Phylogenetic relationships in the genus Cheracebus (Callicebinae, Pitheciidae) Carneiro, J, Sampaio, I, Lima, T, Silva-Júnior, J de S, Farias, I, Hrbek, T, Valsecchi, J, Boubli, JP and Schneider, H http://dx.doi.org/10.1002/ajp.23167

Title Phylogenetic relationships in the genus Cheracebus (Callicebinae, Pitheciidae) Authors Carneiro, J, Sampaio, I, Lima, T, Silva-Júnior, J de S, Farias, I, Hrbek, T, Valsecchi, J, Boubli, JP and Schneider, H Type Article URL This version is available at: http://usir.salford.ac.uk/id/eprint/57702/ Published Date 2020

USIR is a digital collection of the research output of the University of Salford. Where copyright permits, full text material held in the repository is made freely available online and can be read, downloaded and copied for non-commercial private study or research purposes. Please check the manuscript for any further copyright restrictions.

For more information, including our policy and submission procedure, please contact the Repository Team at: [email protected]. American Journal of Primatology

Phylogenetic relationships in the genus Cheracebus (Callicebinae, Pitheciidae)

Journal: American Journal of Primatology

Manuscript ID AJP-19-0267.R1 Wiley - Manuscript type:ForResearch Peer Article Review Date Submitted by the 02-Feb-2020 Author:

Complete List of Authors: Carneiro, Jeferson; Universidade Federal do Pará, Genomics and Systems Biology; Universidade Federal do Pará, Instituto de Estudos Costeiros Sampaio, Iracilda; Universidade Federal do Para, Instituto de Estudos Costeiros; Universidade Federal do Pará, Genomics and Systems Biology Lima, Thaynara; Universidade Federal do Para, Instituto de Estudos Costeiros Silva Júnior, Jose; Museu Paraense Emilio Goeldi, Zoologia Farias, Izeni; Universidade Federal do Amazonoas, Hrbek, Tomas; Universidade Federal do Amazonoas, Laboratory of Evolution and Animal Genetics Valsecchi, João; Instituto de Desenvolvimento Sustentável Mamirauá, Grupo de Ecologia de Vertebrados Terrestres Boubli, Jean; University of Salford, School of Environment and Life Sciences Schneider, Horacio; Universidade Federal do Para - Instututo de Estudos Costeiros; Universidade Federal do Pará, Genomics and Systems Biology

Indicate which taxonomic group was the subject of your New World monkeys, Pitheciidae, Callicebinae, Cheracebus study (select all that apply or type another option)::

Keywords: titi monkeys, New World monkeys, Phylogeny, Taxonomy

John Wiley & Sons Page 1 of 42 American Journal of Primatology

Carneiro 1 1 2 3 4 1 Phylogenetic relationships in the genus Cheracebus (Callicebinae, Pitheciidae) 5 6 1,2 1,2 2 7 2 Jeferson Carneiro , Iracilda Sampaio , Thaynara Lima , José de Sousa and Silva- 8 9 3 Júnior3, Izeni Farias4, Tomas Hrbek4, João Valsecchi5, Jean Boubli6, Horacio 10 11 4 Schneider1,2 12 13 14 5 15 16 6 1 Genômica e Biologia de Sistemas, Universidade Federal do Pará, Belém, Brazil 17 18 7 2 Instituto de Estudos Costeiros, Universidade Federal do Pará, Campus Universitário de 19 20 8 Bragança, Pará, Brazil 21 For Peer Review 22 3 23 9 Museu Paraense Emílio Goeldi, Mammalogy, Belém, Pará, Brazil 24 25 10 4 Universidade Federal do Amazonas, Laboratory of Evolution and Animal Genetics, 26 27 11 Manaus, Amazonas, Brazil 28 29 5 30 12 Mamirauá Sustainable Development Reserve, Amazonas, Brazil 31 32 13 6 School of Environment and Life Sciences, University of Salford, Salford, UK 33 34 14 35 36 37 15 Running title: Phylogeny Cheracebus 38 39 16 40 41 17 Corresponding author: Jeferson Carneiro 42 43 18 E-mail: [email protected] 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

John Wiley & Sons American Journal of Primatology Page 2 of 42

Carneiro 2 1 2 3 4 19 Abstract 5 6 7 20 Cheracebus is a new genus of New World primate of the family Pitheciidae, subfamily 8 9 21 Callicebinae. Until recently, Cheracebus was classified as the torquatus species group 10 11 22 of the genus Callicebus. The genus Cheracebus has six species: C. lucifer, C. lugens, C. 12 13 14 23 regulus, C. medemi, C. torquatus, and C. purinus, which are all endemic to the Amazon 15 16 24 biome. Prior to the present study, there had been no conclusive interpretation of the 17 18 25 phylogenetic relationships among most of the Cheracebus species. The present study 19 20 26 tests the monophyly of the genus and investigates the relationships among the different 21 For Peer Review 22 23 27 Cheracebus species, based on DNA sequencing of 16 mitochondrial and nuclear 24 25 28 markers. The phylogenetic analyses were based on Maximum Likelihood, Bayesian 26 27 29 Inference and multi-species coalescent approaches. The divergence times and genetic 28 29 30 30 distances between the Cheracebus taxa were also estimated. The analyses confirmed the 31 32 31 monophyly of the genus and a well-supported topology, with the following 33 34 32 arrangement: ((C. torquatus, C. lugens), (C. lucifer, (C. purinus, C. regulus))). A well- 35 36 37 33 differentiated clade was also identified within part of the geographic range of C. lugens, 38 39 34 which warrants further investigation to confirm its taxonomic status. 40 41 35 Key words: titi monkeys, New World monkeys, phylogeny, taxonomy 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

John Wiley & Sons Page 3 of 42 American Journal of Primatology

Carneiro 3 1 2 3 4 36 Introduction 5 6 7 37 The titi monkeys are small to medium sized (adult body weight 1–2 kg) New 8 9 38 World primates of the family Pitheciidae. The monophyly of this group was not 10 11 39 recognized until the beginning of the 20th Century, and the species had been allocated 12 13 14 40 to a number of different genera, including Callithrix and Saguinus (see Hershkovitz, 15 16 41 1963). Thomas (1903) placed all the titis described up to that time in the genus 17 18 42 Callicebus. Hershkovitz (1963) recognized two species, Callicebus moloch, with seven 19 20 43 subspecies, and Callicebus torquatus, with three subspecies. Subsequently, following 21 For Peer Review 22 23 44 the analysis of a much larger sample of specimens and geographic localities, 24 25 45 Hershkovitz (1988, 1990) updated the diversity of the genus to 13 species and a total of 26 27 46 25 taxa. These species were arranged in four species groups, based on their 28 29 30 47 morphological similarities and geographic ranges (Table 1). 31 32 48 Kobayashi and Langguth (1999) accepted the species group approach of 33 34 49 Hershkovitz (1988, 1990), but proposed an arrangement with five groups. This 35 36 37 50 arrangement was followed by van Roosmalen et al. (2002), who also considered all the 38 39 51 subspecies to be valid species. Groves (2005) subsequently proposed the division of 40 41 52 Callicebus into two subgenera, one of which, Torquatus, included the species of the 42 43 53 torquatus group, with all the other species being allocated to the subgenus Callicebus. 44 45 46 54 This arrangement was followed by Silva-Júnior et al. (2013). Recently, Byrne et al. 47 48 55 (2016) proposed the division of Callicebus into three genera, based primarily on 49 50 56 divergence times, including two new genera, given the lack of available nomina. The 51 52 53 57 two new genera were designated Plecturocebus (composed of the species of the 54 55 58 donacophilus, cupreus and moloch species groups) and Cheracebus (composed of the 56 57 59 species of the torquatus group). The species of the personatus group remained in the 58 59 60

John Wiley & Sons American Journal of Primatology Page 4 of 42

Carneiro 4 1 2 3 4 60 genus Callicebus. The classification proposed by Byrne et al. (2016) was adopted in 5 6 7 61 the present study. 8 9 62 A variety of taxonomic arrangements have been proposed for the titi monkeys 10 11 63 since the middle of the 20th Century, although the same six taxa compiled the 12 13 14 64 torquatus species group of Hershkovitz (1988, 1990), Groves’ (2005) Torquatus 15 16 65 subgenus, and the genus Cheracebus of Byrne et al. (2016). These taxa are 17 18 66 denominated here as Cheracebus torquatus (Hoffmannsegg, 1807), Cheracebus 19 20 67 purinus (Thomas, 1927), Cheracebus lucifer (Thomas, 1914), Cheracebus lugens 21 For Peer Review 22 23 68 (Humboldt, 1811), Cheracebus regulus (Thomas, 1927), and Cheracebus medemi 24 25 69 (Hershkovitz, 1963). The one exception has been the proposal of Kobayashi (1995), 26 27 70 based on a geometric morphometric analysis, which placed the C. purinus in the 28 29 30 71 personatus species group, the current genus Callicebus. 31 32 72 Cheracebus is endemic to the Amazon region, and the species are assumed to 33 34 73 have an allopatric distribution, with species ranges separated by major rivers (Figure 35 36 37 74 1). The exact limits between the ranges of some species are still unclear, however, due 38 39 75 primarily to the sampling deficiencies of many areas, as in the case of C. lucifer and C. 40 41 76 medemi, which both occur between the Japurá/Solimões and Caquetá/Aguarico rivers, 42 43 77 and are not separated by any obvious physical barrier. There are also a number of 44 45 46 78 discrepancies on the distributions of C. torquatus and C. lugens. Hershkovitz (1990) 47 48 79 suggested that a sympatric zone exists between these two species, while van 49 50 80 Roosmalen et al. (2002) concluded that C. lugens occupies an extensive area to the 51 52 53 81 north of the Branco River, including the basins of the Branco and Orinoco rivers, and a 54 55 82 number of other, smaller rivers, whereas C. torquatus is restricted to the area between 56 57 58 59 60

John Wiley & Sons Page 5 of 42 American Journal of Primatology

Carneiro 5 1 2 3 4 83 the Japurá and Negro rivers. However, Casado et al. (2006) proposed that C. lugens 5 6 7 84 occurs on both margins of the Negro River, in agreement with Hershkovitz (1990). 8 9 85 The present study tested the monophyly of the genus Cheracebus and proposes 10 11 86 a first phylogenetic arrangement of the species of the genus based on DNA sequencing 12 13 14 87 of mitochondrial and nuclear markers. 15 16 88 17 18 89 Material and Methods 19 20 90 Samples, and the Extraction, Amplification, and Sequencing of the DNA 21 For Peer Review 22 23 91 Samples of blood and muscle tissue were obtained from 26 pitheciid specimens, 24 25 92 including 17 representatives of five of the six Cheracebus species (1 C. torquatus, 6 C. 26 27 93 lugens, 3 C. purinus, 3 C. lucifer, 4 C. regulus, 3 Plecturocebus, 3 Callicebus, 1 28 29 30 94 Chiropotes, 1 Cacajao, and 1 Pithecia). No samples of Cheracebus medemi could be 31 32 95 obtained for analysis in the present study. The samples (Table 2, Figure 1) were 33 34 96 identified based on the morphological traits of the specimens, which were compared 35 36 37 97 with the published descriptions of the respective species. The samples were provided by 38 39 98 five Brazilian institutions, the National Institute of Amazonian Research (INPA) and 40 41 99 the Federal University of Amazonas (UFAM) in Manaus, the Rio de Janeiro 42 43 100 Primatology Center (CPRJ), the Pontifical Catholic University of Minas Gerais (PUC) 44 45 46 101 in Belo Horizonte, and the Federal University of Pará (UFPA), in Belém. 47 48 102 Total genomic DNA was extracted using Promega’s Wizard Genomic kit, 49 50 103 according to the manufacturer’s protocol, and 16 molecular markers were amplified by 51 52 53 104 Polymerase Chain Reaction, PCR (Table 3). These markers included three fragments of 54 55 105 the mitochondrial DNA – Cytochrome oxidase subunit I (COI), Cytochrome b (Cytb), 56 57 106 and the ribosomal 16S gene (16S) – and 13 nuclear markers, RAG1, SIM, ZFX, and 10 58 59 60

John Wiley & Sons American Journal of Primatology Page 6 of 42

Carneiro 6 1 2 3 4 107 Alu elements together with their flanking regions. The PCRs were standardized to a 5 6 7 108 final volume of 15 µl, containing ~30 ng of genomic DNA, 2.4 µl of dNTPs (1.25mM); 8 9 109 1.5 µl of 10X buffer (200 mM Tris-HCl, 500 mM KCl); 1 µl of MgCl2 (25 mM); 1 µl of 10 11 110 each primer (0.2 µM), and 1 U of Taq DNA polymerase. With the exception of the 12 13 14 111 primer annealing temperatures, all other steps of the amplification protocol were 15 16 112 identical for all the markers. The thermocycler was programmed for the following 17 18 113 schedule: initial denaturation at 95°C for 5 min, followed by 35 cycles of denaturation 19 20 114 at 95°C for 30 s, annealing at 40 s, and extension at 72°C for 40 s, followed by a final 21 For Peer Review 22 23 115 extension at 72°C for 5 min. The PCR products were purified with polyethylene glycol 24 25 116 (PEG) and ethanol. The sequence reactions were run with the Big Dye kit (Applied 26 27 117 Biosystems), and the samples were sequenced in an ABI 3500 XL automatic sequencer 28 29 30 118 (Applied Biosystems). The access numbers on GenBank of the sequences produced in 31 32 119 the present study are available in the supplementary table S1. 33 34 120 35 36 37 121 Alignment of the sequences, evolutionary models, phylogenetic analyses, and 38 39 122 divergence times 40 41 123 The DNA sequences were aligned in ClustalW (Thompson et al., 1994) and 42 43 124 edited manually in BioEdit v. 7.2.5 (Hall, 1999). The outgroup was composed of 44 45 46 125 samples of the five remaining pitheciid genera, Callicebus, Plecturocebus, Pithecia, 47 48 126 Cacajao, and Chiropotes. PartitionFinder v.2 (Lanfear et al., 2016) was used to identify 49 50 127 the best data partitioning scheme and evolutionary models. We used the greedy 51 52 53 128 algorithm (Lanfear et al. 2012) and the Bayesian Information Criterion (BIC) and 54 55 129 protein coding regions were partitioned by position of the bases in the codons. Were 56 57 130 performed analysis for all concatenated markers, only nuclear regions, mitochondrial 58 59 60

John Wiley & Sons Page 7 of 42 American Journal of Primatology

Carneiro 7 1 2 3 4 131 regions and each individual molecular marker. The data partitioning schemes and their 5 6 7 132 respective evolutionary models can be viewed in the supplementary files (Table S2). 8 9 133 The phylogenetic analyses were based on the Maximum Likelihood (ML), 10 11 134 Bayesian Inference (BI) and coalescent approaches. The ML analysis was run in 12 13 14 135 RAxML v.8 (Stamatakis, 2014). The ML trees was found by 1000 searches followed by 15 16 136 1000 bootstrap pseudoreplicates. The BI was run in MrBayes v.3.2.1 (Ronquist and 17 18 137 Huelsenbeck, 2003) with two independent Markov chain Monte Carlo (MCMC) runs, 19 20 138 one cold and three hot, with 500,000 generations, and trees and parameters sampled 21 For Peer Review 22 23 139 every 5000 generations. The first 20% of the runs were discarded as burn-in. The 24 25 140 species tree with a multi-species coalescent model was estimated with ASTRAL III 26 27 141 (Zhang et al., 2018). ASTRAL uses non-rooted gene trees as the input file. We use the 28 29 30 142 trees of the individual loci estimated in RaxML. 31 32 33 143 The percentage of genetic divergence between taxa was estimated with MEGA 34 35 144 v.6 (Tamura et al. 2013). We perform genetic distance analyzes for all concatenated 36 37 145 molecular markers, and for mitochondrial and nuclear data separately. We use K2P for 38 39 40 146 all analyzes of genetic distance. 41 42 147 Divergence times were estimated in BEAST v.1.8.3 (Drummond et al., 2012), 43 44 148 using two calibration points: (i) the Cacajao–Chiropotes separation, estimated at 45 46 149 6.7±2.3 million years ago (Ma) (Kiesling et al. 2015); (ii) a pitheciine fossil, Nuciruptor 47 48 49 150 rubricae (Meldrum & Kay, 1997) dated to 12.4–12.8 Ma, used in the node that groups 50 51 151 Pithecia, Chiropotes and Cacajao. Evolutionary models were assigned to each 52 53 152 molecular marker, following PartitionFinder. An uncorrelated relaxed clock was applied 54 55 56 153 to the branch lengths and a Yule model was applied as the prior for the tree. The 57 58 154 analyses were based on three independent runs, and the log parameters and trees were 59 60

John Wiley & Sons American Journal of Primatology Page 8 of 42

Carneiro 8 1 2 3 4 155 summarized in LogCombiner v.1.8.3 and TreeAnnotator v.1.8.3 (Drummond et al., 5 6 7 156 2013), respectively. The convergence of the runs was evaluated in Tracer v.1.6 8 9 157 (Rambaut et al., 2014), and an Effective Sample Size (ESS) of over 200 was considered 10 11 158 to be satisfactory. 12 13 14 159 Results 15 16 160 The 16 concatenated markers (nuclear and mitochondrial) provided a database 17 18 161 of 9427 base pairs (bps), 2181 bps from the mitochondrial sequences, and 7246 bps 19 20 162 from the nuclear sequences. Overall, approximately 16% of the data are missing due to 21 For Peer Review 22 23 163 problems encountered in the amplification of the markers in all the samples. 24 25 164 The ML and BI had the same topology, both with maximum support values 26 27 165 (bootstraps or posterior probabilities) for most of the nodes (Figure 2). This analysis 28 29 30 166 separates the titis into three main clades, as suggested by Byrne et al. (2016), with 31 32 167 Cheracebus as the sister taxon of the clade composed of Callicebus and Plecturocebus. 33 34 168 Two well-supported clades were also identified within the genus Cheracebus, 35 36 37 169 one which included C. lugens and C. torquatus, and the other formed by C. regulus, C. 38 39 170 purinus, and C. lucifer. In this latter clade, C. lucifer was recuperated as the sister 40 41 171 species of the clade formed by C. regulus and C. purinus. All allelic diversity within 42 43 172 species was reciprocally monophyletic, and all the relationships within the genus 44 45 46 173 Cheracebus were strongly supported. The Phylogenetic analysis under the multi-species 47 48 174 coalescent model (Figure 3) recovered the same topology of probabilistic methods (ML 49 50 175 and IB), also with most of the nodes strongly supported. We obtained incongruity in the 51 52 53 176 phylogenetic position of C. torquatus when analyzed the mitochondrial and nuclear data 54 55 177 separately (Figura S1). Only mitochondrial data groups C. torquatus within of C. 56 57 58 59 60

John Wiley & Sons Page 9 of 42 American Journal of Primatology

Carneiro 9 1 2 3 4 178 lugens, with 60% of bootstrap, making paraphyletic C. lugens. In contrast, only nuclear 5 6 7 179 markers position C. torquatus as sister to other species of the genus Cheracebus. 8 9 180 All the concatenated molecular markers have genetic distances of approximately 10 11 181 13% separating the three titi genera, Cheracebus, Plecturocebus, and Callicebus (Table 12 13 14 182 4), whereas the mean genetic distance between Cheracebus species was 2.45%. The 15 16 183 distances ranged from 0.9% between C. regulus and C. purinus to 4% between C. 17 18 184 lugens and C. purinus. The C. lugens specimens from opposite margins of the Negro 19 20 185 River were separated by a genetic distance of 1.47%, a value similar to that recorded 21 For Peer Review 22 23 186 between the two species (C. lugens and C. torquatus) in this clade. We also analyze 24 25 187 genetic distances separately using only mitochondrial and nuclear data. Mitochondrial 26 27 188 data has an average genetic distance 5.17 times greater than nuclear data (Table S3 and 28 29 30 189 S4) 31 32 190 The estimates of divergence times indicated that the present-day pitheciids 33 34 191 began to diversify approximately 19.22 Ma, with a 95% Highest Posterior Densities 35 36 37 192 (HPD) range of 15.95–22.49 Ma (Figure 4). It is interesting to note that the estimated 38 39 193 timing of the first diversification within the pitheciines (13.58 Ma; 95% HPD: 11.83– 40 41 194 15.33 Ma) is virtually the same as that of the first diversification within the callicebines, 42 43 195 given that the three lineages of the current genera Cheracebus, Plecturocebus and 44 45 46 196 Callicebus were already separated by 13.15 (95% HPD: 10.13–17.69 Ma). The current 47 48 197 Cheracebus species diversified only during the Pliocene, at around 3.92 Ma (95% HPD: 49 50 198 2.97–4.87 Ma). Cheracebus regulus and C. purinus are the species that diverged most 51 52 53 199 recently, of only 1.93 Ma (95% HPD: 1.38–2.48 Ma). 54 55 56 57 58 59 60

John Wiley & Sons American Journal of Primatology Page 10 of 42

Carneiro 10 1 2 3 4 200 5 6 7 201 Discussion 8 9 202 Until recently, the titi monkeys were classified in five species groups within the 10 11 203 genus Callicebus, although Byrne et al. (2016) proposed a new arrangement, in which 12 13 14 204 the taxon was divided into three genera, Cheracebus, Plecturocebus, and Callicebus. 15 16 205 The results of the analyses presented here provide further, conclusive support for this 17 18 206 arrangement. The genetic distances between these lineages are comparable with those 19 20 207 found between the other pitheciid genera, and appear to be consistent with the timing of 21 For Peer Review 22 23 208 the separation of the three genera, in the mid Miocene (~10 Ma). In fact, the 24 25 209 morphological differences among the three callicebines are smaller than those among 26 27 210 the three pitheciines. Even so, the DNA sequences support the recognition of the six 28 29 30 211 pitheciid genera conclusively. 31 32 212 Despite the lack of C. medemi samples, all the Cheracebus species were 33 34 213 recuperated as monophyletic groups in the present analysis, which is consistent eith the 35 36 37 214 morphological data (Groves, 2005; Hershkovitz, 1988, 1990; Kobayashi & Langguth, 38 39 215 1999; van Roosmalen et al., 2002). The data on the phylogenetic relationships among 40 41 216 the Cheracebus species point to an initial dichotomy between the C. lugens/C. 42 43 217 torquatus and C. lucifer/C. purinus/C. regulus clades, which are found exclusively on 44 45 46 218 opposite margins of the Amazon River. Cheracebus lugens and C. torquatus occur on 47 48 219 the northern margin of the Amazon (Solimões) River, while the other clade is found on 49 50 220 the southern margin. 51 52 53 221 The present estimates of divergence times indicate that these two clades 54 55 222 separated at approximately 3.9 Ma. The current drainage system of the Amazon basin 56 57 223 may have formed around 3 Ma (Ribas et al., 2012), although Hoorn et al. (2010) 58 59 60

John Wiley & Sons Page 11 of 42 American Journal of Primatology

Carneiro 11 1 2 3 4 224 proposed a date of approximately 7 Ma. Whether or not the formation of the Amazon 5 6 7 225 River determined the separation of the two Cheracebus clades, it was almost certainly 8 9 226 in place by at least 3 Ma, and would have contributed to their genetic isolation. 10 11 227 Cheracebus lugens is the species with the largest geographic distribution of any 12 13 14 228 Cheracebus species, although the present analysis identified two clades with a genetic 15 16 229 distance of 1.4%, a value greater than that found between some pairs of recognized 17 18 230 species, such as C. regulus and C. purinus, which were separated by a distance of 0.9%. 19 20 231 Based on this parameter alone, the data suggest the existence of two valid species 21 For Peer Review 22 23 232 within C. lugens, although this inference may be premature, given that many species, 24 25 233 even well-defined ones, may present intraspecific genetic divergences derived from 26 27 234 distinct mutation rates and/or patterns of genetic drift. Furthermore, this genetic 28 29 30 235 distance may be related to the ample geographic distance between the samples, and it is 31 32 236 possible that the analysis of a broader sample including additional localities may reveal 33 34 237 a more intermediate genetic distance. Further research will be needed to resolve this 35 36 37 238 question. 38 39 239 40 41 240 Conclusions 42 43 241 The present study is the first to test the monophyly of the genus Cheracebus 44 45 46 242 systematically, and define interspecific phylogenetic relationships based on DNA 47 48 243 sequences. The results of the study clearly support the monophyly of Cheracebus. 49 50 244 However, the phylogenetic position of C. medemi remains unclear. This species has a 51 52 53 245 restricted geographic distribution in the Caquetá and Putumayo departments of 54 55 246 Colombia. The phylogenetic reconstruction indicated that the initial diversification of 56 57 247 the extant species led to the formation of two reciprocal, monophyletic clades on 58 59 60

John Wiley & Sons American Journal of Primatology Page 12 of 42

Carneiro 12 1 2 3 4 248 opposite margins of the Amazon River at around 4 Ma. The origin of the clades may 5 6 7 249 thus be associated with the formation of the Amazon drainage system. As the 8 9 250 divergence of Cheracebus from the other callicebine genera occurred at approximately 10 11 251 13 Ma, this lineage either remained stable (with no speciation) for around 9 Ma or the 12 13 14 252 forms derived from the speciation processes that occurred during this period are now 15 16 253 extinct, and may only exist in fossil form. The two clades of C. lugens identified in the 17 18 254 present study, based on their accentuated genetic distance, indicate the existence of a 19 20 255 new, as yet unidentified species of Cheracebus. However, confirmation of this 21 For Peer Review 22 23 256 hypothesis will require further genetic and morphological samples from the geographic 24 25 257 range of C. lugens. 26 27 258 28 29 30 259 Ethics 31 32 260 All stages of the experiments and fieldwork were carried out in accordance with 33 34 261 Brazilian laws about primate research as well as the rules established by the American 35 36 37 262 Society of Primatologists in relation to the ethical treatment of primates. Research permits 38 39 263 were granted by Brazilian authorities (FUNAI and IBAMA/ICMBio), and by institutional 40 41 264 IACUC committees. The licenses to fieldwork and collection of tissue samples were 42 43 265 provided by IBAMA (License N° 005/2005 – CGFAU/LIC) and ICMBio (40217-1 and 44 45 46 266 5135-1). 47 48 267 49 50 268 51 52 53 269 Competing interests 54 55 270 We have no competing interests 56 57 271 58 59 60

John Wiley & Sons Page 13 of 42 American Journal of Primatology

Carneiro 13 1 2 3 4 272 Authors’ contributions 5 6 7 273 JC conceived of the study, participated in the data analyses and drafted the 8 9 274 manuscript; IS designed the study, provided samples; TL carried out the molecular 10 11 275 laboratory work and drafted the manuscript, JSSJ provided input on the manuscript, and 12 13 14 276 revised the text; JB, IF, TH and JV provided samples and revised the manuscript; HS 15 16 277 provided samples, and participated in the data analyses and the final revision of 17 18 278 manuscript. All authors have approved the final version of the manuscript for publication. 19 20 279 21 For Peer Review 22 23 280 Acknowledgements 24 25 281 We thank Luciana Watanabe, the laboratory technician at the Bragança campus 26 27 282 of the Federal University of Pará for her support in processing the primate DNA samples, 28 29 30 283 and Stephen Nash for the magnificent drawings provided for this study. Funding: this 31 32 284 study was part of JC’s doctoral thesis, which was supported by the Coordination for 33 34 285 Higher Education Personnel Training (CAPES). It was also supported by funds provided 35 36 37 286 by CAPES-PROAM 3296/2013 and CNPq (grants 306233/2009-6 to IS, and 38 39 287 473341/2010-7 and 305645/2009-9 to HS). Six field expeditions were funded in part by 40 41 288 grants from CNPq/FAPEAM SISBIOTA Program (No. 563348/2010-0), CAPES/PRO- 42 43 289 AMAZONIA/AUXPE (grant no. 3261/2013) to IPF. 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

John Wiley & Sons American Journal of Primatology Page 14 of 42

Carneiro 14 1 2 3 4 5 290 References 6 7 8 9 291 Batzer, M. A. (2005). Alu insertion loci and platyrrhine primate phylogeny. Molecular 10 11 292 phylogenetics and evolution, 35(1), 117-126. 12 13 293 https://doi.org/10.1016/j.ympev.2004.10.023. 14 15 16 17 294 Byrne, H., Rylands, A. B., Carneiro, J. C., Alfaro, J. W. L., Bertuol, F., da Silva, M. N. 18 19 295 F., & Boubli, J. P. (2016). Phylogenetic relationships of the New World titi monkeys 20 21 296 (Callicebus): first appraisalFor of taxonomyPeer based Review on molecular evidence. Frontiers in 22 23 297 Zoology, 13(1), 10. https://doi.org/10.1186/s12983-016-0142-4. 24 25 26 27 298 Carneiro, J., Silva Junior, J. S., Sampaio, I., Pissinatti, A., Hrbek, T., Rezende Messias, 28 29 299 M., Rohe, F., Farias, I., Boubli, J. & Schneider, H. (2016). Phylogeny of the titi 30 31 300 monkeys of the Callicebus moloch group (Pitheciidae, Primates). American journal of 32 33 34 301 primatology, 78(9), 904-913. https//doi.org/10.1002/ajp.22559. 35 36 37 302 Casado, F., Bonvicino, C. R., & Seuanez, H. N. (2006). Phylogeographic analyses of 38 39 303 Callicebus lugens (Platyrrhini, Primates). Journal of Heredity, 98(1), 88–92. 40 41 42 304 https://doi.org/10.1093/jhered/esl054 43 44 45 305 Drummond, A. J., Suchard, M. A., Xie, D., & Rambaut, A. (2012). Bayesian 46 47 306 phylogenetics with BEAUti and the BEAST 1.7. Molecular Biology and Evolution, 48 49 307 29(8), 1969–1973. https://doi.org/10.1093/molbev/mss075 50 51 52 53 308 Groves, C. P. (2005). Order Primates. Mammal species of the world: a taxonomic and 54 55 309 geographic reference, 1(3), 111–151. 56 57 58 59 60

John Wiley & Sons Page 15 of 42 American Journal of Primatology

Carneiro 15 1 2 3 4 310 Hall, T. A. (1999). BioEdit: a user-friendly biological sequence alignment editor and 5 6 7 311 analysis program for Windows 95/98/NT. Nucleic Acids Symposium Series, 41, 95–98. 8 9 10 312 Hershkovitz, P. (1963). A systematic and zoogeographic account of the monkeys of the 11 12 313 genus Callicebus (Cebidae) of the Amazonas and Orinoco river basins. Mammalia, 13 14 15 314 27(1), 1–80. https://doi.org/10.1515/mamm.1963.27.1.1 16 17 18 315 Hershkovitz, P. (1988). Origin, speciation, and distribution of South American titi 19 20 316 monkeys, genus Callicebus (Family Cebidae, Platyrrhini). Proceedings of the Academy 21 For Peer Review 22 317 of Natural Sciences of Philadelphia, 140(1), 240-272. 23 24 25 26 318 Hershkovitz, P. (1990). Titis, New World monkeys of the genus Callicebus (Cebidae, 27 28 319 Platyrrhini): a preliminary taxonomic review. Fieldiana, Zool. New Series, Field 29 30 320 Museum of Natural History, Chicago. 31 32 33 34 321 Hoorn, C., Wesselingh, F. P., Ter Steege, H., Bermudez, M. A., Mora, A., Sevink, J., & 35 36 322 Antonelli, A. (2010). Amazonia through time: Andean uplift, climate change, landscape 37 38 323 evolution, and biodiversity. Science, 330(6006), 927–931. 39 40 41 324 https://doi:org/10.1126/science.1194585. 42 43 44 325 Kiesling, N. M. J., Soojin, V. Y., Xu, K., Sperone, F. G., & Wildman, D. E. (2015). The 45 46 326 tempo and mode of New World monkey evolution and biogeography in the context of 47 48 327 phylogenomic analysis. Molecular Phylogenetics and Evolution, 82, 386-399. 49 50 51 328 https://doi.org/10.1016/j.ympev.2014.03.027. 52 53 54 329 Kobayashi, S. (1995). A phylogenetic study of titi monkeys, genus Callicebus, based on 55 56 330 cranial measurements: I. Phyletic groups of Callicebus. Primates, 36(1), 101-120. 57 58 59 60

John Wiley & Sons American Journal of Primatology Page 16 of 42

Carneiro 16 1 2 3 4 331 Kobayashi, S., & Langguth, A. (1999). A new species of titi monkey, Callicebus 5 6 7 332 Thomas, from north-eastern Brazil (Primates, Cebidae). Revista Brasileira de Zoologia, 8 9 333 16(2), 531–551. http://dx.doi.org/10.1590/S0101-81751999000200018. 10 11 12 334 Lanfear, R., Calcott, B., Simon, Y.W.H., Guindon, S. (2016). PartitionFinder: combined 13 14 15 335 selection of partition schemes and substitution models for phylogenetics analyses. 16 17 336 Molecular biology and evolution, 29(6), 1695-1701. 18 19 337 https://doi.org/10.1093/molbev/mss020. 20 21 For Peer Review 22 338 Lanfear, R., Frandsen, P. B., Wright, A. M., Senfeld, T., & Calcott, B. (2016). 23 24 25 339 PartitionFinder 2: new methods for selecting partitioned models of evolution for 26 27 340 molecular and morphological phylogenetic analyses. Molecular biology and evolution, 28 29 341 34(3), 772-773. https://doi.org/10.1093/molbev/msw260. 30 31 32 33 342 Meldrum, D. J., & Kay, R. F. (1997). Nuciruptor rubricae, a new Pitheciin seed 34 35 343 predator from the Miocene of Colombia. American Journal of Physical Anthropology, 36 37 344 102(3), 407–427. https://doi.org/10.1002/(SICI)1096-8644(199703)102:3<407::AID- 38 39 40 345 AJPA8>3.0.CO;2-R. 41 42 43 346 Osterholz, M., Walter, L., & Roos, C. (2009). Retropositional events consolidate the 44 45 347 branching order among New World monkey genera. Molecular Phylogenetics and 46 47 348 Evolution, 50(3), 507-513. https://doi.org/10.1016/j.ympev.2008.12.014. 48 49 50 51 349 Palumbi, S., Martin, A., & Romano, S. (1991). 16s RNA primers. The simple fool's 52 53 350 guide to PCR, version, 2, 28. 54 55 56 57 58 59 60

John Wiley & Sons Page 17 of 42 American Journal of Primatology

Carneiro 17 1 2 3 4 351 Perelman, P., Johnson, W. E., Roos, C., Seuánez, H. N., Horvath, J. E., Moreira, […] & 5 6 7 352 Pecon-Slaterry, J. (2011). A molecular phylogeny of living primates. PLoS Genet, 7(3), 8 9 353 e1001342. https://doi.org/10.1371/journal.pgen.1001342. 10 11 12 354 Rambaut, A., Suchard, M., Xie, W., & Drummond, A. (2014). Tracer v. 1.6. Institute of 13 14 15 355 Evolutionary Biology, University of Edinburgh. 16 17 18 356 Ray, D. A., Xing, J., Hedges, D. J., Hall, M. A., Laborde, M. E., Anders, B. A., […] & 19 20 357 Cracraft, J. (2012). A palaeobiogeographic model for biotic diversification within 21 For Peer Review 22 358 Amazonia over the past three million years. Proceedings of the Royal Society B: 23 24 25 359 Biological Sciences, 279(1729), 681–689. https://doi.org/10.1098/rspb.2011.1120. 26 27 28 360 Ronquist, F., & Huelsenbeck, J. P. (2003). MrBayes 3: Bayesian phylogenetic inference 29 30 361 under mixed models. Bioinformatics, 19(12), 1572–1574. 31 32 33 362 https://doi.org/10.1093/bioinformatics/btg180. 34 35 36 363 Silva Júnior, J. S. (2013). Biogeography of the Amazonian primates. Conference at the 37 38 364 2nd Latin American Congress of Primatology and 15th Brazilian Congress of 39 40 41 365 Primatology. 42 43 44 366 Stamatakis, A. (2014). RAxML version 8: a tool for phylogenetic analysis and post- 45 46 367 analysis of large phylogenies. Bioinformatics, 30(9), 1312–1313. 47 48 368 https://doi.org/10.1093/bioinformatics/btu033 49 50 51 52 369 Tamura, K., Stecher, G., Peterson, D., Filipski, A., & Kumar, S. (2013). MEGA6: 53 54 370 Molecular Evolutionary Genetics Analysis Version 6.0. Molecular Biology and 55 56 371 Evolution, 30(12), 2725–2729. https://doi:org/10.1093/molbev/mst197. 57 58 59 60

John Wiley & Sons American Journal of Primatology Page 18 of 42

Carneiro 18 1 2 3 4 372 Teeling, E. C., Scally, M., Kao, D. J., Romagnoli, M. L., Springer, M. S., & Stanhope, 5 6 7 373 M. J. (2000). Molecular evidence regarding the origin of echolocation and flight in 8 9 374 bats. Nature, 403(6766), 188-192. https://doi.org/10.1038/35003188. 10 11 12 375 Thomas, O. (1903). XLIV.— Notes on South-American monkeys, bats, carnivores, and 13 14 15 376 rodents, with descriptions of new species. Annals and Magazine of Natural History, 16 17 377 12(70), 455-464. 18 19 20 378 Thompson, J. D., Higgins, D. G., & Gibson, T. J. (1994). CLUSTAL W: improving the 21 For Peer Review 22 379 sensitivity of progressive multiple sequence alignment through sequence weighting, 23 24 25 380 position-specific gap penalties and weight matrix choice. Nucleic Acids Research, 26 27 381 22(22), 4673-4680. https://doi:org/10.1093/nar/22.22.4673. 28 29 30 382 van Roosmalen, M. G. M., van Roosmalen, T., & Mittermeier, R. A. (2002). A 31 32 33 383 taxonomic review of the titi monkeys, genus Callicebus Thomas, 1903, with the 34 35 384 description of two new species, Callicebus bernhardi and Callicebus stephennashi, 36 37 385 from Brazilian Amazonia. Neotropical Primates, 10(Suppl.), 1–52. 38 39 40 386 https://doi:org/10.1007/s10533-007-9087-1. 41 42 43 387 Ward, R. D., Zemlak, T. S., Innes, B. H., Last, P. R., & Hebert, P. D. (2005). DNA 44 45 388 barcoding Australia's fish species. Philosophical Transactions of the Royal Society B: 46 47 389 Biological Sciences, 360(1462), 1847-1857. 48 49 50 51 390 Zang, C., Rabiee, M., Sayyari, E., & Mirarab, S. (2018). ASTRAL-III: polynomial time 52 53 391 species tree reconstruction from partially resolved gene trees. BMC bioinformatics, 54 55 392 19(6), 153. https://doi.org/10.1186/s12859-018-2129-y. 56 57 58 59 60

John Wiley & Sons Page 19 of 42 American Journal of Primatology

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 For Peer Review 20 21 22 23 24 25 26 27 338x190mm (96 x 96 DPI) 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 John Wiley & Sons American Journal of Primatology Page 20 of 42

1 2 3 Highlights: 4 5 6  Cheracebus is a genus of the subfamily Callicebinae; 7 8 9  Cheracebus lineages originated approximately 13 ma ago; 10 11 12  The phylogenetic relationships between the species of th genus Cheracebus are 13 14 as follows: ((C. torquatus, C. lugens), (C. lucifer, (C. purinus, C. regulus))). 15 16 17 18 19 20 21 For Peer Review 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

John Wiley & Sons Page 21 of 42 American Journal of Primatology

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 For Peer Review 20 21 22 23 24 25 Figure 1. Distribution map of Cheracebus species (Hershkovitz, 1990; van Roosmalen et al., 2002). Dotted 26 region represents a possible zone of sympathy between C. lugens and C. torquatus species. The symbols 27 represent the locations where the samples were collected. 28 338x190mm (96 x 96 DPI) 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 John Wiley & Sons American Journal of Primatology Page 22 of 42

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 For Peer Review 20 21 22 23 24 25 Figure 2. Phylogenetic relationships between taxa of the Pitheciidae family. Numbers near nodes refer to 26 bootstrap (left) and posterior probability (right) values. 27 28 338x190mm (96 x 96 DPI) 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 John Wiley & Sons Page 23 of 42 AmericanPlecturocebus Journal of Primatology moloch 1516

1 1 2 3 Plecturocebus cupreus 210 4 5 1 6 7 Callicebus personatus 2466 8 9 1 10 11 12 Callicebus nigrifrons 13 14 15 16 Cheracebus torquatus JPB81 17 18 19 20 Cheracebus lugens JPB124 21 22 0.78 23 1 24 Cheracebus lugens CTGAM119 25 1 26 0.9 27 28 Cheracebus lugens CTGAM136 29 0.87 30 31 32 33 Cheracebus lugens CTGAM734 34 35 0.81 36 37 Cheracebus lugens CTGAM733 38 0.37 39 For Peer Review 40 41 Cheracebus lugens CTGAM753 42 43 44 1 45 Cheracebus purinus CTGAM209 46 47 48 1 49 Cheracebus purinus CTGAM154 50 51 0.79 52 53 54 Cheracebus purinus CTGAM195 55 56 1 57 58 Cheracebus regulus JT54 59 60 0.51 Cheracebus regulus JT61 1

0.87 Cheracebus regulus JT53 0.59 Cheracebus regulus JT71

Cheracebus lucifer CTGAM703

0.95 Cheracebus lucifer CTGAM727 0.33 Cheracebus lucifer CTGAM726

Pithecia

1 Chiropotes 1 Cacajao

John Wiley & Sons 0.8 American Journal of Primatology Page 24 of 42

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 For Peer Review 20 21 22 23 24 25 Figure 4. Estimated divergence time between Pitheciidae taxa. Each genus has a color: blue to Cheracebus, 26 green to Callicebus, orange to Plecturocebus, yellow to Chiropotes; pink to Cacajao and red to Pithecia. (*) 27 highlights clade of C. lugens on the left bank of the river Negro, while (+) indicates the samples collected on 28 the right bank of this river. Numbers next node represent the average time estimated by cladogenesis 29 338x190mm (96 x 96 DPI) 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 John Wiley & Sons Page 25 of 42 American Journal of Primatology

1 2 3 4 Table 1. Hypotheses for classification of titi monkeys. 5 6 Kobayashi and Langguth 7 Hershkovitz (1988, 1990) van Roosmalen et al. (2002) Groves (2005) Byrne et al., (2016) 8 (1999) 9 Subgenus Callicebus 10 11 Callicebus donacophilus Callicebus donacophilus Callicebus donacophilus Callicebus group Genus Plecturocebus 12 group group group 13 C. d. donacophilus C. modestus C. modestus C. donacophilus P. modestus 14 C. d. pallescens C. d. donacophilusFor PeerC. donacophilus ReviewC. pallescens P. donacophilus 15 16 C. oenanthe C. d. pallescens C. pallescens C. oenanthe P. pallescens 17 C. olallae C. olallae C. oenanthe C. olallae P. oenanthe 18 19 C. olallae P. olallae 20 P. moloch 21 Callicebus moloch group Callicebus moloch group Callicebus moloch group Callicebus moloch group P. cinerascens 22 C. moloch C. moloch C. moloch C. moloch P. brunneus 23 24 C. cinerascens C. cinerascens C. cinerascens C. cinerascens P. hoffmannsi 25 C. cupreus cupreus C. brunneus C. brunneus C. brunneus P. baptista 26 27 C. c. discolor C. hoffmannsi hoffmannsi C. hoffmannsi C. hoffmannsi P. bernhardi 28 C. c. ornatos C. h. baptista C. baptista C. baptista P. cupreus 29 C. caligatus C. bernhardi C. bernhardi P. caligatus 30 31 C. brunneus P. discolor 32 C. hoffmannsi hoffmannsi Callicebus cupreus group Callicebus cupreus group Callicebus cupreus group P. ornatos 33 C. h. baptista C. c. cupreus C. cupreus C. cupreus P. dubius 34 35 C. dubius C. c. discolor C. caligatus C. caligatus P. stephennashi 36 C. personatus personatus C. ornatos C. discolor C. discolor P. aureipalatii 37 38 C. p. melanochir C. ornatos C. ornatos P. toppini 39 40 41 42 43 John Wiley & Sons 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 American Journal of Primatology Page 26 of 42

1 2 3 4 C. p. nigrifrons C. dubius C. dubius P. urubambensis 5 6 C. p. barbarabrownae C. stephennashi C. stephennashi P. miltoni 7 Callicebus modestus group Callicebus modestus group P. vieirai 8 9 C. modestus C. modestus P. caquetensis 10 Callicebus personatus group Callicebus personatus group Callicebus personatus group Genus Callicebus 11 C. personatus C. personatus C. personatus C. personatus 12 13 C. melanochir C. melanochir C. melanochir C. melanochir 14 C. nigrifronsFor PeerC. nigrifrons ReviewC. nigrifrons C. nigrifrons 15 C. barbarabrownae C. barbarabrownae C. barbarabrownae C. barbarabrownae 16 17 C. coimbrai C. coimbrai C. coimbrai C. coimbrai 18 Callicebus torquatus group Callicebus torquatus group Callicebus torquatus group CallicebusSubgênero torquatusTorquatus group Genus Cheracebus 19 C. t. torquatus C. t. torquatus C. torquatus C. torquatus C. torquatus 20 21 C. t. lugens C. t. lugens C. lugens C. lugens C. lugens 22 C. t. lucifer C. t. lucifer C. lucifer C. lucifer C. lucifer 23 24 C. t. purinus C. t. purinus C. purinus C. purinus C. purinus 25 C. t. regulus C. t. regulus C. regulus C. regulus C. regulus 26 27 C. t. medemi C. t. medemi C. medemi C. medemi C. medemi 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 John Wiley & Sons 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 Page 27 of 42 American Journal of Primatology

1 2 3 4 Table 2. Samples used in the present study and their respective codes, origins and locations. 5 6 Specie Code Origin Locality 7 8 Cheracebus torquatus JPB81 INPA Mandiquie, right bank of river Negro, Amazonas, Brazil 9 Cheracebus lugens JPB119 INPA Marari, left bank of river Negro, Amazonas, Brazil 10 Cheracebus lugens JPB124 INPA Igarapé Anta, left bank of river Negro, Amazonas, Brazil 11 12 Cheracebus lugens JPB136 INPA Igarapé Cuieiras, left bank of river Negro, Amazonas, Brazil 13 Cheracebus lugens CTGAM733 UFAM Left bank of river Japurá, Amazonas, Brazil 14 Cheracebus lugens CTGAM734ForUFAM Peer LeftReview bank of river Rio Japurá, Amazonas, Brazil 15 Cheracebus lugens CTGAM753 UFAM Left bank of river Japurá, Amazonas, Brazil 16 17 Cheracebus purinus CTGAM154 UFAM Rebio Abufari, left bank of river Purus, Amazonas, Brazil 18 Cheracebus purinus CTGAM195 UFAM Rebio Abufari, left bank of river Purus, Amazonas, Brazil 19 Cheracebus purinus CTGAM209 UFAM Rebio Abufari, left bank of river Purus, Amazonas, Brazil 20 21 Cheracebus lucifer CTGAM703 UFAM Right bank of river Rio Japurá, Amazonas, Brazil 22 Cheracebus lucifer CTGAM726 UFAM Right bank of river Rio Japurá, Amazonas, Brazil 23 Cheracebus lucifer CTGAM727 UFAM Right bank of river Rio Japurá, Amazonas, Brazil 24 25 Cheracebus regulus JT053 UFPA Right bank of river Jutaí, Amazonas, Brazil 26 Cheracebus regulus JT054 UFPA Right bank of river Jutaí, Amazonas, Brazil 27 Cheracebus regulus JT061 UFPA Right bank of river Jutaí, Amazonas, Brazil 28 Cheracebus regulus JT071 UFPA Right bank of river Jutaí, Amazonas, Brazil 29 30 Plecturocebus moloch Cmo 1690 UFPA Left bank of river Tocantins, Amazonas, Brazil 31 Plecturocebus brunneus Cbr 2220 UFPA Right bank of river Jamari, Rondonia, Brazil 32 Plecturocebus cupreus Ccu 4986 UFPA Left bank of river Madeira, Amazonas, Brazil 33 34 Callicebus melanochir melan 2329 CNRJ Eunápolis, Bahia, Brazil 35 Callicebus personatus perso 2466 CNRJ Aracruz, Espirito Santo, Brazil 36 Callicebus nigrifrons 04 PUC Minas Gerais, Brazil 37 38 Chiropotes albinasus CTGAM5663 UFPA Right bank of river Tapajos 39 40 41 42 43 John Wiley & Sons 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 American Journal of Primatology Page 28 of 42

1 2 3 4 Cacajao calvus CTGAM5666 UFPA No information 5 6 Pithecia pithecia Pit 22 UFPA Left bank of river Jari, Amapá, Brasil 7 8 9 10 11 12 13 14 For Peer Review 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 John Wiley & Sons 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 Page 29 of 42 American Journal of Primatology

1 2 3 4 Table 3. Molecular markers used in this study, with their annealing temperatures and references. 5 6 Molecular Annealing Primer forward Primer reverse Reference 7 markers Temperature 8 9 Mitochondrial 10 11 16 S 5' TGGACTATGAGTTGAGCAGAC 3' 5' TATGCTAATTACTCTTCTTGGGC 3' 58 °C Palumbi et al. (1991) 12 COI 5' TCCATTACCAGGCCAGCTAG 3' 5' GAACTTGCTGGCTTTCATATC 3' 45 °C Ward et al. (2005) 13 CYT b 5’ GCACCTACCCACGAAAAGAA 3’ 5’ ACATTGCCTCTGCAAATTGA 3’ 60 °C Carneiro et al. (2016) 14 For PeerNuclear Review 15 16 Pith_Alu1D_24 5’ AAGCCATAACTCCATTACCAAA 3’ 5’ AGATTCTGGTCCCAAGTCCA 3’ 60 ° C Ray et al. (2005) 17 Pith_Alu1D_26 5’ GTTTCATGAGGGCAGAACCT 3’ 5’ TCTGCACTTTGCAGCTGTTT 3’ 60 °C Ray et al. (2005) 18 Pith_Alu1D_27 5’ AACCACATTTTGACTGTATGCTG 3’ 5’ CCCTTCAATGACTCCCTTCA 3’ 57 °C Ray et al. (2005) 19 20 Pith_Alu1D_30 5’ CATGGGACATGCACTTTTTG 3’ 5’ AACAYCTTYCATCAACCTYTGAA 3’ 61 °C Ray et al. (2005) 21 Titi_1DF2_39 5’AACAGAGTTGGCCGTTCATCT 3’ 5’ GTCCTGTTCAAGTCAGCTACGTTG 3’ 54 °C Ray et al. (2005) 22 Pith_Alu1D_84 5’ CTGCTACGTCAGACGTCGTAC 3’ 5’ CTGCTAGCACAAGCTAGTCGA 3’ 62 °C Ray et al. (2005) 23 Pitheciidae2 5’ CAGCCAAAGGAGTGCTTCAC 3’ 5’ CTAAATGGTGYCCCATAAGG 3’ 58 °C Osterholz et al. (2009) 24 25 Pitheciidae3 5’ CGGGGGCCTGATTACTAAAA 3’ 5’ ACCAAAYATAGGCCTCRAATT 3’ 53 °C Osterholz et al. (2009) 26 Pitheciidae4 5’ GCTGGACTATTCCTTGCCATC 3’ 5’ CAGGCATCCTGTTTGGAATTA 3’ 56 °C Osterholz et al. (2009) 27 DENND5A1 5’ CCAGAGTTATCATGGCCAATC 3’ 5’ GTACCAAGCAAGAAGCTGGG 3’ 62 °C Perelman et al. (2011) 28 SIM1 5' GACCTACCGCAGAAAATTCG 3' 5' CTGGGGCTCATCATTCATTC 3' 60 °C Perelman et al. (2011) 29 30 ZFX 5' TGGAATGAAATCCCTCAAATA 3' 5' ATGTCCATCAGGGCCAATAAT 3' 52 °C Perelman et al. (2011) 31 RAG1 5’ GCTTTGATGGACATGGAAGAAGACAT 3’ 5’ GAGCCATCCCTCTCAATAATTTCAGG 3’ 47 °C Teeling et al. (2000) 32 33 34 35 36 37 38 39 40 41 42 43 John Wiley & Sons 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 American Journal of Primatology Page 30 of 42

1 2 3 Table 4. Genetic distance between species of the genus Cheracebus and taxa of the 4 family Pitheciidae. 5 6 1 2 3 4 5 6 7 8 9 10 7 1 Cheracebus lugens * 8 9 2 Cheracebus lugens + 1.47 10 3 Cheracebus torquatus 1.67 1.73 11 4 Cheracebus regulus 2.80 3.27 2.67 12 13 5 Cheracebus purinus 3.39 4.00 3.38 0.97 14 6 Cheracebus lucifer 3.59 3.79 3.18 2.01 2.92 15 16 7 Plecturocebus 13.7 13.3 12.6 13.1 13.9 13.2 17 8 Callicebus 12.6 12.4 12.3 12.7 13.3 12.9 13.0 18 9 19 Chiropotes 22.4 22.3 21.6 22.1 22.6 22.7 21.8 22.4 20 10 Cacajao 21.1 20.9 20.3 20.8 21.3 21.4 22.0 21.1 12.7 21 11 Pithecia For Peer27.6 27.4 Review25.3 25.2 24.9 26.7 25.7 25.9 17.9 16.2 22 23 * and + mean left and right bank of the river Negro, respectively. 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

John Wiley & Sons Page 31 of 42 American Journal of Primatology

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 For Peer Review 20 21 22 23 24 25 26 27 338x190mm (96 x 96 DPI) 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 John Wiley & Sons American Journal of Primatology Page 32 of 42

1 2 3 Table S1. Markers and their access numbers in GenBank. 4 5 Marker Access number range 6 7 ZFX MT011236 MT011248 8 SIM 1 MT011223 MT011235 9 Alu_Pitheciidae4 MT011205 MT011222 10 Alu_Pitheciidae3 MT011186 MT011204 11 Alu_Pitheciidae2 MT011167 MT011185 12 Pith_Alu1D_84 MT011148 MT011166 13 Titi_1DF2_39 MT011128 MT011147 14 15 Pith_Alu1D_30 MT011113 MT011127 16 Pith_Alu1D_27 MT011092 MT011112 17 Cytochrome b MN998472 MN998495 18 rRNA 16S MT002404 MT002424 19 Cytochrome oxidase I MN998547 MN998570 20 Pith_Alu1D_26 MN998449 MN998471 21 Pith_Alu1D_24 For PeerMN998428 Review MN998448 22 23 RAG 1 MN998418 MN998427 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

John Wiley & Sons Page 33 of 42 American Journal of Primatology

1 2 3 Table S2. Data partitioning scheme, markers and respective evolutionary models. 4 5 Number Evolutionary Numbers 6 of Partition names 7 Models of sites 8 Partitions 9 All molecular markers 10 Cyt B_pos1, 16S, SIM1, RAG1_pos2, Cyt 11 B_pos2, COI_pos2, Alu84, RAG1_pos3, 12 I Alu27, PITH3, RAG1_pos1, DENND5A, TRN+G 9191 13 COI_pos1, Alu39, PITH2, Alu30, Alu26, 14 15 ZFX, PITH4, Alu24 16 II COI_pos3, CYTB_pos3 TRN+G 564 17 Only nuclear markers 18 Alu24, Alu26, Alu27, Alu30, Alu39, Alu84, 19 DENND5A, PITH2, PITH3, PITH4, HKY+G I 7574 20 RAG1_pos1, RAG1_pos2, RAG1_pos3, 21 SIM1, ZFXFor Peer Review 22 23 Only mitochondrials markers 24 I 16S, COI_pos1, Cyt B_pos1 GTR+G 1052 25 II COI_pos2, Cyt B_pos2 HKY+I 565 26 III COI_pos3, Cyt B_pos3 TRN+G 564 27 28 Individual molecular markers 29 16S GTR+G 486 30 COI GTR+G 623 31 Cyt B GTR+I 1072 32 33 Alu24 GTR 330 34 Alu26 GTR 390 35 Alu27 GTR+G 636 36 Alu30 GTR 693 37 Alu39 GTR 431 38 39 Alu84 GTR 480 40 DENND5A GTR 637 41 PITH2 GTR 179 42 PITH3 GTR 537 43 44 PITH4 GTR 491 45 RAG1 GTR+I 1030 46 SIM1 GTR 603 47 ZFX GTR 809 48 49 50 51 52 53 54 55 56 57 58 59 60

John Wiley & Sons American Journal of Primatology Page 34 of 42

1 2 3 Table S3. Genetic distance of nuclear data between species of the genus Cheracebus and 4 taxa of the family Pitheciidae. 5 6 1 2 3 4 5 6 7 8 9 10 7 1 Cheracebus lugens * 8 9 2 Cheracebus lugens + 0.26 10 3 Cheracebus torquatus 0.37 0.30 11 4 Cheracebus regulus 1.22 0.40 0.45 12 13 5 Cheracebus purinus 0.84 0.65 0.48 0.27 14 6 Cheracebus lucifer 1.13 0.27 0.47 0.38 0.55 15 16 7 Plecturocebus 2.71 3.24 1.47 3.58 2.60 3.56 17 8 Callicebus 2.95 3.47 1.59 3.76 2.75 3.84 1.64 18 9 19 Chiropotes 4.67 6.63 4.05 6.47 4.33 6.47 4.40 4.95 20 10 Cacajao 4.07 6.92 4.86 6.62 3.89 6.52 3.90 4.16 1.79 21 11 Pithecia For Peer4.22 6.18 Review4.48 6.44 4.19 6.31 4.13 4.88 2.25 1.75 22 23 * and + mean left and right bank of the river Negro, respectively. 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

John Wiley & Sons Page 35 of 42 American Journal of Primatology

1 2 3 Table S4. Genetic distance of mitochondrial data between species of the genus 4 Cheracebus and taxa of the family Pitheciidae 5 6 7 1 2 3 4 5 6 7 8 9 10 8 1 Cheracebus lugens * 9 2 Cheracebus lugens + 1.89 10 11 3 Cheracebus torquatus 1.91 1.56 12 4 Cheracebus regulus 3.54 3.32 3.50 13 5 14 Cheracebus purinus 3.90 3.63 3.56 1.16 15 6 Cheracebus lucifer 4.25 3.42 3.36 3.06 3.12 16 7 Plecturocebus 12.40 12.39 13.10 11.80 12.21 13.41 17 18 8 Callicebus 12.22 12.57 13.22 11.89 12.44 13.26 12.13 19 9 Chiropotes 17.99 18.54 20.14 17.94 18.68 19.83 18.59 18.74 20 10 21 Cacajao For 17.15Peer17.26 18.54Review16.62 17.40 18.36 18.38 18.03 10.26 22 11 Pithecia 18.04 18.68 20.13 18.36 18.42 20.14 19.25 18.66 13.27 12.95 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

John Wiley & Sons American Journal of Primatology Page 36 of 42

1 2 3 4 Dear Dr. Carneiro, 5 6 7 I thank you for submitting your manuscript AJP-19-0267 entitled "Phylogenetic 8 9 relationships in the genus Cheracebus (Callicebinae, Pitheciidae)" for 10 11 review and publication in the American Journal of Primatology. In light of my 12 reading of your paper, as well as the evaluation of your Review Editor and the 13 14 comments of the external reviewers, I am pleased to inform you that your paper 15 16 is accepted pending minor revisions. 17 18 19 In addition to addressing the comments below, please include information 20 21 regarding the ethicalFor approvals Peer for collection Review of the subject 22 23 specimens. Specifically, please confirm both that the protocols were approved 24 25 by the respective institutions, and that the research complied with the American 26 Society of Primatologists Ethical Principles for the Treatment of Non-Human 27 28 Primates. 29 30 R= We incorporated in the manuscript the license number of the collection and 31 that the research followed the ethical principles of American Society of 32 33 Primatologists. 34 35 36 37 When submitting your revised manuscript, please provide an itemized response 38 to reviewer(s) comments in the space labeled "Response to Decision Letter." 39 40 Please note that if you copy and paste your response from a separate 41 42 document, bold, italicized, and colored text from the original document will 43 44 appear as black, upright/roman text. 45 46 47 Please make these revisions within two months or less from the date of this 48 49 letter. 50 51 52 You can upload your revised manuscript and submit it through your Author 53 54 Center. Log into https://mc.manuscriptcentral.com/ajp and enter your Author 55 56 Center, where you will find your manuscript title listed under "Manuscripts with 57 58 Decisions". 59 60

John Wiley & Sons Page 37 of 42 American Journal of Primatology

1 2 3 4 5 IMPORTANT: We have your original files. When submitting (uploading) your 6 7 revised manuscript, please delete the file(s) that you wish to replace and then 8 9 upload the revised file(s). 10 11 12 Your article cannot be published until the corresponding author has signed the 13 14 appropriate license agreement. Once the manuscript is accepted, the 15 16 corresponding author will receive an email from Wiley’s Author Services system 17 18 which will ask them to log in and will present them with the appropriate license 19 for completion. 20 21 For Peer Review 22 23 We thank you for submitting your work to the American Journal of Primatology, 24 25 and look forward to receiving your revised manuscript. 26 27 28 Sincerely, 29 30 31 Dr. Karen Bales 32 33 Editor-in-Chief, American Journal of Primatology 34 35 [email protected] 36 37 38 39 40 41 42 43 44 EDITOR COMMENTS TO AUTHORS: 45 Review Editor: Vigilant, Linda 46 47 Comments to the Author: 48 49 The authors present a focused study on the phylogenetic relationships of the titi 50 51 monkeys that should be of interest to readers of AJP with a particular interest in 52 primate phylogenies. I find it well-written, but concur with the reviewers that 53 54 further experimental/analytical detail is needed and also that it is not acceptable 55 56 to concatenate mitochondrial and nuclear sequences for analyses. Please see 57 58 the review for detailed suggestions and I look forward to seeing a revised 59 version of the manuscript soon. 60

John Wiley & Sons American Journal of Primatology Page 38 of 42

1 2 3 4 5 6 7 REVIEWER COMMENTS TO AUTHORS: 8 9 Reviewing: 1 10 11 12 Comments to the Author 13 14 The authors investigate phylogenetic relationships among 5 of the 6 species of 15 16 Cheracebus. The authors can show that Cheracebus is indeed monophyletic 17 18 and the branching pattern among the species is well resolved. The manuscript 19 is well written, but some rewording is required. Methods and Results are well 20 21 presented, but I am Fora little bit Peer concerned Review about the fact that all analyses are 22 23 done with a concatenated dataset; thus I recommed to redo some of the 24 25 analyses. 26 R= We performed analyzes of mitochondrial and nuclear data separately. 27 28 Additionally, we carried out a coalescent analysis following the suggestion of 29 30 the reviewer 2. 31 32 33 Major points: 34 35 1. you use a concatenated dataset for all analyses. At least mitochondrial and 36 37 nuclear data should be analysed separately; this concerns the phylogenetic 38 trees, the dating as well as the genetic distance calculation. Particulary for the 39 40 distance calculation, one would expect much larger differences in mtDNA 41 42 compared to nuclear DNA. Trees based on the combined dataset can be 43 44 presented as main figures and the individual trees in the supplement. 45 R= We performed analyzes of mitochondrial and nuclear data separately, the 46 47 trees were included in the supplementary files. We also perform genetic 48 49 distance analysis with mitochondrial and nuclear data separately. 50 51 52 2. please provide more information about the calibration points for dating: what 53 54 settings were used in BEAST? Are the 2 points based on fossils, previous 55 56 molecular dating, etc.? please give here more information. Probably also good 57 58 to include addtional NWM genera and use more fossil-based calibrations 59 60

John Wiley & Sons Page 39 of 42 American Journal of Primatology

1 2 3 4 R= We used a fossil and a calibration based on previous study. We rewrote this 5 part of the text and include the appropriate reference to clarify. 6 7 8 9 3. I can not find any information about the applied substitution models for the 10 11 overall dataset or individual loci 12 R= We made a table that shows all the evolutionary models used in this study. 13 14 15 16 Minor points: 17 18 1. Please check the numbers of your affiliations; they are not in order 19 2. l32 and l97: based on DNA sequencing of 16 20 21 3. l44: 13 million yearsFor ago Peer Review 22 23 4. l81: which placed purinus in the 24 25 5. l91: Roosmalen et al. (2002) 26 6. l113: Total genomic DNA 27 28 7. l119: 30ng of genomic DNA 29 30 8. l122, l125 and Table3: annealing instead of hybridizing/hybridization 31 9. l127: ethanol instead of alcohol; ... were run with the Big Dye 32 33 10. l138: The ML trees 34 35 11. l140-2: with two independent Markov chain Monte Carlo (MCMC) runs, with 36 37 500,000 generations, and trees and parameters sampled every 5000 38 generations. 39 40 12. l144: estimated with MEGA (xxx) (Tamura et al. 2013).; add also what 41 42 version was used 43 44 13. l147: abbreviation Ma is not explained before 45 14. l151: LogCombiner v.1.8.3 and TreeAnnotator 46 47 15. l163: the clade composed of 48 49 16. l191: remove bracket after Callicebus 50 51 17. l200: which is consistent eith the morphological data 52 18. Figures 1 and 2: both can be lumped into one 53 54 19. Table1: check arrangements in the Hershkovitz (1990) column 55 56 20. Table2: Genebank accession number sare missing; could be added to 57 58 Table 2 or somewhere else 59 60

John Wiley & Sons American Journal of Primatology Page 40 of 42

1 2 3 4 21. Table3: Mitochondrial instead of Mitochondrials; reference are not in 5 reference list; emty space in reverse primer for RAG1; annealing NOT 6 7 hybridization 8 9 R= Thanks for the corrections, all minor points were corrected. 10 11 12 Reviewing: 2 13 14 15 16 Comments to the Author 17 18 This work is a straightforward analysis of the phylogeny of a new genus of titi 19 monkeys. The authors set out to test the monophyly of the newly proposed 20 21 Cheracebus genus ofFor neotropical Peer primates. Review Using a larger sampling of loci, they 22 23 confirmed earlier taxonomic proposals. Overall, their results are convincing, and 24 25 the authors avoided going into speculations regarding the biogeography and 26 causes of Cheracebus diversification. Because the subject of the manuscript is 27 28 rather restricted, it will be of interest mainly to primatologists working on 29 30 neotropical primate systematics. However, I think this is not a drawback. The 31 only effective shortcoming is the absence of Cheracebus medemi sequences, 32 33 which prevented the authors to make a de facto evaluation of the monophyly of 34 35 the genus. 36 37 38 The authors should correct/clarify the following points: 39 40 41 42 - The authors should justify the concatenation of all loci into a single supergene 43 44 instead of analyzing them independently. Although it is expected that 45 mitochondrial genes will share the same evolutionary history, nuclear loci may 46 47 have different histories if they are located either in different chromosomes or 48 49 distantly enough in the same chromosome (a measure that will depend on the 50 51 recombination rate). To make their work richer - and to further corroborate their 52 findings - I suggest the authors to run a coalescent-based phylogenetic 53 54 inference. You can try fast methods such as ASTRAL. There is no need to run a 55 56 full coalescent inference in BEST, *BEAST or BPP (this will take many days and 57 58 parameters will likely fail to converge). It might be the case that the coalescent- 59 based phylogeny will be topologically identical to ML/BI. This is fine, because at 60

John Wiley & Sons Page 41 of 42 American Journal of Primatology

1 2 3 4 least the methodological section will be improved: it is reasonable to employ 5 such methods particularly when dealing with shallow divergences. 6 7 R= We performed analyzes of mitochondrial and nuclear data separately. 8 9 Additionally, we carried out a coalescent analysis ASTRAL III. 10 11 12 - Figure 2 should be corrected (text in Portuguese in figure). 13 14 R= corriged. A new map was made 15 16 17 18 - The Methods section needs to be expanded. Please provide detailed 19 information on the model of nucleotide substitution used in ML, BI and BEAST 20 21 analyses. For Peer Review 22 23 R= We made a table that shows all the evolutionary models used in this study. 24 25 26 - Which node was calibrated by "the pitheciine fossil, Nuciruptor rubricae 27 28 (Meldrum & Kay, 1997), dated to 14812.4–12.8 Ma." Was it the root node? 29 30 R= We used a fossil and a calibration based on previous study. We rewrote this 31 part of the text and include the appropriate reference to clarify. 32 33 34 35 - "The 16 nuclear and mitochondrial markers provided a database of 9755 base 36 37 pairs (bps), 2300 bps from the mitochondrial sequences, and 7455 bps from the 38 nuclear sequence". An alignment of 9755 base pairs (bps)? 39 40 R= Yes, it is the alignment of the concatenated loci. We corrected that part of 41 42 the text, the complete alignment actually has 9427 base pairs. 43 44 45 - "All the species were identified as monophyletic". I suggest using "All allelic 46 47 diversity within species was reciprocally monophyletic". 48 49 R= We made the suggested change 50 51 52 53 54 - "is virtually the same as that of the first diversification within the callicebines" -- 55 56 > close to the first? 57 58 R= there was a mistake. We wanted to refer to another node. The Split of 59 Pithecia from the other pithecineos (Cacajao and Chiropotes). 60

John Wiley & Sons American Journal of Primatology Page 42 of 42

1 2 3 4 5 - "are the species with the shortest divergence time" --> earliest divergence 6 7 time? 8 9 R= We were referring to the most recent speculations within the genus 10 11 Cheracebus. We rewrote to clarify 12 13 14 - Please clarify what you mean by "patterns of genetic drift". 15 16 R= We referred to random genetic drift events in different species. But we 17 18 decided to remove that part of the text 19 20 21 For Peer Review 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60

John Wiley & Sons