Aerobic Microbial Degradation of Chloroaromatic Compounds Polluting the Environment

Cairo University Faculty of Science Botany Department

AEROBIC MICROBIAL DEGRADATION OF CHLOROAROMATIC COMPOUNDS POLLUTING THE ENVIRONMENT

Presented By

Ola Abdel A'al Abdel A'aty Khalil M.Sc., Banha University, 2005

A Thesis Submitted to Faculty of Science

In Partial Fulfillment of the Requirements for the Degree of Ph.D. of Science (Microbiology)

Botany Department Faculty of Science Cairo University

(2011)

Cairo Univ ersity Faculty of Science Botany Department

AEROBIC MICROBIAL DEGRADATION OF CHLOROAROMATIC COMPOUNDS POLLUTING THE ENVIRONMENT

Presented By

Ola Abdel A'al Abdel A'aty Khalil M.Sc., Banha University, 2005

A Thesis Submitted to Faculty of Science

In Partial Fulfillment of the Requirements for the Degree of Ph.D. of Science

(Microbiology)

Under Supervision of

Prof. Prof. Youssry El-Sayed Saleh Mervat Aly Mohamed Abo-State Professor of Microbiology Professor of Microbiology Faculty of Science National Center for Research & Cairo University Radiation Technology

Botany Department Faculty of Science Cairo University

(2011)

< <<<< Üéu†Ö]<à·†Ö]<]<ÜŠe

وَأ6ْ8ََلَوَأ6ْ8ََلَ ا>ُا>ُ Aَ>ْ?َ@َAَ@َ?ْ<َ اCَDِFْGبَاCَDِFْGبَ واHَIْFِJْGَواHَIْFِJْGَ وIK@َAََ<َوMَGْMَG CَLCَL َ>َIK@َAَْ Mَ@ْPَOُMَ@ْPَO ْNُFَOْNُFَOُ وَآCَنَوَآCَنَ SْTَUُSْTَUُ ا>ِا>ِ Aَ>ْ?َ@َAَ@َ?ْ<َ CًI?ِWَACًI?ِWَA

<<Üé¿ÃÖ]<]<Ñ‚‘

ABSTRACT

Student Name: Ola Abdel A'al Abdel A'aty Khalil

Title of the thesis: Aerobic Microbial Degradation of Chloroaromatic Compounds Polluting the Environment

Degree: (Microbiology)

Eight soil and sludge samples which have been polluted with petroleum wastes for more than 41 years were used for isolation of adapted indigenous microbial communities able to mineralize the chloroaromatic compounds [3-chlorobenzoic acid (3-CBA), 2,4-dichlorophenol (2,4-DCP), 2,6-dichlorophenol indol phenol (2,6-DCPP) and 1,2,4-trichlorobenzene (1,2,4-TCB)] and use them as a sole carbon and energy sources. From these communities, the most promising bacterial strain MAM-24 which has the ability to degrade the four chosen aromatic compounds was isolated and identified by comparative sequence analysis for its 16S-rRNA coding genes and it was identified as Bacillus mucilaginosus HQ 013329. Degradation percentage was quantified by HPLC. Degradation products were identified by GC-MS analysis which revealed that the isolated strain and its mutant dechlorinated the four chloroaromatic compounds in the first step forming acetophenone which is considered as the corner stone of the intermediate compounds.

Keywords : Chloroaromatic compounds – Pollution – Bacteria

Supervisors: Signature:

1- Prof. Dr. Youssry El Sayed Saleh 2- Prof. Dr. Mervat Aly Mohamed Abo-State Prof. Dr. Maimona Abdel-Aziz Kord

Chairman of Botany Department Faculty of Science- Cairo University

APROVAL SHEET FOR SUMISSION

Thesis Title: Aerobic Microbial Degradation of Chloroaromatic Compounds Polluting the Environment

Name of candidate: Ola Abdel A'al Abdel A'aty Khalil

This thesis has been approved for submission by the supervisors:

1- Prof. Dr. Youssry El-Sayed Saleh

Signature:

2- Prof. Dr. Mervat Aly Mohamed Abo-State

Signature:

Prof. Dr. Maimona Abdel-Aziz Kord

Chairman of Botany Department Faculty of Science- Cairo University

LIST OF ABBREVIATIONS

Abbrev. Full Term

1,2,4-TCB 1,2,4-Trichlorobenzene 2,4-DCP 2,4-Dichlorophenol 3-CBA 3-chlorobenzoic acid BLAST Basic logical alignment search tool Blastn Somewhat similar sequences BOD Biochemical oxygen demand CB Chlorinated benzene CBz Chlorobenzoates CDB Chloroaromatic degrading bacteria CFU/ml Colony forming unit/ml Clustal W2 Program for comparing the aligned sequences COD Chemical oxygen demand EBI European biotechnology information GC-MS Gas chromatography/mass spectrometry HPLC High performance liquid chromatography KGy Kilo-gray NCBI National Center for Biotechnology Information PCBs Polychlorinated biphenyls (PCBs) PCP Pentachlorophenol RT Retention time TBC Total bacterial count TCA Tricarboxlic acid cycle TE buffer Tris-HCL buffer used to store DNA and RNA

LIST OF TABLES

Table No. Title Page No.

Table (1): Sampling sites represented different sources of indigenous microbial communities...... 73 Table (2): Growth & concentration of extracellular protein of different bacterial communities on 1 mM of 3-chlorobenzoic acid (3-CBA)...... 89 Table (3): Growth & concentration of extracellular protein of different bacterial communities on 1mM of 2,4-dichlorophenol (2,4-DCP)...... 92 Table (4): Growth & concentration of extracellular protein of different bacterial communities on 1mM of 2,6-dichlorophenol indol phenol (2,6-DCPP)...... 94 Table (5): Growth & concentration of extracellular protein of different bacterial communities on 15µM of 1,2,4-trichlorobenzene (1,2,4-TCB)...... 97 Table (6): Count after incubation period for 28 days of different mixed indigenous bacteria on different chloroaromatic compounds ...... 106 Table (7): Count of different indigenous bacterial communities on different types of media...... 110 Table (8): Determination of the ability of the indigenous isolated strains to grow on different chloroaromatic compounds at different concentrations...... 112 Table (9): Characterization of the most promising isolates...... 113 Table (10): Growth, concentration of extracellular protein & concentration of Cl - of isolate MAM-24 on different concentrations of 3-chlorobenzoic acid (3-CBA)...... 115 Table (11): Growth, concentration of extracellular protein & concentration of Cl - of isolate MAM-27 on different concentrations of 3-chlorobenzoic acid (3-CBA)...... 119

LIST OF TABLES (Cont…)

Table No. Title Page No.

Table (12): Growth, concentration of extracellular protein & concentration of Cl - of isolate MAM-29 on different concentrations of 3-chlorobenzoic acid (3-CBA)...... 122 Table (13): Growth, concentration of extracellular protein & concentration of Cl - of isolate MAM-33 on different concentrations of 3-chlorobenzoic acid (3-CBA)...... 126 Table (14): Growth, concentration of extracellular protein & concentration of Cl - of isolate MAM-3 on different concentrations of 3-chlorobenzoic acid (3-CBA)...... 130 Table (15): Growth, concentration of extracellular protein & concentration of Cl - of E. cloaceae MAM-4 on different concentrations of 3-chlorobenzoic acid (3-CBA)...... 133 Table (16): Degradation percentage of 3-chlorobenzoic acid (3-CBA) after 21 days by HPLC...... 139 Table (17): Growth, concentration of extracellular protein & concentration of Cl - of isolate MAM-24 on different concentrations of 2,4-dichlorophenol (2,4-DCP)...... 142 Table (18): Growth, concentration of extracellular protein & concentration of Cl - of isolate MAM-27 on different concentrations of 2,4-dichlorophenol (2,4-DCP)...... 145 Table (19): Growth, concentration of extracellular protein & concentration of Cl - of isolate MAM-29 on different concentrations of 2,4-dichlorophenol (2,4-DCP)...... 149 Table (20): Growth, concentration of extracellular protein & concentration of Cl - of isolate MAM-33 on different concentrations of 2,4-dichlorophenol (2,4-DCP)...... 152

LIST OF TABLES (Cont…)

Table No. Title Page No.

Table (21): Growth, concentration of extracellular protein & concentration of Cl - of isolate MAM-3 on different concentrations of 2,4-dichlorophenol (2,4-DCP)...... 155 Table (22): Growth, concentration of extracellular protein & concentration of Cl - of E. cloaceae MAM-4 on different concentrations of 2,4-dichlorophenol (2,4-DCP)...... 159 Table (23): Count of different indigenous isolates on different concentrations of 2,4- dichlorophenol (2,4-DCP)...... 162 Table (24): Degradation percentage of 2,4-dichlorophenol (2,4-DCP) after 21 days by HPLC...... 168 Table (25): Growth, concentration of extracellular protein & concentration of Cl –of isolate MAM-24 on different concentrations of 2,6-dichlorophenol indol phenol (2,6-DCPP)...... 172 Table (26): Growth, concentration of extracellular protein & concentration of Cl - of isolate MAM-27 on different concentrations of 2,6-dichlorophenol indol phenol (2,6-DCPP)...... 175 Table (27): Growth, concentration of extracellular protein & concentration of Cl - of isolate MAM-29 on different concentrations of 2,6-dichlorophenol indol phenol (2,6-DCPP)...... 180 Table (28): Growth, concentration of extracellular protein & concentration of Cl - of isolate MAM-33 on different concentrations of 2,6-dichlorophenol indol phenol (2,6-DCPP)...... 183 Table (29): Growth, concentration of extracellular protein & concentration of Cl - of isolate MAM-3 on different concentrations of 2,6-dichlorophenol indol phenol (2,6-DCPP)...... 186

LIST OF TABLES (Cont…)

Table No. Title Page No.

Table (30): Growth, concentration of extracellular protein & concentration of Cl - of E. cloaceae MAM-4 on different concentrations of 2,6-dichlorophenol indol phenol (2,6-DCPP)...... 190 Table (31): Count of different indigenous isolates on different concentrations of 2,6-dichlorophenol indol phenol (2,6-DCPP)...... 193 Table (32): Degradation percentage of 2,6-dichlorophenol indol phenol (2,6-DCPP) after 21 days by HPLC...... 196 Table (33): Growth, concentration of extracellular protein & concentration of Cl - of isolate MAM-24 on different concentrations of 1,2,4- trichlorobenzene (1,2,4-TCB)...... 200 Table (34): Growth, concentration of extracellular protein & concentration of Cl - of isolate MAM-27 on different concentrations of 1,2,4- trichlorobenzene (1,2,4-TCB)...... 203 Table (35): Growth, concentration of extracellular protein & concentration of Cl - of isolate MAM-29 on different concentrations of 1,2,4-trichlorobenzene (1,2,4-TCB)...... 206 Table (36): Growth, concentration of extracellular protein & concentration of Cl - of isolate MAM-33 on different concentrations of 1,2,4-trichlorobenzene (1,2,4-TCB)...... 213 Table (37): Growth, concentration of extracellular protein & concentration of Cl - of isolate MAM-3 on different concentrations of 1,2,4-trichlorobenzene (1,2,4- TCB) ...... 216 Table (38): Growth, concentration of extracellular protein & concentration of Cl - of E. cloaceae MAM-4 on different concentrations of 1,2,4-trichlorobenzene (1,2,4-TCB)...... 219

LIST OF TABLES (Cont…)

Table No. Title Page No.

Table (39): Count of different indigenous isolates on different concentrations of 1,2,4-trichlorobenzene (1,2,4- TCB)...... 224 Table (40): Degradation percentage of 1,2,4- trichlorobenzene (1,2,4-TCB) after 21 days by HPLC...... 225 Table (41): Effect of gamma irradiation on the viability of isolated strain MAM-24...... 231 Table (42): Growth of the parent strain (B. mucilaginosus MAM-24 ) and its mutants exposed to different doses of gamma radiation on different chloroaromatic compounds...... 234 Table (43): Intermediates determined by GC-MS analysis of 3-chlorobenzoic acid (3-CBA) by Bacillus mucilaginosus MAM-24 and its mutant MAM- 24 (9)...... 238 Table (44): Intermediates determined by GC-MS analysis resulted from biodegradation of 2,4- dichlorophenol (2,4-DCP) by Bacillus mucilaginosus MAM-24 and its mutant MAM- 24 (9)...... 243 Table (45): Intermediates determined by GC-MS analysis resulted from biodegradation of 1,2,4- trichlorobenzene (1,2,4-TCB) by Bacillus mucilaginosus MAM-24 and its mutant MAM- 24 (9)...... 248

LIST OF FIGURES

Figure No. Title Page No.

Figure (1): Major pathways for catabolism of aromatic compounds in bacteria ...... 47 Figure (2): Peripheral pathways of biodegradation of aromatic compounds in rhodococci. R=alkyl ...... 51 Figure (3): Central pathways of catabolism of aromatic compounds in rhodococci ...... 52 Figure (4): Degradative pathways for 3-chlorocatechol (3- CC), 4-chlorocatechol (4-CC), and 3,5- dichlorocatechol (3,5-DCC), the central intermediates in chlorophenol degradation, as found in R. opacus 1CP...... 55 Figure (5): Alternative reactions occurring when catechol 2,3-dioxygenases cleave 3-chlorocatechol...... 57 Figure (6): Schematic presentation of the protocatechuate and catechol branches of the 3-oxoadipate pathway plus the modified ortho pathway...... 59 Figure (7): Catabolic pathways for degradation of chlorinated benzoic acids by bacteria...... 61 Figure (8): Brief summary of various metabolic pathways for the degradation of 3-CBA ...... 63 Figure (9): Metabolic pathways for 2,4-dichlorophenoxyacetic acid (2,4-D), 2-methyl-4-chlorophenoxyacetic acid (MCPA) and 3-chlorobenzoate by Ralstonia eutropha JMP134 (pJP4)...... 65 Figure (10): Proposed pathway for the degradation of 2,4-DCP enrichment cultures for the proposed sequential steps are described in the figure...... 66 Figure (11): Proposed catabolic pathway of chlorobenzene by P. putida GJ31 by analogy to the known meta-cleavage pathway...... 67

LIST OF FIGURES (Cont…)

Figure No. Title Page No.

Figure (12): Proposed pathways for the degradation of 1,2,4- TCB, 1,2-DCB, and 1,4-DCB by Pseudomonas sp. strain P51...... 68 Figure (13): Sampling site map...... 72 Figure (14): GC/MS apparatus...... 80 Figure (15): Growth of different bacterial communities on 1mM of 3-chlorobenzoic acid (3-CBA)...... 90 Figure (16): Concentation of extracellular protein of different bacterial communities on 1mM of 3- chlorobenzoic acid (3-CBA)...... 90 Figure (17): Growth of different bacterial communities on 1mM of 2,4-dichlorophenol (2,4-DCP)...... 93 Figure (18): Concentration of extracellular protein of different bacterial communities on 1mM of 2,4- dichlorophenol (2,4-DCP)...... 93 Figure (19): Growth of different bacterial communities on 1mM of 2,6-dichlorophenol indol phenol (2,6- DCPP)...... 95 Figure (20): Concentration of extracellular protein of different bacterial communities on 1mM of 2,6- dichlorophenol indol phenol (2,6-DCPP)...... 95 Figure (21): Growth of different bacterial communities on 15µM of 1,2,4-trichlorobenzene (1,2,4-TCB)...... 98 Figure (22): Concentration of extracellular protein of different bacterial communities on 15µM of 1,2,4-trichlorobenzene (1,2,4-TCB)...... 98 Figure (23): Count after incubation period for 28 days of different indigenous mixed bacteria on different chloroaromatic compounds...... 107 Figure (24): Count of different indigenous bacterial communities on different types of media...... 110

LIST OF FIGURES (Cont…)

Figure No. Title Page No.

Figure (25): Growth of isolate MAM-24 on different concentrations of 3-chlorobenzoic acid (3- CBA)...... 116 Figure (26): Concentration of extracellular protein of isolate MAM-24 on different concentrations of 3- chlorobenzoic acid (3-CBA)...... 116 Figure (27): Concentration of Cl –of isolate MAM-24 on different concentrations of 3-chlorobenzoic acid (3-CBA)...... 117 Figure (28): Growth of isolate MAM-27 on different concentrations of 3-chlorobenzoic acid (3- CBA)...... 120 Figure (29): Concentration of extracellular protein of isolate MAM-27 on different concentrations of 3- chlorobenzoic acid (3-CBA)...... 120 Figure (30): Concentration of Cl –of isolate MAM-27 on different concentrations of 3-chlorobenzoic acid (3-CBA)...... 121 Figure (31): Growth of isolate MAM-29 on different concentrations of 3-chlorobenzoic acid (3- CBA)...... 123 Figure (32): Concentration of extracellular protein of isolate MAM-29 on different concentrations of 3- chlorobenzoic acid (3-CBA)...... 123 Figure (33): Concentration of Cl –of isolate MAM-29 on different concentrations of 3-chlorobenzoic acid (3-CBA)...... 124 Figure (34): Growth of isolate MAM-33 on different concentrations of 3-chlorobenzoic acid (3- CBA)...... 127

LIST OF FIGURES (Cont…)

Figure No. Title Page No.

Figure (35): Concentration of extracellular protein of isolate MAM-33 on different concentrations of 3- chlorobenzoic acid (3-CBA)...... 127 Figure (36): Concentration of Cl –of isolate MAM-33 on different concentrations of 3-chlorobenzoic acid (3-CBA)...... 128 Figure (37): Growth of isolate MAM-3 on different concentrations of 3-chlorobenzoic acid (3- CBA)...... 131 Figure (38): Concentration of extracellular protein of isolate MAM-3 on different concentrations of 3- chlorobenzoic acid (3-CBA)...... 131 Figure (39): Concentration of Cl –of isolate MAM-3 on different concentrations of 3-chlorobenzoic acid (3-CBA)...... 132 Figure (40): Growth of E. cloaceae MAM-4 on different concentrations of 3-chlorobenzoic acid (3- CBA)...... 134 Figure (41): Concentration of extracellular protein of E. cloaceae MAM-4 on different concentrations of 3-chlorobenzoic acid (3-CBA)...... 134 Figure (42): Concentration of Cl –of E. cloaceae MAM-4 on different concentrations of 3-chlorobenzoic acid (3-CBA)...... 135 Figure (43): Degradation percentage of 3-chlorobenzoic acid (3-CBA) after 21 days by HPLC...... 140 Figure (44): Growth of isolate MAM-24 on different concentrations of 2,4-dichlorophenol (2,4- DCP)...... 143 Figure (45): Concentration of extracellular protein of isolate MAM-24 on different concentrations of 2,4- dichlorophenol (2,4-DCP)...... 143

LIST OF FIGURES (Cont…)

Figure No. Title Page No.

Figure (46): Concentration of Cl – of isolate MAM-24 on different concentrations of 2,4-dichlorophenol (2,4-DCP)...... 144 Figure (47): Growth of isolate MAM-27 on different concentrations of 2,4-dichlorophenol (2,4- DCP)...... 146 Figure (48): Concentration of extracellular protein of isolate MAM-27 on different concentrations of 2,4- dichlorophenol (2,4-DCP)...... 146 Figure (49): Concentration of Cl –of isolate MAM-27 on different concentrations of 2,4-dichlorophenol (2,4-DCP)...... 147 Figure (50): Growth of isolate MAM-29 on different concentrations of 2,4-dichlorophenol (2,4-DCP)...... 150 Figure (51): Concentration of extracellular protein of isolate MAM-29 on different concentrations of 2,4- dichlorophenol (2,4-DCP)...... 150 Figure (52): Concentration of Cl – of isolate MAM-29 on different concentrations of 2,4-dichlorophenol (2,4-DCP)...... 151 Figure (53): Growth of isolate MAM-33 on different concentrations of 2,4-dichlorophenol (2,4-DCP)...... 153 Figure (54): Concentration of extracellular protein of isolate MAM-33 on different concentrations of 2,4- dichlorophenol (2,4-DCP)...... 153 Figure (55): Concentration of Cl –of isolate MAM-33 on different concentrations of 2,4-dichlorophenol (2,4-DCP)...... 154 Figure (56): Growth of isolate MAM-3 on different concentrations of 2,4-dichlorophenol (2,4-DCP)...... 156

LIST OF FIGURES (Cont…)

Figure No. Title Page No.

Figure (57): Concentration of extracellular protein of isolate MAM-3 on different concentrations of 2,4- dichlorophenol (2,4-DCP)...... 156 Figure (58): Concentration of Cl – of isolate MAM-3 on different concentrations of 2,4-dichlorophenol (2,4-DCP)...... 157 Figure (59): Growth of E. cloaceae MAM-4 on different concentrations of 2,4-dichlorophenol (2,4-DCP)...... 160 Figure (60): Concentration of extracellular protein of E. cloaceae MAM-4 on different concentrations of 2,4-dichlorophenol (2,4-DCP)...... 160 Figure (61): Concentration of Cl –of E. cloaceae MAM-4 on different concentrations of 2,4-dichlorophenol (2,4-DCP)...... 161 Figure (62): Degradation percentage of 2,4-dichlorophenol (2,4-DCP) after 21 days by HPLC...... 169 Figure (63): Growth of isolate MAM-24 on different concentrations of 2,6-dichlorophenol indol phenol (2,6-DCPP)...... 173 Figure (64): Concentration of extracellular protein of isolate MAM-24 on different concentrations of 2,6- dichlorophenol indol phenol (2,6-DCPP)...... 173 Figure (65): Concentration of Cl – of isolate MAM-24 on different concentrations of 2,6-dichlorophenol indol phenol (2,6-DCPP)...... 174 Figure (66): Growth of isolate MAM-27 on different concentrations of 2,6-dichlorophenol indol phenol (2,6-DCPP)...... 176 Figure (67): Concentration of extracellular protein of isolate MAM-27 on different concentrations of 2,6- dichlorophenol indol phenol (2,6-DCPP)...... 176

LIST OF FIGURES (Cont…)

Figure No. Title Page No.

Figure (68): Concentration of Cl – of isolate MAM-27 on different concentrations of 2,6-dichlorophenol indol phenol (2,6-DCPP)...... 177 Figure (69): Growth of isolate MAM-29 on different concentrations of 2,6-dichlorophenol indol phenol (2,6-DCPP)...... 181 Figure (70): Concentration of extracellular protein of isolate MAM-29 on different concentrations of 2,6- dichlorophenol indol phenol (2,6-DCPP)...... 181 Figure (71): Concentration of Cl – of isolate MAM-29 on different concentrations of 2,6-dichlorophenol indol phenol (2,6-DCPP)...... 182 Figure (72): Growth of isolate MAM-33 on different concentrations of 2,6-dichlorophenol indol phenol (2,6-DCPP)...... 184 Figure (73): Concentration of extracellular protein of isolate MAM-33 on different concentrations of 2,6- dichlorophenol indol phenol (2,6-DCPP)...... 184 Figure (74): Concentration of Cl – of isolate MAM-33 on different concentrations of 2,6-dichlorophenol indol phenol (2,6-DCPP)...... 185 Figure (75): Growth of isolate MAM-3 on different concentrations of 2,6-dichlorophenol indol phenol (2,6-DCPP)...... 187 Figure (76): Concentration of extracellular protein of isolate MAM-3 on different concentrations of 2,6- dichlorophenol indol phenol (2,6-DCPP)...... 187 Figure (77): Concentration of Cl – of isolate MAM-3 on different concentrations of 2,6-dichlorophenol indol phenol (2,6-DCPP)...... 188

LIST OF FIGURES (Cont…)

Figure No. Title Page No.

Figure (78): Growth of E. cloaceae MAM-4 on different concentrations of 2,6-dichlorophenol indol phenol (2,6-DCPP)...... 191 Figure (79): Concentration of extracellular protein of E. cloaceae MAM-4 on different concentrations of 2,6-dichlorophenol indol phenol (2,6-DCPP)...... 191 Figure (80): Concentration of Cl – of E. cloaceae MAM-4 on different concentrations of 2,6-dichlorophenol indol phenol (2,6-DCPP)...... 192 Figure (81): Degradation percentage of 2,6- dichlorophenol indol phenol (2,6-DCPP) after 21 days by HPLC...... 197 Figure (82): Growth of isolate MAM-24 on different concentrations of 1,2,4-trichlorobenzene (1,2,4- TCB)...... 201 Figure (83): Concentration of extracellular protein of isolate MAM-24 on different concentrations of 1,2,4- trichlorobenzene (1,2,4-TCB)...... 201 Figure (84): Concentration of Cl – of isolate MAM-24 on different concentrations of 1,2,4-trichlorobenzene (1,2,4-TCB)...... 202 Figure (85): Growth of isolate MAM-27 on different concentrations of 1,2,4-trichlorobenzene (1,2,4- TCB)...... 204 Figure (86): Concentration of extracellular protein of isolate MAM-27 on different concentrations of 1,2,4- trichlorobenzene (1,2,4-TCB)...... 204 Figure (87): Concentration of Cl – of isolate MAM-27 on different concentrations of 1,2,4-trichlorobenzene (1,2,4-TCB)...... 205

LIST OF FIGURES (Cont…)

Figure No. Title Page No.

Figure (88): Growth of isolate MAM-29 on different concentrations of 1,2,4-trichlorobenzene (1,2,4- TCB)...... 207 Figure (89): Concentration of extracellular protein of isolate MAM-29 on different concentrations of 1,2,4- trichlorobenzene (1,2,4-TCB)...... 207 Figure (90): Concentration of Cl – of isolate MAM-29 on different concentrations of 1,2,4- trichlorobenzene (1,2,4-TCB)...... 208 Figure (91): Growth of isolate MAM-33 on different concentrations of 1,2,4-trichlorobenzene (1,2,4- TCB)...... 214 Figure (92): Concentration of extracellular protein of isolate MAM-33 on different concentrations of 1,2,4- trichlorobenzene (1,2,4-TCB)...... 214 Figure (93): Concentration of Cl – of isolate MAM-33 on different concentrations of 1,2,4- trichlorobenzene (1,2,4-TCB)...... 215 Figure (94): Growth of isolate MAM-3 on different concentrations of 1,2,4-trichlorobenzene (1,2,4- TCB)...... 217 Figure (95): Concentration of extracellular protein of isolate MAM-3 on different concentrations of 1,2,4- trichlorobenzene (1,2,4-TCB)...... 217 Figure (96): Concentration of Cl – of isolate MAM-3 on different concentrations of 1,2,4- trichlorobenzene (1,2,4-TCB)...... 218 Figure (97): Growth of E. cloaceae MAM-4 on different concentrations of 1,2,4-trichlorobenzene (1,2,4- TCB)...... 220

LIST OF FIGURES (Cont…)

Figure No. Title Page No.

Figure (98): Concentration of extracellular protein of E. cloaceae MAM- 4 on different concentrations of 1,2,4-trichlorobenzene (1,2,4-TCB)...... 220 Figure (99): Concentration of Cl – of E. cloaceae MAM-4 on different concentrations of 1,2,4- trichlorobenzene (1,2,4-TCB)...... 221 Figure (100): Degradation percentage of 1,2,4- trichlorobenzene (1,2,4-TCB) after 21 days by HPLC...... 226 Figure (101): Agarose gel of DNA of isolated strain MAM-24 chloroaromatic degrading bacteria...... 228 Figure (102): DNA sequencing of isolate MAM-24...... 229 Figure (103): Phylogenetic tree representing the relationships of 16SrRNA gene sequence analysis of isolated MAM-24 chloroaromatic degrading bacteria and Bacillus sequences from GenBank (NCBI). The tree was constructed using molecular evolutionary genetic analysis MEGA 5 program based on the examination of 841 16S rRNA gene nucleotide positions...... 229 Figure (104): Effect of gamma-radiation doses on the viable count of isolated strain MAM-24...... 231 Figure (105): Proposed pathway of 3-chlorobenzoic acid (3- CBA) degradation by Bacillus mucilaginosus MAM-24 after 24 hours...... 239 Figure (106a): Proposed pathway of degradation of 2,4- dichlorophenol (2,4-DCP) by Bacillus mucilageinosus MAM-24 ...... 243 Figure (106b): Proposed pathway of degradation of 2,4- dichlorophenol (2,4-DCP) by mutant MAM-24 (9)...... 245 Figure (107): Proposed pathway of 1,2,4-trichlorobenzene (1,2,4- TCB) degradation by Bacillus mucilaginosus MAM-24 ...... 249

LIST OF CONTENTS

Title Page No.

• Introduction...... i • Aim of the Work...... ii • Literature Review...... 1-71 1. Spreading of haloaromatic compounds in nature...... 1 2. Health impact of chloroaromatic compounds on human-beings...... 16 3. Petroleum oil contamination ...... 22 4. Microorganisms degrading chloroaromatic compounds...... 28 5. Biodegradation of chloroaromatic compounds ...... 39 6. Mechanisms of chloroaromatic compounds degradation ...... 46 • Materials and methods ...... 72 -87 2.1. Materials...... 72 2.1.1. Sampling sites ...... 72 2.1.2. Sampling...... 72 2.1.3. Media...... 74 2.1.3.1. Low chlorine medium ...... 74 2.1.3.2. Basal salt medium ...... 75 2.1.4. pH determination ...... 76 2.1.5. Protein determination ...... 76 2.1.6. Chloride ion determination ...... 77 2.1.7. Chemicals ...... 77 2.1.8. Source of gamma radiation ...... 78 2.1.9. Bacterial strains ...... 78 2.1.10. High performance liquid chromatography (HPLC)...... 78 2.1.11. Gas chromatographic/mass spectrometry (GC-MS)...... 79 2.2. Methods ...... 80 2.2.1. Cultivation of samples in low chlorine medium ...... 80 2.2.2. Growth of different microbial communities on different chloroaromatic compounds ...... 80

LIST OF CONTENTS (Cont…)

Title Page No.

2.2.3. Determination of the total bacterial and chloroaromatic degrading bacterial count ...... 81 2.2.4. Isolation of different bacterial strains capable of growing on chloroaromatic compounds ...... 81 2.2.5. Screening for the most promising indigenous chloroaromatic degrading bacterial isolates ...... 82 2.2.6. Characterization of the most promising CDB isolates ...... 82 2.2.7. Determination of the best isolate has the ability to degrade different chloroaromatic compounds ...... 82 2.2.8. Effect of gamma irradiation on the viability of the selected isolated bacterial strains ...... 83 2.2.9. Selection of the best mutant has the ability to grow on different chloroaromatic compounds ...... 84 2.2.10. Comparative study between the wild strain and the mutant strain on their degradability of the different chloroaromatic compounds...... 84 2.2.11. Identification of the most promising isolated strain (wild strain) ...... 85 2.2.11.1. Phenotypic characterization of chloroaromatic degrading bacterial strain ...... 85 2.2.11.2. DNA Extraction ...... 85 2.2.11.3. PCR amplification of bacterial 16S-rRNA ...... 86 2.2.11.4. Cloning and sequencing ...... 86 2.2.11.5. Phylogenetic analysis ...... 86 2.2.11.6. Nucleotide sequence accession number ...... 87

• Results and Discussion ...... 88-248 • Summary...... 250-251 • References...... 253-300 • Arabic Summary ...... –––

Introduction

INTRODUCTION

ollution with chloroaromatic compounds is a serious problem. So P microbial metabolism of chloroaromatic compounds has the subject of numerous studies for more than 35 years. One of the main ideas of the last decades was that many manmade compounds, which were introduced in large quantities into the environment, have led to a selection of bacteria with novel characteristics capable of degrading these materials. Especially compounds like chlorinated benzenes, PCBs or other chlorinated aromatics, various herbicides and pesticides, were considered to be substances that bacteria had never encountered before and thus at best metabolized through existing enzyme systems. Organochlorine contamination is usually monitored by measuring levels either in inorganic ecosystem compartments (water, air and sediment) or in biota. The former has the advantage of producing an immediate, geographically localized measure of contamination, while the latter summarizes a variable extent of biotransformation and bioaccumulation processes that the contaminants have undergone during their passage through biological systems, therefore, providing a more realistic view of the contaminant distribution in the environment site (Rissato et al. , 2006). Although there have been numerous reports of aerobic biodegradation of monochlorobenzenes and dichlorobenzenes (diCBz), reports of isolation of bacteria capable of trichlorobenzene (triCBz) degradation are more limited. In addition, to the best of our knowledge, there has been no previous report of the biodegradation of chlorinated aromatic compounds by organisms indigenous to the tropical African environment, even though CBz pollution of most environmental matrices is present in this part of the world. Indeed, most studies that have established biodegradation pathways and kinetics have used isolates obtained in temperate regions of the developed world. It is unlikely, however, that identical xenobiotic degrading bacteria are uniformly distributed around the globe due to differing ambient environmental conditions, soil composition, organic carbon soil inputs, and many other factors (Adebusoye et al ., 2007).

i Aim of the Work

AIM OF THE WORK

So this thesis aimed to cleaning up the environment by efficient, safe and secure manner via

1 Survey for the indigenous bacterial communities that have the ability of growing on different chloroaromatic compounds as a sole carbon and energy source.

2 Determination of the best grown communities on different chloroaromatic compounds.

3 Selection of the most degrading bacteria has the ability to degrade chloroaromatic compounds.

4 Identification of the most promising indigenous isolated strain.

5 Isolation of the hyperproducing mutant for enzyme degrading the chloroaromatic compounds.

6 Evaluation of the most chloroaromatic degraders by analytical method.

ii Literature Review

LITERATURE REVIEW

1 Spreading of Haloaromatic Compounds in Nature:

enobiotic compounds can be defined in a strict or broader sense. X Xenobiotics sensu strictu are defined as manmade molecules, foreign to life and, as such, should have never been encountered by bacterial populations before their introduction by man. Examples are polychlorinated biphenyls (PCBs) and various pesticides. However, structurally related compounds (such as some chlorinated hydrocarbons) have been recently detected in nature, (e.g. as metabolites produced by microorganisms) (Myneni, 2002). Therefore, a broader definition of xenobiotics includes ‘all compounds that are released in any compartment of the environment by the action of man and thereby occur in a concentration that is higher than natural’ (Leisinger, 1983 and Top and Springael, 2003).

Many xenobiotics of environmental importance are halogenated, and halogenation is often implicated as a reason of persistence (Chaudhry and Chapalamadugu, 1991 a and Olaniran et al ., 2001).

Halogens are distributed in soils and waters mostly as inorganic compounds, while more than 200 naturally occurring chloroaromatics were identified in mammals, invertebrates, plants, algae, fungi, and bacteria. After the Second World War, synthetic compounds carrying halogen substituents, largely used as solvents, pesticides, lubricants, hydraulic fluids etc., were released in the environment (Baggi, 2002).

1 Literature Review

Large amounts of halogenated organic compounds are released continuously into the environment, owing to their extensive employment as solvents, herbicides, fungicides, insecticides, pharmaceuticals, etc. (Häggblom, 1990; Chaudhry and Chapalamadugu, 1991b and Solyanikova and Golovleva, 2004). Additionally, many halogenated hydrocarbons are produced as intermediates and byproducts during chemical synthesis as well as throughout natural biosynthesis by a large number of different organisms (Gribble, 1996 and Ferraroni et al ., 2006).

The occurrence of halogenated organic compounds measured as a sum parameter and the evidence of chlorinated benzoic acids in four carbonaceous meteorites (Cold Bokkeveld, Murray, Murchison and Orgueil) from four independent fall events is reported. After AOX (Adsorbable organic halogen) and EOX (Extractable organic halogen) screening to quantify organically bound halogens, chlorinated organic compounds were analyzed by gas chromatography. AOX concentrations varying from 124 to 209 g Cl/g d.w. were observed in carbonaceous meteorites. Their presence and concentrations raise the question concerning the origin of halogenated, especially chlorinated, organic compounds in primitive planetary matter (Schöler et al ., 2005).

The Pulp and paper industry is typically associated with pollutional problems related to high Biochemical Oxygen Demand (BOD), Chemical Oxygen Demand (COD), toxicity, AOX (adsorbable organicallybound halogens), color, suspended solids, lignin and its derivatives and chlorinated compounds. Although numerous studies have looked at ways to remove COD, BOD, color etc. of pulp and paper effluents, the problem still persists (Tiku et al ., 2010).

Organochlorines are the most successful, profitably utilized and commercialized group of pesticides. They have gained huge popularity 2 Literature Review and prominence in a short span of time by virtue of their ability to control almost all kinds of pests including insect, fungi, rodent, etc. The toxicity of an individual pesticide to the pests is predominantly determined by its structure, the different moieties attached to parent compound, their spatial arrangements within molecule, nature of substituents, polarity, symmetry and asymmetry of molecules, the solubility and sorption values (Kaushik and Kaushik, 2007).

Pesticides are the only chemicals deliberately made to be toxic and introduced directly into the environment. Pesticides can be absorbed through the skin, swallowed or inhaled. During application pesticides drift and settle on ponds, laundry, toys, pools and furniture. Only 5% of pesticides reach the target organism. The rest runs off into water or dissipates in the soil or air. Drift from landscape application ranges from 12 ft to 14.5 miles (Rea, 1996). More serious effects appear to be produced by direct inhalation of pesticide sprays than by absorption or ingestion of toxins (Lowengart et al., 1987 and DavilaVazquez et al., 2005).

The use of pesticides has increased since the end of the Second World War. These compounds can be classified on the basis of their chemical structure or the action they perform. Pesticides are mainly used in agriculture (68%), in commercial and industrial activities (17%), domestically (8%) and in governmental applications (7%) (Cantoni and Comi, 1997 and AbouArab, 2002).

The use of DDT and other chlorinated hydrocarbon insecticides increased in the fifties of 20th century due to their effectiveness against a wide range of insect pests, residual activity, and relatively low mammalian toxicity. More recently the use of many of these insecticides has become limited due to their persistence in biological systems. Included in the 3 Literature Review chlorinated hydrocarbon insecticide group are DDT (dichlorodiphenyl trichloroethane), methoxychlor, aldrin, dieldrin, chlordane, toxaphene, endrin, heptachlor, and lindane (gamma isomer of benzene hexachloride (BHC)). These are trade names for closely related hydrocarbon compounds to which several chlorine atoms have been joined. Halflives of 9–116 years for the degradation process of these compounds could be demonstrated at a temperature of 200°C in the soil (UBA Umweltbundesamt, 1992, 1993 and Hung and Thiemann, 2002).

Chlorinated pesticides such as HCH and DDT are effective pest control chemicals, used in agriculture and public health activities (malaria eradication, vectors, etc.) worldwide for the past decades and are still in use in many developing countries (Rissato et al ., 2006). Chlorinated pesticides are still employed in some Third World countries. In Vietnam, a prohibition of these pesticides was first issued in 1993. Since then the contamination of these compounds in different environmental compartments has been studied. In Germany, even more than 25 years after being prohibited, derivatives of DDT, including DDD (1,1dichlor2, 2bis(4chlorphenyl) ethane), DDE (1,1dichlor2,2 bis(4 chlorphenyl) ethylene), DDA (1,1dichlor2, 2bis(4chlorphenyl) acetic acid) were detected and identified in canal waters (Duennbier et al ., 1997 and Heberer and Duennbier, 1999). In America (USA, Nicaragua), Europe (Germany, Russian Federation), Africa (Egypt) as well as in Asia (China), the presence of these pesticides in surface waters, sediment and suspended solids have been investigated in detail (Castilho et al ., 2000; Jiang et al ., 2000; Samia et al ., 2000; Zhulidov et al ., 2000 and Hung and Thiemann, 2002).

PCBs were banned from the U.S. in 1977, our biosphere contains approximately 7.5 x 10 8 kg of released PCBs (Borja et al ., 2005 and De et al ., 2006). It is recognized that longterm exposure to PCBs can provoke toxic effects in humans and wildlife (IARC, 1997 and Li, 2007). In

4 Literature Review addition, PCBs have been identified as potential endocrine disruptors, resulting in renewed research interest (Oskam et al ., 2005; Decastro et al ., 2006 and Sobiecka et al ., 2009).

Fifteen insecticides, which were banned in Vietnam in the period from 1990 to 1998, were chosen for the investigation of surface water samples in Hanoi and its surroundings. The results showed that the contamination of the banned pesticides was highest in the rivers and then in the irrigation canals, followed by the lakes and wells (Hung and Thiemann, 2002).

From the 1950s to 1983 China has produced and consumed large amounts of organochlorine pesticides with production levels of technical hexachlorocyclohexanes (HCHs) being 4 million tons and DDTs being 0.27 million tons (Hua and Shan, 1996; Li et al ., 1998, 1999, 2001 and Fang et al ., 2006).

A field study was conducted in the Taihu Lake region, China in 2004 to reveal the organochlorine pesticide concentrations in soils after the ban of these substances in the year 1983. Thirteen organochlorine pesticides (OCPs) were analyzed in soils from paddy field, tree land and fallow land. Total organochlorine pesticide residues were higher in agricultural soils than in uncultivated fallow land soils. Among all the pesticides, Σ DDX (DDD, DDE and DDT) had the highest concentration for all the soil samples (Fang et al ., 2007).

The occurrence of 43 semivolatile organic compounds (SVOCs) listed as priority pollutants by both China and the United States Environmental Protection Agency, in sewage sludges collected from eleven wastewater treatment plants (WWTPs) of mainland and Hong Kong, China. Thirtysix SVOCs were detected by gas chromatography

5 Literature Review coupled with mass spectrometer (GCMS) and at least 14 in each sample including chlorobenzene (Cai et al ., 2007).

Concentrations of HCH (hexachlorocyclohexane) and DDT (Dichlorodiphenyltrichloroethane) were determined in shallow subsurface (5–30 cm depth) and deep soil layers (150–180 cm depth) from the outskirts of Beijing, China (Zhu et al ., 2005).

The most important pollutants among the toxicants in India are organochlorine and organophosphorus pesticides. For the past several decades, organochlorine pesticides have been widely used for both agricultural and public health purposes, but there is always a tendency to use them in excess. The organochlorine pesticides build up in the environment since they are not at all biodegradable, or are degraded very slowly (Lal and Saxena, 1982; Viswanathan, 1985; Fleming et al., 1999; Nawab et al ., 2003; Bhanti et al., 2004 and Sarkar et al., 2008).

Soil samples were taken from different agricultural fields and analyzed for organochlorine pesticide residues by gas chromatography. The analysis indicated that the soil samples contained some common organochlorine pesticides DDT, DDD, DDE, HCH and Aldrin. γHCH was detected as 47.35 ppb whereas the concentrations of αHCH, βHCH, p,p´DDE, o,p´DDT were 38.81, 1.79, 7.10 and 13.30 ppb, respectively, in the same soil (Nawab et al ., 2003).

Historically, South America is regarded as the continent in which DDT, besides toxaphene and lindane, was heavily used. The impact of residues of highly persistent organochlorine pesticides on environment is particularly interesting. The pesticides applied to the crops, eventually find their way to the aquatic environment, thus contaminating it. These are transported to aquatic bodies by rain runoff, rivers and streams and

6 Literature Review associated with biotic and abiotic macroparticles (Colombo et al ., 1990 and Rissato et al ., 2006).

In Brazil, as elsewhere, organochlorine pesticides (OCPs) were used to control pests and thus improved crop yields during the 1970s. Included in the group of OCP pesticides were DDT, HCH, heptachlor, aldrin, dieldrin and endrin, among which DDT and HCH were the most extensively used. Although their use has been discontinued in Brazil since 1985, their persistence has left residual amounts in the soil in many areas (Rodrigues, 1997 and D’amato et al., 2002). At present, the use of DDT is still allowed in public health programs, to combat etiological vectors (malarial and leishmaniasis) and emergence agricultural use as well. Detailed analyses of persistent organic pollutants (POPs) such as organochlorine pesticides (OCPs), hexachlorocyclohexane (HCH) isomers (HCHs), dichlorodiphenyl trichloroethane (DDT) and its metabolites (DDTs) and congeners of polychlorinated biphenyls (PCBs) in soil and surface water from the northeastern São Paulo, Brazil allowed the evaluation of the contamination status, distribution and possible pollution sources. Overall elevated levels of DDT and PCB were recorded in a site very close to melting, automotive batteries industries, and agricultural practice regions. High ratios of metabolites of DDT to DDT isomers revealed the recent use of DDT in this environment. The sources of contamination are closely related to human activities, such as domestic and industrial discharge, street runoff, agricultural pesticides and soil erosion, due to deforestation as well as atmospheric transport (Rissato et al ., 2006).

Between 1997 and 2001, in an attempt to evaluate the contamination level of a Portuguese population, organochlorine pesticide residues were evaluated in human serum from students of the University of Coimbra. Concentrations of selected organochlorine pollutants showed

7 Literature Review that it is among the highest levels of contamination, when compared with others from Europe, Asia, and America (Lino and Silveira, 2006).

Pesticide residues were determined in Egyptian spices and medicinal plants. For this purpose, a total of 303 samples, which represent 20 different plants were collected from sources in Egypt and several shipments. All the collected samples were analyzed for the determination of organophosphorus and organochlorine residues. Residues of lindane, aldrin, dieldrin, DDT, chlordane and endrin in chamomile samples exceeded the maximum permissible levels (MPLs). Residues of aldrin and dieldrin in karkade were higher than the MPLs, as was chlordane in peppermint. Residues were not detected in the watery extract when the medicinal plant was boiled in water. Also, immersing the plants in hot water transferred some pesticide residues to the aqueous extract. To control pesticide residues in food, many countries restricted the use of organochlorine pesticides, mainly in food applications, because of their long persistence (AbouArab and Abou Donia, 2001).

A novel analytical approach to determine trace levels of 20 organochlorine pesticides (OCPs) in nine vegetable matrices (lettuce, spinach, green bean, green pepper, tomato, broccoli, potato, carrot and onion) is proposed, based on stir bar sorptive extraction followed by liquid desorption and large volume injectiongas chromatography coupled to mass spectrometry using the selectedion monitoring mode acquisition (SBSELD/LVIGCMS (SIM)) (BarriadaPereira et al., 2010).

With mounting evidence, indicating the longrange transport potential of these substances to regions where they have never been used or produced and the consequent threats they pose to the environment, the international community has called for urgent global actions to reduce and eliminate their release into the environment (Burger et al ., 2001). 8 Literature Review

Specifically, one of the key environmental concerns, regarding some POPs, is their occurrence in Polar Regions, at surprisingly high levels (Rissato et al ., 2006).

Hexachlorocyclohexanes (HCHs) were the most predominant in the Arctic surface water body with sum of their concentrations ranging from 0.262 to 3.156 ng L 1 (Qiu and Cai, 2010).

Since then, PCBs were found everywhere, including polar regions, both Arctic and Antarctic. In industrial countries, the contamination originates from inadequate disposal and leaks from equipment. In remote areas where PCBs were not used, the contamination resulted from atmospheric transport (Montone et al ., 2001 and Macková et al ., 2007).

Atmospheric transport is a primary route for transporting persistent organic pollutants (POPs) such as polychlorinated dioxins, PCBs, and DDTs (Wania and Mackay, 1993; Bawden et al ., 2004 and Shen et al ., 2005). POPs can be emitted by many sources, including pesticide applications, uncontrolled combustion (including the open waste burning that is prevalent throughout much of Africa), and volatilization from residues present in soils. Despite the existence of numerous sources and continuing use, information regarding emissions and airborne concentrations of organochlorine pesticides in Africa are extremely limited (Batterman et al ., 2008).

Pesticide leaching to groundwater (Johnson et al ., 2001) represents a severe problem especially in cases where groundwater is a drinking water source due to the very low potential for microbial pesticide degradation of such surface and groundwater sources (Mouvet et al ., 1997; Johnson et al ., 2000 and Grundmann et al ., 2007).

9 Literature Review

Porous aquifers are a vital resource for drinking water, but nowadays subject to multiple threats such as the impact by various kinds of contaminations (Danielopol et al ., 2003). The fate of contaminants in aquifers has been the focus of hydrogeological, geochemical and microbiological research for the last three decades (Bauer et al ., 2009).

Given that organic contaminants in the wastewater tend to sorb on the suspended solids, sewage sludges usually contain significant concentrations of many classes of organic contaminants. Over 300 chemicals from a diverse range of classes of compounds have been identified in sewage sludge. Their concentrations vary from the pg kg _1 to g kg _1 range, depending on the type of wastewater that the wastewater treatment plants (WWTPs) receive (domestic, municipal, or industrial, etc.) (Jacobs et al ., 1987 and Smith, 1996, 2000). The most frequently detected contaminants are monocyclic aromatics, polycyclic aromatic hydrocarbons (PAHs), polychlorinated biphenyls (PCBs), phthalic acid esters (PAEs), polychlorinated dibenzopdioxins and furans (PCDD/Fs), organochlorinated pesticides, chlorobenzenes (CBs), amines, nitrosamines, phenols (Jacobs et al ., 1987; Wang et al ., 1995; Webber et al ., 1996; Smith, 1996, 2000; Manoli and Samara, 1999; Perez et al ., 2001; Fromme et al ., 2002; Stevens et al ., 2003; Durand et al ., 2004; Katsoyiannis and Samara, 2004, 2005; Abad et al ., 2005; Amir et al ., 2005; Gibson et al ., 2005; Oliver et al ., 2005; Katsoyiannis, 2006; Busetti et al ., 2006; Harrison et al ., 2006; Villar et al ., 2006; Dai et al ., 2007and Cai et al ., 2007).

Pesticides are typically applied as mixtures and or sequentially to soil and plants during crop production. A common scenario is herbicide application at planting followed by sequential fungicide applications post emergence. Fungicides depending on their spectrum of activity may alter and impact soil microbial communities. Thus there is a potential to impact

10 Literature Review soil processes responsible for herbicide degradation. This may change herbicide efficacy and environmental fate characteristics (White et al., 2010).

Pesticide residues in crude herbal materials indicate that the presence of chlorinated pesticide residues is quite common. DDT and its derivatives, γHCH and other HCH isomers, HCB, and cyclodiene derivatives such as aldrin, dieldrin, heptachlor and its epoxide were reported to occur in these plants (Ali, 1983; Schilcher, 1985; Benecke et al ., 1986, 1988; Kwon et al ., 1986 and Pluta, 1988). In addition, polychlorinated biphenyls have been reported to occur in raw herbal materials as a result of general environmental pollution (Benecke et al ., 1988 and AbouArab and AbouDonia, 2001).

The widespread presence of organochlorine pesticide residues (OCPs) in food has arisen from their extensive agricultural application and industrial emission in the environment. Many toxic organopollutants such as lindane and heptachlor persist in the environment and tend to accumulate in the body fat of animals occupying a higher trophic level (Addison et al ., 1984 and AbouArab, 2002).

The ability of organochlorine pesticides (OCPs) to persist in the environment and accumulate in food chain and their potential to elicit toxic effects led to the cancellation of their production in many countries during the 1970s and 1990s (Li et al ., 1999, 2001). However, OCPs are still routinely found in soil, water, air and even foodstuff in many countries (Aigner et al ., 1998; Falandysz et al ., 2001; Ribes and Grimalt, 2002; Miglioranza et al ., 2003; Gong et al ., 2004; Barriada Pereira et al ., 2005; ConchaGraña et al ., 2006 and Fang et al ., 2007).

11 Literature Review

The contamination of feeding materials results in the accumulation of persistent pesticides in the animal. Residues of OCPs have been found in meat and meat products (Cantoni et al ., 1991; Arino et al ., 1992, 1993, 1995; Hernandez et al ., 1994; Herrera et al ., 1994; Gallo et al ., 1996 and ElKadi, 2000) at different levels depending on the type of pesticide and meat. Therefore, the technological procedures in food production should be developed to reduce the public health risk of hazardous pesticides in meat products (AbouArab, 2002).

Chlorobenzenes (CBs) are a priority environmental pollutant listed by the US Environmental Protection Agency and are used mainly as intermediates in the synthesis of pesticides and other chemicals. Chlorobenzenes are released to the environment during manufacture or use as intermediates in the production of other chemicals. They are also released during the disposal of chlorobenzene products, such as from incinerators and hazardous waste sites. Chlorobenzene is released directly to the environment due to its use as a pesticide carrier, and is also released this way through its use in deodorizers, fumigants, degreasers, insecticides, herbicides, and defoliants. CB is used in the production of phenol and nitrochlorobenzene (isomers), in the formulation of herbicides, to produce additional chlorobenzenes, and as a solvent in the manufacture of adhesives, paints, resins, dyestuffs, drugs and the production of diphenyl oxide, phenylphenol, silicone resin, and other halogenated organics (Guerin, 2008).

Chlorinated benzenes (CBz), with 12 possible isomers, are common and widespread environmental pollutants with reports of contamination in coastal marine sediments, freshwater lake sediments, sewage sludge, wastewater, groundwater, rivers and estuaries, and soils (Oltmanns et al ., 1988; Boyd et al ., 1997 and Wu et al ., 2002). They

12 Literature Review have been widely used in industrial, agricultural and domestic products such as pesticides, soil fumigants, disinfectants, toilet deodorants, solvents, and precursors for the production of dyes and silicone coatings (Golden et al ., 1993 and Fetzner, 1998). As a result of their persistence, toxicity, and bioaccumulation potential, the production, use and discharge of CBz are subject to regulation in most developed countries. Unfortunately, partly due to limited economic resources, these compounds are not subject of any regulation in most African countries. Consequently, unrestricted use, accidental release and illegal discharge into the environment often continue unabatedly (Adebusoye et al ., 2007).

Chlorobenzenes (CBs) are important basic materials and additives in the production of pesticides, dyes, pharmaceuticals, disinfectants, rubbers, plastics, and electric goods (Beck, 1986; Rapp, 2001 and Zhang et al ., 2005). Their occurrence in the environment is widespread and they were found in the atmosphere (Popp et al ., 2000), water (Monferrán et al ., 2005), soil (Wang et al ., 1995 and Zolezzi et al ., 2005), sediments (Lee et al ., 2005), vegetables (Wang and Jones, 1994 and Zhang et al ., 2005), and biota (Vorkamp et al ., 2004). Since CBs can be accumulated in the food chain (Wang and Jones, 1994 and Zhang et al ., 2005), the elimination of these pollutants from the environment and from polluted sites is of great public interest (Wang et al ., 2007).

1,2,4Trichlorobenzene (1,2,4TCB) is one of the most widely used chlorobenzenes. Due to its use as a dye carrier, pesticide intermediate, heattransfer medium, dielectric fluid in transformers, degreaser, lubricant and solvent in chemical manufacturing it has become a ubiquitous environmental pollutant (Schroll et al ., 2004). They focused on 1,2,4 trichlorobenzene as this compound is one of the most widely used

13 Literature Review chlorobenzenes and also represents a possible intermediate product in the HCB degradation pathway (Brahushi et al ., 2004 and Wang et al ., 2007).

It was found that, 4chlorobenzoic acid, 3bromobenzoic acid, 4 bromobenzoic acid, possess much higher risks to the aquatic organisms as compared to the other benzoic acids. These data are useful for risk assessment and protection of the aquatic environments, because such information is not available in the existing toxicological databases. The toxicity of halogenated benzoic acids was found to be directly related to the compound’s hydrophobicity (the logarithm of the 1octanol/water partition coefficient, log Kow) (Lee and Chen, 2009).

Among pollutants in the environment, chlorophenols are of great concern, because they are widespread, resistant and even found in the groundwater (Jensen, 1996). In general, their concentrations in contaminated soils range between 0.1 and 10 mg/kg (Jensen, 1996), but in highly contaminated areas, as for example an abandoned site near Bitterfeld (Germany), concentrations up to 50 mg/l have been measured in the groundwater (Dermietzel and Vieth, 2002 and Witthuhn et al ., 2005).

Chlorophenols are released in the environment from direct use, accidental spillage, or degradation of other substances. Therefore, they are commonly detected in soil, sediments, surface water, and wastewater and cause severe environmental problems (Czaplicka, 2004; PeraTitus et al ., 2004 and Tamer et al. , 2006).

Chlorinated phenolic compounds constitute an important class of pollutants because of their widespread use in industry (e.g., pulp and paper) and their toxicity and persistence in the environment (Häggblom, 1990). Chlorophenols have found a number of applications as wood preservers, pesticides, and biocides. Monochlorophenols can be formed

14 Literature Review during wastewater chlorination, and as a result of the breakdown of pesticides and chlorinated aromatic compounds (Pritchard et al ., 1987).

Chlorophenols can easily migrate within different aqueous environments and contaminate groundwaters (Smith and Novak, 1987), since their solubility in water is relatively high (Armenante et al ., 1999).

2,4Dichlorophenol (2,4DCP) is used for the production of germicides and soil sterilazants and also in the manufacture of methylated chlorophenols, that are used in antiseptics and disinfectants. US Environmental Protection Agency includes 2,4DCP together with other chlorophenols among 129 priority pollutants in 65 classes (Vroumsia et al ., 2005 and Ziagova and LiakopoulouKyriakides, 2007a).

Polychlorinated biphenyls are a large group of recalcitrant chlorinated pollutants. Commercial PCB products are mixtures of 50 or more PCB congeners, whereas as many as 209 different PCB congeners (containing 1 to 10 chlorines in the molecule) may theoretically arise. PCB mixtures have been used for a variety of applications, including common additives in paints, plastics and insulating fluids. Due to their remarkable stability, they persist in the environment decades after their production was halted (Martínková et al ., 2009).

15 Literature Review

2 Health Impact of Chloroaromatic Compounds on Human Beings:

The contamination of soil with aromatic compounds is of particular environmental concern as they exhibit carcinogenic and mutagenic properties (Mrozik and PiotrowskaSeget, 2010).

The ubiquitous distribution of chlorinated aromatic compounds in the biosphere has caused public concern over the possible effects on the quality of life. Chlorobenzenes are lipophilic compounds, chemically stable in nature, resistant to photodegradation (Thompson et al ., 1999 and Ziagova and LiakopoulouKyriakides, 2007b). Lipophylicity and the high chemical stability makes them accumulate in living organisms and persists in fat tissues and in fat rich organs for life (Silvestroni and Palleschi, 1999 and Pant et al ., 2007).

The worldwide application of organochlorine pesticides is a health problem (Hung and Thiemann, 2002). Some developing countries are still using these compounds because of their low cost and versatility in industry and agriculture for sanitation purpose (Tanabe et al ., 1994). Consequently, environmental problems associated with toxic contaminants in these countries are of great concern. It is reported that approximately three million people are poisoned and 200,000 died each year around the world from pesticide poisoning, and a majority of them belongs to the developing countries (WHO, 1990 and FAO, 2000). It is also believed that in developing countries, the incidence of pesticide poisoning may even be greater than reported due to underreporting, lack of data and misdiagnosis (Forget, 1991 and Sarkar et al ., 2008).

Persistent organic pollutants (POPs) circulate globally via the atmosphere, oceans, and other pathways, so when they released in one part 16 Literature Review of the world, they can travel to regions far from their source of origin (Rissato et al ., 2006).

Unfortunately, chlorophenols are highly toxic and tend to persist in the environment, which is why they have been listed as priority pollutants by the US EPA and the EU (PeraTitus et al ., 2004 and Tamer et al., 2006).

Pesticides are indispensable input for food production and health safeguards for the welfare of the people; however, literature survey indicates that its indiscriminate use has harmed human health and environment (Pant et al ., 2004).

The high chemical stability of PCBs explains their persistence in the environment. Their low water solubility results in their accumulation in the biota (in fats) and their concentration in the food chain. Toxicological studies of PCBs are complex, because they should take into account numerous different molecules with possible synergic effects, studies suggest toxic and carcinogenic properties, particularly for co planar congeners (Faroon et al ., 2001; Golden et al ., 2003 and Macková et al ., 2007).

The two organochlorines DDT and HCH persist in the environment, concentrate in the crops, continue to be detected in the food chain (Nigam and Siddiqui, 2001), accumulate in human tissues and fluid due to their lipophilic nature, and are excreted in breast milk (Snedekers, 2001 and Siddiqui et al ., 1996, 2002, 2005).

Recently, many epidemiological studies have suggested that exposure to persistent organic pollutants may increase the risk of: endocrine disruption by interference with estrogen metabolism.–elevation of the amount of

17 Literature Review bioavailable estradiol, or –synergistic effects on estrogen responsive genes. – cause hypofertility in man (decrease in semen quality, sperm count, penis size) and woman. –cause Cryptorchidism (undescended testicles). –cause carcinogenesis in man (prostate, testis) and woman (breast, ovary). –cause immunological perturbations and neurological effects. –impaired ability to respond to pituitary gonadotropin signaling secondary to direct testicular toxicity in utero (Charlier et al ., 2003).

The exposure to some organochlorine compounds is strongly related to environmental contamination, such as diet (Cruz et al. , 2003). Nowadays, pesticide blood levels are considered a good indicator of pesticide body burden, since correlations between the concentrations of pesticides in blood and fat have been established, even in case of non occupationally exposed individuals (Radomski et al ., 1971). Some organochlorine pesticide residues are considered endocrine disrupters (Vinggaard et al ., 1999; Amaral Mendes, 2002; Calle et al., 2002 and Brody and Rudel, 2003). p,p´DDE being reported as an androgen antagonist, and p,p´DDT and βHCH showing estrogenic effects (Kunisue et al ., 2004). Their presence in biological fluids is related to sexual precocity (KrstevskaKonstantinova et al ., 2001), increased risk of breast cancer (Wolff et al ., 2000; Frías et al ., 2001; Hoyer et al ., 2001; Ahmed et al ., 2002; Iscan et al ., 2002; Muscat et al ., 2003 and O’Leary et al ., 2004), alterations in the reproductive process of women (Saxena et al., 1981; Korrick et al ., 2001 and TorresArreola et al ., 2003), lower birth weight (Gladen et al ., 2003) and smaller head circumference in newborns, diminution of cognitive functioning in young children, lowering of the pharmacological effects of some drugs (Lino and Silveira, 1998 and Garry, 2004), colorectal cancer (Soliman et al ., 1997), decrease of the quantity and quality of human semen during the last 50 years, and incidence of testicular cancer and cryptorchidism in men in

18 Literature Review industrialized countries (Sonnenschein et al ., 1995 and Soto et al ., 1998). High levels of some organochlorine (OC) pesticides in blood associated with hypothyroidism in women are also referred to (Rathore et al., 2002 and Lino and Silveira, 2006).

The mammalian metabolism of organohalides transform these compounds to more reactive and toxic intermediates and products which cause modification of DNA that lead to birth defects or cancer (Wackett, 1995).

The exogenous estrogenic compounds such as DDT can affect estradiol metabolism by enhancing the formation of the genotoxic metabolite 16αhydroxyestrone, which would increase breast cancer risk by stimulating breast cell proliferation, increasing unscheduled DNA synthesis oncogene and virus expression to induce or promote breast cancer (bad estrogen) (Davis et al., 1993 and Bradlow et al ., 1995).

Chlorinated hydrocarbons act by altering the electrophysiological and associated enzymatic properties of nerve cell membranes. Hence, causing change in the kinetics of Na + and K + ion flow through the membrane. It has been stated that the disturbances in calcium transport of Ca 2+ATPase activity as well as phosphokinase activities may also be involved (Hayes and Laws, 1991). The cyclodiene compounds antagonize the action of the neurotransmitter gammaaminobutyric acid (GABA), which induces the uptake of chloride ions by neurons. The blockage of this activity by cyclodiene insecticides results in the partial repolarization of the neuron and creates uncontrolled excitation of neuron (Klaassen and Watkins, 1999 and Kaushik and Kaushik, 2007).

Many studies demonstrate numerous immunotoxic effects following exposure to polychlorinated biphenyls, including dose dependent decreases in antibody response to SRBC (both IgM and IgG), alterations in Tcell subsets,

19 Literature Review increases in Tsuppressor/cytotoxic (CD8) cells, and a reduction in relative numbers of Thelper/inducer (CD4) cells and in the CD4:CD8 ratio, and increased total serum complement activity (Tryphonas, 1994).

Various cognitive and behavioral effects (including decrease motor coordination and muscle tone, weak reflexes and slower reaction times) have been observed in children exposed in utero to high levels of heat degraded PCBs following the YuCheng poisoning incident (Golden et al ., 1998).

The lipidrich tissues, such as adipose tissue, act as depots or reservoirs of persistent, chemical substances by virtue of physicochemical interactions of cellular components. The analysis of human lipidrich compartments, such as adipose tissue and blood serum lipids, reflect the rate of environmental exposure and provide data that permit the quantitative evaluation of organochlorine pesticide hazards associated with health risk for humans (Waliszewski et al ., 2003).

Recently, discussions have concerned the link of ogranochlorine pesticides to breast cancer. To establish the role of these compounds in the development of breast cancer, the study was done by analyzing human serum levels and the extent of their accumulation in the adipose tissue. (Aronson et al ., 2000; Safe, 2000; Woolcott et al ., 2001; O’Leary et al ., 2004 ; Reynolds et al ., 2004 and Siddiqui et al., 2005).

HCH and DDT residues have been reported in placenta, cord blood and umbilical cord (Raizada, 1996 and Siddiqui et al ., 2002, 2003). Epidemiological studies conducted on occupational pesticide workers have shown that exposure to dibromochloropropane (DBCP), chlordecone, endosulfan, ethyldibromide, DDT, carbaryl, ethylmethiniphos causes abortion, still births, defects in offspring, male infertility, neonatal deaths, congenital defects, testicular dysfunction and abnormalities (Kumar et al ., 2000).

20 Literature Review

Environmental exposure to chlorinated hydrocarbons has been associated with an increased rate of miscarriages. In Chinese textile workers, a potential increased risk of spontaneous abortion has been associated with maternal serum DDE levels and other investigators speculated that the antiandrogen activity of pp´DDE might mitigate harmful androgen effects on the ovary during gestation/early life (Hruska et al. , 2000; Korrick et al ., 2001 ; Cohn et al ., 2003 and Pant et al ., 2004).

DDT induces DNA damage in blood cells in women chronically exposed to this insecticide (Yáñez et al ., 2004 ) and induced apoptosis in human mononuclear cells in vitro and is associated with increased apoptosis in exposed children (PérezMaldonado et al ., 2004).

Several studies suggest that prenatal exposure to PCBs may be related to adverse effects on neurological development such as deficits in shortterm memory function at 4 years of age and reduced muscle tone and reflexes in the first week (Ragon et al ., 1986; Gladen et al ., 1988 and Jacobson et al ., 1990 a,b) .

Milk samples of women from the general population of the same city showed the calculated daily intake of DDT and HCH by the neonates exceeding the acceptable daily intake (ADI) set by the WHO. Besides this, exposure of pregnant women to organochlorine pesticides might increase the risk of intrauterine growth retardation, which is a contributing factor for infant mortality in India (Siddiqui et al ., 2002, 2003 and Pant et al. , 2007).

In recent years, publications related to an apparent decline in male sperm quality have led to a controversial discussion whether environmental pollutants in general and chlorinated hydrocarbons and heavy metals in particular may impair male infertility (Pflieger and Schill, 2000 and Pant et al., 2004). In India, cotton field workers exposed

21 Literature Review to various pesticides had an increase risk for male infertility and male mediated adverse reproductive outcome such as abortions, stillbirths, neonatal deaths and congenital defects (Rupa et al ., 1991). DDT and its metabolites, HCH and its isomers, polychlorinated biphenyls have been detected in seminal fluid, cervical mucus and follicular fluid (Dougherty et al ., 1980; Waliszewski and Szymaynski, 1983; Talamanca et al ., 2001 and Pant et al ., 2007).

In vitro study has shown that lindane depolarizes human sperm membrane and inhibits the sperm cytological responsiveness to progesterone, the physiological agonist that stimulates the onset of acrosome reaction at the site of fertilization (Silvestroni and Palleschi, 1999 and Pant et al ., 2007).

3 Petroleum Oil Contamination:

Toxic petroleum hydrocarbons are hazardous for soil flora and fauna as well as for humans (Greenwood et al ., 2009).

Contamination of soils by crude oil and other related products has become a worldwide problem. Crude oil hydrocarbons may be released to soil as a result of accidental spillage (e.g., pipeline ruptures, tank failures) or aerial deposition of partially combusted oil particles (Wang and Bartha, 1990). Both may often be largescale events (AlDaher et al ., 2001). Oily wastes may also be deliberately spread on soil under controlled conditions, such as in landfarming (Chaîneau et al ., 1996). Crude oil is physically, chemically and biologically harmful to soil because it contains many toxic compounds in relatively high concentrations (e.g., polycyclic aromatic hydrocarbons, benzene and its substituted, cycloalkane rings). The fate and effects of spilled crude oil and petroleum products in soils has already been the subject of several

22 Literature Review studies (Atlas, 1977; Leahy and Colwell, 1990; Lee et al ., 1993 and Walworth and Reynolds, 1995). Soils contaminated with crude oil fail to support plant growth and are a source of ground water contamination (Wang and Bartha, 1990). Soils contaminated by crude oil spills in Kuwait, during the Gulf war, have been classified as slightly polluted when contaminated with up to 3% crude oil and heavily polluted from 6% to 8% (AlAwadhi et al ., 1996 and Franco et al ., 2004).

Oil pollution accidents are nowadays become a common phenomenon and have caused ecological and social catastrophes (Shaw, 1992; Burger, 1993 and Burns et al ., 1993). Apart from accidental contamination of ecosystem, the vast amounts of oil sludge’s generated in refineries from water oil separation systems and accumulation of waste oily materials in crude oil storage tank’s bottoms pose severe problem because many of the standard treatment processes used to decontaminate soil and groundwater have been limited in their application, are prohibitively expensive, or may be only partially effective (Nicholas, 1987; Ferrari et al., 1996 and Vasudevan and Rajaram, 2001). Therefore, despite decades of research, successful bioremediation of petroleum hydrocarbon contaminated soil remains a challenge (Rahman et al ., 2003 and Das and Mukherjee, 2007).

Severe subsurface pollution of soils and water can occur via the leakage of underground storage tanks and pipelines, spills at production wells and distribution terminals, and seepage from gasworks sites during coke production, contributing as a major organic contamination to the natural environment (von der Weid et al ., 2007).

The largest spill in the Antarctic occurred when the Bahia Parisio ran aground on the Antarctic peninsula spilling 680000 liter of diesel into Arthur Harbour near Palmer Station (Kennicutt, 1990). Marine spills of 23 Literature Review this type cause immediate ecological impacts on many trophic levels. Terrestrial spills however, can continue to impact on the marine ecosystem for decades after the initial spill as contaminants continue to leach into adjacent marine environments (Powell et al ., 2005).

The Yellow River Delta is an important region of petroleum production in China with a wide distribution of oil wells. Many of the delta soils have been inadvertently contaminated by oil during crude oil extraction and processing (such as oil well blowouts and oil pipe leaks). Because of long term crude oil exploitation, petroleum hydrocarbon pollution causes severe environmental disturbance in the Yellow River Delta. However, no effective remediation technology has been proven in this region and few systematic studies of remediation of these soils have been reported (ZhenYu et al ., 2008).

Nigerian Niger delta has for long suffered very serious problems of pollution especially from crude oil exploration, without appropriate remediation efforts to clean up the mess (Olaniran et al ., 2001).

Naturally existing compounds of environmental concern are primarily pollutants originating from coal or crude oil. As an example, cyanides, phenols, polycyclic aromatic compounds or long chain aliphatics may be hazardous and, particularly if accidentally or deliberately released by the processing industry, they exhibit acute or chronic toxicity. Therefore, a major goal of environmental biotechnology is to establish highly efficient biological processes that use the naturally existing catabolic potential for the elimination and detoxification of these chemicals (Rieger et al ., 2002).

Fuel oils are commonly used in many areas. Despite a large improvement in handling, transportation and containment they still enter

24 Literature Review water and soil environments. The most serious damage to natural ecosystems was reported after accidental releases (Chaineau et al ., 2005). Oils are a mixture of simple and complex, aliphatic or aromatic hydrocarbons which are toxic to humans, plants and animals (Van Hamme and Ward, 2001 and Szewczyk and Dlugoński, 2009).

Among hydrocarbon pollutants, diesel oil is a complex mixture of alkanes and aromatic compounds that frequently are reported as soil contaminants leaking from storage tanks and pipelines or released in accidental spills (Gallego et al ., 2001 and Bento et al ., 2005).

Soils contaminated with diesel oil in the field were collected from Long Beach, California, USA and Hong Kong, China. In this study they evaluated all three technologies (natural attenuation, or treated by biostimulation or bioaugmentation) on the degradation of total petroleum hydrocarbons (TPH) in soil (Bento et al ., 2005).

Petroleum products consist mostly of hydrocarbons, such as long chained alkanes and aromatic compounds, for which there is extensive evidence of microbial degradation (Atlas, 1981 and Powell et al ., 2005).

Since the Stockholm convention entered into force in May 2004, there has been a growing interest in the analysis of PCBs in transformer oils. Many countries that have developed a classification system for PCBcontaining fluids and materials have considered 50 mg/kg as the benchmark level for PCB regulation (UNEP, 1999). In accordance with PCB management, analytical test methods for determination of PCBs in insulating oil have been published as ASTMD4059, EPA600/481045 and NIST (USEPA, 1982; ASTM International, 2000 and Na et al ., 2008).

25 Literature Review

PCBs are not easily separated from oil because the physical and chemical characteristics of PCBs are very similar to those of mineral oil. The components of oilbased liquid wastes coelute with the PCBs during a GC separation, and the baseline shifts or fluctuates due to the oil matrix (Na et al ., 2008).

Pentachlorophenol (PCP) has been widely used for many years and belongs to the most toxic pollutants. Spent engine oils enter environment every day in many ways. Both of them cause great environmental concern (Szewczyk and Dlugoński, 2009).

Soil contamination by petroleum products is a widespread problem, with many hotspots of pollution arising from individual spills (Whittaker et al., 1995). Cleanup of these contaminated sites is an important goal, and bioremediation is a lowinput and cheap approach to remove hydrocarbons (Bundy et al ., 2004).

Studies on microbial distribution in areas suffering from petroleum contamination will provide valuable information to facilitate the development of effective bioremediation in the event of sudden accidental oil spills. In 1995, there was a serious spill from a tanker navigating in the mouth of the Saigon River, Ho Chi Minh City. Barren fields remain around the estuary even though 3 years has passed. They took the samples from this area in 1996 (Huy et al ., 1999).

Oil pollution of the oceans has been a problem ever since man began to use fossil fuels. Biodegradation by naturally occurring populations of microorganisms is a major mechanism for the removal of petroleum from the environment (Delille and Delille, 2000).

26 Literature Review

The 1989 ExxonValdez oil spill in Prince William Sound, Alaska (Bragg et al ., 1994) and the Kuwait oil fires of the 1990s Gulf War (Balba et al ., 1998) provided considerable impetus for development of effective bioremediation strategies and a range of technologies are now available to help accelerate the microbial turnover of chemical pollutants (Greenwood et al ., 2009).

The massive oil discharge in the Saudi Arabian coast at the end of the 1991 Gulf War is used here as a natural experiment to study the ability of microbial mats to transform oil residues after major spills (Oteyza and Grimalt, 2006).

The fate of crude oil spilled into the Arabian Gulf after the 1991 war (68 million barrels; Literathy, 1993 ) has been a question of major concern in recent years. The pollution impact of this episode has been evaluated in several studies (Readman et al ., 1992; Erhrardt and Burns, 1993; Fowler et al ., 1993 and Sauer et al., 1993, 1998), all indicating that crude oil accumulated and remained for a long time in the coastal areas (Sauer et al ., 1998 and Oteyza and Grimalt, 2006).

Laboratory and field pilot studies were carried out on the bioremediation of soil contaminated with petroleum hydrocarbons in the Borhola oil fields, Assam, India. The field tests revealed that up to 75% of the hydrocarbon contaminants were degraded within 1 year, indicating the feasibility of developing a bioremediation protocol (Gogoi et al ., 2003).

The effects of simulated crude oil soil contamination on microbial biomass, its activity and capacity to degrade crude oil hydrocarbons were examined in different soil types under different crop managements. The effect of the addition of different organic amendments (glucose, maize

27 Literature Review stalks and maize stalk compost) on microbial survival and crude oil degradation was also investigated (Franco et al ., 2004).

4 Microorganisms Degrading Chloroaromatic Compounds:

Microbial communities play significant roles in systems ranging from carbon cycling over global and geologic timescales, to microbial transformation of organic contaminants in the modern environment (Slater et al ., 2006).

One of the best approaches to restoring contaminated soil is to make use of microorganisms able to degrade those toxic compounds in a bioremediation process. Bioremediation is an attractive approach of cleaning up petroleum hydrocarbons because it is simple to maintain, applicable over large areas, costeffective and leads to the complete destruction of the contaminant (Frankenberger, 1992 and Bento et al ., 2005).

Both in situ and onsite treatment processes by involving the use of microorganisms to break down hazardous organic environmental contaminants avoid the economic and technical disadvantages (Ahlert and Kosson, 1983; Lee and Ward, 1985 and Das and Mukherjee, 2007).

Since microorganisms have evolved an enormous catabolic potential for numerous natural and synthetic compounds they were considered infallible. In addition, their evolutionary potential and genetic flexibility should allow the generation of new catabolic traits for xenobiotic compounds (Timmis and Pieper, 1999 and Rieger et al ., 2002).

For several decades, significant efforts have been devoted to the study of the biodegradation of organic pollutants. Various aspects need to be studied to obtain a detailed overview of biodegradation processes in the environment and to optimize and predict the performance of degrading 28 Literature Review microorganisms in situ. Approaches to analyze and assess biodegradation processes have been shifting towards the application of cultureindependent methodologies to characterize natural and engineered pollutantdegrading microbial associations. Various new cultureindependent tools have become available to analyze microbial community structure and function in natural and engineered environments. In addition, the genomes of several microbes relevant to biodegradation have been published and others are likely be reported soon, providing the opportunity to gain global insights into the evolutionary potential of specific microorganisms and their ability to bioremediate polluted environments (Pieper et al ., 2004).

In recent decades, organohalogen compounds have become an integral part of our economy as agriculture or industrial chemicals. They are deliberately or accidently released into the environment in large amounts. Considerable problems arise from compounds with haloaromatic ring as a structural feature, because they tend to resist microbial attack. The question arises whether, or to what extent, microorganisms can be adapted to mineralize recalcitrant chemicals. There are reports that bacteria in principal are able to use chloroaromatics as growth substrates with total elimination of chloride (Reineke and Knackmuss, 1980).

Their recalcitrance to microbial degradation depends on the grade, differing in a range from 1 to 12 as in mirex (C10 Cl 12 ), insecticide totally substituted. The nucleus breakage, in fact, requires the C atoms subjected to introduction of atmospheric O 2, catalyzed by bacterial mono and dioxygenases, which are free from substituent (Baggi, 2002).

In the mean time, many groups worked on the enrichment and isolation of bacterial strains from (polluted) environments, with the hope that natural selection had done some of the pathway assembly. This was successful for some substances, for example for 2,4dichlorophenoxy 29 Literature Review acetic acid (Ka et al. , 1994 a, b) or chlorobenzenes, for others it remained only partially an improvement (van der Meer, 1997).

On the other hand, there may have been chlorinated chemicals around in nature (Gribble, 1992 and De Jong et al., 1994), which selected for enzymes specific in degradation of chlorinated compounds a long time ago. The novelty of the chlorobenzene pathway lays in the combination of two existing gene clusters. This was a relatively fast process, expanding the capacities of microorganisms easily, which was selected for upon pollution of the environment with chlorobenzenes (van der Meer, 1997).

Many microorganisms have been extensively used for the detoxification of organic pollutants including, eukaryotes such as fungi, algae, yeasts and prokaryotes (Bumpus, 1989; Yadav and Reddy, 1992; Murandi et al ., 1995; Sommer and Görisch, 1997; Yee and Wood, 1997; Hammer et al ., 1998; Vallini et al ., 2001; Sedarati et al ., 2003; Haldorson et al ., 2004 and Ziagova and LiakopoulouKyriakides, 2007b). Bacterial species can be very tolerant to toxic substances at high concentrations, exhibiting high growth rates and also acting on a broad range of organic compounds. Pseudomonas species are frequently used in bioremediation processes. The aerobic pseudomonads include bacteria that are among the most metabolically versatile organisms known, capable of using as many as 100 different organic compounds as sole sources of carbon and energy, including not only simple carbohydrates, amino acids and organic acids but also unusual organic substrates such as motor oil and organohalogen compounds. This nutrient diversity requires the activity of several different enzymes, thus, making pseudomonads ecologically very important organisms in biosphere and probably responsible for the degradation of many toxic compounds (Ziagova and Liakopoulou Kyriakides, 2007b).

30 Literature Review

Several bacterial strains that degrade chloroaromatics under aerobic or anaerobic conditions have been isolated from contaminated sites (Jencova et al ., 2004).

Xenobiotic aromatic compounds are degraded by a smaller group of bacteria, particularly by strains of the Gramnegative bacteria of Pseudomonas , Sphingomonas , Acinetobacter , Ralstonia and Burkholderia and the Grampositive genus Rhodococcus . Bioremediation of the polluted soil and water by such bacteria has become a generally accepted procedure (Martinková et al ., 2009).

Bacteria that are able to use these compounds as carbon and energy source have been isolated from polluted environments and are described as members of the genera Alcaligenes, Pseudomonas , Burkholderia, Xanthobacter and Rhodococcus and the species Acidovorax avenae and Rhodococcus phenolicus (Schraa et al ., 1986; Spain and Nishino, 1987; van der Meer et al. , 1987; Haigler et al ., 1988; Sander et al., 1991; Brunsbach and Reineke, 1994; Spiess et al ., 1995; Potrawfke et al., 1998; Rapp and GabrielJürgens, 2003; Monferrán et al. , 2005; Rehfuss and Urban, 2005 and Wang et al ., 2007).

Present study exploits the capability of three bacteria, Pseudomonas aeruginosa (DSMZ 03504), P. aeruginosa (DSMZ 03505) and Bacillus megaterium (MTCC 6544) to reduce the BOD and COD level of pulp and paper mill effluents up to permissible level i.e. 30 mg/l and 250 mg/l respectively within a retention time of 24 h in batch cultures. Continuous mode of treatment may further decrease the retention time (Tiku et al., 2010).

Arabian Light and Marlin oils were both degraded when strain P4 was tested for oil degradation ability in microplates. Total Petroleum

31 Literature Review

Hydrocarbons (TPH) analysis, determined by gas chromatography, showed that strain P4 degraded a wide range of nalkanes, and also pristane and phytane (von der Weid et al ., 2007).

In the present work they focused on identifying metabolites of PCP biodegradation formed in the cultures of Mucor ramosissimus IM 6203 and optimizing medium composition to enhance PCP removal in the presence of engine oil acting as a carbon source (Szewczyk and Dlugoński, 2009).

Two Pseudomonas strains isolated from agricultural soil were found to possess chexachlorocyclohexane (cHCH) degrading ability when the isolates were grown in a mineral salt medium containing cHCH as the sole source of carbon and a number of metabolites were produced and detected by the gas chromatography (Nawab et al ., 2003).

Microorganisms in sewage decomposed 3,4dichlorobenzoate and m, p, ochlorobenzoates. As the substrate disappeared, populations capable of growing on these compounds proliferated (DiGeronimo et al ., 1979).

Most bacteria which use halobenzoates eliminate the halogen atom after ring cleavage. One of the interesting features of Pseudomonas sp. strain CBS3 which distinguishes it from other bacteria is that this strain is able to dehalogenate 4chlorobenzoate (4CBA) directly. Only a few other bacteria have been reported to effect this conversion (Savard et al ., 1986).

A number of organisms can use different chloro substituted benzoates as sole energy and carbon source (Fetzner, 1998).

Investigations on the microbial degradation of CBAs have allowed the isolation of different microorganisms capable of degrading these compounds (Baggi, 2002).

32 Literature Review

A soil which has been polluted with chlorinated benzenes for more than 25 years was used for isolation of adapted microorganisms able to mineralize 1,2,4trichlorobenzene (1,2,4TCB) (Wang et al ., 2007).

Research on microorganisms from chlorinated benzene (CB) contaminated groundwater has shown that genetic recombination, between different species of microorganisms, can bring about the development of microorganisms with the capability of completely degrading chlorinated benzenes and that this genetic recombination can occur in contaminated environments. This has implications for the natural attenuation of chlorinated benzenes in soil and groundwater environments contaminated with these compounds (van der Meer et al., 1998 and Guerin, 2008).

An unusually broad range of haloaromatic compounds, including chlorobenzenes and dichlorobenzenes are utilized as carbon sources by Rhodococcus opacus GM14 (Zaitsev et al ., 1995). Another efficient degrader of pollutants, Rhodococcus sp. MS11, grows on highly chlorinated benzenes (di, tri and tetrachlorobenzenes) (Rapp and GabrielJürgens, 2003). Chlorobenzene and dichlorobenzene are also utilized as the sole carbon sources by Rhodococcus phenolicus , which is a novel species in the genus Rhodococcus (Rehfuss and Urban, 2005 and Martinková et al ., 2009).

Pseudomonas aeruginosa JB2 can use 2chlorobenzoate (2CBa), 3CBa, 2,3dihlorobenzoate, and 2,5DCBa as sole carbon and energy sources, whereas strain 142 can only grow on 2CBa and 2,4DCBa. Both strains, however, harbor the same halobenzoate 1,2 dioxygenase ( ohb AB ) and chlorocatechol ( clc ABD ) degradation genes necessary for the metabolism of orthoCBas (Corbella and Puyet, 2003).

33 Literature Review

Parnell et al. (2010), explore the effect of environmental conditions (e.g., carbon source and growth phase) on the variation in PCB degradation profiles of Burkholderia xenovorans LB400.

Burkholderia sp. strain TH2, a 2chlorobenzoate (2CB)degrading bacterium, metabolizes benzoate (BA) and 2CB via catechol. Two different gene clusters for the catechol orthocleavage pathway ( cat1 and cat2) were cloned from TH2 and analyzed (Suzuki et al ., 2002).

Ralstonia eutropha JMP134 (pJP4) degrades 3chlorobenzoate (3 CB) by using two not completely isofunctional, pJP4encoded chlorocatechol degradation gene clusters, tfd C ΙDΙEΙFΙ and tfd C ΙΙ DΙΙ EΙΙ FΙΙ (PérezPantoja et al. , 2003).

The degradation of 1,2,3, 1,3,5 and 1,2,4trichlorobenzene (TCB) by the whiterot fungus Trametes versicolor was studied. A high percent of degradation of 91.1% (1,2,3TCB) and 79.6% (1,2,4TCB) was obtained after 7 d. However, T. versicolor was not able to degrade 1,3,5 TCB under the conditions tested (MarcoUrrea et al ., 2009).

The degradation of 2chlorophenol (2CP), 2,4dichlorophenol (2,4DCP), 2,4,6trichlorophenol (2,4,6TCP) and pentachlorophenol (PCP) via biological, advanced oxidative process (AOP) and sequential biologicalAOP was investigated. The whiterot fungus Trametes pubescens was used for the biodegradation of chlorophenols (González et al., 2010).

Different aerobic bacteria and fungi, such as Pseudomonas sp., Alcaligenes sp., Agrobacterium sp., Rhodococcus sp., Panus sp., Coriolus sp., have been used for degradation of phenol and its derivatives including chlorophenols (Koh et al ., 1997; Wang et al ., 2000; Leontievsky et al ., 2000; Goswami et al ., 2002 and Ziagova and LiakopoulouKyriakides, 2007a).

34 Literature Review

Among the several microorganisms able to degrade halogenated phenols the Grampositive bacterium Rhodococcus opacus 1CP was isolated for its ability to mineralize 2,4dichlorophenol as well as 4 chlorophenol via a modified orthopathway (Gorlatov et al ., 1989; Bondar et al ., 1998 and Ferraroni et al ., 2006).

Comparison of the ability of Pseudomonas sp. to degrade 2,4 dichlorophenol and 4Clmcresol in separate cultures in the presence of glucose, as a conventional carbon source, is reported. The specific growth rates at 0.1mM 2,4dichlorophenol and 4Clmcresol were estimated to be 0.181 and 0.154 h _1, respectively, showing that Pseudomonas sp. is mainly inhibited by 4Clmcresol (Ziagova and LiakopoulouKyriakides, 2007a).

The influence of sorption on the biodegradation of 2,4 dichlorophenol (2,4DCP) by Ralstonia eutropha was investigated using organoclays. The aim was to examine the suitability of organoclays combined with biodegradation in remediation techniques (Witthuhn et al ., 2005).

Ralstonia eutropha JMP134 (which was originally assigned to the species Alcaligenes eutrophus ), isolated by its capability to mineralize 2,4 dichlorophenoxyacetate (2,4D) (Don and Pemberton,1981), is one of the most intensively studied chloroaromaticdegrading organisms. 2,4D, 4 chloro2methylphenoxyacetate (MCPA) (Pieper et al., 1988), 3 chlorobenzoate (3CB) (Ghosal et al ., 1985), 2,4,6trichlorophenol (Clément et al ., 2000) as well as various other aromatic substrates are growth substrates for this strain (Plumeier et al., 2002).

Many researchers have investigated biodegradation of 2,4 dichlorophenol, using different bacterial species and fungi. Micrococcus sp., Chrysosporium sp. and Mucor sp. have been found capable of

35 Literature Review degrading 2,4DCP (Gallizia et al ., 2003 and Vroumsia et al ., 2005). Immobilized cells, of Achromobacter sp. in an airlift bioreactor have also been used for the degradation of 2,4DCP (Xiangchun et al ., 2003, 2004). Among them, Pseudomonas species cells have been used to a higher extent in bioremediation processes, comparing to other bacterial species (Ziagova and LiakopoulouKyriakides, 2007a).

A strain of bromophenol degrading bacteria was isolated from a contaminated desert soil. The isolate identified as Achromobacter piechaudii and designated as strain TBPZ was able to metabolize both 2,4,6 tribromophenol and chlorophenols. The degradation of halophenols resulted in the stechiometric release of bromide or chloride (Ronen et al ., 2000).

The isolation of Rhodococcus percolatus from sludge and sediments contaminated by various chlorophenols showed that Rhodococcus strains are able to utilize various mono di and trichlorophenols as sole carbon sources (Briglia et al ., 1996 and Martinková et al ., 2009).

Two polychlorinated biphenyl (PCBs)degrading bacteria were isolated by traditional enrichment technique from electrical transformer fluid (Askarel)contaminated soils in Lagos, Nigeria. They were classified and identified as Enterobacter sp. SA2 and Pseudomonas sp. SA6 on the basis of 16S rRNA gene analysis, in addition to standard cultural and biochemical techniques. The strains were able to grow extensively on dichloro and trichlorobenzenes as sole sources of carbon and energy (Adebusoye et al ., 2007).

Achromobacter xylosoxidans strain A8, isolated from soil contaminated with polychlorinated biphenyls (PCBs), is able to use 2 chlorobenzoate (2CB) and 2,5dichlorobenzoate (2,5DCB) as sole sources of carbon and energy (Jencova et al ., 2004).

36 Literature Review

The majority of reported PCBdegrading bacteria are Gram negative, including Pseudomonas, Alcaligenes, Acinetobacter, and Achromobacter (Master and Mohn, 2001; Master et al ., 2005; Ohtsubo et al ., 2006 and Yang et al. , 2007), but Grampositive bacteria, including Rhodococcus, Arthrobacter, and Corynebacterium species have also been reported to be capable of metabolizing PCBs (McKay et al ., 1997; Saagua et al ., 1998; Kitagawa et al ., 2001 and Rybkina et al., 2003), using PCBs as their source of carbon and energy (Sobiecka et al ., 2009).

Pseudomonas sp. strain P51 is isolated bacterium able to use chlorobenzenes as sole carbon and energy sources. With the current interest in environmental pollution, increasing numbers of bacterial strains that degrade organic chemicals (Reineke and Knackmuss, 1988). These strains offer the unique possibility of studying the evolution of bacterial metabolism in response to new substrates, such as xenobiotic compounds (van der Meer et al., 1991 b).

Cell extracts of Pseudomonas aeruginosa 142, which was previously isolated from a polychlorinated biphenyldegrading consortium, were shown to degrade 2,4dichlorobenzoate, 2chlorobenzoate, and a variety of other substituted orthohalobenzoates by a reaction that requires oxygen, NADH, Fe(ΙΙ), and flavin adenine dinucleotide (Romanov and Hausinger, 1994).

In natural bacterial communities degrading many PCB congeners, the majority of PCB degraders were identified as members of the genus Rhodococcus (Leigh et al ., 2006) and several strong degraders of this genus were isolated. PCBs are cometabolized with biphenyl (BPH) by R. globerulus P6 (Asturias et al ., 1995), R. erythropolis TA421 (Maeda et al ., 1995), R. jostii RHA1 (Masai et al ., 1995), Rhodococcus sp. M5, (Lau et al ., 1996), R. rhodochrous K37 (Taguchi et al. , 2004) and Rhodococcus sp. R04 (Yang et al ., 2007 and Martínková et al ., 2009). 37 Literature Review

They proposed a model for DDT biodegradation by bacteria grown in microniches created in the porous structure of green bean coffee. Five bacteria isolated from coffee beans, identified as Pseudomonas aeruginosa, P. putida, Stenotrophomonas maltophilia, Flavimonas oryzihabitans, and Morganella morganii, P. aeruginosa and F. oryzihabitans, were selected for pesticide degradation (BarragánHuerta et al ., 2007).

Bioremediation using various bacterial strains of the genus Rhodococcus has proved to be a promising option for the cleanup of polluted sites. The large genomes of rhodococci, their redundant and versatile catabolic pathways, their ability to uptake and metabolize hydrophobic compounds, to form biofilms, to persist in adverse conditions and the availability of recently developed tools for genetic engineering in rhodococci make them suitable industrial microorganisms for biotransformations and the biodegradation of many organic compounds (Martinková et al ., 2009).

Since they are equipped with a large number of enzymatic activities, unique cell wall structure and suitable biotechnological properties, Rhodococcus strains may be utilized as industrial organisms, primarily for biotransformations and the biodegradation of many organic compounds (Bell et al ., 1998 and Martinková et al ., 2009).

Rhodococcus strains were found to be suitable for these biotechnological processes due to their resistance to a number of toxic xenobiotics and their ability to degrade many of these compounds, including the recalcitrant ones. Various strains of rhodococci degrade benzene and its derivatives (toluene, ethylbenzene, xylenes, biphenyl), polycyclic and heterocyclic aromatic compounds, phenolic compounds, aromatic acids, halogenated aromatics, including polychlorinated biphenyls (PCBs), amino and nitroderivatives of aromatic compounds 38 Literature Review

(e.g., aniline and nitrophenol), ethers and pesticides and desulfurize coal and petroleum products (Vogt et al., 2004; van der Geize and Dijkhuizen, 2004; Larkin et al ., 2005 and Martinková et al ., 2009).

Pesticide residues and their transformation products are frequently found in groundwater and surface waters. Önneby et al., (2010) examined whether adding pesticidedegrading microorganisms simultaneously with the pesticide at application could significantly reduce diffuse contamination from pesticide use.

5 Biodegradation Of Chloroaromatic Compounds:

For the disposal of toxic wastes several methods are followed including thermal, chemical, physical and biological. Nonbiological processes lead mainly to the formation of other toxic derivatives from the parent compounds and are usually cost demanding. On the other hand, biological processes imply the use of microorganisms, have the advantage of being natural and in most cases destroy the target contaminants, or convert them to other nontoxic derivatives. Usually, they are less expensive than other technologies and often treat the wastes in situ, eliminating the need for excavation or transport (Ziagova and LiakopoulouKyriakides, 2007b).

Biological remediation methods are often cheaper and more environmentally friendly than their physical or chemical counterparts (Tamer et al ., 2006).

In the 1980s, rapidly increasing environmental contamination raised concerns about the health of ecosystems and humans and interest in biological methods of pollution cleanup (bioremediation) (Martinková et al ., 2009).

39 Literature Review

Biodegradation is the major route of natural breakdown for hydrocarbons. Microorganisms, which are well adapted to degrade virtually all naturally occurring substances, easily convert xenobiotics that resemble natural compounds, but are often recalcitrant to transform structures that deviate strongly from natural patterns. Renowned examples are polychlorinated biphenyls (Chaudhry and Chapalamadugu, 1991a), and polycyclic aromatics (Habe and Omori, 2003), but the degradation fates of chlorobenzenes and chlorophenols are far more important, due to their extensive utilization and release into the environment. Opportunely aerobic bacteria have evolved new catabolic pathways that allow degradation of these pollutants (van der Meer et al ., 1992; Reineke, 1998; Beil et al., 1999 and Ferraroni et al ., 2006).

Mineralization is the complete degradation of a compound to form carbon dioxide and water. Mineralization, which can be an aerobic or anaerobic process, involves the release of CO 2 from the pollutant. In the case of chlorinated organic compounds, such as CB and DCB isomers, chloride ion is also a product of mineralization (Kaschl et al ., 2005 and Guerin, 2008).

A fundamental prerequisite of any remedial activity is a sound knowledge of both the biotic and abiotic processes involved in transport and degradation of contaminants. Investigations of these aspects in situ often seem infeasible due to the complexity of interacting processes. A simplified portrayal of nature can be facilitated in laboratorybased twodimensional (2D) sediment flowthrough microcosms (Bauer et al ., 2009).

Bioremediation is a strategy to utilize biological activities as much as possible for quick elimination of environmental pollutants (Huy et al ., 1999).

40 Literature Review

To warrant a practical application, any bioremediation process should demonstrate that removal of contaminants is the primary effect of biodegradation, and that the degradation rate is greater than the natural rate of decontamination. One of the difficulties of developing bioremediation strategies lies in achieving as good or better results in the field as in the laboratory (Juhasz et al ., 2000 and Bento et al ., 2005).

Bioremediation: The use of living organisms (primarily microorganisms) to degrade environmental pollutant or to prevent pollution through waste treatment. Bioagumentation: It is the way to clean up the pollution by inoculating the site with consortia of specific targeted microbes in high densities. Biostimulation: Since microbes are ubiquitous, the indigenous microbes at the site will take care of the pollution and all that is necessary is the addition of fertilizers & nutrients to speed up the growth of the indigenous microbial population (AboState, 2005).

Field and fullscale remediation projects, particularly those employing bioventing technologies, have also been shown to treat chlorobenzenes, though there are few providing extensive details of these projects in the public domain (Guerin , 2008).

This is particularly relevant for the development of biostimulation or bioaugmentation strategies for the bioremediation of PCBcontaminated wastes (Sobiecka et al ., 2009).

Diesel oil bioremediation in soil can be promoted by stimulation of the indigenous microorganisms, by introducing nutrients and oxygen into the soil (biostimulation) (Seklemova et al ., 2001) or through inoculation of an enriched microbial consortium into soil (bioaugmentation) (Richard and Vogel, 1999; Barathi and Vasudevan, 2001 and Bento et al ., 2005).

41 Literature Review

One of the methods of their removal from soil is bioaugmentation, defined as a technique for improvement of the degradative capacity of contaminated areas by introduction of specific competent strains or consortia of microorganisms. The efficiency of bioaugmentation is determined by many abiotic and biotic factors discussed in this paper. The first include chemical structure, concentration and availability of pollutants as well as physicochemical properties of soil. In turn, among biotic factors the most important is the selection of proper microorganisms that can not only degrade contaminants but can also successfully compete with indigenous microflora. Several strategies are being developed to make augmentation a successful technology particularly in soils without degrading indigenous microorganisms. These approaches involve the use of genetically engineered microorganisms and gene bioaugmentation. The enhancement of bioaugmentation may be also achieved by delivering suitable microorganisms immobilized on various carriers or use of activated soil (Mrozik and PiotrowskaSeget, 2010).

Chlorinated benzenes do, however, undergo biodegradation in the environment through some remain recalcitrant even under conditions of enrichment. These compounds are subject to degradation by various aerobic microorganisms. Anaerobic microorganisms are also capable of degrading these compounds. In the aerobic studies, degradation has been demonstrated with isolated pure cultures of both naturally occurring species and engineered strains. It is also apparent that mixed cultures or communities of microorganisms are able to completely degrade these compounds under both aerobic and anaerobic conditions. Specific strains of the aerobic bacteria Pseudomonas sp. and Alcaligenes sp. have been isolated and grown on CB and DCB and the genetic basis of degradation of these compounds in microorganisms has also been studied extensively. Both mineralization and cometabolism are involved in CB and DCB

42 Literature Review biodegradation (Alfreider et al ., 2003; Jechorek et al ., 2003; Pollmann et al ., 2005 and Guerin, 2008).

Barbeau et al. (1997) successfully utilized a pentachlorophenol (PCP)contaminated soil, containing developed degrader populations, to inoculate and enhance PCPdegradation in another contaminated soil. The use of activated soil may initially appear to be less scientific than other methods of bioaugmentation (Pepper et al. 2002), but it has the potential advantages of: (1) introduction of naturally developed degrader populations that may be composed of several members or even consortia that would not be as effective if they were isolated and applied to the site as pure cultures; (2) the degraders are not cultured outside of the soil and thus do not lose their ability to compete in the environment as is often observed for labcultured strains; and (3) potential inclusion of poorly culturable degraders that would be missed in attempts to isolate and culture an organism from one site in order to introduce the organism to another site (Gentry et al. , 2004).

Due to the hazards presented by chlorobenzoates (CBz) in the environment, information on their rates and extent of biodegradation is of great interest. If bioremediation or bioaugmentation of contaminated matrices are to be effectively used, isolation and characterization of organisms capable of degrading CBz are necessary. Increased knowledge about physiological properties and substrate range will help determine the process conditions that should be used and the range of transformations that can be obtained in practical treatment systems (Adebusoye et al ., 2007).

By inoculation with specialized bacteria the biodegradation of 1,2,4 TCB could be enhanced. But the release of these strains may be related with difficulties because they often are not able to maintain their activity in natural ecosystems and even do not survive. Moreover the reported data are often 43 Literature Review based on the disappearance of the parent compound and processes like volatilization and formation of bound residues which are also involved in the fate of a xenobiotic in soil environments are not considered (Schroll et al ., 2004).

One of the strains was reinoculated to an agricultural soil with low native 1,2,4TCB degradation capacity to investigate its bioremediation potential (Wang et al ., 2007).

Some biodegradation studies of 1,2,4TCB in pure cultures and environmental samples have been performed. Biodegradation of 1,2,4TCB in natural samples occurs in very low rates due to insufficient degradation capacity and slow adaptation of the indigenous microorganisms. In some cases, the biodegradation of 1,2,4TCB in soil could be enhanced by inoculation with adapted bacteria like Pseudomonas sp. P51, Burkholderia sp. PS12 and Burkholderia sp. PS14 under laboratory conditions (van der Meer et al ., 1987; Sander et al., 1991; Rapp and Timmis, 1999; Tchelet et al ., 1999; Schroll et al., 2004 and Wang et al ., 2007).

Growth stimulation of indigenous microorganisms, biostimulation, along with inoculation of foreign oildegrading bacteria is a promising means of accelerating detoxifying and degrading activities at a polluted site with minimum impact on the ecological systems (Margesin and Schinner, 1997 and Huy et al ., 1999).

The effects of aeration, nutrients (i.e. nitrogen and phosphorus) and inoculation of extraneous microbial consortia on the bioremediation process were investigated. The beneficial effects of these parameters on the bioremediation rate were realized equally in laboratory and field pilot tests (Gogoi et al ., 2003).

44 Literature Review

Chlorinated benzenes, including chlorobenzene (CB) and 1,2 dichlorobenzene (DCB) are widely used as chemical intermediates and solvents across industry. Soil contaminated with these compounds was treated in a pilotscale trial in 6m3 cells. Air was drawn through each cell and exhausted via a granulated activated carbon (GAC) filter system. This study confirms that vented exsitu biotreatment processes for chlorinated benzenes can be achieved without excessive losses from volatilization and that naturally occurring microflora can be readily stimulated with aeration and nutrients (Guerin, 2008).

As chemical and photochemical degradation of CBs is very slow, biological degradation could be considered as a feasible process to eliminate these compounds from soil ecosystems. Aerobic microbial degradation of mono, di, tri and even tetrachlorobenzenes is reported (Haigler et al ., 1988; Potrawfke et al ., 1998; Rapp and Timmis, 1999; Schroll et al ., 2004; Monferrán et al ., 2005; Rehfuss and Urban, 2005 and Wang et al ., 2007).

Residual soils are generally poor in nutrients, a characteristic that restricts the use of natural attenuation as a bioremediation tool in sites heavily contaminated by organic pollutants. In such environments, the biodegradation process can be accelerated by adding essential inorganic nutrients, such as phosphate and nitrate. However, this process must be strictly controlled in order to attain the most favorable C:P and C:N balance. In addition, natural attenuation also depends on the microorganisms’ ability to degrade contaminants (Dojka et al ., 1998 and Boopathy, 2000). When autochthon populations are not capable to degrade the contaminant(s) of concern, bioaugmentation is an alternative (Da Rocha et al ., 2009).

45 Literature Review

6 Mechanisms of Chloroaromatic Compounds Degradation:

The microbial degradation of halogenated aromatic compounds have been extensively studied for many years in order to elucidate the degradative mechanisms involved and, more recently, to develop adequate technologies for environmental protection (Baggi, 2002).

Two main pathways are known for metabolism of aromatic compounds – the ortho and meta pathways. Only the ortho pathway leads to complete mineralization of chlorinated aromatic compounds (Lehning et al ., 1997; Tchelet et al ., 1999 and Guerin, 2008).

Aerobic bacterial metabolism of chloroaromatic pollutants occurs via peripheral pathways that produce chlorocatechols or (chloro)hydroxyquinols, which are usually channelled into the central metabolism by orthocleavage pathways, where the key step is the cleavage of the aromatic ring by insertion of molecular oxygen between two adjacent hydroxyl groups catalyzed by nonheme Fe(III)dependent metalloenzymes, classified as intradiol dioxygenases (Sze and Dagley, 1984; Reineke and Knackmuss, 1988 and Solyanikova and Golovleva, 2004). Only in a few remarkable occurrences have metacleavage pathways been observed for chlorocatechols (Mars et al ., 1999; Potrawfke et al ., 2001 and Ferraroni et al ., 2006).

Although aerobic mineralization processes are certainly not the only important biodegradation processes in the natural environment, genetic studies have focused mainly on aerobic pathways. A general comparison of the major pathways for catabolism of aromatic compounds in bacteria has revealed that the initial conversion steps are carried out by different enzymes but that the compounds are transformed to a limited number of central intermediates, such as protocatechuate and (substituted) catechols. These

46 Literature Review dihydroxylated intermediates are channeled into one of two possible pathways, either a meta cleavagetype pathway or an ortho cleavagetype pathway (Fig. 1). Both types of pathways lead to intermediates of central metabolic routes, such as the tricarboxylic acid cycle. This generalized scheme of catabolic pathways for aromatic compounds suggests that microorganisms have extended their substrate range by developing peripheral enzymes, which are able to transform initial substrates into one of the central intermediates (van der Meer et al ., 1992).

Figure (1): Extradiol and intradiol dioxygenase enzymes. Catechol 2,3dioxygenases XylE, NahH, and DmpB catalyze meta cleavage of catechol as indicated by the arrow. The superfamily of extradiol enzymes also includes TodE, NahC, BphC, and CbpC. The preferential substrates and the sites of cleavage are indicated. ortho cleavage is catalyzed by intradiol dioxygenases. The superfamily of intradiol dioxygenases includes protocatechuate 3,4dioxygenases ( PcaGH ), catechol 1,2 dioxygenase ( CatA ), and chlorocatechol 1,2dioxygenases ( TcbC, TfdC, and ClcA ). The catechol 1,2dioxygenase activity which converts 3methyl6chlorocatechol was detected in a mutant of Pseudomonas sp. strain JS6 (van der Meer et al ., 1992).

47 Literature Review

A wide range of natural and xenobiotic aromatic compounds are aerobically catabolized by bacteria via a large variety of upper or peripheral pathways resulting in a limited number of central intermediates. These common metabolites are further degraded through a few central pathways to finally provide intermediates of the citrate cycle (Harwood and Parales, 1996). Such arrangements for the catabolism of aromatic compounds were found in both the longer studied pseudomonads (Jimenez et al ., 2002) and in the recently characterized Rodococcus jostii RHA1 (McLeod et al ., 2006 and Martinková et al ., 2009).

Within the peripheral pathway, the aromatic compound is modified in a number of steps, including the action of monooxygenase or dioxygenase resulting in the formation of a dihydroxylated benzene ring. The main resulting metabolites are catechol and protocatechuate with hydroxyl groups at positions 1,2 and gentisate with hydroxyl groups at positions 1,4 (Fig. 2 and 3). The ring cleavage of both catechol and protocatechuate catalyzed by dioxygenases occurs either between the hydroxyl groups (intradiol cleavage or orthocleavage) or adjacent to one of the hydroxyl groups (extradiolcleavage or metacleavage) (Fig. 3). The orthocleavage pathway of catechol and protocatechuate converging at 3 oxoadipate is also called the 3oxoadipate (βketoadipate) pathway (Harwood and Parales, 1996). In gentisate, cleavage occurs between the carboxyl group and adjacent hydroxyl group (Dagley, 1971). Whereas the upper pathways are only present in a limited number of bacterial strains, the central pathways of aromatic catabolism are common in bacteria (Harwood and Parales, 1996). The catechol, protocatechuate and gentisate dioxygenases play the central roles in degradation of aromatic compounds because they catalyze the critical and chemically difficult aromatic ringcleavage reaction (Broderick, 1999 and Martinková et al ., 2009).

48 Literature Review

The enzymes, genes and regulatory mechanisms of the 3 oxoadipate pathway were found to be similar in various bacteria, e.g., in Acinetobacter, Arthrobacter, Burkholderia, Pseudomonas and Rhodococcus . Catechol or protocatechuate are catabolized in four reactions into 3oxoadipate (Fig. 3), which is in two further reactions converted to acetylcoenzyme A and succinylcoenzyme A. In many bacteria the catA, catB and catC genes, coding for catechol 1,2 dioxygenase, cis,cis muconate cycloisomerase and muconolactone isomerase respectively, form operons and are clustered with the catR gene coding for a LysRtype transcriptional regulator (Chugani et al ., 1997 and Murakami et al ., 2004). These LysRtype regulators are activators and expression of the operons is induced by cis,cis muconate. In contrast, the CatR regulators in some Rhodococcus strains were found to be of the IclRtype (Eulberg and Schlömann, 1998 and Veselý et al ., 2007) and CatR was shown to function as a repressor in Rhodococcus erythropolis CCM 2595 (Veselý et al ., 2007). IclRtype regulators in most cases control the protocatechuate catabolic operons (Eulberg et al ., 1998b; Gerischer et al ., 1998 and Martinková et al ., 2009).

Gentisate is an intermediate of naphthalene, salicylate and 3 hydroxybenzoate degradation. Gentisate is oxidized by 1,2dioxygenase to maleylpyruvate as shown in Rhodococcus erythropolis (Suemori et al ., 1995). Two further reactions catalyzed by maleylpyruvate isomerase and fumarylpyruvate hydrolase finally convert the intermediates to pyruvate and fumarate (Fig. 3) (Martinková et al ., 2009).

The aerobic catabolism of chlorophenols, chlorobenzenes and chlorobenzoates is initiated by their hydroxylation and results finally in the respective chlorocatechols. The degradation of chlorocatechols via a modified orthocleavage pathway completes the catabolic pathway. Rhodococcus opacus 1CP was found to efficiently degrade 4chlorophenol

49 Literature Review and 2,4dichlorophenol (Eulberg et al ., 1998a) and, after prolonged adaptation, 2chlorophenol as well. Their hydroxylation leads to 4 chlorocatechol, 3,5dichlorocatechol and 3chlorocatechol, respectively. Analysis of the R. opacus 1CP genes responsible for the chlorocatechol catabolic pathways showed that the clcBRAD operon is involved in 4 chlorocatechol and 3,5dichlorocatechol degradation, whereas the clcA2D2B2F operon is involved in 3 chlorocatechol degradation. In contrast to the cat and pca operons for the catabolism of catechol and protocatechuate, which are located on the chromosome, the clc and clc2 operons for chlorocatechol degradation were identified on the large linear plasmid p1CP (740 kb) (König et al ., 2004). The location of genes involved in the catabolism of halogenated compounds on large plasmids has also been observed in Pseudomonas putida (McFall et al ., 1998), Ralstonia eutropha (Ogawa et al ., 1999) and Burkholderia sp. (Liu et al ., 2001). The new pathway for 3chlorocatechol degradation (encoded by the clcA2D2B2F operon of R. opacus 1CP) differs from all other known chlorocatechol pathways, because the dechlorinating enzyme is related to muconolactone isomerase, whereas in other pathways it is chloromuconate cycloisomerase (Moiseeva et al ., 2002). Apparently, two chlorocatechol catabolic pathways in R. opacus 1CP originated through independent but convergent evolution (Eulberg et al ., 1998a and Martinková et al ., 2009).

50 Literature Review

Figure (2): Peripheral pathways of biodegradation of aromatic compounds in rhodococci. R=alkyl (Martínková et al ., 2009).

51 Literature Review

Figure (3): Central pathways of catabolism of aromatic compounds in rhodococci (Martínková et al ., 2009).

The chlorocatechol (CC)degradative pathway is often found in bacteria that can use chlorinated aromatic compounds as carbon and energy sources. In these bacteria, the combined action of the CCdegradative pathway with one or more peripheral pathways ensures the complete digestion of the chloroaromatic substrate via CC as an intermediate metabolite (van der Meer et al., 1992 and Leveau and van der Meer, 1996).

52 Literature Review

A major route for mineralization of chloroaromatic compounds by microorganisms is their transformation into chlorocatechols and their further metabolism by enzymes of the chlorocatechol pathway. In this metabolic pathway, chlorocatechols are subject to intradiol cleavage to form the respective chloromuconates, which are converted by chloromuconate cycloisomerases into cis or transdienelactone. The dienelactones undergo hydrolysis by dienelactone hydrolase (Reineke, 1998; Kaulmann et al., 2001; Pieper et al., 2002 and Ferraroni et al., 2006).

The catabolism of chlorocatechols has mainly been investigated with Proteobacteria . While productive meta cleavage pathways have recently been shown to occur, the majority of known strains use a modified ortho cleavage pathway. In this pathway, 3chlorocatechol is cleaved by chlorocatechol 1,2dioxygenase (EC 1.13.11.1) to give 2chloro cis ,cis muconate (Fig. 4). In proteobacterial chlorocatechol pathways, this intermediate is converted by chloromuconate cycloisomerase (EC 5.5.1.7) to the socalled trans dienelactone ( trans 4carboxymethylenebut2en4olide). This reaction comprises a cycloisomerization to 2chloro or 5 chloromuconolactone and a dehalogenation of the latter to the trans dienelactone. Since proteobacterial muconate cycloisomerases (EC 5.5.1.1), in contrast, convert 2chlorocis ,cis muconate only to a mixture of 2chloro and 5chloromuconolactone, the dehalogenation is enzyme catalyzed, and this ability had to be evolved during divergence of proteobacterial muconate and chloromuconate cycloisomerases. The trans dienelactone resulting from dehalogenation is cleaved by a dienelactone hydrolase (EC 3.1.1.45) to give maleylacetate, which is then reduced by maleylacetate reductase (EC 1.3.1.32) to give 3oxoadipate, an intermediate of usual pathways for the catabolism of aromatic compounds (Fig. 4). 4Chlorocatechol may be cleaved by chlorocatechol 1,2dioxygenase to 3chlorocis ,cis muconate. From this intermediate, chloromuconate cycloisomerases generate the cis dienelactone

53 Literature Review

(Fig. 4). In this case, the enzymes had to evolve the ability to avoid formation of the toxic protoanemonin which is generated from 3chlorocis ,cis muconate by usual muconate cycloisomerases. Obviously, in chloromuconate cycloisomerases the rate of chloride elimination from the enolenolate reaction intermediate was enhanced relative to the rate of proton addition to it. The cis dienelactone, like the trans isomer, is again hydrolyzed by dienelactone hydrolase to maleylacetate and then reduced to 3oxoadipate (Fig. 4). 3,5Dichlorocatechol, generated, for example, from the herbicide 2,4dichlorophenoxyacetate, is converted basically like 4chlorocatechol, the difference being that the intermediates carry an additional chlorine substituent (Fig. 4). The latter is eliminated from chloromaleylacetate by maleylacetate reductase, which in a first reduction generates maleylacetate, which is then reduced to 3oxoadipate (Moiseeva et al., 2002).

54 Literature Review

Figure (4): Degradative pathways for 3chlorocatechol (3CC), 4 chlorocatechol (4CC), and 3,5dichlorocatechol (3,5DCC), the central intermediates in chlorophenol degradation, as found in R. opacus 1CP (solid lines). Dashed arrows show the known proteobacterial 3 chlorocatechol pathway for comparison. Enzyme names and their designations as gene products are given (Moiseeva et al., 2002).

55 Literature Review

The microbial degradation of various chloroaromatics has been described to occur via chlorocatechols as central intermediates, which are further degraded through the modified ortho pathway. Chlorocatechol 1,2 dioxygenase, chloromuconate cycloisomerase, dienelactone hydrolase, and maleylacetate reductase fulfill the convergence of the chlorocatechol and catechol degradative pathways. Alternatively to the intradiol type of ring cleavage, the pathway is initiated by extradiol ring cleavage in some microorganisms. The catechol 2,3dioxygenases of the meta pathway are able to convert catechol, both isomeric methylcatechols, and 4 chlorocatechol at respectable rates. The further degradation of the ring cleavage product of 4chlorocatechol seems to be a slow process, since all strains degrading a chloroaromatic compound via 4chlorocatechol through the meta pathway grow slowly on these substrates. However, when 3chlorocatechol occurs in strains with a meta pathway, the catechol 2,3dioxygenase is negatively influenced, either by 3chlorocatechol itself, as a chelating compound resulting in a reversible inactivation, or by a reactive acylchloride, the product of the cleavage of 3chlorocatechol, which causes irreversible inactivation of the enzyme. Autooxidation of accumulating 3chlorocatechol leads to a general toxic effect on the cells; therefore, degradation of haloaromatics via cleavage of 3chlorocatechol has been considered impossible. But Kaschabek et al. (1998) reported that Pseudomonas putida GJ31 degrades chlorobenzene with a generation time of 3h via 3chlorocatechol, using the meta pathway without any apparent toxic effects. They present data on the purification and characterization of the unusual metacleaving enzyme that converts 3 chlorocatechol productively. Comparison with various previously published catechol 2,3dioxygenases was performed. The dechlorination mechanism used by strain GJ31 represents an alternative to the different dechlorination mechanisms which are normally used in the degradation of

56 Literature Review chlorobenzenes through the ortho pathway. These include the oxygenolytic removal of chlorine substituents at an early stage of the degradative pathway by the ringactivating dioxygenases prior to cleavage of the aromatic ring and, alternatively, degradation proceeding through chlorinated catechols as central metabolites. Chlorosubstituted aliphatic structures are then generated after ring cleavage, from which HCl is eliminated by chloromuconate cycloisomerases and maleylacetate reductases (Kaschabek et al., 1998).

Figure (5): Alternative reactions occurring when catechol 2,3dioxygenases cleave 3chlorocatechol. (1): Suicide inactivation when a nucleophilic group of the dioxygenases undergoes acylation; (2): Immediate and spontaneous cyclization occurring when the carbonyl group at C6 of the ring fission product undergoes internal nucleophilic attack by the enolic hydroxyl at C2 after configurational change; (3): Reaction of acylchloride with water to give 2 hydroxymuconate; (4): Distal extradiol cleavage between C1 and C6 to give a typical yellow metacleavage product of the 2hydroxymuconic semialdehyde type (Kaschabek et al., 1998).

57 Literature Review

The following gene clusters encoding the modified ortho cleavage pathway have been studied: clcABDE , encoding the 3chlorobenzoate degradative enzymes of Pseudomonas putida AC866, tfdCDEF , encoding the 2,4dichlorophenoxyacetatedegradative enzymes of Ralstonia eutropha JMP134, tcbCDEF , encoding the 1,2,4trichlorobenzenedegradative enzymes of Pseudomonas sp. strain P51, and the part of clcDE encoding the 3chlorobenzoatedegradative enzymes of Pseudomonas sp. strain B13 (Fig. 6). However, the molecular basis for the connection to the Krebs cycle is an aspect of chloroaromatic degradation that has received no attention, while the genes encoding the lower 3oxoadipate pathway have been the subject of intensive investigations (Göbel et al., 2002).

58 Literature Review

Figure (6): Schematic presentation of the protocatechuate and catechol branches of the 3oxoadipate pathway plus the modified ortho pathway (Göbel et al., 2002).

59 Literature Review

There are two principal ways to indicate how chlorobenzoic acids (CBAs) can be dehalogenated: a) Dehalogenation is the first step of the pathway, preceding the ring cleavage. In most cases, hydroxylated benzoic acids were formed, following the dehalogenation. b) Dehalogenation occurs after ring cleavage. CBAs are converted to chlorocatechols, which are cleaved by enzymes of a modified orthopathway as in Fig (7). The dehalogenation often occurs spontaneously during further metabolism of the nonaromatic intermediates (Grund et al., 1995).

60 Literature Review

Figure (7): Catabolic pathways for degradation of chlorinated benzoic acids by bacteria. I, 2,4dichlorobenzoate; II, 3,4dichlorobenzoate; III, 2chlorobenzoate; IV, 3chlorobenzoate; V, 4chlorobenzoate; VI, 3chloro4 hydroxybenzoate; VII, 3hydroxybenzoate; VIII, 4hydroxybenzoate; IX, catechol; X, gentisate; XI, protocatechuate; XII, 4carboxyl,2benzoquinone. Enzymatic acitivities: A, 2,4 dichlorobenzoate dehalogenase (reductive); B, 3,4dichlorobenzoate dehalogenase; C, 2halobenzoate 1,2 dioxygenase; D, 3chlorobenzoate dehalogenase; E, 4chlorobenzoate dehalogenase (hydrolytic); F, 3chloro4 hydroxybenzoate hydratase; G, 3hydroxybenzoate 6hydroxylase; H, 4 hydroxybenzoate 3hydroxylase (Grund et al ., 1995).

61 Literature Review

CBAs have been used for many years as models to study the degradation for more complex chloroaromatics, both in aerobic and anaerobic conditions and to elucidate the microbial strategies implicated in the release of chlorine substituents (Baggi, 2002).

Chlorobenzoates (CBas) are intermediates produced during the aerobic degradation of polychlorinated biphenyls. Degradation of 2CBa is initiated by the dihydroxylation of the substrate by a halobenzoate 1,2 dioxygenase, which, after decarboxylation and dehalogenation at C2, yields catechol. When dichlorobenzoates (DCBas) are used, the same enzyme activity results in the production of chlorocatechols. Both catechol and chlorocatechols are then channeled through the orthocleavage metabolic pathway to the tricarboxylic acid (TCA) cycle intermediates (Schmidt and Knackmuss, 1980; Kuhm et al., 1990; Harwood and Parales, 1996 and Corbella and Puyet, 2003).

Krooneman et al . (1996) found that Alcaligenes sp. strain L6 at low oxygen concentration could degrade 3chlorobenzoate (3CBA) via pathway not involving chlorocatechols. So the proposed pathway was indicated in Fig. (8).

62 Literature Review

Figure (8): Brief summary of various metabolic pathways for the degradation of 3CBA via catechol, protocatechuate, and gentisate, cited from Krooneman et al ., (1996). TCA:Tricarboxylic acid cycle.

Microbial growth on orthosubstituted chlorobenzoates (CBs) such as 2 and 2,5(di)chlorobenzoic acid (2CB; 2,5DCB) is initiated by an orthohalobenzoate oxygenase, which transforms 2CB and 2,5DCB into catechol and 4chlorocatechol, respectively (Tsoi et al ., 1999 and Hickey et al., 2001). Chlorocatechols are subsequently transformed by the enzymes of the socalled ‘‘modified orthometabolic pathway’’ (Frantz and Chakrabarty, 1987; Perkins et al ., 1990; van der Meer et al ., 1991a,b; Ogawa and Miyashita, 1999; Liu et al ., 2001 and Jencova et al ., 2004, 2008).

63 Literature Review

Genetic studies on the majority of known 2,4dichlorophenoxy acetic acid (2,4D) and 3CBA degraders support the notion that recently evolved genes are used by bacteria to mineralize these compounds. 3CBA and 2,4D are converted to chlorocatechols which are mineralized via a modified ortho cleavage pathway encoded by highly homologus operons, suggestive of a monophyletic origin of the genes (Häggblom, 1992; Sahu et al., 1992 and van der Meer et al ., 1992). Often the genes are carried on conjugative plasmids and have been isolated from different parts of the world, presumably having spread globally via interspecies transfer events (Horvath, 1973; Don and Pemberton, 1981; Massé et al., 1984; Mae et al., 1993; Bhat et al., 1994 and Fulthorpe et al ., 1996).

Ralstonia eutropha JMP134 (pJP4) was originally isolated from an unspecified soil sample based on its ability to use the herbicide 2,4D as sole carbon and energy source (Don and Pemberton 1981 and Don et al. , 1985). The strain can grow on various other haloaromatic compounds, such as 3chlorobenzoate (3CBA) (Don et al. , 1985) and 2methyl4 chlorophenoxyacetic acid (MCPA) (Pieper et al. , 1988). The initial degradation steps of 2,4D and MCPA involve an oxidation at the ether bond by means of an αketoglutarate dependent dioxygenase (encoded by tfdA ), which leads to the release of glyoxylate and the formation of 2,4 dichlorophenol and 2methyl4chlorophenol, respectively (Streber et al. , 1987 and Pieper et al., 1988) as indicated in (Fig. 9). The chlorophenols from 2,4D and MCPA are then oxidized by a hydroxylase (encoded by tfdB and possibly also by tfdBII ) to form 3,5dichloro and 3methyl5 chlorocatechol, respectively. 3CBA is oxidized at the 1,2 or 1,6position by a benzoate dioxygenase and then dehydrogenated to form approximately twothirds 3chloro and onethird 4chlorocatechol (Pieper et al., 1993). tfdA and tfdB are located on the plasmid (pJP4) Streber et al., 1987; Perkins et al., 1990 and Schlömann,2002), whereas the genes for conversion of 3CBA to chlorocatechol are presumed to be chromosomally located (Laemmli et al. , 2002, 2004).

64 Literature Review

Figure (9): Metabolic pathways for 2,4dichlorophenoxyacetic acid (2,4D), 2methyl 4chlorophenoxyacetic acid (MCPA) and 3chlorobenzoate by Ralstonia eutropha JMP134 (pJP4). Individual intermediates in each of the pathways are displayed as far as known, with assignment of the respective Tfdenzymes catalyzing the reaction. For simplicity, not all intermediate steps in muconate conversion are drawn. The pathway for MCPA degradation follows that of 2,4D and the position of the methyl group in MCPA and its intermediates is shown within parentheses . Details of the reactions catalyzed by TfdE and TfdEII with chloro or methyldienelactones are not known. TfdA α Ketoglutaratedependent dioxygenase, TfdB(BII) chlorophenol hydroxylase, TfdC(CII) chlorocatechol 1,2dioxygenase, TfdD(DII) chloromuconate cycloisomerase, TfdE(EII) dienelactone hydrolase, TfdF(FII) maleylacetate reductase (Laemmli et al., 2004). 65 Literature Review

Zhang and Wiegel (1990) indicated that 2, 4dichlorophenol could be degraded anaerobically in freshwater sediments as in Fig. (10).

Figure (10): Proposed pathway for the degradation of 2,4DCP enrichment cultures for the proposed sequential steps are described in the figure. Data are from Zhang and Wiegel (1990).

66 Literature Review

Chlorobenzenes are substrates not easily metabolized by existing bacteria in the environment. Specific strains, however, have been isolated from polluted environments or in laboratory selection procedures that use chlorobenzenes as their sole carbon and energy source. Genetic analysis indicated that these bacteria have acquired a novel combination of previously existing genes. One of these gene clusters contains the genes for an aromatic ring dioxygenase and a dihydrodiol dehydrogenase. The other contains the genes for a chlorocatechol oxidative pathway (van der Meer, 1997).

Figure (11): Proposed catabolic pathway of chlorobenzene by P. putida GJ31 by analogy to the known metacleavage pathway. Enzymes: 1, chlorobenzene dioxygenase; 2, chlorobenzene dihydrodiol dehydrogenase; 3, catechol 2,3 dioxygenase; 4, oxalocrotonate isomerase; 5, oxalocrotonate decarboxylase; 6, 2 oxopent4enoate hydratase; 7, 4hydroxy2oxovalerate aldolase. Enzymes 2, 3, and 5 have been detected, while 3chlorocatechol and pyruvate were determined to be intermediates (van der Meer, 1997).

Organisms able to use CBz as sole carbon and energy sources produced a chlorocatechol as an intermediate by the action of a chlorobenzene 1,2dioxygenase and a dehydrogenase. The chlorocatechols are usually further degraded via a modified orthocleavage pathway involving an intradiol dioxygenase (Reineke and Knachmuss, 1988; van der Meer et al ., 1991c, 1992; Sommer and Görisch, 1997 and Mars et al ., 1997,1999), or alternatively through a metacleavage pathway (Bartels et al ., 1984; Arensdorf and Focht, 1994 and Mars et al ., 1999).

67 Literature Review

Both types of pathways lead to intermediates of central metabolic routes, such as the tricarboxylic acid cycle (TCA) (Adebusoye et al., 2007).

Figure (12): Proposed pathways for the degradation of 1,2,4TCB, 1,2DCB, and 1,4 DCB by Pseudomonas sp. strain P51. The structural genes located on plasmid pP51 encoding the intermediate conversion steps are indicated. A, tcbA (dioxygenase); B, tcbB (dehydrogenase); C, tcbC (catechol 1,2dioxygenase II); D, tcbD (cycloisomerase II); E, tcbE (hydrolase II). Further metabolism of chloromaleylacetic acid is probably chromosomally encoded and is indicated by the dashed arrow. (Cl), Proposed position of the residual chlorine atom of 1,2,4TCB (van der Meer et al., 1991c).

68 Literature Review

All biochemical evidence indicates that the first transformation steps are performed by a multicomponent dioxygenase which catalyzes the NADH dependent conversion of chlorobenzenes to cis chlorobenzene dihydrodiols, and a dihydrodiol dehydrogenase which catalyzes the (formal) oxidation of the chlorobenzene dihydrodiol to chlorocatechol with concomitant reduction of NAD +. The chlorocatechols formed from chlorobenzenes are subsequently converted to 3oxoadipate by the activity of (probably) four enzymes: Chlorocatechol 1,2dioxygenase, chloromuconate cycloisomerase, dienelactone hydrolase and (chloro) malelyacetate reductase. At least two chlorine atoms can be removed during these steps, either spontaneously or mediated by the activity of chloromuconate cycloisomerase and maleylacetate reductase (Schlömann, 1994; Vollmer et al., 1994; Kasberg et al., 1995; Kaschabek and Reineke, 1995 and van der Meer, 1997). The operation of the orthocleavage pathway results in mineralization of chlorinated benzenes without the accumulation of chlorocatechols. Mineralization proceeds via different pathways, depending on the organism and on the position of the chlorine atoms. However, the most common pathway for dichlorobenzene isomer biodegradation can be categorised into five main steps: 1. Dichlorobenzene isomers are converted to a dihydrodiol by a dichlorobenzene dioxygenase enzyme. 2. A dehydrogenase converts the dihydrodiol to a chlorocatechol. 3. The chlorocatechol is then degraded by a nonspecific Type II dioxygenase to form a dichloromuconic acid. 4. Chloromuconate cycloisomerases usually generate dienelactones from chloromuconates. These are then hydrolysed by dienelactone hydrolases to give maleylactates. 5. Maleylactates are reduced to 3oxoadipic or betaketoadipic acid, which may still be chlorinated. Once dechlorinated, these metabolites are then converted to intermediates of the tricarboxylic acid (TCA) cycle for normal metabolism.

69 Literature Review

The operation of the orthocleavage pathway results in mineralization of chlorinated benzenes without the accumulation of chlorocatechols (Guerin, 2008 and MarcoUrrea et al., 2009). 2,4,6trichlorophenol (2,4,6TCP) was successfully and completely degraded in a twostage anaerobicaerobic biological process in which the initial step was conducted anaerobically, resulting in the reductive dechlorination of the target compound to 2,4dichlorophenol (2,4DCP), and then 4chlorophenol (4CP) (Armenante et al ., 1999).

The growth of R. opacus 1G on 2,3,5 trichlorophenol showed that its phenol hydroxylase catalyzes the oxidative dechlorination of 2,3,5 trichlorophenol at the ortho position, which produces 3,5dichlorocatechol (Bondar et al ., 1999). Such oxidative dechlorination at the ortho position makes this phenol hydroxylase exceptional, since all chlorophenol o hydroxylases studied so far prefer monooxygenation of the non halogenated ortho position. Degradation of pentachlorophenol by the strains Rhodococcus sp. CG1 and Rhodococcus sp. CP2 proceeds via para hydroxylation producing tetrachlorohydroquinone (Häggblom et al ., 1988). Tetrachlorohydroquinone is then completely dechlorinated through another hydroxylation and three reductive dechlorinations producing trihydroxybenzene, which is a substrate for aromatic ring cleavage (Häggblom et al ., 1989 and Martinková et al ., 2009). Two distinct biological systems capable of biodegrading PCBs have been identified: aerobic oxidative processes and anaerobic reductive processes (Abramowicz, 1990 and Patureau and Trably, 2006). The aerobic bacterial biodegradation of PCBs has been well studied (Abramowicz, 1995). Several microorganisms have been isolated that can aerobically degrade PCBs, preferentially degrading the lowest chlorinated congeners (Moeder et al ., 2005 and Pieper, 2005). These organisms attack PCBs via the wellknown 2,3dioxygenase pathway, converting PCB congeners to the corresponding chlorobenzoic acids (Seeger et al., 1997 and Sobiecka et al ., 2009). 70 Literature Review

The aerobic degradation of polychlorinated phenols follows a series of hydroxylation dehalogenation reactions before ring breakdown (Fetzner and Lingens, 1994 and Ronen et al ., 2000). The principal means for microbial degradation of polychlorinated biphenyls (PCBs) is through the biphenyl pathway. Although molecular aspects of the regulation of the biphenyl pathway have been studied, information on environmental facts such as the effect of alternative carbon sources on (polychlorinated) biphenyl degradation is limited. Genome wide expression patterns reveal 25 genes commonly up regulated during PCB degradation and growth on biphenyl to be upregulated in the transition to stationary phase (relative to growth on succinate) including two putative detoxification pathways. Quantitative reverse transcription PCR (QRTPCR) analysis of the upper biphenyl pathway ( bphA,bphD, and bphR1), and detoxification genes in response to environmental conditions suggest associated regulation of the biphenyl pathway and chloroacetaldehyde dehydrogenase. The response of genes in the upper biphenyl pathway to carbon source competition and growth phase reveals inhibition of the biphenyl pathway by PCBs. Although PCBs are not degraded during growth on succinate with PCBs, expression data indicate that the biphenyl pathway is induced, suggesting that post transcriptional regulation or active transport of biphenyl may be limiting PCB degradation. Identification of the involvement of peripheral pathways in degradation of PCBs is crucial to understanding PCB degradation in an environmental context as bacteria capable of biodegradation experience a range of carbon sources as growth phases (Parnell et al., 2010). Although the metabolism of chlorinated aromatics has been the focus of research for decades, novel metabolic capabilities are still being discovered (Pieper et al ., 2004).

71 Materials and Methods

MATERIALS AND METHODS

2.1. Materials:

2.1.1. Sampling Sites:

oil and sludge samples were collected from deposits of petroleum S field which are either chronic or recent from the Cairo Oil Refining Company, AlQalyubiyah, Egypt as indicated in Fig. (13). And from agricultural regions around the company as indicated in Table (1). The agricultural soils have a history of pesticide exposure.

Al -Qalyubiyah

Mostorod

Figure (13): Sampling site map.

2.1.2. Sampling:

Soil samples and sludge of waste water were collected from 5 to 30 cm below the surface with sterilized soil cores and the top 5 cm of the sample was discarded. The soil cores were placed in sterile plastic bags, shipped on ice and stored at 4°C to be used within 4 hours.

72 Materials and Methods

Water samples were collected in 250 ml screw capped sterile glass bottles and transported on ice.

Table (1): Sampling sites represented different sources of indigenous microbial communities.

Distance Sample Location of Type of Depth of Site in far from pH (No.) sample soil sample Egypt deposit

Depository of Chronic 1 petroleum Zero meter Surface 4.99 soil field

Depository of Recent soil 2 petroleum Zero meter Surface 4.76 h field

Depository of Chronic 30 cm 3 petroleum Zero meter 5.40 soil depth field

Drainage of Chronic 30 cm 4 200 meter 4.90 waste solar sludge depth

Depository of Recent 30 cm 5 petroleum soil 300 meter 5.40 depth field

Depository of Chronic 6 petroleum 200 meter Surface 5.11 soil field Cairo Oil Refining Company Mostorod ALQalyubiya Agriculture Chronic 7 400 meter Surface 5.49 soil soil

Agriculture Chronic 30 cm 8 400 meter 5.54 soil soil depth

73 Materials and Methods

2.1.3. Media: 2.1.3.1. Low Chlorine Medium (for adaptation): (Schraa et al ., 1986)

This medium consists of the following ingredients (g/L):

Na 2HPO 4. 2H2O 1.4

KH 2PO 4 0.7

NH 4Cl 0.3

MgSO 4.7H20 0.1

CaCl 2.2H2O 10 mg

NaNO 3 1.0 Yeast extract 2.5 mg

For use, the following supplements were added to 1 Liter of the cooled basal medium.

• 1 ml of Trace element. • 0.1 ml of Vitamin solution. Trace element: mg/L

H3BO 3 0.3

CoSO 4 0.4

ZnSO 4.7H2O 0.1

MnCl 2.4H2O 0.03

NaMoO 4.2H2O 0.03

NiSO 4.6H2O 0.02

CuSO 4.5H2O 0.01 HCl 50 ml Deionized water 950 ml

74 Materials and Methods

Vitamin solution: mg/L

Biotine 2.0 Folic acid 2.0 Pyridoxal hydrochloride 10.0 Riboflavine 5.0 Thiamine 5.0 Nicotonic acid 5.0 CaPanthothenate 5.0 Cyanocobalamine 5.0 Paminobenzoic acid 5.0 Deionized water 1000 ml

2.1.3.2. Basal Salt Medium (BSM): (Ogawa and Miyashita, 1995)

This medium consists of the following ingredients (g/L):

(NH 4)2SO 4 1.1

K2HPO 4 2.2

KH 2PO 4 0.9

MgSO 4.7H2O 0.1

MnSO 4.6H2O 0.025

FeSO 4.7H2O 0.005 Lascorbic acid 0.005 Deionized water 1000 ml

For use, the following supplements were added to 1 liter of the cooled basal medium.

• 1 ml of Trace elements. • 0.1 ml of Vitamin solution.

75 Materials and Methods

2.1.3.3. LuriaBertani broth medium: (Martin et al ., 1981)

This medium consists of the following ingredients (g/L):

Tryptone 10.0 Yeast extract 5.0 NaCl 5.0 Distilled water 1000 ml

The pH was adjusted to 7.1 + 0.2.

2.1.4. pH Determination: (Fulthorpe et al., 1996)

For each sample, the pH determination has done. A slurry was made by vortexing 1 gram of soil in 5 ml of deionized water for 1 minute.

2.1.5. Protein Determination: (Lowry et al., 1951)

To determine the amount of soluble protein in any culture of the chloroaromatic degrading bacteria, the following solutions must be prepared:

Sol. (A) Cupper sulphate 1.0 %

Sol. (B) Sodium potassium tartarte 2.0 %

Sol. (C) sodium carbonate 2.0% + Sodium hydroxide 0.4 %

Five ml of the reaction solution was added to 1ml of the diluted enzyme (sample) of the culture and distilled water as a blank. Then the mixture was allowed to stand at room temperature for 10 min. After that 0.5 ml of Folin reagent was added. The reaction tubes were incubated at room temperature for 20 min. The absorbance was

76 Materials and Methods determined at 720 nm. To determine the concentration of the protein in the samples, a standard curve of Bovine serum albumin (BSA) was determined.

2.1.6. Chloride Ion Determination: (Bergmann and Sanik, 1957)

To determine small quantities of chloride in aqueous solution of any culture of chloroaromatic degrading bacteria.

Two ml aliquot of the chloride solution obtained from the bacterial culture is transferred to a clean test tube. 0.2 milliliters of a 0.25M ferric ammonium sulfate (Fe (NH 4) (SO 4)2 . 12 H 2O) solution in 9M nitric acid is added, followed by 0.2 milliliters of a saturated solution of mercuric thiocyanate in ethyl alcohol.

The solutions are mixed, diluted to volume with 0.1 milliliter water and mixed again. A distilled water as blank is treated in the same manner. Ten minutes after developing the color, the absorbance is measured in spectrophotometer at 480 nm.

To determine the concentration of chloride ion in the samples, a standard curve of sodium chloride solution was determined.

2.1.7. Chemicals:

3Chlorobenzoic acid, 2,4Dichlorophenol, 1,2,4Trichlorobenzene and mercuric thiocyanate were obtained from Aldrich, Germany.

2,6Dichlorophenol indolphenol (Dye), ferric nitrate and nitric acid were obtained from ElGomhoria Company, Egypt.

Chloroform, methanol and acetonitrile were HPLC grade, obtained from BDH, England.

77 Materials and Methods

2.1.8. Source of Gamma Radiation:

The Indian chamber of Cobalt60 located at the National Center for Radiation Research and Technology (NCRRT), Nasr City, Cairo, Egypt was used for the irradiation treatments. The source was giving 1 KGy/15 min. at the time of experiment at room temperature.

2.1.9. Bacterial Strains:

2.1.9.1. Bacillus cereus ATCC 11778

2.1.9.2. Enterobacter cloaceae MAM4, isolated from waste water contaminated with heavy metals, Cairo, Egypt.

2.1.9.3. Provdincia rettegri MAM4, isolated from wastewater of El Shaba factory, Ismalia canal, Egypt.

The three strains were kindly provided by Dr. Mervat AboState.

2.1.10. High Performance Liquid Chromatography (HPLC):

The quantitative determination of various chloroaromatic compounds was performed using HighPerformance Chromatography (HPLC) in Egyptian Petroleum Research Institute CairoEgypt.

The various chloroaromatic compounds were quantified by (HPLC pump No. 2360, gradient programmer No. 2360 and detector No. UA5 with a 280nm fitter [Isco, Inc.]; integrator No. SP4600 [SpectraPhysics]; and HPLC auto sampler No. 738 [Alcott Chromatography] with the 150 mm reversed phase column hypersil ODSC18, 5m, [Altech; No. 9876]). The mobile phase consisted of methanol, water and 0.5% acetic. The methanol/water ratio varied from 70:30 to 5:95 (Utkin et al ., 1995).

78 Materials and Methods

2.1.11. Gas Chromatographic/Mass Spectrometry (GC/MS):

The qualitative and quantitative determination of various chloroaromatic compounds was performed using Gas Chromatographic/ Mass Spectrometry (GC/MS) in Central Water Quality Laboratory Holding Company for Water and Waste Water CairoEgypt.

The GC is a 3800 Varian USA, EIITS 1200L Varian USA (Electron Impact Ion Source, Quadrupole MS, and EMD Detector). The capillary column was a VF5MS capillary (30m × 0.25mm i.d., 0.25m film thickness). Helium 5.0 was used as carrier gas for the system (75Psi, 1ml min 1). The chromatographic temperature programme for GCMS was: start (t = 0) at 60 0C followed by a 10 0C min 1 increase to 160 0C and 4250 0C maintaining this final temperature for 10 min. Temperature of the injector was set to 250 0C, transfer line: 270 0C. The injection volume was 1l in the splitless mode.

A measured volume of sample, approximately 1liter, is serially extracted with methylene dichloride at a pH greater than 11 and again at a pH less than 2 using a seperatory funnel or a continuous extractor. The methylene dichloride extract is dried, concentrated to a volume of 1ml, and analyzed by GC/MS. Qualitative identification of the parameters in the extract is performed using the retention time and the relative abundance of three characteristic masses (m/z). Quantitative analysis is performed using internal standard techniques with a single characteristic m/z (Hung and Thiemann, 2002).

79 Materials and Methods

Figure (14): GC/MS apparatus.

2.2. Methods:

2.2.1. Cultivation of samples in low chlorine medium:

Soil samples and sludge (25 gram) or (25 ml) of water samples were added to (100 ml) of low chloride mineral medium, and incubated overnight in shaking incubator at 30°c with 150 rpm for adaptation of the microbial communities (indigenous, mixed bacteria). Then, the solid particles were allowed to sediment, to be used for inoculation of BSM (Juhasz and Naidu, 2000).

2.2.2. Growth of different microbial communities on different chloroaromatic compounds:

From the preadapted microbial communities, 10 ml was used to inoculate 100 ml of BSM, which was free from any chloride ions. The BSM was amended by 1mM of 3chlorobenzoic acid (3CBA), 2,4 dichlorophenol (2,4DCP) or 2,6Dichlorophenol indolphenol (2,6DCPP) 80 Materials and Methods as a sole carbon and energy source. In case of 1,2,4Trichlorobenzene (1,2,4TCB) BSM was amended by 15 M. Three replicates were used for each treatment.

Growth was determined by measuring Optical Density (O.D) at 600 nm periodically at zero time (initial), 7, 15 and 28 days, Protein was determined at 720 nm. periodically at zero time (initial), 7, 15 and 28 days, using spectrophotometer (LWV200RS UV/VIS, Germany). Also bacterial count (CFU/ml) by spreading the serially appropriate diluted cultures on L.B agar medium after 28 days incubation period was determined, which incubated at 37°C for 48 hours.

2.2.3. Determination of the total bacterial and chloroaromatic degrading bacterial count:

The preadapted microbial communities of the different sources were serially diluted and the appropriate three successive dilutions were plated on L.B agar plates and BSM agar plates amended with a mixture of chloroaromatic compounds (330M for each of 3chlorobenzoic acid, 2,4 dichlorophenol and 2,6dichlorophenol indol phenol plus 10M of 1,2,4 trichlorobenzene). The inoculated plates were incubated at 37 0C for 48 hours for L.B plates and for 7 days for the chloroaromatic degrading bacterial (CDB) plates. The bacterial count was determined.

2.2.4. Isolation of different bacterial strains capable of growing on chloroaromatic compounds:

The well grown bacterial colonies on BSM amended with mixture of chloroaromatic compounds were picked up as a separated single colonies. These colonies were called CDB. They stored on slants of L.B medium for further investigation at 40C.

81 Materials and Methods

2.2.5. Screening for the most promising indigenous chloroaromatic degrading bacterial isolates:

The well grown CDB isolates, which are thirtyfour strains, were streaked on BSM agar plates amended with one of the four different chloroaromatic compounds. The plates was amended with three concentrations (2, 3, 5mM) for 3chlorobenzoic acid or 2,4 dichlorophenol, (1, 2mM) for 2,6dichlorophenol indol phenol and (25, 50, 75M) for 1,2,4trichlorobenzene. Three plates were used for each concentration of each compound for each isolate. The plates were incubated at 37 0C. The growth was shaked every day for 15 days.

2.2.6. Characterization of the most promising CDB isolates:

The most five promising CDB isolates, that have the ability to grow on the different concentrations of different chloroaromatic compounds were characterized and investigated for Gram stain with light microscope Leica, LEITZ, LABOR LUXS, Germany.

2.2.7. Determination of the best isolate has the ability to degrade different chloroaromatic compounds:

The five most promising CDB isolates and Enterobacter cloaceae MAM4 were grown on L.B broth media for 48 hours in a shaking incubator (150 rpm) at 37 0C. The well grown cultures were centrifuged at 8000 rpm for 10 min. The pellets were washed twice with BSM. The washed pellets were suspended in BSM and used for inoculation of BSM amended with five different concentrations for each chloroaromatic compound.

Fifteen ml of each of the six selected isolated bacterial strains was used to inoculate 150 ml of BSM, which was free from any chloride ions.

82 Materials and Methods

The BSM was amended by five different concentrations from the different chloroaromatic compounds, (20, 100, 500 M, 1, 2mM) for 3 chlorobenzoic acid, 2,4dichlorophenol or 2,6dichlorophenol indolphenol as a sole carbon and energy source. In case of 1,2,4trichlorobenzene BSM was amended by (5, 10,15, 25, 50 M). Three replicates were used for each treatment.

Growth was determined by measuring Optical Density (O.D) at 600 nm periodically at zero time (initial), 1, 2, 3, 4, 5, 6, 7, 15 and 21 days, Protein was determined at 720 nm. periodically at zero time (initial), 1, 2, 3, 4, 5, 6 and 7, 15 and 21 days, Chloride ion was determined at 480 nm. periodically at zero time (initial), 1, 2, 3, 4, 5, 6 and 7, 15 and 21 days, using spectrophotometer (LWV200RS UV/VIS, Germany), Quantitative analysis by High Performance Chromatography were determined at the end of the incubation period (21 days). Also bacterial count was determined, periodically at zero time (initial), 7 and 21 days.

2.2.8. Effect of gamma irradiation on the viability of the selected isolated bacterial strains:

The most promising selected isolated bacterial strain was grown in L.B broth medium for 24 hours at 37°C in shaking incubator (200 rpm). The well grown bacterial cells were harvested by centrifugation at 8000 rpm for 10 minutes, washed with sterile saline, and resuspended in the sterile saline.

Cells suspended in saline were distributed into 5ml aliquots in sterile screw capped test tubes, and then exposed to different doses of gamma irradiation (Indian cell 60 Co) with dose rate 1KGy/15 min., in National Center for Radiation Research and Technology (NCRRT), Nasr City, Cairo, Egypt.

83 Materials and Methods

Three replicates were used for each dose. Survival of these bacterial strains were determined (Dose Response Curve) on L.B agar plates.

2.2.9. Selection of the best mutant has the ability to grow on different chloroaromatic compounds:

Colonies exposed to different doses of gamma irradiation were picked up from the L.B agar plates. The irradiated colonies, which showed any difference in their morphological characters (shape, color, margin, surface, size…, etc.) were collected.

The twentyfive irradiated colonies and the nonirradiated control (parent strain) were grown each in 50 ml L.B broth and incubated at 37 0C for 48 hours in shaking (150 rpm) incubator. The grown cultures were centrifuged at 8000 rpm for 10 min. The pellets were washed twice with sterile BSM.

The washed pellets were suspended in BSM and used to inoculate (10% v/v) BSM amended with 500M of 3chlorobenzoic acid, 2,4 dichlorophenol, 2,6dichlorophenol indol phenol or 25M of 1,2,4 trichlorobenzene. Three replicates were used for each treatment. Growth was determined by measuring O.D at 600nm at the initial and after 7 days.

2.2.10. Comparative study between the wild strain and the mutant strain on their degradability of the different chloroaromatic compounds:

Each of the selected promising wild strain and the mutant strain were grown in L.B broth medium for 24 hours at 370C in shaking incubator (150 rpm). The well grown bacterial cells were harvested by centrifugation at 8000 rpm for 10 min., washed with BSM, and re suspended in the BSM.

84 Materials and Methods

10ml was used to inoculate 100ml of BSM, which was free from any chloride ions. The BSM was amended by 500M of 3chlorobenzoic acid, 2,4dichlorophenol, 2,6dichlorophenol indolphenol and 25M of 1,2,4trichlorobenzene. Three replicates were used for each treatment.

Growth was determined by measuring Optical Density (O.D) at 600 nm periodically at zero time (initial), 1, 2, 3, 4, 5, 6, 7 days, Protein was determined at 720 nm. periodically at zero time (initial), 1, 2, 3, 4, 5, 6 and 7 days, Chloride ion was determined at 480 nm. periodically at zero time (initial), 1, 2, 3, 4, 5, 6 and 7 days, using spectrophotometer (LWV 200RS UV/VIS, Germany). Qualitative and quantitative analysis by gas chromatographic/mass spectrometry (GC/MS) were determined after 24 and 48 days of incubation.

2.2.11. Identification of the most promising isolated strain (wild strain):

2.2.11.1. Phenotypic characterization of chloroaromatic degrading bacterial strain:

Colony morphology of the isolated most potent chloroaromatic degrading strain (MAM24) was assessed by monitoring their growth on L.B agar plates. Cellular morphology was examined by light microscope Leica, LEITZ, LABOR LUXS, Germany.

2.2.11.2. DNA extraction:

Genomic DNA was extracted from pure bacterial culture; 24 hr grown in LuriaBertani (L.B) media at 37oC, centrifuged for 2 min. Bacterial lysis was performed according to the manufacturer's instructions using The GeneJET TM genomic DNA purification kit (Fermentas life sciences, EU). The obtained purified DNA was resuspended in 100 l of TE buffer (Sambrook and Russel, 2001). 85 Materials and Methods

2.2.11.3. PCR amplification of bacterial 16SrRNA :

Oligonucleotide primers were used to amplify 16SrRNA. The universal primers: PA forward: AGAGTTTGATCCTGGCTCAG and PH reverse: AAGGAGGTGATCCAGCCGCA (synthesized in Korea) were used to amplify the 16SrRNA. 16SrRNA was amplified from the obtained DNA in a reaction mixture of PCR conditions were as follows: 10xTaq buffer, 1.25 U Ampli Taq Gold DNA Polymerase (Fermentas,

EU), 2mM dNTP mixture, 25mM MgCl 2, 0.7 g DNA, doubledistilled water mixed in a final volume of 50 l. The program for PCR was as follows: the initial denaturation at 95 oC for 5 min, followed by 30 cycles of 95 oC for 1 min, annealing at 55 oC for 1 min, and 72 oC for 2 min, and final extension at 72 oC for 7 min (Edwards et al., 1989). Amplification was done using Perkin Elmer GeneAmp PCR system 2400 (Germany). Analysis of the PCR products was performed by electrophoresis on 1% agarose gels using standard conditions according to Sambrook and Russel (2001).

2.2.11.4. Cloning and sequencing:

16SrRNA PCR product was extracted from gel using gel extraction kit QIAquick Qiagen (Promega, USA). DNA sequencing was conducted using ABI Prism BigDye TM Terminator Cycle Sequencing Ready Reaction Kit (Applied Biosystems, USA) according to manufacturer's instructions. ABI Prism TM 3730/3730XL DNA Sequencer (AME Biosciences, USA).

2.2.11.5. Phylogenetic analysis:

The 16SrRNA DNA sequence was submitted to the National Center for Biotechnology Information (NCBI) database and the sequence

86 Materials and Methods was compared to other available 16SrRNA sequences using an automatic alignment tool (Blastn). The construction of the phylogenetic tree was generated by PhyML and the visualization of the tree by TreeDyn using the online program www.phylogeny.fr. The bootstrap values were obtained by drawing a tree using netwick generated file using the molecular evolutionary genetics analysis MEGA 5 program (Kumar et al ., 2008).

2.2.11.6. Nucleotide sequence accession number:

The 16SrRNA sequence was deposited in the NCBI Gene Bankit nucleotide sequence database under accession number HQ013329.

87 Results and Discussion RESULTS AND DISCUSSION

he soil and sludge samples collected from Cairo Oil Refining T Company and agriculture soils near this company have been used to isolate their microbial communities (Indigenous mixed bacteria) to investigate their ability to grow and degrade the chosen chloroaromatic compounds [3chlorobenzoic acid (3CBA), 2,4dichlorophenol (2,4 DCP), 2,6dichlorophenol indol phenol (2,6DCPP) and 1,2,4 trichlorobenzene (1,2,4TCB)] as a sole carbon and energy source.

The eight different indigenous bacterial communities as indicated in Table (1) were isolated from recent and chronic soils at different distances and different depths. The chronic soil had a 41 years exposure history for deposition of petroleum wastes. While the agriculture soils had in addition to contamination with petroleum hydrocarbons a history to exposure to pesticides.

Growth of bacterial community (1) was the best growth on 1mM of 3CBA as indicated in Table (2) and Fig. (15). The growth of this bacterial community was 4.7 times the initial after 7 days incubation. This growth increased and the incubation period increase to be 5 times of the initial after 15 days.

As the incubation period increased more the growth decreased to be 3.9 times. Also the extracellular protein determinations revealed that communities 1 and 2 still expressed the protein in high concentrations even after 28 days incubation, while the other communities secreted the highest extracellular protein at 7 days incubation and decline had been notice after that as indicated in Fig. (16).

88 Results and Discussion

Table (2): Growth & concentration of extracellular protein of different bacterial communities on 1 mM of 3 chlorobenzoic acid (3CBA).

Zero Time After 7 Days After 15 Days After 28 Days Bacterial communities O.D. Protein O.D. Protein O.D. Protein O.D. Protein (Sample No.) I/Io I/Io I/Io (Io) (g/ml) (I) (g/ml) (I) (g/ml) (I) (g/ml)

1 0.165 63.00 0.775 4.69 60.00 0.822 4.98 5.00 0.640 3.87 165.00

2 0.518 71.00 0.878 1.69 65.00 0.818 1.57 5.00 0.931 1.79 188.00

3 0.417 47.00 0.431 1.03 66.00 0.658 1.57 5.00 0.820 1.96 5.00

4 0.417 36.00 0.853 2.04 129.00 1.344 3.22 5.00 0.968 2.32 10.00

5 0.776 45.00 0.969 1.24 71.00 1.263 1.62 6.00 1.294 1.66 8.00

6 0.702 31.00 0.939 1.33 98.00 1.215 1.73 6.00 1.048 1.49 7.00

7 1.164 42.00 1.373 1.17 99.00 1.344 1.15 5.00 0.813 0.69 10.00

8 1.562 47.00 1.604 1.02 90.00 1.794 1.14 6.00 1.746 1.11 8.00

89 Results and Discussion

0 7 15 28

Figure (15): Growth of different bacterial communities on 1mM of 3 chlorobenzoic acid (3CBA).

0 7 15 28

Figure (16): Concentration of extracellular protein of different bacterial communities on 1mM of 3chlorobenzoic acid (3CBA).

90 Results and Discussion

The ability of community (1) to grow on 1mM of 2,4DCP was 2.6 times of the initial after 7 days increased to 2.8 after 15 days and continue its increase to be 3.2 after 28 days. This community was the best in growth on 2,4DCP as indicated in Table (3) and Fig. (17).

Community (2) was the second in growth, as the incubation period increased from 7 to 15 days, the growth increased from 2.0 to 2.2 times of the initial. However this community continues the secretion of extracellular protein till 28 days as indicated in Fig. (18). The growth of community (3) increased as the incubation period increased to reach 2.5 times of the initial at 28 days. The other communities also increased as the incubation period increased.

Growth of different bacterial communities on 2,6DCPP had an exceptional behavior because the interference between growth and color of the chlorinated compound (blue color). As the growth increased, the color of the compound as a sole carbon and energy source decreased. So the reading of the O.D was the sumission of turbidity increase and color disappearance due to degradation of the compound as indicated in Table (4) and Fig. (19).

However, the extracellular protein of communities (1,2 and 3) increased till 28 days incubation period indicated activity of these communities along this period as indicated in Table (4) and Fig. (20).

91 Results and Discussion

Table (3): Growth & concentration of extracellular protein of different bacterial communities on 1mM of 2,4 dichlorophenol (2,4DCP).

Bacterial Zero Time After 7 Days After 15 Days After 28 Days Communities O.D. Protein O.D. Protein O.D. Protein O.D. Protein (Sample No.) I/Io I/Io I/Io (Io) (g/ml) (I) (g/ml) (I) (g/ml) (I) (g/ml) ٢٠٧٠٠ 3.15 ٠٥٤٣ ٥٠٠ 2.76 ٠٤٧٦ ٨٠٠٠ 2.62 ٠٤٥١ ٥٧٢٠٠ ٠١٧٢ 1 ٨٤٦٠٠ 1.95 ٠٩٥١ ٥٠٠ 2.17 ١٠٥٨ ٨٥٠٠ 2.03 ٠٩٩١ ٥٧١٠٠ ٠٤٨٧ 2 ٨٠٠ 2.54 ١٤٦٨ ٥٠٠ 1.64 ٠٩٤٨ ٨٢٠٠ 1.13 ٠٦٥٤ ٤١١٠٠ ٠٥٧٦ 3 ٦٠٠ 1.45 ١٩٣٨ ٧٠٠ 1.22 ١٦٣٣ ١٥٦٠٠ 1.37 ١٨٢٩ ٦٤٥٠٠ ١٣٣٢ 4

٤٠٠ 1.72 ١٧٩٠ ٥٠٠ 1.20 ١٢٥٢ ٥٩٠٠ 1.09 ١١٣٧ ٥٣٢٠٠ ١٠٣٥ 5 ٣٠٠ 2.07 ١٥١٨ ٤٠٠ 1.31 ٠٩٦٧ ٥٢٠٠ 1.15 ٠٨٤٨ ٤٩٣٠٠ ٠٧٣٣ 6 ٤٠٠ 1.54 ١٦٤٣ ٤٠٠ 1.56 ١٦٦٥ ٣٨٠٠ 1.37 ١٤٥٩ ٢٦٩٠٠ ١٠٦٤ 7 ٣٠٠ 1.36 ١٥١٤ ٤٠٠ 1.29 ١٤٣١ ٤٨٠٠ 1.17 ١٣٠٤ ٣٦٩٠٠ ١١٠٦ 8

92 Results and Discussion

0 7 15 28

Figure (17): Growth of different bacterial communities on 1mM of 2,4 dichlorophenol (2,4DCP).

0 7 15 28

Figure (18): Concentration of extracellular protein of different bacterial communities on 1mM of 2,4dichlorophenol (2,4DCP).

93 Results and Discussion

Table (4): Growth & concentration of extracellular protein of different bacterial communities on 1mM of 2,6

dichlorophenol indol phenol (2,6DCPP).

Bacterial Zero Time After 7 Days After 15 Days After 28 Days Communities O.D. Protein O.D. Protein O.D. Protein O.D. Protein (Sample No.) I/Io I/Io I/Io (Io) (g/ml) (I) (g/ml) (I) (g/ml) (I) (g/ml) ٢٣٩٠٠ 0.59 ٠٨٤٠ ٧٠٠ 0.75 ١٠٦٠ ١٣٥٠٠ 0.88 ١٢٤٢ 198.00 ١٤٠٩ 1 ٢٢٥٠٠ 0.63 ٠٨٩٩ ٦٠٠ 0.84 ١١٩١ ١٣٦٠٠ 0.81 ١١٥٦ ٢٦٥٠٠ ١٤١٣ 2 ٥٠٠٠٠ 0.51 ٠٨٤٢ ٧٠٠ 0.56 ٠٩٣٧ ١٣٦٠٠ 0.65 ١٠٦٩ ١١٧٠٠ ١٦٤٤ 3 ٧٠٠ 0.40 ٠٩٥٢ ٧٠٠ 0.45 ١٠٩١ ١٢٧٠٠ 0.51 ١٢١٩ ٦٦٢٠٠ ٢٣٧٨ 4 ٦٠٠ 0.42 ١٠٤٥ ٦٠٠ 0.43 ١٠٥٨ ١٣٥٠٠ 0.46 ١١٤٢ ٨٧٠٠ ٢٤٦٠ 5 ٦٠٠٠ 0.77 ١٤٩٥ ٦٠٠ 0.89 ١٧١٤ ١٢٧٠٠ 0.99 ١٩٠٠ ٧٤٠٠ ١٩١٨ 6 ٣٠٠٠ 0.82 ١٨٢٩ ٧٠٠ 0.86 ١٩١٤ ١٢٧٠٠ 0.87 ١٩٢٩ ١٠٣٠٠ ٢٢١١ 7 ٦٠٠٠ 0.64 ١٠٨٦ ٨٠٠ 0.67 ١١٢٤ ١١٨٠٠ 0.68 ١١٤٦ ١١٧٠٠ ١٦٧٢ 8

94 Results and Discussion

0 7 15 28

Figure (19): Growth of different bacterial communities on 1mM of 2,6 dichlorophenol indol phenol (2,6DCPP).

0 7 15 28

Figure (20): Concentration of extracellular protein of different bacterial communities on 1mM of 2,6dichlorophenol indol phenol (2,6DCPP).

95 Results and Discussion

Growth of different bacterial communities on 1,2,4TCB was indicated in Table (5) and Fig. (21). The results revealed that the best growing community was community (1). After 7 days the growth was 3.9 times of the initial after 14 and 28 days the growth was 3.8 and 3.2 times. This indicated that growth of community (1) on 1,2,4TCB reached its maximum growth after 7 days, as the incubation period increased, the growth decreased.

On the other hand community (3 and 4) the growths continue increased as the incubation period increased to reach 3.5 and 2.0 times of the initial at 28 days respectively. The results of extracellular protein revealed that communities (1 and 2) secreted the highest protein till 28 days as indicated in Table (5) and Fig. (22).

From the previous results, it's clear that community (1) was the best community in the growth on different chloroaromatic compounds used in this study. Also community (1) secretes the highest extracellular protein on the four compounds till the end of incubation period (28 days) indicating activity of the community along this period. Also the same phenomena had been noticed for communities (2, 3) for expressing protein even after 28 days incubation. This may be attributed to the distance from deposition of petroleum wastes, the three communities were results of contaminated soils at zero meter (at the same place of deposition). However, communities (1 and 3) were chronic soil samples, while community (2) was resulted from recent contaminated soil samples.

On the other hand, communities (1 and 2) were from surface soil samples, while community (3) was from soil samples at 30cm depth. So, it is clear that the corner stone in contamination with petroleum wastes was the distance from deposition.

96 Results and Discussion

Table (5): Growth & concentration of extracellular protein of different bacterial communities on 15M of 1,2,4 trichlorobenzene (1,2,4TCB).

Bacterial Zero Time After 7 Days After 15 Days After 28 Days Communities O.D. Protein O.D. Protein O.D. Protein O.D. Protein (Sample No.) I/Io I/Io I/Io (Io) (g/ml) (I) (g/ml) (I) (g/ml) (I) (g/ml) ١٥٥٠٠ 3.15 ٠٤٣٢ ٥٠٠ 3.83 ٠٥٢٦ ٨٥٠٠ 3.86 ٠٥٣٠ ٥٢٠٠ ٠١٣٧ 1 ١٤٥٠٠ 1.81 ٠٧٦٨ ٤٠٠ 2.00 ٠٨٤٦ ٨٣٠٠ 2.03 ٠٨٥٩ ٣٩٠٠ ٠٤٢٣ 2 ٩٠٠ 3.54 ١٣٧٠ ٥٠٠ 2.55 ٠٩٨٦ ٨٥٠٠ 1.66 ٠٦٤٤ ٥٣٠٠ ٠٣٨٦ 3 ٣٠٠٠ 1.97 ١٧٧١ ٦٠٠ 1.56 ١٤٠٣ ٩٤٠٠ 1.22 ١٠٩٩ ٣٢٠٠ ٠٨٩٧ 4 ٥٠٠ 1.34 ١٥٧٧ ٤٠٠ 1.60 ١٨٨٥ ٥١٠٠ 1.58 ١٨٦٤ ٢٠٠٠ ١١٧٥ 5 ٧٠٠ 0.98 ٠٧٠٣ ٣٠٠ 1.92 ١٣٧٣ ٣٩٠٠ 1.48 ١٠٦٠ ٢١٠٠ ٠٧١٥ 6 ٨٠٠ 1.78 ١٩٦٨ ٤٠٠ 1.58 ١٧٤٨ ٢٦٠٠ 1.51 ١٦٧٤ ٢٠٠٠ ١١٠٣ 7 ١٠٠ 1.22 ١٨٩٧ ٣٠٠ 1.26 ١٩٥٢ ٣٤٠٠ 1.04 ١٦٢٣ ٤٦٠٠ ١٥٤٨ 8

97 Results and Discussion

0 7 15 28

Figure (21): Growth of different bacterial communities on 15M of 1,2,4trichlorobenzene (1,2,4TCB).

0 7 15 28

Figure (22): Concentration of extracellular protein of different bacterial communities on 15M of 1,2,4trichlorobenzene (1,2,4TCB).

98 Results and Discussion

Many investigators deals with soil contaminated with chlorinated compounds and the abilities of their indigenous communities to degrade these contaminating compounds.

The degradation was faster in slurries of garden soil containing 8% organic carbon than in soil with lower content of 2.6%. The indigenous soil populations brought about the degradation of monochlorobenzene when incubated at 27 oC in slurries with 29% (w/w) suspended solids. In contrast, the other chlorobenzenes persisted during an incubation period of 1month (Brunsbach and Reineke, 1994).

The ability to mineralize 3CBA was common property of the microbial communities of undisturbed, pristine soils. And the mineralization of 3CBA by the soil differed with respect to lag phase and overall rates in many of the soil samples. The organisms that carried out the mineralization of 3CBA had different spatial distribution and culturability characteristics (Fulthorpe et al., 1996).

It is reasonable to assume that organic substrates that leach into soils will have a major impact on the species composition and capabilities of the bacterial community (Fulthorpe and Schofield, 1999).

Pavlů et al. , (1999) screened two polychlorinated biphenyl contaminated sites in Czech Republic, a soil at Zamberk and sediment sludge at Milevsko for the presence of chlorobenzoate degraders. Sixteen different chlorobenzoate degraders were isolated from the soil compared with only three strains isolated from the sediment. From these strains, only four soil degraders and one strain isolated from the sediment, respectively, were shown to possess a complete chlorobenzoate (CB) pathway. Bacteria

99 Results and Discussion isolated from the soil have expressed more flexibility for CB degradation, namely in the case of orthochlorinated benzoates.

Four petroleumdegrading bacterial strains, ZTNNB, 6TBXCL, MVK25 and XCK were isolated from various oilcontaminated sites in Vietnam. Determination of the nucleotide sequence of the gene encoding 16s rRNA allowed ZTNNB to be identified as Acinetobacter sp. and the other three stains as Pseudomonas sp. Among the four isolates, ZTNNB was most effective in degrading crude oil: in 1 d, it degraded 95% of the crude oil in the culture medium (5%, v/v) (Huy et al ., 1999).

The axenic cultures of the isolates utilize chlorinated compounds for growth up to 1 gram substrate/L and growth were enhanced in the mixed cultures of the isolates. The dehalogenase specific activity observed in the cellfree extracts of the mixed cultures of the isolates was significantly higher than those of their respective monocultures (Olaniran et al., 2001).

Hickey et al., (2001) found that lateral gene transfer between bacteria can potentially affect a variety of processes in soil including the biodegradation of organic pollutants. Acquisition of catabolic genes can enhance contamination biodegradation by increasing the diversity of organisms able to effect at least partial transformation of compound or expanding on existing pathways so that degradation is more extensive or complete.

Under aerobic conditions 1,2,4TCB was only degrade in low amounts by the indigenous microorganism originated from contaminated aquifer (Dermietzel and Vieth, 2002).

100 Results and Discussion

Growth pattern of bacterial community in minimal salt medium with PCP (100 mg/L) as a sole carbon source indicated that O.D increased from 0.1 to reach 0.3 after 5 days incubation, then decreased to less than 0.2 at 20 days incubation, after that the increase in O.D continued to reach the maximum (0.55) after 280 days (Shah and Thakur, 2002).

The broader definition of xenobiotics includes all compounds that are released in any compartment of the environment by the action of man and thereby occur in a concentration that is higher than natural. Retrospective studies clearly indicate that mobile genetic elements (MGEs) play a major role in the in situ and even de novo construction of catabolic pathways in bacteria, allowing bacterial communities to rapidly adapt to new xenobiotics. The construction of novel pathways seems to occur by an assembly process that involves horizontal gene transfere (Top and Springael, 2003).

The distribution of hydrocarbonutilizing microorganisms is also related to the historical exposure of the environment to hydrocarbons. Those environments with a recent or chronic oil contamination will have a higher percentage of hydrocarbon degraders than unpolluted areas. In ‘‘pristine’’ ecosystems, hydrocarbon utilizers may make up less than 0.1% of the microbial community; and in oilpolluted environments, they can constitute up to 100% of the viable microorganisms (Atlas, 1981 and Venosa and Zhu, 2003).

The degradation capacity of 1,2,4TCB in soil from contaminated site was very high rate up to 62% of the initially applied amount of 1,2,4TCB within 23 days (Schroll et al., 2004).

101 Results and Discussion

Swelam et al. , (2005) investigated that indigenous microbial communities of soil samples were superior in growing on chloroaromatic compounds than that of water samples communities. Indigenous microbial communities were capable of growing on 1,3 and 5mM of 1,4 dichlorobenzene or 4chloroaniline as a best sole carbon and energy source. They also capable of growing on the other chloroaromatic compounds but at a less rate.

Kolar et al. , (2007) isolated the aerobic bacteria enriched from marine sediments, using SMS medium supplemented with polychlorinated biphenyl. Marine sediment samples were collected at urban areas of the Croation Adriatic coast and the addition of biphenyl as the only carbon source had been used in shaked cultures in seawater mineral salt (SMS) medium. All enriched mixed cultures demonstrated the capability to use biphenyl.

The efficiency of Bacillus subtilis DM04 and Pseudomonas aeruginosa M and NM strains isolated from a petroleum contaminated soil sample from NorthEast India was compared for the biodegradation of crude petroleumoil hydrocarbons in soil and shake flask study. These bacterial strains could utilize crude petroleumoil hydrocarbons as sole source of carbon and energy. The results showed that B. subtilis DM04 and P. aeruginosa M and NM strains could be effective for in situ bioremediation (Das and Mukherjee, 2007).

Also Wang et al., (2007) isolated bacteria from a soil which has been polluted with chlorinated benzene for more than 25 years and adapted. A microbial community was enriched from this soil and acclimated in liquid culture under aerobic condition using 1,2,4TCB as sole available carbon source.

102 Results and Discussion

Grundmann et al. , (2007) used an active, isoproturon degrading microbial community to successfully enhance pesticide mineralization in various soils under laboratory and outdoor conditions. The microbes, extracted from soil having high native ability to mineralize were established on expanded clay particles and distributed to various soils in the form of microbial "hot spots".

PCBs are not easily separated from petroleum oil because the physical and chemical characteristics of PCPs are very similar to those of mineral oil. The components of oil based liquid wastes coelute with the PCBs (Na et al., 2008).

Dercova et al., (2008) isolated and identified polychlorinated biphenyl degrading microorganisms from sediments of Strazsky canal and Zemplinska Strava water reservoir. Microorganisms that grow on minimal medium with biphenyl as the sole carbon source were isolated from samples of the sediments. Biphenyl is an inducer of the biphenyl operon and its presence causes induction of the socalled PCB "upper" degradation pathway. Microorganisms isolated by this procedure are potential degraders of PCBs.

Baggi et al., (2008) investigated the degradation properties towards chlorobenzoates by a 2chlorobenzoatedegrading mixed culture (2MC). 2MC was constituted of three prominent species; Stenotrophomonas maltophilia, Cupriaridus necator and Flavobacterium sp .

Chlorinated benzenes including chlorobenzene (CB) and 1,2 dichlorobenzene (DCB). Laboratory shake flask trials confirmed that the soils in the pilot scale treatment contained a microbial consortium capable of mineralizing CB and DCB (Guerin, 2008).

103 Results and Discussion

Önneby et al., (2010) examined whether adding pesticide degrading microorganisms simultaneously with pesticide at application could significantly reduced diffuse contamination from pesticide use in agriculture soil and sand soil with low degradation potential (poor in microbial activity). Also they showed that > 80%99% degradation of 2,4D and 4cloro2methylphenoxy acetate (MCPA) in soil within 1 day and > 99% within 3 days after inoculation with 10 510 7 herbicide degrading bacteria/g soil.

The count of indigenous bacterial communities at the end of incubation period revealed an increase in all communities count after 28 days incubation than the initial count on the four chloroaromatic compounds as indicated in Table (6) and Fig. (23). The increase in bacterial count of the eight communities was ranging from 0.2 to 1.5 log cycles on 3CBA. The lowest increase (0.2 log cycles) was from 6.5×10 5 CFU/ml to 1.0×10 6 CFU/ml, while the highest increase (1.5 log cycles) was from 1.0×10 5 CFU/ml to 3.3×10 6 CFU/ml.

The increase in count of bacterial communities on 2,4DCP after 28 days incubation was ranging from 1.0 to 2.3 log cycles i.e. from 1.1×10 6 to 1.1×10 7 CFU/ml and 1.0×10 5 to 2.2 ×10 7 CFU/ml respectively. The increase in case of growth on 2,6DCPP was ranging from 0.6 to 1.7 log cycles. The increase was from 2.3×10 6 to 1.1×10 7 CFU/ml and from 1.0×10 5 to 4.5 ×10 6 CFU/ml respectively.

The increase in bacterial count of the eight communities grown on 1,2,4TCB were ranging from 0.4 to 2.7 log cycles. This increase was from 8.0×10 5 to 2.0×10 6 CFU/ml and from 1.0 ×10 5 to 5.0 ×10 7 CFU/ml respectively.

104 Results and Discussion

Surprisingly, the above results revealed that the highest community in growth on the four chloroaromatic compounds used was community (7). This community increased by 1.5, 2.3, 1.7 and 2.7 log cycles on 3 CBA, 2,4DCP, 2,6DCPP and 1,2,4TCB respectively. However, community (8) increased by 1.1, 1.2, 1.0 and 1.1 log cycle on 3CBA, 2,4 DCP, 2,6DCPP and 1,2,4TCB respectively. Communities (7 and 8) were the results of agriculture soil contaminated with petroleum wastes at a distance 400 meter away from the deposition with record of pesticide exposure. This agriculture soils were cultivated with plants. So, the two soil were similar in everything, the only difference between them was that community (7) was surface soil while community (8) was at 30cm depth. This may be explained the difference in count. The above notice revealed that, the surface soil had a higher bacterial count than that at depth in case of growing on chloroaromatic compounds as sole carbon and energy source.A similar results had been recorded by other investigators.

The biological in situ remediation of a former pesticide production site, highly contaminated with chlorobenzenes, chlorphenols and hexachlorocyclohexanes (HCH) was studied for a period of one year. Dependent on the measurements, elimination of ~70% the pollutants was attributed to microbial degradation. The latter fact is supported by oxygen consumption data, by increase in microbial counts and by changes in the distribution of the pollutants. In all samples, the bacterial counts on R2A agar plates were between 10 3 and 10 5 CFU/ml (Feidieker et al., 1995).

Brunsbach and Reineke (1995) found that about 70% of the organic bound chlorine was eliminated after 28 days from soil when 2 3x10 5cell/g. soil of each the strains were added to the slurries.

105 Results and Discussion

Table (6): Count after incubation period for 28 days of different mixed indigenous bacteria on different chloroaromatic compounds

Bacterial Communities (Sample No.) Initial count Count after 28 days

3 2,4 2,6Dichlorophenol 1,2,4 Chlorobenzoic acid Dichlorophenol indolphenol Trichlorobenzene

Count Count Count Count Count Log.N. Log.N. Log.N. Log.N. Log.N. (CFU/ml) (CFU/ml) (CFU/ml) (CFU/ml) (CFU/ml) 1 6.5×10 5 5.8 1.0×10 6 6.0 3.4×10 7 7.5 3.9×10 6 6.6 7.0×10 6 6.8

2 8.0×10 5 5.9 2.2×10 7 7.3 2.3×10 7 7.4 4.1×10 7 7.6 2.0×10 6 6.3 3 3.0×10 6 6.5 7.0×10 6 6.8 7.3×10 7 7.9 3.0×10 7 7.5 4.4×10 7 7.6

4 2.3×10 6 6.4 9.1×10 6 7.0 2.6×10 7 7.4 1.1×10 7 7.0 1.3×10 8 8.1 5 1.1×10 6 6.0 1.7×10 7 7.2 1.1×10 7 7.0 5.0×10 5 5.7 1.3×10 7 7.1

6 3.5×10 5 5.5 8.0×10 6 6.9 2.9×10 7 7.5 7.6×10 6 6.9 6.0×10 6 6.8 7 1.0×10 5 5.0 3.3×10 6 6.5 2.2×10 7 7.3 4.5×10 6 6.7 5.0×10 7 7.7 8 3.0×10 5 5.5 4.2×10 6 6.6 5.6×10 6 6.7 3.0×10 6 6.5 4.4×10 6 6.6

106 Results and Discussion

Figure (23): Count after incubation period for 28 days of different indigenous mixed bacteria on different chloroaromatic compounds

107 Results and Discussion

The count of soil sample was 6.1x10 5 cells/g and 8.5x10 4 cells/g in sediment of the Czech Republic (Pavlů et al., 1999). However, the ground water contained from 10 4 to 10 7 microscopically counted cells/ml and up to 10 5 CFU/ml heterotrophic bacteria cultivable at 8 and 20 oC (Männisto et al., 2001).

Olaniran et al., (2001) mentioned that the mixed cultures utilized most of the substrates better than the respective monocultures. A similar observation has been reported by other studies which suggest that the biodegradation process could be facilitated by consortium of microorganisms. Baggi et al., (2005) found that the count of two soils of different contamination history was ranging from 4x10 6 to 4x10 7 CFU/g dry soil. Ziagova and LiakopoulouKyriakides (2007a) mentioned that cell growth rate constitutes indication for the degradation efficiency of strains, as it is closely associated to the size of bacterial population (higher number of available degrading enzymes). It is known that the cell growth rate is referred to increment to cell numbers or biomass weight in a given period of time. A bacterial strain, named P4, isolated previously from microcosms containing oilcontaminated soil collected from an environmentally protected area of a tropical Atlantic forest (Biological Reserve of Poço das Antas) located in Brazil was identified as Dietzia cinnamea by morphological, biochemical and genotypic tests (von der Weid et al ., 2007). The biodegradation of PCBs in real contaminated sites is often limited by the low content of autochthonous microbial communities capable of metabolizing these recalcitrant contaminants. In such cases inoculation may be one viable option for successful bioremediation; nevertheless, little is still known about the use of bioaugmentation in real contaminated sites (Di Toro et al. , 2006). Recent advances in the degradation of PCBs have sought PCB degrading communities, which can be surprisingly diverse (Vasilyeva and Strijakova, 2007). In general, pure cultures of PCBdegrading bacteria (Evans et al ., 1996 and Fava and Bertin, 1999), consortia of specialized 108 Results and Discussion bacteria (Abramowicz, 1995; Klasson et al. , 1996; Fava and Bertin, 1999 and RojasAvelizapa et al ., 2003), and genetically engineered bacteria able to avoid the accumulation of potentially toxic or dead end intermediates of target pollutants (Reineke, 1998) have been applied for the bioaugmentation of PCBcontaminated ecosystems (Sobiecka et al ., 2009). The count of the eight indigenous bacterial communities was determined on L.B agar plates (Total Bacterial Count) and on BSM agar plates amended with 1mM mixture of the four chloroaromatic compounds (chloroaromatic degrading bacteria). The highest total bacterial count (3.0×10 6 CFU/ml) and chloroaromatic degrading bacterial (CDB) count (2.0×10 4 CFU/ml) had been recorded for community (3). The results as shown in Table (7) and Fig. (24) cleared that 66% of the bacterial count of community (3) was CDB. This means that chronic soils contaminated with petroleum wastes at the same place of deposition but at 30cm depth having the higher CDB count. In a similar studies Feidieker et al., (1995 ) determined the colony counts as colony forming units (CFU) on different media (nutrient agar; R2A agar and wort agar). In all samples, bacterial counts on R2A agar and nutrient agar were between 10 3 and 10 5 CFU/ml. in general, more colonies could be counted on R2A agar. Count of dechlorinating species amount to at least 6x10 5 cells/ml at total cell number 2x10 6 cell/ml (Adrian et al., 2000). Männisto et al., (2001 ) found that, the number of culturable bacteria ranged from 1x10 2 to 2x10 5 and from < 50 to 1.9x10 5 CFU/ml on PYGV agar at 20 and 8oC respectively. Slightly higher counts were generally obtained on R2A agar than PYGV agar.

While, Baggi et al., (2005) recorded a count for two soils one of them Landfill soil and the other soil treated with prochloraz. The count was 4x10 6 and 4x10 7 CFU/g dry weight on plate agar medium and 7x10 3 and 5x10 5 CFU/g on the two soils respectively.

109 Results and Discussion

Table (7): Count of different indigenous bacterial communities on different types of media.

Total Bacterial Count of Bacterial CDB Log.N. CDB ● Log.N. Log% Communities Count * (CFU/ml) TBC (Sample No.) (CFU/ml) ٤٣٠ 2.5 2 10×3.5 5.8 5 10×6.5 1 ٥٧٠ 3.4 3 10×3.0 5.9 5 10×8.0 2 ٦٦٠ 4.3 4 10×2.0 6.5 6 10×3.0 3 ٤٠٠ 2.6 2 10×4.0 6.4 6 10×2.3 4 ٣٨٠ 2.3 2 10×2.0 6.0 6 10×1.1 5 ٤٧٠ 2.6 2 10×4.0 5.5 5 10×3.5 6 ٣٢٠ 1.6 1 10× 5 5.0 5 10×1.0 7 8 3.0×10 5 5.5 8 ×10 1 1.9 34.0 ● CDB: Chloroaromatic Degrading Bacteria * TBC: Total Bacterial Count

Total Bacterial Count (CFU/ml) 7 Count of CDB (CFU/ml)

Log N. 3

0 1 2 3 4 5 6 7 8 Indigenous bacterial communities

Figure (24): Count of different indigenous bacterial communities on different types of media.

110 Results and Discussion

The separated single colonies, which grown well on BSM amended with mixture of chloroaromatic compounds (CDB) were picked up. To determine their abilities to grow on different concentrations of each of the four chloroaromatic compounds, to chose the most potent strains. A screening had been made for the thirtyfour isolates. Only eighteen isolates in addition to three standard strains shown a degree of growth on one or more of the tested chloroaromatic compounds as indicated in Table (8). From the results, it is clear that isolated strain MAM24 have the ability to grow well on the three concentrations of 3CBA, 2,4DCP and 1,2,4TCB and also on the two concentrations of 2,6DCPP. Five isolates and standard strain, having to some extent a degree of growing on different chloroaromatic compounds at different concentrations have been chosen to further investigations.

The chosen isolates were MAM24, MAM27, MAM29, MAM 33 and MAM3 and Enterobacter cloaceae MAM4 isolated from heavy metal waste water. The most five chosen isolates, that have the ability to grow on chloroaromatic compounds have been characterized by their morphological character and Gram stain. Isolates MAM24, 27, 29 and 33 were Grampositive spore former Bacilli while isolate MAM3 was Gram negative short rods Pseudomonas with pigmentation olive green. The standard strain E. cloaceae MAM4 was Gramnegative also. The morphological characters were indicated in Table (9).

Horvath and Alexander (1970), isolated twenty isolates representing nine bacterial genera obtained from enrichment cultures and were shown to cometabolize one or more of 22 substituted benzoates.

111 Results and Discussion

Table (8): Determination of the ability of the indigenous isolated strains to grow on different chloroaromatic compounds at different concentrations.

Isolate 3Chlorobenzoic 2,4 2,6Dichloro 1,2,4Tri code Acid Dichlorophenol phenol chlorobenzene indolphenol 2mM 3mM 5mM 2mM 3mM 5mM 1mM 2mM 25M 50M 75M +++ +++ +++ ++ + + +++++ +++ ++ + ve MAM3 +++ +++ ++ ++ + + +++++ +++ ++ + ve ve ve ve ve ve ve + ve + ve ve MAM8 ve ve ve ve ve ve + ve + ve ve ve ve + ve ve ve ++ + ++ ++ + MAM14 ve ve ve ve ve ve + + ++ ++ + ve ve ve ve ve ve +++ + + ve ve MAM16 ve ve ve ve ve ve + + + ve ve ve ve ve ve ve ve + + ve ve ve MAM17 ve ve ve ve ve ve + + ve ve ve ++ + ve ve ve ve +++ ++ ++++ +++ ++ MAM18 ++ + ve ve ve ve +++ ++ ++++ +++ ++ + + + + + + ++++ +++ +++ ++ +++ MAM20 + + + + + + +++ +++ ++ ++ ++ + ve ve ++ + ve +++ +++ +++ ++ ++ MAM21 + ve ve ++ + ve +++ +++ ++ ++ + ++ ++ + + + ve ++++ +++ ++ ++ + MAM22 ++ ++ + + + ve ++++ ++ ++ ++ + +++++ ++++ ++ +++ ++ + ++++ +++ ++++ ++++ ++++ MAM24 ++++ ++++ ++ +++ ++ + ++++ +++ +++ +++ ++ +++ +++ ++ +++ ++ + ++++ +++ ++ ++ ++ MAM25 +++ +++ ++ +++ ++ + +++ +++ ++ ++ ++ +++ ++ ++ + + + +++++ ++++ +++ ++ + MAM27 +++ ++ ++ + + + +++++ ++++ +++ ++ + +++ ++ + + ve ve +++ +++ ++ + ve MAM28 ++ ++ + + ve ve ++ ++ ++ + ve + ve ve + + ve +++ +++ +++ ++++ +++ MAM29 + ve ve + + ve +++ +++ +++ +++ +++ ve ve ve ve ve ve + ve + + ve MAM30 ve ve ve ve ve ve + ve + + ve ++ + ve ve ve ve +++ ++ ++++ +++ + MAM32 ++ + ve ve ve ve +++ ++ ++++ +++ + + + ve + + ve +++++ ++++ + + ve MAM33 + + ve + + ve +++++ ++++ + + ve + ve ve ++ + ve +++ + +++ +++ ++ MAM34 + ve ve ++ + ve +++ + +++ +++ ++ ve ve ve ++ + ve ++ + +++ ++ ++ B. cereus ve ve ve ++ + ve ++ + +++ ++ ++ P. rettegri ve ve ve +++++ ++++ +++ +++ ++ ++++ ++++ +++ MAM4 ve ve ve +++++ ++++ +++ +++ ++ +++ +++ +++ E. +++ +++ ve ++++ +++ ++ +++ + +++++ ++++ ++++ Cloaceae MAM4 +++ ++ ve ++++ +++ ++ +++ + +++++ ++++ ++++

ve = no growth + = v. weak growth ++ = weak growth +++ = moderate growth ++++ = good growth +++++ = v. good growth

112 Results and Discussion

Table (9): Characterization of the most promising isolates.

Bacterial Characters of the most promising communities Isolates Code isolates (Sample No.) 1 MAM1, MAM5, MAM8 MAM6, MAM7, MAM10, MAM12, MAM13, MAM14, MAM15, MAM33: Redbrown, circular, 2 MAM22, MAM33 rough, opaque, large, Gram +ve MAM3: Olive green, irregular, 3 MAM3, MAM4, MAM9, MAM16 transparent, flat, Gram ve MAM27: White, small, opaque, rough, irregular, Gram +ve. 4 MAM2, MAM11, MAM17, MAM26, MAM27, MAM29, MAM35. MAM29: Large, circular, rough, Gram +ve 5 MAM28 6 MAM25, MAM32 7 MAM18, MAM19, MAM20, MAM21, MAM30, MAM34 MAM24: Cream, flat, opaque, 8 MAM23, MAM24 MAM31 irregular, large, Gram +ve

113 Results and Discussion

Also Olaniran et al., (2001) isolated four bacterial species from soil and a sewage oxidation pound using enrichment culture technique and the bacterial isolates were identified to belong to the two genera Bacillus and Corynebacterium .

A similar result by other studies confirmed the results of this study. Of, the 102 pure culture, of which 86% Gramnegative, from the pluma area (10.000 g of chlorophenols/L), 57% degraded 2,3,4,6tetrachlorophenol (TeCP); 17% also degraded pentachlorphenol (PCP). The degraders were scattered among 16 different cluster of Gramnegatives. Only one Gram positive degrading cluster was found containing seven actinobacteria (Männisto et al., 2001).

While, Kolar et al., (2007) found that biphenyl–utilizing bacteria isolated from the most active PCBdegrading mixed cultures showed little taxonomic diversity (six out of seven isolates belonged to the genus Rhodococcus and one to the genus Sphingomonas ).

Growth of isolate MAM24, on 20M 3CBA shown slight increase after 1 and 2 days but the growth began to decrease as the incubation period increase. At 100M 3CBA, growth was increased till the fourth day of incubation and then began to decrease. Growth on (500M, 1mM and 2mM) 3CBA continue the increase till 7 days and then decreased. Also, after 7, 15, 21 days incubation period, as the concentration of the compound increased, the growth increased, that is mean the growth was concentration dependent as indicated in Table (10) and Fig. (25).

114 Results and Discussion

Table (10): Growth, concentration of extracellular protein & concentration of Cl of isolate MAM24 on different concentrations of 3chlorobenzoic acid (3CBA).

Conc. 20 M 100 M 500 M 1mM 2mM Incubation Protein Cl Protein Cl Protein Cl Protein Cl Protein Cl Period O.D O.D O.D O.D O.D (g/ml) (mg/L) (g/ml) (mg/L ) (g/ml) (mg/L) (g/ml) (mg/L) (g/ml) (mg/L) (days) Zero 0.223 266.00 5.143 0.237 266.00 5.143 0.231 265.00 5.140 0.234 280.00 5.150 0.255 285.00 5.210 (Initial) 1 0.266 243.00 2.443 0.256 243.00 3.315 0.269 278.00 3.429 0.277 249.00 5.098 0.263 266.00 5.372

2 0.264 197.00 2.114 0.269 207.00 3.114 0.267 210.00 3.114 0.267 231.00 3.143 0.276 224.00 5.000

3 0.201 80.00 1.408 0.257 92.00 1.671 0.256 90.00 1.576 0.245 94.00 1.471 0.245 84.00 3.840

4 0.205 64.00 1.286 0.258 68.00 1.614 0.246 60.00 1.543 0.249 107.00 1.657 0.268 82.00 2.786

5 0.205 64.00 1.286 0.258 68.00 1.614 0.246 60.00 1.543 0.249 107.00 1.657 0.268 82.00 2.786

6 0.174 43.00 0.929 0.193 52.00 1.329 0.318 48.00 1.443 0.656 81.00 2.272 1.203 110.00 2.472

7 0.186 58.00 0.800 0.182 48.00 1.286 0.390 43.00 1.358 0.688 74.00 1.600 1.261 107.00 2.157

15 0.140 56.00 0.800 0.138 48.00 1.286 0.260 43.00 1.358 0.445 74.00 1.570 0.815 108.00 2.157

21 0.156 43.00 0.788 0.137 64.00 1.280 0.230 77.00 1.350 0.429 124.00 1.500 0.875 149.00 2.150

115 Results and Discussion

1.40 20M 100M 1.20 500M 1mM 2mM 1.00

0.80

O.D 0.60

0.40

0.20

0.00 0 1 2 3 4 5 6 7 1521 Incubation period (days)

Figure (25): Growth of isolate MAM24 on different concentrations of 3chlorobenzoic acid (3CBA).

300 20M 100M 500M 1mM

250 2mM

200

150

100 Protein (g/ml)

0 0 1 2 3 4 5 6 7 1521 Incubation period (days)

Figure (26): Concentration of extracellular protein of isolate MAM24 on different concentrations of 3chlorobenzoic acid (3CBA).

116 Results and Discussion

Figure (27): Concentration of Cl –of isolate MAM24 on different concentrations of 3chlorobenzoic acid (3CBA).

117 Results and Discussion

For extracellular protein, as the incubation period increased, the extracellular protein decreased, as indicated in Table (10) and Fig. (26). Also, chloride ion (Cl ), as the incubation period increased, Cl decreased. But after 7 days incubation, as the concentration of 3CBA increased, Cl concentration increased, and this mean that Cl concentration is dependent as in Table (10) and Fig. (27).

Growth for isolate MAM27 on the five different concentration of 3CBA showed that growth was increased after 1 day incubation and began to decrease as the incubation increased as in Table (11) and Fig. (28). Extracellular protein as shown in Table (11) and Fig. (29) revealed that, as the incubation period increased, the secreted protein decreased.

For chloride ion the concentration of Cl increased after 1 day in all concentrations of 3CBA and decreased after that the incubation period increased. The highest concentration (2mM of 3CBA) showed an increase in Cl concentration till the third day and then began to decrease as the incubation period increased as in Table (11) and Fig. (30). This to some extent means that Cl concentration is compound concentration dependent.

In case of isolate MAM29, all the five concentrations, the growth increased after 1 day incubation period and began to decrease as the incubation period increased as shown in Table (12) and Fig. (31). Extracellular protein as indicated in Table (12) and Fig. (32) showed that in all concentrations as the incubation period increased, the secreted protein decreased.

118 Results and Discussion

Table (11): Growth, concentration of extracellular protein & concentration of Cl of isolate MAM27 on different concentrations of 3chlorobenzoic acid (3CBA).

Conc. 20 M 100 M 500 M 1mM 2mM Incubation O.D Protein Cl O.D Protein Cl O.D Protein Cl O.D Protein Cl O.D Protein Cl Period (µg/ml) (mg/L) (µg/ml) (mg/L ) (µg/ml) (mg/L) (µg/ml) (mg/L) (µg/ml) (mg/L) (days) Zero 0.223 284.00 3.229 0.209 290.00 3.320 0.219 300.00 3.250 0.238 299.00 3.300 0.270 293.00 3.400 (Initial) 1 0.246 260.00 5.286 0.250 294.00 5.157 0.258 246.00 3.200 0.269 271.00 5.043 0.281 316.00 5.114 2 0.217 200.00 3.386 0.233 232.00 3.300 0.233 199.00 3.257 0.233 200.00 3.286 0.267 216.00 5.072

3 0.154 81.00 2.575 0.176 77.00 2.177 0.203 112.00 1.011 0.198 122.00 3.325 0.212 90.00 3.565

4 0.182 72.00 1.743 0.173 77.00 1.886 0.191 69.00 0.886 0.200 81.00 3.229 0.213 65.00 2.900 5 0.182 72.00 1.743 0.173 77.00 1.886 0.191 69.00 0.886 0.200 81.00 3.229 0.213 65.00 2.900

6 0.136 35.00 0.572 0.136 51.00 0.772 0.131 38.00 0.729 0.155 52.00 0.629 0.117 56.00 1.215

7 0.120 26.00 0.614 0.131 50.00 0.657 0.121 37.00 0.700 0.135 46.00 0.629 0.206 52.00 1.200 15 0.110 26.00 0.614 0.110 50.00 0.657 0.100 37.00 0.700 0.104 46.00 0.629 0.130 52.00 1.200

21 0.100 16.00 0.610 0.147 32.00 0.630 0.105 27.00 0.680 0.128 37.00 0.652 0.133 41.00 1.150

119 Results and Discussion

Figure (28): Growth of isolate MAM27 on different concentrations of 3chlorobenzoic acid (3CBA).

Figure (29): Concentration of extracellular protein of isolate MAM27 on different concentrations of 3chlorobenzoic acid (3CBA).

120 Results and Discussion

6.0 20M 100M 500M 1mM 2mM 5.0

4.0

3.0 (mg/L) Cl 2.0

1.0

0.0 0 1 2 3 4 5 6 7 1521 Incubation period (days)

Figure (30): Concentration of Cl –of isolate MAM27 on different concentrations of 3chlorobenzoic acid (3CBA).

121 Results and Discussion

Table (12): Growth, concentration of extracellular protein & concentration of Cl of isolate MAM29 on different concentrations of 3chlorobenzoic acid (3CBA).

Conc. 20 M 100 M 500 M 1mM 2mM Incubation Protein Cl Protein Cl Protein Cl Protein Cl Protein Cl Period O.D O.D O.D O.D O.D (µg/ml) (mg/L) (µg/ml) (mg/L ) (µg/ml) (mg/L) (µg/ml) (mg/L) (µg/ml) (mg/L) (days)

Zero 0.263 306.00 3.400 0.271 306.00 3.450 0.259 305.00 3.390 0.267 300.00 3.405 0.289 300.00 3.490 (Initial) 1 0.286 296.00 3.086 0.317 249.00 3.386 0.288 243.00 3.472 0.286 243.00 5.458 0.356 228.00 5.243 2 0.269 264.00 2.886 0.313 203.00 2.943 0.277 201.00 3.200 0.281 203.00 5.429 0.338 221.00 5.100

3 0.235 163.00 0.858 0.249 163.00 2.290 0.201 74.00 2.405 0.215 111.00 5.000 0.221 142.00 4.655

4 0.234 122.00 0.743 0.246 91.00 1.386 0.200 69.00 2.315 0.205 108.00 4.491 0.226 74.00 4.429 5 0.234 122.00 0.743 0.246 91.00 1.386 0.200 69.00 2.315 0.205 108.00 4.491 0.226 74.00 4.429

6 0.181 64.00 0.609 0.216 66.00 1.172 0.200 62.00 2.129 0.259 104.00 2.614 0.200 56.00 2.086 7 0.170 42.00 0.429 0.207 43.00 0.858 0.188 46.00 1.500 0.267 36.00 2.400 0.196 48.00 1.315

15 0.154 42.00 0.429 0.179 43.00 0.858 0.186 45.00 1.500 0.163 37.00 2.400 0.164 48.00 1.315

21 0.144 21.00 0.400 0.170 37.00 0.850 0.172 44.00 1.300 0.143 36.00 2.350 0.145 41.00 1.310

122 Results and Discussion

Figure (31): Growth of isolate MAM29 on different concentrations of 3chlorobenzoic acid (3CBA).

Figure (32): Concentration of extracellular protein of isolate MAM29 on different concentrations of 3chlorobenzoic acid (3CBA).

123 Results and Discussion

Figure (33): Concentration of Cl –of isolate MAM29 on different concentrations of 3chlorobenzoic acid (3CBA).

124 Results and Discussion

For chloride ion, at 20 and 100M of 3CBA the Cl concentrations decreased as the incubation period increased from the beginning as shown in Table (12) and Fig. (33). At 500M of 3CBA, Cl concentration increased till 1 day incubation and began to decrease. However, at the higher concentrations (1,2mM of 3CBA), the increase of Cl concentration was found till the fifth day of incubation and began to decrease.

Isolate MAM33 showed decrease in growth, extracellular protein and chloride ion concentrations as the incubation period increased in all the five concentrations of 3CBA as in Table (13) and Fig. (34, 35, 36).

125 Results and Discussion

Table (13): Growth, concentration of extracellular protein & concentration of Cl of isolate MAM33 on different concentrations of 3chlorobenzoic acid (3CBA).

Zero 0.346 278.00 5.286 0.348 280.00 5.280 0.360 285.00 5.300 0.356 279.00 5.295 0.343 289.00 5.290 (Initial) 1 0.344 256.00 4.000 0.349 252.00 5.257 0.346 232.00 5.500 0.357 242.00 5.243 0.362 240.00 3.358 2 0.334 188.00 3.143 0.337 190.00 3.472 0.333 190.00 5.429 0.324 170.00 5.329 0.329 220.00 3.486

3 0.272 84.00 2.190 0.287 174.00 2.620 0.262 116.00 2.498 0.258 85.00 2.259 0.278 125.00 3.000

4 0.279 66.00 2.272 0.283 91.00 2.757 0.248 77.00 2.672 0.248 84.00 1.715 0.286 53.00 2.243 5 0.279 66.00 2.272 0.283 91.00 2.757 0.248 77.00 2.672 0.248 84.00 1.715 0.286 53.00 2.243

6 0.225 43.00 0.257 0.228 43.00 0.600 0.204 49.00 0.829 0.185 45.00 0.972 0.185 46.00 1.215 7 0.207 32.00 0.257 0.222 36.00 0.500 0.185 31.00 0.657 0.184 38.00 0.715 0.202 43.00 0.972

15 0.153 32.00 0.257 0.157 36.00 0.500 0.118 31.00 0.657 0.164 38.00 0.715 0.190 40.00 0.972

21 0.134 21.00 0.250 0.145 21.00 0.450 0.114 31.00 0.653 0.148 32.00 0.650 0.165 34.00 0.950

126 Results and Discussion

Figure (34): Growth of isolate MAM33 on different concentrations of 3chlorobenzoic acid (3CBA).

Figure (35): Concentration of extracellular protein of isolate MAM33 on different concentrations of 3chlorobenzoic acid (3CBA).

127 Results and Discussion

6.0 20M 100M 500M 1mM 5.0 2mM

4.0

3.0 (mg/L) Cl 2.0

1.0

0.0 0 1 2 3 4 5 6 7 1521 Incubation period (days)

Figure (36): Concentration of Cl –of isolate MAM33 on different concentrations of 3chlorobenzoic acid (3CBA).

128 Results and Discussion

Isolate MAM3, the Gramnegative isolate, showed a slight increase after 1 day incubation and began to decrease as incubation period increase at the first three concentrations of 3CBA. At the higher concentration the growth decreased from the beginning of the incubation period and increased suddenly at 7 and 15 days at concentration 2mM of 3CBA as shown in Table (14) and Fig. (37). This behavior may be attributed to high concentration of the chlorinated compound which lead to prolonged lag phase for this isolate to be adapted. In general, secreted protein was decreased as the incubation period increased as indicated in Table (14) and Fig. (38). Chloride ion showed an increase in Cl concentration after 1 day incubation and then decreased for 100M 3CBA. While the other concentrations showed a decrease in Cl concentration as the incubation period increased as in Table (14) and Fig. (39). Growth of the Gramnegative E. cloaceae MAM4 on 20M of 3CBA increased at first and second days and began to decrease as the incubation period increased. At 100M of 3CBA the increase in growth continue to the fifth day. When the concentration of 3CBA reached 500M, an increase in growth was found till the fifth day and sudden increase had been reported for the rest of the incubation period. A similar trend had been recorded in case of 1mM of 3CBA. As the concentration increased more to be 2mM of 3CBA, the growth increased till the second day and began to decrease along the rest period of incubation as shown in Table (15) and Fig. (40). From the previous results, it is clear that Gramnegative bacterial strains affected with increase in concentration and need a prolonged lag phase to grow at the suitable concentration. Extracellular protein decrease for all the concentrations of 3CBA as the incubation period increased as in Table (15) and Fig. (41). Chloride ions decreased as the incubation period increased except concentrations 100M and 500M where Cl concentrations increased at the first day and then decreased as the incubation period increased as shown in Table (15) and Fig. (42).

129 Results and Discussion

Table (14): Growth, concentration of extracellular protein & concentration of Cl of isolate MAM3 on different concentrations of 3chlorobenzoic acid (3CBA).

Zero 0.295 306.00 3.472 0.282 300.00 3.500 0.300 300.50 3.490 0.295 310.00 3.480 0.293 305.00 3.495 (Initial) 1 0.309 253.00 3.000 0.290 271.00 5.429 0.308 263.00 3.143 0.290 314.00 3.386 0.288 266.00 3.386 2 0.288 200.00 2.900 0.300 203.00 2.972 0.278 215.00 2.829 0.256 211.00 2.286 0.272 221.00 3.200

3 0.224 88.00 2.218 0.202 195.00 2.446 0.262 183.00 2.215 0.305 166.00 2.484 0.238 180.00 3.704

4 0.227 70.00 1.215 0.204 159.00 1.243 0.256 136.00 1.982 0.304 159.00 1.243 0.238 170.00 2.700 5 0.227 70.00 1.215 0.204 159.00 1.243 0.256 136.00 1.982 0.304 159.00 1.243 0.238 170.00 2.700

6 0.163 66.00 0.858 0.151 143.00 0.900 0.247 128.00 1.829 0.332 125.00 0.500 0.224 169.00 2.086 7 0.149 65.00 0.614 0.140 142.00 0.829 0.254 125.00 1.757 0.348 122.00 0.286 0.540 159.00 1.543

15 0.079 65.00 0.614 0.100 142.00 0.829 0.210 125.00 1.757 0.277 122.00 0.286 0.738 159.00 1.543

21 0.071 64.00 0.610 0.095 101.00 0.810 0.204 121.00 1.730 0.265 114.00 0.280 0.676 128.00 1.530

130 Results and Discussion

0.80 20M 100M 0.70 500M 1mM 2mM 0.60

0.50

0.40 O.D

0.30

0.20

0.10

0.00 0 1 2 3 4 5 6 7 1521 Incubation period (days)

Figure (37): Growth of isolate MAM3 on different concentrations of 3chlorobenzoic acid (3CBA).

20M 100M 350 500M 1mM 2mM 300

250

200

150 Protein (g/ml) 100

0 0 1 2 3 4 5 6 7 1521 Incubation period (days)

Figure (38): Concentration of extracellular protein of isolate MAM3 on different concentrations of 3chlorobenzoic acid (3CBA).

131 Results and Discussion

6.0 20M 100M 500M 1mM 2mM 5.0

4.0

3.0 (mg/L) Cl 2.0

1.0

0.0 0 1 2 3 4 5 6 7 1521 Incubation period (days)

Figure (39): Concentration of Cl –of isolate MAM3 on different concentrations of 3chlorobenzoic acid (3CBA).

132 Results and Discussion

Table (15): Growth, concentration of extracellular protein & concentration of Cl of E. cloaceae MAM4 on different concentrations of 3chlorobenzoic acid (3CBA).

Zero 0.351 324.00 5.215 0.345 325.00 5.250 0.357 330.00 5.100 0.337 320.00 5.300 0.351 336.00 5.240 (Initial) 1 0.404 310.00 3.386 0.379 271.00 5.429 0.415 246.00 5.430 0.385 266.00 3.472 0.428 238.00 5.429 2 0.393 171.00 3.114 0.413 201.00 3.229 0.406 217.00 3.890 0.372 201.00 3.257 0.422 235.00 3.800

3 0.314 168.00 2.526 0.410 179.00 2.450 0.403 178.00 2.495 0.383 176.00 2.549 0.350 198.00 2.787

4 0.311 104.00 1.886 0.410 117.00 1.272 0.391 174.00 2.029 0.381 159.00 1.986 0.344 167.00 2.615 5 0.311 104.00 1.886 0.410 117.00 1.272 0.391 174.00 2.029 0.381 159.00 1.986 0.344 167.00 2.615

6 0.287 88.00 1.072 0.325 113.00 1.172 0.561 145.00 1.629 0.692 81.00 1.315 0.319 142.00 2.500 7 0.260 66.00 0.858 0.317 111.00 0.943 0.525 138.00 1.114 0.736 81.00 1.272 0.310 136.00 1.400

15 0.175 55.00 0.850 0.233 100.00 0.943 0.426 130.00 1.100 0.609 80.00 1.272 0.300 120.00 1.388

21 0.135 49.00 0.840 0.197 92.00 0.940 0.403 71.00 1.100 0.578 77.00 1.200 0.227 91.00 1.300

133 Results and Discussion

Figure (40): Growth of E. cloaceae MAM4 on different concentrations of 3chlorobenzoic acid (3CBA).

Figure (41): Concentration of extracellular protein of E. cloaceae MAM4 on different concentrations of 3chlorobenzoic acid (3CBA).

134 Results and Discussion

Figure (42): Concentration of Cl –of E. cloaceae MAM4 on different concentrations of 3chlorobenzoic acid (3CBA).

135 Results and Discussion

Growth of Pseudomonas putida strain isolated from sewage that can utilize 3CBA as the sole source of carbon with a doubling time of about 170 minutes. Growth of this strain (AC858) with 3CBA in minimal medium increased during the first 48 hours and gave positive folin test and during the exponential phase of growth, a positive Evans test (Chatterjee et al., 1981).

Pseudomonas sp. A18 had a shorter lag phase and higher specific growth rate than Pseudomonas sp . B3. Thus 2,5dichlorobenzene (2,5DCB) was degraded in 18h, compared with 30h for the disappearance of 3 chlorobenzene (3CB) utilized by Pseudomonas sp. B3. The growth was increased in O.D. from 0.00 to 0.4 at 600 nm (Pavlů et al., 1999).

Bacterial growth on halogenated aromatics as sole energy and carbon source is often suboptimal, showing slow growth rate, long adaptation lag period and low maximum cell densities. Growth on 2,4dichlorobenzoic acid (2,4DCBA) as a sole carbon source was very inefficient, inoculated culture took on the average, four days to reach 0.2 O.D. and appearance of cell aggregates was common (Corbella et al., 2001 and Baggi et al., 2008).

The concentration of chloride in the medium corresponded always to the amount of substrate utilized throughout the entire course of growth (Reineke and Kanckmuss, 1980).

The release of chloride as a function of growth of strain AC858 with 3CBA as a sole carbon source can be seen from the results. At the end of the log phase (48 h), about 80% of the 3CBAchloride was released as inorganic chloride into the medium (Chatterjee et al., 1981).

Chloride release was stoichiometric and mirrored the disappearance of substrate in the medium (Pavlů et al., 1999).

136 Results and Discussion

The relatively low value of chloride released in 2CBA grown cultures may be described to insolublization of the reaction product or differences in the substrateuptake/chloride release rates. A culture of P. aeruginosa 142 growing on minimal media (MM) supplemented with 2mM 2CBA needs approximately 20h to reach a chloride concentration of 1mM in the medium (Corbella et al., 2001).

Townsend et al., (1997) found that after a lengthy lag period, 3 chlorobenzoates (3CB Z) was degraded in the presence of sulphate. Chlorine removal from 2,5 or 3,5dichlorobenzoates and the transient appearance of benzoate from 3CB Z confirmed that the reductive dehalogenation was the initial fate process for these substrate.

Chlorobenzenes are substrates not easily metabolized by existing bacteria in the environment. Specific strains however, have been isolated from polluted environment or in laboratory selection procedures that use chlorobenzenes as their sole carbon and energy source (van der Meer, 1997).

Chlorobenzoates (CBs) have been the object of many investigations as central intermediates in the degradation of polychlorinated biphenyls (PCBs) and benzoate herbicides (Baggi, 2002 and Pieper, 2005). CB degradation is highly affected by the position of the halosubstituent(s) on the aromatic ring more than by the number (Baggi et al ., 2008).

Chlorinated benzoic acids (CBAs) are often deadend products of the metabolism of PCBs (Grund et al ., 1995). Benzoic acids with halogens at the meta and parapositions were more toxic than those with orthosubstitutions. They explained the difference by the general concept that the ortho halogenated benzoic acids having lower pKa values are more ionized, and therefore less toxic than meta and/or parasubstituted ones (Muccini et al ., 1999 and Lee and Chen, 2009).

137 Results and Discussion

The percentage of 3CBA degradation by the different isolates had been indicated in Table (16) and Fig. (43). The results revealed that all isolates were able to degrade 100% of 20M of 3CBA. Isolate MAM3, MAM29 and E. cloaceae MAM4 degrade 100% of 100 and 500M of 3 CBA. Isolate MAM3 and E. cloaceae MAM4 showed remarkable decrease in 3CBA degradation at higher concentrations (1 and 2mM of 3CBA). Although isolate MAM24 showed gradual decrease in degradation of 3 CBA as the concentration of 3CBA increased, it still capable of degrading more than 35% of 2mM 3CBA, while E. cloaceae MAM4 removed only 1.4% of 2mM 3CBA. This means that isolate MAM24 could removed a detectable amount of 3CBA at high concentration than any of the other isolates did. Another observation, that Gramnegative isolates MAM3 and E. cloaceae MAM4 could remove 3CBA more efficient at low concentration but could not tolerate the higher concentrations of 3CBA.

Biodegradation of two chlorinated aromatic compounds was found to be a common capability of the microorganisms found in the soils of undisturbed, pristine ecosystems. They recovered 610 strains that could release carbon dioxide from ringlabeled 3CBA. Of these, 144 strains released chloride and degraded over 80% of 1mM 3CBA in 3weeks or less (Fulthorpe et al. , 1996).

The recombinant cultures of Burkholderia cepacia were able to dechlorinate and degrade 100% of the 2CBA in less than 48 hours at 30 oC compared to more than 120 hours for wild type culture (UrgunDemirtas et al., 2003).

138 Results and Discussion

Table (16): Degradation percentage of 3chlorobenzoic acid (3CBA) after 21 days by HPLC.

% Degradation of 3CBA Isolate code 20 M 100 M 500 M 1 mM 2 mM

MAM24 100.0 70.9 52.5 36.6 35.3

MAM27 100.0 21.4 48.1 30.6 15.1

MAM29 100.0 100.0 100.0 86.3 15.8

MAM33 100.0 42.9 52.4 35.2 17.5

MAM3 100.0 100.0 100.0 17.1 18.1

E. cloaceae MAM4 100.0 100.0 100.0 15.2 1.4

139 Results and Discussion

MAM24 MAM27 MAM29 MAM33 MAM3 E. cloaceae MAM-4

110

100

40 %Degradation 30

0 20 M 100 M 500 M 1 mM 2 mM Concentration

Figure (43): Degradation percentage of 3chlorobenzoic acid (3CBA) after 21 days by HPLC.

140 Results and Discussion

Growth of isolate MAM24 on different concentrations of 2,4DCP as shown in Table (17) and Fig. (44) revealed that there were an increase in growth to some extent at the first four days at the first four concentrations and then there were a decrease in growth as the incubation period increased. At higher concentration (2mM) the decrease in growth began from the beginning. This may be attributed to toxic effect of high concentration of phenolic compounds.

Extracellular protein increased as the incubation period increased and also as the concentration of 2,4DCP increased as indicated in Table (17) and Fig. (45). Concentration of Cl also increased as the incubation period increased and as the concentration increased as shown in Table (17) and Fig. (46). The result indicated the activity of the isolated strain MAM24 even at high concentrations of the phenolic compound as cleared by secreted protein and increase in Cl concentrations.

Trend of growth of isolate MAM27 showed an increase in growth on 20M of 2,4DCP till the seventh day. As the concentrations of 2,4DCP increased (100, 500M) the increase in growth continue to the whole incubation period (21 days). The maximum growth had been recorded to 500M of 2,4DCP as shown in Table (18) and Fig. (47). As the concentration increased (1mM), there was an increase after 6 days incubation period and this increase continue to the rest of the incubation period.

A more increase in concentration revealed a decrease or stability of growth along the whole incubation period. Extracellular protein was increased as the incubation period increased and also as the concentration of 2,4DCP increased as in Table (18) and Fig. (48). A similar trend had been noticed for Cl concentrations. As the incubation period and concentrations of 2,4DCP increased, the Cl increased as in Table (18) and Fig. (49).

141 Results and Discussion

Table (17): Growth, concentration of extracellular protein & concentration of Cl of isolate MAM24 on different concentrations of 2,4dichlorophenol (2,4DCP).

Zero 0.156 44.8 0.458 0.156 45.8 0.508 0.153 50.0 0.458 0.180 55.0 0.510 0.197 53.0 0.520 (Initial) 1 0.194 60.2 0.715 0.173 67.2 1.329 0.168 222.4 1.286 0.195 278.4 2.143 0.168 337.8 1.272

2 0.175 64.4 1.014 0.169 85.4 2.100 0.161 223.8 1.418 0.194 328.0 2.329 0.166 367.2 2.215

3 0.164 61.6 1.514 0.168 84.0 10.129 0.160 254.6 3.415 0.189 329.4 3.243 0.163 368.6 12.574 4 0.156 61.6 2.700 0.159 95.2 10.315 0.153 235.0 2.614 0.188 342.0 10.672 0.163 450.0 13.000

5 0.155 60.2 2.458 0.155 111.2 11.201 0.147 228.0 2.486 0.181 344.8 10.729 0.153 448.0 13.250

6 0.147 60.2 2.415 0.148 95.2 10.844 0.145 226.6 2.443 0.177 350.4 11.744 0.143 439.0 12.830 7 0.144 60.2 1.929 0.137 92.4 10.372 0.144 226.6 2.400 0.169 375.6 11.859 0.138 438.5 12.600

15 0.143 59.0 1.800 0.135 90.0 10.200 0.131 226.6 2.350 0.157 375.6 11.800 0.136 438.5 12.550

21 0.140 57.4 1.572 0.120 89.6 3.429 0.127 226.0 2.271 0.157 368.6 12.574 0.128 400.0 11.073

142 Results and Discussion

0.22 20M 100M 500M 1mM 0.20 2mM

0.18

0.16 O.D

0.14

0.12

0.10 0 1 2 3 4 5 6 7 1521 Incubation period (days)

Figure (44): Growth of isolate MAM24 on different concentrations of 2,4dichlorophenol (2,4DCP).

Figure (45): Concentration of extracellular protein of isolate MAM24 on different concentrations of 2,4dichlorophenol (2,4DCP).

143 Results and Discussion

Figure (46): Concentration of Cl – of isolate MAM24 on different concentrations of 2,4dichlorophenol (2,4DCP).

144 Results and Discussion

Table (18): Growth, concentration of extracellular protein & concentration of Cl of isolate MAM27 on different concentrations of 2,4dichlorophenol (2,4DCP).

Zero 0.174 44.8 1.972 0.175 45.0 1.982 0.171 45.3 1.990 0.196 48.0 1.900 0.203 48.5 1.950 (Initial) 1 0.220 43.4 2.986 0.224 53.2 2.943 0.228 146.2 2.529 0.193 264.4 1.872 0.194 349.0 2.100

2 0.217 50.4 2.943 0.221 51.8 3.086 0.252 172.8 3.157 0.190 295.2 2.129 0.174 374.2 10.400

3 0.216 51.8 2.872 0.220 53.2 3.372 0.277 202.8 5.143 0.190 313.0 5.443 0.169 400.0 12.910 4 0.213 54.6 2.643 0.218 64.4 3.443 0.295 146.2 10.672 0.191 322.4 11.378 0.161 400.5 13.200

5 0.210 54.6 2.529 0.211 64.4 10.386 0.306 119.6 11.201 0.195 363.0 12.574 0.159 403.2 13.250

6 0.197 53.2 2.443 0.205 63.0 10.315 0.305 115.4 11.316 0.209 363.0 12.600 0.157 406.0 13.670 7 0.194 51.8 2.400 0.199 61.6 10.286 0.303 109.8 11.387 0.230 350.4 13.000 0.168 408.2 14.100

15 0.167 50.0 2.350 0.191 60.0 10.100 0.303 106.0 11.300 0.259 350.0 12.990 0.204 406.0 13.500

21 0.161 61.6 2.257 0.190 58.8 2.043 0.295 93.8 11.101 0.276 272.8 12.830 0.200 401.0 13.200

145 Results and Discussion

Figure (47): Growth of isolate MAM27 on different concentrations of 2,4dichlorophenol (2,4DCP).

Figure (48): Concentration of extracellular protein of isolate MAM27 on different concentrations of 2,4dichlorophenol (2,4DCP).

146 Results and Discussion

Figure (49): Concentration of Cl –of isolate MAM27 on different concentrations of 2,4dichlorophenol (2,4DCP).

147 Results and Discussion

Slight increase in growth at the first day followed by decrease in growth as incubation period increased at 20M of 2,4DCP by isolate MAM29. As the concentration became higher an increase had been notice a long the incubation period as in Table (19) and Fig. (50). As the concentration of 2,4DCP increased or the incubation period increase, the extracellular protein increased as in Table (19) and Fig. (51). At high concentrations of 2,4 DCP (1 and 2mM), as the incubation period increase, the Cl concentration increased to reach the maximum at the sixth of day incubation as shown in Table (19) and Fig. (52).

Growth of isolate MAM33 on 20 and 100M of 2,4DCP indicated an increase till the fifth day and this increase was continue to the seventh day when 500M of 2,4DCP used. As the concentration increased (1mM), the growth increased till the sixth day and decreased. In case of 2mM of 2,4DCP growth decreased and the beginning of increase was after 15 days as shown in Table (20) and Fig. (53). This may be attributed to a lag time needed for the bacterial strain to be adapted since 2,4DCP is a phenolic compound which is toxic especially at high concentrations. Extracellular protein and chloride ion concentration revealed an increase in protein secretion and Cl as the incubation period increased and also as the concentrations of 2,4DCP increased as in Table (20) and Fig. (54 and 55). This may be explained on the bases that Cl concentrations was 2,4 DCP concentration dependent. At low concentrations (20 and 100M) of 2,4DCP, the Gram negative isolate MAM3 increased slightly after 24 hours and began to decrease. But at higher concentrations, as the incubation periods increased, the growth increased as in Table (21) and Fig. (56). As the concentration of 2,4 DCP increased, both the extracellular protein and Cl concentrations increased as in Table (21) and Fig (57 and 58).

148 Results and Discussion

Table (19): Growth, concentration of extracellular protein & concentration of Cl of isolate MAM29 on different concentrations of 2,4dichlorophenol (2,4DCP).

Zero 0.088 53.2 3.329 0.056 55.0 3.220 0.076 52.00 3.300 0.084 56.5 3.350 0.083 58.0 3.295 (Initial) 1 0.093 61.6 5.000 0.107 89.6 1.972 0.099 208.4 0.815 0.108 292.4 2.400 0.081 356.0 5.072

2 0.088 67.2 2.900 0.095 89.6 2.343 0.101 209.8 0.915 0.125 311.2 3.072 0.080 371.4 12.217

3 0.068 63.0 2.858 0.091 101.4 2.600 0.111 221.0 1.443 0.149 323.8 5.243 0.089 400.5 14.948 4 0.066 60.2 2.172 0.076 114.0 2.686 0.118 242.0 2.400 0.154 328.0 12.517 0.112 400.5 15.220

5 0.058 60.2 2.072 0.081 96.6 3.243 0.120 254.6 2.614 0.139 337.8 13.790 0.133 400.0 15.363

6 0.057 60.0 1.700 0.080 95.2 2.729 0.121 264.4 3.172 0.119 333.6 13.632 0.156 382.6 15.625 7 0.049 56.0 1.514 0.080 95.2 2.572 0.125 268.6 2.872 0.118 288.2 13.575 0.168 377.0 15.222

15 0.048 50.0 1.500 0.079 95.0 2.500 0.126 268.0 2.800 0.116 288.0 13.500 0.166 377.0 15.200

21 0.040 29.4 1.429 0.078 92.4 2.443 0.128 271.4 2.014 0.116 314.0 10.472 0.160 307.0 12.302

149 Results and Discussion

Figure (50): Growth of isolate MAM29 on different concentrations of 2,4dichlorophenol (2,4DCP).

20M 100M 500M 1mM 2mM 450

400

350

300

250

200

150 Protein (g/ml) 100

0 0 1 2 3 4 5 6 7 1521 Incubation period (days)

Figure (51): Concentration of extracellular protein of isolate MAM29 on different concentrations of 2,4dichlorophenol (2,4DCP).

150 Results and Discussion

Figure (52): Concentration of Cl – of isolate MAM29 on different concentrations of 2,4dichlorophenol (2,4DCP).

151 Results and Discussion

Table (20): Growth, concentration of extracellular protein & concentration of Cl of isolate MAM33 on different concentrations of 2,4dichlorophenol (2,4DCP).

Zero 0.124 43.4 3.343 0.109 45.5 3.400 0.104 42.9 3.490 0.232 43.9 3.500 0.196 45.5 3.550 (Initial) 1 0.126 44.8 5.386 0.117 92.4 12.560 0.102 216.8 11.602 0.239 272.8 10.758 0.146 356.0 10.315

2 0.128 50.4 12.688 0.115 96.6 13.561 0.102 236.4 13.132 0.231 321.0 13.803 0.128 371.4 12.431

3 0.128 70.0 13.561 0.118 121.0 13.860 0.111 244.8 13.160 0.239 328.0 14.748 0.129 375.6 14.404 4 0.129 101.4 13.575 0.119 102.8 13.861 0.119 253.2 13.218 0.238 360.2 14.791 0.130 400.0 14.462

5 0.139 78.4 13.675 0.121 100.0 13.865 0.128 249.0 14.147 0.237 362.4 14.819 0.141 404.5 15.620

6 0.131 75.6 13.561 0.118 93.8 13.861 0.129 246.2 13.804 0.233 363.0 15.048 0.147 404.9 15.625 7 0.123 72.8 13.375 0.116 91.0 13.755 0.132 236.4 13.732 0.210 367.2 15.051 0.171 407.1 16.078

15 0.117 72.0 13.300 0.106 91.0 13.700 0.130 236.0 13.700 0.201 367.0 15.000 0.205 407.0 16.000

21 0.115 44.8 12.145 0.101 84.0 11.945 0.129 219.6 13.389 0.171 377.0 15.134 0.230 410.0 16.349

152 Results and Discussion

0.26 20M 100M 500M 1mM 2mM 0.24

0.22

0.20

0.18

O.D 0.16

0.14

0.12

0.10

0.08 0 1 2 3 4 5 6 7 1521 Incubation period (days)

Figure (53): Growth of isolate MAM33 on different concentrations of 2,4dichlorophenol (2,4DCP).

Figure (54): Concentration of extracellular protein of isolate MAM33 on different concentrations of 2,4dichlorophenol (2,4DCP).

153 Results and Discussion

Figure (55): Concentration of Cl –of isolate MAM33 on different concentrations of 2,4dichlorophenol (2,4DCP).

154 Results and Discussion

Table (21): Growth, concentration of extracellular protein & concentration of Cl of isolate MAM3 on different concentrations of 2,4dichlorophenol (2,4DCP).

Zero 0.088 53.2 3.329 0.056 50.8 3.400 0.076 53.0 3.550 0.084 54.2 3.500 0.083 53.8 3.490 (Initial) 1 0.093 61.6 5.000 0.107 89.6 1.972 0.099 208.4 0.815 0.108 292.4 2.400 0.081 356.0 5.072

2 0.088 67.2 2.900 0.095 89.6 2.343 0.101 209.8 0.915 0.125 311.2 3.072 0.080 371.4 12.217 3 0.068 63.0 2.858 0.091 101.4 2.600 0.111 221.0 1.443 0.149 323.8 5.243 0.089 400.5 14.948

4 0.066 60.2 2.172 0.076 114.0 2.686 0.118 242.0 2.400 0.154 328.0 12.517 0.112 400.5 15.220

5 0.058 60.2 2.072 0.081 96.6 3.243 0.120 254.6 2.614 0.139 337.8 13.790 0.133 400.0 15.363 6 0.057 60.0 1.700 0.080 95.2 2.729 0.121 264.4 3.172 0.119 333.6 13.632 0.156 382.6 15.625

7 0.049 56.0 1.514 0.080 95.2 2.572 0.125 268.6 2.872 0.118 288.2 13.575 0.168 377.0 15.222

15 0.048 56.0 1.500 0.079 95.0 2.500 0.126 268.6 2.800 0.116 288.0 13.500 0.166 377.0 15.200 21 0.040 29.4 1.429 0.078 92.4 2.443 0.128 271.4 2.014 0.116 314.0 10.472 0.160 307.0 12.302

155 Results and Discussion

Figure (56): Growth of isolate MAM3 on different concentrations of 2,4dichlorophenol (2,4DCP).

Figure (57): Concentration of extracellular protein of isolate MAM3 on different concentrations of 2,4dichlorophenol (2,4DCP).

156 Results and Discussion

Figure (58): Concentration of Cl – of isolate MAM3 on different concentrations of 2,4dichlorophenol (2,4DCP).

157 Results and Discussion

At low concentration (20M), the results of MAM3 indicated that the highest growth and Cl concentration have been recorded after 1 day incubation. This may explained on the bases that bacterial cells utilize 20M of 2,4DCP and stripping Cl in this incubation period, so as incubation increased, there is an decrease in growth accompanied by decreasing in Cl.

The best growth of E. cloaceae MAM4 on 2,4DCP had been recorded on 20M as in Table (22) and Fig. (59). The maximum growth was found after four or five days incubation period for the different concentrations. As the concentration of 2,4DCP increased the extracellular protein increased as shown in Table (22) and Fig. (60). As the incubation period increased, the Cl concentration increased. The highest Cl concentrations had been recorded in case of 2mM 2,4DCP as in Table (22) and Fig. (61). As a class of compounds, chlorophenols were degraded more readily than chlorobenzoates. Within the chlorophenol class, the relative order of degradability was ortho > meta > para, while that of chlorobenzoates was meta > ortho > para. In laboratory transfers, 2chlorobenzoate, 3 chlorobenzoate, and 2chlorophenol degradation was most easily maintained, while degradation of parachlorinated compounds was very difficult to maintain (Genthner et al ., 1989). The average adaptation time for 2,4DCP, 4CP, phenol and benzoate transformations were 7, 37, 11 and 2 days respectively. The highest concentrations which still allowed the transformation of the compound in acclimated sediments were 3.1mM 2,4DCP, 3.1mM 2CP, 13mM phenol and greater than 52mM benzoate (Zhang and Wiegel, 1990).

158 Results and Discussion

Table (22): Growth, concentration of extracellular protein & concentration of Cl of E. cloaceae MAM4 on different concentrations of 2,4dichlorophenol (2,4DCP).

Zero 0.257 68.6 2.257 0.220 70.5 2.400 0.235 66.8 2.380 0.234 71.2 2.280 0.251 72.8 2.300 (Initial) 1 0.352 36.4 2.514 0.256 75.6 2.057 0.280 237.8 2.614 0.203 304.2 3.286 0.148 336.4 1.929

2 0.303 36.4 3.086 0.254 44.8 5.357 0.238 202.8 2.986 0.213 316.8 5.359 0.201 374.2 10.186

3 0.325 37.8 5.358 0.247 48.0 10.486 0.253 223.8 10.844 0.228 329.4 10.386 0.223 371.4 10.358 4 0.356 44.8 10.186 0.277 50.4 10.257 0.279 233.6 10.858 0.234 337.8 10.615 0.246 409.0 12.617

5 0.332 47.6 12.617 0.273 44.8 10.186 0.295 215.4 10.615 0.281 337.8 10.744 0.251 404.5 15.635

6 0.322 44.6 12.503 0.254 44.8 10.180 0.278 158.8 10.143 0.220 319.6 12.688 0.177 404.5 15.630 7 0.311 42.0 11.659 0.255 44.8 10.178 0.274 158.8 10.000 0.167 314.0 12.245 0.167 400.6 15.620

15 0.291 42.0 11.600 0.234 44.0 10.100 0.267 158.0 9.900 0.217 314.0 12.200 0.163 400.0 15.600

21 0.249 41.6 10.000 0.233 43.0 5.443 0.259 157.6 5.443 0.119 312.6 12.217 0.152 400.0 13.250

159 Results and Discussion

Figure (59): Growth of E. cloaceae MAM4 on different concentrations of 2,4dichlorophenol (2,4DCP).

Figure (60): Concentration of extracellular protein of E. cloaceae MAM4 on different concentrations of 2,4dichlorophenol (2,4DCP).

160 Results and Discussion

Figure (61): Concentration of Cl –of E. cloaceae MAM4 on different concentrations of 2,4dichlorophenol (2,4DCP).

161 Results and Discussion

Table (23): Count of different indigenous isolates on different concentrations of 2,4 dichlorophenol (2,4DCP).

Initial After 7 Days After 21 Days

Isolate 20 M 20 M 100 M 500 M 1 m M 2m M 20 M 100 M 500 M 1 m M 2m M code Count Count Count Count Count Count Count Count Count Count Count Log.N Log.N Log.N Log.N Log.N Log.N Log.N Log.N Log.N Log.N Log.N (CFU/ml) (CFU/ml) (CFU/ml) (CFU/ml) (CFU/ml) (CFU/ml) (CFU/ml) (CFU/ml) (CFU/ml) (CFU/ml) (CFU/ml)

MAM24 13× 11× 45× 14× 19× 90× 29× 34× 17× 8.1 30×10 7 8.5 8.0 8.7 9.1 9.3 8.0 5× 10 7 7.6 7.5 7.5 7.2 10 7 10 7 10 7 10 8 10 8 10 6 10 6 10 6 10 6

MAM27 88× 70× 17× 10× 60× 13×10 7 8.1 7.9 7.8 8.2 7.0 2× 10 7 7.3 7× 10 6 6.8 6× 10 6 6.8 3× 10 6 6.5 6.8 8× 10 4 4.9 10 6 10 6 10 7 10 6 10 5

MAM33 29× 12× 14× 13× 60× 38× 13×10 7 8.1 2× 10 7 7.3 2× 10 7 7.3 7.5 7.1 8x 10 5 5.9 8.1 8.1 7.8 7.6 5x 10 5 5.7 10 6 10 6 10 7 10 7 10 6 10 6

MAM3 21× 25× 47× 70× 64× 38× 27× 37×10 6 7.6 7.3 7.4 7.7 9× 10 6 7.0 2x 10 6 6.3 7.8 7.8 7.6 7.4 3x10 5 5.8 10 6 10 6 10 6 10 6 10 6 10 6 10 6

MAM29 11× 74× 13× 11× 90× 66× 20× 26×10 6 7.4 8.0 7.7 8.1 9× 10 6 7.0 1× 10 8 8.0 8.0 8.0 7.8 7.3 5× 10 6 6.7 10 7 10 6 10 7 10 7 10 6 10 6 10 6

162 Results and Discussion

E. 12× 15× 36× 25× 10× 27× cloaceae 11×10 7 8.1 4× 10 6 6.6 7.1 7.2 6x 10 6 6.8 4x 10 6 6.6 7.6 7.4 8.0 7.4 9x 10 5 6.0 10 6 10 6 10 6 10 6 10 7 10 6 MAM4

163 Results and Discussion

The degradation percent of 2chlorophenol, 3chlorophenol and 4 chlorphenol (~ 80 M) reached 100% after 30 to 110 days incubation depending on the type of microorganisms (methanogen; sulphonogenic or denitrifying bacteria). However, in case of benzoate (~ 90120M), 2 chlorobenzoate, 3chlorobenzoate and 4chlorobenzoate, the time needed for complete degradation (100%) ranging from 20 to 90 days for 3 chlorobenzoate but not for 2chlorobernzoate nor 4chlorobenzoate (Häggblom et al., 1993). The ability of soils to mineralize 2,4dichlorophenoxyacetate (2,4D), 3chlorobenzoate (3CBA), 2,4dichlorophenol (2,4DCP) and pentachlorophenol (PCP) were determined. The percent of mineralization (0.0 to 1.0 mg/g dry soil) of 2,4D, 3CBA, 2,4DCP and PCP were ranging from 5% to 85% (Fulthorpe and Schofield, 1999). Growth pattern of isolated bacterial strains on PCP indicated an increase in O.D up to 72 hours (except TE4), but after that it decline (Shah and Thakur, 2002). Under batch culture conditions, Pseudomonas mendocina NSYSU cells were capable to completely mineralizing PCP (40 mg/L) as indicated by decrease in PCP concentration with increase in biomass formation. The cells reached a stationary phase at about 6 days. As the concentration of PCP increased to be 140 mg/L, there was considerable lag phase in the growth rate and the stationary phase was reached after 16 days. Results indicated that the higher the concentration of PCP, the longer the lag phase (Kao et al., 2004). For microorganisms, chlorophenols may act as both a substrate and a toxic substancedepending on their concentration and the biomass. Microbial growth on such a substrate as sole energy and carbon source requires the maintenance of low concentration to avoid killing the population of degraders (Lindstrom and Brown, 1989). A fedbatch technique capable of keeping the concentrations low should enable optimal conditions for effective biodegradation (Witthuhn et al ., 2005).

164 Results and Discussion

All other growth parameters showed a dependence on the DCP concentration indicating 56 mg/L DCP as threshold value. The growth of both strains decreased above DCP concentration of 50 mg/L. It can be assumed that above this concentration, the toxic effect of DCP prevails and causes an energy loss (Witthuhn et al., 2005). However, low cell growth yields were obtained in both batch and fed batch culture (CobosVasconcelos et al., 2006). The lower cell growth yields obtain with 2CP or 4CP suggest that uncoupling was the inhibitor mechanism (Escher et al., 2001). Decrease in specific growth rate and growth yield with increase in the substrate concentrations also was observed by Goswami et al. (2002) in Rhodococcus erythropolis M1 growing on 2CP, 4CP and 2,4DCP degrading bacteria and with Pseudomonas putida grown in mixtures of chlorophenols. Since no real growth of Pseudomonas sp. was observed under these experimental conditions, attempt was to use 2,4DCP and 4Cl mcresol in combination with glucose (Ziagova and Liakapoulou, 2007a). PCP degrading bacteria are found among the Gramnegative genera, Pseudomonas, Alcaligenes, Achromobacter, Burkholderia, Comamonas, Sphingomonas, Ralstonia and Acinetobacter and among the Grampositive genera Rhodococcus, Corynebacterium and Bacillus (Furukawa, 2000;Borja et al., 2005 and Pieper, 2005). The trend reflects the general observation that aerobic PCB biodegradability decreases with increasing chloride (Furukawa, 2000 and Field and SierraAlvarez, 2008). During utilization of carbon source (PCP) a stoichiometric amount of chloride was accumulated in the culture broth. The release of chloride was highest in the case of isolate TE3 followed by TE4, TE2 and TE1, indicating greater degradation of PCP by strain TE3 (Shah and Thakur, 2002). Because molecular weight of PCP consists of 66.7% chloride and the initial concentration of PCP was approximately 40 mg/L, approximately 26.8 mg/L of chloride during PCP mineralization would be detected in A1, B2, B3 at the end when PCP completely depleted (Kao et al., 2004).

165 Results and Discussion

Consumption of 2,4DCP in the growth medium was followed by chloride release. Chloride ion release is stoichiometric only in the case of 2,4 DCP, suggesting complete mineralization as it has been reported by other researchers. Dechlorination of (0.1mM) 2,4DCP took place during the exponential phase of growth (Ziagova and LiakopoulouKyriakides, 2007a). The results of bacterial count of isolates grown on different concentrations of 2,4DCP after 7 and 21 days incubations indicated that isolate MAM24 gave the highest count on the five different concentrations of 2,4DCP as in Table (23). The initial count was 13x10 7 CFU/ml and became 30x10 7, 11x10 7, 45x10 7, 14x10 8 and 19x10 8 CFU/ml on 20, 100, 500, 1000 and 2000M 2,4DCP respectively after 7 days and 9x10 7, 5x10 7, 2.9x10 7, 3.4x10 7 and 1.7x10 7 CFU/ml respectively after 21 days. These results were confirmed by other previous results as the following. The count of colony forming unit was co inside with growth. At the beginning the count was 12x10 6 CFU/ml, after 5 days, the count became 35x10 6 CFU/ml. However, the count decreased to be 21x10 6 after 20 days, then the count increased till it reached 90x10 6 CFU/ml at the end of incubation (240 days) (Shah and Thakur, 2002). Cell population increased from 8x10 6 CFU/ml to more than 23x10 6 CFU/ml within the incubation periods (from day 0 to day 12). Cell population increased from 10x10 6 CFU/ml on day 0 to reach 40x10 6 CFU/ml on day 18. The degradation did not start until cell growth occurred (Kao et al., 2004). Degradation of 2,4DCP by the different bacterial isolates was indicated in Table (24) and Fig. (62). The results revealed that isolates MAM 24 and MAM27 degraded higher percentage (34.7%, 33.0% and 28.8%, 27.4% respectively) of 2,4DCP at the high concentrations (1 and 2mM) than at low concentrations. This may be attributed to the high stress expressed by high concentrations on the bacterial cells, so the bacterial cells secreted more enzymes to degrade 2,4DCP at high concentrations. Surprisingly, one Gram+ve isolate (MAM33) and the two Gramve isolate MAM3 and E. cloaceae MAM4 degraded more than 95% of 2,4DCP at all the

166 Results and Discussion concentrations used in the study. This means that the three isolates having a great ability to degrade this chlorinated compound. Similar results had been recorded by other investigators which confirmed the above results. The degradation of dissolved 2,4DCP was significantly faster than the degradation of the same compound sorbed to the solids, and suspended bacteria degraded the dissolved compound at higher rate than sorbed bacteria. The suspended bacteria degraded 812% of the added dissolved 2,4DCP, while sorbed bacteria made a smaller contribution by degrading about 5% of sorbed 2,4DCP. Suspended bacteria effectively degraded dissolved 2,4DCP (Bengtsson and Carlsson, 2001). Percent of PCP utilization was also parallel to the growth and count. After 5 days incubation, 30% of PCP was utilized, after 20 days 19% of PCP was utilized. The highest utilization (80%) has been achieved after 240 days (Shah and Thakur, 2002). It is observed that TE3 utilized most of PCP (72%) by 96 hours, but TE1, TE2 and TE3 were able to utilize 52, 59, and 68% respectively even after 96 hours (Shah and Thakur, 2002). Complete PCP removal was observed on day 18 (Kao et al., 2004). The removal efficiencies of Burkholderia were 93% for 2CP, 95% for 2,6DCP, 96% for 2,4DCP and 100% for 4CP (CobosVasconcelos et al., 2006). The percentage of consumption ranges between 65% and 11% for 2,4DCP and between 37% and 8% for 4clmcresol respectively depending on its initial concentration (Ziagova and Liakapoulou, 2007a). The degradation of 2CP, 2,4DCP, 2,4,6TCP and PCP by advanced oxidative process (AOP) using the white rot fungus, Trametes pubescens was ranged from 82.0% to 24% (Gonzalez et al., 2010).

167 Results and Discussion

Table (24): Degradation percentage of 2,4dichlorophenol (2,4DCP) after 21 days by HPLC.

% Degradation of 2,4DCP Isolate code 20 M 100 M 500 M 1 mM 2 mM

MAM24 21.4 3.8 3.2 34.7 33.0

MAM27 15.5 2.5 8.8 28.8 27.4

MAM29 7.8 14.1 4.0 11.4 2.4

MAM33 97.4 97.4 96.7 95.3 98.4

MAM3 96.9 98.5 99.1 99.7 99.4

E. cloaceae MAM4 99.8 99.1 99.0 99.3 98.6

168 Results and Discussion

MAM24 MAM27 MAM29 MAM33 MAM3 E. cloaceae MAM-4

110

100

40 %Degradation

0 20 M 100 M 500 M 1 mM 2 mM Concentration

Figure (62): Degradation percentage of 2,4dichlorophenol (2,4DCP) after 21 days by HPLC.

169 Results and Discussion

2,6dichlorophenol indol phenol (2,6DCPP) is a chloroaromatic compound having a special nature. This compound dissolved in water to give dark blue color (dye). This color interfered with growth (O.D), protein and Cl concentration, since all of them depend on turbidity (600nm), calorimetric determination at 720nm for protein or 480nm for Cl determination. So, the results of 2,6DCPP was the net result of the interference between growth (O.D) and the blue color of the compound. As the bacterial growth increased, there is an activity to the bacterial cells, so the color decreased due to degradation. The net result in this case, reading of growth, although it is actually increased, but its spectrophotometric determination decreased. Growth of isolated strain MAM24 on 2,6DCPP was indicated in Table (25) and Fig. (63). At low concentration (20M), growth was decreased as the concentration increased. Growth was increased after 24 hours at 100 and 500M, after that as the incubation period increased, the growth decreased. At 1mM of 2,6DCPP, growth continued its increase for four days and began to decrease. However, at 2mM growth continued for the sixth day and also began to decrease. Extracellular protein, secreted by MAM 24 decreased as the incubation periods increased at 20M of 2,6DCPP as in Table (25) and Fig. (64). However, the other four concentration (100,500,1000,2000M) revealed an increase in extracellular protein after 24 hours incubation and began to decrease as the incubation period increased. The results also showed that as the concentration of 2,6DCPP increased, the extracellular protein increased. In case of Cl concentration, the results as shown in Table (25) and Fig. (65) indicated that at low concentrations (20 and 100M), as the incubation periods increased, the Cl decreased. But, as the concentration of 2,6DCPP increased (500M), Cl concentrations increased for 24 hours and began to decrease. At 1mM, Cl concentration increased till the third day while for 2mM, Cl 170 Results and Discussion concentration was increased and continued higher than the control till the end of the incubation period. The results also, revealed that as the concentrations of 2,6DCPP increased Cl concentrations increased. In case of growth of isolate MAM27 on 2,6DCPP, at 20M, as the incubation period increased, the growth decreased as shown in Table (26) and Fig. (66). At 100 and 500M, growth increased for 24 hours, and began to decreased. As the concentration increased to be 1mM, growth increase continued to the fourth day. However, 2mM continued growth increase to sixth day. Extracellular protein at 20M decreased as the incubation period increased. The other four concentrations increased their secreted protein for 24 hours and began to decrease as the incubation period increased. The results also cleared that as, the concentration of 2,6DCPP increased, the extracellular protein increased as in Table (26) and Fig. (67). Cl at 20M of 2,6DCPP decreased as the incubation period increased from the beginning. Concentration of Cl in all the other four concentrations increased for 24 hours and began to decrease as the incubation periods increased. Also, Cl concentrations increased as the concentrations of 2,6 DCPP increased as shown in Table (26) and Fig. (68).

171 Results and Discussion

Table (25): Growth, concentration of extracellular protein & concentration of Cl –of isolate MAM24 on different concentrations of 2,6dichlorophenol indol phenol (2,6DCPP).

Zero 0.392 107.00 67.00 0.806 101.00 65.50 1.485 103.50 66.50 1.636 101.50 65.60 1.667 100.80 68.50 (Initial) 1 0.377 100.00 61.00 0.829 145.00 62.00 1.529 192.00 80.00 1.778 318.00 87.00 1.759 380.00 158.00 2 0.371 73.00 47.00 0.801 35.00 44.00 1.496 52.00 54.00 1.800 220.00 85.00 1.762 259.00 152.00

3 0.357 71.00 40.00 0.768 35.00 39.00 1.482 50.00 53.00 1.808 129.00 78.00 1.819 183.00 146.00

4 0.329 59.00 33.00 0.754 32.00 38.00 1.445 49.00 52.00 1.844 56.00 65.00 1.834 141.00 136.00 5 0.322 52.00 32.00 0.716 32.00 37.00 1.407 46.00 42.00 1.842 42.00 63.00 1.836 70.00 132.00

6 0.319 35.00 30.00 0.704 28.00 37.00 1.356 39.00 40.00 1.840 35.00 62.00 1.885 48.00 131.00 7 0.311 31.00 29.00 0.675 25.00 36.00 1.219 31.00 37.00 1.832 31.00 61.00 1.855 45.00 101.00

15 0.270 29.00 28.00 0.536 21.00 35.00 1.036 21.00 32.00 1.793 25.00 60.00 1.837 43.00 84.00

21 0.246 20.00 28.00 0.413 7.00 31.00 0.787 21.00 28.00 1.748 21.00 52.00 1.830 35.00 73.00

172 Results and Discussion

Figure (63): Growth of isolate MAM24 on different concentrations of 2,6dichlorophenol indol phenol (2,6DCPP).

Figure (64): Concentration of extracellular protein of isolate MAM24 on different concentrations of 2,6dichlorophenol indol phenol (2,6DCPP).

173 Results and Discussion

Figure (65): Concentration of Cl – of isolate MAM24 on different concentrations of 2,6dichlorophenol indol phenol (2,6DCPP).

174 Results and Discussion

Table (26): Growth, concentration of extracellular protein & concentration of Cl of isolate MAM27 on different concentrations of 2,6dichlorophenol indol phenol (2,6DCPP).

Conc. 20 M 100 M 500 M 1mM 2mM Incubation Protein Cl Protein Cl Protein Cl Protein Cl Protein Cl period O.D O.D O.D O.D O.D (g/ml) (mg/L) (g/ml) (mg/L ) (g/ml) (mg/L) (g/ml) (mg/L) (g/ml) (mg/L) (days)

Zero 0.391 100.00 67.00 0.992 106.00 65.00 1.421 108.00 68.00 1.690 108.50 65.80 1.719 108.50 69.00 (Initial) 1 0.380 91.00 62.00 1.016 160.00 70.00 1.458 215.00 80.00 1.742 342.00 104.00 1.760 400.00 141.00 2 0.372 27.00 57.00 0.903 100.00 62.00 1.378 163.00 59.00 1.773 160.00 90.00 1.781 263.00 140.00

3 0.370 25.00 55.00 0.885 50.00 50.00 1.359 41.00 55.00 1.808 59.00 89.00 1.823 188.00 139.00

4 0.362 15.00 47.00 0.846 31.00 49.00 1.290 35.00 55.00 1.885 57.00 76.00 1.830 125.00 130.00 5 0.354 13.00 40.00 0.808 28.00 48.00 1.279 31.00 47.00 1.890 41.00 73.00 1.855 32.00 126.00

6 0.343 11.00 36.00 0.796 27.00 48.00 1.228 28.00 46.00 1.844 32.00 72.00 1.863 31.00 121.00 7 0.288 10.00 35.00 0.767 24.00 46.00 1.112 25.00 43.00 1.778 27.00 62.00 1.858 28.00 91.00

15 0.216 8.00 34.00 0.600 14.00 44.00 0.959 24.00 41.00 1.771 21.00 61.00 1.847 28.00 86.00

21 0.200 7.00 32.00 0.465 8.00 38.00 0.650 14.00 40.00 1.699 20.00 60.00 1.813 25.00 79.00

175 Results and Discussion

20M 100M 500M 1mM 2mM 2.00 1.80 1.60 1.40 1.20 1.00 O.D 0.80 0.60 0.40 0.20 0.00 0 1 2 3 4 5 6 7 1521 Incubation period (days)

Figure (66): Growth of isolate MAM27 on different concentrations of 2,6dichlorophenol indol phenol (2,6DCPP).

Figure (67): Concentration of extracellular protein of isolate MAM27 on different concentrations of 2,6dichlorophenol indol phenol (2,6DCPP).

176 Results and Discussion

Figure (68): Concentration of Cl – of isolate MAM27 on different concentrations of 2,6dichlorophenol indol phenol (2,6DCPP).

177 Results and Discussion

Growth of isolate MAM29 at low concentrations (20M and 100M) of 2,6DCPP increased for 24 hours and began to decrease as the incubation period increased as in Table (27) and Fig. (69). As the concentration of 2,6DCPP increased, the growth continued to increased second, fifth and seventh days for 500, 1000 and 2000M respectively. Extracellular protein increased for 24 hours and began to decrease as the incubation periods increased for the whole concentrations as in Table (27) and Fig. (70). The results showed that, as the concentration of 2,6DCPP increased, the extracellular protein increased. Concentrations of Cl decreased as the incubation periods increased at low concentrations of 2,6DCPP (20 and 100M). At higher concentrations, Cl increased for the first or second days and began to decreased for 500, 1000 and 2000M respectively as in Table (27) and Fig. (71). Growth trend of isolate MAM33 on different concentrations of 2,6DCPP was shown in Table (28) and Fig. (72). At low concentration (20M), as the incubation increased, the growth decreased. Growth on concentrations (100 and 500M) increased for 24 hours and began to decrease. As the concentrations increased more (1 and 2mM), growth continued increasing for the fourth and sixth days respectively. Extracellular proteins, increased for the five concentrations of 2,6 DCPP for the first day and began to decrease as the incubation period increased as in Table (28) and Fig. (73). The results also revealed that increasing in protein secreted was accompanied by increasing in chloroaromatic compound concentrations. Concentrations of Cl decreased as the incubation periods increased for the first four concentrations of 2,6DCPP as in Table (28) and Fig. (74). At 2mM, Cl increased for 24 hours and began to decreased, but till 21 days, Cl concentrations was higher than the control.

178 Results and Discussion

Growth of the Gramnegative isolate MAM3 on 2,6DCPP at low concentration 20M, was decreased as the incubation period increased as in Table (29) and Fig. (75). As the concentrations increased (100 and 500M), growth increased for 24 hours and began to decrease. At higher concentrations (1 and 2mM), growth continued increasing till the fourth and fifth days respectively. Extracellular protein, decreased as the incubation period increased at 20M of 2,6DCPP as in Table (29) and Fig. (76). At higher concentrations, the secreted protein increased for the first 24 hours and began to decrease as the incubation periods increased. Concentrations of Cl at 20M decreased as the incubation period increased as in Table (29) and Fig. (77). At higher concentrations there were a tinny increase in Cl concentrations. However at 2mM, there was a detectable increase in Cl for 24 hours and began to decrease as the incubation period increased.

179 Results and Discussion

Table (27): Growth, concentration of extracellular protein & concentration of Cl of isolate MAM29 on different concentrations of 2,6dichlorophenol indol phenol (2,6DCPP).

Zero 0.297 59.00 58.00 1.092 60.50 58.00 1.207 60.00 57.50 1.665 62.00 59.00 1.680 62.50 59.50 (Initial) 1 0.322 70.00 56.00 1.174 169.00 58.00 1.213 167.00 66.00 1.757 248.00 72.00 1.779 400.00 125.00

2 0.302 45.00 52.00 1.085 78.00 57.00 1.236 85.00 42.00 1.762 121.00 71.00 1.782 190.00 125.00

3 0.292 38.00 47.00 1.064 70.00 49.00 1.206 69.00 40.00 1.769 97.00 71.00 1.869 171.00 123.00 4 0.278 38.00 38.00 1.045 66.00 47.00 1.166 63.00 38.00 1.839 35.00 66.00 1.913 107.00 121.00

5 0.253 35.00 37.00 1.010 45.00 47.00 1.117 28.00 37.00 1.864 32.00 46.00 1.916 91.00 103.00

6 0.246 32.00 37.00 0.931 36.00 44.00 1.042 25.00 30.00 1.861 29.00 44.00 1.918 90.00 96.00 7 0.244 31.00 35.00 0.706 35.00 40.00 1.034 25.00 29.00 1.783 28.00 42.00 1.828 87.00 95.00

15 0.238 25.00 32.00 0.684 24.00 39.00 0.815 24.00 28.00 1.711 25.00 42.00 1.797 84.00 91.00

21 0.206 14.00 30.00 0.514 20.00 32.00 0.605 21.00 25.00 1.609 24.00 41.00 1.790 78.00 79.00

180 Results and Discussion

Figure (69): Growth of isolate MAM29 on different concentrations of 2,6dichlorophenol indol phenol (2,6DCPP).

Figure (70): Concentration of extracellular protein of isolate MAM29 on different concentrations of 2,6dichlorophenol indol phenol (2,6DCPP).

181 Results and Discussion

Figure (71): Concentration of Cl – of isolate MAM29 on different concentrations of 2,6dichlorophenol indol phenol (2,6DCPP).

182 Results and Discussion

Table (28): Growth, concentration of extracellular protein & concentration of Cl of isolate MAM33 on different concentrations of 2,6dichlorophenol indol phenol (2,6DCPP).

Zero 0.449 97.00 79.00 1.215 95.50 78.00 1.533 96.80 77.80 1.649 98.00 80.00 1.646 98.50 81.50 (Initial) 1 0.437 101.00 77.00 1.301 161.00 71.00 1.613 197.00 70.00 1.671 218.00 71.00 1.738 400.00 122.00 2 0.415 38.00 76.00 1.186 77.00 50.00 1.493 125.00 52.00 1.702 183.00 70.00 1.792 145.00 121.00

3 0.397 35.00 47.00 1.149 76.00 48.00 1.482 62.00 52.00 1.754 53.00 58.00 1.832 134.00 120.00

4 0.390 32.00 46.00 1.119 63.00 47.00 1.431 53.00 47.00 1.838 52.00 55.00 1.860 100.00 115.00 5 0.386 31.00 45.00 1.095 43.00 47.00 1.400 42.00 45.00 1.799 50.00 52.00 1.869 48.00 100.00

6 0.355 27.00 40.00 1.067 36.00 46.00 1.395 32.00 44.00 1.693 48.00 51.00 1.909 46.00 95.00 7 0.318 21.00 37.00 1.017 35.00 45.00 1.333 28.00 42.00 1.567 42.00 51.00 1.854 42.00 95.00

15 0.315 17.00 35.00 0.769 27.00 44.00 1.044 24.00 41.00 1.554 40.00 50.00 1.827 42.00 80.00

21 0.262 11.00 34.00 0.652 24.00 40.00 0.829 20.00 40.00 1.538 28.00 46.00 1.796 35.00 80.00

183 Results and Discussion

Figure (72): Growth of isolate MAM33 on different concentrations of 2,6dichlorophenol indol phenol (2,6DCPP).

20M 100M 500M 450

400 1mM 2mM

350

300

250

200

150 Protein (g/ml) 100

0 0 1 2 3 4 5 6 7 1521 Incubation period (days)

Figure (73): Concentration of extracellular protein of isolate MAM33 on different concentrations of 2,6dichlorophenol indol phenol (2,6DCPP).

184 Results and Discussion

Figure (74): Concentration of Cl – of isolate MAM33 on different concentrations of 2,6dichlorophenol indol phenol (2,6DCPP).

185 Results and Discussion

Table (29): Growth, concentration of extracellular protein & concentration of Cl of isolate MAM3 on different concentrations of 2,6dichlorophenol indol phenol (2,6DCPP).

Zero 0.678 108.00 67.00 1.193 109.00 67.50 1.623 110.00 65.90 1.682 107.50 67.00 1.708 110.00 68.80 (Initial) 1 0.539 100.00 59.00 1.274 210.00 72.00 1.640 129.00 66.00 1.690 160.00 73.00 1.718 372.00 188.00 2 0.401 49.00 53.00 1.160 104.00 56.00 1.592 90.00 57.00 1.699 136.00 71.00 1.782 167.00 154.00

3 0.392 38.00 52.00 1.151 52.00 45.00 1.411 41.00 57.00 1.769 57.00 62.00 1.834 90.00 137.00

4 0.349 31.00 40.00 1.144 46.00 45.00 1.374 35.00 47.00 1.786 52.00 61.00 1.925 45.00 127.00 5 0.312 29.00 37.00 1.065 43.00 44.00 1.343 27.00 47.00 1.742 45.00 59.00 1.951 42.00 107.00

6 0.305 29.00 36.00 1.049 34.00 40.00 1.301 24.00 46.00 1.720 31.00 46.00 1.890 30.00 92.00 7 0.258 28.00 35.00 1.030 30.00 36.00 1.157 21.00 42.00 1.717 27.00 37.00 1.837 25.00 90.00

15 0.245 25.00 31.00 0.673 21.00 32.00 0.978 21.00 42.00 1.697 21.00 36.00 1.804 21.00 83.00

21 0.233 24.00 30.00 0.651 14.00 33.00 0.873 15.00 40.00 1.507 20.00 35.00 1.756 21.00 81.00

186 Results and Discussion

Figure (75): Growth of isolate MAM3 on different concentrations of 2,6dichlorophenol indol phenol (2,6DCPP).

Figure (76): Concentration of extracellular protein of isolate MAM3 on different concentrations of 2,6dichlorophenol indol phenol (2,6DCPP).

187 Results and Discussion

Figure (77): Concentration of Cl – of isolate MAM3 on different concentrations of 2,6dichlorophenol indol phenol (2,6DCPP).

188 Results and Discussion

The other Gramnegative bacteria strain E. cloaceae MAM4 when grown on 2,6DCPP showed decreased growth as the incubation period increased at low concentration (20M) as in Table (30) and Fig. (78). At higher concentrations (100 and 500M), growth increased for 24 hours and began to decreased as the incubation increased. More increasing in concentrations (1 and 2mM) showed increasing in growth till the sixth day. Extracellular protein, in all concentrations indicated an increase for 24 hours and began to decrease as the incubation increased as in Table (30) and Fig. (79). Concentrations of Cl at low concentrations of 2,6 DCPP decreased as the incubation periods increased from the beginning as in Table (30) and Fig. (80). At higher concentrations (500, 1000 and 2000M) Cl concentrations increased for the first 24 hours and began to decrease. Also as the concentrations of 2,6DCPP increased the Cl concentrations increased. Count of different indigenous bacterial isolates on different concentration of 2,6DCPP showed that initial count was ranging from 3.0×10 7 to 4.9×10 8 CFU/ml as indicated in Table (31). Count of isolate MAM24 was ranging from 4.0 ×10 6 to 4.0×10 7 CFU/ml along the period of incubation. The initial count of isolate MAM27 was 4.6×10 7. There was no increase in count along the period of incubation. Count of MAM 27 was ranging from 9.0×10 5 to 4.0 ×10 7 CFU/ml. The highest initial count had been recorded for isolate MAM33 (4.9×10 8 CFU/ml). Count of isolate MAM33 was ranging from 1×10 6 to 1.6×10 8 CFU/ml along the incubation period. Isolate MAM29 recorded the highest count at high concentrations (1 and 2mM) after 21 days incubation as in Table (31). The Gramnegative bacterial isolate MAM3 showed the highest count on 20M of 2,6DCPP along the incubation period. Also E. cloaceae MAM4, the Gramnegative bacteria showed a count ranging for 5.0×10 5 to 6.0 ×10 7 CFU/ml, while its initial count was 2.8×10 8 CFU/ml. There was no increasing in count.

189 Results and Discussion

Table (30): Growth, concentration of extracellular protein & concentration of Cl of E. cloaceae MAM4 on different concentrations of 2,6dichlorophenol indol phenol (2,6DCPP).

Zero 0.479 84.00 66.00 1.288 85.00 67.00 1.469 87.00 65.80 1.718 85.90 66.50 1.747 88.50 67.80 (Initial) 1 0.474 85.00 61.00 1.396 163.00 62.00 1.546 184.00 72.00 1.764 164.00 89.00 1.810 356.00 182.00

2 0.464 71.00 59.00 1.330 83.00 55.00 1.456 86.00 61.00 1.766 153.00 87.00 1.839 190.00 130.00

3 0.435 58.00 42.00 1.258 63.00 53.00 1.450 52.00 55.00 1.783 104.00 72.00 1.866 91.00 128.00 4 0.433 49.00 41.00 1.207 62.00 47.00 1.441 35.00 48.00 1.795 94.00 71.00 1.893 87.00 121.00

5 0.432 38.00 40.00 1.151 55.00 46.00 1.397 27.00 46.00 1.835 91.00 70.00 1.894 86.00 115.00

6 0.412 35.00 39.00 1.131 52.00 44.00 1.212 25.00 45.00 1.861 57.00 66.00 1.928 69.00 101.00 7 0.384 32.00 34.00 1.088 38.00 44.00 1.135 21.00 44.00 1.776 53.00 61.00 1.884 42.00 93.00

15 0.379 32.00 30.00 0.949 29.00 39.00 1.120 21.00 44.00 1.775 36.00 44.00 1.875 38.00 91.00

21 0.331 24.00 30.00 0.731 14.00 36.00 0.897 20.00 40.00 1.657 31.00 42.00 1.819 35.00 88.00

190 Results and Discussion

Figure (78): Growth of E. cloaceae MAM4 on different concentrations of 2,6dichlorophenol indol phenol (2,6DCPP).

Figure (79): Concentration of extracellular protein of E. cloaceae MAM4 on different concentrations of 2,6dichlorophenol indol phenol (2,6DCPP).

191 Results and Discussion

Figure (80): Concentration of Cl – of E. cloaceae MAM4 on different concentrations of 2,6dichlorophenol indol phenol (2,6DCPP).

192 Results and Discussion

Table (31): Count of different indigenous isolates on different concentrations of 2,6dichlorophenol indol phenol (2,6DCPP).

Initial After 7 Days After 21 Days

Isolate code 20 M 20 M 100 M 500 M 1 m M 2m M 20 M 100 M 500 M 1 m M 2m M Count Count Count Count Count Count Count Count Count Count Count Log.N Log.N Log.N Log.N Log.N Log.N Log.N Log.N Log.N Log.N Log.N (CFU/ml) (CFU/ml) (CFU/ml) (CFU/ml) (CFU/ml) (CFU/ml) (CFU/ml) (CFU/ml) (CFU/ml) (CFU/ml) (CFU/ml)

MAM24 38×10 6 7.6 17×10 6 7.2 1× 10 7 7.0 2× 10 7 7.3 4× 10 6 6.6 3× 10 7 7.5 4× 10 7 7.6 2× 10 7 7.3 4× 10 7 7.6 8x 10 6 6.9 9x 10 6 7.0

MAM27 46×10 6 7.7 4× 10 7 7.6 15×10 6 7.2 8× 10 6 6.9 9x 10 5 6.0 5x10 6 6.7 4× 10 6 6.6 3× 10 6 6.5 2× 10 6 6.3 1x 10 6 6.0 9 x 10 5 6.0

MAM33 49×10 7 8.7 14×10 6 7.4 11×10 6 7.0 1× 10 7 7.0 5× 10 7 7.7 7× 10 6 6.8 7× 10 6 6.8 16×10 7 8.2 1× 10 6 6.0 1× 10 6 6.0 1× 10 6 6.0

MAM3 30×10 6 7.5 2× 10 8 8.3 6× 10 7 7.8 2× 10 7 7.3 9x 10 6 7.0 5x 10 6 6.7 1× 10 8 8.0 30×10 6 7.5 10×10 6 7.0 7x 10 5 5.8 8x 10 5 5.9

MAM29 88×10 6 7.9 15×10 7 8.2 21×10 6 7.3 1× 10 7 7.0 17×10 6 7.2 7× 10 6 6.8 46×10 6 7.7 40×10 6 7.6 79×10 6 7.9 19×10 7 8.3 7× 10 7 7.8

E. Cloaceae 28×10 7 8.4 14×10 6 7.1 6× 10 7 7.8 5× 10 6 6.7 3x10 6 6.5 2x 10 6 6.3 3× 10 6 6.5 19×10 6 7.3 3× 10 6 6.5 7x 10 5 5.8 5x10 5 5.7 MAM4

193 Results and Discussion

General observation cleared that all the used isolated had the same behavior in secreting the highest enzymatic activities at the first 24 hours and began to decrease at the rest of incubation period. This means that 2,6 DCPP induced the enzymes at the first 24 hours to degrade the chloroaromatic compound neverless the concentration of the dye (2,6 DCPP). As the concentration of compound increased, the amount of enzymes secreted increased.

The ability of different isolates to remove (degrade 2,6DCPP had been indicated in Table (32) and Fig. (81). The results revealed that the lowest removal percentage had been recorded at the low concentration of 2,6DCPP (20M). As the concentrations of 2,6DCPP increased, the removal (degradation) percentage increased to reach the maximum at 500 or 1000M, then began to decrease as the concentration reached 2000M.

Isolates MAM24, 27, 29, 33, 3 and E. cloaceae MAM4 degraded 96.8%, 93.7%, 97.1%, 93.6%, 92.3% and 93.4% of 500M 2,6DCPP respectively. The same isolates and E. cloaceae MAM4 degraded 95.0%, 84.0%, 93.7%, 96.9%, 94.0% and 90.8% of 1000M of 2,6DCPP respectively. At higher concentration (2000M) of 2,6DCPP, the same isolates and E. cloaceae MAM4 degraded 90.0%, 87.6%, 83.7%, 96.1%, 88.0% and 79.3% respectively.

So, the results revealed that the five isolates and the Gramnegative E. cloaceae MAM4 their degradation percentage of 2,6DCPP at the higher concentrations (500, 1000 and 2000M) was ranging from 79.3% to 97.1%. The best isolate in degrading 2,6DCPP at the high concentration (2000M) was MAM24 which degrade 90% of 2mM of 2,6DCPP.

During the last few years it has been demonstrated that several microorganisms are able, under certain environmental conditions, to transform azo dyes to non colored products or even to completely

194 Results and Discussion mineralize them. Thus, various lignolytic fungi were shown to decolorize azo dye using ligninases, manganese peroxidases or laccases. For some model dyes, the degradative pathways have been investigated and a true mineralization to carbon dioxide has been shown (Stolz, 2001).

It was originally assumed that manganese peroxidases and laccases would only convert a rather limited spectrum of azo dyes and preferencially convert dyes which carry a phenolic substituent in para position to the azo band and additional methylor methoxysubstituents in 2 or 2,6position in relation to the hydroxyl group (PastiGrigsby et al., 1992 and Chivukula et al. , 1995). More recently it was shown that certain manganese peroxidase (e.g., from Bjerkandera adusta ) or laccases (e.g., from Pycnoporus cinnabarinus ) are also able to decolorize complex industrially relevant azo dyes, such as reactive black 5 or direct blue 1 (Heinfling et al., 1998 and Schliephake et al., 2000).

Also, Swelam et al., (2005) found that the indigenous microbial population of the sludge samples grow well on 10M, 100M of 2,6 dichlorophenol indolphenol sodium salt as a sole carbon and energy source.

AboState et al., (2005) investigated the 2,6dichlorophenol indol phenol sodium salt when used as a sole carbon and energy source (1mM) in basal salt media (BSM), the isolate MAM96 was capable to remove 77% after 15 days incubation period.

195 Results and Discussion

Table (32): Degradation percentage of 2,6dichlorophenol indol phenol (2,6DCPP) after 21 days by HPLC.

% Degradation of 2,6DCPP Isolate code 20 M 100 M 500 M 1 mM 2 mM

MAM24 20.5 89.7 96.8 95.0 90.0

MAM27 19.9 83.8 93.7 84.0 87.6

MAM29 77.2 88.0 97.1 93.7 83.7

MAM33 34.4 99.0 93.6 96.9 96.1

MAM3 52.3 77.3 92.3 94.0 88.0

E. cloaceae MAM4 12.8 91.7 93.4 90.8 79.3

196 Results and Discussion

MAM24 MAM27 MAM29 MAM33 MAM3 E. cloaceae MAM-4

110

100

40 % Degradation % 30

0 20 M 100 M 500 M 1 mM 2 mM Concentration

Figure (81): Degradation percentage of 2,6 dichlorophenol indol phenol (2,6DCPP) after 21 days by HPLC.

197 Results and Discussion

Growth of isolate MAM24 on 5M of 1,2,4TCB as in Table (33) and Fig. (82) showed an increase and stability till the third day and began to decreased. As the concentration became 10 M the growth increased till the fourth day. However, at15,25 and 50M the growth was increased till the sixth and fifth day then began to decrease.

Extracellular protein was increased as the incubation period increased at the first three concentrations (5, 10, and 15M) of 1,2,4TCB till the fourth day then began to decrease. At 25M, the secreted protein continued to increase till the fifth day. As the concentration increased more (50M), the secreted protein continued increasing till the sixth day as in Table (33) and Fig. (83). From the previous results, it was clear that as the concentrations of 1,2,4TCB increased, there were an increase in time for extracellular protein secreated by the cells. This may be explained on the bases that higher concentrations of 1,2,4TCB need more enzyme to be secreted to degrade the compound and this increasing in enzymatic activity needs more time to face the increasing demand (stress).

Concentration of Cl was increased till the first and second day for the first four concentrations of 1,2,4TCB as in Table (33) and Fig. (84). At the higher concentration (50M), Cl concentrations continued increasing till the fourth day and began to decrease as the incubation period increased.

Growth of isolate MAM27 showed an increasing till the third day of incubation on the five concentrations of 1,2,4TCB as in Table (34) and Fig. (85). Then growth began to decrease. Extracellular protein of this isolate increased as the incubation period increased till the fifth day on the five concentrations as in Table (34) and Fig. (86). 198 Results and Discussion

Concentrations of Cl increased as the incubation period increased till the third day and then began to decrease in case of the first four concentrations (5, 10, 15 and 25M). At higher concentration (50M), Cl concentration continued to increase till the sixth day as in Table (34) and Fig. (87). The results revealed that, as the concentration of 1,2,4TCB increased, Cl concentration increased.

Trend of growth of isolate MAM29 showed an increase for the first or second day, and then began to decrease as indicated in Table (35) and Fig. (88) for all concentrations. However, its extracellular protein for the five concentration of 1,2,4TCB showed an increase till the fifth day of incubation and then began to decrease as more incubation had been recorded as in Table (35) and Fig. (89).

In case of Cl concentration, isolate MAM29 continued to increase Cl till the third day at the lower concentrations (5, 10 and 15M) as shown in Table (35) and Fig. (90). As the concentrations of 1,2,4TCB increased (25 and 50M), the increase in Cl concentration increased till the fifth and sixth days respectively.

199 Results and Discussion

Table (33): Growth, concentration of extracellular protein & concentration of Cl of isolate MAM24 on different concentrations of 1,2,4trichlorobenzene (1,2,4TCB).

Conc. 5 M 10 M 15 M 25 M 50 M Incubation Protein Cl Protein Cl Protein Cl Protein Cl Protein Cl Period O.D O.D O.D O.D O.D (µg/ml) (mg/L) (µg/ml) (mg/L ) (µg/ml) (mg/L) (µg/ml) (mg/L) (µg/ml) (mg/L) (days)

Zero 0.240 5.6 1.872 0.190 5.6 1.800 0.140 6.2 1.820 0.180 6.3 1.805 0.160 6.4 1.835 (Initial) 1 0.260 6.0 1.900 0.196 11.2 1.215 0.160 6.0 0.872 0.200 6.0 2.257 0.170 2.8 2.514 2 0.260 26.6 1.586 0.200 50.4 3.043 0.170 50.4 3.143 0.200 50.4 3.800 0.180 44.8 2.614

3 0.260 54.8 1.280 0.210 64.5 2.956 0.185 65.0 3.000 0.200 75.0 3.400 0.190 48.5 2.900

4 0.240 61.6 0.872 0.220 39.2 2.800 0.171 67.2 2.614 0.200 85.4 2.614 0.190 50.4 3.800 5 0.240 56.0 0.686 0.210 37.2 1.900 0.180 44.8 2.429 0.219 86.8 2.429 0.200 72.8 3.429

6 0.230 50.4 0.600 0.200 33.6 1.557 0.187 39.2 2.329 0.190 33.6 1.729 0.197 79.8 2.086

7 0.220 44.8 0.458 0.170 32.2 1.043 0.160 35.0 1.800 0.182 29.4 1.329 0.170 44.8 1.900 15 0.215 28.0 0.372 0.160 28.0 0.686 0.150 28.0 1.072 0.180 28.0 0.872 0.160 39.2 1.557

21 0.213 22.4 0.329 0.151 11.2 0.514 0.140 22.4 0.872 0.172 23.8 0.686 0.157 33.6 1.400

200 Results and Discussion

Figure (82): Growth of isolate MAM24 on different concentrations of 1,2,4trichlorobenzene (1,2,4TCB).

Figure (83): Concentration of extracellular protein of isolate MAM24 on different concentrations of 1,2,4trichlorobenzene (1,2,4TCB).

201 Results and Discussion

Figure (84): Concentration of Cl – of isolate MAM24 on different concentrations of 1,2,4trichlorobenzene (1,2,4TCB).

202 Results and Discussion

Table (34): Growth, concentration of extracellular protein & concentration of Cl of isolate MAM27 on different concentrations of 1,2,4trichlorobenzene (1,2,4TCB).

Zero 0.140 9.8 0.514 0.160 10.5 0.520 0.150 10.2 0.530 0.140 10.8 0.535 0.150 10.5 0.540 (Initial) 1 0.160 11.2 0.686 0.170 11.2 0.686 0.180 11.2 2.029 0.160 6.0 2.614 0.160 6.0 1.900 2 0.180 33.6 1.043 0.180 16.8 1.215 0.180 28.0 2.086 0.180 39.2 2.958 0.160 50.4 2.086

3 0.180 53.0 1.143 0.180 36.5 1.280 0.180 34.8 2.190 0.180 48.5 2.980 0.150 54.0 2.750

4 0.150 61.6 0.872 0.140 50.4 1.043 0.150 50.4 1.900 0.136 61.6 2.257 0.130 56.4 2.800 5 0.139 68.6 0.729 0.130 61.6 1.029 0.138 54.6 1.729 0.130 66.0 2.100 0.126 61.6 3.143

6 0.127 64.4 0.614 0.110 58.6 0.986 0.120 47.6 1.657 0.097 51.8 1.929 0.099 53.2 3.343

7 0.113 44.8 0.586 0.106 53.2 0.672 0.117 43.4 1.629 0.094 46.2 1.614 0.095 50.4 2.943 15 0.110 33.6 0.514 0.097 32.2 0.586 0.117 29.4 1.557 0.090 32.2 1.157 0.091 32.2 2.343

21 0.103 25.2 0.458 0.091 21.0 0.372 0.103 26.6 1.500 0.087 25.2 0.815 0.080 30.8 1.657

203 Results and Discussion

Figure (85): Growth of isolate MAM27 on different concentrations of 1,2,4trichlorobenzene (1,2,4TCB).

Figure (86): Concentration of extracellular protein of isolate MAM27 on different concentrations of 1,2,4trichlorobenzene (1,2,4TCB).

204 Results and Discussion

Figure (87): Concentration of Cl – of isolate MAM27 on different concentrations of 1,2,4trichlorobenzene (1,2,4TCB).

205 Results and Discussion

Table (35): Growth, concentration of extracellular protein & concentration of Cl of isolate MAM29 on different concentrations of 1,2,4trichlorobenzene (1,2,4TCB).

Zero 0.134 1.4 1.215 0.134 1.6 1.215 0.139 1.4 1.500 0.126 1.8 0.900 0.132 1.7 1.000 (Initial) 1 0.173 4.2 1.229 0.154 14.0 2.143 0.151 1.4 2.157 0.146 4.2 0.943 0.159 2.8 1.086 2 0.141 26.6 1.572 0.137 28.0 2.257 0.136 35.0 2.643 0.163 28.0 1.143 0.137 35.0 1.114

3 0.141 38.5 1.850 0.135 35.2 1.990 0.132 36.5 2.730 0.150 36.0 1.620 0.120 40.0 1.590

4 0.141 58.8 1.229 0.132 42.0 1.400 0.130 39.2 1.686 0.134 39.2 2.100 0.107 44.8 2.429 5 0.137 63.0 1.227 0.129 56.0 1.358 0.121 50.4 1.315 0.124 40.6 2.660 0.101 49.0 3.000

6 0.101 50.4 0.943 0.113 42.0 0.800 0.116 44.8 1.272 0.121 37.8 1.670 0.092 46.2 3.386

7 0.101 39.2 0.886 0.100 39.0 0.614 0.106 42.0 1.114 0.117 32.2 1.420 0.088 30.8 1.729 15 0.091 36.4 0.715 0.100 28.0 0.586 0.084 40.6 1.043 0.115 29.4 1.009 0.083 29.4 1.157

21 0.061 29.4 0.572 0.069 23.8 0.415 0.083 39.2 0.643 0.100 21.0 0.520 0.071 21.0 0.858

206 Results and Discussion

Figure (88): Growth of isolate MAM29 on different concentrations of 1,2,4trichlorobenzene (1,2,4TCB).

Figure (89): Concentration of extracellular protein of isolate MAM29 on different concentrations of 1,2,4trichlorobenzene (1,2,4TCB).

207 Results and Discussion

Figure (90): Concentration of Cl – of isolate MAM29 on different concentrations of 1,2,4trichlorobenzene (1,2,4TCB).

208 Results and Discussion

Trend of growth of isolate MAM33 showed an increase as the incubation period increased till the third day in all the five concentrations as in Table (36) and Fig. (91). Then the growth began to decrease. Extracellular protein secreted by MAM33 increased as the incubation period increased till the fifth day, and then began to decrease as shown in Table (36) and Fig. (92) for the five concentration of 1,2,4TCB used. Concentration of Cl of isolate MAM33 increased till the fourth day at 5 and 10M of 1,2,4TCB. As the concentrations of 1,2,4TCB increased (15, 25 and 50M), Cl concentration continued to increase till the sixth, seventh and fifteen days respectively as in Table (36) and Fig. (93).

Trend of growth of the Gramnegative isolate MAM3 showed an increase till the second day for the first three concentrations (5, 10 and 15M) of 1,2,4TCB. The increase in growth was recorded for the first day and then began to decrease as the incubation increased at the higher concentrations (25 and 50M) as indicated in Table (37) and Fig. (94). Extracellular protein secreted by isolate MAM3 showed an increase in protein as the incubation period increased till the sixth day as in Table (37) and Fig. (95) for the five concentrations of 1,2,4TCB.

Concentration of Cl increased till the second day at 5M of 1,2,4 TCB, till the fourth day for 10 and 15M, till sixth day for 25M and till seventh day for 50M. This means, as the concentration of 1,2,4TCB increased, the dissociation of Cl increased as in Table (37) and Fig. (96). And means also, as concentrations of 1,2,4TCB increased more time was needed for Cl releases i.e. more time was needed for degradation of 1,2,4 TCB.

209 Results and Discussion

Growth trend of Gramnegative E. cloaceae MAM4 on 5M of 1,2,4TCB as in Table (38) and Fig. (97) showed decrease in growth as incubation period increased. At the higher concentrations (10, 15, 25 and 50M), growth increased for the first day of incubation and then began to decrease. Extracellular protein of E. cloaceace MAM4 increased as the incubation period increased till the fifth day for (5 and 10M) of 1,2,4 TCB and till sixth day for the higher concentrations (15, 25 and 50M) as shown in Table (38) and Fig. (98). This means that E. cloaceae need more time to degrade 1,2,4TCB as the concentration increased by secreting more enzymes (extracellular protein).

Concentrations of Cl increased as the incubation period increased till the second day for 5M of 1,2,4TCB, till the fourth day for 10M and till the fifth day for 15, 25 and 50M as in Table (38) and Fig. (99). The results revealed that, as the concentrations increased, bacterial cells of E. cloaceae MAM4 needs more time to secret more enzymes to stipe off the chlorine and degrade the chlorinated compound. So the results of extracellular protein and Cl concentration confirmed each other. The results of previous investigators also confirmed the above results as the following.

Several pure strains were isolated which used chlorobenzenes as sole source of carbon and energy (de Bont et al., 1986; Schraa et al., 1986; van der Meer et al., 1987; Spain and Nishimo, 1987; Haigler et al., 1988; Potrawfke et al., 1998 and Sander et al., 1991).

The ability to degrade 1,2,4TCB has been previously described for Pseudomonas sp. P51 (van der Meer , 1997), Ralstonia sp. PS12 and Ralstonia sp. PS14 (Sander et al., 1991 and Rapp and Timmis, 1999),

210 Results and Discussion

Rodococcus sp. MS11 (Rapp and GabrielJüregens, 2003) and Bordetella strains (Wang et al., 2007), but there are no previous reports on biodegradation of 1,2,4TCB by Bacillus .

Aerobic mineralization of mono, di, tri and even tetrachlorobenzenes is reported (Marinucci and Bartha, 1979; Nishino et al., 1992; Brunsbach and Reineke, 1995; Yadav et al., 1995; Rapp and Timmis, 1999; Tchelet et al., 1999; Brahushi et al., 2002; Dermetzel and Vieth, 2002 and Schroll et al., 2004).

Inoculation with Pseudomonas aeruginosa strain RHO1, a mono and 1,4dichlorobenzenedegrading organism, to a titre of 1x10 5 cells/g soil led to rapid and complete degradation of 0.8mM growth substrate within 30h. In addition, the strain was able to degrade 1,2dichloro and 1,2,4trichlorobenzene with stoichometric release of chloride in the presence of acetate, ethanol, monochloro or 1,4dichlorobenzene as growth substrates (Brunscbach and Reineke, 1994).

The reported data show that biodegradation of 1,2,4Trichlorobenzene in natural samples occur in very low rates due to insufficient degradation capacity and slow adaptation of the indigenous microorganisms (Schroll et al., 2004). The reinoculated strain kept its biodegradation capability: 14 C labeled 1,2,4TCB applied to this inoculated soil was mineralized to about 40% within one month of incubation. This indicates a possible application of the isolated Bordetella sp. for bioremediation of 1,2,4TCB contaminated sites (Wang et al ., 2007).

Utilization of 1,4dichlorobenzene, 1,2,3TCBs and 1,3,5TCBs by the two strains SA2 and SA6, was visually indicated by increased turbidity

211 Results and Discussion and slight darking of the growth medium, with increase in population densities. Growth rates for both organisms were quite similar regardless of whether the cells grown on 1,2,3TCB or 1,3,5TCB. This may suggest that Clsubstitution patterns have little effect on the ability of this organism to utilize these two trichlorobenzene isomers . Consistent with earlier publications, the carbon for growth may have been derived from cleavage of the catechol intermediate with spontaneous release of organic chloride. With stoichiometric release of chloride, the amount of chloride released during metabolism of chlorobenzenes by strains SA2 and SA6 was not determined but the extent of growth suggested either or total mineralization of the chlorobenzenes (Adebusoye et al., 2007).

The measurement of a specific product of biodegradation of chloroaromatics i.e., chloride is a good indicator for microbial degradation of the chemicals. About 70% of organic bound chlorine was eliminated after 25 days from soil, where 23x10 5 cells/g soil with each of the strains were added to the slurries (Brunsbach and Reineke, 1995).

On, 1,4DCB, Xanthobacter flavus 14 P1, grew with doubling time of 8h, which is similar to those reported for other DCBdegrading Pseudomonas or Alcaligenes species and the stoichiometric amount of two chloride ions per molecule of 1,4DCB was released. At concentrations higher than 0.1mM 1,4DCB, bacterial growth was inhibited (Spiess et al., 1995).

The number of dechlorinating bacteria was strictly limited by the amount of TCB supplied in the medium (Adrian et al., 2000).

212 Results and Discussion

Table (36): Growth, concentration of extracellular protein & concentration of Cl of isolate MAM33 on different concentrations of 1,2,4trichlorobenzene (1,2,4TCB).

Zero 0.169 2.8 1.043 0.165 2.8 1.050 0.198 2.8 1.060 0.164 2.9 1.068 0.171 3.00 1.075 (Initial) 1 0.171 4.2 1.372 0.201 7.0 2.086 0.205 6.4 1.100 0.168 4.2 1.943 0.175 7.4 1.643 2 0.175 32.2 1.386 0.173 11.2 2.386 0.194 28.0 2.043 0.186 32.2 2.157 0.188 28.0 2.000

3 0.180 38.5 1.930 0.190 35.0 2.580 0.185 32.8 2.057 0.191 35.5 2.200 0.192 37.2 2.100

4 0.154 46.2 2.157 0.167 36.4 2.886 0.175 42.0 2.057 0.158 35.0 2.329 0.171 40.6 2.129 5 0.151 54.6 0.958 0.155 42.0 2.614 0.164 54.6 2.086 0.144 37.8 2.358 0.150 46.2 2.257

6 0.150 42.0 0.872 0.152 35.0 2.358 0.164 43.4 2.586 0.138 28.0 2.729 0.149 32.2 2.443

7 0.138 36.4 0.600 0.147 26.6 2.114 0.159 39.2 1.114 0.137 27.7 3.200 0.146 30.8 2.958 15 0.117 28.3 0.458 0.139 25.2 1.943 0.125 28.0 0.657 0.112 21.0 3.143 0.133 26.6 3.343

21 0.108 28.0 0.372 0.134 19.6 0.315 0.113 18.2 0.472 0.111 16.8 0.729 0.118 21.0 0.872

213 Results and Discussion

Figure (91): Growth of isolate MAM33 on different concentrations of 1,2,4trichlorobenzene (1,2,4TCB).

Figure (92): Concentration of extracellular protein of isolate MAM33 on different concentrations of 1,2,4trichlorobenzene (1,2,4TCB).

214 Results and Discussion

Figure (93): Concentration of Cl – of isolate MAM33 on different concentrations of 1,2,4trichlorobenzene (1,2,4TCB).

215 Results and Discussion

Table (37): Growth, concentration of extracellular protein & concentration of Cl of isolate MAM3 on different concentrations of 1,2,4trichlorobenzene (1,2,4TCB)

Zero 0.105 2.8 1.900 0.096 2.7 1.000 0.114 2.6 1.000 0.103 2.9 0.400 0.091 3.0 1.000 (Initial) 1 0.126 4.2 1.929 0.106 4.4 1.072 0.117 2.8 1.072 0.114 5.6 0.429 0.108 7.0 1.029 2 0.153 18.2 1.929 0.100 9.8 1.100 0.128 21.0 1.286 0.110 23.8 1.272 0.107 26.6 2.129

3 0.149 28.5 1.620 0.110 15.8 1.519 0.124 24.0 1.980 0.108 25.2 1.490 0.105 27.5 2.200

4 0.133 33.6 1.157 0.097 22.4 1.614 0.123 29.4 2.057 0.108 26.6 1.629 0.104 28.0 2.257 5 0.120 36.4 0.872 0.082 29.4 1.572 0.122 30.8 1.086 0.096 42.0 2.429 0.093 33.6 2.443

6 0.119 43.4 0.729 0.081 42.0 1.172 0.119 39.2 1.072 0.084 45.0 1.358 0.078 36.4 2.657

7 0.109 28.0 0.657 0.077 23.8 1.100 0.111 28.0 1.029 0.070 23.8 1.229 0.060 23.8 2.958 15 0.078 25.2 0.600 0.063 23.0 0.872 0.091 19.6 0.986 0.070 22.4 0.886 0.058 23.0 2.358

21 0.040 19.6 0.586 0.041 19.6 0.715 0.040 16.8 0.657 0.068 16.8 0.715 0.040 15.4 0.872

216 Results and Discussion

Figure (94): Growth of isolate MAM3 on different concentrations of 1,2,4trichlorobenzene (1,2,4TCB).

Figure (95): Concentration of extracellular protein of isolate MAM3 on different concentrations of 1,2,4trichlorobenzene (1,2,4TCB).

217 Results and Discussion

Figure (96): Concentration of Cl – of isolate MAM3 on different concentrations of 1,2,4trichlorobenzene (1,2,4TCB).

218 Results and Discussion

Table (38): Growth, concentration of extracellular protein & concentration of Cl of E. cloaceae MAM4 on different concentrations of 1,2,4trichlorobenzene (1,2,4TCB).

Zero 0.206 11.2 0.686 0.203 11.0 1.300 0.197 11.8 0.400 0.183 5.0 0.500 0.180 5.0 0.200 (Initial) 1 0.189 11.4 0.729 0.216 12.8 1.315 0.209 19.8 0.472 0.185 5.6 0.586 0.187 7.0 0.257 2 0.188 42.0 0.943 0.199 23.8 1.486 0.208 30.8 0.514 0.178 39.2 1.072 0.185 39.2 1.057

3 0.186 50.2 0.800 0.197 25.8 2.000 0.207 38.9 1.000 0.177 45.8 2.000 0.180 49.5 1.500

4 0.184 63.0 0.672 0.197 29.4 2.472 0.206 51.8 2.300 0.174 46.2 2.043 0.176 58.8 2.014 5 0.183 64.6 0.657 0.194 56.0 2.400 0.186 60.2 2.729 0.172 53.2 2.772 0.175 60.2 3.372

6 0.173 51.8 0.589 0.188 54.6 2.272 0.183 68.6 2.343 0.168 56.2 2.657 0.170 61.6 2.143

7 0.171 47.6 0.500 0.186 47.6 2.029 0.180 51.8 2.086 0.161 37.8 2.514 0.157 44.8 2.129 15 0.160 35.0 0.429 0.177 44.8 2.014 0.150 40.6 1.815 0.153 36.4 2.386 0.152 33.6 1.757

21 0.109 26.6 0.372 0.110 42.0 1.858 0.120 29.4 1.472 0.104 30.1 2.086 0.100 25.2 1.614

219 Results and Discussion

Figure (97): Growth of E. cloaceae MAM4 on different concentrations of 1,2,4trichlorobenzene (1,2,4TCB).

Figure (98): Concentration of extracellular protein of E. cloaceae MAM 4 on different concentrations of 1,2,4trichlorobenzene (1,2,4TCB).

220 Results and Discussion

Figure (99): Concentration of Cl – of E. cloaceae MAM4 on different concentrations of 1,2,4trichlorobenzene (1,2,4TCB).

221 Results and Discussion

Count of different bacterial isolates on different concentrations of 1,2,4TCB had been shown in Table (39). The initial count was ranging from 3.9×10 5 to 9.3×10 7 CFU/ml. Isolate MAM24 showed good growth on all the five concentrations of 1,2,4TCB after 7 days and 28 days incubation. Its initial count was 7×10 6 CFU/ml. However, the range of growth was 8.0×10 6 to 2.1 ×10 8. This means an increase in count ranging from 0.1 to 1.5 log cycles.

Isolate MAM27 its initial count was 3.9 ×10 5 CFU/ml and showed an increase in count ranging from 2×10 7 to 1.8×10 8 CFU/ml. This increase in count was ranging from 1.7 to 2.7 log cycles. Isolate MAM29, its initial count was 9.3×10 7 but their growth was lower or equal that of the initial count in all the five concentrations after 7 and 28 days incubation as shown in Table (39).

Isolate MAM33 showed good growth on different concentrations of 1,2,4TCB after 7 days incubation. Its initial count was 3.7×10 7 CFU/ml. Increasing in count after 7 days was ranging from 1.2×10 8 to 8.4×10 8 CFU/ml (i.e. 0.5 to 1.3 log cycles). However, after 28 days incubation at the lower concentration (5M), there was an increasing in count, but at higher concentration the count was equal or lower than the initial. The Gram negative bacteria isolate MAM3 and E. cloaceae MAM4 showed no increasing or lowering in count compared with their initial count after 7 and 28 days.

The ability of different isolates to degrade 1,2,4TCB had been indicated in Table (40) and Fig. (100). The results showed that isolate MAM 24 was the best 1,2,4TCB degrader. MAM24 could degrade 99.3%, 98.0%, 98.6%, 99.3% and 14.4% of 5,10,15,25 and 50M 1,2,4TCB respectively. The other isolates couls degrade between 1.3% to 28.4% of 1,2,4TCB along the five different concentration.

222 Results and Discussion

Degradation percent of 1,4DCB, 1,2,3TCB and 1,3,5TCB was 80%, 84% and 88% by strain SA2 while it was 89%, 91% and 91% by strain SA6 (Adebusoye et al., 2007).

The isolated strains E3 and F2 of Bordetella showed nearly as high mineralization capacities as the enriched mixed culture with 58% and 46% mineralization of 1,2,4TCB respectively within 30 days incubation. Highest mineralization rate were observed 6 days after incubation (Wang et al., 2007).

223 Results and Discussion

Table (39): Count of different indigenous isolates on different concentrations of 1,2,4trichlorobenzene (1,2,4TCB).

Initial After 7 Days After 21 Days

Isolate 5 M 5 M 10 M 15 M 25 M 50 M 5 M 10 M 15 M 25 M 50 M code Count Count Count Count Count Count Count Count Count Count Count Log.N Log.N Log.N Log.N Log.N Log.N Log.N Log.N Log.N Log.N Log.N (CFU/ml) (CFU/ml) (CFU/ml) (CFU/ml) (CFU/ml) (CFU/ml) (CFU/ml) (CFU/ml) (CFU/ml) (CFU/ml) (CFU/ml)

MAM24 7× 10 6 6.8 26×10 6 7.4 12× 10 7 8.0 21× 10 7 8.3 12× 10 7 8.0 46× 10 6 7.7 77× 10 6 7.9 57× 10 6 7.8 57× 10 6 7.8 55× 10 6 7.7 8× 10 6 6.9

MAM27 39×10 4 5.6 13× 10 7 8.1 18× 10 7 8.3 14× 10 7 8.1 13× 10 7 8.1 9× 10 7 8.0 13× 10 7 8.1 12× 10 7 8.1 2× 10 7 7.3 5× 10 7 7.7 3× 10 7 7.5

MAM33 37×10 6 7.6 53×10 7 8.7 84× 10 7 8.9 29× 10 7 8.5 14× 10 7 8.1 12× 10 7 8.1 13× 10 7 8.1 7× 10 7 7.8 5× 10 7 7.7 9× 10 6 7.0 10× 10 6 7.0

MAM3 21×10 6 7.3 12× 10 7 8.1 60× 10 6 7.8 4× 10 7 7.6 96× 10 6 8.0 68× 10 6 7.8 7× 10 7 7.8 6× 10 7 7.8 5× 10 7 7.7 4× 10 7 7.6 2× 10 6 7.3

MAM29 93×10 6 8.0 6× 10 7 7.8 11× 10 7 8.0 10× 10 6 7.0 2× 10 6 6.3 72× 10 6 7.9 4× 10 7 7.6 8× 10 7 7.9 13× 10 6 7.1 6× 10 6 6.8 28× 10 6 7.4

E. cloaceae 83×10 6 8.0 96× 10 6 8.0 12× 10 7 8.1 91× 10 7 8.0 74× 10 6 7.9 69× 10 7 8.8 2× 10 7 7.3 3× 10 7 7.5 3× 10 7 7.5 7× 10 7 7.8 2× 10 7 7.3 MAM4

224 Results and Discussion

Table (40): Degradation percentage of 1,2,4 trichlorobenzene (1,2,4TCB) after 21 days by HPLC.

% Degradation of 1,2,4TCB Isolate code 5 M 10 M 15 M 25 M 50 M

MAM24 99.3 98.0 98.6 99.3 14.4

MAM27 12.5 28.4 7.3 14.1 16.6

MAM29 27.7 13.8 16.7 17.9 5.2

MAM33 17.1 10.9 6.9 4.5 1.3

MAM3 5.9 23.7 5.8 4.7 2.9

E. cloaceae MAM4 18.9 40.4 45.5 20.1 14.6

225 Results and Discussion

MAM24 MAM27 MAM29 MAM33 MAM3 E. cloaceae MAM-4

110

100

40 % Degradation %

0 5 M 10 M 15 M 25 M 50 M Concentration

Figure (100): Degradation percentage of 1,2,4 trichlorobenzene (1,2,4TCB) after 21 days by HPLC.

226 Results and Discussion

From all the previous results, we select isolate MAM24 as a representative for chloroaromatic degrading bacteria (CDB). This isolate was characterized as Gram positive sporeforming Bacillus , creamy, large, irregular margin, flat, rough when grown on L.B agar plates. The isolate MAM24 was identified by the molecular techniques.

DNA extracted from isolate MAM24 was amplified by PCR. The product of PCR was electrophoresed by agarose gel electrophoresis shown in Fig. (101) DNA was 1500 kbp. The nucleotide sequences of the 16S rRNA from the isolated strain MAM24 was determined comprising 841 nucleotides and deposited in the NCBI Gene Bankit sequence databases under accession number (HQ013329) as shown in Fig. (102).

A phylogenetic tree constructed on the obtained 16SrDNA coding gene sequences of the isolate MAM24 and the nearest relatives was shown in Fig. (103). The 16SrRNA of isolate MAM24 showed a similarity of 100% to Bacillus mucilaginosus (GQ866855) and had a close match to the described species, Bacillus sp. (FJ607057) with homology of 84%. So, the isolate MAM24 was identified as Bacillus mucilaginosus HQ013329.

Wang et al., (2007) isolated two strains and identified them by comparative sequence analysis of their 16SrRNA coding genes as members of the genus Bordetella with Bordetella sp. QJ25 as the highest homological strain and with Bordetella petrii as the closest related described species. The 16SrDNA of the two isolated strains showed a similarity of 100%.

227 Results and Discussion

The isolates R2, D31, D32 and D14 revealed the highest sequence similarity (99%) to Rhodococcus erythropolis DCL14 isolated from freshwater sediment, to Rhodococcus erythropolis OUCZ211 isolated from a PCB contaminated soil and to Rhodococcus sp. X309 isolated from marine sediment. On the other hand, the isolates Z56 and Z57 showed highest sequence similarity (99% and 98% respectively) to R. ruber M2 isolated from an industrial waste water (Kolar et al., 2007).

Figure (101): Agarose gel of DNA of isolated strain MAM24 chloroaromatic degrading bacteria.

228 Results and Discussion

1 gagatgcgcg aaccgggtat gtgtgg tatgaagg cctatggatc acctacag 61 ccgaaagg agcgctaata ccgcatacgt cctacgggag aaagcagggg accttcgggc 121 cgcgctaa tagatgagcc taagtcggat tagctagg gtagggtaaa ggcctaccaa 181 ggcgacgatc tgtagcgggt ctgagaggat gatccgccac actgggactg agacacggcc 241 cagactccta cgggaggcag cagtggggaa taggacaa tggggggaac cctgatccag 301 ccatgccgcg tgtgtgaaga aggccttttg gttgtaaagc actttaagcg aggaggaggc 361 tacctaga aatactag gatagtggac gactcgca gaataagcac cggctaactc 421 tgtgccagca gccgcggtaa tacagagggt gcgagcga atcggata ctgggcgtaa 481 agcgtgcgta ggcggccaat taagtcaaat gtgaaatccc cgagcaac ttgggaattg 541 cacgatac tggggcta gagtatggga gaggatggta gaaccagg tgtagcggtg 601 aaatgcgtag agatctggag gaataccgat ggcgaaggca gccatctggg cctaatactg 661 acgctgaggt acgaaagcat ggggagcaaa caggaaga tacctggtag tccatgccgt 721 aaacgatgtc tactagccgt tggggccctt gaggctttag tggcncagct ncgcgataag 781 tagaccgcct gggagtacgn ngcagactac aactcaatga gacggggc ccgcacagcg 841 gtgagcatgt gtat

Figure (102): DNA sequencing of isolate MAM24

AM183958 Bacillus pumilus HM134865 Bacillus cereus AB331454 Uncultured Bacillus sp. 96 AF039408 Bacillus tipchiralis

100 FJ174633 Bacillus megaterium 0 76 Y13061 B.circulans

86 EU073968 Brevibacterium frigoritolerans AM110924 Bacillus subtilis 83 EF445107 Uncultured Bacillus sp. 0 100 HM032876 Bacillus thuringiensis

66 FJ607057 Bacillus sp. 100 84 GQ866855 Bacillus mucilaginosus 100 MAM24 FJ937888 Bacillus cereus 100 93 EU256396 Bacillus megaterium EU365680 Bacillus cereus

Figure (103): Phylogenetic tree representing the relationships of 16SrRNA gene sequence analysis of isolated MAM24 chloroaromatic degrading bacteria and Bacillus sequences from GenBank (NCBI). The tree was constructed using molecular evolutionary genetic analysis MEGA 5 program based on the examination of 841 16S rRNA gene nucleotide positions.

229 Results and Discussion

The CDB, Bacillus mucilaginosus (HQ013329) was exposed to different doses of γirradiation to determine the dose response curve of this newly isolated strain of Bacillus mucilaginosus that having the ability to degrade different chloroaromatic compounds at different concentrations and select a mutant having the ability to degrade chloroaromatic compounds more than the parent strain B. mucilaginosus .

The dose response curve of B. mucilaginosus indicated that as the dose of γradiation increased the viable count decreased exponentially as indicated in Table (41) and Fig. (104). Dose of 10 KGy (1.0 Mega) reduced the viable count by 3.5 log cycles; However, dose 15 KGy (1.5 Mega) reduced the viability by 4.8 log cycles. This means that B. mucilaginosus like other strains of Bacilli was highly resistant to gamma radiation. These results were in a good agreement with that of AboState (1991, 1996, and 2004), AboState and Khalil (2001) and AboState et al., (2005).

AboState et al., (2005) found that 10 KGy reduced the viability of the isolated Bacillus MAM96 by 2.5 log cycles. AboState (1991) found that 10 KGy reduced the viable count of B. cereus by 5.8 log cycles. And Abo State (1996) indicated that Bacillus cereus NRRL569 when exposed to 10 KGy the viability was reduced by 1.97 log cycles and 15 KGy reduced the viability by 3.77 log cycles.

Meanwhile, AboState and Khalil (2001) indicated that the count of B. cereus strains NRRL569 and ATCC11778 were reduced by 5.5 and 2.7 log cycles after exposure to 10 KGy respectively. This means that B. cereus ATCC11778 is more resistant than B. cereus NRRL569.

This high resistance of Bacillus strains to gamma radiation may be attributed to increased sulphur content and efficient repair mechanisms. Also, it may be attributed to presence of spores, which highly resistant to unfavorable conditions (AboState, 1996).

230 Results and Discussion

Table (41): Effect of gamma irradiation on the viability of isolated strain MAM24.

Dose (KGy) Count (CFU/ml) Log.N.

Control 1.28×10 9 9.1 1.0 4.7×10 8 8.6 2.0 3.4×10 8 8.0 4.0 7.0×10 7 7.8 6.0 1.7×10 7 7.2 8.0 3.5×10 6 6.5 10.0 3.0×10 5 5.6 15.0 1.7×10 4 4.2

Figure (104): Effect of gammaradiation doses on the viable count of isolated strain MAM24.

231 Results and Discussion

The lethal effect of gamma radiation may be explained on the basis that γradiation induces DNA damage, single or double strain breaks and disrupter of proteinDNA complex, so affecting gene expression (Trumbore et al., 2001 and Eon et al., 2001).

Colonies resulted from exposure of the parent strain B. mucilaginosus to different doses of gamma irradiation, that having morphological changes on L.B agar medium were picked up as separated single colonies. Twenty five colonies were grown on BSM supplemented with chloroaromatic compounds (3CBA, 2,4DCP, 2,6DCPP and 1,2,4TCB) for 7 days. The best mutant (colonies) grown on the different chloroaromatic compound was mutant no. "9" as indicated from Table (42).

Mutant "9" which resulted from B. mucilaginosus showed superior growth on 2,4DCP and 1,2,4TCB than the parent strain (control) and equal growth with control on 2,6DCPP, but the control was growing more on 3

CBA. The ratio of I/I 0 for control and mutant "9" was 1.78 and 2.03 for 2,4 DCP, 0.872 and 1.5 for 1,2,4TCB, 0.755 and 0.740 for 2,6DCPP and 2.22 and 1.72 for 3CBA respectively.

Radiation reduced the viable count of bacteria and fungi. As the dose increased the viable count decreased gradually (AboState, 1991, 1996, 2003 and 2004).

Aziz and Mahrous (2004) recorded that the dose required for complete inhibition of fungi ranged from 4.0 to 6.0 KGy.

ElBatal and AboState (2006) found enhanced productivity in CMCase, FPase, Avicelase, xylanase, pectinase, αamylase and protease by gammairadiation at dose 1.0 KGy with percent increase 8%, 20%, 10%, 4%, 31%, 22% and 34% respectively as compared with unirradiated control.

Also, the highest CMCase activity was recorded for Fusarium neoceras mutant No. "1" and No. "6" which exposed to 1 min UVradiation. 232 Results and Discussion

While, the highest CMCase of F. oxysporum was mutant No. "4" which exposed to 4 min. UVradation (AboState, 2003). Mutant No. "36" which exposed to 10 KGy produced the highest extracellular protein and xylanase activity (700 g/ml and 9993 U/g).

This hyper producer mutant which exposed to 4 min. UVirradiation produced 10.350 U/g xylanase compared with the parent strain which produced 9.651 U/g (AboState, 2004).

Rajoka (2005) reported 1.6 fold enhanced productivity of extracellualr endoglucanase over the mutant parent. After the optimization, the FPase in Trichoderma reesei MCG77 mutant was increased by 2.5 fold compared to that of Trichoderma reesei QM9414 mutant (Latifian et al., 2007).

Also, AboState et al., (2010) found that the most potent strain Aspergillus terreus MAMF23 and Aspergillus flavus of cellulases production were exposed to increasing doses of gamma radiation to determine their dose response curve. Gamma radiation reduced, the viable count of Aspergillus MAMF23 and MAMF35 gradually decreased as the dose incraeed. Doses 5.0 and 4.0 KGy reduced the viable count of Aspergillus MAMF23 and MAMF35 completely. Mutant No. "4" of Aspergillus MAMF23 which exposed to 0.5 KGy produced higher cellulases (CMCase 372 U/ml, FPase 64 U/ml and Avicellase 39 U/ml) than the parent strain (CMCase 305 U/ml, FPase 48 U/ml and Avicellase 29 U/ml).

This mutant "9" was grown in a large quantity on different chloroaromatic compounds and its parent strain (as control) for GCMS analysis after 24 and 48 hours incubation. This incubation period had been selected to determine the different metabolites formed in degradation of chloroaromatic compounds.

233 Results and Discussion

Table (42): Growth of the parent strain (B. mucilaginosus MAM24 ) and its mutants exposed to different doses of gamma radiation on different chloroaromatic compounds.

2,6 3Chlorobenzoic 2,4 1,2,4 Dichlorophenol Mutant Dose acid Dichlorophenol Trichlorobenzene No. (KGy) indol phenol After 7 After 7 After 7 After 7 Initial Initial Initial Initial DAYS DAYS DAYS DAYS Parent 0 0.125 0.278 0.150 0.268 0.157 0.137 1.698 1.282 strain 1 1 0.182 0.304 0.208 0.273 0.148 0.149 1.741 1.267 2 1 0.191 0.271 0.183 0.287 0.170 0.211 1.710 1.274 3 1 0.206 0.300 0.187 0.284 0.229 0.193 1.801 1.302 4 1 0.171 0.311 0.185 0.322 0.157 0.150 1.742 1.316 5 2 0.171 0.326 0.206 0.332 0.222 0.255 1.781 1.300 6 2 0.178 0.264 0.149 0.254 0.144 0.118 1.745 1.297 7 2 0.107 0.262 0.074 0.274 0.118 0.108 1.683 1.232 8 2 0.105 0.216 0.170 0.204 0.112 0.071 1.777 1.275 9 4 0.175 0.302 0.144 0.293 0.174 0.264 1.751 1.297 10 4 0.114 0.237 0.117 0.255 0.152 0.093 1.722 1.304 11 4 0.170 0.276 0.191 0.303 0.167 0.162 1.638 1.234 12 6 0.162 0.294 0.169 0.293 0.172 0.143 1.751 1.243 13 6 0.182 0.255 0.172 0.273 0.138 0.123 1.939 1.270 14 6 0.136 0.269 0.154 0.260 0.131 0.100 1.836 1.291 15 6 0.147 0.280 0.136 0.259 0.150 0.130 1.684 1.209 16 8 0.166 0.269 0.151 0.268 0.212 0.141 1.681 1.280 17 8 0.233 0.292 0.237 0.319 0.192 0.165 1.562 1.183 18 8 0.223 0.370 0.223 0.353 0.247 0.255 1.967 1.223 19 10 0.145 0.294 0.172 0.284 0.172 0.218 1.561 1.152 20 10 0.130 0.277 0.107 0.234 0.130 0.102 1.752 1.243 21 10 0.131 0.231 0.129 0.263 0.166 0.127 1.956 1.317 22 10 0.239 0.321 0.221 0.289 0.186 0.167 1.987 1.308 23 15 0.183 0.262 0.182 0.249 0.129 0.112 1.775 1.288 24 15 0.162 0.307 0.166 0.304 0.202 0.185 1.635 1.301 25 15 0.192 0.291 0.203 0.278 0.167 0.142 1.558 1.234

234 Results and Discussion

Large number of studies investigated the pathway of the Gram negative bacteria especially Pseudomonas spp . Also, investigated the pathway of the Grampositive bacteria, Rhodococcus , but a little or nearly non of the studies investigated the pathway of Bacillus spp. to degrade chloroaromatic compounds. So this study may be the first study to investigate the pathways of Bacillus sp. ( Bacillus mucilaginosus ) to degrade three of the chloroaromatic compounds (3CBA, 2,4DCP and 1,2,4TCB). The results of GCMS analysis as indicated in Table (43) and Fig. (105) revealed that Bacillus mucilaginosus MAM24 dechlorinated the chloroaromatic compound (3chlorobenzoic acid) firstly to give benzoic acid. Benzoic acid may be reduced to give four intermediates (acetophenone, phenol, benzomethanol and/or benzeneethanol). The intermediates, phenol and benzomethanol were found after 24 and 48 hours in case of B. mucilaginosus MAM24 and 24 hours only in case of mutant MAM24(9). The above result had been confirmed by similar results of other investigators. Arthrobacter globiformis (Zaitsev and Karasevich, 1981 a, b), Arthrobacter sp. strain TM1 (Marks et al., 1984), Pseudmonas sp. strain CBS3 (Müller et al., 1984, 1988), Alcaligenes denitrificans NTB1 (van den Tweel et al., 1986), Arthrobacter sp. strain SB8 (Shimao et al., 1989) and Pseudomonas sp. strain DJ12 (Chae and Kim, 1997 and Chae et al., 1999). In this route, dechlorination of 4CB constitutes the initial reaction sequence (Zhou et al., 2004). The corner stone was the intermediates, acetophenone and αbisabolol which had been recorded after 24 and 48 hours for both of MAM24 and its mutant MAM24 (9). These intermediates with further oxidation converted to carvone. Carvone intermediate suffered cleavage to give octanoic acid. Octanoic acid may inter the tricarboxylic acid cycle (TCC) or with reduction followed by polymerization converted to nanadecane or heneicosane. These aliphatic intermediates degraded to CO 2 and H 2O, or may serve in the formation of the cell wall of the Gram+ve microorganisms as Bacillus and Rhodococcus sp. (Fritsche and Hofrichter, 2008). 235 Results and Discussion

The intermediate, 3,5,5trimethyl hexonic acid had been recorded in the case of both mutant and parent strain (MAM24) after 24 hours only and then disappeared. Carvone and octanoic acid intermediates were closely related to each other; they produced early (24 hours) in case of the parent strain MAM24 and suffered delay (48 hours) in the case of mutant MAM 24(9). The intermediates heneicosane and nanadecane had been recorded in both of parent and mutant strains after 24 and 48 hours. The intermediates, nananol, benzeneethanol, dimethyl phathalate, benzoic acid, 2aminomethyl ester and benzoic acid,3chloromethyl ester were found only in case of parent strain MAM24 and disappeared completely in case of mutant MAM24(9). The intermediate benzaldehyde had been recorded after 48 hours in both the parent strain and its mutant. This intermediate could not be found in the early stages. GCMS analysis provided the evidence that mutant MAM 24 (9) differed from the parent strains. Many of the intermediates had been disappeared in case of mutant MAM24 in spite of their occurrence in the parent strain especially in the early stage (24 hours). 4CB degradation can occur aerobically in two ways; one proceeding via 4chlorocatechol with the elimination of the chlorine atom after ortho cleavage. The second route is followed in several microorganisms such as Nocardia and Pseudomonas (Klages and Lingens, 1979 and 1980). During the early growth phase (early log phase), there is a shift in adsorption from 248nm peak of 3CBA to 275nm peak of 3chlorocatecol (Chatterjee et al., 1981). Cell extract of P. aeruginosa 142 which was previously isolated from a polychlorinated biphenyldegrading consortium were shown to degrade 2,4 dichlorobenzoic acid (2,4DCBA) and 2chlorobenzoic acid (2CBA) and other halobenzoates via orthocleavage. The products of degradation were identified as 4chlorocatecol and catecol (Romanov and Hausinger, 1994).

236 Results and Discussion

Catechol 1,2 dioxygenase activity was detected in all bacterial strain investigated. Pure soil cultures could not utilize other than orthochlorinated benzoates which support the hypothesis that, in that particular microbial community, a specialized orthochlorobenzoate1,2dioxygenase (OCBD) which cannot attack meta and parachlorinated benzoates (Pavlů et al., 1999). In addition to the orthodehalogenation ( ohb 142 ) genes encoding the α and β subunits of the oxygenase component of 2halobenzoate dioxygenase, strain 142 harbours a closely related ohb ABCDFG gene cluster previously identified in P. aeruginosa JB42 ( ohb JB42 ) (Corbella et al., 2001 and Corbella and Puyet, 2003). The first step in the orthodehalogenation pathway is dihydroxylation mediated by orthoCBA 1,2dioxygenase followed by dehalogenation (UrgunDemirtas et al., 2003). Arthrobacter sp. strain TM1 degrade 4chlorobenzoate (4CB) via the ortho ring fission pathway to give protocatechuate (Zhou et al., 2004). Achromobacter xylosoxidans strain A8 is able to use 2CB and 2,5 DCB as sole source of carbon and energy. It could degrade 2CB and 2,5 DCB via modified orthocleavage and accumulate chlorocatechol as metabolite (Jencova et al., 2004). Two ringhydroxylating Ben A gene sequences of the upper "modified ortho pathway" were present in 2chlorobenzoatedegrading mixed culture (2MC) (Baggi et al., 2008). Chlorocatechols resulting from the degradation of various chlorinated aromatics like chlorobenzenes and chlorobenzoates are mainly catabolized by a modified orthocleavage pathway (Martinková et al ., 2009).

237 Results and Discussion

Table (43): Intermediates determined by GCMS analysis of 3 chlorobenzoic acid (3CBA) by Bacillus mucilaginosus MAM24 and its mutant MAM24 (9).

R.T MAM24 MAM24 MAM24 (9) MAM24 (9) after 24 hours after 48 hours after 24 hours after 48 hours 11.484 Benzaldehyde Benzaldehyde 12.083 Phenol Phenol Phenol 13.577 Nananol Nananol 13.848 Benzomethanol Benzomethanol Benzomethanol 14.828 Acetophenone Acetophenone Acetophenone Acetophenone 16.112 Benzaldehyde, dimethyl acetal 16.297 Benzene ethanol Benzene ethanol 17.039 3,5,5trimethyl hexonic 3,5,5tri methyl acid hexonic acid 17.984 2,4 Dichlorophenol 18.061 Octanic acid Octanoic acid 18.535 Propionic acid, 2chloro isopropyl ester 19.163 Piperidinone 20.587 Carvone Carvone 20.553 Benzoic acid, 3 Benzoic acid, 3chloro, methyl chloromethyl ester ester 22.918 Benzoic acid, 2, amino Benzoic acid, 2amino, methyl methyl ester ester 23.182 3chlorobenzoic 3chlorobenzoic 3chlorobenzoic acid 3chlorobenzoic acid acid acid 25.658 Dimethyl phthalate Dimethyl phthalate 26.665 ptertbutyl ptertbutyl ptertbutyl benzoic acid ptertbutyl benzoic acid benzoic acid benzoic acid 26.938 Butylated hydroxy Butylated Hydroxy toluene toluene 28.324 Dodecanoic acid Dodecanoic acid Dodecanoic acid 31.244 αBisabolol αBisabolol αBisabolol αBisabolol 32.756 Tetradecanoic acid 33.544 Heneicosane Heneicosane Heneicosane Heneicosane 35.587 Nanadecane Nanadecane Nanadecane Nanadecane

238 Results and Discussion

Figure (105): Proposed pathway of 3chlorobenzoic acid (3CBA) degradation by Bacillus mucilaginosus MAM24 after 24 hours

239 Results and Discussion

Biodegradation of 2,4dichlorophenol (2,4DCP) as determined by GCMS analysis was indicated in Table (44) and Fig. (106 a,b) revealed that the corner stone of the intermediates resulted after 24 and 48 hours for the parent strain Bacillus mucilaginosus MAM24 and its mutant MAM 24 (9) was acetophenone. This intermediate had been recorded for the parent strain after 24 hours and 48 hours also. This intermediate had been recorded after 24 hours in case of mutant, although the majority of the mutant intermediates had not been recorded by the parent strain in both the early stage (24 hours) and later stage (48 hours). Similar results which dechlorination was done firstly had been recorded.

Biodegradation of PCP indicated an intermediates, tetrachlorop hydroxyquinon, and chlorohydroxyphenol (Shah and Thakur, 2002).

Results showed that PCP was rapidly dechlorinated after 46 days lag period. Approximately 99% of the PCP was removed within 10 days (Kao et al., 2004).

These results provided evidence that mutant strain (MAM24 (9)), had special pathway that differed from that of the parent strain. Parent strain dechlorined 2,4DCP to give phenol firstly. Phenol undergoes oxidation to give acetophenone which represent the corner stone. Acetophenone undergo esterfication to give benzoic acid methyl ester. This intermediate represents another corner stone in the pathway of the parent strain. Benzoic acid, methyl ester may be undergoing firstly oxidation followed by cleavage to give propyl methacrylate (ortho cleavage).

240 Results and Discussion

This intermediate could also undergo firstly cleavage followed by cycloisomerization to give ethyl cyclopropane carboxlate. Benzoic acid, methyl ester may also undergo firstly cleavage followed by polymerization to give tridecanoic acid, pentadecanoic acid and/or hepta decanoic acid methyl ester. Another intermediate, benzyl alcohol may undergo firstly cleavage followed by polymerization to give 2(2 ethoxyethoxy) ethanol.

All the aliphatic organic acids or alcohol undergo further degradation to give CO 2 and H 2O i.e. complete mineralization. However, the mutant strain MAM24 (9) had a special pathway. This mutant disrupted the chlorinated ion of the para position to give 2chlorophenol. The intermediate 2chlorophenol may be undergo further dechlorination and methylation to give 4methyl phenol or hydroxylation to give 2 chloro1,4benzodiol may be undergo (meta) cleavage to give aliphatic intermediates which mineralized to CO 2 and H 2O.

Also, the intermediate 2chlorophenol may be undergo dechlorination followed by oxidation to give acetophenone, which undergo further degradation as previously mentioned to give complete mineralization.

2,4dichlorophenol (2,4DCP) was anaerobically degraded in fresh water lack sediment. From observed intermediates in incubated sediment samples and from enrichment cultures, the following sequence of transformation was postulated. 2,4DCP is dechlorinated to 4chlorophenol (4CP), 4CP is dechlorinated phenol, phenol is carboxylated to benzoate, and benzoate is degraded via acetate to methane and CO 2 (Zhang and Wiegel, 1990).

241 Results and Discussion

Dehalogenation activity in enrichments from four of the primary microcosms showed at least five different dechlorination reactions, each mediated by different microbial communities. Three of these are distinct orthodechlorinating paths, two metadechlorinating and one is the para dechlroination of 3,4DCP (Sanford and Tiedje, 1997).

The chlorocatechol 1,2dioxygenase and the chloromuconate cycloisomerases of Gramnegative bacteria appear to be more closely related to the catechol 1,2dioxygenases and cycloisomerases of Grampositive Rhodococcus erythropolis 1CP than to the corresponding enzymes of Gram negative bacteria (Eulberg et al., 1997).

All strains showed orthoring cleavage (Shah and Thakur, 2002).

Pseudomonas putida F6 transformed 4substituted halophenols. Biotransformation resulted in greater than 95% utilization of halogenated substrate. Product accumulation was identified as the corresponding 4 substituted catechols (Brooks et al., 2004).

242 Results and Discussion

Table (44): Intermediates determined by GCMS analysis resulted from biodegradation of 2,4dichlorophenol (2,4DCP) by Bacillus mucilaginosus MAM24 and its mutant MAM24 (9). MAM24 MAM24 MAM24 (9) MAM24 (9) R.T after 24 hours after 48 hours after 24 hours after 48 hours 10.369 Pyridine 10.582 Butanoic acid 3 hydroxy methyl ester 12.322 2chlorophenol 15.227 4methyl phenol 15.403 Benzyl alcohol 15.718 2(2ethoxy ethoxy ethanol) 16.255 2(2ethoxy methoxy ethanol) 15.352 16.352 Acetophenone 16.735 Acetophenone Acetophenone 17.243 Benzoic acid Benenethanol methyl ester 18.006 2,4 Dichlorophenol 22.590 Ethyl cyclo Ethyl cyclo propane propane carboxylate carboxylate 22.899 2chloro1,4 benzenediol 24.724 5nanol 25.479 2nitro, 4,6 dichlorophenol 26.946 2,6Bisc (1,14 methyl phenol) 28.914 Tridecanoic acid, methyl ester 29.919 Tridecanoic acid Tridecanoic acid 33.206 Propylmethacrylate 33.353 Hepta decanoic acid, methyl ester 34.342 Penta decanoic Penta decanoic acid acid 42.721 Tetrasul 46.768 Diisooctyl phathalate

243 Results and Discussion

Figure (106a): Proposed pathway of degradation of 2,4dichlorophenol (2,4DCP) by Bacillus mucilageinosus MAM24 .

244 Results and Discussion

Figure (106b): Proposed pathway of degradation of 2,4dichlorophenol (2,4DCP) by mutant MAM24 (9).

245 Results and Discussion

Biodegradation of 1,2,4trichlorobenzene (1,2,4TCB) by Bacillus mucilaginosus MAM24 and its mutant MAM24 (9) as shown in Table (45) and Fig. (107) revealed that, both the parent strain MAM24 or the mutant MAM24 (9) dechlorinated the aromatic compound as a first step and the resulted intermediates undergo either direct cleavage to the benzene ring or oxidation to give acetophenone and the intermediate acetophenone undergo cleavage of the ring to give aliphatics, followed by polymerization process to give a mixture of intermediates with variable polymer length of aliphatic chains.

Several investigators have proposed that bacterial PCBs degradation is initiated by attack of dioxygenase at carbon positions 2,3 (or 5,6). Available evidence suggests that a necessary requirement is the availability of 2,3 (or 5,6) site free of chlorines (Ahmed and Focht, 1973; Furukawa et al., 1979; Yagi and Suda, 1980 and Bedard et al., 1986).

High chlorinated benzene can only be degraded by preliminary reductive dechlorination (Beurskens et al., 1993; Ramanand et al., 1993; Nowak et al., 1996; Prytula and Pavlostathis, 1996; Chang et al., 1998; Yuan et al., 1999; Pavlostathis and Prytula, 2000; Wu et al., 2002 and Schroll et al., 2004).

Repeated subculturing maintaining high dechlorination of 1,2,3 and 1,2,4TCB supplied in the medium. This indicated that reductive dechlorination of TCB was the primary conservating process (Adrian et al., 2000).

Cl released with hexachlorobenzene as electron acceptor; with pentachlorobenzene, the growth yield was 2.9 g/mol Cl . Hexachlorobenzene was reductively dechlorinated to pentachlorobenzene, which was converted to a mixture of 1,2,3,5 and 1,2,4,5tetrachlorobenzene. Formation of tetrachlorobenzene was not detected. The final end products of dechlorination of hexachloro and pentchlorobenzene were 1,3,5trichlorobenzene, 1,3 and 1,4 dichlorobenzene. As reported previous, Dehalococcoides sp. strain CBDB1 converted 1,2,3,5tetrachlorobenzene exclusively to 1,3,5trichlorobenzene and 1,2,4,5trichlorobenzene exlcuisvely to 1,2,4 trichlorobenzene. The organism

246 Results and Discussion therefore catalyzes two different pathways to dechlorinate highly chlorinated benzenes. In the route leading to 1,3,5trichlorobenzene, only double flanked chlorine substituents were removed, while in the route leading to 1,3, 1,4 dichlorobenzene via 1,2,4trichlorobenzene single flanked chlorine substituents were also removed (Jayachandran et al., 2003).

These intermediates were pentadecane, pentadecanoic acid, tritetracontane, hentriacontane, pentacosane, docosane and dicyclohexyl phathalate. These intermediates could be undergoing further degradation to CO 2 and H 2O to give complete mineralization. A little difference had been recorded between the parent strain and its mutant.

P. putida GJ31 has a meta cleavage enzyme which is resistant to inactivation by the acylchloride providing this strain with the exptional ability to degrade both toluene and chlorobenzene via meta cleavage pathway (Mars et al., 1997).

Previouslydescribed bacteria which can use chlorobenzenes as their sole carbon and energy degrade CB2 via the modified orthocleavage pathway, and it is generally accepted that the metacleavage pathway is not suitable for the degradation of haloaromatics (Mars et al., 1997 and Adebusoye et al., 2007).

Mutant MAM24 (9) showed 2ethyl hexanol and acetophenone intermediates which had not been recorded in case of parent strain. Also, the parent strain showed two intermediates after 48 hours which had not found in the early stage (24 hours). These intermediates were hexadecane and tetracontane.

In any way, additional work will be necessary to clear degradation pathway of the present isolate.

247 Results and Discussion

Table (45): Intermediates determined by GCMS analysis resulted from biodegradation of 1,2,4trichlorobenzene (1,2,4TCB) by Bacillus mucilaginosus MAM24 and its mutant MAM24 (9).

MAM24 MAM24 MAM24 (9) R.T after 24 hours after 48 hours after 24 hours 12.107 Phenol 15.126 4methyl phenol 18.29 1,2,4Trichlorobenzene 1,2,4Trichlorobenzene 1,2,4Trichlorobenzene 25.824 2,6Di(tbutyl) 4hydroxy4 methyl2,5cyclohexadiene1one 26.951 2,4Bis(1,1 dimethyl ethyl 2,6Bis(1,1dimethyl ethyl) phenol) 4methyl phenol 29.158 Nonadecane 31.418 Eicosane 32.778 Octadecanoic acid 33.548 Pentadecane Penta decane 34.825 Pentadecanoic acid Pentadecanoic acid 35.658 Tritetracontane Tritetracontane 36.793 Dibutylphathalate Dibutyl phathalate Dibutyl phathalate 37.531 Henicosane Heneicosane Heneicosane 39.384 Octacosane Octacosane Octacosane 41.161 Triacontane Triacontane Triacontane 42.866 Hentriacontane Hentriacontane Hentriacontane 43.757 Benzylbutylphathalate 44.501 Pentacosane Pentacosane Pentacosane 48.115 Docosane Docosane Docosane 46.524 Dicyclohexyl phathalate Dicyclohexyl phthalate 46.772 Di (2ethyl hexyl) phathalate Di (2ethyl hexyl) phathalate Di (2ethyl hexyl) phathalate 48.015 Hexadecane 50.383 Tetratetracontane

248 Results and Discussion

Figure (107): Proposed pathway of 1,2,4trichlorobenzene (1,2,4TCB) degradation by Bacillus mucilaginosus MAM24 .

249 Summary

SUMMARY

he eight soil and sludge samples collected from Cairo Oil Refining T Company and agriculture soils near this company used to isolate their microbial communities.

The ability of these microbial communities to grow and degrade the chosen chloroaromatic compounds (3chlorobenzoic acid, 2,4 dichlorophenol, 2,6dichlorophenol indol phenol, 1,2,4trichlorobenzene) was determined.

Bacterial community (1) was the best community in the growth on different chloroaromatic compounds used in the study and it secretes the highest extracellular protein till the end of incubation period.

Also, bacterial communities (2, 3) were the best for expressing protein even after 28 days incubation.

The count of indigenous bacterial communities (7, 8) recorded the highest count on the four chloroaromatic compounds.

The highest total bacterial count (3.0x10 6 CFU/ml) and (2.0x10 4 CFU/ml) chloroaromatic degrading bacterial (CDB) count has been recorded for community (3).

The most five chosen isolates (MAM24, MAM27, MAM29, MAM33 and MAM3) and standard strain Enterobacter cloaceae MAM 4, have the ability to grow on the four chloroaromatic compounds at different concentrations.

Isolate MAM24 could removed a detectable amount of 3CBA at high concentration than any of the other isolates did.

250 Summary

Gramnegative isolates MAM3 and E. cloaceae MAM4 could remove 3CBA more efficient at low concentration but couldn't tolerate the higher concentrations of 3CBA.

The bacterial count of isolates grown on different concentrations 2,4DCP after 7 and 21 days incubations indicated that isolate MAM24 gave the highest count on the five different concentrations of 2,4DCP.

Isolates MAM24 and MAM27 degraded higher percentage of 2,4DCP at the higher concentrations (1 and 2mM) than at low concentrations.

The Gram +ve isolate MAM33 and the two Gram –ve isolates MAM3 and E. cloaceae MAM4 degraded more than 95% of 2,4DCP all the concentrations used in this study.

The five isolates and the Gramnegative E. cloaceae MAM4 their degradation percentage of 2,6DCPP at the higher concentrations (500, 1000 and 2000mM) was ranging from 79.3% to 97.1%.

The best isolate is degrading 2,6DCPP at the high concentration was MAM24 which degrade (96.8%, 95.0%, 90.0%) of (500M, 1, 2mM) of 2,6DCPP respectively.

Isolate MAM24showed good growth on all the five concentrations of 1,2,4TCB after 7 and 28 days incubation.

The isolate MAM24 was the best 1,2,4TCB degrader. It degrade 99.3%, 98.0%, 9+8.6%, 99.3% and 14.4% of 5, 10, 15, 25 and 50M 1,2,4 TCB respectively.

251 Summary

Isolate MAM24 was selected as a representative for chloroaromatic degrading bacteria (CDB).

The 16SrRNA of isolate MAM24 showed a similarity of 100% to Bacillus mucilaginosus (GQ866855).

The isolate MAM24 was identified as Bacillus mucilaginosus (HQ013329).

The dose response curve of B. mucilagiosus indicated that as the dose of γradiation increased the viable count decreased exponentially.

Mutant "9" was chosen and its parent strain (as control) for GCMS analysis after 24 and 48 hours incubation.

Bacillus mucilaginosus MAM24 dechlorinated the chloroaromatic compound (3chlorobenzoic acid, 2,4dichlorophenol, 1,2,4trichlorobenzene) as a first step.

The corner stone was the intermediates, had been recorded after 24 and 48 hours for both of MAM24 and its mutant MAM24 (9).

GCMS analysis provides the evidence that mutant MAM24 (9) differed from the parent strains.

252 References

REFERENCES

Abad, E.; Martinez, K.; Planas, C.; Palacios, O.; Caixach, J. and Rivera, J. (2005): Priority organic pollutant assessment of sludges for agricultural purposes. Chemosphere 61: 1358–1369. AboState, M.A.M. (1991): Control of Bacillus cereus isolated from certain foods. M.Sc. thesis, Fac. Sci., Cairo Univ. AboState, M.A.M. (1996): Study of genetic background and effect of radiation on toxin production by Bacillus cereus . Ph.D. thesis, Fac. Sci., Cairo Univ. AboState, M.A.M. (2003): Production of carboxymethyl cellulose by Fusarium oxysporium and Fusarium neoceros from gammapretreated lignocellulosic wastes. Egypt J. Biotechnol. 15: 151168. AboState, M.A.M. (2004): Highlevel xylanase production by radioresistent, thermophilic Bacillus megaterium and its mutants in solid state fermentation. Egypt J. Biotechnol. 17: 119137. AboState, M.A.M. (2005):

AboState, M.A.M. and Khalil, M.S. (2001): Effect of gamma radiation on protein fingerprinting and enzyme of Bacillus cereus NRRL569 and Bacillus cereus ATCC11778. Egypt J. Genet. Cytol. 29:159173. AboState, M.A.M.; Hammad, M. A. M.; Swelam, M. and Gannam, R.B. (2010): Enhanced production of cellulase(s) by Aspergillus spp. isolated from agriculture wastes by solid state fermentation. American Eurasian J. Agric. Environ. Sci. 8:402410. AboState, M.A.M.; Swelam, M.; Aziz, N.H.; Aly, N.M. and Khalil, O.A.A. (2005): Characterization and effect of gamma irradiation on indigenous chloroaromatic degrading bacteria. Isotope Rad. Res. 37:11391157. AbouArab, A.A.K. (2002): Degradation of organochlorine pesticides by meat starter in liquid media and fermented sausage. Food Chem. Toxicol. 40:33–41. AbouArab, A.A.K. and Abou Donia, M.A. (2001): Pesticide residues in some Egyptian spices and medicinal plants as affected by processing. Food Chem. 72: 439445.

253 References

Abramowicz, D.A. (1990): Aerobic and anaerobic biodegradation of PCBs: a review. In: Steward, G.G., Russell, I. (Eds.), CRC Crit. Rev. Biotechnol. CRC Press, Boca Raton, FL, pp. 241–251. Abramowicz, D.A. (1995): Aerobic and anaerobic PCB biodegradation in the environment. Environ. Health Persp. Suppl. 103: 97–99. Addison, R.F.; Brodle, P.F. and Zinck, M.E. (1984): DDT has declined more than PCBs in eastern Canadian seals during the 1970s. Environ. Sci. Technol. 18:935–937. Adebusoye, S. A.; Picardal, F. W.; Ilori, M. O.; Amund, O.O.; Fuqua, C. and Grindle, N. (2007): Aerobic degradation of di and trichlorobenzenes by two bacteria isolated from polluted tropical soils. Chemosphere 66: 1939–1946. Adrian, L.; Szewzyke, U. and Görisch, H. (2000): Bacterial growth based on reductive dechlrination of trichlorobenzenes. Biodegradation 11:73 81. Ahlert, R.C. and Kosson, D.S. (1983): In situ and onsite biodegradation of industrial landfill leachate. Report to Dept. of the Interior, Washington, DC. Ahmed, M. and Focht, D.D. (1973): Degradation of polychlorinated biphenyls by two species of Achromobacter . Can. J. Microbiol. 19:4752. Ahmed, M.T.; Loutfy, N. and El Shieke, E. (2002): Residue levels of DDE and PCBs in blood serum of women in Port Said in Egypt. J. Hazard. Matt. 89: 41–48. Aigner, E. J.; Leone, A. D. and Falconer, R. L. (1998): Concentrations and enantiomeric ratios of organochlorine pesticides in soils from the U.S. corn belt. J. Environ. Sci. Technol. 32: 1162–1168. AlAwadhi, N.; AlDaher, R.; Nawawy, A. and Balba, M.T. (1996): Bioremediation of oil contaminated soil in Kuwait: I. Land farming to remediate oilcontaminated soil. J. Soil Contam. 5: 243–260. AlDaher, R.; Al Awadhi, N.; Yateem, A. and Balba, M.T. (2001): Compost soil piles for treatment of oil contaminated soils. Soil Sediment Contam. 10: 197– 209. Alfreider, A.; Vogt, C. and Babel, W. (2003): Expression of chlorocatechol 1,2 dioxygenase and chlorocatechol 2,3dioxygenase genes in chlorobenzene contaminated subsurface samples. Appl. Environ. Microbiol. 69 :1372–1376.

254 References

Ali, S.L. (1983): Bestimmung der pestiziden Rüeckstäende und anderer bedenklicher veruntreinigungen wie toxische Metallspuren in Arzflneipanzen. 1. Mitt: Pestizid Rüeckstäende in Arzneidrogen. Pharmazie Industrial. 45:11541156. Amaral Mendes, J.J. (2002): The endocrine disrupters: a major medical challenge. Food Chem. Toxicol. 40: 781–788. Amir, S.; Hafidi, M.; Merlina, G.; Hamdi, H.; Jouraiphy, A.; Gharous, M.E. and Revel, J.C. (2005): Fate of phthalic acid esters during composting of both lagooning and activated sludges. Process. Biochem. 40: 2183– 2204. Arensdorf, J.J. and Focht, D.D. (1994): Formation of chlorocatechol meta cleavage products by a pseudomonad during metabolism of monochlorobiphenyls. Appl. Environ. Microbiol. 60: 2884–2889. Arino, A.; Herrera, A.; Conchello, M.P. and Perez, C. (1992): Hexachlorobenzene residues in Spanish meat products after cooking, curing and longterm ripening. J. Food Prot. 55: 920–923. Arino, A.; Herrera, A.; Conchello, M.P.; Lazaro, R. and Perez, C. (1993): Hexachlorocyclohexane residues in meat products after processing. J. Food Comp. Anal. 6: 55–61. Arino, A.; Lazaro, R.; Conchello, P.; Bayarri, S. and Herrera, A. (1995): The effect of processing on incurred residues on DDE in meat products. Food Add. Contam. 12: 559–566. Armenante, P.M.; Kafewitz, D.; Lewandowski, G. and Jou, C.J. (1999): Anaerobicaerobic treatment of halogenated phenolic compounds. Wat. Res. 33: 681692. Aronson, K.J.; Miller, A.B.; Woolcott, Ch.G.; Sterns, E.E.; McCready, D. R.; Lickely, L. A.; Fish, E. B.; Hiraki, G.Y.; Holloway, C.; Ross, T.; Hanna, W. M.; SenGupta, S.K. and Weber, J.P. (2000): Breast adipose tissue concentrations of polychlorinated biphenyls and other organochlorines and breast cancer risk. Cancer Epidemiol. Biomark Prev. 9:5563. ASTM International, (2000): Analysis of PCBs in Insulating Liquids by Gas Chromatography. ASTM D4059, ASTM International, USA. Asturias, J.A.; Diaz, E. and Timmis, K.N. (1995): The evolutionary relationship of biphenyl dioxygenase from grampositive Rhodococcus globerulus P6 to multicomponent dioxygenases from gramnegative bacteria. Gene 156:11–18.

255 References

Atlas, R.M. (1977): Stimulated petroleum biodegradation. Crit. Rev. Microbiol. 5: 371– 386. Atlas, R.M. (1981): Microbial degradation of petroleum hydrocarbons: an environmental perspective. Microbiol. Rev. 45:180– 209. Aziz, N.H. and Mahrous, S.R. (2004): Effect of gamma irradiation on aflatoxin B1 production by Aspergillus flavus and chemical composition of three crop seeds. NahrungFood. 48:238243. Baggi, G. (2002): Microbial degradation of chlorobenzoates (CBAs): Biochemical aspects and ecological implications. Biotransform. Bioremed. Technol. Health and Environ. Pro. 36: 149173. Baggi, G.; Bernasconi, S. and Zangrossi, M. (2005): 3Chloro, 2,3 and 3,5 dichlorobenzoate cometabolism in a 2chlorobenzoatedegrading consortium. Biodegradation 16: 275–282. Baggi, G.; Bernasconi, S.; Zangrossi, M.; Cavalca, L. and Andreoni, V. (2008): Cometabolism of di and trichlorobenzoates in a 2chlorobenzoate degrading bacterial culture: Effect of the position and number of halo substituents. Int. Biodeterior. Biodegrad. 62: 57–64. Balba, M.T.; AlDaher, R.; AlAwadhi, N.; Chino, T. and Tsuji, H. (1998): Bioremediation of oilcontaminated desert soil: the Kuwait experience. Environ. Int. 24: 163–173. Barathi, S. and Vasudevan, N. (2001): Utilization of petroleum hydrocarbons by Pseudomonas fluorescence isolated from a petroleum contaminated soil. Environ. Int. 26: 413–416. Barbeau, C.; Deschênes, L.; Karamanav, D.; Comeau, Y. and Samson, R. (1997): Bioremediation of pentachlorophenolcontaminated soil by bioaugmentation using activated soil. Appl. Microbiol. Biotechnol. 48:745752. BarragánHuerta, B.E.; CostaPérez, C.; PeraltaCruz, J.; BarreraCortés, J.; EsparzaGarcía, F. and RodríguezVá zquez, R. (2007): Biodegradation of organochlorine pesticides by bacteria grown in microniches of the porous structure of green bean coffee. Int. Biodeterior. Biodegrad. 59:239–244. BarriadaPereira, M.; GonzálezCastro, M. J. and MuniateguiLorenzo, S. (2005): Organochlorine pesticides accumulation and degradation products in vegetation samples of a contaminated area in Galicia (NW Spain). Chemosphere 58:1571–1578.

256 References

BarriadaPereira, M.; Serôdio, P.; GonzálezCastro, M. J. and Nogueira, J.M.F. (2010): Determination of organochlorine pesticides in vegetable matrices by stir bar sorptive extraction wiyh liquid desorption and large volume injectiongas chromatographymass spectrometry towards compliance with European Union directives. J. Chromatogr. A. 1217: 119126. Bartels, I.; Knackmuss, H.J. and Reineke, W. (1984): Suicide inactivation of catechol 2,3dioxygenase from Pseudomonas putida mt2 by 3 halocatechols. Appl. Environ. Microbiol. 47: 500–505. Batterman, S.A.; Chernyak, S.M.; Gounden, Y.; Matooane, M. and Naidoo, R.N. (2008): Organochlorine pesticides in ambient air in Durban, South Africa. Sci. Total. Environ. 397: 119–130. Bauer, R. D.; Rolle, M.; Kürzinger, P.; Grathwohl, P. and Meckenstock, R.U. (2009): Twodimensional flowthrough microcosms – Versatile test systems to study biodegradation processes in porous aquifers. Christian Griebler J. Hydrol. 369: 284–295. Bawden, K.; Ormerod, R.; Starke, G and Zeise, K. (2004): National dioxin programme technical report no. 3, inventory of dioxin emissions in Australia. National dioxins programme & consultancy, Pacific Air and Environment. Beck, U. (1986): Nucleuschlorinated aromatic hydrocarbons. In: Campbell, F.T., Pfefferkorn, R., Rounsaville, J.F. (Eds.), Ullmann’s Encyclopedia of Industrial Chemistry, 5th ed. VCH Verlagsgesellschaft, Weinheim, Germany 330–355. Bedard, D.L.; Unterman, R.; Bopp, L.H. and Brennan, M.J. (1986): Rapid assay for screening and characterizing microorganisms for the ability to degrade polychlorinated biphenyls. Appl. Environ. Microbiol. 51:761768. Beil, S.; Timmis, K.N. and Pieper, D.H. (1999): Genetic and biochemical analyses of the tec operon suggest a route for evolution of chlorobenzene degradation genes. J. Bacteriol. 181: 341–346. Bell, K.S.; Philp, J.C.; Aw, D.W.J. and Christofi, N. (1998): The genus Rhodococcus . J. Appl. Microbiol. 85:195–210. Benecke, R.; Brotka, J.; Wijsbeek, J.; Frank, J. P.; Bruins, A. P. and DeZeeuw, R. A. (1986): Untersuchung pflanzlicher Drogenauf Rüeckstäende von organochlorverbindungen. 2. Mittelung. Identifizierung der Rüeckstäende von DDT und semen Analogen durch vergleich von Gaschromatographi an gepackter und kapillars ule sowie GC/MS Kopplung. Pharmazie 41: 499501.

257 References

Benecke, R.; Brotka, J.; Wijsbeek, J.; Frank, J. P.; Bruins, A. P. and Dezeeuw, R. A. (1988): Untersuchung pflanzlicher Drogen auf Rckstnden polychlorierter Biphenyle durch vergleich von GasIdentifizierung von Rüeckstäenden polychlorierter Biphenyle durch vergleich von Gas chromatographie an gepackter und kapillarsule sowie GC/MS Kopplung. Pharmazie 43: 123125. Bengtsson, G. and Carlsson, C. (2001): Degradation of dissolved and sorbed 2,4 dichlorophenol in soil columns by suspended and sorbed bacteria. Biodegradation. 12:419432. Bento, F. M.; Camargo, F. A.O.; Okeke, B. C. and Frankenberger, W.T. (2005): Comparative bioremediation of soils contaminated with diesel oil by natural attenuation, biostimulation and bioaugmentation. Bioresour. Technol. 96: 1049–1055. Bergmann, J. G. and Sanik, J. (1957): Determination of trace amounts of chlorine in naphtha. Anal. Chem. 29: 241243. Beurskens, J.E.M.; Dekker, C.G.C.; Jonkhoff, J. and Pompstre, L. (1993): Microbial dechlorination of hexachlorobenzene in a sedimentation area of Rhine river. Biogeochem. 19:6181. Bhanti, M.; Shukla, G. and Taneja, A. (2004): Contamination levels of organochlorine pesticides and farmers' knowledge, perception, practices in rural India: a case study. Bull. Environ. Contam. Toxicol. 73:787 793. Bhat, M.A.; Tsuda, M.; Horike, K.; Nozaki, M.; Vaidyanathan, C.S. and Nakazawa, T. (1994): Identification and characterization of a new plasmid carrying genes for degradation of 2,4dichlorophenoxyacetate from Pseudomonas cepacia CSV90. Appl. Environ. Microbiol. 60: 307312. Boopathy, R. (2000): Factors limiting bioremediation technologies. Bioresour. Technol. 74: 63–67. Bondar, V. S.; Boersma, M. G.; Golovlev, E. L.; Vervoort, J.; van Berkel, W. J. and Finkelstein, Z. I. (1998): 19F NMR study on the biodegradation of fluorophenols by various Rhodococcus species. Biodegradation 9: 475–486. Bondar, V. S.; Boersma, M.G.; van Berkel, W.J.; Finkelstein, Z.I.; Golovlev, E.L. and Baskunov, B.P. (1999): Preferential oxidative dehalogenation upon conversion of 2halophenols by Rhodococcus opacus 1G. FEMS Microbiol. Lett. 181: 73–82.

258 References

Borja, J.; Taleon, D.M.; Auresenia, J. and Gallardo, S. (2005): Polychlorinated biphenyls and their biodegradation. Proc. Biochem. 40:1999–2013. Boyd, E.M.; Killham, K.; Wright, J.; Rumford, S.; Hetheridge, M.; Cumming, R. and Meharg, A.A. (1997): Toxicity assessment of xenobiotic contaminated groundwater using lux modified Pseudomonas fluorescens . Chemosphere 35: 1967–1985. Bradlow, H.L.; Davis, D.L.; Lin, G.; Sepkovic, D. and Tiwari, R. (1995): Effects of pesticides on the ratio of 16α/2hydroxyestrone: A biologic marker of breast cancer risk. Environ. Health Perspect. Suppl. 103:147. Bragg, J.R.; Prince, R.C.; Harner, E.J. and Atlas, R.M. (1994): Effectiveness of bioremediation for the Exxon Valdez oil spill. Nature 368: 413–418. Brahushi, F.; Dörfler, U.; Schroll, R. and Munch, J.C. (2004): Stimulation of reductive dechlorination of hexachlorobenzene in soil by inducing the native microbial activity. Chemosphere 55: 1477–1484. Brahushi, F.; Dörfler, U.; Schroll, R.; Feicht, E. and Munch, J.C. (2002): Environmental behavior of monochlorobenzene in an arable soil. Fres. Environ. Bull. 11:599604. Briglia, M.; Rainey, F.A.; Stackebrandt, E.; Schraa, G. and SalkinojaSalonen, M.S. (1996): Rhodococcus percolatus sp. nov., a bacterium degrading 2,4,6trichlorophenol. Int. J. Syst. Bacteriol. 46:23–30. Broderick, J.B. (1999): Catechol dioxygenases. Essays Biochem. 34:173–89. Brody, J.G. and Rudel, R.A. (2003): Environmental pollutants and breast cancer. Environ. Health Perspect. 111: 1007–1019. Brooks, S.J.; Doyle, E.M.; Hewage, C.; Malthouse, J.P.G.; Duetz, W. and Connor, K.E.O. (2004): Biotransformation of halophenols using crude cell extracts of Pseudomonas putida F6. Appl. Microbiol. Biotechnol. 64:486492. Brunsbach, F.R. and Reineke, W. (1994): Degradation of chlorobenzenes in soil slurry by a specialized organism. Appl. Microbiol. Biot. 42: 415–420. Brunsbach, F.R. and Reineke, W. (1995): Degradation of mixtures of chloroaromatic compounds in soil slurry by mixed cultures of specialized organisms. Appl. Microbiol. Biotechnol. 43:529533. Bumpus, J.A. (1989): Biodegradation of polycyclic aromatic hydrocarbons by Phanerochaete chrysosporium . Appl. Environ. Microbiol. 55: 154–158.

259 References

Bundy, J.G.; Paton, G.I. and Campbella, C.D. (2004): Combined microbial community level and single species biosensor responses to monitor recovery of oil polluted soil. Soil Biol. Biochem. 36: 1149–1159. Burger, A.E. (1993): Estimating the mortality of seabirds following oilspills effects of spill volume. Mar. Pollut. Bull. 26: 239–248. Burger, J.K.; Giesy, J.P.; Grue, C.E. and Gochfeld, M. (2001): Effects of environmental pollutants on avian behaviour. In: Dell’Omo, G. (Ed.), Behavioural Ecotoxicology. John Wiley & Sons, West Sussex, UK 337– 376. Burns, K.A.; Garrity, S.D. and Levings, S.C. (1993): How many years until mangrove ecosystems recover from catastrophic oilspills. Mar. Pollut. Bull. 26: 239–248. Busetti, F.; Heitz, A.; Cuomo, M.; Badoer, S. and Traverso, P. (2006): Determination of sixteen polycyclic aromatic hydrocarbons in aqueous and solid samples from an Italian wastewater treatment plant. J. Chromatogr. A. 1102: 104–115. Cai, Q.Y.; Mo, C.H.; Wu, Q.T.; Zeng, Q.Y. and Katsoyiannis A. (2007): Occurrence of organic contaminants in sewage sludges from eleven wastewater treatment plants, China. Chemosphere 68: 1751–1762. Calle, E.E., Frumkin, H., Henley, S.J., Savitz, D.A., Thun, M.J. (2002): Organochlorines and breast cancer risk. C. A. Cancer J. Clin. 52:301– 309. Cantoni, C.; Fabbris, F. and Rogledi, S. (1991): Contenuto in pesticide organochlorurati in alcuni alimenti rilevati nel 1990. Industrie Alimentari 30: 383–389. Cantoni, C. and Comi, G. (1997): Changes in the concentrations of pesticide residues in foods and in human tissues between 1960 and 1996. Outlook Agri. 26: 47–52. Castilho, J.A.A.; Fenzl, N.; Guillen, S.M. and Nascimento, F.S. (2000): Organochlorine and organophosphorus pesticide residues in the Atoya river basin, Chinandega, Nicaragua. Environ. Poll. 110:523–533 Chae, J.C. and Kim, C.K. (1997): Dechlorination of 4chlorobenzoate by Pseudomonas sp. DJ12. Kor. J. Microbiol. 35:290294. Chae, J.C.; Kim, Y.; Min, K.H.; Kim, Y.C. and Kim, C.K. (1999): Cloning and sequencing of the fcbB gene encoding 4chlorobenzoatecoenzyme A dehalogenase from Pseudomonas sp. DJ12. Mol. Cells. 9:225229.

260 References

Chaineau, C.H.; Morel, J.L. and Oudot, J. (1996): Land treatment of oilbased drill cuttings in an agricultural soil. J. Environ. Qual. 25: 858– 867. Chaineau, C.H.; Rougeux, G.; Yéprémian, C. and Oudot, J. (2005): Effects of nutrient concentration on the biodegradation of crude oil and associated microbial populations in the soil. Soil Biol. Biochem. 37: 1490–1497. Chang, BV.; Su, CJ. and Yuan, SY. (1998): Microbial hexachlorobenzene dechlorination under three reducing conditions. Chemosphere. 36:27212730. Charlier, C.; Pitance, F. and Plomteux, G. (2003): PCB residues in a breast cancer patient population. Bull. Environ. Contam. Toxicol. 71:887 891. Chatterjee, D.K.; Kellogg, S.T.; Hamada, S. and Chakrabarty, A.M. (1981): Plasmid specifying total degradation of 3chlorobenzoate by a modified ortho pathway. J. Bacterial. 146:639646. Chaudhry, G.R. and Chapalamadugu, S. (1991 a): Biodegradation of textile azo dyes by Phanerochaete chrysosporium . World J. Microbiol. Biotechnol. UK 8: 309312. Chaudhry, G. R. and Chapalamadugu, S. (1991 b): Biodegradation of halogenated organic compounds. Microbiol. Rev. 55: 59–79. Chivukula, M.; Spadaro, J.P.; Renganathan, V. (1995): Lignin peroxidase catlyzed oxidation of sulfonated azo dyes generates novel sulfonyl hydroperoxides. Biochemist. 34: 77657772. Chugani, S.A.; Parsek, M.R.; Hershberger, C.D.; Murakami, K.; Ishihama, A. and Chakrabarty, A.M. (1997): Activation of the catBCA promoter: probing the interaction of CatR and RNA polymerase through in vitro transcription. J. Bacteriol. 179: 2221–2227. CobosVasconcelos, D.D.L.; SantoyoTepole, F.; JuárezRamírez, C.; RuizOrdaz, N. and GalíndezMayer, C.J.J. (2006): Cometabolic degradation of chlorophenols by a strain of Burkholderia in fed –batch culture. Enz. Micro. Technol. 40:5760. Clément, P.; Pieper, D. H. and González, B. (2000): Molecular characterization of a deletion/duplication rearrangement in tfd genes from Ralstonia eutropha JMP134 (Pjp4) that improves growth on 3chlorobenzoic acid but abolishes growth on 2,4dichlorophenoxyacetic acid. Microbiol. 147: 21412148.

261 References

Cohn, B. A.; Cirillo, P. M.; Wolff, M.S.; Schwingl, P.J.; Cohen, R. D. and Sholtz, R. I. (2003): DDT and DDE exposures in mothers and time to pregnancy in daughters. Lancet. 361:2205–2206. Colombo, J.G.; Khali, M.F.; Horth, A.C. and Catoggio, J.A. (1990): Distribution of chlorinated pesticides and individual polychlorinated biphenyls in biotic and abiotic compartments of the Rio de La Plate. Environ. Sci. Technol. 24: 498–505. ConchaGrãna, E.; TurnesCarou, M. I. and MuniateguiLorenzo, S. (2006): Evaluation of HCH isomers and metabolites in soils, leachates, river water and sediments of a highly contaminated area. Chemosphere 64: 588–595. Corbella, M.E. and Puyet, A. (2003): Realtime reverse transcriptionPCR analysis of expression of halobenzoate and salicylate catabolismassociated operons in two strains of Pseudomonas aeruginosa . Appl. Environ. Microbiol. 69: 22692275. Corbella, M.E.; GarridoPertierra, A. and Puyet, A. (2001): Induction of the halobenzoate catabolic pathway and cometabolism of ortho chlorobenzoates in Pseudomonas aeruginosa 142 grown on glucose supplemented media. Biodegradation 12:149157. Cruz, S.; Lino, C. and Silveira, M.I. (2003): Evaluation of organochlorine pesticide residues in human serum from an urban and two rural populations in Portugal. Sci. Total Environ. 317: 23–35. Czaplicka, M. (2004): Sources and transformations of chlorophenols in the natural environment. Sci. Tot. Environ. 322:21–39. Dagley, S. (1971): Catabolism of aromatic compounds by microorganisms. Adv. Microbiol. Physiol. 6:1–76. Dai, J.; Xu, M.; Chen, J.; Yang, X. and Ke, Z. (2007): PCDD/ PAH and heavy metals in the sewage sludge from six wastewater treatment plants in Beijing, China. Chemosphere 66: 353–361. D’amato, C.; Torres, J.P.M. and Malm, O. (2002): DDT (Dicloro DifenilTricloroetano): Toxicidade e Contaminação Ambiental – Uma Revisão. Quím. Nova 25: 995–1002. Danielopol, D.L.; Griebler, C.; Gunatilaka, A. and Notenboom, J. (2003): Present state and future prospects for groundwater ecosystems. Environ. Conser.30:104–130.

262 References

Da Rocha, U. N.; Tótola, M. R.; Pessoa, D. M.M.; Jùnior, J. T. A.; Neves, J. C. L. and Borges, A. C. (2009): Mobilisation of bacteria in a finegrained residual soil by electrophoresis. J. Hazard. Mat. 161: 485–491. Das, K. and Mukherjee, A. K. (2007): Crude petroleumoil biodegradation efficiency of Bacillus subtilis and Pseudomonas aeruginosa strains isolated from a petroleumoil contaminated soil from NorthEast India. Bioresour. Technol. 98: 1339–1345. DavilaVazquez, G.; Tinoco, R.; Pickard, M. A. and VazquezDuhalt, R. (2005): Transformation of halogenated pesticides by versatile peroxidase from Bjerkandera adusta . Enz. Microbial Technol. 36:223231. Davis, D. L.; Bradlow, H. L.; Wolff, M. ; Woodruff, T.; Hoel, D.G. and Anton Culver, H. (1993): Medical hypothesis: Xenoestrogens as preventable causes of breast cancer. Environ. Health Perspest. 101:372. De, S.; Perkins, M. and Dutta, S. K. (2006): Nitrate reductase gene involvement in hexachlorobiphenyl dechlorination by Phanerochaete chrysosporium . J. Hazard. Mat. 135:350–354. De Bont, J.A.M.; Vorage, M.J.A.W.; Hartmans, S. and van den Tweel, W.J.J.(1986): Microbial degradation of 1,3dichlorobenzene. Appl. Environ. Microbiol. 52:677680. Decastro, B.R.; Korrick, S.A.; Spengler, J.D. and Soto, A.M. (2006): Estrogenic activity of polychlorinated biphenyls present in human tissue and the environment. Environ. Sci. Technol. 40:2819–2825. De Jong, E.; Field, J. A.; Spinnler, H.E.; Wijnberg, J.B.P.A. and de Bont, J.A.M. (1994): Significant biogenesis of chlorinated aromatics by fungi in natural environments. Appl. Environ. Microbiol. 61:12791289. Delille, D. and B. Delille (2000): Field observations on the variability of crude oil impact on indigenous hydrocarbondegrading bacteria from sub Antarctic intertidal sediments. Marine Environ. Res. 49: 403417. Dermietzel, J. and Vieth, A. (2002): Chloroaromatics in groundwater: chances of bioremediation. Environ. Geol. 41: 683–689. Dercová, K.; Čičmanová, J.; Lovecká, P.; Demnerová, K.; Macková, M.; Hucko, P. and Kušnír, P. (2008): Isolation and identification of PCB degrading microorganisms from contaminated sediments. Int. Biodeter. Biodeg. 62:219225.

263 References

DiGeronimo, M.J.; Nikaido, M. and Alexander, M. (1979): Utilization of chlorobenzoates by microbial populations in sewage. Appl. Environ. Microbiol. 37: 619625. Di Toro, S.; Zanaroli, G. and Fava, F. (2006): Intensification of the aerobic bioremediation of an actual site soil historically contaminated by polychlorinated biphenyls (PCBs) through bioaugmentation with a non acclimated, complex source of microorganisms. Microb. Cell Fact. 5:111. Dojka, M.A.; Hugenholtz, P.; Haack, S.K. and Pace, N.R. (1998): Microbial diversity in a hydrocarbon and chlorinatedsolventcontaminated aquifer undergoing intrinsic bioremediation. Appl. Environ. Microbiol. 64: 3869–3877. Don, R. H. and Pemberton, J. M. (1981): Properties of six pesticide degradation plasmids isolated from Alcaligenes paradoxus and Alcaligenes eutrophus. J. Bacteriol. 145:681686. Don, R.H.; Weightman, A.J.; Knackmuss, HJ and Timmis, K.N. (1985): Transposon mutagenesis and cloning analysis of the pathways for degradation of 2,4dichlorophenoxyacetic acid and 3chlorobenzoate in Alcaligenes eutrophus JMP134 (pJP4). J. Bateriol. 161:8590. Dougherty, R.C.; Whitaker, M.J.; Jang, S.Y.; Bottcher, R.; Keller, M. and Kuehl, D.W. (1980): Sperm density and toxic substance: a potential key to environmental health hazards. Environ. Health Chem. 13: 263. Duennbier, U.; Heberer, Th. and Reichlich, Ch. (1997): Occurrence of bis (chlorophenyl)acetic acid (DDA) in surface and ground water in Berlin. Fresenius Environ. Bull. 6:753–759. Durand, C.; Ruban, V.; Ambles, A. and Oudot, J. (2004): Characterization of the organic matter of sludge: determination of lipids, hydrocarbons and PAHs from road retention/ infiltration ponds in France. Environ. Pollut. 132:375–384. Edwards, U.; Rogalt, T.; Blocker, H.; Emde, M. and Bottger, E.C. (1989): Isolation and direct complete nucleotide determination of entire genes, charactrerization of a gene coding for 16S ribosomal RNA. Nucleic Acid Res. 19:78437853. ElBatal, A.I. and AboState, M.A.M. (2006): Production of cellulose, xylanase, cocktail by Bacillus spp. and their mixed cultures with Candida tropicalis and Rhodotorula glutinis under solidstate fermentation. Egypt J. Rad. Sci. Applic. 19:139156.

264 References

ElKadi, A.A.M. (2000): Survey study on the presence of some pesticides and heavy metals in local and imported meat and effect of processing on them. M.Sc. thesis, Food Technology Department, Faculty of Agriculture, Cairo University. Eon, S.; Culard, F.; Sy, D.; Charlier, M. and SpotheimMaurizott, M. (2001): Radiation disrupts proteinDNA complexes through damage to the protein. The lac repressoroperator system. Rad. Res. 156:110117. Erhrardt, M.G. and Burns, K.A. (1993): Hydrocarbons and related photooxidation products in Saudi Arabian Gulf coastal waters and hydrocarbons in underlying sediments and bioindicator bivalves. Mar. Pollut. Bull. 27: 187197. Escher, B.I.; Hunziker, R.W. and Schwarzenbach, R.P. (2001): Interaction of phenolic uncouplers in binary mixtures: concentrationadditive and synergistic effects. Environ. Sci. Technol. 35:39053914. Eulberg, D. and Schlömann, M. (1998): The putative regulator of catechol catabolism in Rhodococcus opacus 1CP an IclRtype, not a LysRtype transcriptional regulator. Antonie Van Leeuwenhoek 74: 71–82. Eulberg, D.; Golovleva, L.A. and Schlömann, M. (1997): Characterization of catechol catabolic genes from Rhodococcus erythropolis 1CP. J. Bacteriol. 179:370381. Eulberg, D.; Kourbatova, E.M.; Golovleva, L.A. and Schlömann, M. (1998a): Evolutionary relationship between chlorocatechol catabolic enzymes from Rhodococcus opacus 1CP and their counterparts in proteobacteria: sequence divergence and functional convergence. J. Bacteriol. 180: 1082–94. Eulberg, D.; Lakner, S.; Golovleva, L.A. and Schlömann, M. (1998b): Characterization of a protocatechuate catabolic gene cluster from Rhodococcus opacus 1CP: evidence for a merged enzyme with 4 carboxymuconolactonedecarboxylating and 3oxoadipate enol lactonehydrolyzing activity. J. Bacteriol. 180:1072–81. Evans, B.S.; Dudley, C.A. and Klasson, K.T. (1996): Sequential anaerobicaerobic biodegradation of PCBs in soil slurry microcosms. Appl. Biochem. Biotechnol. 57–58: 885–894. Falandysz, J. and Brudnowska, B. and Kawano, M. (2001): Polychlorinated biphenyls and organochlorine pesticides in soils from the southern part of Poland. J. Arch. Environ. Contam. Toxicol. 40: 173178.

265 References

FAO/ WHO. (2000): Maximum residue limits in codex Alimentarious, Vol2B. Fang, W.; YongRong, B.; Xin, J.; HongJian, G.; GuiFen, Y.; and JianCai, D. (2006): Residual characteristics of organochlorine pesticides in Lou Soils with different fertilization modes. Pedosphere 16: 161168. Fang, W.; Xin, J.; YongRong, B.; FenXia, Y.; Hongjian, G.; GuiFen, Y.; Munch, J. C. and Schroll, R. (2007): Organochlorine pesticides in soils under different land usage in the Taihu Lake region, China. J. Environ. Sci. 19:584–590. Faroon, O.M.; Keith, S.; Jones, D. and De Rosa, C. (2001): Carcinogenic effects of polychlorinated biphenyls. Toxicol. Ind. Health. Mar. 17: 4162. Fava, F. and Bertin, L. (1999): Use of exogenous specialised bacteria in the biological detoxification of a dump sitepolychlorobiphenyl contaminated soil in slurry phase conditions. Biotechnol. Bioeng. 64: 240–249. Feidieker, D.; Kämpfer, P. and Dott, W. (1995): Fieldscale investigations on the biodegradation of chlorinated aromatic compounds and HCH in the subsurface environment. J. Contam. Hydrol. 19:145169. Ferrari, M.D.; Neirotti, E.; Albornoz, C.; Mostazo, M.R. and Cozzo, M. (1996): Biotreatment of hydrocarbons from petroleum tank bottom sludge in soil slurries. Biotechnol. Lett. 18: 1241–1246. Ferraroni, M.; Kolomytseva, M.P.; Solyanikova, I.P.; Scozzafava, A.; Golovleva, L. A. and Briganti F. (2006): Crystal structure of 3 chlorocatechol 1,2dioxygenase key enzyme of a new modified ortho pathway from the grampositive Rhodococcus opacus 1CP grown on 2 chlorophenol. J. Mol. Biol. 360:788799. Fetzner, S. (1998): Bacterial dehalogenation. Appl. Microbiol. Biotechnol. 50: 633–657. Fetzner, S. and Lingens, F. (1994): Bacterial dehalogenases: biochemistry, genetics and biotechnological applications. Microbiol. Rev. 58: 641685. Field, J.A. and SierraAlvarez, R. (2008): Microbial transformation and degradation of polychlorinated biphenyls. Environ. Pollut. 155:112. Fleming, L. E.; Bean, J. A.; Rudolph, M. and Hamilton, K. (1999): Mortality in a cohort of licensed pesticide applicator in Florida. Occup. Eniron. Med. 56:1421. Forget, G. (1991): Pesticides and the third world. J. Toxicol. Environ. Health 32:1131. 266 References

Fowler, S.W.; Readman, J.W.; Oregioni, B.; Villeneuve, J.P. and McKay, K. (1993): Petroleum hydrocarbons and trace metals in nearshore Gulf sediments and biota before and after the 1991 war: an assessment of temporal and spatial trends. Mar. Pollut. Bull. 27: 117134. Franco, I.; Contin, M.; Bragato, G. and Nobili, M.D. (2004): Microbiological resilience of soils contaminated with crude oil. Geoderma 121: 17–30. Frankenberger, W.T. (1992): The need for laboratory feasibility study in bioremediation of petroleum hydrocarbons. In: Calabrese, E.J., Kostecki, P.T. (Eds.), Hydrocarbon contaminated soils and groundwater. Lewis, Boca Raton, FL 237–293. Frantz, B. and Chakrabarty, A.M. (1987): Organization and nucleotide sequence determination of a gene cluster involved in 3chlorocatechol degradation. Proc. Natl. Acad. Sci USA 84: 44604464. Frías, M.M.; Frenich, A.G.; Vidal, J.L.M.; Sánchez, M.M.; Olea, F. and Olea, N. (2001): Analyses of lindane, vinclozolin, aldrin, p,p´DDE, o,p´ DDT and p,p´DDT in human serum using gas chromatography with electron capture detection and tandem mass spectrometry. J. Chromatogr. B. 760: 1–15. Fritsche, W. and Hofrichter, M. (2008): Aerobic degradation by microorganisms . in Biotechnology: Environmental Processes II, vol. 11b. Fromme, H.; Kuchler, T.; Otto, T.; Pilz, K.; Muller, J. and Wenzel, A., (2002): Occurrence of phthalates and bisphenol A and F in the environment. Water Res. 36:1429–1438. Fulthorpe, R.R. and Schofield, L.N. (1999): A comparison of the ability of forest and agricultural soils to mineralize chlorinated aromatic compounds. Biodegradtion 10: 235244. Fulthorpe, R.R.; Rhodes, A.N. and Tiedje, J.M. (1996): Pristine soils mineralize 3chlorobenzoate and 2,4dichlorophenoxyacetate via different microbial populations. Appl. Environ. Microbiol. 62:11591166. Furukawa, K. (2000): Biochemical and genetic bases of microbial degradation of polychlorinated biphenyls (PCBs). J. General Appl. Microbiol. 46:283296. Furukawa, K.; Tomizuka, N. and Kamibayashi, A. (1979): Effect of chlorine substitution on the bacterial metabolism of various polychlorinated biphenyls. Appl. Environ. Microbiol. 38:301310.

267 References

Gallego, J.R.; Loredo, J.; Llamas, J.F.; Vazquez, F. and Sanchez, J. (2001): Bioremediation of dieselcontaminated soils: evaluation of potential in situ techniques by study of bacterial degradation. Biodegradation 12: 325–335. Gallizia, I.; McClean, S. and Banat, I.M. (2003): Bacterial biodegradation of phenol and 2,4dichlorophenol. J. Chem. Technol. Biotechnol. 78: 959–963. Gallo, P.; Castellano, V. and Serpe, L. (1996): Monitoraggis dei residui di pesticidi organochlorurated organofosforati ialimenti di origine animale: resultatie consderazioni relativi agli anni 1990–1994. Alimentaria 35: 253–257. Garry, V.F. (2004): Pesticides and children. Toxicol. Appl. Pharmacol. 198:152– 163. Genthner, B. R. S.; Price II, W. A. and Pritchard, P. H. (1989): Anaerobic degradation of chloroaromatic compounds in aquatic sediments under a variety of enrichment conditions. Appl. Environ. Microbiol. 55:1466 1471. Gentry, T. J.; Josephson, K.L. and Pepper, I. L. (2004): Functional establishment of introduced chlorobenzoate degraders following bioaugmentation with newly activated soil. Biodegradation 15:6775. Gerischer, U.; Segura, A. and Ornston, L.N. (1998): PcaU , a transcriptional activator of genes for protocatechuate utilization in Acinetobacter . J. Bacteriol. 180:1512–24. Ghosal, D.; You, IS.; Chatterjee, D.K. and Chakrabarty, A.M. (1985): Genes specifying degradation of 3chlorobenzoic acid in plasmid pAC27 and pJP4. Proc. Natl. Acad. Sci. USA 82:16381642. Gibson, R.; Wang, M.J.; Padgett, E. and Beck, A.J. (2005): Analysis of 4 nonylphenols, phthalates, and polychlorinated biphenyls in soils and biosolids. Chemosphere 61: 1336–1344. Gladen, B.C.; ShkiryakNyzhnyk, Z.A., Chyslovska, N. and Zadorozhnaja, T.D. (2003): Persistent organochlorine compounds and birth weight. Ann. Epidemiol. 13: 151157. Gladen, B. C.; Rogan, W. J.; Hardy, P.; Thullen, J.; Tinglestad, J. and Tully, M. (1988): Development after exposure to polychlorinated biphenyls and dichlorophenyl dichloroethane transplacentally and through human milk. J. Pediatr. 113: 991995..

268 References

Göbel, M.; KasselCati, K.; Schmidt, E. and Reineke, W. (2002): Degradation of aromatics and chloroaromatics by Pseudomonas sp. strain B13: Cloning, characterization, and analysis of sequences encoding 3 oxoadipate: Succinylcoenzyme (COA) transferase and 3oxoadipyl COA thiolase. J. Bacteriol. 184:216223. Gogoi, B.K.; Duttaa, N.N.; Goswamia, P. and Mohan, T.R.K. (2003): A case study of bioremediation of petroleumhydrocarbon contaminated soil at a crude oil spill site. Adv. Environ. Res. 7: 767–782. Golden, K.A.; Wong, C.S.; Jeremiasion, J.D.; Eisenreich, S.J.; Hallgren, J., Swackhamer, D.L.; Engstrom, D.R. and Long, D.T. (1993): Accumulation and preliminary inventory of organochlorines in Great Lakes sediments. Water Sci. Technol. 28: 19–31. Golden, R.; Doull, J.; Waddell, W. and Mandel, J. (2003): Potential human cancer risks from exposure to PCBs: a tale of two evaluations. Crit. Rev. Toxicol. 33: 543580. Golden, R. J.; Noller, K. L.; TitusErnstoff, L.; Kaufman, R. H.; Mittendorf, R.; Stillman, R. and Reese, E. A. (1998): Environmental endocrine modulators and human health: An assessment of the biological evidence. Crit. Rev. Toxicol. 28:109227. Gong, Z. M.; Tao. S. and Xu, F. L. (2004): Level and distribution of DDT in surface soils from Tianjing, China. Chemosphere 54: 1247–1253. González, L. F.; Sarria, V. and Sanchez, O. F. (2010): Degradation of chlorophenols by sequential biologicaladvanced oxidative process using Trametes pubescens and TiO2/UV. Bioresour. Technol. 101: 3493–3499 Gorlatov, S. N.; Maltseva, O. V.; Shevchenko, V. I. and Golovleva, L. A. (1989): Degradation of Chlorophenols by a culture of Rhodococcus erythropolis . Mikrobiol. 58: 802–806. Goswami, M.; Shivaraman, N. and Singh, R.P. (2002): Kinetics of chlorophenol degradation by benzoateinduced culture of Rhodococcus erythropolis M1. World J. Microbiol. Biotechnol. 18: 779–783. Greenwood, P.F.; Wibrow, S.; George, S.J. and Tibbett, M. (2009): Hydrocarbon biodegradation and soil microbial community response to repeated oil exposure. Organic Geochem. 40: 293–300. Gribble, G. W. (1992): Naturally occurring organohalogen compounds a survey. J. Nat. Prod. 55:13531395.

269 References

Gribble, G. W. (1996): Naturally occurring organohalogen compounds–a comprehensive survey. Fortschr. Chem. Org. Naturst 68:1–423. Grund, E.; Schmitz, A.; Fiedler, J. and Gartemann, K. H. (1995): Aerobic biodegradation of polycyclic and halogenated aromatic compounds. Biotrans. Microb. Degrad. Health Risk Comp. 103123. Grundmann, S.; Fuβ, R.; Schmid, M.; Laschinger, M.; Ruth, B.; Schulin, R.; Munch, J.C. and Schroll, R. (2007): Application of microbial hot spots enhances pesticide degradation in soils. Chemosphere 68:511–517. Guerin, T. F. (2008): Exsitu bioremediation of chlorobenzenes in soil. J. Haz. Mat. 154: 9–20. Habe, H. and Omori, T. (2003): Genetics of polycyclic aromatic hydrocarbon metabolism in diverse aerobic bacteria. Biosci. Biotechnol. Biochem. 67: 225–243. Häggblom, M. M. (1990): Mechanisms of bacterial degradation and transformation of chlorinated monoaromatic compounds. J. Basic Microbiol. 30:115– 141. Häggblom, M. M. (1992): Microbial breakdown of halogenated aromatic pesticides and related compounds. FEMS Microbiol. Rev. 103: 2972. Häggblom, M.M.; Janke, D. and SalkinojaSalonen, M.S. (1989): Hydroxylation and dechlorination of tetrachlorohydroquinone by Rhodococcus sp. strain CP2 cell extracts. Appl. Environ. Microbiol. 55:516–519. Häggblom, M.M.; Nohynek, L.J. and SalkinojaSalonen, M.S. (1988): Degradation and Omethylation of chlorinated phenolic compounds by Rhodococcus and Mycobacterium strains. Appl. Environ. Microbiol. 54: 3043–3052. Häggblom, M.M.; Rivera, M.D. and Young, L.Y. (1993): Influence of alternative election acceptors on the anaerobic biodegradability of chlorinated phenols and benzoic acids. Appl. Environ. Microbiol. 59:11621167. Haigler, B.E.; Nishino, S.F. and Spain, J.C. (1988): Degradation of 1,2 dichlorobenzene by a Pseudomonas sp. Appl. Environ. Microbiol. 54: 294–301. Haldorson, V.S.N.; Steiner, R.L. and Smith, G.B. (2004): Residual toxicity after biodegradation: interactions among benzene, toluene, and chloroform. Ecotoxicol. Environ. Saf. 57:162–167. Hammer, E.; Krowas, D.; Schäfer, A.; Specht, M.; Francke, W. and Schauer, F. (1998): Isolation and characterization of a dibenzofurandegrading yeast: identification of oxidation and ring cleavage products. Appl. Environ. Microbiol. 64:2215–2219.

270 References

Harrison, E.Z.; Oakes, S.R.; Hysell, M. and Hay, A. (2006): Organic chemicals in sewage sludges. Sci. Total Environ. 367: 481–497. Harwood, C.S. and Parales, R.E. (1996): The betaketoadipate pathway and the biology of selfidentity. Annu. Rev. Microbiol. 50: 553–590. Hayes, W.J. and Laws, E.R. (1991): Handbook of Pesticide Toxicology, Academic Press Inc. Heberer, Th. and Duennbier, U. (1999): DDT metabolite bis chorophenyl)acetic acid (DDA): the neglected environmental contaminant. Environ. Sci. Technol. 33:15–23. Heinfling, A.; Martinez, M.J.; Martinez, A.T.; Bergbauer, M. and Szewzyk, U. (1998): Purification and characterization of peroxidase from the dye decolorizing fungus Bjerkandera adusta . FEMS. Microbial. Lett., 165: 4350. Hernandez, L.M.; Fernandez, M.A.; Jimenez, B.; Gonzalez, M.J. and Garicia, J.F. (1994): Organochlorine pollutants in meats and cow’s milk from Madrid (Spain). Bull. Environ. Contam. Toxicol. 52: 246–253. Herrera, A.; Arino, A.; Conchello, M.P.; Lazaro, R.; Bayarri, S. and Perez, C. (1994): Organochlorine pesticide residues in Spanish meat products and meat of different species. J. Food Protect. 57: 441–444. Hickey, W. J. and Sabat, G. (2001): Integration of matrixassisted laser desorption ionizationtime of flight mass spectrometry and molecular cloning for the identification and functional characterization of mobile Pseudomonas aeruginosa strain JB2. Appl. Environ. Microbiol. 67: 56485655. Hickey, W.J.; Sabat, G.; Yuroff, A.S.; Arment, A.R. and Perez Lesher, J. (2001): Cloning, nucleotide sequencing, and functional analysis of a novel, mobile cluster of biodegradation genes from Pseudomonas aeruginosa strain JB2. Appl. Environ. Microbiol. 67: 46034609. Horvath, R.S. (1973): Enhancement of cometabolism of chlorobenzoates by the cosubstrate enrichment technique. Appl. Microbiol. 25:961963. Horvath, R.S. and Alexander, M. (1970): Cometabolism of mchlorobenzoate by an Arthrobacter. Appl. Microbiol. 20:254258. Hoyer, A.P.; Jorsensen, T.; Rank, F. and Grandjean, P. (2001): Organochlorine exposures influence on breast cancer risk and survival according to estrogen receptor status: a Danish cohortnested case control study. BMC Cancer 1:8 .

271 References

Hruska, K. S.; Furth, P.A.; Seifer, D.B.; Sharara, F. I. and Flaws, J.A. (2000): Environmental factors in infertility. Clin. Obstet. Gynecol. 43:821– 829. Hua, X. M. and Shan, Z. J. (1996): Production and application of pesticides and factors analysis of their pollution in environment in China. Adv. Environ. Sci. 4: 3345. Hung, D. Q. and Thiemann, W. (2002): Contamination by selected chlorinated pesticides in surface waters in Hanoi, Vietnam. Chemosphere 47:357–367. Huy, N. Q.; Jin, S.; Amada, K.; Harukl, M.; Huu, N. B.; Hang, D. T.; Camha, D.T.; Imanaka, T.; Morikawa, M. and Kanaya, S. (1999): Characterization of petroleumdegrading bacteria from oil contaminated sites in Vietnam. J. Biosci. Bioeng. 88: 100102. IARC, (1997): International Agency for Research on Cancer, Polychlorinated DibenzoparaDioxins and Polychlorinated Dibenzofurans. Summary of Data Reported and Evaluation. World Health Organization. Iscan, M.; Coban, T.; Cok, I.; Bulbul, D.; Eke, B.C. and Burgaz, S. (2002): The organochlorine pesticide residues and antioxidant enzyme activities in human breast tumors: is there any association? Breast Cancer Res. Treat. 72: 173–182. Jacobs, L.W.; O’Connor, G.A.; Overcash, M.R.; Zabik, M.J. and Rygiewicz, P. (1987): Effects of trace organics in sewage sludge on soilplant systems and assessing their risk to humans. In: Page, A.L., Logan, T.G., Ryan, J.A. (Eds.), Land Application of Sludge. Lewis Publisher, Chelsea, MI 101–143. Jacobson, J. L.; Jacobson, S.W. and Humphery, H. E. B. (1990 a): Effects of exposure to PCBs and related compounds on growth and activity in children. Neurotox. Teratol. 12:319326. Jacobson, J. L.; Jacobson, S.W. and Humphery, H. E. B. (1990 b): Effects of utero exposure to polychlorinated biphenyls and related contaminants on cognitive functioning in young children. J. Pediatrics.116:3845. Jayachandran, G.; Görish, H. and Adrian, L. (2003): Dehalorespiration with hexachlorobenzene and pentachlorobenzene by Dehalococcides sp. strain CBDB1. Arch. Microbiol. 180:411416. Jechorek, M.; Wendlandt, K.D. and Beck, M. (2003): Cometabolic degradation of chlorinated aromatic compounds. J. Biotechnol. 102: 93–98.

272 References

Jencova, V.; Strnad, H.; Chodora, Z.; Ulbrich, P.; Hickey, W.J. and Paces, V. (2004): Chlorocatechol catabolic enzymes from Achromobacter xylosoxidans A8. Int. Biodeterior. Biodegrad. 54: 175 – 181. Jencova, V.; Strnad, H.; Chodora, Z.; Ulbrich, P.; Vlcek, C.; Hickey, W.J. and Paces, V. (2008): Nucleotide sequence, organization and characterization of the (halo) aromatic acid catabolic plasmid pA81 from Achromobacter xylosoxidans A8. Res. Microbiol. 159: 118127. Jensen, J. (1996): Chlorophenols in the terrestrial environment. Rev. Environ. Contam. Toxicol. 146:25– 51. Jiang, X.; Martens, D.; Schramm, K.W.; Kettrup, A.; Xu, S.F. and Wang, L.S. (2000): Polychlorinated organic compounds (PCOCs) in waters, suspended solids and sediments of the Yangtse River. Chemosphere 41:901–905. Jimenez, J.I.; Minambres, B.; Garcia, J.L. and Diaz, E. (2002): Genomic analysis of the aromatic catabolic pathways from Pseudomonas putida KT2440. Environ. Microbiol. 4: 824–841. Johnson, A.C.; White, C. and Bhardwaj, C.L. (2000): Potential for isoproturon, atrazine and mecoprop to be degraded within a chalk aquifer system. J. Contam. Hydrol. 44: 1–18. Johnson, A.C.; Besien, T.J.; Bhardwaj, C.L.; Dixon, A.; Gooddy, D.C.; Haria, A.H. and White, C. (2001): Penetration of herbicides to groundwater in an unconfined chalk aquifer following normal soil applications. J. Contam. Hydrol. 53:101–117. Juhasz, A.L and Naidu, R. (2000): Enrichement and isolation of nonspecific aromatic degraders from unique uncontaminated (plant and faecal material) sources and contaminated soils. J. Appl. Microbiol. 89:642 650. Juhasz, A.; Stanley, G.A. and Britz, M.L. (2000): Degradation of high molecular weight PAHs in contaminated soil by a bacterial consortium: effects on Microtox and mutagenicity bioassays. Bioremed. J. 4: 271–283. Ka, J.O.; Holben, W.E. and Tiedje, J.M. (1994 a): Genetic and phenotypic diversity of 2,4dichlorophenoxyacetic acid (2,4D)degrading bacteria isolated from 2,4 D treated field soils. Appl. Environ. Microbiol. 60:1106 1115. Ka, J.O.; Holben, W.E. and Tiedje, J.M. (1994 b): Use of gene probe to aid in recovery and identification of functionally dominant 2,4 dichlorophenoxyacetic aciddegrading populations in soil. Appl. Environ. Microbiol. 60:11161120.

273 References

Kao, C.M.; Chai, C.T.; Liu, J.K.; Yeh, T.Y.; Chen, K.F. and Chen, S.C. (2004): Evaluation of natural and enhanced PCP biodegradation at a former pesticide manufacturing plant. Water Research 38:663672. Kasberg, T.; Daubaras, D.L.; Chakrabarty, A.M.; Kinzelt, D. and Reineke, W. (1995): Evidence that operons tcb , tfd , and clc encode maleylacetate reductase, the fourth enzyme of the modified ortho pathway. J. Bacteriol. 177: 38853889. Kaschabek, S.R. and Reineke, W. (1995): Maleylacetate reductase of Pseudomonas sp. strain B13: specificity of substrate conversion and halide elimination . J. Bacteriol. 1774: 320325. Kaschabek, S. R.; Kasberg, T.; Müller, D.; Mars, A. E.; Janssen, D.B. and Reineke, W. (1998): Degradation of chloroaromatics: purification and characterization of a novel type of chlorocatechol 2,3dioxygenase of Pseudomonas putida GJ31. J. Bacteriol. 180:296302. Kaschl, A.; Vogt, C.; Uhlig, S.; Nijenhuis, I.; Weiss, H. and Richnow, H.H. (2005): Isotopic fractionation indicates anaerobic monochlorobenzene biodegradation. Environ. Toxical. Chem. 24: 1315–1324. Katsoyiannis, A. (2006): Occurrence of polychlorinated biphenyls (PCBs) in the Soulou stream in the power generation area of Eordea, northwestern Greece. Chemosphere 65:1551–1561. Katsoyiannis, A. and Samara, C. (2004): Persistent organic pollutants (POPs) in the sewage treatment plant of Thessaloniki, northern Greece: Occurrence and removal. Water Res. 38: 2685–2698. Katsoyiannis, A. and Samara, C. (2005): Persistent organic pollutants (POPs) in the conventional activated sludge treatment process: fate and mass balance. Environ. Research 97: 245–257. Kaulmann, U.; Kaschabek, S. R. and Schlömann, M. (2001): Mechanism of chloride eliminaton from 3chloro and 2,4 dichloro cis, cis muconate: new insight obtained from analysis of muconate cycloisomerase variant CatBK169A. J. Bacteriol. 183:45514561. Kaushik , P. and Kaushik, G. (2007): An assessment of structure and toxicity correlation in organochlorine pesticides. J. Haz. Mat. 143: 102–111. Kennicutt, M.C. (1990): Oil spillage in Antarctica. Environ. Sci. Technol. 24: 620– 624. Kitagawa, W.; Miyauchi, K.; Masai, E. and Fukuda, M. (2001): Cloning and characterization of benzoate catabolic genes in the grampositive polychlorinated biphenyl degrader Rhodococcus sp. strain RHA1. J. Bacteriol. 183: 6598–6606.

274 References

Klages, U. and Lingens, F. (1979): Degradation of 4chlorobenzoic acid by a Nocardia sp. FEMS Microbiol. Lett. 6:201203. Klages, U. and Lingens, F. (1980): Degradation of 4chlorobenzoic acid by a Pseudomonas sp. Zb1. Bakt. Hyg. I. Abt. Orig. C1:215223. Klaassen, C.D. and Watkins, J.B. (1999): Casarett & Doull’s ToxicologyThe Basic Science of Poisons, 5th ed., MacGrawHill Publishing Company, New York. Klasson, K.T.; Barton, J.W.; Evans, B.S. and Reeves, M.E. (1996): Reductive microbial dechlorination of indigenous polychlorinated biphenyls in soil using sedimentfree inoculums. Biotechnol. Prog. 12: 310315. Koh, S. C.; McCullar, M.V. and Focht, D.D. (1997): Biodegradation of 2,4 dichlorophenol through a distal metafission pathway. Appl. Environ. Microbiol. 63: 2054–2057. Kolar, A.B.; Hršak, D.; Fingler, S.; Ćetkovic, H.; Petrić, I. and Kolic, N.U. (2007): PCPdegrading potential of aerobic bacteria enriched from marine sediments. Int. Biodeter. Biodeg. 60:1624. König, C.; Eulberg, D.; Groning, J.; Lakner, S.; Seibert, V. and Kaschabek, S.R. (2004): A linear megaplasmid, p1CP, carrying the genes for chlorocatechol catabolism of Rhodococcus opacus 1CP. Microbiol. 150: 3075–3087. Korrick, S. A.; Chen, C.; Damokosh, A. I.; Jialong, N.; Liu, X. and Cho, S.I.I. (2001): Association of DDT and spontaneous abortion. Ann. Epidemiol. 11:491–6. Krooneman, J.; Wieringa, E. B. A.; Moore, E. R. B.; Gerritse, J.; Prins, R.A. and Gottschal, J.C. (1996): Isolation of Alcaligenes sp. strain L6 at low oxygen concentrations and degradation of 3chlorobenzoate via a pathway not involving (chloro) catechols. Appl. Environ. Microbiol. 62:24272434. KrstevskaKonstantinova, M.; Charlier, C.; Craen, M.; Du Caju, M.; Heinrichs, C.; Beaufort, C.; Plomteux, G. and Bourguignon, J.P. (2001): Sexual precocity after immigration from developing countries to Belgium: evidence of previous exposure to organochlorine pesticides. Human Reprod. 16: 1020–1026. Kuhm, A.E.; Schlömann, N.; Knackmuss, H.J. and Pieper, D.H. (1990): Purification and characterization of dichloromuconate cycloisomerase from Alcaligenes eutrophus JMP134. Biochem. J. 266: 877883.

275 References

Kumar. S.; Gautam, A.K. and Saiyed, H.W. (2000): Occupational exposure and male reproductive dysfunction a growing concern. Indian J. Occup. Environ. Med. 4:89–94. Kumar, S.; Dudley, J.; Nei, M. and Tamura, K. (2008): MEGA: A biologist centric software for evolutionary analysis of DNA and protein sequences. Briefings in Bioinformatics 9: 299306 . Kunisue, T.; Someya, M.; Kayama, F.; Jin, Y. and Tanabe, S. (2004): Persistent organochlorines in human breast milk collected from primiparae in Dalian and Shenyang. China Environ. Pollut. 131:381–392. Kwon, S. K.; Dicke, W. and Thier, H. P. (1986): Pestizidrüeckstäende in drei Drogen aus Sudkorea. Planta Medica 155156. Laemmli, C.; Werlen, C. and van der Meer, J.R. (2004): Mutation analysis of the different tfd genes for degradation of chloroaromatic compounds in Ralstonia eutropha JMP134. Arch. Microbiol. 181:112121. Laemmli, C.M.; Schönenberger, R.; Suter, M. JF.; Zehnder, A.J.B. and van der Meer, J.R. (2002): TfdDII, one of the two chloromuconate cycloisomerases of Ralstonia eutopha JMP134 (pJP4), cannot efficiently convert 2chlorocis,cismuconate to trans dienelactone to allow growth on 3chlorobenzoate. Arch. Microbiol. 178:1325. Lal, R. and Saxena, D.M. (1982): Accumulation, metabolism and effects of organochlorine insecticides on microorganisms . Microbiol. Rev. 46:95–127. Larkin, M.J.; Kulakov, L.A. and Allen, C.C. (2005): Biodegradation and Rhodococcus masters of catabolic versatility. Curr. Opin. Biotechnol. 16: 282–290. Latifian, M.; HamidinEsfahani, Z. and Barzeger, M. (2007): Evaluation of culture conditions for cellulose production by two Trichoderma reesei mutants under solidstate fermentation conditions. Biores. Technol. 98:14. Lau, P.C.; Garnon, J.; Labbe, D. and Wang, Y. (1996): Location and sequence analysis of a 2hydroxy6oxo6phenylhexa2,4dienoate hydrolase encoding gene (bpdF) of the biphenyl/polychlorinated biphenyl degradation pathway in Rhodococcus sp. M5. Gene 171:53–57. Leahy, J.G. and Colwell, R.R. (1990): Microbial degradation of hydrocarbons in the environment. Microbiol. Rev. 54: 305–315.

276 References

Lee, C.L.; Song, H.J. and Fang, M.D. (2005): Pollution topography of chlorobenzenes and hexachlorobutadiene in sediments along the Kaohsiung coast, Taiwa – a comparison of two consecutive years´ surveys with statistical interpretation. Chemosphere 58: 1503–1516. Lee, K.; Tremblay, G.H. and Levy, E.M. (1993): Bioremediation: application of slowrelease fertilizers on lowenergy shorelines. Proceedings of the International Oil Spill Conference. Am. Petroleum Inst., Washington, DC, 449– 454. Lee, M.D. and Ward, C.H. (1985): Environmental and biological methods for the restoration of contaminated aquifers. Environ. Toxicol. Chem. 4: 743–750. Lee, P. Y. and Chen, C. Y. (2009): Toxicity and quantitative structure–activity relationships of benzoic acids to Pseudokirchneriella subcapitata . J. Haz. Mat. 165: 156–161 Lehning, A.; Fock, U.; Wittich, R.; Timmis, K.N. and Pieper, D.H. (1997): Metabolism of chlorotoluenes by Burkholderia sp. strain PS12 and toluene dioxygenase of Pseudomonas putida F1: Evidence for monooxygenation by toluene and chlorobenzene dioxygenases. Appl. Environ. Microbiol. 63: 1974–1979. Leigh, M.B.; Prouzová, P.; Macková, M.; Macek, T.; Nagle, D.P. and Fletcher, J.S. (2006): Polychlorinated biphenyl (PCB)degrading bacteria associated with trees in a PCBcontaminated site. Appl. Environ. Microbiol. 72 : 2331–2342. Leisinger, T. (1983): Microorganisms and xenobiotic compounds. Experientia 39:11831220. Leontievsky, A.A.; Myasoedova, N.M.; Baskunov, B.P.; Evans, C.S. and Golovleva, L.A. (2000): Transformation of 2,4,6trichlorophenol by the white rot fungi Panus tigrinus and Coriolus versicolor . Biodegradation 11: 331–340. Leveau, J.H.J. and van der Meer, J.R. (1996): The tfdR gene product can successfully take over the role of the insertion elementinactivated TfdT protein as a transcriptional activator of the tfdCDEF gene cluster, which encodes chlorocatechol degradation in Ralstonia eutropha JMP134 (pJP4). J. Bacteriol. 178:68246832. Li, L.A. (2007): Polychlorinated biphenyl exposure and CYP19 gene regulation in testicular and adrenocortical cell lines. Toxicol. Vitro 21:1087–1094.

277 References

Li, Y.F.; Cai, D.J. and Singh, A. (1998): Technical Hexachlorocyclohexane use trends in China and their impact on the environment. Arch. Environ. Contam. Toxicol. 35: 688697. Li, Y. F.; Cai, D. J. and Singh, A. (1999): Historical DDT use trend in China and usage data gridding with 1/4O by 1/6O longitude/latitude resolution. Adv Environ. Res. 2: 497506. Li, Y. F.; Cai, D. J.; Shan, Z. J. and Zhu, Z. L. (2001): Gridded usage inventories of technical hexachlorocyclohexane and lindane for China with 1/6O latitude by 1/4" longitude resolution. Arch. Environ. Contam. Toxicol. 41: 261266. Lindstrom, J.E. and Brown, E.J. (1989): Supplemental carbon use by microorganisms degrading toxic organic compounds and the concept of specific toxicity. Hazard. Waste Hazard. Meter. 6: 195200. Lino, C.M. and Silveira, M.I.N. (1998): Níveis de resíduos de pesticidas organoclorados no Homem: IIISangue. Rev. Port. Farm. 48:143–148. Lino, C.M. and Silveira, M.I.N. (2006): Evaluation of organochlorine pesticides in serum from students in Coimbra, Portugal: 1997–2001. Environ. Research 102: 339–351. Literathy, P. (1993): Considerations for the assessment of environmental consequences of the 1991 Gulf War. Mar. Pollut. Bull. 27: 349356. Liu, S.; Ogawa, N. and Miyashita, K. (2001): The chlorocatechol degradative genes, tfdTCDEF , of Burkholderia sp. strain NK8 are involved in chlorobenzoate degradation and induced by chlorobenzoates and chlorocatechols. Gene 268: 207214. Lowengart, R.A.; Peters, J.M.; Cicioni, C.; Buckley, J.; Bernstein, L. and PrestonMartin, S. (1987): Childhood leukemia and parents occupational and home exposures. J. Natl. Cancer Inst. 79:3946. Lowry, H.; Rosebrough, N.J.; Farr, A.L. and Randall, R.J. (1951): Protein measurement with the folin phenol reagent. J. Biol. Chem. 193:265275 Mackova´, M.; Vrchotova´, B.; Francova´, K.; Sylvestre, M.; Tomaniova´, M.; Lovecka´, P.; Demnerova´, K. and Macek, T. (2007): Biotransformation of PCBs by plants and bacteria consequences of plant microbe interactions. Europ. J. Soil Biol. 43: 233241. Mae, A.A.; Marits, R.O.; Ausmees, N.R.; Koiv, V.M. and Heinaru, A.L. (1993): Characterization of a new 2,4dichlorophenoxyacetic acid degrading plasmid pEST4011: physical map and localization of catabolic genes. J. Gen. Microbiol. 139: 31653170.

278 References

Maeda, M.; Chung, S.Y.; Song, E. and Kudo, T. (1995): Multiple genes encoding 2,3dihydroxybiphenyl 1,2 dioxygenase in the grampositive polychlorinated biphenyldegrading bacterium Rhodococcus erythropolis TA421, isolated from a termite ecosystem. Appl. Environ. Microbiol. 61:549–555. Männisto, M.K.; SalkinojaSalonen, M.S. and Puhakka, J.A. (2001): In situ polychlorophenol bioremediation potential of the indigenous bacterial community of boreal groundwater. Wat. Res. 35:24962504. Manoli, E. and Samara, C. (1999): Occurrence and mass balance of polycyclic aromatic hydrocarbons in the Thessaloniki sewage treatment plant. J. Environ. Qual. 28: 176–187. MarcoUrrea, E.; PérezTrujillo, M.; Caminal, G. and Vicent, T. (2009): Dechlorination of 1,2,3 and 1,2,4trichlorobenzene by the whiterot fungus Trametes versicolor. J. Hazard. Mat. 166: 1141–1147. Margesin, R. and Schinner, F. (1997): Efficiency of indigenous and inoculated coldadapted soil microorganisms for biodegradation of diesel oil in Alpine soils. Appl. Environ. Microbial. 63: 26602664. Marks, T.S.; Smith, A.R.W. and Quirk, A.V. (1984): Degradation of 4 chlorobenzoic acid by Arthrobacter sp. strain TM1. Appl. Environ. Microbiol. 48:10201025. Marinucci, A. C. and Bartha, R. (1979): Biodegradation of 1,2,3 and 1,2,4 trichlorobenzene in soil and in liquid enrichment culture. Appl. Environ. Microbiol. 38:811817. Mars, A.E.; Kingma, J.; Kaschabek, S.R.; Reineke, W. and Janssen, D.B. (1999): Conversion of 3chlorocatechol by various catechol 2,3 dioxygenases and sequence analysis of the chlorocatechol dioxygenase region of Pseudomonas putida GJ31. J. Bacteriol. 181: 1309–1318. Mars, A.E.; Kasberg, T.; Kaschabek, S.R.; van Agteren, M.H.; Janssen, D.B. and Reineke, W. (1997): Microbial degradation of chloroaromatics: use of the metacleavage pathway for mineralization of chlorobenzene. J. Bacteriol. 179: 4530–4537. Martin, P.A.W.; Lohr, J.R. and Dean, D.H. (1981): Transformation of Bacillus thuringiensis protoplasts by plasmid deoxyribonucleic acid. J. Bacteriol. 145: 980983.

279 References

Martínková, L.; Uhnáková, B.; Pátek, M.; Nešvera, J. and Křen, V. (2009): Biodegradation potential of the genus Rhodococcus. Environ. Int. 35: 162–177. Masai, E.; Yamada, A.; Healy, J.M.; Hatta, T.; Kimbara, K. and Fukuda, M. (1995): Characterization of biphenyl catabolic genes of grampositive polychlorinated biphenyl degrader Rhodococcus sp. strain RHA1. Appl. Environ. Microbiol. 61:2079–85. Massè, R.; Messier, F.; Pèloquin, L.; Ayotté, C. and Sylvestre, M. (1984): Microbial biodegradation of 4chlorobiphenyl, a model compound of chlorinated biphenyls. Appl. Environ. Microbiol. 47:947951. Master, E.R. and Mohn, W.W. (2001): Induction of bphA , encoding biphenyl dioxygenase, in two polychlorinated biphenyldegrading bacteria, psychrotolerant Pseudomona strain Cam1 and mesophilic Burkholderia strain LB400. Appl. Environ. Microbiol. 67:2669–2676. Master, E.R.; McKinlay, J.J.; Stewart, G.R. and Mohn, W.W. (2005): Biphenyl uptake by psychrotolerant Pseudomonas sp. strain Cam1 and mesophilic Burkholderia sp. strain LB400. Canad. J. Microbiol. 51: 399–404. McFall, S.M.; Chugani, S.A. and Chakrabarty, A.M. (1998): Transcriptional activation of the catechol and chlorocatechol operons: variations on a theme. Gene 223: 257–267. McKay, D.B.; Seeger, M.; Zielinski, M.; Hofer, B. and Timmis, K.N. (1997): Heterologous expression of biphenyl dioxygenaseencoding genes from a grampositive broadspectrum polychlorinated biphenyl degrader and characterization of chlorobiphenyl oxidation by the gene products. J. Bacteriol. 179: 1924–1930. McLeod, M.P.; Warren, R.L.; Hsiao, W.W.; Araki, N.; Myhre, M. and Fernandes, C. (2006): The complete genome of Rhodococcus sp. RHA1 provides insights into a catabolic powerhouse. Proc. Natl. Acad. Sci. USA 103: 15582–15587. Miglioranza, K.S.B.; Moreno, J.E.A. and Moreno, V.J. (2003): Dynamics of organochlorine pesticides in soils from a southeastern region of Argentina. J. Environ. Toxicol. Chem. 22: 712–717. Moeder, M.; Cajthaml, T.; Koeller, G.; Erbanová, P. and Sâsêk, V. (2005): Structure selectivity in degradation and translocation of polychlorinated biphenyls (Delor 103) with a Pleurotus ostreatus (oyster mushroom) culture. Chemosphere 61:1370–1378.

280 References

Moiseeva, O.V.; Solyanikova, I.P.; Kaschabek, S.R.; Groning, J. and Thiel, M. Golovleva, L.A. (2002): A new modified ortho cleavage pathway of 3chlorocatechol degradation by Rhodococcus opacus 1CP: genetic and biochemical evidence. J. Bacteriol. 184: 5282–5292. Monferrán, M.V.; Echenique, J.R. and Wunderlin, D.A. (2005): Degradation of chlorobenzenes by a strain of Acidovorax avenae isolated from a polluted aquifer. Chemosphere 61: 98–106. Montone, R.C.; Taniguchi, S. and Weber, R.R. (2001): Polychlorinated biphenyls in marine sediments of Admiralty Bay, King George Island, Antarctica. Mar. Pollut. Bull. 42: 611614. Mouvet, C.; Jeannot, R.; Riolland, H. and Maciag, C. (1997): Stability of isoproturon, bentazone, terbuthylazine and alachlor in natural groundwater, surface water and soil water samples stored under laboratory conditions. Chemosphere 35: 1083–1097. Mrozik, A. and PiotrowskaSeget, Z. (2010): Bioaugmentation as a strategy for cleaning up of soils contaminated with aromatic compounds. Microbiol. Res. 165:363375. Muccini, M.; Layton, A.C.; Sayler, G.S. and Schultz, T.W. (1999): Aquatic toxicities of halogenated benzoic acids to Tetrahymena pyriformis . Bull. Environ. Contam. Toxicol. 62: 616–622. Müller, R.; Oltmanns, R.H. and Lingens, F. (1988): Enzymatic dehalogenation of 4chlorobenzoate by extracts from Arthrobacter sp. strain SUDSM20407. Biol. Chem. HoppeSeyler. 369:567571. Müller, R.; Thiele, J.; Klages, U. and Lingens, F. (1984): Incorporation of [ 18 O] water into 4hydroxybenzoic acid in the reaction of 4chlorobenzoate dehalogenase from Pseudomonas sp. strain CBS3. Biochem. Biophys. Res. Commun. 124:178182. Murakami, S.; Kohsaka, C.; Okuno, T.; Takenaka, S. and Aoki, K. (2004): Purification, characterization, and gene cloning of cis,cis muconate cycloisomerase from benzamideassimilating Arthrobacter sp. BA5 17. FEMS Microbiol. Lett. 231:119124. Murakami, S.; Takashima, A.; Takenaka, S.; Takemoto, J.; Shinke, R. and Aoki, K. (1999): Cloning and sequence analysis of two catechol degrading gene clusters from the anilineassimilating bacterium Frateuria species ANA18. Gene 226:189198.

281 References

Murandi, F.S.; Tóe, A.; Guyod, J.L.B.; Steiman, R. and Kadri, M. (1995): Depletion of pentachlorophenol by deuteromycetes isolated from soil. Chemosphere 31:2677–2686. Muscat, J.E.; Britton, J.A.; Djordjevic, M.V.; Citron, M.L.; Kemeny, M.; BuschDevereaux, E.; Pittman, B. and Stellman, S.D. (2003): Adipose concentrations of organochlorine compounds and breast cancer recurrence in Long Island, New York. Cancer Epidemiol. Biomarker Prev. 12: 1474–1478. Myneni, S. C. B. (2002): Formation of stable chlorinated hydrocarbons in weathering plant material. Science 295:10391041. Na, Y.C.; Kim, K. J.; Hong, J. and Seo, J. J. (2008): Determination of polychlorinated biphenyls in transformer oil using various adsorbents for solid phase extraction. Chemosphere 73: S7–S12. Nawab, A.; Aleem, A. and Malik A. (2003): Determination of organochlorine pesticides in agricultural soil with special reference to cHCH degradation by Pseudomonas strains. Bioresour. Technol. 88: 41–46. Nicholas, R.B. (1987): Biotechnology in hazardouswaste disposal: an unfulfilled promise. Am. Soc. Microbiol. News 53:138–142. Nigam, U. and Siddiqui, M.K.J. (2001): Organochlorine insecticide residues in dairy milk samples collected in Lucknow, India. Bull. Environ. Contam. Toxicol. 66:678–682. Nishino, S.F.; Spain, J.C.; Belcher, L.A. and Lichfield, C.D. (1992): Chlorobenzene degradation by bacteria isolated from contaminated groundwater. Appl. Environ. Microbiol. 58:17191726. Nowak, J.; Kirsch, N.H.; Hegemann, W. and Stan, H.J. (1996): Total reductive dechlorination of chlorobenzenesto benzene by methanogenic mixed culture enriched from Saale river sediment. Appl. Microbiol. Biotechnol. 45:700709. Ogawa, N. and Miyashita, K. (1995): Recombination of a 3chlorobenzoate catabolic plasmid from Alcaligenes eutrophus NH9 mediated by direct repeat elements. Appl. Environ. Microbiol. 61:37883795. Ogawa, N. and Miyashita, K. (1999): The chlorocatecholcatabolic transposon Tn5707 of Alcaligenes eutrophus NH9, carrying a gene bacterium Pseudomonas sp. strain P51, confers the ability to grow on 3chlorobenzoate. Appl. Environ. Microbiol. 65 : 724731.

282 References

Ogawa, N.; McFall, S.M.; Klem, T.J.; Miyashita, K. and Chakrabarty, A.M. (1999): Transcriptional activation of the chlorocatechol degradative genes of Ralstonia eutropha NH9. J. Bacteriol. 181: 6697–705. Ohtsubo, Y.; Goto, H.; Nagata, Y.; Kudo, T. and Tsuda, M. (2006): Identification of a response regulator gene for catabolite control from a PCBdegrading betaproteobacteria, Acidovorax sp. KKS102. Molec. Microbiol. 60: 1563–1575. Olaniran, A. O.; Babalola, G. O. and Okoh, A. I. (2001): Aerobic dehalogenation potentials of four bacterial species isolated from soil and sewage sludge. Chemosphere 45:4550. O’Leary, E.S.; Vena, J.E.; Freudenheim, J.L.; Brasure, J. (2004): Pesticide exposure and risk of breast cancer: a nested casecontrol study of residentially stable women living on Long Island. Environ. Res. 94:134–144. Oliver, R.; May, E. and Williams, J. (2005): The occurrence and removal of phthalates in a trickle filter STW. Water Res. 39:4436–4444. Oltmanns, R.H.; Rast, H.G. and Reineke, W. (1988): Degradation of 1,4 dichlorobenzene by enriched and constructed bacteria. Appl. Microbiol. Biotechnol. 28:609–616. Önneby, K.; Jonsson, A. and Stenström, J. (2010): A new concept for reduction of diffuse contamination by simultaneous application of pesticide and pesticidedegrading microorganisms. Biodegradation 21:2129. Oskam, I.C.; Lyche, J.L.; Krogenaes, A.; Thomassen, R.; Skaare, J.U.; Wiger, R.; Dahl, E.; Sweeney, T.; Stien, A. and Ropstad, E. (2005): Effects of longterm maternal exposure to low doses of PCB126 and PCB153 on the reproductive system and related hormones of young male goats. Reprod. 130: 731–742. Oteyza, T.G. and Grimalt, J.O. (2006): GC and GCMS characterization of crude oil transformation in sediments and microbial mat samples after the 1991 oil spill in the Saudi Arabian Gulf coast. Grimalt Environ. Poll. 139: 523531. Pant, N.; Mathur, N.; Banerjee, A.K.; Srivastava, S.P. and Saxena, D.K. (2004): Correlation of chlorinated pesticides concentration in semen with seminal vesicle and prostatic markers. Reprod. Toxicol. 19:209–214. Pant, N.; Kumar, R.; Mathur, N.; Srivastava, S.P.; Saxena , D.K. and Gujrati, V.R. (2007): Chlorinated pesticide concentration in semen of fertile and infertile men and correlation with sperm quality. Environ. Toxicol. Pharmacol. 23: 135–139.

283 References

Parnell, J.J.; Denef, V.J.; Park, J.; Tsoi, T. and Tiedje, J.M. (2010): Environmentally relevant parameters affecting PCB degradation: carbon source and growth phasemitigated effects of the expression of the biphenyl pathway and associated genes in Burkholderia xenovorans LB400. Biodegradation 21:147156. PastiGrigsby, M.B.; Paszczynski, A.; Goszczynski, S.; Crawford, D.L. and Crawford, R.L. (1992): Influence of aromatic substitution patterns on azo dyes degradation by Streptomyces spp . and Phanerochaete chrysosporium . Appl. Environ. Microbiol. 58: 36053613. Patureau, D. and Trably, E. (2006): Impact of anaerobic and aerobic processes on polychlorobiphenyl removal in contaminated sewage sludge. Biodegradation 17: 9–17. Pavlostathis, S.G. and Prytula, M.T. (2000): Kinetics of the sequential microbial reductive dechlorination of hexachlorobenzene. Environ. Sci. Technol. 34:40014009. Pavlů, L.; Vosáhlova, J.; Klierová, H.; Prouza, M.; Demnerová, K. and Brenner, V. (1999): Characterization of chlorobenzoate degraders isolated from polychlorinated biphenylcontaminated soil and sediment in the Czech Republic. J. Appl. Microbiol. 87:381386. Pepper, I.L.; Gentry, T.J.; Neweby, D.T.; Roane, T.M. and Josephon, K.L. (2002): The role of cell bioaugmentation and gene bioaugmentation in the remediation of cocontaminated soils. Environ. Health Perspect. 110:943946. PeraTitus, M.; GarciaMolina, V.; Banos, M.A.; Gimenez, J. and Esplugas, S. (2004): Degradation of chlorophenols by means of advanced oxidation processes: a general review. Appl. Catal. B Environ. 47: 219–256. Perez, S.; Guillamon, M. and Barcelo, D. (2001): Quantitative analysis of polycyclic aromatic hydrocarbons in sewage sludge from wastewater treatment plants. J. Chromatogr. A 938: 57–65. PérezMaldonado, I. N.; DiazBarriga, F.; Fuente, H.; GonzálezAmaro, R.; Calderon, J. and Yanez, L. (2004): DDT induces apoptosis in human mononuclear cells in vitro and is associated with increased apoptosis in exposed children. Environ. Res. 94:3846. PérezPantoja, D.; Ledger, T.; Pieper, D.H. and González, B. (2003): Efficient turnover of chlorocatechols is essential for growth of Ralstonia eutropha JMP134 (pJP4) in 3chlorobenzoic acid. J. Bacteriol. 185: 15341542.

284 References

Perkins, E.J.; Gordon, M.P.; Caceres, O. and Lurquin, P.F. (1990): Organization and sequence analysis of the 2,4dichlorophenol hydroxylase and dichlorocatechol oxidative operons of plasmid pJP4. J. Bacteriol. 172: 23512359. Pflieger, B.S. and Schill, W.B. (2000): Effects of chlorinated hydrocarbons on sperm function in vitro. Andrologia 32: 311315. Pieper, D.H. (2005): Aerobic degradation of polychlorinated biphenyls. Appl. Microbiol. Biotechnol. 67: 170–191. Pieper, D. H.; dos Santos, A. P. M. and Golyshin, P. N. (2004): Genomic and mechanistic insights into the biodegradation of organic pollutants. Curr. Opin. Biotechnol. 15: 215–224. Pieper, D.H.; Knackmuss, HJ. and Timmis, K.N. (1993): Accumulation of 2 chloromuconate during metabolism of 3chlorobenzoate by Alcaligenes eutrophus JMP134. Appl. Microbiol. Biotechnol. 39: 563–567. Pieper, D.H.; Reineke, W.; Engesser, KH. and Knackmuss, HJ. (1988): Metabolism of 2,4dichlorophenoxyacetic acid, 4chloro2 methylphenoxyacetic acid and 2methylphenoxyacetic acid by Alcaligenes eutrophus JMP134. Arch. Microbiol. 150: 95–102. Pieper, D.H.; Pollmann, K.; Nikodem, P.; González, B. and Wray, V. (2002): Monitoring key reactions in degradation of chloroaromatics by in situ 1H nuclear magnetic resonance: solution structures of metabolites formed from cis dienelactone. J. Bacteriol. 184:14661470. Pollmann, K.; Wray, V. and Pieper, D.H. (2005): Chloromethylmuconolactones as critical metabolites in the degradation of chloromethylcatechols: recalcitrance of 2chlorotoluene. J. Bacteriol. 187: 2332–2340. Popp, P.; Brueggemann, L.; Keil, P.; Thus, U. and Weis, H. (2000): Chlorobenzenes and hexachlorocyclohexanes (HCHs) in the atmosphere of Bitterfeld and Leipzig (Germany). Chemosphere 41: 849–855. Potrawfke, T.; Armengaud, J. and Wittich, R. M. (2001): Chlorocatechols substituted at positions 4 and 5 are substrates of the broadspectrum chlorocatechol 1,2dioxygenase of Pseudomonas chlororaphis RW71. J. Bacteriol. 183: 997–1011. Potrawfke, T.; Timmis, K.N. and Wittich, R.M. (1998): Degradation of 1,2,3,4 tetrachlorobenzene by Pseudomonas chlororaphis RW71. Appl. Environ. Microbiol. 64: 3798–3806.

285 References

Powell, S. M.; Snapeb, I.; Bowman, J.P.; Thompson, B. A.W.; Stark, J.S.; McCammon, S.A. and Riddle, M.J. (2005): A comparison of the short term effects of diesel fuel and lubricant oils on Antarctic benthic microbial communities. J. Exp. Marine Biol. Ecol. 322: 53–65. Plumeier, I.; PérezPantoja, D.; Heim, S.; González, B. and Pieper, D.H. (2002): Importance of different tfd genes for degradation of chloroatomatics by Ralstonia eutropha JMP134 (pJP4) on 3chlorobenzoate. J. Bacteriol. 184: 4054–4064. Pluta, J. (1988): Studies on contamination of vegetable drugs with halogen derivative pesticides. Part 1: Changes of concentrations of halogen derivatives in herbal raw materials within the period of 19801984. Part 2: Concentrations of halogen derivatives pesticides in vegetable blends and herbal granulated products produced in Poland in 19801984. J. Pharmazie 43 (H.2): 121123, (H.5):348351. Pritchard P.H.; O'Neill E.J.; Spain C.M. and Ahern D.J. (1987): Physical and biological parameters that determine the fate of pchlorophenol in laboratory test systems. Appl. Environ. Microbiol. 53:18331838. Prytula, M.T. and Pavlostathis, S.G. (1996): Effect of contaminant and organic matter bioavailability on the microbial dehalogenation of sediment bound chlorobenzenes. Wat. Res. 30:26692680. Qiu, C. and Cai, M. (2010): Ultra trace analysis of 17 organochlorine pesticides in water samples from the Arctic based on the combination of solidphase extraction and headspace solidphase microextractiongas chromatographyelectroncapture detector. J. Chromatogr. A. 1217:11911202. Radomski, J.L.; Astolfi, E.; Deichmann, W.M.B. and Rey, A.A. (1971): Blood levels of organochlorine pesticides in Argentina: occupationally and nonoccupationally exposed adults, children and newborn infants. Toxicol. Appl. Pharmacol. 20:186–193. Ragon, W.J.; Gladen, B.C.; Mckinney, J.D.; Carreras, N.; Hardy, P.; Thullen, J.; Tinglestad, J. and Tully, M. (1986): Neonatal effects of transplacental exposure to PCBs and DDE. J. Pediatr. 8: 335341. Rahman, K.S.M.; ThahiraRahman, J.; Kourkoutas, Y.; Petsas, I.; Marchant, R. and Banat, I.M. (2003): Enhanced bioremediation of nalkanes in petroleum sludge using bacterial consortium amended with rhamnolipid and micronutrients. Bioresour. Technol. 90: 159–168.

286 References

Raizada, R.B. (1996): Organochlorine pesticide residues in environmental component, food material and human tissue. Paper presented at International seminar on problems of monitoring the pesticide residues in exportable commodities, viz. rice, tea, fish and minor crops. Colombo, Sri Lanka. Rajoka, M.I. (2005): Double mutants of Cellulomonas biazotea for production of cellulases and hemicellulases following growth on straw of a perennial grass. World J. Microbiol. Biotechnol. 21:10631066. Ramanand, K.; Balba, M.T. and Duffy, J. (1993): Reductive dehalogenation of chlorinated benzenes and toluenes under methanogenic conditions. Appl. Environ. Microbio. 59:32663272. Rapp, P. (2001): Multiphasic kinetics of transformation of 1,2,4trichlorobenzene at nano and micromolar concentrations by Burkholderia sp. strain PS14. Appl. Environ. Microbiol. 67:3496–3500. Rapp, P. and GabrielJürgens, L.H.E. (2003): Degradation of alkanes and highly chlorinated benzenes, and production of biosurfactants, by a psychrophilic Rhodococcus sp. and genetic characterization of its chlorobenzene dioxygenase. Microbiol. 149: 2879–2890. Rapp, P. and Timmis, K.N. (1999): Degradation of cholorobenzenes at nanomolar concentrations by Burkholderia sp. strain PS14 in liquid cultures and in soil. Appl. Environ. Microbiol. 65:2547–2552. Rathore, M.; Bhatnagar, P.; Mathur, D. and Saxena, G.N. (2002): Burden of organochlorine pesticides in blood and its effects on thyroid hormones in women. Sci. Total Environ. 295: 207–215. Rea, W.J. (1996): Pesticides. J. Nutrit. Environ. Med. 6:55124. Readman, J.W.; Fowler, S.W.; Villeneuve, J.P.; Cattini, C.; Oregioni, B. and Mee, L.D. (1992): Oil and combustionproduct contamination of the Gulf marine environment following the war. Nature 358: 662665. Rehfuss, M. and Urban, J. (2005): Rhodococcus phenolicus sp. nov., a novel bioprocessor isolated actinomycete with the ability to degrade chlorobenzene, dichlorobenzene and phenol as sole carbon sources. Syst. Appl. Microbiol. 28: 695–701. Reineke, W. (1998): Development of hybrid strains for the mineralization of chloroaromatics by patchwork assembly. Annu. Rev. Microbiol. 52: 287–331.

287 References

Reineke, W. and Knackmuss, H.J. (1980): Hybrid pathway for chlorobenzoate metabolism in Pseudomonas sp. B13 derivatives. J. Bacteriol. 142: 467473. Reineke, W. and Knachmuss, H.J. (1988): Microbial degradation of haloaromatics. Annu. Rev. Microbiol. 42: 263–287. Reynolds, P.; Hurley, S. E.; Goldberg, D. E..; Yerabati, S.; Gunier, R. B.; Hertz, A.; AntonCulver, H.; Bernstein, L.; Deapen, D.; Horn Ross, P.. L.; Peel, D.; Pinder, R.; Ross, R. K.; West, D.; Wright, W. E. and Ziogas, A. (2004): Residential proximity to agricultural pesticide use and incidence of breast cancer in California teachers study cohort. Environ. Res. 96:206218. Ribes, A. and Grimalt, J. O. (2002): Temperature and organic matter dependence of the distribution of organochlorine compounds in mountain soils from the subtropical Atlantic (Teide, Tenerife Island). J. Environ. Sci. Technol. 36: 821–827. Richard, J.Y. and Vogel, T.M. (1999): Characterization of a soil bacterial consortium capable of degrading diesel fuel. Int. Biodeterior. Biodegrad. 44: 93–100. Rieger, P.G.; Meier, H.M.; Gerle, M.; Vogt, U.; Groth, T. and Knackmuss, H.J. (2002): Xenobiotics in the environment: present and future strategies to obviate the problem of biological persistence. J. Biotechnol. 94: 101– 123. Rissato, S.R.; Galhiane, M.S.; Ximenes, V.F.; de Andrade, R. M.B.; Talamoni, J.L.B.; Libânio, M.; de Almeida; M.V.; Apon, B.M. and Cavalari, A.A. (2006): Organochlorine pesticides and polychlorinated biphenyls in soil and water samples in the Northeastern part of São Paulo State, Brazil. Chemosphere 65: 1949–1958. Rodrigues, G.S. (1997): In: Libro Verde – Elementos para una politica agroambiental en el Cono Sur. Programa cooperativo para el desarrollo Tecnologico Agropecuario del Cono Sur – PROCISUR–Subprograma Recursos Naturales y Sostenibilidad Agrícola. Instituto Interamericano de Cooperación para la Agricultura, Montevideo, Uruguay. RojasAvelizapa, N.G.; MartinezCruz, J.; Lis, J. and RodriguezVazquez, R. (2003): Levels of polychlorinated biphenyls in Mexican soils and their biodegradation using bioaugmentation. Bull. Environ.Contam. Toxicol. 70: 63–70.

288 References

Romanov, V. and Hausinger, R. P. (1994): Pseudomonas aeruginosa 142 uses a threecomponent orthohalobenzoate 1,2dioxygenase for metabolism of 2,4dichloro and 2 chlorobenzoate. J. Bacteriol. 176: 33683374. Ronen, Z.; Vasiluk, L.; Abeliovich, A. and Nejidat, A. (2000): Activity and survival of tribromophenoldegrading bacteria in a contaminated desert soil. Soil Biol. Biochem. 32: 16431650. Rupa, D.S.; Reddy, P.P. and Reddy, O.S. (1991): Reproductive performance in population exposed to pesticides in cotton fields in India. Environ. Res. 55:123. Rybkina, D.O.; Plotnikova, E.G.; Dorofeeva, L.V.; Mironenko, Y.L. and Demakov, V.A. (2003): A new aerobic grampositive bacterium with a unique ability to degrade ortho and parachlorinated biphenyls. Microbiol. 72: 672–677. Saagua, M.C.; Vieira, G.; Paveia, H. and Anselmo, A. (1998): Isolation and preliminary characterization of Bacillus sp. MCS, a grampositive 4 chlorobiphenyl degrading bacterium. Int. Biodeterior. Biodegrad. 42 : 39–43. Safe, S. (2000): Endocrine disruptors and human healthis there a problem? An update. Environ. Health Perspect. 108:487493. Sahu, S.K.; Patnaik, K.K. and Sethunathan, N. (1992): Dehydrochlorination of Disomer of hexachlorohexane by a soil bacterium Pseudomonas sp. Bull. Environ. Contam. Toxicol. 48: 265–268. Sambrook, J. and Russel, D.W. (2001): Molecular Cloning: A aboratory Manual 3rd Ed. cold Spring Harbor Laboratory Press. Cold spring Harbor. NY. Samia, E.K.; Rashed, M.M. and Zayed, M.A. (2000): Monitoring of the pesticide levels in some water supplies and agricultural land, in El Haram, Giza (A.R.E). Hazard. Waste Hazard. Mat. 72: 11–21. Sander, P.; Wittich, R.M.; Fortnagel, P.; Wilkes, H. and Francke, W. (1991): Degradation of 1,2,4tricholoro and 1,2,4,5tetrachlorobenzene by Pseudomonas strains. Appl. Environ. Microbiol. 57: 1430–1440. Sanford, R.A. and Tiedje, J.M. (1997): Chlorophenol dechlorination and subsequent degradation in denitrifying microcosm fed low concentrations of nitrate. Biodegradation. 7:425434. Sarkar, S.K.; Bhattacharya, B.D.; Bhattacharya, A.; Chatterjee, M.; Alam, A.; Satpathy, K.K. and Jonathan, M.P. (2008): Occurrence, distribution and possible sources of organochlorine pesticide residues in tropical coastal environment of India: An overview. Environ. Int. 34: 1062–1071. 289 References

Sauer, T.C.; Michel, J.; Hayes, M.O. and Aurand, D.V. (1998): Hydrocarbon characterization and weathering of oiled intertidal sediments along the Saudi Arabian coast two years after the Gulf War oil spill. Environ. Int. 24: 4360. Sauer, T.C.; Brown, J.S.; Boehm, P.D.; Aurand, D.V.; Michel, J. and Hayes, M.O. (1993): Hydrocarbon source identification and weathering characterization of intertidal and subtidal sediments along the Saudi Arabian coast after the Gulf War oil spill. Mar. Pollut. Bull. 27: 117 134. Savard, P.; Péloquin, L. and Sylvestre, M. (1986): Cloning of Pseudomonas sp. strain CBS3 genes specifying dehlogenation of 4chlorobenzoate. J. Bacteriol 168: 8185. Saxena, M.C.; Siddiqui, M.K.J.; Seth, T.D.; Krishna Murti, C.R.; Bhargava, A.K. and Kutty, D. (1981): Organochlorine pesticides in specimens from women undergoing spontaneous abortion, premature or fullterm delivery. J. Anal. Toxicol. 5: 6–9. Schilcher, H. (1985): Ruckstandbelastung von Drogen und Drogenzubereitungen. Dtsch. A. poth. Ztg. 125: 4752. Schliephake, K.; Mainwaring, D.E.; Lonergan, G.T.; Jones, I.K. and Baker, W.L. (2000): Transformation and degradation of the disazo dye Chicago sky blue by a purified laccase from Pycnoporus cinnabarinus . Enzyme Microb. Technol. 27: 100107. Schlömann, M. (1994): Evolution of chlorocatechol catabolic pathways. Conclusions to be drawn from comparisons of lactone hydrolases. Biodegradation 5: 301321. Schlömann, M. (2002): Two Chlorocatechol Catabolic Gene Modules on plasmid pJP4. J. Bacteriol. 184: 40494053. Schmidt, E. and Knackmuss, H.J. (1980): Chemical structure and biodegradability of halogenated aromatic compounds: conversion of chlorinated muconic acids into maleoylacetic acid. Biochem. J. 192: 339347. Schöler, H.F.; Nkusi, G.; Niedan, V.W.; Müller, G.; Spitthoff, B. (2005): Screening of organic halogens and identification of chlorinated benzoic acids in carbonaceous meteorites. Chemosphere 60:15051512. Schraa, G.; Boone, M.L.; Jetten, M.S.M.; van Neerven, A.R.W.; Colberg, P.J. and Zehnder, A.J.B. (1986): Degradation of 1,4dichlorobenzene by Alcaligenes sp. strain A175. Appl. Environ. Microbiol. 52: 1374– 1381.

290 References

Schroll, R.; Brahushi, F.; Dörfler , U.; Kühn, S.; Fekete, J. and Munch, J.C. (2004): Biomineralisation of 1,2,4trichlorobenzene in soils by an adapted microbial population. Environ. Pollut. 127: 395–401. Sedarati, M.R.; Keshavarz, T.; Leontievsky, A.A. and Evans, C.S. (2003): Transformation of high concentrations of chlorophenols by the white rot basidiomycete Trametes versicolor immobilized on nylon mesh. Electr. J. Biotechnol. 6:104–114. Seeger, M.; Timmis, K.N.; Hofer, B. (1997): Bacterial pathways for the degradation of polychlorinated biphenyls. Marine Chem. 58: 327–333. Seklemova, E.; Pavlova, A. and Kovacheva, K. (2001): Biostimulation based bioremediation of diesel fuel: field demonstration. Biodegradation 12: 311–316. Shah, S. and Thakur, I.S. (2002): Enrichement and characterization of a microbial community from tannery effluent for degradation of pentachlorophenol. World J. Microbiol. Biotechnol. 18:693698. Shaw, D.G. (1992): The Exxonvaldez oilspillecology and social consequences. Environ. Conserv. 19: 253–258. Shelton, D.R. and Karns, J.S. (1998): Pesticide bioremediation: genetic and ecological considerations. In: Kearnly, P., Roberts, T. (Eds.), Pesticide Remediation in Soils and Water. John Wiley and Sons. Shen, L.; Wania, F.; Lei, Y.D.; Teixeira, C.; Muir, D.C.G. and Bidleman, T.F. (2005): Atmospheric distribution and longrange transport behavior of organochlorine pesticides in North America. Environ. Sci. Tech. 39:409–420. Shimao, M.; Onishi, S.; Mizumori, S.; Kato, N. and Sakazawa, C. (1989): Degradation of 4chlorobenzoate by facultatviely alkalophilic Arthrobacter sp. strain SB8. Appl. Environ. Microbiol. 55:478482. Siddiqui, J.; Srivastava, S.; Srivastava, P.; Mehrotra, K.; Mathur, N. and Tandon, P. (2003): Persistent chlorinated pesticides and intrauterine foetal growth retardation: a possible association. Int. Arch. Occup. Environ. Health 76:75–80. Siddiqui, M.K.J.; Nigam, U.; Kaul, P.P. and Seth, T.D. (1996): Bioaccumulation of HCH isomers in different tissues of young and old rats: a comparison. Bull. Environ. Contam. Toxicol. 56: 896–902.

291 References

Siddiqui, M.K.J.; Anand, M.; Mehrotrab, P.K.; Sarangi, R. and Mathur, N. (2005): Biomonitoring of organochlorines in women with benign and malignant breast disease. Environ. Research 98: 250–257. Siddiqui, M.K.J.; Nigam, U.; Srivastava, S.; Tejeshwar, D.S. and Chandrawati, S. (2002): Association of maternal blood pressure and hemoglobin level with organochlorines in human milk. Hum. Environ.Toxicol. 21:1–6. Silvestroni, L. and Palleschi, S. (1999): Effects of organochlorine xenobiotics on human spermatozoa. Chemosphere 39: 12491252. Slater, G.F.; Nelson, R.K.; Kile, B.M. and Reddy, C.M. (2006): Intrinsic bacterial biodegradation of petroleum contamination demonstrated in situ using natural abundance, molecularlevel 14 C analysis. Organic Geochem. 37: 981–989. Smith J.A. and Novak J.T. (1987): Biodegradation of chlorinated phenols in subsurface soils. Water Air Soil Pollut. 33: 2942. Smith, S.R. (1996): Agricultural Recycling of Sewage Sludge and the Environment. CAB Int. Wallingford 207–236. Smith, S.R. (2000): Are controls on organic contaminants necessary to protect the environment when sewage sludge is used in agriculture? Prog. Environ. Sci. 2: 129–146. Snedekers, M. (2001): Pesticides and breast cancer risk: a review of DDT, DDE and dieldrin. Environ. Health Perspect. 109: 35–47. Sobiecka, E.; Cedzynska, K.; Bielski C. and AntizarLadislao, B. (2009): Biological treatment of transformer oil using commercial mixtures of microorganisms. Int. Biodeterior. Biodegrad. 63:328–333. Soliman, A.S.; Smith, M.A.; Cooper, S.P.; Ismail, K.; Khaled, H.; Ismail, S.; McPherson, R.S.; Seifeldin, I.A. and Bondy, M.L. (1997): Serum organochlorine pesticide levels in patients with colorectal cancer in Egypt. Arch. Environ. Health 52: 409–415. Solyanikova, I. P. and Golovleva, L. A. (2004): Bacterial degradation of chlorophenols: pathways, biochemica, and genetic aspects. J. Environ. Sci. Health B. 39:333–351. Sommer, C. and Görisch, H. (1997): Enzymology of the degradation of (di)chlorobenzenes by Xanthobacter flavus 14p1. Arch. Microbiol. 167:384–391.

292 References

Sonnenschein, C.; Soto, A.M.; Fernandez, M.F.; Olea, N.; OleaSerrano, M.F. and RuizLopez, M.D. (1995): Development of a marker of estrogenic exposure in human serum. Clin. Chem. 41/42: 1888–1895. Soto, A.M.; Michaelson, C.L.; Prechtl, N.V.; Weill, B.C.; Sonnenschein, C., OleaSerrano, F. and Olea, N. (1998): Assays to measure estrogen and androgen agonists and antagonists. Adv. Exp. Med. Biol. 444: 9– 23. Spain, J.C. and Nishino, S.F. (1987): Degradation of 1,4dichlorobenzene by a Pseudomonas sp. Appl. Environ. Microbiol. 53: 1010–1019. Spiess, E.; Sommer, C. and Gorisch, H. (1995): Degradation of 1,4 dichlorobenzene by a Xanthobacter flavus 14p1. Appl. Environ. Microbiol. 61:3884–3888. Stevens, J.; Northcott, G.; Stern, G.; Tomy, G. and Jones, K.C. (2003): PAHs, PCBs, PCNs, organochlorine pesticides, synthetic musks, and polychlorinated nalkanes in UK sewage sludge: survey results and implications. Environ. Sci. Technol. 37:462–467. Stolz, A. (2001): Basic and applied aspects in the microbial degradation of azo dyes. Appl Microbiol Biotechnol 56: 6980. Streber, W.R.; Timmis, K.N. and Zenk, M.H. (1987): Analysis, cloning, and highlevel expression of 2,4dichlorophenoxyacetate monooxygenase gene tfdA of Alcaligenes eutrophus . J Bacteriol 169: 2950–2955. Suemori, A.; Nakajima, K.; Kurane, R. and Nakamura, Y. (1995): o, m and p hydroxybenzoate degradative pathways in Rhodococcus erythropolis . FEMS Microbiol. Lett. 125: 31–35. Suzuki, K.; Ichimura, A.; Ogawa, N.; Hasebe, A. and Miyashita, K. (2002): Differential expression of two catechol 1,2dioxygenases in Burkholderia sp. strain TH2. J. Bacteriol. 184: 57145722. Swelam, M.; AboState, M.A.M.; Aziz, N.H.; Aly, N.M. and Khalil, O.A.A. (2005): Biodegradation of chloroaromatic compounds by indigenous microbial communities of soil and water. N. Egypt J. Microbiol. 12:7287. Szewczyk, R. and D1ugoński, J. (2009): Pentachlorophenol and spent engine oil degradation by Mucor ramosissimus. Int. Biodeterior. Biodegrad. 63: 123–129.

293 References

Sze, I.S. and Dagley, S. (1984): Properties of salicylate hydroxylase and hydroxyquinol 1,2dioxygenase purified from Trichosporon cutaneum . J. Bacteriol. 159: 353–359. Taguchi, K.; Motoyama, M. and Kudo, T. (2004): Multiplicity of 2,3 dihydroxybiphenyl dioxygenase genes in the grampositive polychlorinated biphenyl degrading bacterium Rhodococcus rhodochrous K37. Biosci. Biotechnol. Biochem. 68:787–95. Talamanca, F.; Traina, M. and Urbani, E. (2001): Occupational exposure to metals, solvents and pesticides recent evidence on male reproductive effects and biological markers. Occup. Med. 51: 174188. Tamer, E.; Hamid, Z.; Aly, A. M.; Ossama, E.T.; Bo, M. and Benoit, G. (2006): Sequential UV–biological degradation of chlorophenols. Chemosphere 63: 277–284. Tanabe, S.; Iwata, H. and Tatsukawa, R. (1994): Global contamination by persistent organochlorines and their ecotoxicological impact on marine mammals. Sci. Tot. Environ. 154:163–77. Tchelet, R.; Meckenstock, R.; Steinle, P. and van der Meer, J.R. (1999): Population dynamics of an introduced bacterium degrading chlorinated benzenes in a soil column and in sewage sludge. Biodegradation 10:113–125. Thompson, I.P.; Bailey, M.J.; Ellis, R.J.; Maguire, N. and Meharg, A. A. (1999): Response of soil microbial communities to single and multiple doses of an organic pollutant. Soil Biol. Biochem. 31:95–105. Tiku, D. K.; Kumar, A.; Chaturvedi, R.; Makhijani, S. D.; Manoharan, A.; Kumar, R. (2010): Holistic bioremediation of pulp mill effluents using autochthonous bacteria. Int. Biodeterior. Biodegrad. 64: 173 183 Timmis, K.N. and Pieper, D.H. (1999): Bacteria designed for bioremediation. TIBTECH 17: 201–204. Top, E. M. and Springael, D. (2003): The role of mobile genetic elements in bacterial adaptation to xenobiotic organic compounds. Curr. Opin. Biotechnol. 14:262269. TorresArreola, L.; Berkowitz, G.; LópezCervantes, M.; Cebrián, M.E.; Marisela, U. and LópezCarrillo, L. (2003): Pretem birth in relation to maternal organochlorine serum levels. Ann. Epidemiol. 13: 158– 162.

294 References

Townsend, G.T,; Ramanand, K. and Suflita, J.M. (1997): Reductive dehalogenation and mineralization of 3chlorobenzoate in the presence of sulfate by microorganisms from a methanogenic aquifer. Appl. Environ. Microbiol. 63:27852791. Trumbore, C.N.; Ehrlich, R.S. and Myers, Y.N. (2001): Changes in DNA conformation induced by gamma irradiation in the presence of copper. Rad. Res. 155:453465. Tryphonas, H. (1994): Immunotoxicity of polychlorinated biphenyls: Present status and future considerations. Exp. Clin. Immunogenet. 11: 149162. Tsoi, T.V.; Plotnikova, E.G.; Cole, J.R.; Guerin, W.F.; Bagdasarian, M. and Tiedje, J.M. (1999): Cloning, expression, and nucleotide sequence of the Pseudomonas aeruginosa 142 ohb genes coding for oxygenolytic ortho dehalogenation of halobenzoates. Appl. Environ. Microbiol. 65: 21512162. UBA Umweltbundesamt, (1992): Daten zur Umwelt. Erich Schmidt Verlag, Berlin. 439–442. UBA Umweltbundesamt, (1993): Daten zur Umwelt. Erich Schmidt Verlag, Berlin. 439–442. UNEP, (1999): Guidelines for the Identification of PCBs and Materials Containing PCBs. United Nation Environmental Programme, Geneva, Switzerland. UrgunDemirtas, M.; Pagilla, K.R.; Stark, B.C. and Webster, D. (2003): Biodegradation of 2chlorobenzoate by recombinant Burkholderia cepacia expressing Vitreoscilla hemoglobin under variable levels of oxygen availability. Biodegradation. 14:357365. USEPA, (1982): The Determination of polychlorinated biphenyls in transformer fluid and waste oils. USEPA, USA Utkin, I.; Dalton, D. D. and Wiegel, J. ( 1995): Specificity of reductive dehalogenation of substituted orthochlorophenols by Desulfitobacterium dehalogenans JW/IUDC1. Appl. Environ. Microbiol. 61 :346351. Vallini, G.; Frassinetti, S.; D’Andrea, F.; Catelani, G. and Agnolucci, M. (2001): Biodegradation of 4(1nonyl) phenol by axenic cultures of the yeast Candida aquaetextoris : identification of microbial breakdown products and proposal of a possible metabolic pathway. Int. Biodeterior. Biodegrad. 47:133–140.

295 References van den Tweel, W.J.J.; ter Bung, W.J.J.; Kok, J.B. and de Bont, J.A.M. (1986): Biotransformation of 4hydroxybenzoate from 4chlorobenzoate by Alcaligenes denitrificans NTB1. Appl. Microbiol. Biotech. 25:289 294. van der Geize, R. and Dijkhuizen, L. (2004): Harnessing the catabolic diversity of rhodococci for environmental and biotechnological applications. Curr. Opin. Microbiol. 7: 255–261. van der Meer, J.R. (1997): Evolution of novel metabolic pathways for the degradation of chloroaromatic compounds. Antonie van Leeuwenhoek 71: 159178. van der Meer, J.R.; Zehnder, A. J. B. and de Vos, W.M. (1991a): Identification of a novel composite transposable element, Tn5280, carrying chlorobenzene dioxygenase genes of Pseudomonas sp. strain P51. J. Bacteriol. 173:70777083. van der Meer, J.R.; de Vos, W.M.; Harayama, S. and Zehnder, A.J.B. (1992): Molecular mechanisms of genetic adaptation to xenobiotic compounds. Microbiol. 71: 159–178. van der Meer, J.R.; Eggen, R.I.L.; Zehnder, A.J.B. and Devos, W.M. (1991b): Sequence analysis of the Pseudomonas sp. strain P51 tcb gene cluster, which encodes metabolism of chlorinated catechols evidence for specialization of catechol 1,2dioxygenases for chlorinated substrates. J. Bacteriol. 173: 24252434. van der Meer, J.R.; Roelofsen, W.; Schraa, G. and Zehnder, A.J.B. (1987): Degradation of low concentrations of dichlorobenzenes and 1,2,4 trichlorobenzene by Pseudomonas sp. strain P51 in nonsterile soil columns. FEMS Microbiol. Ecol. 45: 333–341. van der Meer, J.R.; Werlen, C.; Nishino, S.F. and Spain, J.C. (1998): Evolution of a pathway for chlorobenzene metabolism leads to natural attenuation in contaminated groundwater, Appl. Environ. Microbiol. 64: 4185– 4193. van der Meer, J.R., van Neerven, A.R.W.; de Vries, E.J.; de Vos, W.M. and Zehnder, A.J.B. (1991c): Cloning and characterization of plasmid encoded genes for the degradation of 1,2dichloro, 1,4dichloro, and 1,2,4trichlorobenzene of Pseudomonas sp. strain P51. J. Bacteriol. 173: 6–15.

296 References

Van Hamme, J.D. and Ward, O.P. (2001): Volatile hydrocarbon biodegradation by a mixedbacterial culture during growth on crude oil. J. Microbiol. Biotechnol. 26: 356–362. Vasilyeva, G.K. and Strijakova, E.R. (2007): Bioremediation of soils and sediments contaminated by polychlorinated biphenyls. Microbiol. 76: 639–653. Vasudevan, N. and Rajaram, P. (2001): Bioremediation of oil sludge contaminated soil. Environ. Int. 26: 409–411. Venosa, A.D. and Zhu, X. (2003): Biodegradation of crude oil contaminating marine shorelines and freshwater wetlands. Spill Sci. Technol. Bull. 8: 163–178. Veselý, M.; Knoppová, M.; Nešvera, J. and Pátek, M. (2007): Analysis of catRABC operon for catechol degradation from phenoldegrading Rhodococcus erythropolis . Appl. Microbiol. Biotechnol. 76: 159–168. Villar, P.; Callejon, M.; Alonso, E.; Jimenez, J.C. and Guiraum, A. (2006): Temporal evolution of polycyclic aromatic hydrocarbons (PAHs) in sludge from wastewater treatment plants: Comparison between PAHs and heavy metals. Chemosphere 64: 535–541. Vinggaard, A.M.; Breinholt, V. and Larsen, J.C. (1999): Screening of selected pesticides for oestrogen receptor activation in vitro. Food Contam. Toxicol. 16: 533–542. Viswanathan, P.N. (1985): Environmental toxicology in India. Biol. Mem. 11:88– 97. Vogt, C.; Alfreider, A.; Lorbeer, H.; Hoffmann, D.; Wuensche, L. and Babel, W. (2004): Bioremediation of chlorobenzenecontaminated ground water in an in situ reactor mediated by hydrogen peroxide. J. Contam. Hydrol. 68: 121–141. Vollmer, M.D.; Fischer, P.; Knackmuss, H. J. and Schlömann, M. (1994): Inability of muconate cycloisomerases to cause dehalogenation during conversion of 2chlorocis,cismuconate. J. Bacteriol. 1768:4366 4375. von der Weid, I.; Marques, J. M.; Cunha, C.D.; Lippi, R. K.; dos Santos, S.C.C.; Rosado, A.S.; Lins, U. and Seldin, L. (2007): Identification and biodegradation potential of a novel strain of Dietzia cinnamea isolated from a petroleumcontaminated tropical soil. System. Appl. Microbiol. 30: 331–339.

297 References

Vorkamp, K.; Riget, F.; Glasius, M.; Pécseli, M.; Lebeuf, M. and Muir, D. (2004): Chlorobenzenes, chlorinated pesticides, coplanar chlorobiphenyls and other organochlorine compounds in Greenland biota. Sci. Total Environ. 331: 157–175. Vroumsia, T.; Steiman, R.; SeigleMurandi, F. and BenoitGuyod, J.L. (2005): Fungal bioconversion of 2,4dichlorophenoxyacetic acid (2,4D) and 2,4 dichlorophenol (2,4DCP). Chemosphere 60: 1471–1480. Wackett, L. P. (1995): Bacterial cometabolism of halogenated organic compounds. In: Microbial Transformation and Degradation of Toxic Organic Chemicals, Young, L. Y. and Cerniglia, C. E. (eds.) 217241. Waliszewski, S.M. and Szymaynski, G.A. (1983): Determination of selected chlorinated pesticides bound and free in human semen. Arch. Environ. Contam. Toxicol. 12: 577. Waliszewski, S. M.; GomezArroyo, S.; Infanzon, R. M.; VillalobosPietrini, R. and Maxwell Hart, M. (2003): Comparison of organochlorine pesticide levels between abdominal and breast adipose tissue. Bull. Environ. Contam. Toxicol. 71:156162. Walworth, J.L. and Reynolds, C.M. (1995): Bioremediation of a petroleum contaminated cryic soil: effects of phosphorus, nitrogen and temperature. J. Soil Contam. 4: 299– 310. Wang, C.C.; Lee, C.M.; Lu, C.J.; Chuang, M.S. and Huang, C.Z. (2000): Biodegradation of 2,4,6trichlorophenol in the presence of primary substrate by immobilized pure culture bacteria. Chemosphere 41: 1873–1879. Wang, F.; Grundmann, S.; Schmid, M.; Dörfler, U.; Roherer, S.; Munch, J. C.; Hartmann, A.; Jiang, X. and Schroll, R. (2007): Isolation and characterization of 1,2,4trichlorobenzene mineralizing Bordetella sp. and its bioremediation potential in soil. Chemosphere 67: 896–902. Wang, M.J. and Jones, K.C. (1994): Uptake of chlorobenzens by carrots from spiked and sewage sludgeamended soil. Environ. Sci. Technol. 28:1260–1267. Wang, M.J.; McGrath, S.P. and Jones, K.C. (1995): Chlorobenzenes in fields oil with a history of multiple sewage sludge applications. Environ. Sci. Technol. 29: 356–362.

298 References

Wang, X. and Bartha, R. (1990): Effects of bioremediation on residues, activity and toxicity in soil contaminated by fuel spills. Soil Biol. Biochem. 22: 501–505. Wania, F. and Mackay, D. (1993): Global fractionation and cold condensation of low volatility organochlorine compounds in polar regions. Ambio. 22: 10–18. Webber, M.D.; Roger, H.R.; Watts, C.D.; Boxall, A.B.A.; DaVis, R.D. and Scoffm, R. (1996): Monitoring and prioritization of organic contaminants in sewage sludges using specific chemical analysis and predictive nonanalytical methods. Sci. Total Environ. 185: 27–44. White, P.M.; Potter, T.L. and Culbreath, A.K. (2010): Fungicide dissipation and impact on metachlor aerobic soil degradation and soil microbial dynamics. Sci Total Environ. 408:13931402. Whittaker, M.; Pollard, S.J.T. and Fallick, T.E. (1995): Characterizastion of refractory wastes at hydrocarboncontaminated sites: a review of conventional and novel analytical methods. Environ. Technol. 16: 1009–1033. WHO/UNEP Working Group. (1990): Public health impact of pesticides used in agriculture. Geneva: World Health Organization. Witthuhn, B.; Klauth, P.; Klumpp, E.; Narres, H.D. and Martinius, H. (2005): Sorption and biodegradation of 2,4dichlorophenol in the presence of organoclays. Appl. Clay Sci. 28:55– 66 Wolff, M.S.; ZeleniuchJacquotte, A.; Dubin, N. and Toniolo, P. (2000): Risk of breast cancer and organochlorine exposure. Cancer Epidemiol. Biomarker Prev. 9: 271–277. Woolcott, C. G.; Aronson, K. J.; Hanna, W. M.; SenGupta, S. K.; McCready, D. R.; Sterns, E. E. and Miller, A. B. ( 2001): Organochlorines and breast cancer risk by receptor status, tumor size and grade (Canada). Cancer causes control 12:395404. Wu, Q.; Milliken, C.E.; Meier, G.P.; Watts, J.E.M.; Sowers, K.R. and May, H.D. (2002): Dechlorination of chlorobenzenes by a culture containing bacterium DF1, a PCB dechlorinating microorganism. Environ. Sci. Technol. 36:3290–3294. Xiangchun, Q.; Hanchang, S.; Yongming, Z.; Jianlong, W. and Yi, Q. (2003): Biodegradation of 2,4dichlorophenol in an airlift honeycomblike ceramic reactor. Process Biochem. 38: 1545–1551.

299 References

Xiangchun, Q.; Hanchang, S.; Yongming, Z.; Jianlong, W. and Yi, Q. (2004): Biodegradation of 2,4dichlorophenol and phenol in an airlift innerloop bioreactor immobilized with Achromobacter sp. Sep. Purif. Technol. 34: 97–103. Yadav, J.S. and Reddy, C.A. (1992): Noninvolvement of lignin peroxidases and manganese peroxidases in 2,4,5trichlorophenoxyacetic acid degradation by Phenerochaete chrysosporium . Biotechnol. Lett. 14:1089–1092. Yadav, J.S.; Wallace, R.E. and Reddy, C.A. (1995): Mineralization of mono and dichlorobenzenes and simultaneous degradation of chloro and methyl substituted benzenesby the white rot fungus Phanaerochaete chrysosporium . Appl. Environ. Microbiol. 61:677680. Yagi, O. and Sudo, R. (1980): Degradation of polychlorinated biphenyls by microorganisms. J. Water Pollut. Control Fed. 52:10351043. Yàñez, L.; BorjaAburto, V. H.; Rojas, E.; Fuente, H.; GonzálezAmaro, R.; Gomes, H.; Jongitud, A. A. and DiazBarriga, F. (2004): DDT induces DNA damage in blood cells studies in vitro and in women chronically exposed to this insecticide. Environ. Res. 94:1824. Yang, X.; Liu, X.; Song, L.; Xie, F.; Zhang, G. and Qian, S. (2007): Characterization and functional analysis of a novel gene cluster involved in biphenyl degradation in Rhodococcus sp. strain R04. J. Appl. Microbiol. 103: 2214–2224. Yee, D.C. and Wood, T.K. (1997): 2,4Dichlorophenol degradation using Streptomyces viridosporus T7A lignin peroxidase. Biotechnol. Prog. 13: 53–59. Yuan, S.Y.; Su, C.J. and Chang, B.V. (1999): Microbial dechlorination of hexachlorobenzene in anaerobic sewage sludge. Chemosphere 38:10151023. Zaitsev, G.M. and Karasevich, Y.N. (1981a): Utilisation of 4chlorobenzoic acid in Arthrobacter globiformis . Microbiol. 50:2327. Zaitsev, G.M. and Karasevich, Y.N. (1981b): Preparative metabolism of 4 chlorobenzoic acid in Arthrobacter globiformis . Microbiol. 50:287 291. Zaitsev, G.M.; Uotila, J.S.; Tsitko, I.V.; Lobanok, A.G. and SalkinojaSalonen, M.S. (1995): Utilization of halogenated benzenes, phenols, and benzoates by Rhodococcus opacus GM14. Appl. Environ. Microbiol. 61:4191–201.

300 References

Zhang, J.; Zhao, W.; Pan, J.; Qiu, L. and Zhu, Y. (2005): Tissuedependent distribution and accumulation of chlorobenzenes by vegetables in urban area. Environ. Int. 31:855–860. Zhang, X. and Wiegel, J. (1990): Sequential anaerobic degradation of 2,4 dichlorophenol in freshwater sediments. Appl. Environ. Microbiol. 56:11191127. ZhenYu, W.; DongMei, G.; FengMin, L.; Jian, Z.; YuanZheng, X.; Simkins, S. and BaoShan , X. (2008): Petroleum Hydrocarbon Degradation Potential of Soil Bacteria Native to the Yellow River Delta. Pedosphere 18: 707–716, Zhou, L.; Marks, T.S.; Poh, R.P.C.; Smith, R.J.; Chowdhry, B.Z. and Smith, A.R.W. (2004): The purification and characterization of 4 chlorobenzoate: CoA ligase and 4chlorobenzoyl CoA dehlogenase from Arthrobacter sp. strain TM1. Biodegradation 15: 97109. Zhu, Y.; Liu, H.; Xi, Z.; Cheng, H. and Xu, X. (2005): Organochlorine pesticides (DDTs and HCHs) in soils from the outskirts of Beijing, China. Chemosphere 60:770–778. Zhulidov, A.V.; Headley, J.V.; Pavlov, D.F.; Robarts, R.D.; Korotova, L.G.; Vinnikov, Y.Y. and Zhulidova, O.V. (2000): Riverine fluxes of the persistent organochlorine pesticides hexachlorcyclohexane and DDT in the Russian Federation. Chemosphere 41:829–841. Ziagova, M. and LiakopoulouKyriakides, M. (2007a): Kinetics of 2,4 dichlorophenol and 4Clmcresol degradation by Pseudomonas sp. cultures in the presence of glucose. Chemosphere 68: 921–927. Ziagova, M. and LiakopoulouKyriakides, M. (2007b): Comparison of cometabolic degradation of 1,2dichlorobenzene by Pseudomonas sp. and Staphylococcus xylosus . Enzy. Microb. Technol. 40:12441250. Zolezzi, M.; Cattaneo, C. and Tarazona, J.V. (2005): Probabilistic ecological risk assessment of 1,2,4trichlorobenzene at a former industrial contaminated site. Environ. Sci. Technol. 39: 2920–2926.

301 Arabic Summary

@ @ @ói‹ÈÛa@˜ƒÜ¾a

ﻓﻰ ﻫﺫﻩ ﺍﻝﺩﺭﺍﺴﺔ ﺘﻡ ﻋﺯل ﺍﻝﻤﺤﺘﻭﻯ ﺍﻝﺒﻜﺘﻴﺭﻯ ﻝﺜﻤﺎﻨﻴﺔ ﻋﻴﻨﺎﺕ ﻤﻥ ﺍﻝﺘﺭﺒﺔ ﻭﻁﻤـﻰ ﺍﻝـﺼﺭﻑ ﻭﺍﻝﺘﻰ ﺘﻡ ﺘﺠﻤﻴﻌﻬﺎ ﻤﻥ ﺸﺭﻜﺔ ﺍﻝﻘﺎﻫﺭﺓ ﻝﺘﻜﺭﻴﺭ ﺍﻝﺒﺘﺭﻭل ﻭﺍﻷﺭﺍﻀﻰ ﺍﻝﺯﺭﺍﻋﻴﺔ ﺍﻝﻤﺤﻴﻁﺔ ﺒﻬﺎ . .

ﺘﻡ ﺍﺨﺘﺒﺎﺭ ﻗﺩﺭﺓ ﺍﻝﻤﺤﺘﻭﻯ ﺍﻝﺒﻜﺘﻴﺭﻯ ﻝﻠﻨﻤﻭ ﻋﻠﻰ ﺃﺭﺒﻊ ﻤﺭﻜﺒـﺎﺕ ﻜﻠﻭﺭﻭﺃﺭﻭﻤﺎﺘﻴـﺔ ﻭﻫـﻰ ٣- ﻜﻠﻭﺭﻭﺒﻨﺯﻭﻴﻙ ﺃ ﺴﻴﺩ، ٤,٢- ﺜﻨﺎﺌﻰ ﻜﻠﻭﺭﻭﺍﻝﻔﻴﻨﻭل، ٦,٢- ﺜﻨﺎﺌﻰ ﺍﻝﻜﻠﻭﺭﻭﻓﻴﻨﻭل ﺃﻨﺩﻭل ﻓﻴﻨـﻭل ﻭ ٤,٢,١ - - ﺜﻼﺜﻰ ﺍﻝﻜﻠﻭﺭﺒﻨﺯﻴﻥ . .

ﺃﻅﻬﺭ ﺍﻝﻤﺤﺘﻭﻯ ﺍﻝﺒﻜﺘﻴﺭﻯ ١( ) ﺃﻋﻠﻰ ﻤﻌﺩل ﻨﻤﻭ ﻋﻠﻰ ﺍﻝﻤﺭﻜﺒﺎﺕ ﺍﻝﻜﻠﻭﺭﻭﺃﺭﻭﻤﺎﺘﻴـﺔ ﺍﻷﺭﺒﻌـﺔ ﻭﻗﺩ ﺃﻨﺘﺞ ﺃﻋﻠﻰ ﻨﺴﺒﺔ ﺒﺭﻭﺘﻴﻨﺎﺕ ﺫﺍﺌﺒﺔ ﺤﺘﻰ ﻨﻬﺎﻴﺔ ﻓﺘﺭﺓ ﺍﻝﺘﺤﻀﻴﺭ . ﻜﻤﺎ ﺃﻅﻬﺭ ﺍﻝﻤﺤﺘﻭﻯ ﺍﻝﺒﻜﺘﻴـﺭﻯ ( ٣,٢ ) ﺃﻓﻀل ﺇﻨﺘﺎﺝ ﻝﻠﺒﺭﻭﺘﻴﻨﺎﺕ ﺍﻝﺫﺍﺌﺒﺔ ﻭﺍﻝﺫﻯ ﺘﺠﺎﻭﺯ ﻓﺘﺭﺓ ﺍﻝﺘﺤﻀﻴﻥ ﻭﻫﻰ ٢٨ ﻴﻭﻡ . .

ﺴﺠل ﺍﻝﻤﺤﺘﻭﻯ ﺍﻝﺒﻜﺘﻴﺭﻯ ( ٨,٧ ) ﺃﻋﻠﻰ ﻋﺩﺩ ﺤﻴـﻭﻯ ﻋﻠـﻰ ﺍﻝﻤﺭﻜﺒـﺎﺕ ﺍﻝﻜﻠﻭﺭﻭﺃﺭﻭﻤﺎﺘﻴـﺔ ﺍﻷﺭﺒﻌﺔ . .

ﺘﻡ ﺍﺨﺘﻴﺎﺭ ﺃﻓﻀل ﺨﻤﺱ ﻋﺯﻻﺕ ﻜﺎﻨﺕ ﻝﻬﺎ ﺍﻝﻘﺩﺭﺓ ﻋﻠـﻰ ﺍﻝﻨﻤـﻭ ﻋﻠـﻰ ﺍﻷﺭﺒـﻊ ﻤﺭﻜﺒـﺎﺕ ﺍﻝﻜﻠﻭﺭﻭﺃﺭﻭﻤﺎﺘﻴﺔ ﻓﻰ ﺘﺭﻜﻴﺯﺍﺕ ﻤﺨﺘﻠﻔﺔ ﻭﻫﻰ ﻡ ﻉ ﻡ- ٢٤ ، ﻡ ﻉ ﻡ- ٢٧ ، ﻡ ﻉ ﻡ - ٢٩ ، ﻡ ﻉ ﻡ - ٣٣ ﻭ ﻡ ﻉ ﻡ-٣ ﺒﺎﻹﻀﺎﻓﺔ ﻝﻠﻌﺯﻝﺔ ﺍﻝﻘﻴﺎﺴﻴﺔ E. cloaceae ﻡ ﻉ ﻡ- .٤ .٤

ﻭﻗﺩ ﻝﻭﺤﻅ ﺃﻥ ﺍﻝﻌﺯﻝﺔ ﻡ ﻉ ﻡ- ٢٤ ﻝﻬﺎ ﺍﻝﻘﺩﺭﺓ ﻋﻠﻰ ﺘﻜﺴﻴﺭ ﺘﺭﻜﻴﺯﺍﺕ ﻋﺎﻝﻴﺔ ﻤﻥ ﺍﻝﻤﺭﻜـﺏ ٣- ﻜﻠﻭﺭﻭﺒﻨﺯﻭﻴــﻙ ﺃﺴــﻴﺩ ﻤﻘﺎﺭﻨــﺔ ﺒــﺎﻝﻌﺯﻻﺕ ﺍﻷﺨــﺭﻯ، ﺒﻴﻨﻤــﺎ ﺍﻝﻌــﺯﻝﺘﻴﻥ ﻡ ﻉ ﻡ-٣ ﻭ E. cloaceae ﻡ ﻉ ﻡ-٤ ﻜﺎﻨﺕ ﻝﻬﻤﺎ ﻓﻌﺎﻝﻴﺔ ﺘﻜﺴﻴﺭ ﺍﻝﺘﺭﻜﻴﺯﺍﺕ ﺍﻝﻤﻨﺨﻔﻀﺔ ﺩﻭﻥ ﺍﻝﺘﺭﻜﻴﺯﺍﺕ ﺍﻝﻌﺎﻝﻴﺔ . .

ﻭﻗﺩ ﺃﻅﻬﺭﺕ ﺍﻝﻨﺘﺎﺌﺞ ﻝﻠﻌﺯﻻﺕ ﺍﻝﻤﺨﺘﻠﻔﺔ ﺍﻝﻨﺎﻤﻴﺔ ﻋﻠﻰ ﺍﻝﻤﺭﻜﺏ ٤,٢- ﺜﻨﺎﺌﻰ ﻜﻠﻭﺭﻭﻓﻴﻨـﻭل ﺒﻌﺩ ﻓﺘﺭﺓ ٧ ﻭ ٢١ ﻴﻭﻡ ﻤﻥ ﺍﻝﺘﺤﻀﻴﻥ ﺃﻥ ﺍﻝﻌﺯﻝﺔ ﻡ ﻉ ﻡ - ٢٤ ﺃﻋﻁﺕ ﺃﻋﻠﻰ ﻋـﺩﺩ ﺤﻴـﻭﻯ ﻋﻠـﻰ ﺍﻝﺘﺭﻜﻴﺯﺍﺕ ﺍﻝﻤﺨﺘﻠﻔﺔ ﻝﻬﺫﺍ ﺍﻝﻤﺭﻜﺏ . .

ﺴﺠﻠﺕ ﺍﻝﻌﺯﻝﺘﻴﻥ ﻡ ﻉ ﻡ- ٢٤ ﻭ ﻡ ﻉ ﻡ- ٢٧ ﺃﻋﻠﻰ ﻨﺴﺒﺔ ﺘﻜﺴﻴﺭ ﻋﻨﺩ ﺍﻝﺘﺭﻜﻴﺯﺍﺕ ﺍﻝﻤﺭﺘﻔﻌﺔ ١( ٢، ﻤﻠﻰ ﻤﻭل ) ﻤﻥ ٤,٢- ﺜﻨﺎﺌﻰ ﻜﻠﻭﺭﻭﻓﻴﻨﻭل ﻋﻥ ﺍﻝﺘﺭﻜﻴﺯﺍﺕ ﺍﻝﻤﻨﺨﻔﻀﺔ . ﻓﻰ ﺤﻴﻥ ﺃﻥ ﺍﻝﻌﺯﻻﺕ ﻡ ﻉ ﻡ- ٣٣ ﻭﻡ ﻉ ﻡ-٣ ﻭﺍﻝﻌﺯﻝﺔ ﺍﻝﻘﻴﺎﺴﻴﺔ ﻝﻬﻡ ﺍﻝﻘﺩﺭﺓ ﻋﻠﻰ ﺘﻜﺴﻴﺭ ﺃﻜﺜـﺭ ﻤـﻥ ٩٥ % ﻤـﻥ ﻜـل ﺘﺭﻜﻴﺯﺍﺕ ﺍﻝﻤﺭﻜﺏ ٤,٢- ﺜﻨﺎﺌﻰ ﻜﻠﻭﺭ ﻭﻓﻴﻨﻭل . .

١ Arabic Summary

ﻭﻗﺩ ﻝﻭﺤﻅ ﺃﻥ ﻨﺴﺒﺔ ﺍﻝﺘﻜﺴﻴﺭ ﻝﻠﻌﺯﻻﺕ ﺍﻝﺨﻤﺱ ﺒﺎﻹﻀﺎﻓﺔ ﻝﻠﻌﺯﻝﺔ ﺍﻝﻘﻴﺎﺴﻴﺔ ﻋﻨﺩ ﺍﻝﺘﺭﻜﻴﺯﺍﺕ ﺍﻝﻤﺭﺘﻔﻌﺔ ( ٥٠٠ ، ١٠٠٠ ، ٢٠٠٠ ﻤﻠﻰ ﻤﻭل ) ﻤﻥ ٦,٢- ﺜﻨﺎﺌﻰ ﻜﻠﻭﺭﻭﻓﻴﻨﻭل ﺇﻨﺩﻭل ﻓﻴﻨﻭل ﺘﺘـﺭﺍﻭﺡ ﺒﻴﻥ ٧٩,٣ % ﺇﻝﻰ ٩٧,١% ، ﻭﻗﺩ ﻜﺎﻨﺕ ﻡ ﻉ ﻡ- ٢٤ ﺃﻓﻀل ﻫﺫﻩ ﺍﻝﻌـﺯﻻﺕ ﺤﻴـﺙ ﻜﺎﻨـﺕ ﻨـﺴﺒﺔ ﺘﻜﺴﻴﺭﻫﺎ ﻋﻨﺩ ﺍﻝﺘﺭﻜﻴﺯﺍﺕ ﺍﻝﺴﺎﺒﻘﺔ ٩٦,٨% ، ٩٥,٠% ، ٩٠,٠ % ﻋﻠﻰ ﺍﻝﺘﻭﺍﻝﻰ . .

ﺃﺜﺒﺘﺕ ﺍﻝﻨﺘﺎﺌﺞ ﺃﻥ ﺍﻝﻌﺯﻝﺔ ﻡ ﻉ ﻡ- ٢٤ ﻨﻤﺕ ﺒﺸﻜل ﺠﻴﺩ ﻋﻠﻰ ﺍﻝﺨﻤـﺱ ﺘﺭﻜﻴـﺯﺍﺕ ﻤـﻥ ٤,٢,١- ﺜﻼﺜﻰ ﻜﻠﻭﺭﻭﺒﻨﺯﻴﻥ ﺒﻌﺩ ٧ ﻭ ٢٨ ﻴﻭﻡ ﻤﻥ ﺍﻝﺘﺤﻀﻴﻥ ﺤﻴﺙ ﺍﻅﻬﺭﺕ ﺃﻋﻠﻰ ﻨـﺴﺒﺔ ﺘﻜـﺴﻴﺭ ﻭﺍﻝﺘﻰ ﻜﺎﻨﺕ ٩٩,٣% ، ٩٨,٠% ، ٩٨,٦% ، ٩٩,٣% ، ﻭ ١٤,٤ % ﻋﻨﺩ ﺍﻝﺘﺭﻜﻴﺯﺍﺕ ٥ ، ١٠ ، ١٥ ، ٢٥ ﻭ ٥٠ ﻤﻴﻜﺭﻭﻤﻭل ﻋﻠﻰ ﺍﻝﺘﻭﺍﻝﻰ . .

ﺘﻡ ﺍﺨﺘﻴﺎﺭ ﺍﻝﻌﺯﻝﺔ ﻡ ﻉ ﻡ- ٢٤ ﻜﺒﻜﺘﻴﺭﻴﺎ ﻤﻜﺴﺭﺓ ﻝﻠﻤﺭﻜﺒﺎﺕ ﺍﻝﻜﻠﻭﺭﻭﺃﺭﻭﻤﺎﺘﻴﺔ، ﻭﺒﻤﻘﺎﺭﻨـﺔ 16S-rRNA ﻝﻬﺫﻩ ﺍﻝﻌﺯﻝﺔ ﺃﻅﻬﺭﺕ ﺘﺸﺎﺒﻪ ﺒﻨﺴﺒﺔ ١٠٠ % ﻝﻠﺒﻜﺘﻴﺭﻴـﺎ Bacillus mucilaginosus (GQ866855) ﻭﻋﺭﻓﺕ ﻋﻠﻰ ﺃﻨﻬﺎ (Bacillus mucilaginosus (HQ013329

ﻭﺒﺩﺭﺍﺴﺔ ﺘﺄﺜﻴ ﺭ ﺃﺸﻌﺔ ﺠﺎﻤﺎ ﻋﻠﻰ B. Mucilaginosus ﺜﺒﺕ ﺃﻥ ﻜﻠﻤﺎ ﺯﺍﺩﺕ ﺃﺸﻌﺔ ﺠﺎﻤﺎ، ﻜﻠﻤﺎ ﻗل ﺍﻝﻌﺩ ﺍﻝﺤﻴﻭﻯ ﻝﻠﻌﺯﻝﺔ ﺘﺩﺭﻴﺠﻴﺎﹰ . .

ﻜﻤﺎ ﺘﻡ ﺍﻝﺤﺼﻭل ﻋﻠﻰ ﻁﻔﺭﺓ ﺭﻗﻡ ٩( ) ﻭﺍﻝﺘﻰ ﺘﻌﺭﻀﺕ ﻝﺠﺭﻋﺔ ﻤﻥ ﺃﺸﻌﺔ ﺠﺎﻤﺎ ﻤﻘﺩﺍﺭﻫﺎ ٤,٠ ﻜﻴﻠﻭ ﺠﺭﺍﻯ ﻓﺄﻅﻬﺭﺕ ﻨﺴﺒﺔ ﻨﻤﻭ ﺃﻋﻠﻰ ﻤﻥ ﺍﻝﻌﺯﻝﺔ ﺍﻷﺼﻠﻴﺔ ﻋﻠـﻰ ﺍﻝﻤـﺭﻜﺒﻴﻥ ٤,٢- ﺜﻨـﺎﺌﻰ ﻜﻠﻭﺭﻭﻓﻴﻨﻭل ﻭ ٤,٢,١- ﺜﻼﺜﻰ ﻜﻠﻭﺭﻭﺒﻨﺯﻴﻥ، ﺒﻴﻨﻤﺎ ﺘﺴﺎﻭﻯ ﻓﻰ ﻨﺴﺒﺔ ﺍﻝﻨﻤﻭ ﻤﻊ ﺍﻝﻌﺯﻝﺔ ﺍﻷﺼﻠﻴﺔ ﻋﻠﻰ ﺍﻝﻤﺭﻜﺏ ٦,٢- ﺜﻨﺎﺌﻰ ﻜﻠﻭﺭﻭﻓﻴﻨﻭل ﺇﻨﺩﻭل ﻓﻴﻨﻭل ﻓﻰ ﺤﻴﻥ ﺃﻅﻬﺭﺕ ﺍﻝﻌﺯﻝﺔ ﺍﻷﺼﻠﻴﺔ ﺃﻋﻠﻰ ﻨﺴﺒﺔ ﻨﻤﻭ ﻋﻠﻰ ٣- ﻜﻠﻭﺭﻭﺒﻨﺯﻭﻴﻙ ﺃﺴﻴﺩ . .

ﺘﻭﺼﻠﺕ ﻫﺫﻩ ﺍﻝﺩﺭﺍﺴﺔ ﺇﻝـﻰ ﺃﻥ ﺍﻝﻌﺯﻝـﺔ ﺍﻷﺼـﻠﻴﺔ B. mucilaginosus ﻡ ﻉ ﻡ- ٢٤ ٢٤ ﻭﻁﻔﺭﺘﻬﺎ ٩( ) ﺘﺒﺩﺃ ﺒﻨﺯﻉ ﺃﻴﻭﻥ ﺍﻝﻜﻠﻭﺭ ﻜﺨﻁﻭﺓ ﺃﻭﻝﻰ ﻨﺤﻭ ﺘﻜـﺴﻴﺭ ﺍﻝﻤﺭﻜﺒـﺎﺕ ﺍﻝﻜﻠﻭﺭﻭﺃﺭﻭﻤﺎﺘﻴـﺔ ﺍﻝﻤﺨﺘﺎﺭﺓ، ﻭﺃﻥ ﺍﻝﻤﺭﻜﺏ ﺃﺴﻴﺘﻭﻓﻴﻨﻭﻥ ﻫﻭ ﺤﺠﺭ ﺍﻝﺯﺍﻭﻴﺔ ﻝﻨﻭﺍﺘﺞ ﺍﻝﺘﻜﺴﻴﺭ ﻝﻠﻤﺭﻜﺒﺎﺕ ﺍﻝﻜﻠﻭﺭﻭﺃﺭﻭﻤﺎﺘﻴﺔ ﺍﻷﺭﺒﻌﺔ . .

< <<<< ì†{{{â^{{Ï{Ö]<í{Ã{{Ú^{{q < <<<< <Ýç{{{×{{{Ã{{Ö]<í{{é{×{{Ò < < < <<<< l^{f{ß{Ö]<Ü{{Š{Î < < <<

< <<<< ]‚Âc

< < Øé×}<î^ÃÖ]<‚fÂ<Ù^ÃÖ]<‚fÂ<øÂ ﻣﺎﺟﺴﺘﲑ ﰱ ﺍﻟﻌﻠﻮﻡ - ﺟﺎﻣﻌﺔ ﺑﻨﻬﺎ ( ٢٠٠٥ ) )

ر إ آ ام

آء ت ال درﺝ اآرا ( و ) )

< <<<< l^fßÖ] <ÜŠÎ<ÜŠÎ<ÜŠÎ < <<<< ÝÝÝç×ÃÖ]<íé×Ò < <<<< ì†â^ÏÖ]<íÃÚ^q < <<<< D

< <<<< ì†{{{â^{{Ï{Ö]<í{Ã{{Ú^{{q < <<<< <Ýç{{{×{{{Ã{{Ö]<í{{é{×{{Ò < < < <<<< l^{f{ß{Ö]<Ü{{Š{Î < < <<

< <<<< ]‚Âc

< < Øé×}<î^ÃÖ]<‚fÂ<Ù^ÃÖ]<‚fÂ<øÂ ﻣﺎﺟﺴﺘﲑ ﰱ ﺍﻟﻌﻠﻮﻡ - ﺟﺎﻣﻌﺔ ﺑﻨﻬﺎ ( ٢٠٠٥ ) )

ر إ آ ام

آء ت ال درﺝ اآرا ( و ) )

< <<<< Í]†c

ﺍﳌﺴﺘﺨﻠﺺ ﺃﺳﻢ ﺍﻟﻄﺎﻟﺐ : ﻋﻼ ﻋﺒﺪ ﺍﻟﻌﺎﻝ ﻋﺒﺪ ﺍﻟﻌﺎﻃﻰ ﺧﻠﻴﻞ

ﻋﻨﻮﺍﻥ ﺍﻟﺮﺳﺎﻟﺔ : ﺍﻟﺘﻜﺴﲑ ﺍﳍﻮﺍﺋﻰ ﺍﳌﻴﻜﺮﻭﰉ ﻟﻠﻤﺮﻛﺒﺎﺕ ﺍﻟﻜﻠﻮﺭﻭﺃﺭﻭﻣﺎﺗﻴﺔ ﺍﳌﻠﻮﺛﺔ ﻟﻠﺒﻴﺌﺔ

ﺍﻟﺪﺭﺟﺔ : ﺍﻟﺪﻛﺘﻮﺭﺍﻩ ( ﺍﳌﻴﻜﺮﻭﺑﻴﻮﻟﻮ )ﺟﻰ )ﺟﻰ ﻓﻰ ﻫﺫﻩ ﺍﻝﺩﺭﺍﺴﺔ ﺘﻡ ﻋﺯل ﺍﻝﻤﺤﺘﻭﻯ ﺍﻝﺒﻜﺘﻴﺭﻯ ﻝﺜﻤﺎﻨﻴﺔ ﻋﻴﻨﺎﺕ ﻤﻥ ﺍﻝﺘﺭﺒﺔ ﻭﻁﻤﻰ ﺍﻝﺼﺭﻑ ﻤﻠﻭﺜـﺔ ﺒﺎﻝﺒﺘﺭﻭل ﻝﻤﺩﺓ ﺘﺯﻴﺩ ﻋﻥ ٤١ ﻋﺎﻤﺎﹰ، ﻝﻬﺎ ﺍﻝﻘﺩﺭﺓ ﻝﻠﻨﻤﻭ ﻋﻠﻰ ﺍﻷﺭﺒﻌﺔ ﻤﺭﻜﺒـﺎﺕ ﺍﻝﻜﻠﻭﺭﻭﺃﺭﻭﻤﺎﺘﻴـﺔ ﺍﻝﻤﺨﺘﺎﺭﺓ ﻭﻫﻡ ٣- ﻜﻠﻭﺭﻭﺒ ﻨﺯ ﻭﻴﻙ ﺃﺴﻴﺩ، ٤،٢- ﺜﻨﺎﺌﻰ ﺍﻝﻜﻠﻭﺭﻭﻓﻴﻨﻭل، ٦،٢- ﺜﻨﺎﺌﻰ ﺍﻝﻜﻠﻭﺭﻭﻓﻴﻨـﻭل ﺇﻨﺩﻭل ﻓﻴﻨﻭل، ٤،٢،١- ﺜﻼﺜﻰ ﺍﻝﻜﻠﻭﺭﻭﺒﻨﺯﻴﻥ ﻜﻤﺼﺩﺭ ﻭﺤﻴﺩ ﻝﻠﻜﺭﺒﻭﻥ ﻭﺍﻝﻁﺎﻗﺔ . ﻤﻥ ﻫﺫﺍ ﺍﻝﻤﺤﺘﻭﻯ ﺍﻝﺒﻜﺘﻴﺭﻯ ﺘﻡ ﺃﺨﺘﻴﺎﺭ ﺴﻼﻝﺔ ﻡ ﻉ ﻡ – ٢٤ ﺍﻝﺘﻰ ﺘﺴﺘﻁﻴﻊ ﻜﺴﺭ ﺍ ﻝﻤﺭﻜﺒﺎﺕ ﺍﻝﻜﻠﻭﺭﻭﺃﺭﻭﻤﺎﺘﻴﺔ ﻭﺒﻤﻘﺎﺭﻨﺔ ﺍﻝـ 16S-rRNA ﻝﻬﺫﻩ ﺍﻝﻌﺯل ﻋﺭﻓﺕ ﻋﻠﻰ ﺃﻨﻬﺎ Bacillus mucilaginosus HQ013329 ﻭﻗﺩ ﺤﺩﺩﺕ ﻫﺫﻩ ﺍﻝﺩﺭﺍﺴﺔ ﻨﺴﺒﺔ ﺍﻝﺘﻜﺴﻴﺭ ﻝﻜل ﻤﻥ ﺍﻝﻤﺭﻜﺒﺎﺕ ﺍﻝﻜﻠﻭﺭﻭﺃﺭﻭﻤﺎﺘﻴﺔ ﺍﻝﻤﺨﺘﺎﺭﺓ ﻭﺍﻝﻤﺭﻜﺒﺎﺕ ﺍﻝﻨﺎﺘﺠﺔ ﻋﻥ ﻫﺫﺍ ﺍﻝﺘﻜﺴﻴﺭ ﻭﺘﻭﺼﻠﺕ ﺃﻴﻀﺎﹰ ﺇﻝﻰ ﺃﻥ ﺍﻝﻌﺯﻝﺔ ﻡ ﻉ ﻡ – ٢٤ ﻭﻁﻔﺭﺘﻬﺎ ٩( ) ﺘﺒﺩﺃ ﺒﻨﺯﻉ ﺃﻴﻭﻥ ﺍﻝﻜﻠﻭﺭ ﻜﺨﻁﻭﺓ ﺃﻭﻝﻰ ﻨﺤﻭ ﺍﻝﺘﻜﺴﻴﺭ ﻭﺃﻥ ﺍﻝﻤﺭﻜﺏ ﺃﺴﻴﺘ ﻭﻓﻴﻨﻭﻥ ﻫﻭ ﺤﺠﺭ ﺍﻝﺯﺍﻭﻴـﺔ ﻝﻨـﻭﺍﺘﺞ ﺍﻝﺘﻜﺴﻴﺭ . .

ﺗﻮﻗﻴﻊ ﺍﻟﺴﺎﺩﺓ ﺍﳌﺸﺮﻓﻮﻥ: ﺍﻷﺴﺘﺎﺫ ﺍﻝﺩﻜﺘﻭﺭ / ﻴﺴـﺭﻯ ﺍﻝــﺴﻴــﺩ ﺼـﺎﻝـﺢ ﺍﻷﺴﺘﺎﺫ ﺍﻝﺩﻜﺘﻭﺭ / ﻤﺭﻓﺕ ﻋﻠﻰ ﻤﺤﻤﺩ ﺍﺒﻭ ﺴﺘﻴﺕ

ﺩ.ﺃ . ﻣﻴﻤﻮﻧﺔ ﻋﺒﺪ ﺍﻟﻌﺰﻳﺰ ﻛﺮﺩ

ﺭﺋﻴﺲ ﳎﻠﺲ ﻗﺴﻢ ﺍﻟﻨﺒﺎﺕ ﻛﻠﻴﺔ ﺍﻟﻌﻠﻮﻡ – ﺟﺎﻣﻌﺔ ﺍﻟﻘﺎﻫﺮﺓ

IInnttrroodduuccttiioonn

AAiimm ooff tthhee WWoorrkk

LLiitteerraattuurree RReevviieeww

MMaatteerriiaallss aanndd MMeetthhooddss

RReessuullttss aanndd DDiissccuussssiioonn

SSuummmmaarryy

RReeffeerreenncceess

AArraabbiicc SSuummmmaarryy