This article was downloaded by: [US Fish & Wildlife Service] On: 07 December 2011, At: 12:47 Publisher: Taylor & Francis Informa Ltd Registered in England and Wales Registered Number: 1072954 Registered office: Mortimer House, 37-41 Mortimer Street, London W1T 3JH, UK

Transactions of the American Fisheries Society Publication details, including instructions for authors and subscription information: http://www.tandfonline.com/loi/utaf20 The Reproductive Biology of Siscowet and Lean Lake Trout in Southern Lake Superior Frederick Goetz a , Shawn Sitar b , Daniel Rosauer a , Penny Swanson c , Charles R. Bronte d , Jon Dickey c & Crystal Simchick a a School of Freshwater Sciences, University of Wisconsin–Milwaukee, 600 East Greenfield Avenue, Milwaukee, Wisconsin, 53204, USA b Michigan Department of Natural Resources, Marquette Fisheries Research Station, 484 Cherry Creek Road, Marquette, Michigan, 49855, USA c National Oceanic and Atmospheric Administration–Fisheries, Northwest Fisheries Science Center, 2725 Montlake Boulevard East, Seattle, Washington, 98112–2097, USA d U.S. Fish and Wildlife Service, Green Bay Fish and Wildlife Conservation Office, 2661 Scott Tower Drive, New Franken, Wisconsin, 54229, USA Available online: 17 Nov 2011

To cite this article: Frederick Goetz, Shawn Sitar, Daniel Rosauer, Penny Swanson, Charles R. Bronte, Jon Dickey & Crystal Simchick (2011): The Reproductive Biology of Siscowet and Lean Lake Trout in Southern Lake Superior, Transactions of the American Fisheries Society, 140:6, 1472-1491 To link to this article: http://dx.doi.org/10.1080/00028487.2011.630276

PLEASE SCROLL DOWN FOR ARTICLE

Full terms and conditions of use: http://www.tandfonline.com/page/terms-and-conditions This article may be used for research, teaching, and private study purposes. Any substantial or systematic reproduction, redistribution, reselling, loan, sub-licensing, systematic supply, or distribution in any form to anyone is expressly forbidden. The publisher does not give any warranty express or implied or make any representation that the contents will be complete or accurate or up to date. The accuracy of any instructions, formulae, and drug doses should be independently verified with primary sources. The publisher shall not be liable for any loss, actions, claims, proceedings, demand, or costs or damages whatsoever or howsoever caused arising directly or indirectly in connection with or arising out of the use of this material. Transactions of the American Fisheries Society 140:1472–1491, 2011 C American Fisheries Society 2011 ISSN: 0002-8487 print / 1548-8659 online DOI: 10.1080/00028487.2011.630276

ARTICLE

The Reproductive Biology of Siscowet and Lean Lake Trout in Southern Lake Superior

Frederick Goetz* School of Freshwater Sciences, University of Wisconsin–Milwaukee, 600 East Greenfield Avenue, Milwaukee, Wisconsin 53204, USA Shawn Sitar Michigan Department of Natural Resources, Marquette Fisheries Research Station, 484 Cherry Creek Road, Marquette, Michigan 49855, USA Daniel Rosauer School of Freshwater Sciences, University of Wisconsin–Milwaukee, 600 East Greenfield Avenue, Milwaukee, Wisconsin 53204, USA Penny Swanson National Oceanic and Atmospheric Administration–Fisheries, Northwest Fisheries Science Center, 2725 Montlake Boulevard East, Seattle, Washington 98112–2097, USA Charles R. Bronte U.S. Fish and Wildlife Service, Green Bay Fish and Wildlife Conservation Office, 2661 Scott Tower Drive, New Franken, Wisconsin 54229, USA Jon Dickey National Oceanic and Atmospheric Administration–Fisheries, Northwest Fisheries Science Center, 2725 Montlake Boulevard East, Seattle, Washington 98112–2097, USA Crystal Simchick School of Freshwater Sciences, University of Wisconsin–Milwaukee, 600 East Greenfield Avenue, Milwaukee, Wisconsin 53204, USA Downloaded by [US Fish & Wildlife Service] at 12:47 07 December 2011 Abstract Lean and siscowet morphotypes of lake trout Salvelinus namaycush in Lake Superior are thought to be genetically separate, but the reproductive isolating mechanism is unknown. The testicular and ovarian cycles and reproductive hormone levels of these morphotypes were determined from May to October in populations east and west of the Keweenaw Peninsula in southern Lake Superior.The gonadosomatic index (GSI) increased from August to October for lean and siscowet males and females east of the Keweenaw Peninsula and for siscowets west of the Keweenaw Peninsula. Circulating estradiol-17β (E2) levels and ovarian GSIs increased simultaneously in females of both morphotypes. However, circulating 11-ketotestosterone (11-KT) levels in lean and siscowet males were not significantly elevated until October even though testicular GSIs increased by August. Transcripts of the follicle stimulating hormone (FSH) beta subunit (an indirect measure of FSH activity) increased in lean and siscowet males and females during August and September, when GSIs were increasing for both morphotypes. The seasonal changes in GSIs and hormone levels indicate that both lean and siscowet individuals in southern Lake Superior populations undergo reproductive

*Corresponding author: [email protected] Received November 13, 2010; accepted May 26, 2011

1472 REPRODUCTIVE BIOLOGY OF SISCOWET AND LEAN LAKE TROUT 1473

maturation at the same time in the fall; therefore, reproductive timing does not appear to genetically isolate the morphotypes in these populations. A proportion of the sampled females (lean lake trout: 54%; siscowets: 42%) exhibited no increase in GSI from August to October, strongly suggesting that in any given year some proportion of the population does not reproduce. This was also observed in males but at a lower percentage (19–20%). Fish that did not have maturing gonads from August to October also had lower E2 and 11-KT levels than maturing fish. Fecundity measured for lean and siscowet lake trout was not statistically different and was similar to historical values.

The lake trout Salvelinus namaycush is the dominant native Salvelinus alpinus, which exhibit both temporal and spatial re- salmonine predator in the Laurentian Great Lakes and is the productive isolation (Sandlund et al. 1992; Elliot and Baroudy focus of a large international restoration and management ef- 1995; Hesthagen et al. 1995; Telnes and Saegrov 2004); how- fort by federal, state, provincial, and tribal fisheries agencies. In ever, reproductive isolation has not yet been reported for lake Lake Superior, there are three principal lake trout morphotypes: trout morphotypes. lean, siscowet, and humper. These forms have differing mor- Many studies have described spawning and reproductive phologies (Eschmeyer and Phillips 1965; Lawrie and Rahrer staging of lean lake trout from North American lakes (Martin 1973; Moore and Bronte 2001) and osteology (Burnham-Curtis and Olver 1980). However, relatively few studies have examined and Smith 1994); they also occupy different habitats that are other lake trout forms. Even for lean lake trout, only a few stud- mainly separated on the basis of bathymetry, although there is ies have comprehensively followed gonadal maturation in both some spatial overlap (Moore and Bronte 2001; Bronte et al. sexes throughout the year for wild fish from the same popula- 2003). Lean lake trout, which were originally found in all of tions or sampling sites. Eschmeyer (1955) reported that ovarian the Great Lakes, tend to be distributed in waters shallower weights in Lake Superior siscowets peaked by late September than 100 m. Siscowet-like lake trout were once present in all and in two cases by late July, whereas in lean lake trout the ovar- of the Great Lakes except Lake Ontario (Krueger and Ihssen ian weights peaked from October to November. Bronte (1993) 1995). While they are found outside the basin, in the Great captured one ripe male siscowet and one ripe female siscowet Lakes, siscowet-like lake trout are present only in Lake Superior (sperm and eggs flowing readily) in late April from deep wa- where they occur mostly at depths greater than 100 m (Bronte ter northeast of the Apostle Islands in Lake Superior. Humper et al. 2003). Siscowets have larger fins and eyes, a shorter snout, lake trout in Lake Superior have been observed in spawning larger caudal peduncle, and higher lipid content in the muscle condition during August (Burnham-Curtis and Bronte 1996) than lean lake trout (Eschmeyer and Phillips 1965; Moore and and mid-September off Isle Royale (Rahrer 1965) and during Bronte 2001). Humper lake trout (also known as “bankers”) September at Klondike Reef (U.S. Fish and Wildlife Service, derive their name from the offshore humps that they inhabit New Franken, Wisconsin, unpublished data). In addition, three (Lawrie and Rahrer 1973; Burnham-Curtis and Bronte 1996). female humper or siscowet lake trout that were ripe or spent Humper lake trout have large fins, a short head with large eyes were observed in June off the eastern extremity of Isle Royale and convex snout, a thin abdominal wall (Rahrer 1965; Khan (Eschmeyer 1955). Thus, one isolating mechanism may be the and Qadri 1970; Moore and Bronte 2001), and lipid content that relative timing of reproductive maturation and spawning among is intermediate between those of lean and siscowet lake trout lake trout forms. To address the possible genetic separation of (Eschmeyer and Phillips 1965). these lake trout morphotypes by the seasonal timing of repro- Garden-variety rearing experiments have shown that sis- duction, we assessed gonadal maturation in male and female cowets and lean lake trout derived from wild populations in siscowets and lean lake trout from two areas in southern Lake Downloaded by [US Fish & Wildlife Service] at 12:47 07 December 2011 Lake Superior exhibit the same morphological and physiolog- Superior during spring to fall by analyzing temporal changes in ical (e.g., lipid levels) phenotypes when grown under envi- the gonadosomatic index (GSI) and by histological examination ronmental conditions as do wild lean and siscowet lake trout of cytological changes in the gonads. (Stauffer and Peck 1981; Goetz et al. 2010). These results, in Another way to assess the stage of gonadal maturation in fish combination with evidence from microsatellite studies (Page is to measure seasonal changes in the levels of key reproductive et al. 2004), strongly suggest that differences between lean and hormones, including gonadal steroids (estrogens and androgens) siscowet lake trout are genetic and are not the result of en- and pituitary gonadotropins (gonadotropic hormones [GTHs]: vironmental plasticity. To maintain these genetic differences, follicle stimulating hormone [FSH] and luteinizing hormone partial reduction in migration and gene flow between popula- [LH]). The levels of these hormones are correlated with the de- tions should occur by (1) prezygotic barriers that restrict random gree of gonadal growth and maturation (Swanson 1991; Gomez mating (e.g., the seasonal timing of reproduction or location of et al. 1999; Campbell et al. 2006). The primary estrogenic steroid spawning sites), (2) postzygotic barriers (e.g., the viability and in female salmonids is estradiol-17β (E2), which is produced fitness of hybrids), or (3) both mechanisms. Examples of sepa- under the control of FSH by follicle cells (theca and granulosa ration can be observed in coexisting morphotypes of Arctic char cells) surrounding the developing oocyte (Fostier et al. 1983; 1474 GOETZ ET AL.

Planas et al. 2000; Young et al. 2005). The primary androgen Davies et al. 1999; Gomez et al. 1999). Attempts to measure in salmonids is 11-ketotestosterone (11-KT), which is also con- plasma GTH levels in chars by using current assays for salmon trolled by FSH (Planas and Swanson 1995). In the female, LH FSH and LH have so far been unsuccessful (P. Swanson, unpub- is involved in the stimulation of the final maturational events lished data). Past studies have demonstrated that there is some (i.e., germinal vesicle breakdown) in the follicle (Lubzens et al. correlation between circulating FSH and the FSH transcript lev- 2010), whereas in males LH plays a major role in regulating els in the rainbow trout pituitary (Gomez et al. 1999), and several sperm maturation and the release of sperm into the sperm duct studies of other fish species have observed seasonal changes in (spermiation; Schulz et al. 2010). pituitary GTH transcript levels in relation to the reproductive Changes in the levels of sex steroids during gonadal matura- cycle (Sohn et al. 1999; Hellqvist et al. 2006; Martyniuk et al. tion have been documented in many salmonids, including brook 2009). Thus, changes in pituitary transcript levels of the LH and trout Salvelinus fontinalis (Tam et al. 1986; de Montgolfier FSH beta subunits in the same lake trout that were sampled for et al. 2009), Arctic char (Mayer et al. 1992; Frantzen et al. GSI and steroid levels were analyzed as an indirect measure of 1997; Tveiten et al. 1998), and whitespotted char Salvelinus changes in GTHs during the seasonal gonadal cycle. leucomaenis (Kagawa et al. 1981). To our knowledge, there has been only one study that reported the circulating levels of sex steroids in lake trout, and this was in captive lean lake trout METHODS broodstocks (Foster et al. 1993). Thus, in the current study, the Field collection of fish.—During 2006–2008, lean and sis- circulating levels of E2 in females and 11-KT in males that were cowet lake trout were collected by using multifilament bottom- assayed for GSI and cytology were measured as another index set gill nets (stretch measure mesh sizes = 11.4, 12.7, 14.0, of the seasonal changes in gonad maturation. and 15.2 cm) at two areas in the Michigan waters of southern Although GTH levels in wild or captive chars Salvelinus Lake Superior (Figure 1). Nets were 1.83 m high, their lengths spp. have not been reported, several such studies have been con- varied from 360 to 2,300 m, and they were set for one to two ducted on rainbow trout Oncorhynchus mykiss (Prat et al. 1996; nights. During 2007 and 2008, lake trout were collected monthly Downloaded by [US Fish & Wildlife Service] at 12:47 07 December 2011

FIGURE 1. Locations of lean lake trout (open circles) and siscowet lake trout (shaded triangles) sampling sites in Lake Superior east and west of the Keweenaw Peninsula. REPRODUCTIVE BIOLOGY OF SISCOWET AND LEAN LAKE TROUT 1475

between May and October east of the Keweenaw Peninsula near logit transformed (log10[x/{1 − x}]) and were analyzed by two- Marquette, Michigan (hereafter, “EK area”). In 2006, samples way ANOVA with morphotype and time as factors, followed by were collected from the EK area only in June. West of the Tukey’s post hoc test in Minitab version 15.1.30.0. Differences Keweenaw Peninsula (hereafter, “WK area”), lake trout were were considered significant at P-values of 0.05 or less. Further- collected during May, August, and October in 2007 and 2008; more, monthly GSI distributions for each sex were tested for nor- however, insufficient numbers of lean lake trout were collected mality by using a one-sample Kolmogorov–Smirnov test in Pre- from the WK area. Thus, for lean lake trout, only data from fish dictive Analytics Software version 18.0 (α = 0.05; SPSS, Inc.) sampled in the EK area were analyzed for GSI and hormone to determine GSI groupings according to maturational state. levels. At each sampling area, bathymetric depths of lean lake After gonads were weighed, a small piece of each gonad trout sampling stations were less than 80 m and depths of sis- pair from each fish was placed in Altmann’s fixative (Humason cowet sampling stations were greater than 90 m. The targeted 1972) for 48 h. Fixed sections were washed in tap water and number of fish to be collected at each area per sampling time were held in a 50% solution of ethanol until processing. Histo- was 15 individuals of each morphotype and each sex. Given that logical processing was carried out by Mass Histology Service, the objective of this study was to profile seasonal gonadal mat- Inc. (Boston, Massachusetts), and included tissue dehydration, uration, attempts were made to restrict fish sampling to mature paraffin embedding, sectioning, staining, and slide preparation. lean lake trout and siscowets (total length [TL] ≥ 550 mm) by One slide was produced for each gonad sample and was stained using the gill-net meshes described above based on previously with hematoxylin and eosin. Sections were viewed under a com- reported selectivity curves (Hansen et al. 1997). Recent infor- pound microscope, and each sampled fish was assigned to a stage mation on length at maturity indicates that most of the lean and of oogenesis (Nagahama 1983) or spermatogenesis (Kusakabe siscowet lake trout are mature at a TL of 550 mm or greater et al. 2006). (Sitar and He 2006; S. Sitar, unpublished data). Hatchery-origin Fecundity analysis.—During September and October 2008, lake trout that were previously stocked for restoration (Hansen the ovaries of prespawning female lean lake trout (n = 17) and et al. 1995) were excluded from analyses. Lean and siscowet siscowets (n = 25) sampled from the EK area were used to lake trout were differentiated based on their morphometry, in- estimate fecundity. For each fish, two cross-sections from each cluding the shape and relative size of the head, the size of the ovary were excised and weighed (nearest 0.1 g). The number of fins, and the location and size of the eyes (Moore and Bronte vitellogenic eggs (>3 mm) was counted twice for each ovarian 2001); the depth at which the fish were sampled was also used section, the counts were averaged, and the average was then to differentiate between the morphotypes (Bronte et al. 2003). divided by the section weight to estimate the number of eggs Total length (nearest 1 mm), weight (nearest 5.0 g), and sex per kilogram of sectioned ovary. The mean number of eggs were recorded for each fish, and the gonads, otoliths, pituitaries, per kilogram for all four sections (E¯ ) was then estimated. The and a blood sample were collected from each individual. We total number of eggs per female was estimated as E¯ times the used analysis of variance (ANOVA) in R version 2.8.1 to test total weight of ovaries (O). Total fecundity per individual fish for significant differences (α = 0.05) in mean TL and weight (TF), expressed as eggs per kilogram of total body weight, was between lean lake trout and siscowets by sex and sampling site. calculated as The lateral views of the head and whole body of each fish were photographed with a digital camera to address questions regard- E¯ × O TF = , ing morphotype identification. W Age determination.—Extracted sagittal otoliths from a subset of female lean and siscowet lake trout that were collected from where W is total body wet weight (nearest 0.1 kg). Based on the EK area during September 2007 and 2008 were used to a priori indications that fecundity was higher in lean lake trout Downloaded by [US Fish & Wildlife Service] at 12:47 07 December 2011 assess ages. In the laboratory, whole otoliths were sanded on than in siscowets (Eschmeyer 1955; Peck 1988), we tested the the dorsal surface to establish a sagittal plane, which exposed difference in mean relative fecundity between lean and siscowet the annuli for counting under a compound microscope. Sanded lake trout by using Welch’s two-sample t-test in R version 2.8.1 otoliths were soaked in mineral oil, and annuli were counted (H0: lean TF > siscowet TF; α = 0.05). visually by using a compound microscope with reflected light; Fecundity was analyzed as a function of TL (mm) and weight counts were aided by use of a digital camera and computer with (g). Both relationships were analyzed with a linear model (lm the Hierarchical Discrete Correlation/Wallis Filter in OPTIMAS function in R version 2.8.1); length data were log transformed. version 6.5 (Media Cybernetics 1999). Differences in mean age Potential differences in intercept between lean and siscowet by morphotype and maturity category were assessed by use of lake trout were evaluated by including morphotype as a factor two-way ANOVA (α = 0.05; R version 2.8.1). in the models. Furthermore, possible differences in slope be- Gonad assays.—Gonad pairs were held in plastic bags on tween the two morphotypes were evaluated by including the ice during fish collection and were then immediately weighed interaction between morphotype and body size (TL or weight) (nearest 0.1 g) onshore for calculation of the GSI ([gonad in the models. Nonsignificant intercepts or slopes were removed weight/body weight] × 100). For statistical analysis, GSIs were in a stepwise fashion from the models based on Student’s t-test 1476 GOETZ ET AL.

TABLE 1. Primer sequences for cloning and quantitative reverse-transcription polymerase chain reaction (qPCR) of the beta subunits of lake trout follicle stimulating hormone (FSH) and luteinizing hormone (LH; F = forward primer; R = reverse primer; W = AorT;Y= CorT). GenBank accession Annealing temperature Gene name number Primer name (◦C) Primer sequence (5–3) Cloning FSH beta subunit FSHb F 58 ATGTACTGCACCCACTTAAAGAYGC FSHb R 56 CTAGTGGGTTTACWAYGCAGCTC LH beta subunit LHb F 60 AGCCCTGTCAGCCCATCAAC LHb R 57 ACATACAACCTACAAGCCCATGTC qPCR FSH beta subunit HM057170 FSH F 58 GTTGCCATGCTTATGCGATC FSH R 58 CTTAAAGATGCTGCAGCTGG LH beta subunit HM057171 LH F 58 CAGACTGTGTCTCTGGAGAAG LH R 58 CCTACAAGCCCATGTCTGTAG Actin ABI20511 Act F 58 AGCAAGCAGGAATACGACGA Act R 58 AGCCATGCCAATGAGACTGA

values (α = 0.05). Differences in intercept and slope between Pituitary gonadotropin beta subunit transcript analysis.—At lean and siscowet lake trout were determined by use of anal- collection, the skull of each fish was opened, and the pituitary ysis of covariance. Relative fecundity (eggs/kg) was estimated was removed and placed in an RNase/DNase-free, 1.5-mL mi- only when the intercept was not significantly different from crocentrifuge tube that was held on dry ice. In the laboratory, zero, and the slope was interpreted as the number of eggs per pituitary samples were transferred from dry ice to a −80◦C kilogram. The difference in relative fecundity between lean and freezer until assay. siscowet lake trout was based on the statistical difference in The beta subunits of lake trout FSH and LH were cloned slopes. by using reverse-transcription (RT) polymerase chain reaction Estradiol and 11-ketotestosterone analyses.—At collection, (PCR) with degenerate primers (Table 1) derived from other a 5.0-mL blood sample was drawn from the caudal vein of salmonid GTHs. Total RNA was extracted from lake trout pi- each fish by using a heparinized syringe fitted with an 18-gauge tuitaries by using TRI reagent (Sigma–Aldrich) according to needle. The blood was held on ice until collections were com- the manufacturer’s instructions (Chomcynski and Sacchi 1987; plete, and the sample was then centrifuged at 2,000 × gravity Chomcynski 1993). Pools of selected RNA samples collected (g) for 20 min at 4◦C. The plasma was removed and frozen during May–October were used for RT-PCR to ensure that both in aliquots at −20◦C until steroid assay. Plasma samples were GTHs would be present. Complementary DNA (cDNA) was extracted twice with either 1.5 mL of ether (for E2 in females) produced by RT in a PTC-200 thermocycler (Bio-Rad Labo- or 1.0 mL of dichloromethane (for 11-KT in males). Extracts ratories). Oligo(dT) primer (0.25 µg) was added to 500 ng of were dried at 37◦C under a nitrogen atmosphere. Estradiol was total RNA in a volume of 5 µL. The mixture was allowed to measured in female plasma samples via radioimmunoassay (de- incubate at 70◦C for 5 min and then at 4◦Cfor5min;4µL scribed by Sower and Schreck 1982) by using an antibody of 5× reaction buffer, 2.4 µLofMgCl2 (25 mM), 1 µL of de- (cross-reactivities: estrone, 2.6%; estriol, 4.2%; testosterone, oxynucleotide triphosphate mix (10 mM), 1 µL of the Promega Downloaded by [US Fish & Wildlife Service] at 12:47 07 December 2011 0.02%; Korenman et al. 1974) purchased from Dr. Gordon ImProm-II RT system, and 6.6 µL of water were then added and Niswender (Colorado State University, Fort Collins). Measure- incubated at 25◦Cfor5min,at37◦C for 1 h, and at 70◦Cfor ment of 11-KT in male plasma samples was accomplished with 15 min. an enzyme immunoassay (described by Cuisset et al. 1994) by Gradient PCR was performed on cDNA by using degenerate using tracer- and secondary-antibody-coated plates purchased primers (Table 1) and AmpliTaq Gold (Applied Biosystems). from Cayman Chemical (Ann Arbor, Michigan). Primary 11-KT The PCR products were separated on agarose gels and viewed antiserum (cross-reactivities: testosterone, 3.4%; dihydrotestos- under ultraviolet illumination. Potential bands of interest were terone, 2.25%; androstenedione, <0.1%; Schulz 1984) was pro- cut and purified with the QIAquick gel extraction kit (Qiagen). vided by Dr. Rudiger Schulz (Department of Biology, University Purified DNA was ligated into vector pCR2.1 by using the TOPO of Utrecht, The Netherlands). Interassay coefficients of varia- cloning kit (Invitrogen), and TOPO 10 competent cells were tion were 5.89% for E2 and 13.21% for 11-KT. The E2 and transformed with ligated plasmid. After colony PCR was per- 11-KT levels were analyzed by two-way ANOVA with morpho- formed to identify positive clones, plasmid DNA was produced type and time as factors, followed by Tukey’s post hoc test in and sequenced by using the dideoxy chain termination method Minitab version 15.1.30.0 (α = 0.05). with Big Dye Terminator (Applied Biosystems) and the M13 REPRODUCTIVE BIOLOGY OF SISCOWET AND LEAN LAKE TROUT 1477

reverse primer. The reactions were precipitated and resuspended the relative messenger RNA concentration (R0) for each gene in Hi-Di formamide with EDTA and were run on an ABI Prism per individual sample. Briefly, this was calculated by using the 3730 automated sequencer (Applied Biosystems). Sequence following equation: chromatogram files were trimmed for quality by using phred software (Ewing and Green 1998), vector screened with cross 1 R0 = , match (www.phrap.org/phrap.docs/phrap.html), and analyzed (1 + E)Ct locally with BLASTX against the National Center for Biotech- nology Information (NCBI) nonredundant protein database and where E is the gene efficiency (calculated as the average of all with BLASTN against the NCBI nucleotide database. individual sample efficiencies across all reactions for a given Quantitative RT-PCR (qPCR) was used for the analysis of gene/qPCR plate) and Ct is the cycle number at threshold (Zhao FSH and LH beta subunit transcript levels in only those fish that and Fernald 2005). The R0 for each gene was normalized to were sampled in 2007. Total RNA was isolated from pituitaries a control R0 (actin: see Table 1) from each individual sample. by using the illustra RNAspin 96 RNA isolation kit (GE Health- The total amount of FSH or LH beta subunit transcript per care) according to the manufacturer’s protocol. Briefly, 300 µL pituitary was calculated by adjusting for the total amount of of a lysis buffer were added to each pituitary sample and ho- RNA extracted for each sample and was calculated as follows: mogenized by using a plastic micropestle in a 1.5-mL tube. The = × / . , homogenized samples were then transferred to a 96-well plate, Total(GTHpituitary) qPCRGTH( RNApituitary) 0 5 and 300 µL of a neutralization buffer were added to each sample. The solution was then transferred to the RNAspin RNA binding where total GTHpituitary is the total amount of FSH or LH beta plate and was centrifuged for 2 min at 5,600 × g (Allegra 25R subunit in the pituitary, qPCRGTH is the normalized qPCR level centrifuge; Beckman Coulter). Desalting buffer (500 µL) was of FSH or LH beta subunit, RNApituitary is the total amount of added to each well of the binding plate and was centrifuged for RNA (µg) in the pituitary, and 0.5 is the amount of RNA (µg) 2 min at 5,600 × g; the flow-through was then discarded. Ge- used for cDNA synthesis. The FSH beta subunit levels were nomic DNA was removed by adding the endonuclease DNase analyzed with two-way ANOVA (factors = morphotype and I and incubating at room temperature for 15 min. Wash buffer time), followed by Tukey’s post hoc test in Minitab version (500 µL) was added to each well of the binding plate and was 15.1.30.0 (α = 0.05). centrifuged for 2 min at 5,600 × g, followed by the addition of µ desalting buffer (800 L) and centrifugation for 2 min at 5,600 RESULTS × g. The flow-through was discarded. The RNA was eluted by using 50 µL of RNase-free water that was applied directly to Length and Weights of Sampled Fish the bottom of the binding plate; the plate was then allowed to sit Among all years and sampling sites, 463 lean lake trout and at room temperature for 2 min and was centrifuged for 3 min at 600 siscowets were collected (Table 2). At the EK sites, the 5,600 × g. The concentration of each sample was obtained by total numbers of lean and siscowet lake trout sampled were analyzing 1.5 µL on a NanoDrop ND1000 spectrophotometer similar (379 lean lake trout; 413 siscowets). At the WK sites, (Thermo Scientific). 187 siscowets were collected, but only 84 lean lake trout were The cDNA was produced by RT exactly as described above sampled. Thus, for lean lake trout, only data from EK-sampled for cloning the lake trout FSH and LH beta subunits. All qPCR fish were subsequently analyzed for GSI and hormone levels. reactions were created as master mixes, and individual reactions For EK samples, mean TL did not differ between lean and contained the following: 2.0 µL of cDNA, 5 pM each of the siscowet lake trout (F1, 788 = 0.41, P = 0.52) or between males forward and reverse gene primers (Table 1), and 12.5 µLof and females (F1, 795 = 0.0004, P = 0.98; Table 2). Lean lake Downloaded by [US Fish & Wildlife Service] at 12:47 07 December 2011 Power SYBR Green PCR Master Mix (Applied Biosystems). trout sampled at WK sites were shorter than siscowets (F1, 267 Cycling and fluorescence measurements were carried out in an = 41.8, P < 0.001) for both sexes. Among WK samples, there Mx3000P qPCR system (Stratagene) with the following cycling were no differences in mean TL of males versus females within ◦ ◦ parameters: 1 cycle of 95 C for 10 min; and 40 cycles of 95 Cfor morphotypes (F1, 267 = 0.18, P = 0.67). Lean lake trout from ◦ 15 s and 58 C for 1 min. Fluorescence readings were taken at the WK sites were shorter than those from EK sites (F1, 459 = 17.1, end of each cycle. Immediately after cycling, a melting curve P < 0.001). However, siscowets from WK sites were longer analysis was run. Amplification products from qPCR primers than those from EK sites (F1, 596 = 14.9, P < 0.001). were analyzed initially on agarose gels to ensure the presence Mean weights of fish sampled at EK sites did not differ of single bands of the correct size, and quality control for qPCR between lean lake trout and siscowets (F1, 788 = 0.02, P = 0.90) included the analysis of (1) no-template controls for the absence or between males and females (F1, 788 = 0.06, P = 0.81; Table of primer dimers and (2) dissociation curves for the presence of 2). For samples collected at WK sites, siscowets were heavier sharp single peaks. than lean lake trout (F1, 267 = 33.5, P < 0.001) and weights were Raw data were processed with Real-Time PCR Miner (Zhao not different between sexes (F1, 267 = 0.24, P = 0.63). Within and Fernald 2005). Quantification was performed by calculating morphotypes, siscowets from WK sites were heavier than those 1478 GOETZ ET AL.

TABLE 2. Mean (with 95% confidence interval [CI]) total length (TL; mm) and weight (g) of lean and siscowet lake trout collected during 2006–2008 in Michigan waters of Lake Superior west (WK) and east (EK) of the Keweenaw Peninsula. For a given variable, values with differing letters were significantly different (ANOVA: P < 0.05). WK EK Morphotype Statistic TL Weight n TL Weight n Males Lean Mean 588 a 1,597 x 34 627 b 2,155 y 193 95% CI 575–601 1,476–1,718 616–637 1,975–2,334 Siscowet Mean 644 c 2,392 y 97 622 b 2,055 y 207 95% CI 630–659 2,154–2,630 614–630 1,943–2,167 Females Lean Mean 595 a 1,726 x 50 623 b 2,058 y 186 95% CI 581–608 1,574–1,878 614–632 1,928–2,187 Siscowet 646 c 2,419 y 90 622 b 2,179 y 206 95% CI 632–660 2,210–2,627 611–633 2,018–2,340

from EK sites (F1, 596 = 9.8, P < 0.01) and lean lake trout from Ovarian Histology EK sites were heavier than those from WK sites (F1, 459 = 12.4, Oocytes varied in size and stage of development among P < 0.001). months. During May, the largest oocytes were primarily in the cortical alveolus and yolk granule stages, and this observation Female Gonadosomatic Indices was similar for both morphotypes (Table 4; Figure 4a, b). Frequency plots of the individual female GSIs across all Although GSIs of females did not increase in June and July samples indicated that from August to October, there was an (Figures 2, 3a), more ovaries contained oocytes in the primary increase in the ovarian size of lean and siscowet lake trout sam- and secondary yolk globule stages during those months (Table pled at EK sites and siscowets sampled at WK sites (Figure 2). 4; Figure 4c, d). In August, the ovaries of females with GSIs However, statistical analyses also indicated that monthly GSI of 3.0 or greater contained oocytes that were at least 2.0 mm in distributions were nonnormal for female lean lake trout from diameter (Figure 4e). Histology was not performed on ovaries August to October and for female siscowets during September collected during August–October since the oocytes were too < and October (P 0.05), suggesting that not all females had large and yolky to embed and section (Figure 4f). maturing ovaries at this time of year. Thus, we categorized fe- males sampled during August–October into two groups—those with maturing ovaries (GSI ≥ 3.0) and those without matur- TABLE 3. Mean (with 95% confidence interval [CI]) age (years) and total ing ovaries (GSI < 3.0)—based on the GSI distributions from length (TL; mm) of female lean and siscowet lake trout sampled in Lake Superior east of the Keweenaw Peninsula during September 2007 and 2008. Females with September and October, when the ovaries of a proportion of the nonmaturing ovaries had gonadosomatic indices (GSIs) less than 3.0, and those fish were clearly increasing in size. These groupings were fur- with maturing ovaries had GSIs of 3.0 or greater. Mean ages with different ther supported by scatter plots of individual GSI as a function of letters are significantly different (two-way ANOVA: F1, 70 = 306.4, P < 0.001). loge transformed E2 levels, another reproductive indicator (see Estradiol Levels section below; Figure A.1). Based on an exam- Without maturing With maturing Downloaded by [US Fish & Wildlife Service] at 12:47 07 December 2011 ination of GSIs for only those fish with maturing ovaries from Variable Statistic ovaries ovaries August to October, there was a significant increase in the mean Lean lake trout GSIs of female lean and siscowet lake trout at EK sites and fe- Age Mean 8.8 z 10.2 z male siscowets at WK sites during those months (Figure 3a). 95% CI 7.8–9.7 9.2–11.2 Of the 177 female siscowets collected at EK and WK sites TL Mean 618 661 from August to October, 74 (42%) had GSIs less than 3.0; of the 95% CI 603–634 620–702 106 lean lake trout sampled at EK sites during the same time, 57 n 22 16 (54%) had GSIs less than 3.0. Within the September-sampled Siscowets groups of lean or siscowet lake trout, those with maturing ovaries Age Mean 20.7 y 22 y were similar in age to those with nonmaturing ovaries (two- 95% CI 18.5–22.8 20.6–23.5 way ANOVA: F = 3.8, P = 0.056; Table 3). However, 1, 70 TL Mean 630 663 lean lake trout that contained nonmaturing or maturing ovaries 95% CI 603–657 630–697 were significantly younger than siscowets with the same ovary n 12 23 maturation status (two-way ANOVA: F1, 70 = 306.4, P < 0.001). REPRODUCTIVE BIOLOGY OF SISCOWET AND LEAN LAKE TROUT 1479

FIGURE 3. (a) Mean (+SD) gonadosomatic indices (GSIs) of female lean lake trout (white bars) and siscowet lake trout (black bars) sampled from Lake Supe- rior east of the Keweenaw Peninsula (EK; May–October) and female siscowets (gray bars) sampled west of the Keweenaw Peninsula (WK; May, August, and October). Mean female GSIs for May–July were calculated from all samples, whereas only GSIs greater than or equal to 3.0 were used to compute means for August–October. (b) Mean (+SD) GSIs of male lean lake trout (white bars) and siscowets (black bars) sampled at EK sites (May–October) and male siscowets (gray bars) sampled at WK sites (May, August, and October) are presented. Mean male GSIs for May–July were calculated from all samples, whereas only GSIs of 1.0 or greater were used to compute means for August–October. Within a morphotype population, bars with different letters represent significantly dif- ferent means (P < 0.05). Numbers below the bars indicate sample sizes.

were in the cortical alveolus stage, 20% were in the yolk granule stage, 26% were in the primary yolk globule stage, and 3% were in the secondary yolk globule stage. For lean lake trout with Downloaded by [US Fish & Wildlife Service] at 12:47 07 December 2011 FIGURE 2. Frequency distributions of gonadosomatic indices (GSIs) in rela- tion to sampling month for female lake trout in Lake Superior: (a) lean morpho- nonmaturing ovaries, 66% of the normal oocytes were in the type sampled east of the Keweenaw Peninsula (EK); (b) siscowet morphotype cortical alveolus stage, 21% were in the yolk granule stage, 9% sampled in the EK area; and (c) siscowet morphotype sampled west of the were in the primary yolk globule stage, and 4% were in the Keweenaw Peninsula (WK). Circles represent individual GSIs; horizontal lines secondary yolk globule stage. indicate the GSI value (3.0) used to differentiate fish with maturing versus nonmaturing ovaries. Numbers below the x-axes indicate total sample sizes; From August to October, many of the fish with nonmatur- numbers above the x-axes indicate sample sizes of fish with GSIs less than 3.0 ing ovaries also contained degenerating oocytes, most of which (August–October only). were large in size (1.5–2.0 mm; Figure 4g, h). Degenerating oocytes were characterized by a condensed and granulated cy- From August to October, the ovaries of nearly every fish with toplasm and collapsed zonae pellucidae (Figure 4g, h). Among nonmaturing gonads (GSI < 3.0), regardless of morphotype, siscowets with GSIs less than 3.0, 55% contained ovaries with contained a proportion of normal (i.e., no signs of degeneration) degenerating oocytes; among lean lake trout with GSIs less than oocytes in various stages (e.g., Figure 4h: cortical alveolus and 3.0, 35% contained ovaries with degenerating oocytes. In addi- yolk granule stages; Figure 5a, b: cortical alveolus stage). For tion, while difficult to quantify, many of the nonmaturing ovaries siscowets with nonmaturing ovaries, 51% of the normal oocytes of siscowets contained resorbing follicles, some of which were 1480 GOETZ ET AL.

TABLE 4. Percentage of females with ovaries in various stages of oogenesis Male Gonadosomatic Indices for lean and siscowet lake trout sampled in Lake Superior east of the Keweenaw Frequency plots of the GSIs for individual males across all Peninsula (EK; stages: CA = cortical alveolus; YG = yolk granule; PYG = primary yolk globule; SYG = secondary yolk globule; TYG = tertiary yolk samples indicated that there was an increase in the testicular globule). See Figure 4 for examples of each oocyte stage. Note that staging was size of lean and siscowet lake trout sampled at EK sites and not conducted on females with maturing ovaries (gonadosomatic index ≥ 3.0) siscowets sampled at WK sites from August to October (Figure sampled in August–October; the ovaries could not be processed for histology 8). Statistical analyses indicated that the monthly GSI distri- because of the large amount of yolk. Staging of ovaries from siscowets sampled butions did not deviate from normality (except for the August- west of the Keweenaw Peninsula is not presented since only the May sample could be staged. sampled siscowets), but the frequency plots (Figure 8) suggested that some individuals sampled during August–October did not Ovarian stage have maturing testes; however, the numbers were lower than the observed number of females with nonmaturing gonads. Thus, Month N CA YG PYG SYG TYG we categorized males from August–October samples into two Lean lake trout at EK sites groupings—those with maturing testes (GSI ≥ 1.0) and those May 25 84 12 4 0 0 without maturing testes (GSI < 1.0)—based on the GSI dis- Jun 43 74 6 13 3 3 tributions from September and October, when the testes of a Jul 12 75 0 8 17 0 proportion of the fish were clearly increasing in size. Unlike Siscowets at EK sites the relationship of ovarian GSIs and E2 levels in females, the May 35 58 30 12 0 0 11-KT levels in males were not correlated with testicular GSIs Jun41501720130until October (see 11-Ketotestosterone Levels section below); Jul 17 63 13 6 19 0 however, scatter plots of individual GSIs as a function of loge transformed 11-KT levels in October supported the GSI group- ings for maturing and nonmaturing testes (Figure A.2). Of the 190 male siscowets that were collected at EK and WK sites from quite large and numerous in histological sections (Figure 5a, August to October, 36 (19%) had GSIs less than 1.0; of the 123 lean lake trout males that were collected at EK sites during the b). This phenomenon was observed less frequently in lean lake same period, 25 (20%) had GSIs less than 1.0. Based on only trout with nonmaturing ovaries. In all of the ovaries sampled from May to July, the number the GSIs of fish with maturing testes from August to October, the mean GSIs of male lean and siscowet lake trout in the EK of fish that had resorbing or postovulatory follicles (e.g., see area and male siscowets in the WK area significantly increased Figure 4a, b) was quantified. The follicles were smaller than those described in the nonmaturing ovaries of fish sampled from during that period (Figure 3b). August to October (e.g., Figure 5a, b). With the exception of fish Testicular Histology containing nonmaturing ovaries, we did not assess samples for The testes of fish sampled in May from EK or WK sites were resorbing or postovulatory follicles after July because the size primarily filled with spermatogonia that had not yet undergone of the maturing oocytes (diameter > 2.0 mm) at this time made spermatogenesis (Table 5; Figure 5c). By July, nearly half of the it difficult to obtain a sufficient amount of extrafollicular tissue males had testes that had begun spermatogenesis and contained within a histological section where these follicles were located. some spermatocytes (Table 5; Figure 5d). From July to October, From May to July, postovulatory or resorbing follicles were development of the testes continued: all stages of spermatoge- observed in 96% of the siscowets compared with 32% of the nesis were observed by August, and increasing quantities of lean lake trout. mature sperm were observed during September and October Downloaded by [US Fish & Wildlife Service] at 12:47 07 December 2011 (Table 5; Figure 5e–g). Testicular development staged by his- Estradiol Levels tology was similar across morphotypes from the EK sites and Circulating E2 levels were relatively low from May to July between siscowets sampled from the EK and WK sites (Table in lean and siscowet lake trout but increased significantly during 5). No signs of spermatogenesis were apparent in males that had August in lake trout (both morphotypes) with maturing ovaries, GSIs less than 1.0 for either morphotype sampled from August coincident with the increase in GSI (Figure 6a). Levels remained to October (Figure 5h). elevated from August to October. As with GSIs, the mean E2 levels from August to October (Figure 6a) were computed only 11-Ketotestosterone Levels for fish with maturing ovaries. The mean E2 levels of females Unlike the E2 levels in females, 11-KT levels in males that had nonmaturing ovaries from August to October were low remained low during May–August even though the male and, with one exception (August sample of siscowets in the EK GSIs significantly increased in August (Figures 3b, 6b). Mean area), were significantly lower than the corresponding levels 11-KT levels increased in September but were not significantly for females with maturing ovaries within a morphotype at each different from levels in August. By October, 11-KT levels in sampling time (Figure 7a). males of both morphotypes were significantly elevated relative REPRODUCTIVE BIOLOGY OF SISCOWET AND LEAN LAKE TROUT 1481 Downloaded by [US Fish & Wildlife Service] at 12:47 07 December 2011

FIGURE 4. Lake trout ovarian histology: (a) oocytes in the cortical alveolus (CA) stage, depicting CAs in the periphery and postovulatory follicles (Fs); (b) oocytes in the early yolk granule (YG) stage, with pink-stained YGs forming in the periphery (Fs are also shown); (c) oocytes in the beginning of the primary yolk globule (YGL) stage; (d) oocytes in the secondary YGL stage; (e) YGLs nearly fused in the tertiary YGL stage; (f) ovary of a siscowet lake trout sampled in September, showing oocytes approximately 4 mm in diameter; and (g), (h) degenerating oocytes (DOs) containing collapsed zonae pellucidae (ZP) and normal CA- and YG-stage oocytes in lake trout with nonmaturing ovaries (gonadosomatic indices < 3.0) sampled during August–October. 1482 GOETZ ET AL. Downloaded by [US Fish & Wildlife Service] at 12:47 07 December 2011

FIGURE 5. Lake trout ovarian and testicular histology: (a), (b) resorbing follicles (RFs) and normal cortical alveolus (CA)-stage oocytes in lake trout with nonmaturing ovaries (gonadosomatic indices [GSIs] < 3.0) sampled during August–October; (c) stage 1 of spermatogenesis, with testis containing only spermatogonia (SG); (d) stage 2 of spermatogenesis, with testis beginning to form spermatocytes (SCs); (e) stage 3 testis exhibiting all stages of spermatogenesis, including SCs, spermatids (STs), and mature sperm (SP); (f) stage 4 testis containing less than 50% SP; (g) stage 5 testis containing greater than 50% SP; and (h) representative nonmaturing testis showing only SG, from a male siscowet lake trout sampled during September (GSI < 1.0; total length = 691 mm; weight = 2,525 g). REPRODUCTIVE BIOLOGY OF SISCOWET AND LEAN LAKE TROUT 1483

TABLE 5. Percentage of males with testes in various stages of spermatoge- nesis for lean and siscowet lake trout sampled in Lake Superior east (EK) and west (WK) of the Keweenaw Peninsula (stages: 1 = spermatogonia only; 2 = spermatocytes; 3 = all stages of spermatogenesis; 4 = less than 50% mature sperm; 5 = greater than 50% mature sperm). See Figure 5 for examples of each stage. Testicular staging was conducted on all samples collected in May–July, whereas only males with gonadosomatic indices of 1.0 or greater were used for staging of August–October testis samples. Testicular stage Month N 1 234 5 Lean lake trout at EK sites May 32 100 0 0 0 0 Jun 28 52 48 0 0 0 Jul 10 55 45 0 0 0 Aug25222741110 Sep 34 13 0 21 58 8 Oct 39 12 0 3 44 41 Siscowets at EK sites May49928000 Jun 27 78 22 0 0 0 Jul 15 60 40 0 0 0 Aug143336300 0 Sep 27 18 15 33 30 3 Oct 45 0 0 14 61 25 Siscowets at WK sites

May 23 78 22 0 0 0 FIGURE 6. Mean (+SD) plasma levels of (a) estradiol-17β (E2) in female Aug27181845180lake trout and (b) 11-ketotestosterone (11-KT) in male lake trout of the lean Oct 34 11 0 0 67 22 morphotype (white bars) and siscowet morphotype (black bars) sampled from Lake Superior east of the Keweenaw Peninsula (EK; May–October) and fe- male and male siscowets (gray bars) sampled west of the Keweenaw Peninsula (WK; May, August, and October). Mean female E2 and male 11-KT levels for May–July were calculated from all samples, whereas only individuals with ma- to May–August levels (Figure 6b). As with females, only turing gonads (females with gonadosomatic indices [GSIs] ≥ 3.0; males with those males with testicular GSIs of 1.0 or greater were used to GSIs ≥ 1.0) were used to compute the means for August–October. Within a mor- compute the mean 11-KT levels for August–October. Because photype population, bars with different letters represent significantly different 11-KT levels in maturing fish did not increase during August, means (P < 0.05). Numbers below bars indicate sample sizes. the 11-KT levels in males with testicular GSIs less than 1.0 were significantly lower than the corresponding levels in fish with fragment was 98% identical to the corresponding coho salmon maturing testes only for the September and October samples sequence. (Figure 7b). Quantitative PCR was performed on beta subunits of both LH Downloaded by [US Fish & Wildlife Service] at 12:47 07 December 2011 and FSH in the pituitaries; however, LH beta subunit transcripts Pituitary Gonadotropin Beta Subunit Transcript Levels were only observed in a small number of samples from October, Portions of the lake trout FSH and LH beta subunit transcripts when GSIs were elevated (results not shown). In contrast, FSH were cloned by using RT-PCR. The cloned 412-nucleotide seg- beta subunit transcript was observed at all times, although a ment of the lake trout FSH beta subunit (GenBank accession general pattern in expression was observed wherein the FSH number HM057170) that encoded a partial protein of 135 amino beta subunit transcript was low in May and June, increased in acids was 96% identical to the FSH beta subunit protein of rain- August and September, and then decreased in October (Figure bow trout (NP 001118058). At the nucleotide level, the 412- 9). The levels of FSH beta messenger RNA were statistically nucleotide fragment was 95% identical to the corresponding higher in August, September, or both compared with May, June, rainbow trout sequence. The cloned 489-nucleotide segment of or both for siscowet females and males in the EK area, for the lake trout LH beta subunit (accession number HM057171) siscowet males in the WK area, and for lean males in the EK encoded a partial protein of 115 amino acids that was 100% area. The same monthly trend in FSH beta subunit transcript identical to the LH beta subunit protein of coho salmon O. expression was observed in lean females sampled at EK sites kisutch (AAO72300). At the nucleotide level, the 489-nucleotide and in siscowet females sampled at WK sites, but the values 1484 GOETZ ET AL.

FIGURE 7. Mean (+SD) plasma levels of (a) estradiol-17β (E2) in female lake trout and (b) 11-ketotestosterone (11-KT) in male lake trout of the lean morphotype (white bars) and siscowet morphotype (black bars) sampled from Lake Superior east of the Keweenaw Peninsula (EK; August–October) and female and male siscowets (gray bars) sampled west of the Keweenaw Peninsula (WK; August and October). Individuals with nonmaturing gonads are depicted (females with gonadosomatic indices [GSIs] < 3.0; males with GSIs < 1.0). Asterisks indicate significant (P < 0.05) differences from the corresponding mean E2 or 11-KT level (August–October) in Figure 6 (i.e., for individuals with maturing gonads). Within a morphotype population, E2 and 11-KT did not differ between samples of individuals with nonmaturing gonads from August to October. Numbers below bars indicate sample sizes. FIGURE 8. Frequency distribution of gonadosomatic indices (GSIs) in rela- Downloaded by [US Fish & Wildlife Service] at 12:47 07 December 2011 tion to sampling month for male lake trout in Lake Superior: (a) lean morpho- were not significantly different. The FSH beta transcript levels type sampled east of the Keweenaw Peninsula (EK); (b) siscowet morphotype measured from August to October in females with GSIs less than sampled in the EK area; and (c) siscowet morphotype sampled west of the Keweenaw Peninsula (WK). Circles represent individual GSIs; horizontal lines 3.0 and males with GSIs less than 1.0 appeared to be lower at all indicate the GSI value (1.0) used to differentiate fish with maturing versus times than the corresponding levels in females and males with nonmaturing testes. Numbers below the x-axes indicate total sample sizes, and maturing gonads (female GSI ≥ 3.0; male GSI ≥ 1.0) within a numbers above the x-axes indicate sample sizes of fish with GSIs less than 1.0. morphotype per sampling period (compare Figures 9 and 10). However, these differences were not significant, probably as a was 2,590 g for lean lake trout and 2,716 g for siscowets. The result of the small sample sizes used in the comparisons. slopes (F1, 38 = 0.02, P = 0.89) and intercepts (F1, 38 = 0.6, P = 0.44) for fecundity as a function of log-transformed TL were Fecundity not significantly different between lean lake trout and siscowets The average size of fish used in the assessment of fecundity (Figure 11a). For fecundity as a function of weight, the intercept was similar between morphotypes: mean TL was 663 mm for did not differ between lean lake trout and siscowets (t1, 38 = lean lake trout and 655 mm for siscowets, and mean weight 1.44, P > 0.15). In a reduced model, the common intercept REPRODUCTIVE BIOLOGY OF SISCOWET AND LEAN LAKE TROUT 1485

FIGURE 9. Mean (+SD) whole-pituitary follicle stimulating hormone (FSH) beta subunit transcript levels in (a) female lake trout and (b) male lake trout of the lean (white bars) and siscowet (black bars) morphotypes sampled from Lake Superior east of the Keweenaw Peninsula (EK; May–October 2007) and siscowets (gray bars) sampled west of the Keweenaw Peninsula (WK; May, August, and October 2007). Mean FSH levels for May–June were calculated FIGURE 10. Mean (+SD) whole-pituitary follicle stimulating hormone (FSH) from all samples, whereas only individuals with maturing gonads (females beta subunit transcript levels for (a) female lake trout with nonmaturing ovaries with gonadosomatic indices [GSIs] ≥ 3.0; males with GSIs ≥ 1.0) were used (gonadosomatic indices [GSIs] < 3.0) and (b) male lake trout with nonmaturing to compute the means for August–October. Within a morphotype population, testes (GSIs < 1.0). Samples represent lean (white bars) and siscowet (black bars with different letters represent significantly different means (P < 0.05). bars) morphotypes from Lake Superior east of the Keweenaw Peninsula (EK; Numbers below bars indicate sample sizes. August–October 2007) and siscowets (gray bars) west of the Keweenaw Penin- sula (WK; August and October 2007). Within a given morphotype population, was only marginally different from zero (t1, 39 = 2.25, P > levels did not differ between sampling times; means also did not differ from the 0.03), but a significant difference in slope between lean lake corresponding values for fish with maturing gonads (August–October; Figure 9). Numbers below bars indicate sample sizes. trout and siscowets was detected (F2, 39 = 82.9, P < 0.0001). The final model had an intercept of zero for both lean lake trout and siscowets (Figure 11b). Based on the slopes, relative trout from the same geographic sites over an extended period of fecundity was 1,404 eggs/kg (95% confidence interval [CI] = the year (spring to fall) and to directly compare it with gonadal development in a lean lake trout population. To assess seasonal Downloaded by [US Fish & Wildlife Service] at 12:47 07 December 2011 1,250–1,558 eggs/kg) for lean lake trout and 1,167 eggs/kg (95% CI = 1,049–1,286 eggs/kg) for siscowets. The average relative changes in gonadal development, we measured the changes in fecundity for lean lake trout was far above the 95% CI for GSI, gonadal cytology, and reproductive hormone levels. Over- siscowets, and the average relative fecundity for siscowets was all, our results provide strong evidence that the timing of gonadal far below the 95% CI for lean lake trout. The slight overlap maturation in both female and male siscowets is synchronized between the two CIs occurred because the common intercept of within a population; over the 2 years of the study, gonadal matu- the regression lines marginally differed from zero (see reduced ration within the examined lake trout populations occurred from model above). late summer to fall, as has been generally observed in other char species (brook trout: Tam et al. 1986; de Montgolfier et al. 2009; Arctic char: Frantzen et al. 1997). Further, the results show that DISCUSSION in some Lake Superior populations, the timing of gonadal mat- Although a number of studies have reported on the reproduc- uration is virtually identical for lean and siscowet lake trout. tion of lean lake trout in various North American lakes (sum- The results of several studies have suggested that lean and sis- marized by Martin and Olver 1980), the current study is the first cowet lake trout are genetically distinct (Page et al. 2004; Goetz to systematically track gonadal development in siscowet lake et al. 2010); therefore, some reduction in gene flow should 1486 GOETZ ET AL.

different parts of the lake could have maturation or spawning times that differ from those reported here for southern Lake Su- perior. If so, this would be similar to the sympatric populations of Arctic char morphotypes that spawn in the spring or late win- ter as well as in the fall (Elliot and Baroudy 1995; Klemetsen et al. 1997; Telnes and Saegrov 2004). In addition to the changes in the GSI, we observed correla- tions between the levels of several reproductive hormones and changes in GSI. In fact, this study provides the first report of seasonal changes in the levels of reproductive hormones in wild lake trout. Changes in the circulating levels of E2 in female lean and siscowet lake trout were very similar to those reported for other chars in which the E2 levels increased dramatically between July and August (Tam et al. 1986; Frantzen et al. 1997; Tveiten et al. 1998). Where it was measured, this increase cor- related well with a large increase in ovarian GSI (Tam et al. 1986; Frantzen et al. 1997), as was also observed in the present study. However, E2 levels in lake trout appeared to remain ele- vated in October, whereas in Arctic char and brook trout there was an obvious decrease in E2 levels (Tam et al. 1986; Mayer et al. 1992; Tveiten et al. 1998). In salmonids, estrogen levels decrease drastically at the time of oocyte maturation and ovu- lation (Goetz et al. 1987). Thus, the decrease is related to the timing of oocyte maturation and not just to the time of year. Our samples did not contain many fish that were undergoing meiotic maturation or that were spent. Thus, because our last sampling was in October and fish may spawn in November, we may have missed fish with the low E2 levels that are generally found at the time of ovulation. FIGURE 11. Relationship between total number of eggs and (a) total length Male lake trout undergoing gonadal maturation had signif- or (b) weight of mature female lake trout of the lean and siscowet morphotypes icant increases in circulating 11-KT, the primary androgen in sampled from Lake Superior east of the Keweenaw Peninsula during September salmonids. However, the timing of the increase in 11-KT did and October 2008. not directly coincide with the August increase in testicular GSI. The 11-KT levels increased later, in September and October, occur between them. However, the results presented here in- after the GSI had already increased. This pattern is similar to dicate that if the lean and siscowet lake trout populations we observations of captive rainbow trout, which exhibited a sub- sampled are reproductively isolated, the timing of gonad mat- stantial increase in testicular GSI and progression of spermato- uration is not involved, although the timing of spawning (i.e., genesis 2–3 months prior to any significant increase in plasma release of gametes) could still be different. 11-KT levels (Kusakabe et al. 2006). It is also notable that the Ripe male and female siscowets (eggs and milt flowing plasma levels of 11-KT in lake trout were variable and that the Downloaded by [US Fish & Wildlife Service] at 12:47 07 December 2011 freely) have been collected in late April from deep water peak mean levels (October) were lower than those reported for (118–145 m) northeast of the Apostle Islands in Lake Supe- captive fish. This is probably attributable to the nature of field- rior (Bronte 1993); the timing indicated in the study by Bronte sampled animals, which are often less synchronized than captive (1993) is quite different from that presented here. Eschmeyer fish. In brook trout that spawned during November, significant (1955) reported that three ripe siscowet or humper lake trout increases in GSI and plasma 11-KT levels occurred in July, were collected in June off the eastern extremity of Isle Royale and the mean 11-KT levels peaked in September and declined (no depth was reported). Further, historical accounts of lake trout at spawning in October and November (de Montgolfier et al. in Lake Superior have indicated that siscowets reproduce either 2009). Similar seasonal changes in 11-KT have been reported earlier than lean lake trout (Milner 1874) or at various times of for Arctic char (Mayer et al. 1992; Tveiten et al. 1998), but those the year (Goode 1888; Sweeny 1890). Siscowet females with studies did not report changes in GSI. postvitellogenic ovaries in prespawning condition and siscowet We originally wanted to measure circulating levels of FSH males with mature testes have been collected in May off Isle and LH, but we could not detect either FSH or LH in the Royale (100–150-m depth; S. Sitar, unpublished data). Collec- lake trout plasma samples by using immunoassays developed tively, these observations suggest that siscowet populations in for coho salmon (P. Swanson, unpublished data). The lack of REPRODUCTIVE BIOLOGY OF SISCOWET AND LEAN LAKE TROUT 1487

detection of LH in plasma is not surprising because we did not parently refrain from spawning in some years. In lake trout, obtain many samples from spawning fish. In salmon and trout, this has been previously referred to as “intermittent spawning” LH levels are generally low or undetectable prior to spawning (Martin and Olver 1980) or as fish that were “infertile” (Fry and then increase at spawning (Prat et al. 1996; Davies et al. 1949). Such an occurrence in fish is now more commonly re- 1999; Gomez et al. 1999). However, the inability to measure ferred to as “skipped spawning” or as “spawning omission” plasma FSH was surprising; this inability was probably not due (Rideout et al. 2005). Investigations on lake trout populations to major differences in antigenic sites of the molecules because in several Canadian lakes have suggested that 8–87% of the fe- (1) the beta subunits are highly conserved among salmonids and males in a population may skip spawning (Miller and Kennedy (2) these assays have been used for both rainbow trout (Davies 1948; Kennedy 1954; Cuerrier and Schultz 1957; Rawson 1961; et al. 1999) and Atlantic salmon Salmo salar (Oppenberntsen Johnson 1972, 1973). et al. 1994). In lieu of plasma hormone levels, we chose to mea- In the current study, 42% of female siscowets and 54% of sure pituitary FSH and LH beta subunit transcript levels. Studies female lean lake trout sampled from August to October had have demonstrated a relationship between transcript levels of the GSIs less than 3.0 and would not have spawned in the fall. FSH beta subunit and circulating FSH levels in rainbow trout Because lean lake trout generally mature at a larger size than (Gomez et al. 1999), and studies have examined the seasonal siscowets (S. Sitar, unpublished data), the percentage of lean changes in LH and FSH beta subunit transcript levels in dif- females with nonmaturing gonads is probably inflated by in- ferent fish species (Martyniuk et al. 2009; Mittelholzer et al. cluding fish with GSIs less than 3.0 that were actually immature 2009). Thus, we measured the levels of FSH and LH beta sub- (had not yet reached puberty) and would not have spawned any- unit transcripts in lake trout pituitaries as an indirect method of way. Nearly all of the siscowets sampled from May to July that assessing seasonal changes in GTHs. Transcripts for FSH beta were examined histologically contained postovulatory follicles, subunit were detected in the pituitaries of all fish at all sampling suggesting that they had prior reproductive activity and there- times from May to October, whereas LH beta subunit transcript fore were not immature. However, only 32% of female lean lake was only detected during October and was not detected in all trout contained postovulatory follicles during the same time, fish. In separate collections, we sampled lean lake trout that suggesting that a higher proportion of lean females were imma- were caught directly on the spawning shoals, and all of those ture. Postovulatory follicles in fish ovaries have been described fish had measurable levels of LH beta subunit transcript in the (Saborido-Rey and Junquera 1998; Witthames et al. 2009) and pituitary (results not shown). This result is consistent with the can be used to track past spawning events. In some fish, such as role of LH in later stages of oogenesis and spermatogenesis in northern anchovy Engraulis mordax, the postovulatory follicles salmonids (Swanson et al. 2003; Rosenfeld et al. 2007). do not last very long (Hunter and Goldberg 1980), whereas in One issue with evaluating pituitary hormone transcript data Atlantic cod Gadus morhua they can last for 3–5 months after is how best to express it to reflect changes in the pituitary’s spawning (Saborido-Rey and Junquera 1998). Given the large capacity to produce and secrete hormones into circulation dur- size of lake trout follicles, resorption after spawning or after ing the reproductive cycle. In many studies that have monitored oocyte degeneration probably takes a long time, especially for pituitary hormone content by immunoassay, data are often re- siscowets since they are mostly demersal and the water temper- ported per pituitary to fully capture the seasonal changes in atures they experience throughout the year are colder than those hormone production. Similar issues have been described when experienced by lean lake trout. Whether this might influence the monitoring changes in transcripts for steroidogenic enzymes in higher incidence of postovulatory follicles observed in siscowets the testes of fish (Kusakabe et al. 2006). When we analyzed the versus lean lake trout is unclear. Further, the potential level of normalized FSH beta subunit transcript levels from fish sampled spawning omission in siscowets may be underestimated because during May–October, we did not observe any seasonal trends our sampling protocol was restricted to 550-mm and larger fish Downloaded by [US Fish & Wildlife Service] at 12:47 07 December 2011 in the means. However, when we adjusted the values on the and thus may have excluded smaller siscowets that were still basis of the total yield of RNA extracted per pituitary to reflect old enough to reproduce. As we observed, siscowets were older the total amount within the entire pituitary, we found that FSH at a given length than lean lake trout. Since younger, mature beta subunit transcript levels peaked in approximately August or fish are more likely to skip spawning than older fish (Rideout et September for both sexes within both morphotypes. This peak al. 2005; Jorgensen et al. 2006; Rideout and Rose 2006), size is consistent with the observed changes in gonadal development could have influenced our estimate of spawning omission in and plasma sex steroid levels during the same period. siscowets. An additional observation from this study was that a propor- Relative to females, spawning omission in males is reported tion of female and male lake trout within populations from the much less frequently because of the greater difficulty in visu- EK and WK areas did not undergo gonadal maturation. This ally assessing the reproductive stage of the testes (Miller and occurred in both lean and siscowet lake trout and was obvious Kennedy 1948; Johnson 1972). To our knowledge, the only in both sexes starting in August, when GSIs increased, thus past study that specifically addressed spawning omission in reflecting gonadal growth. Hence, a certain proportion of the male lake trout was conducted in the Waterton Lakes, Alberta, adults within these populations, regardless of morphotype, ap- where 42% of sampled males did not appear to be reproducing 1488 GOETZ ET AL.

(Cuerrier and Schultz 1957), similar to the percentage of fe- Lake Superior, suggesting that reproductive timing does not males with nonmaturing ovaries in the present study. In our genetically isolate the morphotypes in these populations. Fur- study, 19–20% of the males had nonmaturing testes based on thermore, not all siscowet or lean lake trout in these populations GSI and histology, and this percentage was similar between reproduce every year, and this finding could have important morphotypes. Among the males sampled from August to Octo- implications for the management of lake trout in Lake Superior. ber, all those with GSIs less than 1.0 had testes that looked the same macroscopically and histologically and that were com- posed only of spermatogonia, similar to the testes of males ACKNOWLEDGMENTS sampled in May. However, among females sampled during The crews of the R/V Judy and R/V Lake Char, including August–October, those with GSIs less than 3.0 had ovaries Brandon Bastar, Dawn Dupras, Greg Kleaver, Helen Morales, that varied in oocyte development and cytology. Many of the Kevin Rathbun, Dan Traynor, and Tim Wille, worked extremely nonmaturing ovaries contained oocytes that were undergoing hard in the field collection of fish for this study. Henry Quin- degeneration. Curiously, many of these oocytes were relatively lan and Mark Brouder (Ashland Fish and Wildlife Conservation large (1.5–2.0 mm) and appeared to have reached the yolk glob- Office, U.S. Fish and Wildlife Service) and Bill Mattes (Great ule stage before degenerating. The lower E2 levels in these fish Lakes Indian Fish and Wildlife Commission) provided addi- are probably related to the follicular degeneration. Spawning tional and essential field support for collections. This study was omission has been described for many fishes and appears to supported by a grant from the Great Lakes Fishery Commis- take several forms, including retention of fully mature oocytes sion (to F.G., S.S., and C.B.) and by the Michigan Department or ovulated eggs, resorption of oocytes that have begun vitello- of Natural Resources (Federal Aid in Sport Fish Restoration genesis (accumulation of yolk protein), and cessation of oocyte Project F-81-R). The findings and conclusions in this article are development prior to vitellogenesis (Rideout et al. 2005). Based those of the authors and do not necessarily represent the views on this and our observations, we hypothesize that the female of the U.S. Fish and Wildlife Service. Reference to trade names lake trout that exhibit skipped spawning begin to undergo go- does not imply endorsement by the U.S. Government. nadal maturation, but then the maturational process stops and the largest oocytes begin to degenerate and to be resorbed. Oocytes in lake trout that were undergoing normal development attained REFERENCES Bronte, C. R. 1993. Evidence of spring spawning lake trout in Lake Superior. a diameter of about 2.0 mm at the yolk globule stage in August; Journal of Great Lakes Research 19:625–629. thus, the mechanism that activates degeneration and resorption Bronte, C. R., M. P. Ebener, D. R. Schreiner, D. S. DeVault, M. M. Petzold, probably takes place in July or August. D. A. Jensen, C. Richards, and S. J. Lozano. 2003. Fish community change Currently, management of lake trout in much of the upper in Lake Superior, 1970–2000. Canadian Journal of Fisheries and Aquatic Great Lakes relies on age-structured stock assessment models Sciences 60:1552–1574. Burnham-Curtis, M. K., and G. R. Smith. 1994. Osteological evidence of genetic to generate safe harvest limits (e.g., Modeling Subcommittee divergence of lake trout (Salvelinus namaycush) in Lake Superior. Copeia 2009). A key population metric generated by the models is 1994:843–850. spawning stock biomass per recruit (SSBR). Estimates of SSBR Burnham-Curtis, M. K., and C. R. Bronte. 1996. Otoliths reveal a diverse age require female maturation-at-age schedules, and a failure to structure for humper lake trout in Lake Superior. Transactions of the American account for the fraction of mature females that are undergoing Fisheries Society 125:844–851. Campbell, B., J. Dickey, B. Beckman, G. Young, A. Pierce, H. Fukada, and spawning omission would lead to overestimation of the SSBR P. Swanson. 2006. Previtellogenic oocyte growth in salmon: relationships and estimates of safe harvest. among body growth, plasma insulin-like growth factor-1, estradiol-17beta, In this study, fecundity of lean and siscowet lake trout was follicle-stimulating hormone and expression of ovarian genes for insulin- found to be similar to historical values (Eschmeyer 1955; Peck like growth factors, steroidogenic-acute regulatory protein and receptors for Downloaded by [US Fish & Wildlife Service] at 12:47 07 December 2011 1988). Although the siscowet fecundity at size was somewhat gonadotropins, growth hormone, and somatolactin. Biology of Reproduction 75:34–44. comparable to that observed for lean lake trout, the size-at-age Chomcynski, P. 1993. A reagent for the single-step simultaneous isolation relationship was drastically different for the two morphotypes. of RNA, DNA and protein from cell and tissue samples. Biotechniques For example, a mature female lean lake trout that is 660 mm 15:532–537. would produce about 3,400 eggs and would be approximately Chomcynski, P., and N. Sacchi. 1987. Single-step method of RNA isolation 10 years old, whereas a female siscowet of the same size would by acid guanidinium thiocyanate-phenol extraction. Analytical Biochemistry 162:156–159. produce around 2,900 eggs and would be approximately 22 Cuerrier, J.-P., and F. H. Schultz. 1957. Studies on the lake trout and common years old (Table 3). This clearly illustrates that age is a key whitefish in Waterton Lakes, Waterton Lakes National Park, Alberta. Wildlife factor to consider when contrasting the growth or reproductive Management Bulletin 3:1–41. capacity of lean and siscowet lake trout. Cuisset, B., P. Pradelles, D. E. Kime, E. R. Kuhn, P. Babin, S. Davail, In conclusion, the observed seasonal changes in GSI, go- and F. Lemenn. 1994. Enzyme-immunoassay for 11-ketotestosterone us- ing acetylcholinesterase as label - application to the measurement of 11- nadal histology, and reproductive hormone levels demonstrate ketotestosterone in plasma of Siberian sturgeon. Comparative Biochem- that there is little difference in the timing of gonadal maturation istry and Physiology C Pharmacology Toxicology & Endocrinology 108: between lean and siscowet lake trout populations in southern 229–241. REPRODUCTIVE BIOLOGY OF SISCOWET AND LEAN LAKE TROUT 1489

Davies, B., N. Bromage, and P. Swanson. 1999. The brain-pituitary- Johnson, L. 1973. Stock and recruitment in some unexploited Canadian Arctic gonadal axis of female rainbow trout Oncorhynchus mykiss: effects of lakes. Conseil International pour l’Exploration de la Mer Extrait des Rapports photoperiod manipulation. General and Comparative Endocrinology 115: et Proces-Verbaux 164:219–227. 155–166. Jorgensen, C., B. Ernande, O. Fiksen, and U. Dieckmann. 2006. The logic of de Montgolfier, B., A. Faye, C. Audet, and D. G. Cyr. 2009. Seasonal variations skipped spawning in fish. Canadian Journal of Fisheries and Aquatic Sciences in testicular connexin levels and their regulation in the brook trout, Salvelinus 63:200–211. fontinalis. General and Comparative Endocrinology 162:276–85. Kagawa, H., K. Takano, and Y. Nagahama. 1981. Correlation of plasma Elliot, J. M., and E. Baroudy. 1995. The ecology of Arctic charr, Salvelinus estradiol-17 beta and progesterone levels with ultrastructure and histochem- alpinus, and brown trout, Salmo trutta, in Windemere (northeast England). istry of ovarian follicles in the white-spotted char, Salvelinus leucomaenis. Nordic Journal Freshwater Research 71:33–48. Cell Tissue Research 218:315–29. Eschmeyer, P.H. 1955. The reproduction of lake trout in southern Lake Superior. Kennedy, W. A. 1954. Growth, maturity and mortality in the relatively unex- Transactions of the American Fisheries Society 84:47–74. ploited lake trout, Cristivomer namaycush, of Great Slave Lake. Journal of Eschmeyer, P. H., and A. M. Phillips. 1965. Fat content of the flesh of siscowets the Fisheries Research Board of Canada 11:827–852. and lake trout from Lake Superior. Transactions of the American Fisheries Khan, N. Y., and S. U. Qadri. 1970. Morphological differences in Lake Superior Society 94:62–74. lake charr. Journal of the Fisheries Research Board of Canada 27:161–167. Ewing, B., and P.Green. 1998. Base-calling of automated sequencer traces using Klemetsen, A., P.-A. Amundsen, R. Knudsen, and B. Hermansen. 1997. A phred II: error probabilities. Genome Research 8:186–94. profundal, winter-spawning morph of Arctic charr Salvelinus alpinus (L.) in Foster, N. R., D. V. O’Connor, and C. B. Schreck. 1993. Gamete ripening and Lake Fjellfrosvatn, northern Norway. Nordic Journal of Freshwater Research hormonal correlates in 3 strains of lake trout. Transactions of the American 73:13–23. Fisheries Society 122:252–267. Korenman, S. G., R. H. Stevens, L. A. Carpenter, M. Robb, G. D. Niswender, and Fostier, A., B. Jalabert, R. Billard, B. Breton, and Y. Zohar. 1983. The gonadal B. M. Sherman. 1974. Estradiol radioimmunoassay without chromatography: steroids. Pages 277–372 in D. J. Randall, W. S. Hoar, and E. M. Donaldson, procedure, validation and normal values. Journal of Clinical Endocrinology editors. Fish physiology, volume 9, part A. Academic Press, New York. and Metabolism 38:718–20. Frantzen, M., H. K. Johnsen, and I. Mayer. 1997. Gonadal development and Krueger, C. C., and P. E. Ihssen. 1995. Review of genetics of lake trout in sex steroids in a female Arctic charr broodstock. Journal of Fish Biology the Great Lakes: history, molecular genetics, physiology, strain comparisons, 51:697–709. and restoration management. Journal of Great Lakes Research 21(Supplement Fry, F. E. J. 1949. Statistics of a lake trout fishery. Biometrics 5:27–67. 1):348–363. Goetz, F., D. Rosauer, S. Sitar, G. Goetz, C. Simchick, S. Roberts, R. Johnson, Kusakabe, M., I. Nakamura, J. Evans, P.Swanson, and G. Young.2006. Changes C. Murphy, C. R. Bronte, and S. MacKenzie. 2010. A genetic basis for the in mRNAs encoding steroidogenic acute regulatory protein, steroidogenic phenotypic differentiation between siscowet and lean lake trout (Salvelinus enzymes and receptors for gonadotropins during spermatogenesis in rainbow namaycush). Molecular Ecology 19(Supplement 1):176–196. trout testes. Journal of Endocrinology 189:541–54. Goetz, F. W., A. Y. Fostier, B. Breton, and B. Jalabert. 1987. Hormonal changes Lawrie, A. H., and J. F. Rahrer. 1973. Lake Superior: a case history of the lake during meiotic maturation and ovulation in the brook trout (Salvelinus fonti- and its fisheries. Great Lakes Fishery Commission Technical Report 19. nalis). Fish Physiology and Biochemistry 3:203–211. Lubzens, E., G. Young, J. Bobe, and J. Cerda. 2010. Oogenesis in teleosts: how Gomez, J. M., C. Weil, M. Ollitrault, P. Y. Le Bail, B. Breton, and F. Le Gac. eggs are formed. General and Comparative Endocrinology 165:367–89. 1999. Growth hormone (GH) and gonadotropin subunit gene expression and Martin, N. V., and C. H. Olver. 1980. The lake charr, Salvelinus namaycush. pituitary and plasma changes during spermatogenesis and oogenesis in rain- Pages 205–277 in E. K. Balon, editor. Charrs: salmonid fishes of the genus bow trout (Oncorhynchus mykiss). General and Comparative Endocrinology Salvelinus. Dr W. Junk, The Hague, The Netherlands. 113:413–28. Martyniuk, C. J., K. J. Kroll, W. F. Porak, C. Steward, H. J. Grier, and N. Goode, G. B. 1888. American fishes: a popular treatise upon the game and food D. Denslow. 2009. Seasonal relationship between gonadotropin, growth hor- fishes of North America with special reference to habitats and methods of mone, and estrogen receptor mRNA expression in the pituitary gland of capture. Standard Book, New York. largemouth bass. General and Comparative Endocrinology 163:306–317. Hansen, M. J., C. P. Madenjian, J. H. Selgeby, and T. E. Helser. 1997. Gillnet Mayer, I., M. Schmitz, B. Borg, and R. Schulz. 1992. Seasonal endocrine selectivity for lake trout (Salvelinus namaycush) in Lake Superior. Canadian changes in male and female Arctic charr (Salvelinus alpinus). 1. Plasma Journal of Fisheries and Aquatic Sciences 54:2483–2490. levels of 3 androgens, 17-alpha-hydroxy-20-beta-dihydroprogesterone, and Hansen, M. J., J. W. Peck, R. G. Schorfhaar, J. H. Selgeby, D. R. Schreiner, 17-beta-estradiol. Canadian Journal of Zoology 70:37–42. S. T. Schram, B. L. Swanson, W. R. MacCallum, M. K. Burnham-Curtis, Miller, R. B., and W. A. Kennedy. 1948. Observations on the lake trout of Great G. L. Curtis, J. W. Heinrich, and R. J. Young. 1995. Lake trout (Salvelinus Bear Lake. Journal of the Fisheries Research Board of Canada 7:176–189. Downloaded by [US Fish & Wildlife Service] at 12:47 07 December 2011 namaycush) populations in Lake Superior and their restoration in 1959–1993. Milner, J. W. 1874. The fisheries of the Great Lakes and the species of Coregonus Journal of Great Lakes Research 21(Supplement 1):152–175. or white fish. Appendix A in Report on the fisheries of the Great Lakes; the Hellqvist, A., M. Schmitz, I. Mayer, and B. Borg. 2006. Seasonal changes result of inquiries prosecuted in 1871 and 1872. U.S. Commission of Fish and in expression of LH-beta and FSH-beta in male and female three-spined Fisheries, Report of the Commissioner for 1872 and 1873, Part II, Washington, stickleback, Gasterosteus aculeatus. General and Comparative Endocrinol- D.C. ogy 145:263–269. Mittelholzer, C., E. Andersson, G. L. Taranger, D. Consten, T. Hirai, B. Hesthagen, T., K. Hindar, B. Jonsson, J. O. Ousdal, and H. Holthe. 1995. Effects Senthilkumaran, Y. Nagahama, and B. Norberg. 2009. Molecular charac- of acidification on normal and dwarf Arctic charr Salvelinus alpinus (L) in a terization and quantification of the gonadotropin receptors FSH-R and LH-R Norwegian Lake. Biological Conservation 74:115–123. from Atlantic cod (Gadus morhua). General and Comparative Endocrinology Humason, G. L. 1972. Animal tissue techniques. Freeman, San Francisco. 160:47–58. Hunter, J. R., and S. R. Goldberg. 1980. Spawning incidence and batch fecun- Modeling Subcommittee. 2009. Technical Fisheries Committee adminis- dity in northern anchovy Engraulis mordax. U.S. National Marine Fisheries trative report 2009: status of lake trout and lake whitefish popula- Service Fishery Bulletin 77:641–652. tions in the 1836 treaty-ceded waters of Lake Superior, Huron, and Johnson, L. 1972. Keller Lake: characteristics of a culturally unstressed Michigan with recommended yield and effort levels for 2009. Avail- salmonid community. Journal of the Fisheries Research Board of Canada able: www.michigan.gov/documents/dnr/2009-status-report 303561 7.pdf. 29:731–740. (November 2010). 1490 GOETZ ET AL.

Moore, S. A., and C. R. Bronte. 2001. Delineation of sympatric morphotypes of Schulz, R. 1984. Serum levels of 11-oxotestosterone in male and 17beta- lake trout in Lake Superior. Transactions of the American Fisheries Society estradiol in female rainbow trout (Salmo gairdneri) during the first repro- 130:1233–1240. ductive cycle. General and Comparative Endocrinology 56:111–120. Nagahama, Y. 1983. The functional morphology of teleost gonads. Pages Schulz, R. W., L. R. de Franca, J. J. Lareyre, F. Legac, H. Chiarini-Garcia, 223–275 in D. J. Randall, W. S. Hoar, and E. M. Donaldson, editors. Fish R. H. Nobrega, and T. Miura. 2010. Spermatogenesis in fish. General and physiology, volume 9, part A. Academic Press, New York. Comparative Endocrinology 165:390–411. Oppenberntsen, D. O., S. O. Olsen, C. J. Rong, G. L. Taranger, P. Swanson, and Sitar, S. P., and J. X. He. 2006. Growth and maturity of hatchery and wild lean B. T. Walther. 1994. Plasma levels of eggshell zr-proteins, estradiol-17-beta, lake trout during population recovery in Michigan waters of Lake Superior. and gonadotropins during an annual reproductive-cycle of Atlantic salmon Transactions of the American Fisheries Society 135:915–923. (Salmo salar). Journal of Experimental Zoology 268:59–70. Sohn, Y. C., Y. Yoshiura, M. Kobayashi, and K. Aida. 1999. Seasonal changes Page, K. S., K. T. Scribner, and M. Burnham-Curtis. 2004. Genetic diversity in mRNA levels of gonadotropin and thyrotropin subunits in the gold- of wild and hatchery lake trout populations: relevance for management and fish, Carassius auratus. General and Comparative Endocrinology 113:436– restoration in the Great Lakes. Transactions of the American Fisheries Society 444. 133:674–691. Sower, S. A., and C. B. Schreck. 1982. Steroid and thyroid hormones during Peck, J. W. 1988. Fecundity of hatchery and wild lake trout in Lake Superior. sexual maturation of coho salmon (Oncorhynchus kisutch) in seawater and Journal of Great Lakes Research 14:9–13. freshwater. General and Comparative Endocrinology 47:42–53. Planas, J. V., J. Athos, F. W. Goetz, and P. Swanson. 2000. Regulation of ovar- Stauffer, T. M., and J. W. Peck. 1981. Morphological characteristics of juvenile ian steroidogenesis in vitro by follicle-stimulating hormone and luteinizing lake trout of various races. Michigan Department of Natural Resources, Study hormone during sexual maturation in salmonid fish. Biology of Reproduction 408, Final Report, Lansing. 62:1262–1269. Swanson, P. 1991. Salmon gonadotropins: reconciling old and new ideas. Pages Planas, J. V., and P. Swanson. 1995. Maturation-associated changes in the re- 2–7 in A.P. Scott, J. P. Sumpter, D. E. Kime., and M. S. Rolf, editors. Repro- sponse of the salmon testis to the steroidogenic actions of gonadotropins ductive physiology of fish. FishSymp91, Sheffield, UK. (GTH-I and GTH-II) in vitro. Biology of Reproduction 52:697–704. Swanson, P., J. T. Dickey, and B. Campbell. 2003. Biochemistry and physiology Prat, F., J. P. Sumpter, and C. R. Tyler. 1996. Validation of radioimmunoassays of fish gonadotropins. Fish Physiology and Biochemistry 28:53–59. for two salmon gonadotropins (GTH I and GTH II) and their plasma concen- Sweeny, R. O. S. 1890. The siskiwit. Transactions of the American Fisheries trations throughout the reproductive cycle in male and female rainbow trout Society 19:84–86. (Oncorhynchus mykiss). Biology of Reproduction 54:1375–82. Tam, W. H., R. J. J. Roy, and R. Makaran. 1986. Ovarian cycle and plasma con- Rahrer, J. F. 1965. Age, growth, maturity, and fecundity of “humper” lake trout, centrations of estrogen and vitellogenin in brook trout (Salvelinus fontinalis, Isle Royale, Lake Superior. Transactions of the American Fisheries Society Mitchell). Canadian Journal of Zoology 64:744–751. 94:75–83. Telnes, T., and H. Saegrov. 2004. Reproductive strategies in two sympatric Rawson, D. S. 1961. The lake trout of Lac la Ronge, Saskatchewan. Journal of morphotypes of Arctic charr in Kalandsvatnet, west Norway. Journal of Fish the Fisheries Research Board of Canada 18:423–462. Biology 65:574–579. Rideout, R. M., and G. A. Rose. 2006. Suppression of reproduction in Atlantic Tveiten, H., I. Mayer, H. K. Johnsen, and M. Jobling. 1998. Sex steroids, growth cod Gadus morhua. Marine Ecology Progress Series 320:267–277. and condition of Arctic charr broodstock during an annual cycle. Journal of Rideout, R. M., G. A. Rose, and M. P. M. Burton. 2005. Skipped spawning in Fish Biology 53:714–727. female iteroparous fishes. Fish and Fisheries 6:50–72. Witthames, P. R., A. Thorsen, H. Murua, F. Saborido-Rey, L. N. Greenwood, Rosenfeld, H., I. Meiri, and A. Elizur. 2007. Gonadotropic regulation of oocyte R. Dominguez, M. Korta, and O. S. Kjesbu. 2009. Advances in methods development. Pages 175–202 in P. Babin, J. Cerda, and E. Lubzens, edi- for determining fecundity: application of the new methods to some marine tors. The fish oocyte: from basics to biotechnological applications. Springer, fishes. U.S. National Marine Fisheries Service Fishery Bulletin 107:148– Dordrecht, The Netherlands. 164. Saborido-Rey, F., and S. Junquera. 1998. Histological assessment of variations Young, G., P. M. Lokman, M. Kusakabe, I. Nakamura, and F. W. Goetz. 2005. in sexual maturity of cod (Gadus morhua L.) at the Flemish Cap (north-west Gonadal steroidogenesis in teleost fish. Pages 155–223 in C. Hew, editor. Atlantic). ICES Journal of Marine Science 55:515–521. Hormones and their receptors in fish reproduction: molecular aspects of fish Sandlund, O. T., K. Gunnarsson, P. M. Jonasson, B. Jonsson, T. Lindem, K. and marine biology. World Scientific Press, Hackensack, New Jersey. P. Magnusson, H. J. Malmquist, H. Sigurjonsdottir, S. Skulason, and S. S. Zhao, S., and R. D. Fernald. 2005. Comprehensive algorithm for quantita- Snorrason. 1992. The Arctic charr Salvelinus alpinus in Thingvallavatn. Oikos tive real-time polymerase chain reaction. Journal of Computational Biology 64:305–351. 12:1047–64. Downloaded by [US Fish & Wildlife Service] at 12:47 07 December 2011 REPRODUCTIVE BIOLOGY OF SISCOWET AND LEAN LAKE TROUT 1491

APPENDIX: RELATIONSHIPS BETWEEN THE GONADOSOMATIC INDEX AND GONADAL STEROIDS

FIGURE A.2. Scatter plot of the gonadosomatic index (GSI) versus loge transformed 11-ketotestosterone (ng/mL) for male lake trout sampled in Lake FIGURE A.1. Scatter plot of the gonadosomatic index (GSI) versus loge trans- Superior during October: (a) lean morphotype sampled east of the Keweenaw formed estradiol-17β (ng/mL) for female lake trout sampled in Lake Superior Peninsula (EK); and (b) siscowet morphotype sampled from the EK area and during August–October: (a) lean morphotype sampled east of the Keweenaw west of the Keweenaw Peninsula (WK). Lines indicate the GSI value (1.0) used to differentiate fish with maturing versus nonmaturing testes.

Downloaded by [US Fish & Wildlife Service] at 12:47 07 December 2011 Peninsula (EK); and (b) siscowet morphotype sampled from the EK area and west of the Keweenaw Peninsula (WK). Horizontal lines indicate the GSI value (3.0) used to differentiate fish with maturing versus nonmaturing ovaries.