T_T G_G C_T T_T A_C A_G G_G G_G 167 T_T T_T G_G A_G T_T G_G T_T C_T C_C G_G G_G A_A 168 T_T C_T A_A A_G C_C G_G T_T T_T C_C A_G G_G G_G 169 T_T T_T A_A A_G T_T G_G C_C T_T A_C A_G A_G A_G 170 T_T T_T A_G A_A T_T G_G T_T T_T A_C G_G G_G A_G 171 T_T T_T G_G A_A T_T G_G T_T T_T C_T G_G G_G G_G 172 T_T T_T G_G A_A C_T A_G C_T C_C A_C A_G A_G A_G 173 T_T T_T A_G G_G T_T G_G T_T C_T C_C G_G G_G A_G 174 T_T T_T G_G A_G T_T G_G T_T C_T C_C G_G G_G A_A 175 T_T T_T G_G A_A C_C G_G T_T C_T A_A A_A A_G G_G 176 G_T T_T G_G A_A T_T G_G C_T C_T A_A A_G G_G A_G 177 T_T T_T G_G A_A T_T G_G C_T C_T A_A A_A G_G A_G 178 T_T T_T G_G A_G T_T G_G C_T C_T A_A A_A G_G A_G 179 T_T T_T G_G A_G T_T G_G C_T T_T C_C A_G A_G G_G 180 T_T T_T A_A A_G C_C G_G C_C C_T A_C A_G A_A A_G 181 T_T T_T A_G A_A T_T G_G C_T T_T C_C A_G G_G A_G 182 T_T T_T G_G A_A T_T G_G C_T T_T C_C A_G A_G G_G 183 G_G T_T G_G A_G T_T G_G C_T T_T A_C A_A A_G A_G 184 T_T T_T G_G A_G T_T A_G C_T T_T C_T A_A G_G G_G 185 T_T T_T G_G A_G T_T G_G T_T T_T A_C A_G A_A A_G 186 T_T T_T G_G A_G T_T A_G T_T T_T A_C A_G A_G A_G
187 T_T C_T G_G A_G T_T A_G C_T C_T A_C A_A A_G G_G 188 T_T T_T A_G G_G C_T A_G T_T T_T A_C A_G A_G A_G 189 T_T T_T G_G A_G T_T G_G C_T C_T A_A A_A A_A G_G 190 G_T C_T G_G G_G T_T G_G T_T C_T A_C A_G A_G A_G 191 T_T T_T G_G A_G T_T G_G T_T C_T A_A A_A A_G A_G 192 T_T T_T G_G A_A T_T G_G T_T T_T A_A A_A G_G A_A 193 T_T T_T G_G A_A T_T G_G C_T T_T A_C A_G G_G A_G 194 T_T T_T G_G A_G T_T A_G T_T C_C C_C A_G A_G A_G 195 T_T T_T G_G A_G T_T G_G C_T T_T C_C A_A G_G A_G 196 T_T T_T G_G A_G T_T G_G T_T C_T A_C A_G A_G A_G 197 T_T T_T G_G A_A T_T G_G T_T T_T C_C G_G G_G A_G 198 T_T T_T G_G A_G T_T G_G T_T C_C C_C A_A A_A G_G 199 T_T T_T A_G A_G C_T G_G C_T C_T A_C A_G G_G A_G 200 T_T T_T A_G A_A C_T G_G C_T T_T C_T A_A G_G G_G 201 G_G T_T A_A A_G C_C G_G C_T C_T A_A A_A A_A G_G 202 T_T T_T G_G A_G T_T G_G T_T C_C C_C A_G G_G A_A 203 T_T T_T G_G A_A T_T G_G C_T T_T A_A A_A A_A G_G 204 T_T C_T G_G A_G T_T A_A C_T C_C C_C G_G G_G A_G 205 T_T T_T G_G A_G T_T G_G T_T T_T C_C G_G A_G A_A 206 T_T T_T A_A A_G C_C A_G T_T C_T A_T A_G G_G G_G 207 G_T T_T G_G A_G T_T G_G C_C C_T C_T A_G G_G A_G 208 T_T T_T G_G A_G T_T G_G T_T C_C C_T G_G G_G G_G 209 T_T T_T G_G A_G T_T G_G T_T C_T A_C A_G A_G A_G 210 T_T T_T G_G A_G T_T G_G C_C T_T A_C A_G G_G A_A 211 T_T T_T A_G A_G C_T A_G T_T C_T A_A A_A A_G A_G 212 T_T T_T A_G A_A C_T A_G C_T C_T A_C A_G G_G A_G 213 T_T T_T G_G A_G T_T G_G C_T T_T C_C A_G G_G G_G
214 T_T T_T A_G G_G C_T G_G C_C T_T A_A A_A A_A A_G 215 T_T T_T A_G A_G C_T G_G C_T T_T A_C A_G G_G A_G 216 T_T T_T A_G A_G C_C G_G T_T C_T A_C A_A A_G A_G 217 G_G T_T G_G A_G T_T G_G T_T C_T A_T A_G A_G G_G 218 T_T T_T G_G G_G T_T G_G T_T T_T A_A A_A A_G A_G 219 T_T T_T G_G A_G T_T G_G T_T C_C A_T A_G A_G A_G 220 T_T T_T G_G A_A T_T G_G T_T T_T A_C A_G A_G A_G 221 T_T T_T A_G G_G C_T G_G T_T C_T C_C G_G G_G G_G 222 T_T T_T G_G A_G T_T G_G C_T C_T A_T A_G A_G A_G 223 T_T T_T G_G A_G T_T G_G C_T T_T C_C A_A G_G G_G 224 G_T C_T G_G A_A T_T G_G T_T C_C A_C A_A A_G A_G 225 T_T T_T G_G A_G T_T G_G T_T C_T A_A A_A A_G G_G 226 T_T T_T G_G A_G T_T G_G T_T T_T C_T A_G A_G A_G 227 T_T T_T G_G G_G T_T G_G T_T T_T A_C A_G A_G G_G 228 G_T T_T G_G A_G T_T G_G T_T T_T A_C A_G A_G G_G 229 T_T T_T A_G A_A C_T G_G C_T T_T C_T A_A G_G A_G 230 T_T T_T G_G A_A T_T G_G C_T C_T C_C A_G A_G A_G 231 T_T T_T G_G A_G T_T G_G C_T C_C A_C A_G A_A G_G 232 T_T T_T G_G A_A T_T G_G C_T C_T A_C A_A A_G G_G 233 T_T T_T A_G A_A C_T G_G T_T C_T C_C A_G G_G A_G 234 G_T T_T G_G A_A T_T G_G T_T C_T C_C G_G A_G A_G 235 T_T C_T G_G G_G T_T G_G C_C C_T C_C A_G G_G A_G 236 T_T T_T G_G A_A T_T G_G C_T T_T A_C A_G A_G G_G 237 T_T T_T G_G A_G T_T G_G T_T T_T C_C G_G A_G A_G 238 T_T T_T G_G A_G T_T G_G T_T C_T C_C G_G A_G G_G 239 T_T T_T G_G G_G T_T G_G T_T T_T C_C A_G G_G A_G 240 T_T T_T G_G A_G T_T G_G C_C T_T C_C A_G G_G A_G
241 T_T T_T G_G G_G T_T A_G C_T T_T A_C A_A G_G G_G 242 T_T T_T G_G A_G T_T A_G C_T T_T A_A A_A A_A A_A 243 T_T T_T A_G A_A C_T G_G C_T T_T A_C A_G A_G A_A 244 T_T T_T G_G A_A T_T G_G C_C C_T A_C A_A A_G G_G 245 T_T T_T A_G A_G C_T G_G C_T C_T A_T G_G A_G A_G 246 T_T T_T A_G A_G C_T G_G T_T C_C A_C A_G A_G G_G 247 T_T T_T A_G A_G C_T G_G C_T C_T A_C A_G A_A A_G 248 T_T T_T A_G A_A C_T G_G T_T T_T A_C A_A A_G G_G 249 T_T T_T G_G A_G T_T G_G C_T C_T C_C A_G G_G G_G 250 T_T T_T G_G G_G T_T G_G T_T T_T C_C A_G G_G G_G 251 T_T T_T G_G A_G T_T G_G C_T T_T A_C A_G A_G A_G 252 T_T T_T A_G A_A C_T G_G C_C C_T C_C A_A A_G A_G 253 T_T T_T A_G G_G C_T G_G T_T C_T A_C A_A A_G A_G 254 T_T T_T G_G G_G T_T G_G T_T C_T C_C A_G A_G A_G 255 T_T T_T A_G A_G C_T A_G C_T T_T C_T G_G G_G A_G 256 T_T T_T G_G A_G T_T G_G T_T C_T A_C A_G A_G G_G 257 T_T C_T A_G A_A C_T G_G T_T T_T A_T A_G A_G A_G 258 G_T T_T G_G G_G T_T G_G T_T T_T C_C A_G G_G A_G 259 T_T T_T G_G G_G T_T G_G C_T C_T C_T A_G G_G A_A 260 T_T T_T G_G A_G C_C G_G T_T C_T C_C G_G G_G G_G 261 T_T T_T A_A A_G T_T A_G C_T C_T C_C G_G G_G A_G 262 T_T T_T G_G A_A T_T G_G C_T T_T A_C A_G A_G G_G 263 T_T T_T G_G A_G T_T G_G C_T C_T A_A A_A A_G A_G 264 T_T T_T G_G G_G T_T G_G C_T T_T C_C G_G A_G A_G 265 T_T T_T G_G A_A T_T G_G C_T C_T A_A A_A A_A A_G 266 T_T T_T A_G A_G C_T G_G C_T T_T C_C A_A A_G A_G 267 T_T C_T A_G A_G C_T A_G T_T C_C A_C A_G G_G G_G
268 T_T T_T A_G A_G C_T G_G C_T C_T C_C A_A A_G G_G 269 T_T T_T G_G A_G T_T G_G T_T T_T C_C A_A G_G G_G 270 T_T T_T G_G A_G T_T G_G C_T C_T C_C A_A G_G G_G 271 T_T T_T A_G A_G C_T G_G C_T C_T A_A A_A A_A G_G 272 T_T T_T A_G G_G C_T G_G C_T T_T A_C A_A G_G G_G 273 T_T T_T G_G G_G T_T G_G C_T T_T A_C A_A A_G A_G 274 T_T T_T A_G A_G C_T G_G T_T C_C A_C A_A A_G A_G 275 T_T T_T A_G G_G C_T G_G C_T T_T A_C A_A G_G G_G 276 T_T T_T A_A A_G C_C G_G C_T C_C C_C G_G G_G A_A 277 T_T T_T G_G A_G T_T G_G T_T T_T A_C A_G A_G A_G 278 T_T T_T G_G A_G T_T G_G T_T C_T C_C A_A A_G G_G 279 T_T T_T G_G A_A T_T G_G C_C C_T A_T A_G G_G G_G 280 T_T T_T G_G A_G T_T A_G C_C C_C C_C A_G G_G G_G 281 T_T T_T G_G A_G T_T G_G C_C T_T C_C A_G G_G G_G 282 T_T T_T G_G A_G T_T G_G C_T T_T A_C A_G A_G A_G 283 T_T T_T A_G A_G T_T G_G T_T C_C C_T G_G G_G A_G 284 T_T T_T G_G A_G T_T G_G C_T C_C C_C A_G A_A G_G 285 T_T T_T G_G A_G T_T G_G T_T C_T C_T A_G A_G G_G 286 T_T T_T G_G A_A T_T G_G C_T C_T A_C A_G A_G G_G 287 G_T T_T A_G A_G C_T G_G T_T C_T A_C A_G G_G A_G 288 T_T T_T G_G A_G T_T G_G C_T C_T C_C A_G A_A G_G 289 T_T C_T A_G G_G C_T G_G C_T C_T C_C A_G A_G G_G 290 T_T T_T A_G A_A C_T G_G T_T C_T A_C A_G A_G A_G 291 T_T C_T G_G A_A T_T G_G T_T T_T A_C A_G G_G A_G 292 T_T T_T A_G G_G C_T G_G C_T T_T A_C A_G G_G G_G 293 T_T T_T G_G A_G T_T G_G C_T T_T C_C A_G A_G G_G 294 G_T T_T A_G G_G C_T G_G C_C T_T C_C A_G G_G A_G
295 T_T T_T A_G G_G T_T G_G T_T C_T A_A A_A A_A G_G 296 T_T T_T G_G A_G C_T G_G T_T C_T C_C A_G A_G A_G 297 T_T T_T A_G A_G C_T G_G T_T C_T A_C A_G A_G G_G 298 G_T T_T G_G A_A T_T G_G T_T C_T A_C A_G A_G G_G 299 T_T T_T A_G A_G C_T A_G C_T C_T C_T A_G G_G A_A 300 T_T T_T A_G G_G C_T A_G T_T T_T A_A A_A A_G A_G 301 T_T T_T G_G G_G T_T G_G T_T C_T A_T A_G A_G A_A 302 T_T C_T A_G G_G C_T G_G T_T C_T A_T A_G A_G A_A 303 T_T T_T G_G A_A T_T A_G T_T C_T A_C G_G G_G A_G 304 T_T T_T G_G G_G T_T G_G T_T C_T C_C A_G A_G A_G 305 T_T T_T G_G G_G T_T G_G T_T C_T A_C A_G A_G A_A 306 T_T C_T G_G A_A T_T A_G C_T T_T C_C A_A A_G G_G 307 T_T T_T A_G A_G T_T G_G T_T C_T A_A A_G A_G A_G 308 T_T T_T G_G A_A T_T G_G T_T C_T A_C A_G A_G G_G 309 T_T T_T G_G A_G T_T G_G C_T T_T A_C A_G G_G G_G 310 T_T T_T G_G A_G T_T G_G T_T T_T A_T A_G A_G A_G 311 T_T T_T G_G A_G T_T A_G C_C T_T A_C A_A A_G A_G 312 T_T T_T G_G A_G T_T G_G T_T C_T C_C A_G G_G A_G 313 T_T T_T G_G A_G C_T A_G T_T T_T C_C G_G G_G G_G 314 T_T T_T G_G A_A T_T G_G C_T T_T A_A A_A A_A G_G 315 T_T T_T A_G A_G C_T G_G C_T C_T A_A A_A A_G G_G 316 T_T T_T G_G G_G C_T G_G T_T C_C C_C A_G G_G A_G 317 T_T T_T G_G A_G T_T G_G C_T C_T A_C A_G A_G G_G 318 T_T T_T G_G A_A T_T G_G T_T C_T A_T A_A A_A G_G 319 T_T T_T G_G A_A T_T G_G C_C T_T C_C A_A G_G A_A 320 T_T T_T G_G A_G T_T G_G T_T C_C C_C A_A A_A A_G 321 T_T T_T G_G A_G T_T G_G T_T C_T A_A A_A A_A G_G
322 T_T T_T A_G A_G C_T A_G C_T C_T A_C A_G A_G G_G 323 T_T T_T A_G A_G C_T G_G C_T C_T C_C A_G G_G A_G 324 G_G C_T G_G G_G T_T G_G T_T C_T C_C G_G G_G A_G 325 T_T T_T A_G A_A C_T G_G T_T T_T C_C A_G G_G G_G 326 T_T T_T G_G A_G T_T G_G T_T C_C C_C G_G A_G G_G 327 T_T C_T G_G A_G T_T G_G T_T T_T C_C A_G G_G G_G 328 T_T T_T G_G A_G T_T G_G C_T T_T A_C A_G G_G G_G 329 T_T T_T G_G A_A T_T G_G T_T C_T A_C A_G A_G G_G 330 G_G T_T G_G A_G T_T G_G T_T T_T A_A A_A A_A A_G 331 T_T T_T G_G A_A T_T G_G T_T T_T A_C A_G A_G A_A 332 T_T T_T G_G G_G T_T G_G C_T T_T A_C A_G A_G G_G 333 T_T T_T G_G A_A T_T A_G T_T C_T A_T A_G A_G A_G 334 T_T T_T G_G A_G T_T A_G T_T C_C A_C A_G G_G G_G 335 T_T C_T A_G A_G C_T G_G T_T C_T C_C G_G A_G A_G 336 T_T T_T G_G A_G T_T G_G T_T C_T A_C A_G A_G A_G 337 T_T T_T G_G A_G T_T A_G T_T C_T A_A A_A A_A A_G 338 T_T T_T G_G A_G T_T G_G T_T C_T A_C A_A A_G A_G 339 T_T T_T G_G A_G T_T A_G C_T C_C A_C A_G A_G A_G 340 G_T T_T A_A A_G C_C G_G C_C T_T C_C A_A G_G G_G 341 T_T T_T G_G A_G T_T G_G T_T T_T C_C A_A A_G A_A 342 T_T T_T A_G A_G C_T G_G T_T T_T C_C G_G G_G A_G 343 T_T T_T G_G G_G T_T A_G C_T C_C C_C A_G A_G A_G 344 T_T T_T G_G G_G T_T G_G C_T T_T A_C A_G A_G A_G 345 T_T T_T G_G A_G T_T G_G T_T T_T A_C A_G A_G A_G 346 T_T T_T G_G A_G T_T G_G T_T T_T A_C A_G A_G A_G 347 T_T T_T A_G A_G C_T G_G C_T C_T C_C A_A G_G G_G 348 T_T T_T G_G A_G T_T G_G C_T C_T C_C A_A A_G A_G
349 T_T T_T A_G G_G C_T G_G T_T C_T A_C G_G A_G G_G 350 T_T T_T G_G A_A T_T G_G T_T T_T C_C A_A A_G G_G 351 T_T T_T G_G A_G T_T G_G C_T C_C A_C A_G A_G A_G 352 T_T C_T G_G G_G T_T G_G T_T T_T C_C G_G G_G G_G 353 T_T T_T G_G A_A T_T G_G C_T C_T A_C A_G A_G A_A 354 T_T T_T G_G G_G T_T G_G T_T T_T T_T A_G G_G G_G 355 T_T T_T G_G A_G T_T G_G C_T T_T A_A A_A A_G G_G 356 T_T T_T G_G A_A T_T G_G T_T C_C A_C A_G A_G A_G 357 T_T C_T G_G A_G C_T G_G T_T C_T A_C A_G A_A A_A 358 T_T T_T G_G A_G T_T A_G C_T T_T A_C A_G G_G G_G 359 G_T T_T A_G A_G C_T G_G C_T T_T A_C A_G G_G G_G 360 T_T T_T G_G A_G T_T G_G T_T C_C C_C A_G A_G G_G 361 T_T T_T A_G A_G C_T G_G C_T T_T C_C A_G A_G G_G 362 T_T C_T G_G G_G C_T G_G C_T C_T A_A A_A A_A A_G 363 G_T T_T G_G G_G T_T G_G T_T T_T A_A A_A A_A A_G 364 T_T T_T A_G G_G C_T G_G T_T T_T A_T A_G A_G G_G 365 T_T T_T G_G A_A T_T G_G T_T T_T C_T G_G G_G A_A 366 T_T T_T G_G G_G T_T A_G T_T T_T A_C A_G A_A G_G 367 T_T T_T G_G G_G T_T G_G T_T C_T A_T A_A G_G G_G 368 T_T C_T G_G A_G T_T G_G T_T C_T A_T A_G A_G G_G 369 T_T T_T G_G A_G T_T G_G C_T T_T A_T A_A A_G A_A 370 T_T T_T G_G G_G T_T A_G T_T C_T A_C A_A G_G G_G 371 T_T T_T G_G G_G C_T G_G T_T T_T A_C A_G A_A G_G 372 T_T T_T G_G G_G T_T A_G C_T C_T A_A A_G A_A G_G 373 T_T T_T A_G A_A T_T A_G T_T C_C A_T A_A A_G G_G 374 T_T T_T A_G G_G T_T G_G C_T C_T A_T A_A A_G A_G 375 T_T T_T G_G A_A C_T G_G T_T T_T C_C A_G A_G A_A
376 T_T T_T A_G A_G C_T G_G T_T C_C C_C G_G G_G A_G 377 T_T T_T A_G A_A T_T G_G C_T T_T A_T A_G A_G A_G 378 T_T T_T G_G A_A T_T G_G C_C T_T C_C G_G G_G A_A 379 T_T T_T G_G A_G T_T A_G T_T T_T A_C A_G A_G A_G 380 T_T T_T A_G A_A C_T G_G T_T T_T A_A A_A` A_A A_G 381 T_T T_T G_G G_G T_T G_G C_T T_T A_T A_A` A_G A_G 382 T_T T_T A_G A_G T_T G_G C_T T_T C_C A_A A_G A_G 383 T_T T_T G_G A_A T_T G_G C_T C_T A_T A_G A_G A_A 384 T_T T_T G_G A_G T_T G_G T_T C_C C_T G_G A_G A_G 385 T_T T_T G_G A_A T_T G_G C_T C_T C_T A_G G_G G_G 386 T_T T_T A_G A_A T_T A_G C_T C_T C_T A_G A_G A_G 387 T_T T_T G_G A_G T_T G_G C_T T_T A_C A_A A_G A_G 388 T_T T_T A_G A_G T_T A_G C_T C_T A_C A_A A_G A_G 389 G_G T_T A_G G_G C_T G_G T_T T_T C_C A_G G_G A_G 390 T_T C_T G_G A_G T_T G_G C_T T_T A_A A_A A_A A_G 391 T_T T_T G_G A_A T_T G_G T_T T_T C_C A_A A_G A_G 392 T_T T_T G_G A_G T_T G_G T_T T_T A_T A_A A_G G_G 393 T_T T_T G_G A_G T_T A_G C_T C_T A_C A_G A_G G_G 394 T_T T_T A_G A_G T_T A_G T_T T_T C_C A_G G_G A_A 395 G_G T_T G_G A_A T_T G_G T_T C_C A_C A_G G_G G_G 396 T_T T_T A_G A_A C_T G_G T_T C_T C_C A_G G_G A_G 397 T_T T_T A_G A_A C_T G_G C_T T_T C_C G_G G_G A_G 398 T_T T_T G_G A_A C_T A_G C_T T_T A_C A_G A_G A_G 399 T_T T_T G_G G_G T_T G_G T_T C_T C_T G_G G_G G_G 400 T_T T_T A_G A_G C_T G_G T_T C_T A_C A_A A_G G_G 401 T_T C_T G_G A_G T_T G_G T_T C_T A_C A_G A_A G_G 402 T_T T_T G_G A_A T_T G_G T_T C_C A_C A_G G_G A_G
403 T_T T_T G_G A_G T_T G_G T_T C_T A_C A_A G_G G_G 404 T_T T_T G_G A_A T_T G_G C_T C_T C_T G_G G_G A_G 405 G_T T_T A_G A_G T_T G_G C_T C_T T_T G_G A_G G_G 406 T_T T_T G_G A_G T_T G_G C_T C_T T_T A_G A_G A_G 407 T_T T_T G_G A_G T_T G_G C_T C_C C_C G_G A_G A_A 408 T_T T_T G_G A_G T_T A_G C_T T_T C_T G_G G_G G_G 409 T_T T_T A_G G_G C_T G_G T_T T_T A_A A_G G_G G_G 410 T_T T_T G_G G_G C_T G_G C_T C_T A_C A_G A_G G_G 411 T_T T_T G_G A_G T_T A_G T_T C_T C_T A_A A_G G_G 412 T_T T_T A_G A_G T_T G_G T_T T_T A_A A_A A_A G_G 413 T_T T_T A_G A_A T_T G_G C_C C_T A_C A_A A_G A_G 414 T_T T_T G_G A_G T_T G_G C_T T_T C_T A_G G_G G_G 415 T_T T_T A_G A_G C_T G_G C_T T_T A_A A_A A_A G_G 416 T_T T_T G_G A_G C_T G_G T_T T_T A_C A_A A_G G_G 417 T_T T_T G_G G_G C_T G_G T_T T_T C_T A_G G_G A_G 418 T_T T_T A_G A_G T_T G_G T_T T_T C_T A_A G_G G_G 419 T_T T_T A_G G_G C_T A_G C_T T_T T_T A_G A_G G_G 420 T_T T_T G_G A_G T_T G_G C_T T_T C_T A_G G_G A_G 421 T_T T_T A_G A_G T_T G_G T_T T_T C_T G_G G_G G_G 422 T_T T_T G_G A_G C_T G_G T_T C_C C_T A_G A_G G_G 423 T_T C_T G_G G_G T_T G_G C_C T_T A_C A_A A_G G_G 424 G_T T_T A_G A_G C_T G_G T_T C_C A_C A_G A_A A_G 425 T_T T_T G_G A_G T_T G_G T_T T_T C_T A_G G_G A_G 426 T_T T_T G_G G_G C_T G_G T_T C_T A_C A_G A_G G_G 427 T_T T_T G_G A_G T_T G_G C_T C_T A_C A_G A_G A_G 428 G_T T_T G_G G_G T_T G_G T_T C_C A_C A_A A_G G_G 429 T_T T_T G_G G_G T_T G_G T_T C_T A_C A_A A_G A_G
430 T_T T_T G_G G_G T_T A_G T_T C_C C_T G_G G_G A_G 431 T_T T_T A_G A_G T_T A_G C_C T_T A_A A_A A_A A_G 432 T_T T_T G_G A_G T_T G_G T_T T_T C_C A_A A_A A_G 433 T_T T_T G_G G_G T_T G_G T_T C_C C_T A_G A_G G_G 434 T_T C_T G_G G_G T_T G_G T_T C_T C_T G_G G_G G_G 435 T_T T_T G_G G_G T_T G_G T_T C_T C_T G_G A_A G_G 436 T_T T_T G_G A_A C_T G_G T_T T_T A_C A_G A_G A_G 437 T_T T_T G_G A_G T_T A_G C_T C_T C_C G_G A_G G_G 438 T_T T_T G_G A_G T_T G_G C_T C_T A_C A_A A_G A_G 439 T_T T_T G_G G_G C_T G_G C_T C_C A_A A_A A_A A_A 440 T_T T_T A_G A_G C_T A_G T_T C_T A_C A_G G_G G_G 441 T_T T_T G_G G_G T_T G_G C_T C_T A_A A_A A_G G_G 442 T_T T_T A_G A_G C_T A_G T_T T_T A_C A_A A_G A_G 443 T_T T_T G_G A_G T_T G_G T_T T_T C_T G_G A_G A_G 444 T_T T_T G_G G_G C_T G_G C_C C_C A_C A_G A_G A_G 445 T_T T_T A_A G_G C_T G_G C_C T_T A_A A_A A_A G_G 446 T_T C_T G_G G_G T_T G_G T_T T_T A_C A_G A_G A_G 447 T_T T_T G_G G_G T_T G_G T_T C_C A_T A_A A_G G_G 448 T_T T_T A_G G_G C_T A_G T_T T_T C_T A_G G_G G_G 449 T_T T_T A_G G_G T_T G_G T_T C_T A_C A_G A_G A_G 450 T_T T_T G_G G_G T_T G_G C_T T_T A_C A_G A_G G_G 451 T_T T_T G_G G_G T_T G_G T_T C_T C_T G_G G_G A_G 452 T_T T_T G_G A_G T_T G_G C_T C_C C_T A_A G_G G_G 453 T_T T_T G_G G_G T_T A_G C_T C_T A_C A_A A_G A_G 454 G_G T_T G_G G_G T_T G_G C_T C_T A_C A_G A_G A_G 455 T_T T_T G_G G_G T_T G_G T_T C_T A_C A_A G_G A_A 456 T_T C_T A_g G_G C_T G_G C_T T_T C_T G_G G_G G_G
457 G_T T_T G_G A_G T_T A_G C_T T_T A_A A_A A_A G_G 458 G_G T_T G_G G_G C_T A_G C_T C_C T_T G_G A_G G_G 459 T_T T_T A_A G_G C_C G_G T_T C_T A_A A_G A_A A_G
Appendix E: Genotyping results for control ID rs1042114 rs702764 rs910080 rs199774 rs1022563 rs10494334 rs737866 rs1800955 rs2032582 rs1128503 rs1045642 rs950302 OPRD1 OPRK1 PDYN PDYN PDYN COMT DRD4 ABCB1 ABCB1 ABCB1 DUSP 1 T_T T_T A_A G_G C_C G_G T_T C_T A_C A_G A_G G_G 2 T_T T_T G_G A_G C_T G_G T_T T_T A_A A_A A_A A_G 3 T_T T_T G_G A_G T_T G_G T_T C_T A_C A_G G_G A_A 4 T_T T_T A_G G_G C_T G_G C_T C_C C_C G_G G_G G_G 5 T_T T_T G_G G_G C_T G_G T_T C_T A_C A_A A_G A_A 6 T_T C_T G_G G_G T_T G_G T_T C_T A_C A_A A_G A_A 7 T_T T_T A_G A_A T_T G_G C_T C_C A_C A_A A_G G_G 8 T_T T_T G_G G_G C_T G_G T_T C_T A_C A_A A_A A_A 9 T_T T_T G_G A_G T_T G_G C_T T_T C_C A_G A_G A_G 10 T_T T_T G_G A_A T_T G_G C_C C_T A_C A_G A_G G_G 11 T_T C_T G_G A_G T_T G_G C_T C_C C_C A_G G_G G_G 12 T_T T_T G_G A_G T_T A_G T_T C_T A_C A_A A_G A_G 13 T_T T_T A_G A_A C_T G_G C_T C_C A_A A_A A_A G_G 14 T_T T_T A_G A_G C_T G_G C_C C_T A_A A-G A_A A_G 15 T_T T_T G_G A_G T_T G_G T_T C_T A_C A_G A_G A_A 16 T_T T_T A_G A_G C_T A_G C_T C_C A_C A_G A_G A_G 17 T_T T_T A_G A_G C_T A_G T_T C_T A_A A_A A_G A_G 18 T_G T_T G_G A_G T_T G_G T_T C_T C_T A_A A_G A_G 19 T_T T_T G_G A_A C_T G_G C_T T_T A_C A_G G_G A_A 20 T_T T_T A_G A_G C_T G_G T_T T_T A_A A_A A_G A_G 21 T_T C_T A_G A_G C_T G_G T_T C_T A_C A_G A_G G_G 22 T_T T_T G_G A_G T_T G_G C_C C_T A_C A_G A_G A_A 23 T_T T_T G_G A_A T_T G_G T_T C_T C_C A_G G_G G_G
24 T_T C_T A_G G_G C_T G_G C_T C_T C_C G_G G_G G_G 25 T_T C_T G_G A_A C_T G_G C_T C_T A_C A_A A_G A_G 26 T_T T_T G_G A_A T_T G_G C_T C_T C_T G_G G_G A_A 27 T_T T_T A_G G_G C_T G_G C_T C_T A_C A_G A_A A_A 28 T_T T_T G_G A_A T_T G_G T_T C_C A_A A_G A_A A_A 29 T_T T_T G_G A_G T_T G_G T_T T_T A_C A_G A_G G_G 30 T_T T_T G_G G_G T_T G_G T_T C_C A_C A_G G_G A_A 31 T_T T_T G_G A_G T_T A_G T_T C_T A_C A_A G_G A_G 32 T_T T_T A_G A_G T_T G_G T_T C_C A_C A_A A_G G_G 33 T_T T_T G_G G_G T_T G_G T_T C_C A_C A_A G_G G_G 34 T_T T_T G_G G_G T_T A_G C_T T_T C_C A_G A_G G_G 35 T_T T_T G_G A_A T_T G_G T_T C_T C_C A_G A_G A_G 36 T_T T_T G_G A_G T_T G_G C_T T_T A_A A_A G_G A_G 37 T_T T_T G_G A_A T_T G_G C_T T_T C_C A_G G_G G_G 38 T_T T_T G_G A_A C_T G_G C_T C_T A_A A_A A_G G_G 39 T_T T_T G_G A_G T_T A_G C_T T_T A_C A_G A_G A_G 40 T_T T_T G_G A_A T_T G_G C_T C_T A_C A_G A_G G_G 41 T_T T_T G_G A_G T_T G_G T_T C_T C_C A_G G_G A_G 42 T_T T_T G_G A_G T_T G_G C_C T_T A_C A_G A_A G_G 43 T_T T_T G_G A_G T_T G_G T_T T_T A_C A_A A_G A_G 44 T_T T_T G_G G_G T_T G_G C_T C_T A_C A_A A_G G_G 45 T_T T_T A_G A_G T_T G_G C_T C_C A_C A_A A_G A_G 46 T_T T_T G_G G_G C_T G_G T_T C_T A_C A_G A_G A_G 47 T_G T_T A_G A_G C_T G_G T_T C_T A_A A_A A_G A_G 48 T_T T_T G_G A_G T_T G_G C_T T_T C_C G_G G_G G_G 49 T_T T_T G_G A_G C_T G_G C_T C_T A_C A_A A_G A_G 50 T_T T_T G_G A_G T_T G_G C_C C_T A_A A_A A_G A_G
51 T_T T_T G_G A_A C_T G_G C_T C_T A_C A_G G_G G_G 52 T_T T_T G_G G_G T_T G_G C_T C_T A_T A_G A_A G_G 53 T_T T_T G_G A_A T_T A_G T_T C_T A_C A_G A_G A_G 54 T_G T_T G_G A_A T_T G_G T_T T_T A_C A_G A_G G_G 55 T_T C_T G_G A_A T_T G_G T_T T_T C_C A_G A_G A_G 56 T_T T_T G_G A_G T_T G_G T_T T_T A_C A_A G_G G_G 57 T_T T_T A_G A_G C_T G_G T_T T_T C_C A_A G_G G_G 58 T_T T_T G_G A_G C_T G_G T_T C_T C_C G_G G_G A_G 59 T_T T_T G_G A_A T_T G_G T_T T_T A_C A_G A_G G_G 60 T_T T_T A_G A_G T_T G_G T_T C_C A_C A_A A_G A_G 61 T_T T_T G_G A_G T_T G_G T_T C_T C_C G_G G_G A_G 62 T_T T_T A_G A_G C_T G_G T_T C_T C_C A_A G_G G_G 63 T_G T_T G_G A_G C_T A_G T_T C_C A_A A_A A_A G_G 64 T_T T_T G_G A_A T_T A_G T_T T_T C_C A_A G_G A_G 65 T_T T_T G_G A_A T_T G_G T_T T_T A_C A_G A_G A_G 66 T_T T_T G_G G_G C_T G_G T_T C_T C_C A_G A_G G_G 67 T_T T_T G_G A_G C_C G_G T_T C_T A_C A_A A_G G_G 68 T_T T_T G_G A_A C_T G_G C_C C_T A_C A_G A_G A_G 69 T_T T_T A_G A_G T_T G_G T_T C_C C_C A_A A_G A_G 70 T_T T_T G_G A_G T_T G_G C_T T_T C_C A_G G_G G_G 71 T_T T_T G_G A_G T_T G_G T_T T_T A_C A_G A_G A_G 72 T_T T_T G_G A_G T_T G_G C_T C_T A_C A_G A_G G_G 73 T_T C_T G_G G_G T_T G_G T_T C_T A_C A_G A_A G_G 74 T_T T_T G_G G_G T_T G_G C_T C_T C_C A_A A_G A_G 75 T_T T_T A_A A_A C_C G_G C_T C_T A_C A_G G_G A_G 76 T_T T_T G_G A_G T_T G_G T_T T_T A_C A_A A_G G_G 77 T_T T_T A_G A_A T_T A_G C_T C_T A_A A_A A_G G_G
78 T_T T_T G_G A_A T_T G_G C_T T_T A_C A_A G_G G_G 79 T_T T_T G_G A_G C_T G_G C_T C_T C_C A_A G_G G_G 80 T_T T_T G_G G_G T_T G_G T_T T_T A_C A_A A_G G_G 81 T_T T_T A_A A_G T_T G_G T_T T_T A_T A_G A_G A_G 82 T_T C_T G_G A_A T_T G_G T_T C_T C_C A_G A_G A_A 83 T_T T_T A_G A_G C_T G_G C_T T_T C_T G_G G_G A_A 84 T_T T_T G_G A_A T_T G_G C_T T_T A_T A_G A_G A_G 85 T_T T_T A_G A_G T_T G_G T_T T_T A_T A_G A_G G_G 86 T_T T_T G_G A_G T_T G_G C_C T_T A_A A_A A_A A_A 87 T_T T_T G_G A_G T_T G_G C_T C_C T_T A_A A_G G_G 88 T_T C_T G_G A_G C_T G_G C_C C_C A_A A_A A_A A_A 89 T_T T_T A_A G_G T_T A_G T_T C_C C_C A_G G_G G_G 90 T_T T_T G_G A_A T_T G_G C_C C_T A_C A_A A_G A_G 91 T_T C_T G_G A_A C_T G_G C_T C_T C_C A_A A_G A_G 92 T_T T_T A_G A_G T_T G_G T_T T_T C_C G_G G_G A_A 93 T_T T_T G_G A_A T_T G_G C_C T_T A_A A_G A_A G_G 94 T_T T_T A_G A_A T_T G_G C_T C_T A_A A_A A_A G_G 95 T_T T_T G_G A_G T_T G_G C_T C_T A_T A_G A_G G_G 96 T_T T_T G_G A_G C_T A_G C_T C_T C_C A_A A_G G_G 97 T_T T_T A_G G_G C_T G_G C_T T_T A_C A_G A_G A_G 98 T_T T_T G_G A_G T_T G_G T_T C_T C_C A_A G_G G_G 99 T_T T_T G_G G_G T_T G_G C_T C_T A_C A_A G_G A_G 100 T_T T_T G_G A_G T_T G_G T_T C_T C_C A_G G_G A_G 101 T_T T_T G_G A_A T_T G_G T_T T_T A_C A_A G_G G_G 102 T_T T_T G_G A_A T_T G_G C_T C_T C_T G_G A_G A_G 103 T_T T_T A_G G_G C_T A_G T_T T_T C_T A_G G_G G_G 104 T_T T_T A_A A_G C_T G_G T_T C_T A_C A_G A_G G_G
105 T_T C_T A_G A_G C_C G_G T_T T_T A_C A_A A_G A_G 106 T_T T_T G_G A_A T_T A_G C_T T_T C_C A_G G_G A_A 107 T_T T_T G_G A_G T_T A_G C_T C_T A_C A_G A_G G_G 108 T_T T_T G_G A_G T_T G_G C_T T_T A_A A_A A_G G_G 109 T_T T_T G_G A_G T_T A_G C_T C_T C_C G_G A_A A_A 110 T_T T_T G_G G_G T_T G_G C_T T_T A_C A_G G_G G_G 111 T_T T_T A_G A_A C_T G_G C_T C_T A_A A_A A_A A_G 112 T_T T_T G_G A_A T_T G_G T_T T_T A_C A_A G_G A_G 113 T_T T_T A_G G_G C_T G_G C_T T_T A_C A_A A_G A_G 114 T_T T_T G_G A_G T_T G_G T_T T_T C_C G_G G_G A_G 115 T_T T_T G_G G_G T_T G_G C_T C_T A_C A_G A_G G_G 116 T_T T_T A_G A_A T_T G_G C_T T_T A_C A_G A_G A_G 117 T_T T_T A_G A_G C_T A_G T_T C_T A_A A_A A_G G_G 118 T_T T_T A_G A_G T_T G_G C_C T_T A_C A_G A_G A_G 119 T_T T_T G_G A_A T_T G_G T_T T_T A_C A_G A_G G_G 120 T_T T_T G_G A_G T_T G_G C_T C_C A_T A_G A_G A_A 121 T_T T_T A_G G_G C_T G_G T_T T_T A_C A_A G_G A_G 122 T_T T_T G_G A_G T_T G_G T_T T_T A_C A_A A_G G_G 123 T_T T_T G_G A_G T_T G_G T_T T_T C_C A_A A_G G_G 124 T_T T_T G_G G_G T_T G_G C_T T_T A_C A_A A_G A_G 125 T_T C_T G_G A_A C_C G_G T_T C_T A_A A_A A_A G_G 126 T_T T_T A_G G_G C_T G_G T_T C_C A_A A_A A_A A_G 127 T_T T_T G_G A_G C_T A_G C_T T_T C_C A_A A_A G_G 128 T_T C_T A_G A_G T_T G_G T_T C_T A_C A_A A_A G_G 129 T_T T_T G_G A_A T_T G_G T_T C_T C_C A_G G_G A_G 130 T_T T_T G_G G_G C_T G_G C_T T_T C_C A_G A_G A_G 131 T_T T_T G_G A_G T_T G_G T_T T_T A_A A_A A_G G_G
132 T_G T_T G_G A_A T_T G_G T_T C_T C_C A_A G_G A_G 133 T_T T_T G_G A_A T_T G_G T_T T_T A_C A_G A_G G_G 134 T_T T_T G_G G_G T_T G_G T_T T_T C_C G_G G_G A_A 135 T_T T_T G_G A_G T_T G_G C_T T_T C_C A_A A_G A_G 136 T_T T_T G_G G_G T_T G_G T_T T_T A_C A_G A_G G_G 137 T_T T_T G_G A_G T_T G_G C_T C_C C_C G_G G_G G_G 138 T_T T_T A_G A_A T_T G_G C_T T_T A_A A_A A_A A_G 139 T_T T_T G_G A_A T_T G_G T_T C_T C_T G_G G_G G_G 140 T_T C_T A_G A_G C_T G_G C_T C_C A_C A_A A_G A_G 141 T_T T_T G_G A_G T_T G_G C_T T_T C_T G_G G_G A_G 142 T_T T_T G_G A_A C_T A_G T_T T_T C_C A_G G_G G_G 143 T_T T_T G_G A_A T_T G_G T_T C_T C_T A_G A_G G_G 144 T_T T_T G_G A_G T_T G_G C_T C_T A_A A_A A_A G_G 145 T_T T_T G_G A_A C_T G_G T_T T_T C_C A_G G_G A_G 146 T_T T_T G_G A_A T_T G_G C_T C_T C_C A_G A_G G_G 147 T_T T_T G_G A_G T_T G_G T_T T_T A_C A_G A_G G_G 148 T_T T_T G_G A_A C_T G_G C_T T_T A_C A_A A_A A_G 149 T_T T_T G_G A_A T_T G_G T_T C_T C_C A_A A_G A_G 150 T_T T_T A_G A_G T_T G_G T_T C_C A_C A_G G_G G_G 151 T_T T_T G_G G_G T_T G_G T_T C_T C_C A_G G_G G_G 152 T_T T_T G_G G_G T_T G_G T_T C_T A_C A_G A_G A_G 153 T_G T_T G_G A_G T_T A_G T_T C_T C_T A_G G_G G_G 154 T_T T_T G_G A_A C_T G_G T_T T_T A_C A_A A_G G_G 155 T_T T_T G_G A_A T_T G_G T_T C_T A_C A_G A_A A_A 156 T_T T_T G_G A_A T_T G_G T_T C_T C_C A_A G_G A_G 157 T_T T_T A_G A_A C_T G_G C_T T_T A_C A_A A_A A_G 158 T_T C_T A_G A_G T_T G_G T_T T_T A_A A_A A_A G_G
159 T_T T_T G_G G_G T_T G_G T_T C_C A_A A_A A_G G_G 160 T_T T_T G_G A_A T_T G_G T_T T_T C_C A_G A_G A_G 161 T_T T_T G_G A_A T_T G_G C_C C_T A_C G_G A_G A_A 162 T_T T_T G_G A_G T_T G_G C_T T_T A_A A_A A_G G_G 163 T_T T_T A_G A_G C_C G_G C_T T_T C_T A_G G_G A_G 164 T_T T_T G_G A_A T_T G_G C_T C_T A_C A_A A_A A_G 165 T_T T_T G_G A_A T_T G_G T_T T_T C_C A_G G_G A_G 166 T_T T_T A_G A_A C_T G_G C_T C_C A_A A_A A_A A_G 167 T_T T_T G_G A_G T_T A_G T_T C_T C_C A_A A_G G_G 168 T_T T_T G_G G_G T_T G_G C_T T_T A_A A_A A_G A_G 169 T_T T_T A_G A_A C_T G_G T_T C_T C_C A_G A_G A_A 170 T_T T_T G_G A_G T_T A_G C_T T_T A_A A_A A_G G_G 171 T_T T_T G_G A_G T_T G_G T_T C_T A_A A_A A_A A_G 172 T_T T_T G_G A_G T_T G_G T_T C_C C_C A_G A_G A_A 173 T_T T_T A_G A_G C_T G_G C_C T_T A_C A_A A_G G_G 174 T_T T_T A_G A_G C_T G_G T_T C_T C_T G_G G_G A_G 175 T_G T_T G_G A_G T_T G_G C_T T_T C_C A_G G_G G_G 176 T_T T_T A_G A_G C_T G_G T_T C_T A_A A_A A_G G_G 177 T_T T_T A_A G_G T_T A_G T_T C_C A_C A_A A_G A_G 178 T_T T_T G_G A_A T_T G_G T_T C_T C_T G_G G_G G_G 179 T_T T_T G_G A_G T_T G_G T_T T_T C_C A_G A_G A_A 180 T_T T_T A_G G_G C_T G_G T_T C_T A_C A_G A_G G_G 181 T_T T_T A_G A_G C_T G_G C_T C_T C_T G_G A_G A_G 182 T_T T_T G_G A_G T_T G_G T_T C_T A_C A_A A_G G_G 183 T_T T_T G_G G_G T_T G_G T_T C_T A_A A_A A_A G_G 184 T_T T_T G_G G_G T_T G_G T_T T_T C_C A_G G_G A_G 185 T_T T_T A_G A_G C_T G_G C_T T_T A_C A_G A_G G_G
186 T_T T_T A_G A_G T_T G_G T_T T_T C_C A_G A_G G_G 187 T_T T_T G_G A_G T_T G_G T_T T_T A_C G_G A_G G_G 188 T_T T_T G_G G_G T_T G_G T_T C_T A_C A_G A_A G_G 189 T_T T_T G_G A_A T_T G_G C_C T_T A_C A_A A_G A_G 190 T_T T_T G_G G_G T_T G_G C_T C_T A_A A_A A_G A_G 191 T_T T_T A_G G_G T_T G_G C_T C_T C_C A_A G_G G_G 192 T_T T_T G_G G_G C_C G_G T_T C_T C_C A_G A_A G_G 193 T_T T_T G_G G_G T_T G_G T_T T_T C_C A_G A_G G_G 194 T_T C_T G_G G_G T_T G_G T_T C_T C_T G_G G_G A_A 195 T_T T_T G_G A_G T_T A_G T_T T_T A_C G_G A_A A_G 196 T_T T_T G_G A_G T_T G_G C_C T_T G_G G_G G_G 197 T_T T_T G_G A_G T_T G_G T_T C_T A_C A_G A_G G_G 198 T_T T_T G_G A_G C_T G_G C_T C_C A_A A_G A_G 199 T_T T_T G_G A_G T_T G_G C_C C_T C_C A_A A_G G_G 200 T_T C_T G_G A_G T_T G_G T_T C_T A_A A_A G_G A_G 201 T_T T_T G_G A_G T_T G_G C_C T_T A_A A_A G_G G_G 202 T_T T_T G_G A_G T_T G_G T_T T_T A_A A_A A_G G_G 203 T_T T_T G_G G_G T_T G_G T_T C_T C_C A_G A_G A_G 204 T_T T_T A_G A_G C_T G_G C_T T_T C_C A_A A_G A_G 205 T_T T_T G_G A_A T_T A_G T_T C_T C_C A_G G_G A_G 206 T_T T_T G_G A_G T_T G_G C_T C_T C_C A_G G_G A_G 207 T_T T_T G_G G_G T_T G_G C_T T_T C_C G_G A_G A_G 208 T_T T_T G_G A_G T_T G_G C_T C_T A_A A_A A_A A_G 209 T_T T_T G_G A_G T_T A_G T_T T_T A_A A_G A_A G_G 210 T_T T_T G_G A_G T_T G_G T_T T_T C_C G_G G_G G_G 211 T_T T_T G_G A_G T_T G_G T_T C_T C_C A_A A_A A_G 212 T_T T_T G_G A_G T_T G_G C_T C_C A_C A_G A_G A_G
213 T_T T_T G_G A_A T_T G_G T_T C_T A_C A_G G_G A_G 214 T_T T_T G_G G_G T_T G_G T_T C_T A_C A_G A_G A_G 215 T_T T_T A_G G_G C_T G_G T_T T_T C_C A_G A_G A_G 216 T_T C_C G_G G_G C_T G_G C_C C_T C_C A_A A_G A_G 217 T_T C_T A_G A_A C_C G_G C_T C_T A_C A_A A_A G_G 218 T_T C_T G_G A_G C_T G_G T_T T_T C_C G_G G_G G_G 219 T_T T_T G_G A_G T_T G_G T_T C_T A_A A_A A_A A_G 220 T_T T_T G_G A_G T_T G_G T_T T_T A_C A_G A_G A_G 221 T_T T_T G_G A_A C_T G_G C_T T_T C_C A_G A_G A_G 222 T_T T_T G_G A_A C_T G_G T_T C_T C_C A_A G_G A_A 223 T_T T_T G_G A_G T_T G_G C_T T_T C_C A_G A_A G_G 224 T_T T_T G_G A_G T_T A_G T_T C_T C_C A_G A_G G_G 225 T_T T_T G_G A_G C_T G_G C_T T_T A_A A_A A_G A_G 226 T_T T_T G_G A_G T_T G_G C_C C_T A_A A_G A_A G_G 227 T_T T_T G_G A_G T_T G_G T_T C_T A_A A_A A_A G_G 228 T_T T_T G_G G_G T_T G_G T_T T_T A_C A_G A_G G_G 229 T_T T_T G_G A_G C_T G_G T_T C_T C_C A_G G_G A_G 230 T_T C_T G_G A_G T_T A_G T_T T_T A_C A_G G_G A_A 231 T_T T_T G_G A_G T_T A_G C_C T_T A_A A_A A_A A_G 232 T_T T_T G_G A_G T_T G_G C_T C_T T_T G_G G_G A_G 233 T_T T_T G_G A_A T_T G_G T_T C_C C_C A_G G_G A_A 234 T_T C_T G_G G_G C_T G_G C_T C_T C_T G_G G_G A_G 235 T_T T_T G_G G_G T_T A_G C_T C_T C_C A_A A_G G_G 236 T_T T_T G_G A_G C_T G_G T_T T_T C_T A_A A_G A_G 237 T_T T_T G_G A_A T_T G_G T_T T_T A_A A_G A_G A_G 238 T_T T_T G_G A_G T_T G_G T_T C_T A_A A_A G_G A_G 239 T_T T_T A_G A_G C_T G_G T_T T_T C_C A_G A_A A_G
240 T_T T_T A_G A_G C_T G_G C_T C_C A_C A_A A_G A_G 241 T_T T_T G_G A_G T_T G_G T_T C_T A_A A_G A_A G_G 242 T_T T_T A_G A_G C_T G_G T_T C_T A_C A_G A_G G_G 243 T_T T_T G_G A_G T_T A_A T_T T_T A_C A_G A_G G_G 244 T_T T_T G_G A_G T_T G_G T_T T_T A_C A_A A_G A_G 245 T_T T_T G_G A_G T_T G_G C_T C_T A_C A_G G_G A_G 246 T_T T_T G_G G_G T_T G_G C_T T_T A_T A_G G_G A_G 247 T_T T_T A_G A_A C_T G_G T_T C_T C_C A_A G_G A_G 248 T_T T_T A_G A_G C_T A_G C_T T_T A_A A_A A_A G_G 249 T_T T_T G_G A_G T_T G_G T_T T_T A_C A_G A_G A_G 250 T_T T_T G_G G_G T_T A_G T_T T_T A_C A_G A_G A_G 251 T_T T_T A_G A_G C_T G_G C_T T_T A_C A_A A_G A_G 252 T_T T_T G_G A_A C_T G_G T_T T_T A_C A_G A_G A_A 253 T_T T_T A_G G_G T_T G_G C_T C_T C_C A_G A_G G_G 254 T_T T_T G_G G_G T_T G_G C_C T_T A_C A_A A_A G_G 255 T_G T_T G_G G_G T_T G_G C_T T_T A_C A_G A_G G_G 256 T_T T_T A_G A_A C_T G_G C_C T_T A_C A_G G_G A_G 257 T_T T_T G_G A_G T_T G_G T_T T_T A_C A_A A_A A_G 258 T_T T_T G_G A_A T_T G_G C_T T_T C_C A_G A_A G_G 259 T_T C_T G_G A_G T_T G_G C_T C_T C_C A_A A_G G_G 260 T_T T_T G_G A_G T_T G_G C_T C_C A_C A_A A_A A_G 261 T_T T_T G_G A_G T_T G_G T_T C_T C_T A_G G_G A_A 262 T_T T_T A_G G_G C_C G_G C_C C_T A_T A_G A_A G_G 263 T_T T_T G_G A_G T_T G_G T_T T_T A_A A_A G_G A_G 264 T_T T_T G_G A_G C_T A_G T_T T_T A_C A_G A_G A_G 265 T_T C_T A_G A_G C_T G_G T_T T_T A_C A_G A_A A_G 266 T_T T_T G_G A_G C_T A_G C_T C_T A_C A_A A_G A_G
267 T_T T_T G_G A_A T_T A_G T_T T_T A_C A_G A_A G_G 268 T_T T_T G_G A_G T_T G_G C_T T_T A_T A_G G_G G_G 269 T_T T_T G_G G_G T_T A_G C_T C_T C_C A_G A_G A_G 270 T_T T_T G_G A_G T_T G_G C_C C_C C_C A_A G_G A_A 271 T_T T_T A_G G_G C_C G_G T_T C_T C_T A_A A_A A_G 272 T_T T_T G_G A_G T_T G_G T_T C_T T_T A_A G_G G_G 273 T_T T_T G_G G_G C_T G_G T_T T_T C_C G_G A_A A_G 274 T_T T_T G_G A_A T_T G_G T_T T_T C_C G_G G_G G_G 275 T_T T_T A_A G_G C_C A_G T_T C_T A_C A_G A_G A_G 276 T_T C_T G_G A_G T_T G_G T_T T_T A_T A_A A_G A_G 277 T_T T_T G_G A_G T_T G_G T_T C_C A_C A_A A_A A_G 278 T_T C_T G_G A_G T_T G_G T_T C_T A_C A_A A_G A_G 279 T_T T_T A_G A_G T_T G_G T_T T_T A_A A_G A_A A_G 280 T_T T_T G_G A_G T_T G_G T_T C_T A_A A_G A_G G_G 281 T_T T_T G_G A_G T_T G_G C_T C_C A_A A_G A_G A_A 282 T_T C_T A_G A_G C_T G_G C_T C_T A_C A_A A_A G_G 283 T_T C_T A_G G_G C_T G_G T_T C_T C_C A_A A_A G_G 284 T_T C_T G_G A_A T_T G_G C_T C_C A_C A_A G_G A_G 285 T_T T_T G_G A_G T_T A_G C_T C_T C_C A_G A_G G_G 286 T_T T_T G_G A_G C_T G_G T_T T_T C_C A_G G_G G_G 287 T_T T_T G_G A_A T_T G_G T_T C_T C_C A_G A_G A_G 288 T_T T_T G_G A_A T_T G_G T_T C_C A_C A_A A_G A_G 289 T_T T_T G_G A_G T_T A_G T_T C_T C_C A_G A_G A_G 290 T_T T_T G_G A_G T_T G_G C_T C_C C_C A_A A_A A_A 291 T_T T_T G_G A_A T_T G_G T_T C_T A_A A_A G_G A_G 292 T_T C_T G_G G_G C_T A_G T_T T_T C_T A_G A_G G_G 293 T_T T_T G_G G_G T_T G_G T_T T_T A_C A_A A_G G_G
294 T_T C_T G_G A_A T_T G_G T_T T_T A_C A_A A_A G_G 295 T_T C_T G_G A_G T_T G_G C_T C_T A_G G_G A_G 296 T_T T_T A_G A_A C_T A_G C_T C_C A_C A_A A_G G_G 297 T_T T_T A_G G_G C_T A_G T_T C_T C_C A_G A_G G_G 298 T_T T_T G_G A_G T_T G_G C_T C_T A_A A_A A_G G_G 299 T_T C_T G_G A_A T_T G_G C_T T_T A_C A_A A_G G_G 300 T_T T_T G_G A_A T_T A_G T_T T_T A_C A_A A_G A_G 301 T_T T_T G_G A_G T_T G_G T_T T_T C_C A_G A_G A_G 302 T_T T_T G_G A_A T_T G_G C_T C_T C_C A_G A_G A_G 303 T_T T_T G_G A_G T_T G_G C_T T_T A_C A_G G_G G_G 304 T_T T_T G_G A_A T_T G_G C_T T_T C_C A_A A_G A_G 305 T_T T_T G_G G_G C_T G_G T_T C_T C_C G_G G_G A_G 306 T_T T_T A_G G_G C_T G_G C_C T_T C_C G_G G_G A_A 307 T_T T_T G_G A_G C_T A_G T_T C_C C_C A_G A_G A_G 308 T_T T_T A_G A_G T_T G_G C_T C_T C_C A_A G_G A_A 309 T_T T_T G_G G_G T_T A_G C_T C_C C_C A_G G_G G_G 310 T_T T_T A_G A_G C_T A_G T_T C_C C_C A_G A_G G_G 311 T_T T_T A_G A_G T_T G_G T_T C_T A_A A_G A_A G_G 312 T_T T_T G_G G_G C_T G_G T_T T_T T_T A_G A_G G_G 313 T_T T_T G_G G_G T_T G_G T_T T_T C_C A_A G_G G_G 314 T_T T_T G_G A_A C_T G_G T_T T_T C_C A_A A_A A_G 315 T_T T_T G_G A_G T_T G_G T_T T_T A_C A_G A_G G_G 316 T_T T_T G_G A_G T_T G_G T_T C_T A_A A_A A_A G_G 317 T_T T_T A_G A_A C_T A_G C_C T_T T_T A_A A_A G_G 318 T_T T_T G_G A_A T_T A_G C_T T_T A_A A_A A_A A_G 319 T_T T_T A_G A_G C_T A_G T_T C_T A_C A_G A_A G_G 320 T_T T_T G_G A_G T_T G_G C_T C_T A_A A_A A_A G_G
321 T_T T_T G_G A_A T_T A_G C_T T_T A_C A_A A_A A_A 322 T_T T_T G_G G_G T_T G_G C_T T_T A_A A_G A_G A_G 323 T_T T_T G_G A_A T_T G_G T_T T_T A_A A_G A_G A_A 324 T_T T_T G_G A_G T_T A_A C_C C_T A_C A_A G_G A_G 325 T_T T_T G_G A_G T_T G_G C_T T_T A_C A_G G_G A_G 326 T_T T_T G_G A_A T_T A_G C_T C_T A_A A_A A_A A_G 327 T_T T_T G_G G_G T_T G_G C_T T_T C_C G_G G_G G_G 328 T_T T_T G_G A_A T_T G_G T_T T_T A_T A_A A_G A_G 329 T_T T_T A_G A_G C_T G_G C_T T_T A_T A_G A_G A_A 330 T_T T_T G_G A_G T_T G_G C_T C_T C_C G_G A_A A_A 331 T_T C_T G_G A_A C_T G_G t_T C_T A_C A_A G_G A_G 332 T_T T_T G_G A_A T_T G_G T_T T_T A_C A_A A_G A_G 333 T_T T_T G_G G_G T_T G_G C_T T_T C_C A_A A_A A_A 334 T_T T_T G_G G_G T_T A_G C_C T_T A_A A_A A_G A_G 335 T_T C_T G_G A_A T_T G_G C_T C_T A_C A_A A_A A_A 336 T_T T_T A_G A_A C_T G_G T_T T_T A_C A_A A_G A_G 337 T_T C_T G_G A_G C_T G_G C_T T_T C_C A_G A_G A_A 338 T_T T_T G_G G_G T_T G_G T_T T_T A_C A_A A_G G_G 339 T_T C_T G_G A_A C_C G_G C_T C_C A_C A_G G_G G_G 340 T_T T_T G_G A_A T_T G_G C_C T_T A_C A_A A_A A_G 341 T_T T_T G_G A_A C_T G_G T_T C_C A_C A_G A_A G_G 342 T_T T_T G_G A_G C_C G_G T_T T_T A_C A_A A_G G_G 343 T_T T_T G_G A_G C_T G_G T_T C_T A_C A_G A_G A_G 344 T_T T_T G_G A_G T_T G_G C_T T_T C_C A_G G_G A_G 345 T_T T_T A_G A_A C_T A_G T_T C_T A_C A_G A_G A_G 346 T_T T_T A_G A_A C_T G_G T_T C_T A_C A_G A_G G_G 347 T_T C_T G_G A_G T_T G_G C_T C_C A_A A_G A_A A_G
348 T_T T_T G_G A_A T_T A_G T_T C_T A_C A_A A_G A_A 349 T_T C_T A_G A_G C_T G_G T_T C_C A_A A_G A_G A_G 350 T_T T_T G_G A_A T_T G_G T_T T_T C_C G_G G_G A_G 351 T_T C_T G_G A_A T_T G_G C_T T_T A_A G_G G_G A_G 352 T_T T_T G_G A_A T_T G_G C_C C_C A_A A_A G_G A_G 353 T_T C_T G_G A_A C_C G_G T_T T_T A_C A_A G_G A_A 354 T_T T_T A_A A_G C_C G_G C_T C_T A_A A_A A_G G_G 355 T_T C_T G_G G_G T_T G_G T_T C_T A_C A_G A_G A_G 356 T_T T_T G_G A_G T_T G_G T_T T_T A_C A_A A_G A_G 357 T_T T_T G_G A_G T_T A_G T_T T_T A_C A_G G_G A_G 358 T_T C_C G_G G_G C_T G_G T_T T_T A_A A_A A_G G_G 359 T_T T_T G_G G_G T_T G_G T_T C_T A_A A_A G_G A_G 360 T_T T_T G_G G_G T_T G_G C_T C_C C_C A_G A_G A_G 361 T_T T_T G_G A_G T_T G_G C_T C_T C_C A_G A_G A_G 362 T_T C_T G_G A_G T_T G_G T_T C_T C_C A_G A_A G_G 363 T_T T_T A_G A_G T_T G_G T_T C_C A_C A_G G_G A_G 364 G_G C_T G_G A_A T_T G_G C_T C_T C_C A_G G_G A_G 365 T_T T_T G_G A_A C_T G_G T_T T_T C_C A_A G_G G_G 366 T_T C_T A_G A_A C_T G_G C_C T_T A_C A_G G_G A_G 367 T_T T_T A_A A_A C_C G_G T_T T_T C_C A_G G_G G_G 368 T_T C_T A_G A_G C_T G_G C_T C_T A_C A_G A_G A_G 369 T_T C_T G_G A_G T_T G_G C_T C_C C_C G_G A_G A_G 370 T_T T_T G_G A_A T_T G_G C_T C_C A_C A_G A_G G_G 371 T_T T_T G_G A_G T_T G_G T_T C_T A_C A_G A_G A_G 372 T_T T_T A_G A_G C_T G_G C_T T_T A_A A_G A_G A_G 373 T_T T_T A_G G_G T_T G_G C_T C_T C_C G_G G_G G_G 374 T_T T_T G_G G_G T_T A_G C_T T_T A_C A_A A_G A_G
375 T_T C_T G_G A_G T_T G_G T_T C_T C_C A_A A_G A_G 376 T_T T_T G_G A_A T_T G_G C_T C_C C_C A_A A_G A_G 377 T_T T_T G_G A_G T_T A_G C_T C_T A_C A_G A_G G_G 378 T_G C_T G_G A_G T_T G_G T_T C_T A_C A_G G_G G_G 379 T_T T_T G_G A_G T_T G_G T_T T_T C_C G_G G_G G_G 380 T_T C_T G_G A_A C_T G_G T_T C_C A_A A_A G_G A_G 381 T_T T_T G_G G_G T_T A_G C_T C_T A_C A_G A_G G_G 382 T_T T_T G_G G_G T_T A_G C_T C_T A_C A_A A_G A_G 383 T_T T_T G_G A_G T_T G_G C_T T_T A_C A_G A_G G_G 384 T_T T_T A_A A_G T_T G_G C_T T_T C_C A_A A_A G_G 385 T_T T_T G_G G_G C_T G_G T_T T_T C_C G_G A_A A_G 386 T_T T_T G_G G_G T_T G_G C_T C_C A_C A_G A_G G_G 387 T_T T_T A_G G_G T_T G_G T_T C_C C_C G_G A_G A_G 388 T_T T_T A_G G_G C_T G_G T_T T_T A_A A_A A_A A_G 389 T_T T_T G_G A_G T_T G_G T_T C_C C_C G_G A_A A_G 390 T_T T_T G_G A_G C_T G_G T_T C_T A_T A_G A_G G_G 391 T_T T_T G_G A_G T_T G_G C_T C_C A_C A_G A_G G_G 392 T_T C_T A_G A_G T_T A_G T_T C_C A_C G_G A_A A_G 393 T_T T_T A_A A_G C_T G_G C_C T_T A_C A_A A_A G_G 394 T_T T_T A_G G_G C_T G_G T_T C_T C_C A_G A_G A_G 395 T_G T_T G_G G_G T_T G_G T_T T_T C_T G_G A_A A_G 396 T_T T_T G_G A_G C_T G_G C_T T_T C_T A_G G_G G_G 397 T_T T_T G_G G_G C_T G_G T_T C_T A_C A_G A_G A_G 398 T_T T_T G_G G_G T_T G_G T_T T_T A_A A_A A_G G_G 399 T_T T_T G_G G_G T_T G_G C_T C_T C_C A_G A_G G_G 400 T_T C_T G_G A_G C_T G_G T_T C_T A_C A_G A_G A_G 401 T_T T_T G_G A_G C_T G_G T_T T_T A_C A_G A_G A_A
402 T_T T_T G_G A_G T_T G_G C_T T_T C_C A_A G_G G_G 403 T_T T_T G_G A_G C_T G_G T_T C_T C_C A_G A_G A_A 404 T_T T_T G_G G_G T_T A_G T_T C_T C_C A_A G_G A_G 405 T_T T_T A_A G_G T_T G_G C_T C_T C_T A_G G_G G_G 406 T_T T_T G_G G_G T_T G_G C_C T_T C_T A_G A_G G_G 407 T_T T_T G_G G_G T_T A_G T_T T_T C_T A_G A_G G_G 408 T_T T_T G_G G_G T_T A_G T_T C_T C_C G_G G_G A_G 409 T_T T_T G_G G_G T_T G_G T_T T_T A_C A_G A_A A_G 410 T_T T_T G_G G_G T_T A_G C_T C_T T_T A_G A_A G_G 411 T_T T_T G_G G_G T_T A_G C_T C_T C_C A_A A_A A_G 412 T_G T_T G_G A_A T_T A_G C_C T_T A_C A_G A_G G_G 413 T_T T_T G_G A_G C_T A_G T_T C_C C_C A_G A_G G_G 414 T_T T_T G_G A_G T_T G_G C_C C_T A_C G_G A_G A_G 415 T_T T_T G_G A_G T_T G_G T_T C_T C_C A_G A_A G_G 416 T_T T_T G_G A_A T_T G_G C_C C_C A_C G_G A_G A_G 417 T_T T_T G_G A_G C_T G_G T_T C_C A_C A_G G_G A_G 418 T_T T_T G_G G_G T_T G_G T_T T_T C_C G_G G_G G_G 419 T_T T_T G_G A_G T_T G_G C_T C_C A_C A_G A_G G_G 420 T_T T_T A_G A_G T_T G_G T_T C_T A_C A_G A_G A_G 421 T_T T_T G_G G_G C_T G_G T_T T_T A_A A_A G_G A_G 422 G_T T_T G_G G_G C_T A_G C_T T_T A_A A_A G_G G_G 423 T_T C_T G_G A_G T_T G_G C_T T_T A_A A_A A_G G_G 424 T_T T_T G_G A_A C_T G_G C_C T_T A_C A_G A_G A_G 425 T_T T_T G_G G_G T_T G_G C_T C_T A_C A_G A_A A_G 426 T_T T_T G_G G_G T_T G_G C_T T_T A_A A_A A_A G_G 427 T_T C_T G_G A_G C_T G_G T_T T_T A_A A_A A_G G_G 428 T_T T_T G_G G_G T_T G_G T_T T_T A_C A_A G_G A_G
429 T_T T_T G_G G_G T_T G_G T_T T_T C_C A_G A_A G_G 430 T_T T_T A_A A_G C_C G_G T_T C_C A_A A_G A_G A_G 431 T_T T_T G_G G_G T_T G_G C_C C_T A_C A_G G_G G_G 432 T_T T_T G_G G_G T_T G_G C_T C_T A_C A_G G_G G_G 433 T_T T_T G_G A_G T_T G_G T_T C_T A_A A_G A_G G_G 434 T_T T_T G_G G_G T_T G_G T_T C_C C_T A_A G_G A_G 435 T_T T_T A_G G_G T_T G_G C_T T_T C_C G_G G_G A_G 436 T_G T_T G_G G_G T_T A_G C_T T_T A_C A_G G_G G_G 437 T_T T_T G_G A_G C_T G_G C_T T_T A_A A_A A_G A_G 438 T_T T_T G_G G_G T_T G_G C_T C_T A_C A_G A_G G_G 439 T_T T_T G_G A_G T_T G_G T_T T_T A_A A_A G_G A_G 440 T_T T_T G_G G_G C_T G_G C_T T_T C_C A_G G_G G_G 441 T_T T_T G_G A_G T_T G_G T_T C_T A_C A_A A_G A_G 442 G_T T_T G_G G_G C_T A_G T_T T_T A_C A_G A_G G_G 443 T_G T_T G_G A_A T_T G_G T_T T_T A_A A_A A_A A_A 444 T_T T_T G_G G_G T_T G_G C_T T_T A_C A_G A_G A_A 445 T_T C_T G_G A_G C_T G_G T_T T_T A_A A_G A_G G_G 446 T_T C_C G_G G_G T_T G_G T_T T_T A_C A_G A_A A_A 447 T_T C_T G_G A_G T_T G_G T_T T_T A_C A_G A_A A_G 448 T_T T_T G_G A_G C_T G_G T_T T_T A_A A_A A_G A_G 449 T_T T_T G_G G_G C_T A_G T_T C_T C_C A_A G_G G_G 450 T_T T_T G_G G_G T_T A_G T_T T_T A_C A_G A_G A_G 451 T_T T_T G_G A_A T_T G_G C_T T_T A_C A_A A_G G_G 452 T_G T_T A_G A_G T_T G_G C_T C_T C_T G_G G_G A_G 453 T_T T_T G_G G_G C_T G_G T_T T_T A_C A_G A_G G_G 454 T_T T_T G_G A_A C_T G_G C_T T_T C_C G_G G_G A_A 455 T_T T_T G_G A_G T_T G_G C_C T_T A_C A_G G_G G_G
456 T_T T_T G_G G_G T_T G_G T_T C_T A_A A_A A_A A_G 457 T_T T_T G_G A_G T_T G_G C_T C_T A_A A_A A_G G_G 458 T_T T_T G_G A_G C_T A_G C_T T_T A_C A_G A_A A_G 459 T_T T_T G_G A_A T_T G_G C_T T_T A_T A_G A_G A_G 460 T_T T_T G_G A_G C_T G_G T_T T_T A_C A_G A_G A_A 461 T_T T_T G_G A_G T_T G_G C_T C_T C_C A_G G_G A_G 462 T_T T_T G_G G_G T_T G_G T_T T_T A_A A_A A_A A_G 463 T_T T_T G_G A_G T_T A_G C_C T_T A_C A_G A_G A_G 464 T_T T_T G_G A_G C_T A_G C_T C_T A_C A_A A_G G_G 465 T_T T_T G_G G_G C_T G_G C_T T_T C_T G_G G_G G_G 466 T_T T_T G_G A_G C_T G_G T_T T_T A_C A_G A_G G_G 467 T_T T_T G_G A_A T_T G_G C_T C_T C_C A_G G_G A_A 468 T_T T_T G_G A_A T_T G_G C_T T_T A_C A_G A_G A_G 469 T_G T_T G_G A_G T_T G_G C_T C_T A_C A_G A_G A_A 470 T_T T_T G_G G_G C_T G_G T_T T_T A_A A_A A_A A_G 471 T_T T_T G_G G_G T_T G_G T_T T_T A_C A_G A_G A_A 472 T_T T_T G_G A_G T_T G_G T_T C_T A_A A_A A_A A_A 473 T_T T_T G_G A_G T_T G_G T_T T_T A_A A_A A_A A_A 474 T_T T_T G_G A_G T_T G_G T_T C_T A_C A_G A_G G_G 475 T_T T_T G_G G_G T_T G_G C_T C_C A_C A_G A_G G_G 476 T_T T_T G_G G_G C_T G_G T_T C_C C_C G_G G_G A_A 477 T_T T_T A_G A_A C_T G_G T_T C_T A_C A_G A_G A_G 478 T_T T_T G_G A_G T_T A_G C_T C_T A_T A_A A_A A_G 479 T_T T_T G_G A_G T_T G_G T_T C_C C_C G_G G_G G_G 480 T_T T_T G_G A_A T_T G_G C_T C_C A_C A_A A_G A_G 481 T_T T_T G_G G_G T_T G_G T_T T_T C_C A_G A_G G_G 482 T_T T_T G_G A_G T_T G_G C_T C_C C_T G_G G_G A_G
483 T_T T_T G_G A_G T_T A_G T_T C_T A_C A_A A_G A_G 484 T_T T_T G_G A_G T_T G_G C_T T_T C_C A_G G_G A_G 485 T_T T_T G_G G_G T_T G_G T_T T_T A_A G_G A_A A_G 486 T_T T_T G_G G_G C_T G_G T_T C_T A_A A_A A_G G_G 487 T_T T_T A_G G_G C_T G_G T_T T_T A_C A_A A_G A_G 488 T_T T_T A_G G_G T_T G_G T_T T_T A_A A_A A_A A_A 489 T_T T_T G_G G_G C_T G_G C_C T_T A_C A_G G_G G_G 490 T_T T_T G_G A_G T_T G_G C_T T_T A_C A_G A_G A_G 491 T_T T_T G_G A_G C_T G_G T_T C_T A_T A_G A_G A_G 492 T_T T_T G_G A_G T_T G_G T_T T_T A_C A_G A_G A_G 493 T_T T_T G_G A_G C_T G_G C_C T_T A_A A_A A_A G_G 494 T_T T_T G_G A_G T_T A_G T_T C_T C_T G_G G_G G_G 495 T_T T_T G_G G_G T_T A_G C_T T_T A_C A_G A_G G_G 496 T_T T_T A_G A_G T_T G_G C_T T_T C_C A_G G_G A_G 497 T_T T_T A_G A_G T_T G_G T_T C_T A_C G_G A_G A_G 498 T_T T_T G_G A_A T_T G_G C_T C_T A_C A_A G_G A_C 499 T_T T_T G_G G_G T_T A_G T_T C_T A_C A_G A_G A_G 500 T_T T_T A_G A_G C_T G_G T_T T_T C_T A_A A_G A_G 501 T_G T_T G_G A_G T_T A_A C_T T_T C_T G_G G_G A_G 502 T_T T_T G_G A_A C_T A_G C_T C_T C_T G_G G_G G_G 503 T_T T_T G_G A_G T_T G_G C_T T_T C_C A_G A_G G_G 504 T_T T_T G_G A_A T_T G_G C_C C_C C_C A_G A_G G_G 505 T_T T_T G_G A_G T_T A_G T_T T_T A_C A_G A_G G_G 506 T_G T_T G_G A_G T_T G_G C_T C_T A_T A_G A_G A_A 507 T_T T_T G_G A_G T_T G_G C_C C_T A_T A_G A_G A_G 508 T_T T_T G_G A_G C_T G_G T_T C_T A_C A_A A_G A_G 509 T_T T_T A_G A_G C_T G_G T_T T_T A_C A_G A_G A_G
510 T_T T_T G_G G_G T_T G_G T_T C_T A_A A_A A_A G_G 511 T_T T_T G_G A_G T_T G_G T_T C_T C_C A_A G_G G_G 512 T_T T_T G_G A_G T_T G_G C_T T_T C_C A_A A_G G_G 513 T_T T_T G_G G_G T_T G_G C_T T_T T_T A_G G_G A_G 514 T_T T_T A_G A_G T_T G_G T_T C_T C_T A_G A_G A_G 515 T_T T_T G_G G_G T_T G_G T_T T_T C_C A_G G_G A_G 516 T_T T_T G_G A_G T_T G_G T_T C_T A_C G_G A_G A_A 517 T_T T_T G_G A_G C_T G_G T_T T_T C_C A_G A_G A_G 518 T_G T_T G_G A_A T_T G_G C_T C_T C_C G_G A_A G_G 519 T_T T_T A_G G_G T_T G_G C_C T_T A_A A_G G_G A_A 520 T_T T_T G_G A_A T_T G_G C_T T_T A_A A_G A_A A_A 521 T_T T_T G_G A_G C_T G_G T_T C_T A_A G_G A_G A_G 522 T_T T_T A_G A_G T_T G_G T_T T_T A_C G_G A_G A_G 523 T_T T_T G_G G_G T_T G_G T_T T_T C_C A_G G_G A_G 524 G_T T_T G_G A_G C_T G_G T_T C_T C_C A_G A_G A_A 525 T_T T_T G_G A_G T_T G_G C_T T_T A_C G_G A_G G_G 526 T_T T_T A_G A_G T_T G_G T_T T_T C_C G_G A_G G_G 527 T_T T_T G_G A_G T_T G_G C_T C_T C_C A_G A_G A_G 528 T_T T_T G_G A_G T_T A_G C_T T_T A_C A_G A_G G_G 529 T_T T_T A_G A_G C_T G_G T_T T_T C_C A_G A_G G_G 530 T_T T_T G_G A_G T_T G_G C_T C_T A_C G_G A_G A_G 531 T_T T_T A_G A_A T_T G_G T_T T_T C_C G_G A_A A_G 532 T_T T_T G_G A_G T_T G_G T_T C_T C_T A_G A_G G_G 533 T_T T_T G_G A_G T_T G_G C_T T_T C_T A_G A_G A_G 534 T_T T_T A_G A_A C_T A_G T_T T_T A_C A_G A_A G_G 535 T_T T_T G_G A_A T_T A_G T_T C_T A_C G_G A_A G_G 536 T_T T_T G_G A_G C_T G_G T_T C_T C_C G_G A_G G_G
537 T_T T_T A_G A_G C_T G_G C_C T_T A_A A_G A_A A_G 538 T_T T_T A_G A_G C_T G_G C_C C_T A_C G_G A_G A_G 539 T_T T_T A_G A_G T_T G_G T_T T_T C_C G_G A_G G_G 540 T_T T_T G_G A_G T_T G_G C_C C_C C_C A_G A_G A_A 541 G_T T_T G_G A_A T_T G_G C_T T_T A_A G_G A_A G_G 542 T_T T_T G_G A_G C_C A_G C_T C_C A_T A_G A_G G_G 543 T_T T_T A_G A_G T_T G_G C_C T_T C_C A_G A_G A_G
Appendix D: SNP SNP Interaction (OPRD1rs1042114) OPRD1 OPRK1 p Case Control Odds Ratio rs1042114 rs702764 Value TT TT 378 464 TT CT/CC 38 56 0.409 0.83(0.539-1.285) GG/GT TT 38 21 0.004 2.22(1.281-3.849) GG/GT CT/CC 6 2 0.112 3.68(0.739-18.35) OPRD1 COMT p Case Control Odds Ratio rs1042114 rs737866 Value TT TT 228 282 TT CT/CC 188 238 0.860 0.97(0.754-1.265) GG/GT TT 26 11 0.003 2.92(1.414-6.043) GG/GT CT/CC 17 12 0.147 1.75(0.820-3.744) OPRD1 PDYN p Case Control Odds Ratio rs1042114 rs910080 Value TT GG 299 400 TT AG/AA 117 120 0.078 1.30(0.970-1.752) GG/GT GG 28 21 0.052 1.78(0.990-3.202) GG/GT AG/AA 15 2 0.895 0.95(0.484-1.884) OPRD1 PDYN p Case Control Odds Ratio rs1042114 rs199774 Value TT GG 91 136 TT AG/AA 325 384 0.129 1.26(0.933-1.713) GG/GT GG 13 5 0.010 3.88(1.330-11.27) GG/GT AG/AA 30 18 0.005 2.49(1.311-4.732) OPRD1 PDYN p Case Control Odds Ratio rs1042114 rs1022563 Value TT TT 290 353 TT CT/CC 126 168 0.521 0.91(0.691-1.205) GG/GT TT 23 18 0.173 1.55(0.823-2.938) GG/GT CT/CC 20 4 0.001 6.08(2.057-18.00) OPRD1 p rs10494334 Case Control Odds Ratio rs1042114 Value TT GG 343 438 TT AG/AA 73 82 0.467 1.13(0.804-1.606) GG/GT GG 39 16 0.0002 3.11(1.710-5.660) GG/GT AG/AA 4 7 0.617 0.72(0.211-2.510) OPRD1 DRD4 p Case Control Odds Ratio rs1042114 rs1800955 Value TT TT 179 240 TT CT/CC 237 280 0.330 1.13(0.875-1.471) GG/GT TT 16 11 0.098 1.95(0.883-4.300) GG/GT CT/CC 27 12 0.002 3.01(1.480-6.117)
OPRD1 ABCB1 p Case Control Odds Ratio rs1042114 rs1128503 Value TT AA 132 204 TT AG/GG 284 316 0.017 1.38(1.05-1.82) GG/GT AA 14 6 0.010 3.60(1.35-9.61) GG/GT AG/GG 29 17 0.0029 2.63(1.39-4.98) OPRD1 ABCB1 p Case Control Odds Ratio rs1042114 rs1045642 Value TT GG 161 144 TT AG/AA 255 376 0.0004 0.61(0.460-0.778) GG/GT GG 14 9 0.455 1.39(0.584-3.311) GG/GT AG/AA 29 14 0.070 1.85(0.942-3.643) OPRD1 ABCB1 p Case Control Odds Ratio rs1042114 rs2032582 Value TT CC 129 157 TT AC/AA 209 305 0.222 0.83(0.622-1.116) TT CT/TT 50 37 0.044 1.64(1.012-2.670) GG/GT CC 13 2 0.007 7.91(1.753-35.69) GG/GT AC/AA 24 2 0.0003 14.60(3.387-62.96) GG/GT TC/TT 4 0 0.109 10.94(0.583-205.20) OPRD1 DUSP p Case Control Odds Ratio rs1042114 rs950302 Value TT GG 184 217 TT AG/AA 232 302 0.457 0.91(0.698-1.170) GG/GT GG 18 12 0.139 1.76(0.830-3.760) GG/GT AG/AA 25 18 0.128 1.63(0.866-3.090)
OPRK1 OPRD1 p Case Control Odds Ratio rs702764 rs1042114 Value
TT TT 378 464 TT GT/GG 38 21 0.004 2.22(1.28-3.40) CT/CC TT 38 56 0.408 0.833(0.539-1.285) CT/CC GT/GG 5 2 0.181 3.06(0.592-15.90) OPRK1 COMT p Case Control Odds Ratio rs702764 rs737866 Value TT TT 217 377 TT CT/CC 189 108 0.023 1.41(1.047-1.91) CT/CC TT 27 44 0.661 0.89(0.55-1.45) CT/CC CT/CC 16 14 0.826 1.09(0.497-2.39) OPRK1 PDYN p Case Control Odds Ratio rs702764 rs910080 Value TT GG 296 377 TT AG/AA 120 108 0.023 1.41(1.047-1.91) CT/CC GG 31 44 0.661 0.89(0.55-1.45) CT/CC AG/AA 12 14 0.826 1.09(0.497-2.39) OPRK1 PDYN p Case Control Odds Ratio rs702764 rs199774 Value TT GG 90 130 TT AG/AA 326 355 0.072 1.32(0.974-1.804) CT/CC GG 14 11 0.152 1.83(0.798-4.23) CT/CC AG/AA 29 47 0.673 0.89(0.521-1.522) OPRK1 PDYN P Case Control Odds Ratio rs702764 rs1022563 Value TT TT 286 340 TT CT/CC 130 145 0.66 1.06(0.802-1.416) CT/CC TT 27 30 0.807 1.06(0.621-1.840) CT/CC CT/CC 16 28 0.232 0.67(0.360-1.280) OPRK1 p rs10494334 Case Control Odds Ratio rs702764 Value TT GG 344 399 TT AG/AA 72 86 0.867 0.97(0.687-1.370) CT/CC GG 38 55 0.321 0.80(0.517-1.241) CT/CC AG/AA 5 3 0.369 1.93(0.458-8.14)
OPRK1 DRD4 p Case Control Odds Ratio rs702764 rs1800955 Value TT TT 176 231 TT CT/CC 240 254 0.109 1.24(0.952-1.614) CT/CC TT 19 20 0.51 0.80(0.517-1.241) CT/CC CT/CC 24 38 0.501 1.93(0.458-8.14) OPRK1 ABCB1 P Case Control Odds Ratio rs702764 rs1128503 Value TT AA 135 182 TT AG/GG 281 303 0.118 1.24(0.945-1.641) CT/CC AA 12 28 0.131 0.57(0.283-1.177) CT/CC AG/GG 32 30 0.191 1.43(0.833-2.481) OPRK1 ABCB1 P Case Control Odds Ratio rs702764 rs1045642 Value TT GG 159 138 TT AG/AA 257 349 0.0017 0.639(0.483-0.845) CT/CC GG 16 16 0.703 0.867(0.418-1.800) CT/CC AG/AA 27 41 0.041 0.571(0.33-0.977) OPRK1 ABCB1 p Case Control Odds Ratio rs702764 rs2032582 Value TT CC 126 148 TT AC/AA 212 278 0.4679 0.895(0.665-1.205) TT CT/TT 52 39 0.066 1.566(0.970-2.526) CT/CC CC 16 14 0.445 1.342(0.630-2.857) CT/CC AC/AA 21 39 0.122 0.632(0.353-1.131) CT/CC CT/TT 2 3 0.7906 0.783(1.128-4.760) DUSP p COMT Case Control Odds Ratio rs950302 Value TT GG 185 207 TT AG/AA 231 278 0.589 0.929(0.713-1.210) CT/CC GG 17 22 0.667 0.864(0.445-1.678) CT/CC AG/AA 26 36 0.44 0.808(0.470-1.389)
PDYN OPRK1 p Case Control Odds Ratio rs910080 rs702764 Value GG TT 296 377 GG CT/CC 31 44 0.661 0.89(0.553-1.4560 AG/AA TT 120 108 0.023 1.41(1.047-1.912) AG/AA CT/CC 12 14 0.826 1.09(0.497-2.395) PDYN OPRD1 p Case Control Odds Ratio rs910080 rs1042114 Value GG TT 299 400 GG GT/GG 28 21 0.05 1.78(0.993-3.202) AG/AA TT 117 120 0.07 1.30(0.970-1.752) AG/AA GT/GG 15 2 0.002 10(2.277-44.20) PDYN COMT p Case Control Odds Ratio rs910080 rs737866 Value GG TT 186 226 GG CT/CC 141 195 0.383 0.87(0.656-1.175) AG/AA TT 68 67 0.291 1.23(0.835-1.820) AG/AA CT/CC 64 55 0.09 1.41(0.939-2.129) PDYN PDYN p Case Control Odds Ratio rs910080 rs199774 Value GG GG 71 111 GG AG/AA 256 310 0.141 1.29(0.918-1.815) AG/AA GG 32 30 0.08 1.66(0.933-2.975) AG/AA AG/AA 99 92 0.01 1.68(1.114-2.538) PDYN PDYN p Case Control Odds Ratio rs910080 rs1022563 Value GG TT 274 327 GG CT/CC 53 94 0.03 0.67(0.463-0.977) AG/AA TT 39 43 0.73 1.08(0.681-1.718) AG/AA CT/CC 93 79 0.05 1.40(0.999-1.974) PDYN p rs10494334 Case Control Odds Ratio rs910080 Value GG GG 278 349 GG AG/AA 53 72 0.432 0.85(0.575-1.269) AG/AA GG 39 105 0.173 1.24(0.908-1.701) AG/AA AG/AA 93 17 0.02 2.06(1.109-3.854)
PDYN DRD4 p Case Control Odds Ratio rs910080 rs1800955 Value GG TT 133 198 GG CT/CC 194 223 0.08 1.29(0.967-1.734) AG/AA TT 21 22 0.27 1.42(0.751-2.687) AG/AA CT/CC 111 100 0.004 1.65(1.166-2.341) PDYN ABCB1 p Case Control Odds Ratio rs910080 rs1128503 Value GG AA 98 161 GG AG/GG 229 260 0.018 1.44(1.06-1.968) AG/AA AA 48 49 0.04 1.60(1.00-2.576) AG/AA AG/GG 84 73 0.001 1.89(1.260-2.82) PDYN ABCB1 p Case Control Odds Ratio rs910080 rs1045642 Value GG GG 118 126 GG AG/AA 209 295 0.075 0.75(0.556-1.030) AG/AA GG 57 27 0.002 2.25(1.337-3.000) AG/AA AG/AA 75 95 0.394 0.84(0.568-1.249) PDYN ABCB1 p Case Control Odds Ratio rs910080 rs2032582 Value GG CC 103 130 GG AC/AA 167 242 0.405 0.87(0.629-1.205) GG CT/TT 39 31 0.09 1.58(0.927-2.718) AG/AA CC 39 32 0.114 1.54(0.901-2.624) AG/AA AC/AA 66 75 0.624 1.11(0.729-1.690) AG/AA TC/TT 15 11 0.194 1.72(0.758-3.907) PDYN DUSP p Case Control Odds Ratio rs910080 rs950302 Value GG GG 146 180 GG AG/AA 181 241 0.604 0.92(0.692-1.239) AG/AA GG 56 49 0.127 1.40(0.906-2.190) AG/AA AG/AA 76 73 0.207 1.28(0.870-1.892)
PDYN OPRK1 p Case Control Odds Ratio rs199774 rs702764 Value GG TT 90 130 GG CT/CC 14 11 1.525 1.83(0.798-4.233) AG/AA TT 326 355 0.072 1.32(0.974-1.804) AG/AA CT/CC 29 47 0.673 0.89(0.521-1.522) PDYN OPRD1 p Case Control Odds Ratio rs199774 rs1042114 Value GG TT 91 136 GG GT/GG 13 5 0.013 3.88(1.339-11.27) AG/AA TT 325 384 0.129 1.26(0.933-1.713) AG/AA GT/GG 30 18 0.005 2.49(1.311-4.732) PDYN PDYN p Case Control Odds Ratio rs199774 rs910080 Value GG GG 71 111 GG AG/AA 33 30 0.065 1.71(0.965-3.06) AG/AA GG 256 310 1.417 1.29(0.918-1.815) AG/AA AG/AA 99 92 0.013 1.68(1.149-2.538) PDYN COMT p Case Control Odds Ratio rs199774 rs737866 Value GG TT 64 81 GG CT/CC 40 60 0.519 0.84(0.503-1.415) AG/AA TT 190 212 0.517 1.13(0.774-1.661) AG/AA CT/CC 165 190 0.633 1.09(0.745-1.621) PDYN PDYN P Case Control Odds Ratio rs199774 rs1022563 Value GG TT 65 95 GG CT/CC 39 46 0.624 1.14(0.667-1.950) AG/AA TT 248 275 0.131 1.31(0.920-1.887) AG/AA CT/CC 107 127 0.316 1.23(0.819-1.850) PDYN p rs10494334 Case Control Odds Ratio rs199774 Value GG GG 85 114 GG AG/AA 19 27 0.861 0.94(0.492-1.809) AG/AA GG 297 340 0.333 1.17(0.849-1.615) AG/AA AG/AA 58 62 0.328 1.25(0.796-1.977)
PDYN DRD4 p Case Control Odds Ratio rs199774 rs1800955 Value GG TT 47 69 GG CT/CC 57 72 0.561 1.16(0.699-1.931) AG/AA TT 148 182 0.418 1.19(0.770-1.834) AG/AA CT/CC 207 220 0.128 1.38(0.910-2.094) PDYN ABCB1 p Case Control Odds Ratio rs199774 rs1128503 Value GG AA 31 49 GG AG/GG 73 92 0.415 1.25(0.727-2.162) AG/AA AA 115 161 0.64 1.12(0.678-1.879) AG/AA AG/GG 240 241 0.06 1.56(0.966-2.543) PDYN ABCB1 p Case Control Odds Ratio rs199774 rs1045642 Value GG GG 40 44 GG AG/AA 64 97 0.237 0.72(0.426-1.235) AG/AA GG 135 109 0.227 1.36(0.828-2.239) AG/AA AG/AA 220 293 0.417 0.82(0.520-1.311) PDYN ABCB1 p Case Control Odds Ratio rs199774 rs2032582 Value GG CC 24 47 GG AC/AA 56 77 0.248 1.42(0.781-2.595) GG CT/TT 17 14 0.048 2.37(1.004-5.628) AG/AA CC 118 116 0.014 1.99(1.144-3.468) AG/AA AC/AA 176 240 0.179 1.43(0.846-2.436) AG/AA TC/TT 37 28 0.007 2.58(1.291-5.184) PDYN DUSP p Case Control Odds Ratio rs199774 rs950302 Value GG GG 48 67 GG AG/AA 56 74 0.832 1.05(0.635-1.755) AG/AA GG 154 162 0.198 1.32(0.862-2.040) AG/AA AG/AA 201 240 0.461 1.16(0.771-1.770)
PDYN OPRK1 p Case Control Odds Ratio rs1022563 rs702764 Value TT TT 286 340 TT CT/CC 27 30 0.800 1.06(0.021-1.841) CT/CC TT 130 145 0.660 1.06(0.802-1.416) CT/CC CT/CC 16 28 0.232 0.67(0.360-1.280) PDYN OPRD1 p Case Control Odds Ratio rs1022563 rs1042114 Value TT TT 290 352 TT GT/GG 23 18 0.176 1.55(0.821-2.929) CT/CC TT 126 168 0.508 0.91(0.689-1.202) CT/CC GT/GG 20 5 0.001 4.85(1.800-13.01) PDYN PDYN p Case Control Odds Ratio rs1022563 rs910080 Value TT GG 274 327 TT AG/AA 39 43 0.737 1.08(0.681-1.718) CT/CC GG 53 94 0.037 0.67(0.463-0.977) CT/CC AG/AA 93 79 0.05 1.40(0.999-1.974) PDYN PDYN p Case Control Odds Ratio rs1022563 rs199774 Value TT GG 65 95 TT AG/AA 248 275 0.131 1.31(0.920-1.887) CT/CC GG 39 46 0.428 1.23(0.728-2.106) CT/CC AG/AA 107 127 0.316 1.23(0.819-1.850) PDYN PDYN p Case Control Odds Ratio rs1022563 rs1022563 Value TT TT 171 191 TT CT/CC 142 179 0.432 0.88(0.655-1.198) CT/CC TT 83 102 0.598 0.90(0.636-1.297) CT/CC CT/CC 63 71 0.964 0.99(0.666-1.474) PDYN p rs10494334 Case Control Odds Ratio rs1022563 Value TT GG 264 310 TT AG/AA 49 60 0.841 1.04(0.691-1.573) CT/CC GG 118 144 0.797 0.96(0.717-1.290) CT/CC AG/AA 28 29 0.651 1.13(0.657-1.954)
PDYN DRD4 p Case Control Odds Ratio rs1022563 rs1800955 Value TT TT 136 171 TT CT/CC 177 199 0.469 1.11(0.826-1.513) CT/CC TT 59 80 0.714 0.92(0.618-1.390) CT/CC CT/CC 87 93 0.388 1.17(0.813-1.701) PDYN ABCB1 p Case Control Odds Ratio rs1022563 rs1128503 Value TT AA 103 136 TT AG/GG 210 234 0.293 1.18(0.863-1.626 CT/CC AA 43 74 0.253 0.76(0.486-1.209) CT/CC AG/GG 103 99 0.098 1.37(0.942-2.001) PDYN ABCB1 p Case Control Odds Ratio rs1022563 rs1045642 Value TT GG 114 110 TT AG/AA 199 260 0.06 0.73(0.536-1.017) CT/CC GG 61 43 0.19 1.36(0.855-2.190) CT/CC AG/AA 85 130 0.017 0.63(0.432-0.921) PDYN ABCB1 p Case Control Odds Ratio rs1022563 rs2032582 Value TT CC 24 47 TT AC/AA 56 77 0.443 0.87(0.622-1.230) TT CT/TT 17 14 0.059 1.71(0.979-3.005) CT/CC CC 118 115 0.602 1.13(0.699-1.852) CT/CC AC/AA 177 240 0.488 0.86(0.580-1.296) CT/CC TC/TT 37 28 0.659 1.18(0.562-2.553) PDYN DUSP p Case Control Odds Ratio rs1022563 rs950302 Value TT GG 138 158 TT AG/AA 175 212 0.715 0.94(0.697-1.280) CT/CC GG 64 72 0.932 1.02(0.677-1.528) CT/CC AG/AA 82 102 0.66 0.92(0.636-1.332)
OPRK1 p rs10494334 Case Control Odds Ratio rs702764 Value GG TT 344 399 GG CT/CC 38 55 0.321 0.80(0.517-1.241) AG/AA TT 72 86 0.867 0.97(0.687-1.370) AG/AA CT/CC 5 13 0.128 0.44(0.157-1.264) OPRD1 p rs10494334 Case Control Odds Ratio rs1042114 Value GG TT 343 438 0.0002 GG GG/GT 39 16 3.11(1.710-5.660) 0.4356 AG/AA TT 73 82 1.13(0.804-1.606) 0.022 AG/AA GG/GT 34 7 0.72(0.211-2.513) PDYN p rs10494334 Case Control Odds Ratio rs910080 Value GG GG 278 349 GG AG/GG 104 105 0.173 1.24(0.908-1.701) AG/AA GG 49 72 0.435 0.85(0.575-1.269) AG/AA AG/GG 28 17 0.022 2.06(1.109-3.854) PDYN p rs10494334 Case Control Odds Ratio rs199774 Value GG GG 85 114 GG AG/AA 297 340 0.333 1.17(0.849-1.615) AG/AA GG 19 27 0.861 0.94(0.492-1.809) AG/AA AG/AA 58 62 0.328 1.25(0.796-1.977) PDYN p rs10494334 Case Control Odds Ratio rs1022563 Value GG TT 264 310 GG CT/CC 118 144 0.962 0.79(0.717-1.290) AG/AA TT 49 60 0.841 0.95(0.635-1.447) AG/AA CT/CC 28 29 0.651 1.13(0.657-1.954) DRD4 p rs10494334 Case Control Odds Ratio rs1800955 Value GG TT 164 213 GG CT/CC 219 241 0.235 1.18(0.897-1.551) AG/AA TT 31 38 0.826 1.05(0.632-1.775) AG/AA CT/CC 45 51 0.552 1.14(0.731-1.796)
COMT p rs10494334 Case Control Odds Ratio rs737866 Value GG TT 220 246 GG CT/CC 162 208 0.323 0.87(0.661-1.145) AG/AA TT 34 47 0.383 0.80(0.501-1.303) AG/AA CT/CC 43 42 0.566 1.14(0.731-1.796) ABCB1 p rs10494334 Case Control Odds Ratio rs112850 Value GG AA 121 176 GG AG/GG 261 278 0.033 1.36(1.024-1.818) AG/AA AA 25 34 0.815 1.06(0.607-1.883) AG/AA AG/GG 52 55 0.159 0.13(0.882-2.144 ABCB1 p rs10494334 Case Control Odds Ratio rs1045642 Value GG GG 143 133 GG AG/AA 239 321 0.012 0.69(0.518-0.925) AG/AA GG 32 20 0.199 1.48(0.811-2.729) AG/AA AG/AA 45 69 0.027 0.60(0.389-0.945) ABCB1 p rs10494334 Case Control Odds Ratio rs2032582 Value GG CC 125 138 GG AC/AA 187 263 0.121 0.78(0.578-1.066) GG CT/TT 43 33 0.165 1.43(0.860-2.405) AG/AA CC 17 24 0.469 0.78(0.401-1.523) AG/AA AC/AA 46 54 0.794 0.94(0.592-1.492) AG/AA TC/TT 11 9 0.52 1.34(0.541-3.364) DUSP p rs10494334 Case Control Odds Ratio rs950302 Value GG GG 167 183 GG AG/AA 215 271 0.319 0.86(0.659-1.145) AG/AA GG 35 46 0.464 0.83(0.512-1.357) AG/AA AG/AA 42 43 0.778 1.07(0.666-1.719)
DRD4 OPRK1 p Case Control Odds Ratio rs1800955 rs702764 Value TT TT 176 231 TT CT/CC 19 21 0.605 1.18(0.619-2.276) CT/CC TT 240 254 0.109 1.24(0.952-1.614) CT/CC CT/CC 24 37 0.566 0.85(0.419-1.475) DRD4 OPRD1 p Case Control Odds Ratio rs1800955 rs1042114 Value TT TT 179 240 TT GT/GG 16 11 0.098 1.95(0.883-4.310) CT/CC TT 237 280 0.339 1.13(0.875-1.474) CT/CC GT/GG 27 12 0.002 3.01(1.487- 6.117) DRD4 PDYN p Case Control Odds Ratio rs1800955 rs910080 Value TT GG 134 198 TT AG/AA 62 53 0.001 1.72(1.127-2.649) CT/CC GG 193 223 0.098 1.27(0.955-1.712) CT/CC AG/AA 70 69 0.046 1.49(1.006-2.232) DRD4 PDYN p Case Control Odds Ratio rs1800955 rs199774 Value TT GG 47 69 TT AG/AA 148 182 0.418 1.19(0.777-1.834) CT/CC GG 57 72 0.561 1.16(0.692-1.931) CT/CC AG/AA 207 220 0.128 1.38(0.910-2.090) DRD4 PDYN p Case Control Odds Ratio rs1800955 rs1022563 Value TT TT 136 171 TT CT/CC 59 80 0.714 0.92(0.618-1.390) CT/CC TT 177 199 0.469 1.11(0.826-1513) CT/CC CT/CC 87 93 0.388 1.17(0.813-1.702) DRD4 p rs10494334 Case Control Odds Ratio rs1800955 Value TT GG 164 213 TT AG/AA 31 38 0.826 1.05(0.632-1.775) CT/CC GG 218 241 0.248 1.17(0.893-1.545) CT/CC AG/AA 46 51 0.488 1.17(0.748-1.852) DRD4 COMT p Case Control Odds Ratio rs1800955 rs737866 Value TT TT 94 136 TT CT/CC 98 115 0.352 1.19(0.821-1.738) CT/CC TT 157 157 0.052 1.40(0.996-1.976) CT/CC CT/CC 107 135 0.717 1.06(0.742-1.541)
DRD4 ABCB1 Contro p Case Odds Ratio rs1800955 rs1128503 l Value TT AA 68 93 TT AG/GG 127 158 0.634 1.09(0.744-1.624) CT/CC AA 78 117 0.669 0.91(0.596-1.393) CT/CC AG/GG 186 175 0.030 1.45(0.999-2.114) DRD4 ABCB1 Contro p Case Odds Ratio rs1800955 rs1045642 l Value TT GG 82 72 TT AG/AA 113 179 0.003 0.55(0.373-0.822) CT/CC GG 93 81 0.77 1.00(0.652-1.557) CT/CC AG/AA 171 211 0.07 0.71(0.488-1.035) DRD4 ABCB1 Contro p Case Odds Ratio rs1800955 rs2032582 l Value TT CC 58 71 TT AC/AA 106 153 0.448 0.84(0.553-1.298) TT CT/TT 20 17 0.329 1.44(0.691-2.999) CT/CC CC 84 91 0.599 1.13(0.715-1.783) CT/CC AC/AA 127 164 0.801 0.94(0.624-1.438) CT/CC TC/TT 34 25 0.108 1.66(0.893-3.101) DRD4 DUSP Contro p Case Odds Ratio rs1800955 rs950302 l Value
TT GG 88 109 0.93(0.640-1.360) TT AG/GG 107 142 0.719 1.17(0.804-1.721) CT/CC GG 114 120 0.401 9.08(0.756- CT/CC AG/GG 150 172 0.671 1.5420)
ABCB1 OPRK1 p Case Control Odds Ratio rs1128503 rs702764 Value AA TT 135 182 AA CT/CC 11 28 0.088 0.52(0.252-1.101) AG/GG TT 281 303 0.112 1.25(0.949-1.646) AG/GG CT/CC 32 30 0.191 1.43(0.833-2.481) ABCB1 OPRD1 p Case Control Odds Ratio rs1128503 rs1042114 Value AA TT 133 204 AA GG/GT 14 6 0.441 1.34(0.634-2.84) AG/GG TT 284 31 0.019 1.38(1.054-1.813) AG/GG GG/GT 28 18 0.006 2.38(1.269-4.485) ABCB1 PDYN p Case Control Odds Ratio rs1128503 rs910080 Value AA GG 98 161 AA AG/AA 48 49 0.047 1.60(1.900-2.576) AG/GG GG 229 60 0.018 1.44(1.063-1.963) AG/GG AG/AA 84 73 0.001 1.89(1.260-2.820) ABCB1 PDYN p Case Control Odds Ratio rs1128503 rs199774 Value AA GG 31 49 AA AG/AA 115 161 0.64 1.12(0.678-1.879) AG/GG GG 73 92 0.415 1.25(0.727-2.162) AG/GG AG/AA 240 241 0.066 1.57(0.970-2.554) ABCB1 PDYN p Case Control Odds Ratio rs1128503 rs1022563 Value AA TT 103 136 AA CT/CC 44 74 0.294 0.78(0.499-1.234) AG/GG TT 210 234 0.293 1.18(0.863-1.626) AG/GG CT/CC 102 99 0.109 1.36(0.933-1.983)
ABCB1 p rs10494334 Case Control Odds Ratio rs1128503 Value AA GG 121 176 AA AG/AA 25 34 0.815 1.06(0.607-1.883) AG/GG GG 261 278 0.033 1.36(1.025-1.818) AG/GG AG/AA 52 55 0.086 1.48(0.945-2.326) ABCB1 DRD4 p Case Control Odds Ratio rs1128503 rs1800955 Value AA TT 68 93 AA CT/CC 78 117 0.669 0.91(0.596-1.393) AG/GG TT 127 158 0.635 1.09(0.744-1.624) AG/GG CT/CC 186 175 0.05 1.45(0.999-2.114) ABCB1 COMT P Case Control Odds Ratio rs1128503 rs737866 Value AA TT 73 112 AA CT/CC 73 98 0.535 1.14(0.748-1.744) AG/GG TT 181 181 0.001 1.53(1.070-2.198) AG/GG CT/CC 132 152 0.134 1.33(0.914-1.940) ABCB1 ABCB1 P Case Control Odds Ratio rs1128503 rs1045642 Value AA GG 32 46 AA AG/AA 115 164 0.975 1.00(0.605-1.679) AG/GG GG 143 107 0.013 1.92(1.146-3.2180 AG/GG AG/AA 169 226 0.774 1.07(0.656-1.760) ABCB1 ABCB1 P Case Control Odds Ratio rs1128503 rs2032582 Value AA CC 29 43 AA AC/AA 102 155 0.928 0.97(0.572-1.663) AA CT/TT 7 5 0.248 2.75(0.600-1.177) AG/GG CC 113 119 0.211 1.41(0.823-2.403) AG/GG AC/AA 131 162 0.497 1.19(0.709-2.025) AG/GG TC/TT 47 34 0.029 2.04(1.075-3.908) ABCB1 DUSP P Case Control Odds Ratio rs1128503 rs950302 Value AA GG 74 84 AA AG/AA 72 127 0.042 0.64(0.420-0.985) AG/GG GG 128 145 0.991 1.00(0.676-1.483) AG/GG AG/AA 185 187 0.541 1.12(0.773-1.633)
ABCB1 OPRK1 P Case Control Odds Ratio rs1045642 rs702764 Value GG TT 156 136 GG CT/CC 16 17 0.555 0.80(0.391-1.654) AG/AA TT 257 349 0.001 0.62(0.476-0.833) AG/AA CT/CC 27 41 0.036 0.56(0.321-0.903) ABCB1 OPRD1 P Case Control Odds Ratio rs1045642 rs1042114 Value GG TT 161 145 GG GG/GT 14 9 0.44 1.40(0.588-3.330) AG/AA TT 255 376 0.0004 0.60(0.463-0.804) AG/AA GG/GT 29 14 0.07 1.86(0.948-3.668) ABCB1 PDYN P Case Control Odds Ratio rs1045642 rs910080 Value GG GG 118 126 GG AG/AA 57 27 0.002 2.25(1.330-3.800) AG/AA GG 209 295 0.075 0.75(0.550-1.028) AG/AA AG/AA 75 95 0.39 0.84(0.568-1.241) ABCB1 PDYN P Case Control Odds Ratio rs1045642 rs199774 Value GG GG 40 44 GG AG/AA 135 109 0.222 1.36(0.855-2.190) AG/AA GG 64 97 0.237 0.72(0.426-1.235) AG/AA AG/AA 220 293 0.417 0.82(0.520-1.311) ABCB1 PDYN P Case Control Odds Ratio rs1045642 rs1022563 Value GG TT 114 10 GG CT/CC 61 43 0.19 1.36(0.855-2.190) AG/AA TT 199 260 0.063 0.73(0.536-1.017) AG/AA CT/CC 85 130 0.017 0.82(0.520-1.311)
ABCB1 P rs10494334 Case Control Odds Ratio rs1045642 Value GG GG 143 133 GG AG/AA 32 20 0.199 1.48(0.811-2.792) AG/AA GG 239 321 0.012 0.69(0.518-0.925) AG/AA AG/AA 45 69 0.027 0.63(0.432-0.921) ABCB1 DRD4 P Case Control Odds Ratio rs1045642 rs1800955 Value GG TT 82 72 GG CT/CC 93 81 0.970 1.00(0.625-1.557) AG/AA TT 113 179 0.003 0.55(0.373-0.822) AG/AA CT/CC 171 211 0.075 0.71(0.488-1.035) ABCB1 ABCB1 P Case Control Odds Ratio rs1045642 rs1128503 Value GG AA 32 46 GG AG/GG 143 107 0.013 1.92(1.146-3.218) AG/AA AA 114 164 0.997 0.99(0.599-1.665) AG/AA AG/GG 170 226 0.756 1.08(0.660-1.770) ABCB1 COMT P Case Control Odds Ratio rs1045642 rs737866 Value GG TT 98 81 GG CT/CC 77 71 0.623 0.89(0.576-1.387) AG/AA TT 156 212 0.007 0.60(0.424-0.871) AG/AA CT/CC 128 178 0.006 0.59(0.409-0.862) ABCB1 ABCB1 P Case Control Odds Ratio rs1045642 rs2032582 Value GG CC 73 73 GG AC/AA 59 52 0.616 1.13(0.692-1.859) GG CT/TT 38 24 0.136 1.58(0.864-2.900) AG/AA CC 69 89 0.269 0.77(0.493-1.218) AG/AA AC/AA 174 265 0.020 0.65(0.450-0.956) AG/AA TC/TT 16 18 0.750 0.88(0.420-1.877) ABCB1 DUSP P Case Control Odds Ratio rs1045642 rs950302 Value GG GG 83 63 GG AG/AA 92 90 0.256 0.77(0.500-1.202) AG/AA GG 119 166 0.003 0.54(0.363-0.8145) AG/AA AG/AA 165 224 0.003 0.55(0.380-0.821)
DUSP OPRK1 P Case Control Odds Ratio rs950302 rs702764 Value GG TT 185 207 GG CT/CC 17 22 0.667 0.86(0.445-1.678) AG/AA TT 231 278 0.588 0.92(0.713-1.210) AG/AA CT/CC 26 36 0.441 0.80(0.470-1.389) DUSP OPRD1 P Case Control Odds Ratio rs950302 rs1042114 Value GG TT 184 217 GG GG/GT 18 12 0.139 1.76(0.830-3.769) AG/AA TT 232 303 0.442 0.90(0.696-1.171) AG/AA GG/GT 25 11 0.008 2.68(1.28-5.59) DUSP PDYN P Case Control Odds Ratio rs950302 rs910080 Value GG GG 146 180 GG AG/AA 56 49 0.127 1.40(0.906-2.190) AG/AA GG 181 241 0.604 0.92(0.692-1.239) AG/AA AG/AA 76 73 0.207 1.28(0.870-1.892) DUSP PDYN P Case Control Odds Ratio rs950302 rs199774 Value GG GG 48 67 GG AG/AA 154 162 0.198 1.32(0.832-2.042) AG/AA GG 56 74 0.832 1.05(0.630-1.755) AG/AA AG/AA 201 240 0.461 1.16(0.771-1.770) DUSP PDYN P Case Control Odds Ratio rs950302 rs1022563 Value GG TT 138 158 GG CT/CC 64 71 0.879 1.03(0.686-1.550) AG/AA TT 175 212 0.715 0.94(0.697-1.280) AG/AA CT/CC 82 102 0.66 0.92(0.636-1.332)
DUSP P rs10494334 Case Control Odds Ratio rs950302 Value GG GG 167 183 GG AG/AA 35 46 0.464 0.83(0.512-1.350) AG/AA GG 215 271 0.0001 1.85(1.369-2.512) AG/AA AG/AA 42 43 0.778 1.07(0.666-1.719) DUSP DRD4 P Case Control Odds Ratio rs950302 rs1800955 Value GG TT 88 109 GG CT/CC 114 120 0.497 1.17(0.804-1.721) AG/AA TT 107 142 0.719 0.93(0.640-1.360) AG/AA CT/CC 150 172 0.671 1.08(0.756-1.542) DUSP ABCB1 P Case Control Odds Ratio rs950302 rs1128503 Value GG AA 74 84 GG AG/GG 138 145 0.991 1.00(0.676-1.483) AG/AA AA 72 126 0.040 0.64(0.423-0.993) AG/AA AG/GG 185 188 0.560 1.11(0.760-1.621) DUSP ABCB1 P Case Control Odds Ratio rs950302 rs1045642 Value GG GG 83 63 GG AG/AA 119 166 0.003 0.54(0.365-0.8140 AG/AA GG 92 90 0.256 0.77(0.500-1.2020 AG/AA AG/AA 165 224 0.003 0.55(0.380-0.821) DUSP ABCB1 P Case Control Odds Ratio rs950302 rs2032582 Value GG CC 58 70 GG AC/AA 101 132 0.719 0.92(0.598-1.425) GG CT/TT 30 19 0.059 1.90(0.973-3.750) AG/AA CC 84 92 0.677 1.10(0.697-1.739) AG/AA AC/AA 132 185 0.478 0.86(0.569-1.302) AG/AA TC/TT 24 23 0.499 1.25(0.644-2.459) DUSP COMT P Case Control Odds Ratio rs950302 rs737866 Value GG TT 106 120 GG CT/CC 96 109 0.987 0.99(0.682-1.456) AG/AA TT 148 175 0.854 0.96(0.688-1.362) AG/AA CT/CC 109 141 0.469 0.87(0.609-1.256)
LIST OF PUBLICATIONS
NAGAYA, D., ZALINA, Z., SALEEM, M., YAHAYA, B. H., TAN, S. C. & YUSOFF, N. M. 2017. An analysis of genetic association in opioid dependence susceptibility. Journal of Clinical Pharmacy and Clinical Therapy, 1-6.
NAGAYA, D., PARASIVAM, D., KRISHNAN, K., RAVICHANDRAN, M.,YAHAYA, B.H. & YUSOFF, N.M.2013. Genetic Polymorphisms of -521T>C and 80G>T among Malaysian Population. Special Congress On Addiction and Mental Health, October 1-4, 2013 KLCC.
NAGAYA, D., ISMAIL, R ., SALEEM, M., YAHAYA, B. H. & YUSOFF, N.M. 2014. Genetic Polymorphisms of OPRD1 and OPRK1 Among Malay Opiate Dependents. 1st Postgraduates Colloquium on Translational Research, 9th -10t September 2014, Advanced Medical and Dental Institute (AMDI) USM.
NAGAYA, D., ZALINA, Z., SALEEM, M., YAHAYA, B. H., TAN,S.C.&YUSOFF, N. M. 2015.Genetic Polymorphisms of PDYN Among Malaysian Opiate Dependents. Human Genome Meeting (HUGO), 14th – 17th March 2015 Kuala Lumpur Convention Centre.
NAGAYA, D., ZALINA, Z., SALEEM, M., YAHAYA, B. H., TAN,S.C.&YUSOFF, N.M. 2016. Genetic variants associated with opioid addiction among Malay population. 2nd International Biohealth Sciences Conference, 27th and 28th January 2015 Sains@USM, Bukit Jambul, Penang.