Role of Viruses Within Metaorganisms: Ciona Intestinalis As a Model System Brittany A

University of South Florida Scholar Commons

Graduate Theses and Dissertations Graduate School

September 2017 Role of viruses within metaorganisms: Ciona intestinalis as a model system Brittany A. Leigh University of South Florida, [email protected]

Follow this and additional works at: https://scholarcommons.usf.edu/etd Part of the Immunology and Infectious Disease Commons, Microbiology Commons, and the Other Oceanography and Atmospheric Sciences and Meteorology Commons

Scholar Commons Citation Leigh, Brittany A., "Role of viruses within metaorganisms: Ciona intestinalis as a model system" (2017). Graduate Theses and Dissertations. https://scholarcommons.usf.edu/etd/7420

This Dissertation is brought to you for free and open access by the Graduate School at Scholar Commons. It has been accepted for inclusion in Graduate Theses and Dissertations by an authorized administrator of Scholar Commons. For more information, please contact [email protected].

Role of viruses within metaorganisms:

Ciona intestinalis as a model system

Brittany A. Leigh

A dissertation submitted in partial fulfillment of the requirements for the degree of Doctorate of Philosophy College of Marine Science University of South Florida

Co-Major Professors: Dr. Larry J. Dishaw, Ph.D. and Dr. Mya Breitbart, Ph.D. John Paul, Ph.D. John P. Cannon, Ph.D. Kristen Buck, Ph.D. Gary W. Litman, Ph.D.

Date of Approval: August 29, 2017

Keywords: Ciona, bacteriophage, innate immunity, microbiome, prophage, biofilm

TABLE OF CONTENTS

LIST OF FIGURES…………………………………………………………………….……….iii

ABSTRACT……………………………………………………………………...... iv

INTRODUCTION………………………………………………………………………………..1 1.1 The metaorganism….…………………………………………………….....….1 1.2 The animal immune system…………………………………………………....2 1.3 Host-associated bacterial communities…………...………………...………..4 1.4 Host-associated viral communities…………………………………………....5 1.5 The gut environment………………………………..…………………..…....…7 1.6 The model system: Ciona intestinalis……………………………………..…..8

RESEARCH OVERVIEW…………………………………………………...... 12

DISCUSSION…………………………………………………………………………………..17

REFERENCES………………………………………………………………………………...28

APPENDIX A: An immune effector system in the protochordate gut sheds light on the fundamental aspects of vertebrate immunity……………………………………….………35

APPENDIX B: Generation of germ-free Ciona intestinalis for studies of gut-microbe interactions………………………………………………………………………………..…....51

APPENDIX C: The gut virome of the protochordate model organism, Ciona intestinalis……………………………………………………………………………..….…....60

APPENDIX D: Isolation and characterization of a Shewanella phage-host system from the gut of the tunicate, Ciona intestinalis……………………………………….…..……....95

APPENDIX E: Induced prophages from resident lysogens cultured from the Ciona intestinalis gut demonstrate lytic infection against co-occurring bacteria………………………………………………………………………………………..112

APPENDIX F: Secretory immune effector-mediated induction of prophages from lysogenic gut bacteria…………….…………………………..……………………………..139

LIST OF FIGURES

Figure1: The metaorganism concept……………………………………………..…………11

Figure 2: Phylogenetic tree of major animal groups………………………………...……..11

iii

ABSTRACT

Marine animals live and thrive in a literal sea of microorganisms, yet are often able to maintain specific associations that are largely dictated by the environment, host immunity and microbial interactions. Animal-associated microbiomes include bacteria and viruses that vastly outnumber host cells, especially in the gut environment, and are considered to be integral parts of healthy, functioning animals that act as a metaorganism. However, the processes underlying the initial establishment of these microbial communities are not very well understood. This dissertation focuses on the establishment of a well-known developmental animal model, Ciona intestinalis (sea squirt), to study the establishment and maintenance of a stable gut microbiome.

Generation of a new model for studying microbial colonization of the gut requires the ability to rear Ciona in the absence of microbes (i.e., germ-free). This dissertation describes the establishment of a germ-free technique for rearing Ciona and the methods utilized for bacterial exposure and colonization. Additionally, to determine the spatial structure of the gut microbiome, viral and bacterial communities within the three main gut compartments (stomach, midgut, hindgut) of Ciona from San Diego, CA, were assessed. The viral community was dominated by phages (viruses infecting bacteria), and numerous prophages (phages integrated into bacterial genomes) matching sequences found in bacteria belonging to the Ciona microbiome were detected within the active viral fraction. To determine the prevalence of prophages within the Ciona microbiome, a total of 70 bacteria cultured from the gut were tested, and 22 isolates were found to possess inducible prophages. When co-cultured with other bacteria,

these induced prophages were capable of lytic infection of other members of the microbiome, often exhibiting broad host ranges.

The dynamic interactions of gut bacteria and phages were explored further with the isolation and characterization of a novel Shewanella phage-host system from the adult Ciona gut. Lytic phage infection resulted in an increase in biofilm formation correlating with the release of extracellular DNA, a process that was also observed to a lesser degree in control cultures as a result of spontaneous prophage induction.

Furthermore, addition of the Ciona immune protein VCBP-C to static cultures of this

Shewanella sp. 3313 also enhanced biofilm formation; a similar phenomenon was noted in another bacteria, a Pseudoalteromonas sp. 6751. Interestingly, both of these isolates contained inducible prophages and binding of the VCBP-C protein to these lysogenic strains was found to influence prophage induction in vitro. Colonization of the gut in vivo also correlated with differential up-regulation of VCBP-C expression in germ-free animals and a subsequent induction of prophages.

This dissertation makes an important contribution to the symbiosis field by developing a new model system in which novel aspects of host-microbe interactions can be investigated. The discovery that an innate immune effector can influence bacterial biofilms and result in the induction of prophages capable of lytic infection of other co- occurring bacteria reveals a previously unrecognized intersection between secretory immune molecules and phages in shaping the microbiome. These findings establish

Ciona as a relevant and tractable model for studying trans-kingdom interactions during colonization of the gut epithelium.

v INTRODUCTION

The metaorganism

All eukaryotes maintain complex relationships with an assortment of microbes that are often vital to maintaining homeostasis, a stable balance between an animal host and its microbiota (Tlaskalova-Hogenova et al., 2004). Co-evolution of these complex systems has resulted in extensive assimilation of both the physiology and genetics of each partner involved (Rosenberg and Zilber-Rosenberg, 2011) and a strong inter-dependency for survival. Mucosal surfaces of animals, such as the gut, house large communities of symbiotic microbes including bacteria, viruses and fungi

(Lloyd-Price et al., 2016), yet these host surfaces are able to distinguish between commensal and pathogenic microbes through a variety of mechanisms including innate signaling pathways such as Toll-like receptors (TLRs) or the inflammasome (Kau et al.,

2011). Because of the inability of animals to live healthy lives without their microbes in nature, a new paradigm has emerged, viewing animals as metaorganisms and considering all of the associated microbes when studying animal biology and evolution

(Figure 1) (Bourne et al., 2009; Dittmer et al., 2016; Fraune and Bosch, 2010; McFall-

Ngai et al., 2013; Minard et al., 2013).

The structure and/or composition of the metaorganism is often specific to each species and disruptions of these associations frequently results in detrimental outcomes such as disease (Levy et al., 2017) or improper development (Lee and Mazmanian,

2010). This functional unit, therefore, is fundamental in tissue and immune system development and regulation vital for host survival (Rooks and Garrett, 2016).

Understanding the biology and evolution of animals requires an ecological and systems

1 approach, considering all of the interactions with both the external environment as well as all associated microorganisms. This dissertation examines three critical components of the metaorganism, namely the host immune system, as well as associated bacterial and viral communities in an effort to understand the dynamics shaping the colonization of microbial communities in naïve host gut tissue.

The animal immune system

Host immunity plays a fundamental role in maintaining specific relationships with microbes without allowing pathogens to invade (Levy et al., 2017; Tlaskalova-Hogenova et al., 2004). The animal immune system is traditionally described as the tissues, cells and molecules that are able to discriminate between “self” and “non-self”. This system not only functions in defense but also in order to establish and maintain homeostasis.

All metazoans possess some form of an immune system and are able to sustain symbiotic relationships with microorganisms using primarily innate immune mechanisms. However, only gnathostome (i.e., jawed) vertebrates possess adaptive immunity, a branch of the immune system encompassing the B and T lymphocytes bearing clonally derived antigen-specific receptors, such as T cell receptors (TCRs) and immunoglobulins (Igs). The specificity of these receptors is generated through somatic recombination that yields extremely large numbers of somatic (i.e., non-heritable) antigen recognition sites. This process is entirely due to random processes that initiate and contribute to generation of specificity (Medzhitov and Janeway, 1997) including

VDJ-recombination, somatic hypermutation and class switch recombination (Litman et al., 2010). Additionally, these highly specific receptors are maintained by long-lived cells

2 (along with very stable secreted Igs, or antibodies) and contribute to “memory”, resulting in a more rapid response to subsequent encounters with the same antigen (Beverly,

1990; Sprent, 1994; Sprent and Surh, 2002).

In contrast, the innate immune system is the primary form of protection for all metazoans through a wide range of molecules called pattern recognition receptors

(PRRs), which can respond immediately to infection. PRRs encompass secretory, trans- membrane and cytosolic classes of molecules capable of recognizing a wide range of microbial patterns known as conserved microbial-associated molecular patterns

(MAMPs) (Iwasaki and Medzhitov, 2010); examples include lipopolysaccharide from

Gram-negative bacteria or peptidoglycan from Gram-positive bacteria. Genes that encode PRRs generate diversity through varying levels of polymorphisms (i.e., allelic diversity) and are inherited through simple Mendelian principles (Medzhitov and

Janeway, 1997).

The innate immune system evolved first as an effective form of defense for all metazoans, and later in evolution, innate components have been integrated into providing signals within vertebrates to activate the adaptive immune system (Fearon and Locksley, 1996; Medzhitov and Janeway, 1997). The more we learn about the diversity of animal immune systems, the line between innate and adaptive immunity is becoming increasingly more blurry, especially in terms of interactions with microbes.

Historically, interactions with pathogenic microbes have received most of the attention; however, considering the recognition of animals as metaorganisms, it is imperative that we understand how the immune system interacts with symbiotic microorganisms to establish and maintain homeostasis within the animal host as well.

3 Host-associated bacterial communities

Bacteria are the most well-studied and recognized component of the microbiome and usually far outnumber the cells of the host (Qin et al., 2010). Additionally, a significant functional contribution is often made by bacterial genes and their products to the animal host through better nutrient acquisition and protection (Sommer and

Backhed, 2013). Many reports have already begun to describe the exceptional diversity of bacteria within a variety of animal systems (Bourne et al., 2009; Fraune and Bosch,

2010; McFall-Ngai et al., 2013; Minard et al., 2013; Shin et al., 2011; Sommer and

Backhed, 2013; Tlaskalova-Hogenova et al., 2004) due to the ease and affordability of sequencing the 16S rRNA gene, the most conserved bacterial ribosomal gene (~1,500 bp) that can serve as a fingerprint for identification (Gurtler and Stanisich, 1996).

Using 16S rRNA gene sequencing, many animals have been shown to maintain a species-specific or “core” community of bacteria (Dishaw et al., 2014; Meeus et al.,

2015; Otani et al., 2014; Schmitt et al., 2012; Ainsworth et al., 2015), suggesting important functional roles for these members. Additionally, it has been proposed that symbiotic bacteria form an added layer of protection for the host through the formation of barriers such as biofilms in mucus layers (de Vos, 2015; Donaldson et al., 2016;

Sonnenburg et al., 2004). Biofilms are a widely known phenotype exhibited by resident bacteria within the mucus layer of the gut (Sonnenburg et al., 2004), and often contain of a number of different species encased in extrapolymeric substances secreted by its members (Donaldson et al., 2016; Davey and O'Toole, 2000). This complex matrix consists of hydrated polysaccharides, proteins, glycopeptides, lipids and extracellular

DNA (Donlan and Costerton, 2002). Bacteria within biofilms are often protected from

4 external assaults from a variety of chemicals and biological effectors, and the biofilms can also shield them from natural enemies such as bacteriophages (phages; i.e., viruses that infect bacteria).

Host-associated viral communities

There are an estimated 1031 viruses on the planet (Breitbart and Rohwer, 2005;

Whitman et al., 1998), with phages dominating the majority of identified viruses. Phages exhibit a variety of morphologies, yet the most abundant group classified by the

International Committee on Taxonomy of Viruses are the double-stranded DNA tailed phages belonging to the Caudovirales order. Upon infection of their bacterial host, phages can exhibit one of two main life cycles: lytic or lysogenic (i.e., temperate)

(Mirzaei and Maurice, 2017). If a phage is lytic, it immediately hijacks the bacterial DNA replication machinery and begins making new viral particles. Upon completion, the newly made phage particles (i.e., virions) are released into the environment via lysis of the bacterial cell membrane. Temperate phages, on the other hand, encode additional genes called integrases, which allow for integration into the bacterial genome upon infection; the integrated phage is referred to as a prophage and the bacterial cell containing the prophage is referred to as a lysogen. The prophage then remains dormant, replicating with the bacterial cell, until upon some trigger, it excises itself from the bacterial genome and begins the lytic cycle.

In the marine environment, phages outnumber bacteria 10:1 and play vital roles in biogeochemical cycling (Brussaard et al., 2008). Nevertheless, within healthy host- associated viromes (i.e., free virions), lytic phages are less common than temperate

5 phages (Minot et al., 2013; Minot et al., 2011; Reyes et al., 2010). The presence of temperate phages within host-associated microbiomes may present bacterial lysogens with a variety of evolutionary advantages including dominance of a particular niche in the presence of related strains (Duerkop et al., 2012), super-immunity exclusion providing protection against further phage infection (Hargreaves et al., 2014) and the enhanced ability to form biofilms (Nanda et al., 2015).

In humans, the infant microbiome is highly dynamic, with large numbers of lytic phages and high bacterial diversity following the traditional “Kill the Winner” (KtW) hypothesis where phages aim to kill the most abundant bacterial member of a population (Breitbart et al., 2008; Lim et al., 2015; Mirzaei and Maurice, 2017; Sharon et al., 2013). However, for reasons that remain unclear, it appears that this changes in healthy adults, with lysogeny dominating (Minot et al., 2013; Minot et al., 2011; Reyes et al., 2010). This enhanced lysogeny is believed to follow the “fluctuating selection dynamics” (FSD) model, where bacteria and phages coexist and fluctuate without the elimination of any particular microorganism (Hall et al., 2011; Mirzaei and Maurice,

2017). Gut mucus is nutrient-rich, which contradicts the general theory that lysogeny predominates in nutrient-poor environments (Weinbauer, 2004; Williamson et al., 2007).

Another proposed model of lysogeny provides a solution: the “piggyback the winner”

(PtW) hypothesis (Knowles et al., 2016; Silveira and Rohwer, 2016). The PtW hypothesis states that lysogeny will dominate when bacteria are dominant and maintain high growth rates, parameters which match observations of bacterial communities within the gut mucus (Silveira and Rohwer, 2016). These hypotheses highlight the lack of

6 experimental knowledge on the biology of prophages within the complex gut ecosystem, a knowledge gap that the development of Ciona as a model system can help resolve.

Various environmental triggers have been shown to influence the switch from the lysogenic to lytic cycle such as UV light and chemical agents like mitomycin C through the induction of the cell’s SOS response (Weinbauer and Suttle, 1999). Additionally, in the gut environment, antibiotics (Allen et al., 2011; Zhang et al., 2000) as well as local inflammation (Diard et al., 2017) induce prophages. However, little is known about natural inducing factors of prophages or whether prophages serve a role in colonization by resident lysogens. The gut environment provides a highly dynamic atmosphere in which little is known about phage-bacteria interactions. Although a number of systems have been generated in attempts to explain these behaviors in vitro, development of simple animal systems in which to study these dynamics is imperative to understanding host-associated microbial communities and the metaorganism in vivo.

The gut environment

The gastrointestinal (GI) tract has received much attention in medicine due to the widespread occurrence of diseases like inflammatory bowel disease (IBD). The gut represents the most densely populated environment ever described, with over 1011 bacteria per gram of human feces (Qin et al., 2010). Gut microbes have also been shown to affect development and morphogenesis of other organs and tissues in a variety of systems (Koropatnick et al., 2004; Shin et al., 2011). The gut epithelial barrier is a single cell layer that serves as the primary point of contact in communicating with both resident and transient microbes as well as in maintaining the sterility of internal

7 tissue. The epithelium shows differences in cell type and morphology along the GI tract, and the lumen-facing side is overlaid by host-secreted mucus (Johansson et al., 2011).

Mucus is made up of mucins, which are glycoproteins assembled into a viscous gel-like layer that, although for decades was considered to be an inert barrier to keep microbes out, is now known to serve as a haven for microbial growth and colonization.

The gut mucus is composed of two structurally distinct layers: a tight inner mucus layer void of microbes and an outer mucus layer that is formed by glycolytic cleavages of the inner mucus and houses an array of microbes including bacteria and viruses

(Johansson et al., 2011). This inner mucus layer thereby prevents the penetration of microbes to the sterile apical side of the epithelium (Hansson and Johansson, 2010).

The mucus layer also differs in structure along the GI tract with the stomach possessing both an outer and inner mucus layer similar to the intestine, although not as thick

(Johansson et al., 2011). A number of invertebrates, including arthropods (Kelkenberg et al., 2015) and protochordates (Dishaw et al., 2016), as well as many non-mammalian vertebrates (Tang et al., 2015) produce endogenous chitin within the gut mucus layer as well, establishing an additional barrier along the length of the epithelium. The gut environment is a highly dynamic ecosystem with countless variables interacting to form a stable and healthy metaorganism, and a simple model organism may help elucidate the mechanisms of establishment of homeostasis within the gut.

The model system: Ciona intestinalis

The protochordate, Ciona intestinalis, is a sessile filter-feeding ascidian that, together with the vertebrates, is included within the phylum Chordata (Figure 2). The

8 presence of a notochord, pharyngeal gills and a dorsal tubular nerve cord in the larval stage of Ciona led to the belief that the ascidian tadpole larvae represents the closest living species to the origin of the chordate lineage. This has made Ciona a pillar in the study of evolutionary and developmental biology of chordates (Satoh et al., 2003).

C. intestinalis is a cosmopolitan species distributed world-wide from temperate zones to the poles (Millar, 1953). They survive in a wide range of temperatures, salinities and depths, and grow in large colonies as a result of successful broadcast spawning. Ciona was also one of the first eukaryotes to have its complete genome sequenced, which revealed a small, streamlined genome (~117 Mbp) (Dehal et al.,

2002; Simmen et al., 1998).

Ciona intestinalis is a hermaphroditic species that, after external fertilization via broadcast spawning, forms a swimming tadpole larvae which after a few hours finds and attaches itself to a desired substrate such as pilings and ship hulls (Simmen et al.,

1998). After settlement, the larva retracts its tail at the start of metamorphosis, effectively losing its notochord and tubular nervous system in order to become a sessile adult (Chiba et al., 2004). Throughout metamorphosis, Ciona remains attached to the original substrate through villi while undergoing an entire body axis rotation. During metamorphosis, three main stages can be identified: the rotation stage corresponding to a body axis rotation and internal organ configuration, the 1st ascidian stage characterized by the presence of two pre-atrial siphons and the 2nd ascidian stage characterized by the fusion of the two pre-atrial siphons (Chiba et al., 2004; Cirino,

2002).

9 The development of the digestive tract, composed of the pharynx, esophagus, stomach, intestine (midgut and hindgut) and pyloric gland, has been studied in much detail (Nakazawa et al., 2013), and it is well known that feeding does not begin until after body axis rotation is complete at stage 4 (Chiba et al., 2004). Prior to the onset of feeding, the siphons remain closed and the gut remains sterile. Upon opening, the animal is exposed to a literal sea of microorganisms in the wild, yet the adults have been shown to maintain a core bacterial community in populations across the world, encompassing 13 families of bacteria (Dishaw et al., 2014). However, in laboratory settings, selective exposure of the animals to chosen microbes can be performed at this stage of development. These bacteria then become concentrated into the gut and are differentially retained or excluded (Leigh et al., 2016). The establishment and maintenance of a core bacterial community within the animal gut implies a selective process by the host and/or co-colonizing microbes during the initial colonization event.

10 Animal host Bacteria and immunity archaea

Viruses Environment

Pro4sts and fungi Environment

Modiﬁed from Bosch and McFall-Ngai, 2011.

Figure 1: The metaorganism concept. (Concept from (McFall-Ngai et al., 2013)).

Figure 2: Phylogenetic tree of major animal groups. (Adapted from (Liberti, Leigh et al., 2015)).

11 RESEARCH OVERVIEW

Ciona provides a unique opportunity to unravel the roles that innate immune mechanisms serve in governing the establishment and maintenance of stable host- associated microbiomes. Through the following six research studies, this dissertation describes the development of Ciona intestinalis as a model system for studies of host- microbe interactions.

• An immune effector system in the protochordate gut sheds light on the

fundamental aspects of vertebrate immunity (Appendix A). Protochordates

are marine invertebrate chordates that belong to the phylum Chordata, making

them part of the closest invertebrate group to vertebrates. The lack of an

adaptive immune system in these animals provides an opportunity to study the

roles of the innate immune system in the establishment of homeostasis without

the added complexity of the adaptive immune system. However, one secretory

protein family confined to the protochordates possesses characteristics of

immune recognition molecules and has been since shown to bind and opsonize

bacteria, effectively increasing phagocytosis by granular amoebocytes. These

molecules, the variable region-containing chitin binding proteins (VCBPs),

possess two variable (V) immunoglobulin-like domains and a chitin-binding

domain and are expressed almost exclusively in the gut and circulating

hemocytes. Originally, VCBPs were discovered in amphioxus (Cannon et al.,

2002); however, functional studies of VCBPs in this less than tractable animal

model proved to be difficult. Therefore, we turned to the tractable protochordate

system Ciona intestinalis in order to study the function of these proteins and their

12 potential role in host gut-microbe interactions. In Ciona, four VCBP proteins (A-D)

have been identified in the sequenced genome, with one of the proteins, VCBP-

C, represented by limited main haplotypes and expression throughout

development and metamorphosis in the stomach and intestine. In vivo studies of

VCBP-C have shown direct interaction with bacteria in the lumen, and

recombinant protein studies of VCBP-C have shown opsonic activity through

solely the V domains. The role of VCBPs in the complex interaction between the

animal host and microbes across the single-cell layer of the gut epithelium could

provide insight to functional components of immunity in both the invertebrate and

vertebrate taxa.

• Generation of germ-free Ciona intestinalis for studies of gut-microbe

interactions (Appendix B). In order to establish any new model system for

studies of host-microbe interactions, it is first important to establish a GF

mariculture system to control all aspects of colonization. Through modification of

published techniques to generate GF zebrafish, this paper describes techniques

to rear Ciona intestinalis germ-free after in vitro fertilization and a short series of

chemical treatments. Axenic juveniles can then be kept in large numbers (~100

animals per petri dish) in artificial seawater where they attach and undergo

metamorphosis. These dishes are maintained in bench-top cleanrooms and are

treated with slight modifications to standard cell/tissue culture approaches. At

stage 4 of the 1st ascidian stage of development, juveniles open their gut for the

first time to the external environment, allowing controlled exposure to microbes.

13 Select cultured bacteria can be fluorescently stained and inoculated to the water,

allowing observation of colonization in real time through transparent juveniles.

• The gut virome of the protochordate model organism, Ciona intestinalis

(Appendix C). Viruses have been shown previously to dominate host-associated

microbiomes. However, the role of these viruses within the metaorganism is still

widely unexplored. Here, the viral community associated with the gut of Ciona

intestinalis was described across two years. There is evidence of a host-

associated virome distinct from surrounding seawater that is dominated by the

Caudovirales order. This order encompasses the tailed bacteriophages that are

thought to be the most abundant in the marine environment. Unique viral

communities among distinct gut niches (stomach, midgut and hindgut) were also

present, although most viruses were ubiquitous throughout the length of the gut.

In contrast, bacterial communities were more compartmentalized. Twenty-nine

complete phage genomes were assembled from the viromes, most of which have

not been previously described. Inclusion of viruses that infect host-associated

bacteria to microbiome studies allows a more comprehensive assessment of how

host-specific bacterial communities develop and function.

• Isolation and characterization of a Shewanella phage-host system from the

gut of the tunicate, Ciona intestinalis (Appendix D). A number of bacterial

isolates were cultured from wild-harvested Ciona intestinalis, and surrounding

seawater was screened for lytic phages capable of infecting these isolates. One

phage-host system including a Shewanella fidelis strain and a myovirus (SFCi1)

14 was identified and characterized. Both the bacterial host and lytic phage

genomes were sequenced and annotated. Additionally, two active prophages

within the Shewanella strain were also identified, annotated and imaged. The

effect of both the prophages and the lytic phage SFCi1 on biofilm formation was

determined. We found that lysis resulted in an increase in biofilm formation due

to the release of extracellular DNA, a common structural component of bacterial

biofilms. This phenomenon was present in both the control cultures (due to

spontaneous prophage lysis) and to a much higher extent in the cultures

exposed to the lytic phage SFCi1.

• Induced prophages from lysogens cultured from the Ciona intestinalis gut

demonstrate lytic infection against co-occurring bacteria (Appendix E). A

total of 70 bacterial isolates from the Ciona gut were treated with a DNA

damaging agent, mitomycin C, to determine the presence of inducible prophages

within cultured members of the microbiome. A total of 22 isolates were shown to

possess mitomycin C-inducible prophages within their genomes, and

transmission electron microscopy and genomic sequencing demonstrated they

encompassed a variety of viral families. Each of these induced phages was

screened for lytic activity against all other bacterial isolates. A number of phages

were capable of infecting bacterial members across different families, orders, and

classes. Although it has been speculated in the literature, this is the first in vivo

demonstration that induced prophages can infect other non-related, co-occurring

members of the microbiome within an animal, indicating a potential role for

15 prophages in shaping microbial community structures not only through gene

transfer but also through lysis.

• Secretory immune effector-mediated induction of prophages from

lysogenic gut bacteria (Appendix F). The majority of bacteria within the gut

environment are lysogens, maintaining active prophages within their genomes.

This common occurrence suggests that prophages can confer advantages to

their bacterial hosts. Induction or activation of prophages can be caused by

diverse phenomena, from chemical stress to ultraviolet radiation. However, within

the context of animal-associated bacterial communities, little is known about the

physiological and ecological interactions with the animal host that may influence

prophage behavior. Here, we show that prophages can be induced when a

secretory immune molecule (VCBP-C) binds lysogens both in vitro and in vivo.

The induction of prophages results in enhanced biofilm formation by these

lysogens. In GF juveniles, an increase in VCBP-C expression is followed by a

reduction in live bacteria and an increase in free phage particles. Being able to

show that VCBP-C can induce prophages both in vitro and in vivo highlights the

utility of Ciona as a model in examining the role of phages in establishing the

microbiome. Lastly, we showed that VCBP-C induced a new prophage from a

Pseudoalteromonas sp. 6751 that was not inducible by mitomycin C, indicating a

potential alternative route for activation of this particular prophage.

Understanding the role of soluble immunoglobulin-like molecules (also present in

vertebrates) in prophage induction is imperative to understanding the initial

colonization of mucosal surfaces such as the gut epithelium.

16 DISCUSSION

Dynamic relationships that animals maintain with microbes are now understood to play a major role in animal health and disease. Interplay between all of the microbial members as well as the host immune system is a highly complex and active dialogue, perhaps explaining why most metazoans described thus far maintain a specific community. To reduce complexity, studying microbial colonization and selection in simple and tractable model systems is advantageous. The presence of specific host- associated microbial communities within a variety of invertebrate animals implicates a major role of the innate immune system in the assembly and maintenance of the microbiome. Additionally, the establishment of model systems across broad animal phylogenetic groups to study microbial interactions will shed light on the evolution of animals with their symbionts and may provide a better understanding of how the adaptive immune system evolved in vertebrates to further mediate these interactions.

Recognition by vertebrate immune receptors is enhanced through recombination events not encoded within the germline (Brack et al., 1978; Hozumi and Tonegawa,

1976). However, a number of proteins encoded by invertebrate animals that do not exhibit this recombination activity have been shown to interact with bacteria, and as a result influence host behavior, most notably via the induction of the innate immune response (Aderem and Ulevitch, 2000; Ozinsky et al., 2000). The VCBP gene family in

Ciona (Appendix A), although exhibiting random single nucleotide polymorphisms, demonstrates very little haplotypic variation and is able to differentially interact with bacterial groups. The variable domain on the N-terminus of the protein displays bacterial binding behavior, and extensive expression and secretion patterns within the

17 gut environment during both development and colonization indicate a potential role for these proteins in structuring the gut microbiome (Liberti et al., 2014). The VCBP-C protein, in particular, has been determined to be opsonic, tagging various bacteria for enhanced engulfment by phagocytes (Dishaw et al., 2011). All early studies were conducted with laboratory strains of Gram-negative (E. coli) and Gram-positive (B. cereus) bacteria, neither of which is native to the marine environment of Ciona, yet these studies provided a foundation in which to begin to understand the interactions of the VCBP molecules with resident bacteria. To build upon these foundational results, further studies with members isolated from the Ciona gut were conducted here.

In order to understand the process of colonization, a GF system was essential, providing a “clean slate” through which to study the interactions of the immune system with isolated bacteria. GF methods to achieve sterile Ciona juveniles were established and published (Appendix B). Ciona can be fertilized in vitro, with fast chemical treatments for sterilization, and maintenance is simple and compact with hundreds of

GF animals per petri dish in sterile artificial seawater (ASW). Following bacteria stained with a fluorescent dye in GF juveniles by microscopy revealed that bacteria introduced into the water localize to the gut within the first hour of exposure but do not significantly associate anywhere else in the rest of the body. In wild juveniles, concentration of bacteria from the initial water they feed on may ensure that the necessary bacteria can successfully colonize. For non-native bacteria like E. coli, this concentration event occurs, but the bacteria are quickly excluded from the gut within the first few hours after exposure. Native bacteria isolated from the gut of wild-caught Ciona tended to be retained longer than lab strains. This particular phenomenon allows for colonization

18 studies through the simple addition of bacteria to the surrounding seawater, setting the stage for studying the biology of colonization of both of the most abundant groups of microorganisms within the environment, bacteria and viruses.

The next step to deciphering the roles of the VCBP family with resident microbes was to understand which bacteria and viruses were present. Therefore, the 16S rRNA genes of bacteria from disparate Ciona intestinalis populations were sequenced

(Dishaw et al., 2014). This study found that 13 core families exist within the Ciona gut, indicating a potential host selection mechanism for establishing this conserved community. Although bacteria are a predominant component of the microbiome, viruses outnumber bacteria in most environments, yet much less is known about viruses in host-associated communities. Therefore, viral metagenomics was utilized in order to characterize the viral component of the Ciona microbiome (Appendix C). Metagenomics is a powerful tool for assessing the genetic content of any particular microbial community. Because viruses do not have a conserved gene like the16S rRNA gene of bacteria, metagenomics is the only way to adequately characterize an unknown viral community. Viral genomes are notably small (~30 kb on average), and many times complete viral genomes can be assembled from these deep-sequencing efforts

(Nishimura et al., 2017). Filtration and purification steps prior to sequencing allow for targeted sequencing of viral-like particles based on their expected sizes and densities.

Additionally, downstream analyses of this multitude of data have since been made more accessible through the advent of bioinformatics resources such as the iVirus pipeline

(Bolduc et al., 2017). In this project, viruses and bacteria from the three main regions of the gut (stomach, midgut and hindgut) were individually sequenced from both uncleared

19 (with dietary material) and cleared (dietary content removal with virus-free ASW) animal guts. Through quality trimming, assembly and sorting of the viral reads, the differences and similarities among the viral communities throughout the gut of the animal were determined. Both bacteria and viruses were shown to compartmentalize within the gut, but the bacteria exhibited a more striking pattern with only 24 of the bacterial operational taxonomic units (OTUs) shared among the major gut regions. The different environmental niches provided by each gut compartment offer a potential explanation for this distinct distribution. The midgut in particular harbored the most unique bacterial and viral communities, and interestingly, this compartment is the only site in the Ciona gut where VCBP-C is not expressed (Liberti et al., 2014), which may allow for more extensive proliferation of these microbial communities. Due to the methods used in this study, only viral particles that were outside of their bacterial host (i.e. currently lytic) were detected. However, integrase genes that allow for integration into the bacterial genome to establish lysogeny were identified in each sample, and their predicted hosts matched many core bacterial genera described previously (Dishaw et al., 2014).

In order to understand the potential significance of these stable core bacterial members, as many bacteria as possible were cultured from the most easily accessible population of Ciona in San Diego, CA. Members belonging to eight of the 13 core families have been successfully cultured, resulting in a total of 70 bacterial isolates on which all further studies were conducted. In addition to the bacterial isolates, a lytic phage specific to a Shewanella sp. 3313 belonging to the Ciona core bacterial community was also successfully isolated from surrounding seawater (Appendix D).

Morphological analysis using transmission electron microscopy (TEM), demonstrated

20 that the lytic phage SFCi1 belonged to the Myoviridae family of the tailed dsDNA virus order Caudovirales. The genomes of both the lytic phage and the Shewanella sp. 3313 isolate were sequenced, assembled and annotated. The bacterial genome showed significant similarity to a sequenced Shewanella fidelis isolate from the South China Sea

(Ivanova et al., 2003); yet genetic differences suggest it to be a novel strain of this species. The phage genome showed a dynamic interaction with Vibrio species through assessment of codon usage and ~42% nucleotide (nt) similarity of SFCi1 to known

Vibrio parahaemolyticus phages. This finding is not necessarily surprising as

Shewanella and Vibrio species often interact both within the gut environment (Rolig et al., 2015) and in the water column (Erauso et al., 2011). Additionally, the Shewanella genome revealed the presence of two active prophages, SFMu1 and SFPat, which could be induced using the common DNA damaging agent, mitomycin C. The TEM of the induced prophages showed one tailed viral particle and one non-tailed viral particle, and while SFMu1 showed similarity to other known Mu phages, the majority of the genes within the induced SFPat virus did not match anything in current databases.

Consistent with these findings, Shewanella oneidensis, a well-known model organism for bioremediation studies, has been shown to possess numerous prophages within its genome that are vital to biofilm formation (Godeke et al., 2011). Similarly, the presence of extracellular DNA within uninfected cultures of Shewanella fidelis 3313 highlights a potential role for spontaneous prophage lysis in biofilm formation of this isolate as well.

Interestingly, infection with the lytic phage SFCi1 was also shown to enhance biofilm formation of Shewanella fidelis 3313 in vitro in a DNA-dependent manner. Influence of lytic phages on bacterial biofilm behavior is a particularly complex interaction that is

21 largely still under investigation (Donlan, 2009; Godeke et al., 2011; Leigh et al., 2017;

Tan et al., 2015). Implications for these interactions are far-reaching to fields ranging from phage therapy in host-associated mucosa to bioremediation of biofouled pipelines, just a few of the many environments in which biofilm-forming bacteria thrive.

Additionally, understanding the effects of prophages on biofilm generation is crucial to deciphering the establishment of stable microbial communities in all environments, including that of the gut.

To test whether biofilm formation was a common phenotype in the Ciona gut as has been seen for mammals (Probert and Gibson, 2002), all bacterial isolates were screened for biofilm formation. Additionally, in attempts to mimic the gut environment of

Ciona, bacteria were grown in the presence and absence of recombinant VCBP-C protein. Biofilm formation by a number of bacterial isolates significantly increased in the presence of the VCBP-C protein (Dishaw et al., 2016). This observation suggests an additional role for host immunity in modulating barrier defenses within the gut mucosa, although the mechanisms underlying this enhancement of biofilm formation through interaction with VCBP-C protein warrant further investigation.

In conjunction with this biofilm study, all bacterial isolates were assessed for inducible prophages (Appendix E). Twenty-two of the 70 bacterial isolates produced active phage particles as a result of mitomycin C induction. Each of these induced phages was purified using cesium chloride (CsCl) ultracentrifugation, imaged on the

TEM and sequenced. TEM images showed that the induced isolates belonged to a variety of viral families, ranging from the tailed Caudovirales to only the second member ever discovered from the Corticoviridae family (6751). Interestingly, two of the bacteria

22 with significantly enhanced biofilms in the presence of VCBP-C, Shewanella fidelis 3313 and Pseudoalteromonas sp. 6751, both contained inducible prophages. With all of the available tools described above including GF methods and native bacterial and viral isolates, interactions between lysogens and VCBP-C were examined for potential roles in prophage induction during colonization of the Ciona gut.

Currently, only a few natural inducers of prophages within the gut environment have been described including antibiotics (Allen et al., 2011; Zhang et al., 2000) and an inflammatory environment (Diard et al., 2017). However, no natural inducers during colonization of the gut environment have yet been defined. A large number of marine bacteria have been shown to maintain prophages within their genomes and have been described as “molecular time bombs” (Paul, 2008), influencing bacterial host transcription and metabolism. Additionally, prophages can provide their hosts with a number of advantages (Nanda et al., 2015), and enhanced colonization through biofilm formation may very well be one of them. Two isolates previously described to have enhanced biofilm formation in the presence of recombinant VCBP-C protein

(Shewanella fidelis 3313 and Pseudoalteromonas sp. 6751) were chosen for further study (Appendix F). In vitro, recombinant VCBP-C protein was shown to induce prophages within stationary biofilm cultures of the lysogens. Cultures that remained in suspension exhibited no such induction. Shewanella fidelis 3313 has two prophages within its genome, and each of these prophages was induced at a different time point, a phenomenon also seen for other Shewanella spp. during biofilm formation (Godeke et al., 2011). Additionally, a new prophage for Pseudoalteromonas sp. 6751 exposed to

23 VCBP-C was detected via TEM that was not induced via mitomycin C, and because of this the genome was not originally sequenced with the mitomycin C-induced samples.

Induction during colonization of GF animals by a single bacterial isolate showed similar trends with an increase in VCBP-C expression followed by a decrease in live bacteria and an increase in free phage particles. After two weeks, these bacteria remained at large quantities within the animal, indicating colonization success despite phage induction. Because integrated prophages can impart superinfection immunity on their bacterial host, induced phage particles during mono-associated experiments are not able to infect other members of the same population. The role(s) of prophages in the colonization event can only be definitively determined with the use of the same strain of bacteria that is cured of its prophage. All attempts at generating these cured strains via mitomycin C, UV radiation and homologous recombination have been unsuccessful to date. Although the current results are largely correlation-based, they lend support to the hypothesis that enhanced biofilm formation through VCBP-mediated prophage induction might be one of the mechanisms through which invertebrates can “select” their microbial communities. Because similar increases in biofilm formation have been documented with the addition of human Immunoglobulin A (IgA) to in vitro cultures of the human gut isolate E. coli (Bollinger et al., 2003; Bollinger et al., 2006; Orndorff et al., 2004), prophage induction may actually be a more generalized and widespread mechanism leveraged by host immunity. Additionally, phage particles have been proposed to provide a more indirect form of immunity by binding mucins via the Ig-domain on the viral capsid and preventing colonization by incoming pathogens (Barr et al., 2013).

24 The mucus layer is a highly dynamic environment where it is believed that components of host immunity and microbes establish a balance to generate a healthy and stable symbiosis. In the marine environment, animals encounter ~106 bacterial cells per milliliter of surface seawater (Hobbie et al., 1977), yet are able to maintain a specific microbial consortia (Dishaw et al., 2014; Schmitt et al., 2012; Ainsworth et al., 2015). A number of other non-marine animal systems exhibit the same phenomenon (Roeselers et al., 2011; Sabree et al., 2012; Turnbaugh and Gordon, 2009). Establishment of a microbiome in naïve gut tissue is a complicated and multi-faceted process, and the mechanisms involved in this process have likely evolved multiple times throughout phylogeny. The VCBP protein family is one such example and the teleost immunoglobulin T (IgT) is another example of the evolution of a highly abundant mucosal immune molecule with no homology to mammalian IgA (Zhang et al., 2010).

Like VCBP-C, the IgT molecule shares similar functions to IgA, including the interaction with bacteria in the mucus layer of teleost fish. As comparative immunology expands its use of animal models, more of these diverse and novel mechanisms are likely to emerge defining the complex dialogue between animals and their microbes.

Studies of animal immune systems throughout phylogeny have led to a better understanding of the many ways metazoans have evolved to interact with the microbes they encounter. This dissertation describes the development of a new protochordate animal model to understand the complex dialogue occurring at the gut epithelial surface between the protochordate host and its associated microbiota. Although the VCBP family was discovered approximately 15 years ago and its genetic sequences and protein structures have all been determined in Branchiostoma floridae (Cannon et al.,

25 2002; Cannon et al., 2004; Hernandez Prada et al., 2004), this model was not a tractable system for determining function of VCBPs within the animal. Ciona intestinalis, however, has shown to be a promising model for VCBP functional studies, and the genomics and expression patterns within the gut have already been determined

(Dishaw et al., 2008; Dishaw et al., 2011; Liberti et al., 2014). Through isolation of a number of bacteria from the gut of the animal and the development of a GF system, we have only just begun to elucidate some potential functions for this gene family in Ciona.

Additionally, the finding that VCBP-C may activate prophages through a pathway different from the SOS response induced by mitomycin C is an exciting observation and will open the door for future questions regarding the interaction of the VCBP proteins and lysogens. For example, what does VCBP-C bind to that can influence biofilm formation? Which pathway(s) does this cell surface molecule or receptor activate? Do all of the core bacteria within the Ciona gut exhibit this behavior or is it specific to lysogens? Do lysogens colonize more successfully as a result of their interaction with

VCBP-C in the gut? Can these induced phage particles be maintained in the gut mucus as an indirect form of immunity as proposed by the BAM model? With advanced tools and technology, we can now begin answering these questions and arrive to a better understanding of colonization and the establishment of a healthy microbiome.

Phages are the most abundant biological entities on the planet (Suttle, 2005) and are highly abundant within humans and Ciona alike. Understanding the interplay among phages, both free and integrated, and bacteria with the host innate immune system is imperative to deciphering how homeostasis is established in naïve tissues. Immune mechanisms involved in microbiome establishment in protochordates are especially

26 relevant due to their phylogenetic proximity to vertebrates. With anatomical and physiological similarities, Ciona provides a unique vantage point in our studies of host gut-microbe interactions. As secretory immune molecules within gut tissue, the VCBP gene family comprises innate immune molecules that interact with a variety of bacteria, effectively coupling with natural microbial ecology phenomena such as prophage induction that may be more widespread than previously thought. Through understanding of these and other innate immune molecules in various other model systems in the context of the metaorganism, we hope to shed light on the evolution of antigen recognition and establishment of symbiosis within the highly dynamic, microbe-rich gut environment.

APPENDICES:

(Appendix A): An immune effector system in the protochordate gut sheds light on the fundamental aspects of vertebrate immunity

(Appendix B): Generation of germ-free Ciona intestinalis for studies of gut-microbe interactions

(Appendix C): The gut virome of the protochordate model organism, Ciona intestinalis

(Appendix D): Isolation and characterization of a Shewanella phage-host system from the gut of the tunicate, Ciona intestinalis

(Appendix E): Induced prophages from resident lysogens cultured from the Ciona intestinalis gut demonstrate lytic infection against co-occurring bacteria

(Appendix F): Secretory immune effector-mediated induction of prophages from lysogenic gut bacteria

27 REFERENCES

Aderem, A., Ulevitch, R.J., 2000. Toll-like receptors in the induction of the innate immune response. Nature 406(6797), 782-787. Ainsworth, D.T., Krause, L., Bridge, T., Torda, G., Raina, J.B., Zakrzewski, M., Gates, R.D., Padilla-Gamino, J.L., Spalding, H.L., Smith, C., Woolsey, E.S., Bourne, D.G., Bongaerts, P., Hoegh-Guldberg, O., Leggat, W., 2015. The coral core microbiome identifies rare bacterial taxa as ubiquitous endosymbionts. ISME J 9(10), 2261-2274. Allen, H.K., Looft, T., Bayles, D.O., Humphrey, S., Levine, U.Y., Alt, D., Stanton, T.B., 2011. Antibiotics in feed induce prophages in swine fecal microbiomes. MBio 2(6). Barr, J.J., Auro, R., Furlan, M., Whiteson, K.L., Erb, M.L., Pogliano, J., Stotland, A., Wolkowicz, R., Cutting, A.S., Doran, K.S. and Salamon, P., 2013. Bacteriophage adhering to mucus provide a non–host-derived immunity. Proc Natl Acad Sci U S A, 110(26), 10771-10776. Beverly, P.C., 1990. Human T cell memory. Curr Top Microbiol Immunol(159), 111-122. Bolduc, B., Youens-Clark, K., Roux, S., Hurwitz, B.L., Sullivan, M.B., 2017. iVirus: facilitating new insights in viral ecology with software and community data sets imbedded in a cyberinfrastructure. ISME J 11(1), 7-14. Bollinger, R.R., Everett, M.L., Palestrant, D., Love, S.D., Lin, S.S., Parker, W., 2003. Human secretory immunoglobulin A may contribute to biofilm formation in the gut. Immunology 109(4), 580-587. Bollinger, R.R., Everett, M.L., Wahl, S.D., Lee, Y.H., Orndorff, P.E., Parker, W., 2006. Secretory IgA and mucin-mediated biofilm formation by environmental strains of Escherichia coli: role of type 1 pili. Mol Immunol 43(4), 378-387. Bourne, D.G., Garren, M., Work, T.M., Rosenberg, E., Smith, G.W., Harvell, C.D., 2009. Microbial disease and the coral holobiont. Trends Microbiol 17(12), 554-562. Brack, C., Hirama, M., Lenhard-Schuller, R., Tonegawa, S., 1978. A complete immunoglobulin gene is created by somatic recombination. Cell 15(1), 1-14. Breitbart, M., Haynes, M., Kelley, S., Angly, F., Edwards, R.A., Felts, B., Mahaffy, J.M., Mueller, J., Nulton, J., Rayhawk, S., Rodriguez-Brito, B., Salamon, P., Rohwer, F., 2008. Viral diversity and dynamics in an infant gut. Res Microbiol 159(5), 367- 373. Breitbart, M., Rohwer, F., 2005. Here a virus, there a virus, everywhere the same virus? Trends Microbiol 13(6), 278-284. Brussaard, C.P., Wilhelm, S.W., Thingstad, F., Weinbauer, M.G., Bratbak, G., Heldal, M., Kimmance, S.A., Middelboe, M., Nagasaki, K., Paul, J.H., Schroeder, D.C., Suttle, C.A., Vaque, D., Wommack, K.E., 2008. Global-scale processes with a nanoscale drive: the role of marine viruses. ISME J 2(6), 575-578. Cannon, J.P., Haire, R.N. and Litman, G.W., 2002. Identification of diversified genes that contain immunoglobulin-like variable regions in a protochordate. Nat Immunol, 3(12),1200-1207. Cannon, J.P., Haire, R.N., Schnitker, N., Mueller, M.G. and Litman, G.W., 2004. Individual protochordates have unique immune-type receptor repertoires. Curr Biol, 14(12), R465-R466.

28 Chiba, S., Sasaki, A., Nakayama, A., Takamura, K., Satoh, N., 2004. Development of Ciona intestinalis juveniles (through 2nd ascidian stage). Zoolog Sci 21(3), 285- 298. Cirino P., T.A., Caramiello D., Macina A., Miraglia V. and Monte A. , 2002. Laboratory culture of the ascidian Ciona intestinalis (L.): a model system for molecular developmental biology research, Biological Bulletin, Marine models, pp. 1939- 8697. Davey, M.E., O'Toole G, A., 2000. Microbial biofilms: from ecology to molecular genetics. Microbiol Mol Biol Rev 64(4), 847-867. de Vos, W.M., 2015. Microbial Biofilms and the human intestinal microbiome. Biofilms and Microbiomes 1, 15005. Dehal, P., Satou, Y., Campbell, R.K., Chapman, J., Degnan, B., De Tomaso, A., Davidson, B., Di Gregorio, A., Gelpke, M., Goodstein, D.M., Harafuji, N., Hastings, K.E., Ho, I., Hotta, K., Huang, W., Kawashima, T., Lemaire, P., Martinez, D., Meinertzhagen, I.A., Necula, S., Nonaka, M., Putnam, N., Rash, S., Saiga, H., Satake, M., Terry, A., Yamada, L., Wang, H.G., Awazu, S., Azumi, K., Boore, J., Branno, M., Chin-Bow, S., DeSantis, R., Doyle, S., Francino, P., Keys, D.N., Haga, S., Hayashi, H., Hino, K., Imai, K.S., Inaba, K., Kano, S., Kobayashi, K., Kobayashi, M., Lee, B.I., Makabe, K.W., Manohar, C., Matassi, G., Medina, M., Mochizuki, Y., Mount, S., Morishita, T., Miura, S., Nakayama, A., Nishizaka, S., Nomoto, H., Ohta, F., Oishi, K., Rigoutsos, I., Sano, M., Sasaki, A., Sasakura, Y., Shoguchi, E., Shin-i, T., Spagnuolo, A., Stainier, D., Suzuki, M.M., Tassy, O., Takatori, N., Tokuoka, M., Yagi, K., Yoshizaki, F., Wada, S., Zhang, C., Hyatt, P.D., Larimer, F., Detter, C., Doggett, N., Glavina, T., Hawkins, T., Richardson, P., Lucas, S., Kohara, Y., Levine, M., Satoh, N., Rokhsar, D.S., 2002. The draft genome of Ciona intestinalis: insights into chordate and vertebrate origins. Science 298(5601), 2157-2167. Diard, M., Bakkeren, E., Cornuault, J.K., Moor, K., Hausmann, A., Sellin, M.E., Loverdo, C., Aertsen, A., Ackermann, M., De Paepe, M., Slack, E., Hardt, W.D., 2017. Inflammation boosts bacteriophage transfer between Salmonella spp. Science 355(6330), 1211-1215. Dishaw, L.J., Flores-Torres, J., Lax, S., Gemayel, K., Leigh, B., Melillo, D., Mueller, M.G., Natale, L., Zucchetti, I., De Santis, R., Pinto, M.R., Litman, G.W., Gilbert, J.A., 2014. The gut of geographically disparate Ciona intestinalis harbors a core microbiota. PLoS One 9(4), e93386. Dishaw, L.J., Giacomelli, S., Melillo, D., Zucchetti, I., Haire, R.N., Natale, L., Russo, N.A., De Santis, R., Litman, G.W., Pinto, M.R., 2011. A role for variable region- containing chitin-binding proteins (VCBPs) in host gut-bacteria interactions. Proc Natl Acad Sci U S A 108(40), 16747-16752. Dishaw, L.J., Leigh, B., Cannon, J.P., Liberti, A., Mueller, M.G., Skapura, D.P., Karrer, C.R., Pinto, M.R., De Santis, R., Litman, G.W., 2016. Gut immunity in a protochordate involves a secreted immunoglobulin-type mediator binding host chitin and bacteria. Nat Commun 7, 10617. Dittmer, J., van Opstal, E.J., Shropshire, J.D., Bordenstein, S.R., Hurst, G.D., Brucker, R.M., 2016. Disentangling a holobiont - recent advances and perspectives in Nasonia wasps. Front Microbiol 7, 1478.

29 Donaldson, G.P., Lee, S.M., Mazmanian, S.K., 2016. Gut biogeography of the bacterial microbiota. Nat Rev Microbiol 14(1), 20-32. Donlan, R.M., 2009. Preventing biofilms of clinically relevant organisms using bacteriophage. Trends Microbiol 17(2), 66-72. Donlan, R.M., Costerton, J.W., 2002. Biofilms: survival mechanisms of clinically relevant microorganisms. Clin Microbiol Rev 15(2), 167-193. Duerkop, B.A., Clements, C.V., Rollins, D., Rodrigues, J.L., Hooper, L.V., 2012. A composite bacteriophage alters colonization by an intestinal commensal bacterium. Proc Natl Acad Sci U S A 109(43), 17621-17626. Erauso, G., Lakhal, F., Bidault-Toffin, A., Le Chevalier, P., Bouloc, P., Paillard, C., Jacq, A., 2011. Evidence for the role of horizontal transfer in generating pVT1, a large mosaic conjugative plasmid from the clam pathogen, Vibrio tapetis. PLoS One 6(2), e16759. Fearon, D.T., Locksley, R.M., 1996. The instructive role of innate immunity in the acquired immune response. Science 272(5258), 50-53. Fraune, S., Bosch, T.C., 2010. Why bacteria matter in animal development and evolution. Bioessays 32(7), 571-580. Godeke, J., Paul, K., Lassak, J., Thormann, K.M., 2011. Phage-induced lysis enhances biofilm formation in Shewanella oneidensis MR-1. ISME J 5(4), 613-626. Gurtler, V., Stanisich, V.A., 1996. New approaches to typing and identification of bacteria using the 16S-23S rDNA spacer region. Microbiology 142 ( Pt 1), 3-16. Hall, A.R., Scanlan, P.D., Morgan, A.D., Buckling, A., 2011. Host-parasite coevolutionary arms races give way to fluctuating selection. Ecol Lett 14(7), 635- 642. Hansson, G.C., Johansson, M.E., 2010. The inner of the two Muc2 mucin-dependent mucus layers in colon is devoid of bacteria. Gut Microbes 1(1), 51-54. Hargreaves, K.R., Kropinski, A.M., Clokie, M.R., 2014. Bacteriophage behavioral ecology: How phages alter their bacterial host's habits. Bacteriophage 4, e29866. Hernandez Prada, J.A., Haire, R.N., Cannon, J.P., Litman, G.W. and Ostrov, D.A., 2004. Crystallization and preliminary X-ray analysis of VCBP3 from Branchiostoma floridae. Acta Crystallographica Section D: Biological Crystallography, 60(11), 2022-2024. Hobbie, J.E., Daley, R.J., Jasper, S., 1977. Use of nuclepore filters for counting bacteria by fluorescence microscopy. Appl Environ Microbiol 33(5), 1225-1228. Hozumi, N., Tonegawa, S., 1976. Evidence for somatic rearrangement of immunoglobulin genes coding for variable and constant regions. Proc Natl Acad Sci U S A 73(10), 3628-3632. Ivanova, E.P., Sawabe, T., Hayashi, K., Gorshkova, N.M., Zhukova, N.V., Nedashkovskaya, O.I., Mikhailov, V.V., Nicolau, D.V. and Christen, R., 2003. Shewanella fidelis sp. nov., isolated from sediments and sea water. Int J Syst Evol Microbiol, 53(2), 577-582. Iwasaki, A., Medzhitov, R., 2010. Regulation of adaptive immunity by the innate immune system. Science 327(5963), 291-295. Johansson, M.E., Larsson, J.M., Hansson, G.C., 2011. The two mucus layers of colon are organized by the MUC2 mucin, whereas the outer layer is a legislator of host- microbial interactions. Proc Natl Acad Sci U S A 108 Suppl 1, 4659-4665.

30 Kau, A.L., Ahern, P.P., Griffin, N.W., Goodman, A.L., Gordon, J.I., 2011. Human nutrition, the gut microbiome and the immune system. Nature 474(7351), 327- 336. Kelkenberg, M., Odman-Naresh, J., Muthukrishnan, S., Merzendorfer, H., 2015. Chitin is a necessary component to maintain the barrier function of the peritrophic matrix in the insect midgut. Insect Biochem Mol Biol 56, 21-28. Knowles, B., Silveira, C.B., Bailey, B.A., Barott, K., Cantu, V.A., Cobián-Güemes, A.G., Coutinho, F.H., Dinsdale, E.A., Felts, B., Furby, K.A. and George, E.E., 2016. Lytic to temperate switching of viral communities. Nature, 531(7595), 466-470. Koropatnick, T.A., Engle, J.T., Apicella, M.A., Stabb, E.V., Goldman, W.E., McFall-Ngai, M.J., 2004. Microbial factor-mediated development in a host-bacterial mutualism. Science 306(5699), 1186-1188. Lee, Y.K., Mazmanian, S.K., 2010. Has the microbiota played a critical role in the evolution of the adaptive immune system? Science 330(6012), 1768-1773. Leigh, B.A., Karrer, C., Cannon, J.P., Breitbart, M., Dishaw, L.J., 2017. Isolation and characterization of a Shewanella phage-host system from the gut of the tunicate, Ciona intestinalis. Viruses 9(3). Leigh, B.A., Liberti, A., Dishaw, L.J., 2016. Generation of germ-free Ciona intestinalis for studies of gut-microbe interactions. Front Microbiol 7, 2092. Levy, M., Kolodziejczyk, A.A., Thaiss, C.A., Elinav, E., 2017. Dysbiosis and the immune system. Nat Rev Immunol 17(4), 219-232. Liberti, A., Leigh, B., De Santis, R., Pinto, M.R., Cannon, J.P., Dishaw, L.J., Litman, G.W., 2015. An immune effector system in the protochordate gut sheds light on fundamental aspects of vertebrate immunity. Pathogen-Host Interactions: Antigenic Variation v. Somatic Adaptations. Springer Int. Pub., 2015. 159-173. Liberti, A., Melillo, D., Zucchetti, I., Natale, L., Dishaw, L.J., Litman, G.W., De Santis, R., Pinto, M.R., 2014. Expression of Ciona intestinalis variable region-containing chitin-binding proteins during development of the gastrointestinal tract and their role in host-microbe interactions. PLoS One 9(5), e94984. Lim, E.S., Zhou, Y., Zhao, G., Bauer, I.K., Droit, L., Ndao, I.M., Warner, B.B., Tarr, P.I., Wang, D., Holtz, L.R., 2015. Early life dynamics of the human gut virome and bacterial microbiome in infants. Nat Med 21(10), 1228-1234. Litman, G.W., Cannon, J.P., Dishaw, L.J., Haire, R.N., Eason, D.D., Yoder, J.A., Prada, J.H. and Ostrov, D.A., 2007. Immunoglobulin variable regions in molecules exhibiting characteristics of innate and adaptive immune receptors. Immunologic Res, 38(1), 294-304. Litman, G.W., Rast, J.P., Fugmann, S.D., 2010. The origins of vertebrate adaptive immunity. Nat Rev Immunol 10(8), 543-553. Lloyd-Price, J., Abu-Ali, G., Huttenhower, C., 2016. The healthy human microbiome. Genome Med 8(1), 51. McFall-Ngai, M., Hadfield, M.G., Bosch, T.C., Carey, H.V., Domazet-Loso, T., Douglas, A.E., Dubilier, N., Eberl, G., Fukami, T., Gilbert, S.F., Hentschel, U., King, N., Kjelleberg, S., Knoll, A.H., Kremer, N., Mazmanian, S.K., Metcalf, J.L., Nealson, K., Pierce, N.E., Rawls, J.F., Reid, A., Ruby, E.G., Rumpho, M., Sanders, J.G., Tautz, D., Wernegreen, J.J., 2013. Animals in a bacterial world, a new imperative for the life sciences. Proc Natl Acad Sci U S A 110(9), 3229-3236.

31 Medzhitov, R., Janeway, C.A., Jr., 1997. Innate immunity: the virtues of a nonclonal system of recognition. Cell 91(3), 295-298. Meeus, I., Parmentier, L., Billiet, A., Maebe, K., Van Nieuwerburgh, F., Deforce, D., Wackers, F., Vandamme, P., Smagghe, G., 2015. 16S rRNA Amplicon sequencing demonstrates that indoor-reared bumblebees (Bombus terrestris) harbor a core subset of bacteria normally associated with the wild host. PLoS One 10(4), e0125152. Millar, R.H., 1953. Ciona. University Press of Liverpool. Minard, G., Mavingui, P., Moro, C.V., 2013. Diversity and function of bacterial microbiota in the mosquito holobiont. Parasit Vectors 6, 146. Minot, S., Bryson, A., Chehoud, C., Wu, G.D., Lewis, J.D., Bushman, F.D., 2013. Rapid evolution of the human gut virome. Proc Natl Acad Sci U S A 110(30), 12450- 12455. Minot, S., Sinha, R., Chen, J., Li, H., Keilbaugh, S.A., Wu, G.D., Lewis, J.D., Bushman, F.D., 2011. The human gut virome: inter-individual variation and dynamic response to diet. Genome Res 21(10), 1616-1625. Mirzaei, M.K., Maurice, C.F., 2017. Menage a trois in the human gut: interactions between host, bacteria and phages. Nat Rev Microbiol. 15.7 (2017): 397-408. Nakazawa, K., Yamazawa, T., Moriyama, Y., Ogura, Y., Kawai, N., Sasakura, Y. and Saiga, H., 2013. Formation of the digestive tract in Ciona intestinalis includes two distinct morphogenic processes between its anterior and posterior parts. Dev Dynamics, 242(10), 1172-1183. Nanda, A.M., Thormann, K., Frunzke, J., 2015. Impact of spontaneous prophage induction on the fitness of bacterial populations and host-microbe interactions. J Bacteriol 197(3), 410-419. Nishimura, Y., Watai, H., Honda, T., Mihara, T., Omae, K., Roux, S., Blanc-Mathieu, R., Yamamoto, K., Hingamp, P., Sako, Y. and Sullivan, M.B., 2017. Environmental viral genomes shed new light on virus-host interactions in the ocean. mSphere, 2(2), e00359-16. Orndorff, P.E., Devapali, A., Palestrant, S., Wyse, A., Everett, M.L., Bollinger, R.R., Parker, W., 2004. Immunoglobulin-mediated agglutination of and biofilm formation by Escherichia coli K-12 require the type 1 pilus fiber. Infect Immun 72(4), 1929-1938. Otani, S., Mikaelyan, A., Nobre, T., Hansen, L.H., Kone, N.A., Sorensen, S.J., Aanen, D.K., Boomsma, J.J., Brune, A., Poulsen, M., 2014. Identifying the core microbial community in the gut of fungus-growing termites. Mol Ecol 23(18), 4631-4644. Ozinsky, A., Underhill, D.M., Fontenot, J.D., Hajjar, A.M., Smith, K.D., Wilson, C.B., Schroeder, L., Aderem, A., 2000. The repertoire for pattern recognition of pathogens by the innate immune system is defined by cooperation between toll- like receptors. Proc Natl Acad Sci U S A 97(25), 13766-13771. Paul, J.H., 2008. Prophages in marine bacteria: dangerous molecular time bombs or the key to survival in the seas? ISME J 2(6), 579-589. Probert, H.M., Gibson, G.R., 2002. Bacterial biofilms in the human gastrointestinal tract. Curr Issues Intest Microbiol 3(2), 23-27. Qin, J., Li, R., Raes, J., Arumugam, M., Burgdorf, K.S., Manichanh, C., Nielsen, T., Pons, N., Levenez, F., Yamada, T., Mende, D.R., Li, J., Xu, J., Li, S., Li, D., Cao,

32 J., Wang, B., Liang, H., Zheng, H., Xie, Y., Tap, J., Lepage, P., Bertalan, M., Batto, J.M., Hansen, T., Le Paslier, D., Linneberg, A., Nielsen, H.B., Pelletier, E., Renault, P., Sicheritz-Ponten, T., Turner, K., Zhu, H., Yu, C., Li, S., Jian, M., Zhou, Y., Li, Y., Zhang, X., Li, S., Qin, N., Yang, H., Wang, J., Brunak, S., Dore, J., Guarner, F., Kristiansen, K., Pedersen, O., Parkhill, J., Weissenbach, J., Meta, H.I.T.C., Bork, P., Ehrlich, S.D., Wang, J., 2010. A human gut microbial gene catalogue established by metagenomic sequencing. Nature 464(7285), 59- 65. Reyes, A., Haynes, M., Hanson, N., Angly, F.E., Heath, A.C., Rohwer, F., Gordon, J.I., 2010. Viruses in the faecal microbiota of monozygotic twins and their mothers. Nature 466(7304), 334-338. Roeselers, G., Mittge, E.K., Stephens, W.Z., Parichy, D.M., Cavanaugh, C.M., Guillemin, K., Rawls, J.F., 2011. Evidence for a core gut microbiota in the zebrafish. ISME J 5(10), 1595-1608. Rolig, A.S., Parthasarathy, R., Burns, A.R., Bohannan, B.J., Guillemin, K., 2015. Individual members of the microbiota disproportionately modulate host innate immune responses. Cell Host Microbe 18(5), 613-620. Rooks, M.G., Garrett, W.S., 2016. Gut microbiota, metabolites and host immunity. Nat Rev Immunol 16(6), 341-352. Rosenberg, E., Zilber-Rosenberg, I., 2011. Symbiosis and development: the hologenome concept. Birth Defects Res C Embryo Today 93(1), 56-66. Sabree, Z.L., Hansen, A.K., Moran, N.A., 2012. Independent studies using deep sequencing resolve the same set of core bacterial species dominating gut communities of honey bees. PLoS One 7(7), e41250. Satoh, N., Satou, Y., Davidson, B., Levine, M., 2003. Ciona intestinalis: an emerging model for whole-genome analyses. Trends Genet 19(7), 376-381. Schmitt, S., Tsai, P., Bell, J., Fromont, J., Ilan, M., Lindquist, N., Perez, T., Rodrigo, A., Schupp, P.J., Vacelet, J., Webster, N., Hentschel, U., Taylor, M.W., 2012. Assessing the complex sponge microbiota: core, variable and species-specific bacterial communities in marine sponges. ISME J 6(3), 564-576. Sharon, I., Morowitz, M.J., Thomas, B.C., Costello, E.K., Relman, D.A., Banfield, J.F., 2013. Time series community genomics analysis reveals rapid shifts in bacterial species, strains, and phage during infant gut colonization. Genome Res 23(1), 111-120. Shin, S.C., Kim, S.H., You, H., Kim, B., Kim, A.C., Lee, K.A., Yoon, J.H., Ryu, J.H., Lee, W.J., 2011. Drosophila microbiome modulates host developmental and metabolic homeostasis via insulin signaling. Science 334(6056), 670-674. Silveira, C.B., Rohwer, F.L., 2016. Piggyback-the-winner in host-associated microbial communities. Biofilms Microbiomes 2(16010). Simmen, M.W., Leitgeb, S., Clark, V.H., Jones, S.J., Bird, A., 1998. Gene number in an invertebrate chordate, Ciona intestinalis. Proc Natl Acad Sci U S A 95(8), 4437- 4440. Sommer, F., Backhed, F., 2013. The gut microbiota--masters of host development and physiology. Nat Rev Microbiol 11(4), 227-238.

33 Sonnenburg, J.L., Angenent, L.T., Gordon, J.I., 2004. Getting a grip on things: how do communities of bacterial symbionts become established in our intestine? Nat Immunol 5(6), 569-573. Sprent, J., 1994. T and B memory cells. Cell 76(2), 315-322. Sprent, J., Surh, C.D., 2002. T cell memory. Annu Rev Immunol 20, 551-579. Suttle, C.A., 2005. Viruses in the sea. Nature, 437(7057), 356. Tan, D., Dahl, A., Middelboe, M., 2015. Vibriophages differentially influence biofilm formation by Vibrio anguillarum strains. Appl Environ Microbiol 81(13), 4489- 4497. Tang, W.J., Fernandez, J.G., Sohn, J.J., Amemiya, C.T., 2015. Chitin is endogenously produced in vertebrates. Curr Biol 25(7), 897-900. Tlaskalova-Hogenova, H., Stepankova, R., Hudcovic, T., Tuckova, L., Cukrowska, B., Lodinova-Zadnikova, R., Kozakova, H., Rossmann, P., Bartova, J., Sokol, D., Funda, D.P., Borovska, D., Rehakova, Z., Sinkora, J., Hofman, J., Drastich, P., Kokesova, A., 2004. Commensal bacteria (normal microflora), mucosal immunity and chronic inflammatory and autoimmune diseases. Immunol Lett 93(2-3), 97- 108. Turnbaugh, P.J., Gordon, J.I., 2009. The core gut microbiome, energy balance and obesity. J Physiol 587(Pt 17), 4153-4158. Weinbauer, M.G., 2004. Ecology of prokaryotic viruses. FEMS Microbiol Rev 28(2), 127-181. Weinbauer, M.G., Suttle, C.A., 1999. Lysogeny and prophage induction in coastal and offshore bacterial communities. Aquat Microb Ecol 18(3), 217-225. Whitman, W.B., Coleman, D.C., Wiebe, W.J., 1998. Prokaryotes: the unseen majority. Proc Natl Acad Sci U S A 95(12), 6578-6583. Williamson, K.E., Radosevich, M., Smith, D.W., Wommack, K.E., 2007. Incidence of lysogeny within temperate and extreme soil environments. Environ Microbiol 9(10), 2563-2574. Zhang, X., McDaniel, A.D., Wolf, L.E., Keusch, G.T., Waldor, M.K., Acheson, D.W., 2000. Quinolone antibiotics induce Shiga toxin-encoding bacteriophages, toxin production, and death in mice. J Infect Dis 181(2), 664-670.

34 Appendix A: An immune effector system in the protochordate gut sheds light on

the fundamental aspects of vertebrate immunity

This appendix is a co-first authored review chapter published in the book entitled

Pathogen-Host Interactions: Antigenic Variation v. Somatic Adaptations.

Liberti, A.*, Leigh, B.A.*, De Santis, R., Pinto, M.R., Cannon, J.P., Dishaw, L.J., and

Litman, G.W. An immune effector system in the protochordate gut sheds light on fundamental aspects of vertebrate immunity. Pathogen-Host Interactions: Antigenic

Variation v. Somatic Adaptations. Springer International Publishing, 2015. 159-173.

(*contributed equally)

35 An Immune Effector System in the Protochordate Gut Sheds Light on Fundamental Aspects of Vertebrate Immunity

Assunta Liberti, Brittany Leigh, Rosaria De Santis, Maria Rosaria Pinto, John P. Cannon, Larry J. Dishaw, and Gary W. Litman

Abstract A variety of germline and somatic immune mechanisms have evolved in vertebrate and invertebrate species to detect a wide array of pathogenic invaders. The gut is a particularly significant site in terms of distinguishing pathogens from potentially beneficial microbes. Ciona intestinalis, a filter-feeding marine protochordate that is ancestral to the vertebrate form, possesses variable region- containing chitin-binding proteins (VCBPs), a family of innate immune receptors, which recognize bacteria through an immunoglobulin-type variable region. The manner in which VCBPs mediate immune recognition appears to be related to the development and bacterial colonization of the gut, and it is likely that these molecules are critical elements in achieving overall immune and physiological homeostasis.

A. Liberti • R. De Santis • M.R. Pinto Department of Animal Physiology and Evolution, Stazione Zoologica Anton Dohrn, Villa Comunale, 80121 Napoli, Italy e-mail: [email protected]; [email protected]; [email protected] B. Leigh Department of Marine Sciences, University of South Florida St. Petersburg, St Petersburg, FL, USA e-mail: [email protected] J.P. Cannon • L.J. Dishaw • G.W. Litman (*) Department of Pediatrics, University of South Florida College of Medicine, St Petersburg, FL, USA e-mail: [email protected]; [email protected]; [email protected]

© Springer International Publishing Switzerland 2015 159 E. Hsu, L. Du Pasquier (eds.), Pathogen-Host Interactions: Antigenic Variation v. Somatic Adaptations, Results and Problems in Cell Differentiation 57, DOI 10.1007/978-3-319-20819-0_7 160 A. Liberti et al.

1 The Antiquity and Evolution of Immune Genetic Diversity

Extreme genetic variation in the small genomes of some viruses, bacteria, and other protozoa results in extraordinary functional diversity, of which some is utilized to escape host defense strategies (Bainard and Gregory 2013; Steward et al. 2000). Since all living organisms can generate genetic diversity, which may result in functional novelty, an evolutionary arms race is maintained between host immune receptors and potential pathogens. Similar dynamics influence harmless as well as beneficial microbes (Hooper and Gordon 2001); the host must evolve strategies that either ignore or actively protect some organisms while aggressively responding to those that otherwise could prove fatal. A remarkable number of different mechanisms have evolved at all levels of invertebrate and vertebrate phylogeny; however, in the vertebrates, an adaptive strategy for generating an extraordinary level of receptor variation at the somatic cell level gives rise to highly specific responses, which can mature affinity and, through providing memory, effect heightened responses upon secondary contact. This strategy can afford protection to nonpathogenic or nonthreatening flora and has the potential to both interfere with and minimize collateral damage common to innate responses. The immunoglobulin superfamily (IgSF) is one of the largest and most functionally diversified gene families. Through domain duplication and shuffling, diversified gene families, consisting of multiple nonhomologous segments, have emerged. These diverse genes serve roles in both innate and adaptive immune responses, as well as in some aspects of developmental patterning. Because of the vast sequence variation thus created in certain members of the IgSF, bona fide orthologs may conserve only short amino acid segments, confounding efforts to detect homologous forms in lower chordate species. Although the ancestral elements responsible for the somatic diversification of adaptive antigen receptors are not understood, characterizing novel Ig-like domains in the more ancient phylogenetic taxa has led to the discovery of alternative forms of the Ig-domain-containing proteins. It is likely that organisms whose ancestry predates vertebrate divergence may provide the most meaningful insight into the evolution of the components that were assembled into modern adaptive immune systems.

2 Immunity in Protochordates: The VCBPs

Protochordates are deuterostome invertebrates belonging to the phylum Chordata, of which two subphyla are recognized: the cephalochordates, of which amphioxus is representative, and the urochordates, of which the sea squirt is representative (Fig. 1). Cephalochordates diverged from a common chordate ancestor and urochordates diverged more recently from a common ancestor with vertebrates (Delsuc et al. 2006). Protochordates maintain chordate anatomical and developmental characteristics such as: an endostyle, a notochord, pharyngeal slits, segmented An Immune Effector System in the Protochordate Gut Sheds Light on... 161

Fig. 1 The evolution of Chordates. Divergence of Chordata, including subphyletic grouping of Vertebrata, Urochordata, and Cephalochordata. The urochordates, which include Ciona intestinalis, and the cephalochordates, which include Branchiostoma ﬂoridae, both are classiﬁed as protochordates muscle blocks, a hollow dorsal nerve cord, and a postanal tail (Berrill 1947) but do not possess adaptive immune systems. Organized lymphoid tissues, which play important roles in various phases of the adaptive immune response, are lacking in protochordates and all other invertebrates. Protochordates afford an opportunity to further characterize a chordate system that relies exclusively on streamlined innate immune networks to achieve and maintain homeostasis in the absence of a highly complex adaptive immune system (e.g., redundant pathways, complex signaling, rearranging receptors, and additional specialized cell types).

2.1 VCBPs in Branchiostoma ﬂoridae

In the course of an investigation into the origins of early forms of the immunoglobulin/T cell antigen receptor (Ig/TCR) variable region domain, the variable region-containing chitin-binding protein (VCBP) genes were identified in the cephalochordate amphioxus, Branchiostoma floridae (Cannon et al. 2002). The VCBPs include at least five proteins (VCBP1–5) that possess two tandem V-type domains at the N-terminus and a single chitin-binding domain (CBD) at the C-terminus (Fig. 2A). VCBP1, VCBP2, VCBP4, and VCBP5 map to the same chromosomal locus and VCBP3 maps to a separate locus. An extraordinarily large number of haplotypes of VCBPs have been identified in amphioxus (Cannon et al. 2004). Although at the time of their discovery VCBP function was not understood, it was hypothesized that extensive polymorphism may compensate for a lack of somatic variation in receptor diversity. VCBP2 and VCBP5 share closer overall organization and sequence identity as compared to VCBP1, VCBP3, and VCBP4, which are related more distantly to each other as well 162 A. Liberti et al.

Fig. 2 VCBP protein structure. (A) A generic VCBP protein possessing a leader peptide, two tandem N-terminal V-type immunoglobulin domains, and a C-terminal chitin-binding domain (CBD). (B) The crystal structure of the VCBP3 domain compared with other antigen receptors, with the V1 domain being the most closely related to TCR Vδ (C). VCBP3 V1 superimposed on the V2 domain reveals that the CC0 and BC loops differ. Adapted from Dishaw et al. (2008) and Hernandez Prada et al. (2006) as to the VCBP2/VCBP5 cluster (Dishaw et al. 2008). The VCBP2/VCBP5 cluster has been characterized extensively; the genes display indel polymorphism in both coding and noncoding regions. In particular, one of the haplotypes (B) exhibits a much higher instance of inverted repeats (IRs) compared to the rest of the genome and that in turn may influence genomic stability. Gene inactivation, diversity, and transcriptional conformation could be affected (Dishaw et al. 2008). VCBPs are expressed predominantly as full-length versions; shorter-length spliced variants also have been identified. VCBP haplotypes are characterized both by copy number variation and by extensive variation in repeat type and density. Gene duplication, gene conversion, locus differentiation, unequal cross- over, and/or other mechanisms of gene exchange may generate exceptional VCBP haplotype and allelic diversity in wild populations (Dishaw et al. 2010). VCBPs exhibit certain characteristics of what we consider as immune recognition molecules, including: a high degree of germline polymorphism, V-family distribution, tissue-specific expression (largely confined to the gut), and a chimeric immunoglobulin-lectin structure similar to other non-vertebrate receptor types (Cannon et al. 2002; Ghosh et al. 2011). The structures of the V domains in amphioxus are situated head-to-tail (Fig. 2B, C), as opposed to the jawed vertebrate Igs and TCRs, where the two V domains are packed in a head-to-head orientation An Immune Effector System in the Protochordate Gut Sheds Light on... 163

(Cannon et al. 2002; Hernandez Prada et al. 2006). Hypervariable complementarity- determining regions (CDRs) in vertebrate Igs are positioned in a manner that cooperatively form an antigen-binding site comprising two V domains. In VCBPs, the orientation of the two V-type domains positions the sequence segments corresponding to CDRs in Ig vertebrate V regions at the opposite ends (Fig. 2B, C). It is important to note that the sequence regions that exhibit the greatest variation in VCBPs do not correspond to the positions of CDRs in vertebrate Ig V regions and likely are not involved in interactions of VCBPs with their ligands (Hernandez Prada et al. 2006). The contiguous joining J-region, which is present in all rearranging antigen receptor genes, is important for antigen receptor dimerization and combinatorial diversity (Gough and Bernard 1981). However, J-region-like segments in VCBPs are intimately involved in V-domain packing (Hernandez Prada et al. 2006). The V domains of VCBPs represent an alternative utilization of the V domain as a platform for immunological function. In addition to the V-type domains, VCBPs possess C-terminal regions consisting of conserved structural residues (e.g., characteristically spaced cysteines) that are present in CBDs. Chitin, beta-(1–4)-poly-N-acetyl D-glucosamine, is the second most abundant polysaccharide found in nature, after cellulose, and is present in every kingdom including bacteria, Archaea, fungi, plants, animals, and protists (Jeuniaux and Vossfoucart 1991). Chitin exerts a number of effects on animal physiology and immunity as a signaling molecule, likely mediated by host enzymes such as chitinases. Host production of chitin via chitin synthase genes is observed throughout all classes of metazoans except mammals, indicating an important and integral ancient role for this biopolymer (Lee 2009). More than 250 CBD-encoding open reading frames, scattered over 31 scaffolds, have been identified in the amphioxus genome. VCBP1 and VCBP3 contain exons that encode the CBM_14- type CBD, a domain in the carbohydrate-binding family that is related very closely to those described in peritrophins, which are glycoproteins that are incorporated into the chitin-rich gut environment of insects (Dishaw et al. 2008). Expression of VCBP proteins in amphioxus essentially is specific to the gut of filter-feeding adults that are exposed to a constant influx of potential pathogens.

2.2 VCBPs in Ciona intestinalis

Amphioxus at best is a challenging experimental model system for characterizing molecular functions. In order to determine VCBP function, a different protochordate model system, Ciona intestinalis, is being developed. Ciona is a sessile, filter-feeding protochordate that has served as a significant model in developmental biology (Satoh 2003). The genome of Ciona has been sequenced and annotated, and four unlinked VCBPs have been identified: VCBP-A, VCBP-B, VCBP-C, and VCBP-D (Azumi et al. 2003; Cannon et al. 2002, 2004; Dishaw et al. 2011). 164 A. Liberti et al.

VCBP-A, VCBP-C, and VCBP-D are located on chromosomes 5, 4, and 10, respectively (JGI version 2.0). VCBP-B was placed on scaffold 41 in the first Ciona genome draft (JGI version 1.0), but assembly-related problems and/or allelic ambiguities have precluded its mapping in the second Ciona genome draft (JGI version 2.0). The predicted transcript lengths of VCBP-A, VCBP-B, and VCBP-C are ~1 kb. VCBP-A and VCBP-B are encoded by nine exons of similar length and are related most closely; however, their respective introns and intergenic regions exhibit only limited sequence similarity, indicating that they do not represent allelic variants (Dishaw et al. 2011). VCBP-C and VCBP-D are encoded in five exons and are more similar to each other than to VCBP-A and VCBP-B.The30 terminal exons of VCBP-D encode termination and polyadenylation signals but not a CBD (Dishaw et al. 2011). Multiple, randomly distributed, single nucleotide polymorphisms (SNPs) have been identified in coding regions, introns, and intergenic regions of VCBP-A, VCBP-B, and VCBP-C. VCBP-D is the least polymorphic (Dishaw et al. 2011). Further inspection of polymorphisms indicates that VCBP-C and, to a minor extent, VCBP-B are represented by limited main haplotypes. Point mutations and frequent indels have been identified in intron and intergenic regions. Frequent indels have been identified in introns of alleles that exhibit moderate polymorphism in their coding regions (Dishaw et al. 2011). Although the VCBP genes in Ciona are polymorphic, they lack the high degree of haplotypic variation seen in amphioxus VCBPs (Cannon et al. 2004; Dishaw et al. 2008). VCBP (A–C) in Ciona exhibit the same domain organization as VCBPs in amphioxus consisting of a leader peptide, two N-terminal V-type Ig domains, and a single C-terminal CBD. A gene corresponding to VCBP-D, which contains two complete V-type domains but lacks a CBD, has not been identified in amphioxus. However, an alternatively spliced form of VCBP3, in which the CBD is absent, is found in this species (Dishaw et al. 2008). Comparisons of VCBPs at the peptide level indicate ~72 % relatedness at the predicted peptide level between VCBP-A and VCBP-B and ~29 % identity when VCBP-C is compared with VCBP-A and VCBP-B. VCBP-D shares ~47 % identity with VCBP-C and ~26 % with VCBP-A and VCBP-B, taking into account its shorter length (Dishaw et al. 2011).

2.2.1 VCBP Expression in Immunocompetent Tissues from Larval Stage to the Adult

At an early stage in the life cycle of Ciona, the embryo develops into a swimming tadpole larva, which attaches to a substrate within the course of several hours. After settlement, the larva undergoes metamorphosis, during which the body axes are reorganized, the tail retracts, and consequently the notochord and the tubular nervous system are lost (Satoh 2003). VCBP genes in Ciona are expressed in deﬁned territories from the larval stage through metamorphosis to adulthood (Fig. 3). Speciﬁcally, VCBP-A and VCBP-C are expressed the earliest, paralleling the development of the digestive tract. The patterns of expression essentially trace An Immune Effector System in the Protochordate Gut Sheds Light on... 165

Fig. 3 VCBP expression in Ciona intestinalis gut. (A) VCBP expression patterns from larval stage to “small adult.” In the adult stomach epithelium, (B) VCBP-A expression is not detected, while (C) VCBP-B and (D) VCBP-C are expressed differentially in scattered cells of the epithelium and in cells localized in the stomach crypts, respectively. (E) VCBP-C expression also is detected in the intestine. Asterisk, the lumen of the organ. Scale bars:(B)–(D) 100 μm; (E)50μm. Adapted from Liberti et al. (2014) and Dishaw et al. (2011) 166 A. Liberti et al. the formation and the specification of distinctive areas of the stomach and intestine (Fig. 3A) (Liberti et al. 2014). At the larval stage, VCBP-A and VCBP-C are localized in two different regions of the endoderm (Liberti et al. 2014), corresponding to the prospective regions in the adult that give rise to the esophagus, stomach, and intestine, respectively (Hirano and Nishida 2000). At the initiation of metamorphosis, VCBP-A and VCBP-C are expressed in the primordium of the gut, designated as intestine disk. From the beginning of late rotation (BLR) stage until the end of metamorphosis, VCBP-A and VCBP-C are expressed in different regions (Fig. 3A). Throughout metamorphosis, expression of VCBP-A is confined to scattered cells of the stomach epithelium (Liberti et al. 2014). At the BLR stage, VCBP-C is detected in one region of the developing intestine, whereas at stage 4 of 1st ascidian juvenile, corresponding to a further level of intestinal differentiation, gene expression is localized to a small ring of cells at the border between the stomach and intestine as well as to a more extended region of the intestine identified as the hindgut (Fig. 3A). The expression patterns of VCBP-C may reflect early compartmentalization of functions in the developing intestine. At the onset of feeding, at stage 5 of 1st ascidian juvenile, VCBP-C also is expressed in the stomach, suggesting a link between the gene expression in this organ and the contact with the external environment (Fig. 3A). Expression of VCBP-C in the stomach and intestine is maintained until adulthood (Liberti et al. 2014). At the end of metamorphosis, VCBP-A and VCBP-C exhibit different expression patterns. VCBP-A is expressed in cells scattered in the epithelium of the stomach, whereas VCBP-C expression is localized in groups of cells at the base of the ridges, which are a feature of the adult stomach. The expression patterns of these genes suggest they represent either different cell types or different stages of differentiation of the same cell type (Liberti et al. 2014). At the small adult stage, corresponding to animals 1–2 cm in size, VCBP-A expression appears to switch off and is replaced by expression of VCBP-B that occurs in scattered cells of the stomach epithelium (Liberti et al. 2014). Differences in the expression patterns of VCBP-A and VCBP-C suggest they may play a dual role in development and immunity. The timing and patterns of the expression suggest a role in mediating initial microbial colonization of the gut. It is well recognized that the gut epithelium in vertebrates is the first line of defense against invading pathogens. Gut innate immune molecules recognize microbial signatures and mediate signaling to the adaptive immune system of an impending attack. In both vertebrates and invertebrates, a protective mucus layer, colonized extensively by mostly beneficial microbes that are important for host health and homeostasis, covers the gut epithelium. Deciphering beneficial from pathogenic microorganisms is a critical task as microbial heterogeneity likely accounts for extensive variation in immune molecules of gut tissue. However, a direct role for VCBP molecules in gut differentiation, in some ways reminiscent of the duality of function seen in the DSCAM system (Boehm 2007), cannot be ruled out. Effective knockdown strategies of VCBPs could clarify whether or not these genes are An Immune Effector System in the Protochordate Gut Sheds Light on... 167 important in specifying territories of the digestive tract and/or in the differentiation of the various functional tracts of the gut. In the adult, VCBP-A, VCBP-B, and VCBP-C transcripts are localized in immune competent tissues, including the digestive tract (Fig. 3B–E) and the blood cells (Dishaw et al. 2011). VCBP-B expression in the gut is localized in cells scattered throughout the stomach epithelium (Fig. 3E); in contrast, VCBP-C is expressed in the cell types that reside at the base of each epithelial fold (Fig. 3D) (Dishaw et al. 2011; Liberti et al. 2014). VCBP-C protein is localized both in the granules of zymogenic cells, which morphologically are analogous to mammalian stomach and pancreatic cells (Burighel 1997), and as soluble protein in the stomach lumen associated with the microvilli of the stomach cells (Dishaw et al. 2011). VCBP-C also can be detected in the intestine (Dishaw et al. 2011) where it maintains the regionalized expression observed during the differentiation of the organ at the juvenile stage (Liberti et al. 2014). The expression of both VCBP-A and VCBP-C has been detected in granular amoebocytes localized in the connective tissue surrounding the stomach epithelium, the so-called lamina propria, as well as in circulating blood cells (Dishaw et al. 2011; Liberti et al. 2014). VCBP-A is expressed in the blood cells, but not in the stomach epithelium, where VCBP-A protein has been detected. VCBP-A protein can be detected in the cytoplasm and large vacuoles of the absorptive cells as well as in the lamina propria, both as a secreted molecule in the lymph and in the granular amoebocytes. This latter group of cells has been observed to be associated closely with the basement and plasma membranes of the stomach cells. Although further investigation will be necessary to clarify the dynamics of the localization of VCBP-A in the stomach cells, these data support the hypothesis that a non-endogenous origin of VCBP-A, likely from the adjacent blood cell-rich tissue, accounts for localization in the stomach epithelial cells (Liberti et al. 2014). The expression of VCBP-D has not yet been characterized.

2.2.2 VCBPs in Recognition of Bacteria

Although the precise function of VCBP molecules has not yet been determined, extensive data indicate that these proteins act as secreted immune-type molecules (Dishaw et al. 2011, 2012). Experiments in which Ciona were fed either Gram- positive (Bacillus cereus) or Gram-negative (Escherichia coli) bacteria indicate that endogenous VCBP-C binds to the bacteria present in the stomach lumen (Fig. 4a, b) (Dishaw et al. 2011). Furthermore, afﬁnity-puriﬁed VCBP-C protein acts as an opsonin, increasing the capacity of granular amoebocytes to phagocytose FITC-labeled B. cereus in vitro. An increase in phagocytosis also is observed when the bacteria are preincubated with recombinant VCBP-C protein fragment containing only the V-type domains. The full-length form of VCBP-C is only slightly more effective as an opsonin than is the truncated recombinant form lacking the CBD (Dishaw et al. 2011). VCBP-C is secreted by the stomach epithelium into the lumen, where it binds ingested bacteria. At the end of 168 A. Liberti et al.

Fig. 4 VCBP-C functions as an immune-type molecule. VCBP-C immuno-localization on stomach sections of bacteria-fed animals showing gold particles localized on the surface (arrows)of both (A) B. cereus and (B) E. coli, indicating the ability of secreted VCBP-C to bind to the bacteria in the organ lumen. Phagocytic activity of Ciona hemocytes to FITC-labeled B. cereus (C and D). When the FITC-labeled B. cereus (arrows) are preincubated with the affinity-purified VCBP-C protein, an increased number of phagocytic granular amoebocytes (arrows) is observed, consistent with an opsonic function for VCBP-C (E and F). (C and E) fluorescence microscopy and (D and F) Nomarski optics. Scale bars:(A)2μm, (B)1μm, and (C)–(F)20μm. Adapted from Dishaw et al. (2011) metamorphosis (e.g., stage 7–8 juvenile), corresponding to the early phases of contact between the gut and the external environment, the ingestion of either Gram-positive B. cereus or Gram-negative E. coli influences the expression of VCBP-A and VCBP-C, both of which can be detected at this stage; this observation is consistent with the hypothesis that the VCBPs have a role at the onset of gut colonization by microbiota as well as in gut homeostasis and immunity (Dishaw An Immune Effector System in the Protochordate Gut Sheds Light on... 169 et al. 2011). VCBP-A and VCBP-C exhibit an opposite response to different bacteria strains (Liberti et al. 2014). The relative ease of generating germfree (gnotobiotic) Ciona will facilitate investigation of how the host-microbiota interaction affects VCBP expression and/or their localization in the gut lumen. By introducing selected bacteria strains in gnotobiotic animals, it will be possible to study which strains or communities of bacteria influence VCBP expression as well as how pathogenic bacteria influence these processes. The role of the VCBPs in the complex interaction between the host and microorganisms across the gut epithelium is still under investigation. Ciona is ideally suited to such investigations as they possess numerous experimental advantages for studies of gut host-microbe interactions, a topic that is of particular current medical relevance in relation to bowel and other diseases in humans (Dishaw et al. 2012). The functional analogies that can be drawn between VCBPs and other components of gut immunity in invertebrates and gut immunity in higher vertebrates are striking. In mammals it is known that specialized epithelial cells, such as enterocytes and goblet cells, secrete mucins, which are glycoproteins that assemble into a viscous gel-like mucus layer that provides the frontline protections against microorganisms in the gut lumen (Atuma et al. 2001; Hooper and Macpherson 2010; Johansson et al. 2008). The gel-forming mucins are a recognized element of innate immunity and are well conserved during evolution, from the earliest metazoans (Lang et al. 2007). Mucin-related proteins have been identified in the Ciona genome but have not been characterized in detail (Lang et al. 2007). It is essential to study the structure of the mucus layer within the Ciona gut and determine if it is organized as in mammals with an inner, firmly adherent epithelium-associated layer devoid of bacteria and an outer loose, non-adherent layer, rich with bacteria (Johansson et al. 2008). Determining how the VCBP molecules are distributed in each compartment of the gut, if they are immobilized in some way to the mucus layers, how they attach to lumen bacteria, if specificity exists in such interactions, and what factors influence the distribution of these molecules will help delineate the role of VCBPs in the complex dynamics that define the colonization of the gut by resident microbiota and defense against pathogens. The diverse locations in which VCBPs are expressed and secreted could indicate a differential role played by the VCBP molecules during microbiota colonization in the distinct compartments of the digestive tract. Although the core community of bacteria is known in Ciona (Dishaw et al. 2014b), it is particularly important to elucidate the distribution of these microbiota among the stomach, midgut, and hindgut and determine what, if any, relationship this has to the patterned expression and secretion of VCBPs.

2.2.3 VCBP and IgA

Increasing interest has been focused on primary investigations of both innate and adaptive immunity in the digestive tract, which essentially constitutes an external environment within an animal. Even the simplest animals with a gut appear to host complex microbiota (Dishaw et al. 2014a). Separation of the gut lumen from the 170 A. Liberti et al. host via a single layer of epithelium is a common feature of all animal forms. The epithelial layer is fully immunocompetent and secretes substances that initiate and maintain barriers. In addition, these barriers also support the growth of the host- specific microbiomes to which the animal in general does not mount detrimental responses (Hooper and Gordon 2001). While these barriers are maintained primarily via innate immune responses, the gut has sustained conditions that have driven and shaped the evolution of different forms of immunity over tens to hundreds of millions of years. Adaptive immunity in jawed and jawless vertebrates may have evolved to negotiate the intrinsic complexity of microbiomes and to regulate tolerance to beneficial flora (Lee and Mazmanian 2010; McFall-Ngai 2007). Adap- tive immune systems, over millions of years, have coevolved with signals from symbiotic microbiota in ways that have resulted in protection of both the host and microbiota from pathogens (Lee and Mazmanian 2010). In vertebrates, the developmental maturation of the gut is coupled to symbiotic interactions that also are responsible for sustaining homeostasis. We speculate that while complex animal forms evolved vasculature within the gut to mobilize nutrition through larger, sub-compartmentalized bodies (as seen in most vertebrates), the adaptive immune system and functionally diverse immunocytes provide long-term protection from pathogens that may breach this limited barrier. Thus, the origins and evolution of adaptive immunity can be understood better by studying how diverse model systems (including those lacking adaptive immunity) negotiate with complex gut microbiota. Although much is known about the genetics and structure of VCBPs, relatively little is known regarding the relationship between the Ig V regions and the C-terminal CBDs. In a broad sense, parallels exist between protochordate VCBPs and mammalian IgA (Holland et al. 2008), the predominant class of antibody produced in mucosal secretions of mammals. IgA is produced in a unique anatomical site localized within the gut lamina propria, i.e., in the gut-associated lymphoid tissue (GALT). The main site of production is in the Peyer’s patches (Craig and Cebra 1971) and isolated lymphoid follicles (Fagarasan et al. 2010). Once produced, dimeric IgA is transported into the lumen via polymeric immunoglobulin receptor-dependent transcytosis through the intestinal epithelial cells (Mostov et al. 1986). The high-affinity, antigen-specific mode of IgA production within the gut lumen originally was recognized as an important factor protecting host integrity by preventing colonization and invasion by pathogenic microbes. IgA also may function in a low-affinity mode to confine the dense commensal microbiota within the intestinal lumen through “immune exclusion,” which effectively elimi- nates microbes by coating them with the soluble antibody, thus preventing their adherence to the epithelial surface (Macpherson et al. 2008). Secretory IgA also may function within distinct compartments of the gut through the selective modu- lation of biofilms (Bollinger et al. 2003). Structural and functional features of VCBPs strongly suggest parallels with IgA. Although vertebrate-type GALT has not been identified in Ciona, the localization of the VCBPs in different areas of the stomach epithelium implies that this organ could be the main site of production of immune molecules involved in gut An Immune Effector System in the Protochordate Gut Sheds Light on... 171 homeostasis. The VCBP-bacteria interaction should not be interpreted from the traditional perspective of vertebrate immunity but rather in the context of a complex symbiosis of host and microbes across the gut (Dishaw et al. 2011). VCBP-A, VCBP-B, and VCBP-C could mediate both immune exclusion and potentially other functions within the host-bacterial interface. Specifically, VCBP-C may function in the immune exclusion mechanism of microorganisms in the stomach lumen, and VCBP-A could have a defense role in at least one type of stomach cell that is in contact with microorganisms that have crossed the epithelial barrier. Although VCBPs can recognize microorganisms via the V-type domains (Dishaw et al. 2011), the precise structural mechanism of recognition likely is entirely different from that of the antigen-binding receptors in contemporary vertebrates. Protochordate VCBPs and higher vertebrate IgA present an interesting potential case of convergent evolution of gut immunity.

3 Conclusion

The presence and diversity of the V domain in VCBPs suggested initially that these molecules could be important in immune recognition; however, only recently has a role for them in mediating immune function been shown. A role for VCBPs in gut development and function underscores their broad involvement in immunological homeostasis. Although VCBPs do not exhibit the high degree of variability of somatically rearranged adaptive immune receptors, they likely mediate an array of functions, some of which may be shared with IgA, an important feature of adaptive immune systems of vertebrates. Irrespective of our less than complete understanding of VCBP function(s), they emphasize continuity between innate and adaptive immunity. Further investigations of VCBP function in the Ciona gut promise to deﬁne and clarify the precise role of the VCBPs in microbial gut colonization, innate immunity, and development of the gut.

Acknowledgments The authors would like to thank both the ASSEMBLE (Association of European Marine Biological Laboratories) program for collaborative support and Barbara Pryor for editorial assistance. LJD is supported by grants from the All Children’s Hospital Foundation and the University of South Florida College of Medicine Sponsored Research; GWL is supported by NIH R01 Al 23338.

References

Atuma C, Strugala V, Allen A, Holm L (2001) The adherent gastrointestinal mucus gel layer: thickness and physical state in vivo. Am J Physiol Gastrointest Liver Physiol 280:G922–G929 Azumi K, De Santis R, De Tomaso A, Rigoutsos I, Yoshizaki F, Pinto MR, Marino R, Shida K, Ikeda M, Ikeda M, Arai M, Inoue Y, Shimizu T, Satoh N, Rokhsar DS, Pasquier D, Kasahara L, Satake M, Nonaka M (2003) Genomic analysis of immunity in a Urochordate and the 172 A. Liberti et al.

emergence of the vertebrate immune system: “waiting for Godot”. Immunogenetics 55:570–581 Bainard JD, Gregory TR (2013) Genome size evolution: patterns, mechanisms, and methodolog- ical advances. Genome 56:Vii–Viii Berrill NJ (1947) The development and growth of Ciona. J Mar Biol Assoc UK 26:616–625 Boehm T (2007) Two in one: dual function of an invertebrate antigen receptor. Nat Immunol 8:1031–1033 Bollinger RR, Everett ML, Palestrant D, Love SD, Lin SS, Parker W (2003) Human secretory immunoglobulin A may contribute to biofilm formation in the gut. Immunology 109:580–587 Burighel P, Cloney RA (1997) Urochordata: Ascidiacea. In: Harrison FW, Ruppert EE (eds) Microscopic analysis of invertebrates. Wiley-Liss, New York, pp 221–347 Cannon JP, Haire RN, Litman GW (2002) Identification of diversified genes that contain immunoglobulin-like variable regions in a protochordate. Nat Immunol 3:1200–1207 Cannon JP, Haire RN, Schnitker N, Mueller MG, Litman GW (2004) Individual protochordates have unique immune-type receptor repertoires. Curr Biol 14:R465–R466 Craig SW, Cebra JJ (1971) Peyer’s patches – enriched source of precursors for iga-producing immunocytes in rabbit. J Exp Med 134:188–200 Delsuc F, Brinkmann H, Chourrout D, Philippe H (2006) Tunicates and not cephalochordates are the closest living relatives of vertebrates. Nature 439:965–968 Dishaw LJ, Mueller MG, Gwatney N, Cannon JP, Haire RN, Litman RT, Amemiya CT, Ota T, Rowen L, Glusman G, Litman GW (2008) Genomic complexity of the variable region- containing chitin-binding proteins in amphioxus. BMC Genet 9:78 Dishaw LJ, Ota T, Mueller MG, Cannon JP, Haire RN, Gwatney NR, Litman RT, Litman GW (2010) The basis for haplotype complexity in VCBPs, an immune-type receptor in amphioxus. Immunogenetics 62:623–631 Dishaw LJ, Giacomelli S, Melillo D, Zucchetti I, Haire RN, Natale L, Russo NA, De Santis R, Litman GW, Pinto MR (2011) A role for variable region-containing chitin-binding proteins (VCBPs) in host gut-bacteria interactions. Proc Natl Acad Sci USA 108:16747–16752 Dishaw LJ, Flores-Torres JA, Mueller MG, Karrer CR, Skapura DP, Melillo D, Zucchetti I, De Santis R, Pinto MR, Litman GW (2012) A basal chordate model for studies of gut microbial immune interactions. Front Immunol 3:96 Dishaw LJ, Cannon JP, Litman GW, Parker W (2014a) Immune-directed support of rich microbial communities in the gut has ancient roots. Dev Comp Immunol 47:36–51 Dishaw LJ, Flores-Torres J, Lax S, Gemayel K, Leigh B, Melillo D, Mueller MG, Natale L, Zucchetti I, De Santis R, Pinto MR, Litman GW, Gilbert JA (2014b) The gut of geographically disparate Ciona intestinalis harbors a core microbiota. PLoS One 9, e93386 Fagarasan S, Kawamoto S, Kanagawa O, Suzuki K (2010) Adaptive immune regulation in the gut: T cell-dependent and T cell-independent IgA synthesis. Annu Rev Immunol 28:243–273 Ghosh J, Lun CM, Majeske AJ, Sacchi S, Schrankel CS, Smith LC (2011) Invertebrate immune diversity. Dev Comp Immunol 35:959–974 Gough NM, Bernard O (1981) Sequences of the joining region genes for immunoglobulin heavy chains and their role in generation of antibody diversity. Proc Natl Acad Sci USA 78:509–513 Hernandez Prada JA, Haire RN, Allaire M, Jakoncic J, Stojanoff V, Cannon JP, Litman GW, Ostrov DA (2006) Ancient evolutionary origin of diversified variable regions demonstrated by crystal structures of an immune-type receptor in amphioxus. Nat Immunol 7:875–882 Hirano T, Nishida H (2000) Developmental fates of larval tissues after metamorphosis in ascidian Halocynthia roretziI. II. Origin of endodermal tissues of the juvenile. Dev Genes Evol 210:55–63 Holland LZ, Albalat R, Azumi K, Benito-Gutierrez E, Blow MJ, Bronner-Fraser M, Brunet F, Butts T, Candiani S, Dishaw LJ, Ferrier DE, Garcia-Fernandez J, Gibson-Brown JJ, Gissi C, Godzik A, Hallbook F, Hirose D, Hosomichi K, Ikuta T, Inoko H, Kasahara M, Kasamatsu J, Kawashima T, Kimura A, Kobayashi M, Kozmik Z, Kubokawa K, Laudet V, Litman GW, McHardy AC, Meulemans D, Nonaka M, Olinski RP, Pancer Z, Pennacchio LA, Pestarino M, An Immune Effector System in the Protochordate Gut Sheds Light on... 173

Rast JP, Rigoutsos I, Robinson-Rechavi M, Roch G, Saiga H, Sasakura Y, Satake M, Satou Y, Schubert M, Sherwood N, Shiina T, Takatori N, Tello J, Vopalensky P, Wada S, Xu A, Ye Y, Yoshida K, Yoshizaki F, Yu JK, Zhang Q, Zmasek CM, de Jong PJ, Osoegawa K, Putnam NH, Rokhsar DS, Satoh N, Holland PW (2008) The amphioxus genome illuminates vertebrate origins and cephalochordate biology. Genome Res 18:1100–1111 Hooper LV, Gordon JI (2001) Commensal host-bacterial relationships in the gut. Science 292:1115–1118 Hooper LV, Macpherson AJ (2010) Immune adaptations that maintain homeostasis with the intestinal microbiota. Nat Rev Immunol 10:159–169 Jeuniaux C, Vossfoucart MF (1991) Chitin biomass and production in the marine-environment. Biochem Syst Ecol 19:347–356 Johansson MEV, Phillipson M, Petersson J, Velcich A, Holm L, Hansson GC (2008) The inner of the two Muc2 mucin-dependent mucus layers in colon is devoid of bacteria. Proc Natl Acad Sci USA 105:15064–15069 Lang TA, Hansson GC, Samuelsson T (2007) Gel-forming mucins appeared early in metazoan evolution. Proc Natl Acad Sci USA 104:16209–16214 Lee CG (2009) Chitin, chitinases and chitinase-like proteins in allergic inﬂammation and tissue remodeling. Yonsei Med J 50:22–30 Lee YK, Mazmanian SK (2010) Has the microbiota played a critical role in the evolution of the adaptive immune system? Science 330:1768–1773 Liberti A, Melillo D, Zucchetti I, Natale L, Dishaw LJ, Litman GW, De Santis R, Pinto MR (2014) Expression of Ciona intestinalis variable region-containing chitin-binding proteins during development of the gastrointestinal tract and their role in host-microbe interactions. PLoS One 9, e94984 Macpherson AJ, Mccoy KD, Johansen FE, Brandtzaeg P (2008) The immune geography of IgA induction and function. Mucosal Immunol 1:11–22 McFall-Ngai M (2007) Adaptive immunity: care for the community. Nature 445:153 Mostov KE, de Bruyn KA, Deitcher DL (1986) Deletion of the cytoplasmic tail of the polymeric immunoglobulin receptor prevents basolateral localization and endocytosis. Cell 47:359–364 Satoh N (2003) The ascidian tadpole larva: comparative molecular development and genomics. Nat Rev Genet 4:285–295 Steward GF, Montiel JL, Azam F (2000) Genome size distributions indicate variability and similarities among marine viral assemblages from diverse environments. Limnol Oceanogr 45:1697–1706 Appendix B: Generation of germ-free Ciona intestinalis for studies of gut-

microbe interactions

This appendix is a methods paper published in Frontiers in Microbiology in the

special issue Experimental models in animal-associated microbiota.

Leigh, B.A., A. Liberti, and L.J. Dishaw, 2016. Generation of germ-free Ciona

intestinalis for studies of gut-microbe interactions. Frontiers in microbiology 7.

51 METHODS published: 27 December 2016 doi: 10.3389/fmicb.2016.02092

Generation of Germ-Free Ciona intestinalis for Studies of Gut-Microbe Interactions

Brittany A. Leigh 1, 2, Assunta Liberti 2 and Larry J. Dishaw 2*

1 College of Marine Science, University of South Florida (USF), St. Petersburg, FL, USA, 2 Department of Pediatrics, College of Medicine, University of South Florida (USF), St. Petersburg, FL, USA

Microbes associate with animal hosts, often providing shelter in a nutrient-rich environment. The gut, however, can be a harsh environment with members of the microbiome settling in distinct niches resulting in more stable, adherent biofilms. These diverse communities can provide orders of magnitude more gene products than the host genome; selection and maintenance of a functionally relevant and useful microbiome is now recognized to be an essential component of homeostasis. Germ-free (GF) model systems allow dissection of host-microbe interactions in a simple and direct way where each member of the symbiosis can be studied in isolation. In addition, because immune defenses in the gut are often naïve in GF animals, host immune recognition and responses during the process of colonization can be studied. Ciona intestinalis, a basal chordate, is a well-characterized developmental model system and holds promise for addressing Edited by: some of these important questions. With transparent juveniles, Ciona can be exposed Robert Brucker, Rowland Institute at Harvard, USA to distinct bacterial isolates by inoculating GF artificial seawater; concentrated bacteria Reviewed by: can subsequently be visualized in vivo if fluorescent stains are utilized. Rearing GF Ciona Tony De Tomaso, is a first step in untangling the complex dialogue between bacteria and innate immunity University of California, Santa Barbara, during colonization. USA Juris A. Grasis, Keywords: germ-free, Ciona intestinalis, Gut colonization, microbiome, host-microbe interaction San Diego State University, USA *Correspondence: Larry J. Dishaw INTRODUCTION [email protected] The ability to establish germ-free (GF) versions of both traditional and non-traditional model Specialty section: systems has become essential in studies that aim to develop and expand our understanding of This article was submitted to the role of host-associated microbial communities in both health and disease. Because of diverse Microbial Symbioses, phylogenetic histories, each of these models can offer insight into the role microbes have played a section of the journal in shaping molecular and ecological processes that sustain homeostasis at host mucosal tissue Frontiers in Microbiology surfaces. The gut, in particular, is a highly dynamic ecosystem where homeostasis is imperative Received: 18 September 2016 to maintaining host health (Round and Mazmanian, 2009; Tlaskalová-Hogenová et al., 2011). Accepted: 09 December 2016 The initial establishment of these microbes early in development influences long-term community Published: 27 December 2016 structure and shapes host response (Nicholson et al., 2012; Sommer and Backhed, 2013). Citation: The sea squirt, Ciona intestinalis, is a marine protochordate; these invertebrates (Subphylum: Leigh BA, Liberti A and Dishaw LJ (2016) Generation of Germ-Free Ciona Tunicata) are particularly interesting because they represent the most basal chordate condition intestinalis for Studies of Gut-Microbe (Dunn et al., 2008), yet possess a gut characterized by the same three main anatomic compartments Interactions. Front. Microbiol. 7:2092. found in the more recently diverged vertebrates: esophagus, stomach and intestine. During its doi: 10.3389/fmicb.2016.02092 life cycle, the embryo develops into a swimming tadpole larva that attaches to a substrate and

Frontiers in Microbiology | www.frontiersin.org 1 December 2016 | Volume 7 | Article 2092 Leigh et al. Generating Germ-Free Ciona undergoes metamorphosis, losing its notochord and becoming - sterile petri dishes (150, 100, and 60mm) a sessile adult (Chiba et al., 2004). In the early stages of - 50 and 15mL conical tubes metamorphosis, the intestine disc (gut primordium) begins to - 70 µm sterile cell strainer baskets (Corning #431751) differentiate into its anatomical compartments and, at stage 4 of - centrifuge the 1st ascidian juvenile, the digestive tract opens to the external - autoclave environment, initiating the process of feeding and microbial - thermocycler colonization. Moreover, Ciona possesses an immune system that - lab coat relies exclusively on what is known as innate immunity; adaptive - disposable gloves immunity, and the signature genes associated with antigen - acid washed glass bottles recognition, antibody production, and memory, is restricted to Reagents: the vertebrates (Azumi et al., 2003). Thus, this model allows investigators to utilize a chordate model system while focusing - Instant OceanR (or equivalent artificial salt mix) attention on defining the role(s) of innate immunity during - 10% (wt/vol) polyvinyl pyrrolidone-iodine complex (PVP-I) microbial colonization of gut epithelial surfaces. - 5% (vol/vol) bleach stock solution The protocol described herein was developed by modifying - Methylene blue, 1% (LabChem LC19940-7) previously described methods to rear germ-free zebrafish (Pham - 70% isopropanol et al., 2008). In Ciona, a single fertilization can give rise - 1% agarose LE (Fisher BMA50004; gel electrophoresis grade) to hundreds of juveniles, which can be reared easily at the in ASW bench-top, facilitating numerous experimental conditions and/or - Pen/Strep 100x stock (Fisher BP295950) replicates. Briefly, Ciona is fertilized in vitro, and within the first - ZymoResearch Tissue & Insect DNA MiniPrep (Zymo hour of development the zygotes are treated to remove or kill Research, Irvine, CA, USA) microorganisms living on or within the chorion. Subsequently, - Bacterial 16S rRNA PCR primers (27F and 1492R) the embryos, and later the juveniles, are reared in artificial - Fungal Internal Transcribed Spacer (ITS) 18S primers (ITS1 seawater (ASW) supplemented with antibiotics and a simple and ITS4)(White et al., 1990) antifungal solution. One week after fertilization, when the - Ciona intestinalis cytoskeletal actin (gene accession number animals reach stage 4 of metamorphosis, the antibiotics and AJ297725) PCR primers, designed in-house (F5′- ATGGAC antifungal solution are removed, and the freshly changed GATGATGTTGCCG, R5′- TTAGAAGCATTTGCGGTG water can then be inoculated with one (monoassociation) or GAC) more (mixed community) microbes of choice for colonization - 2X Master Mix, premade commercial mix (Preferred: experiments. The Ciona juveniles will continuously siphon and Promega PCR Master Mix M7505) concentrate microoganisms in its gut where a selection process - Preferred media and culture plates for sterility checks likely occurs. Because Ciona juveniles are also transparent, (Preferred bacterial media: Marine Broth (Fisher DF0791- visual detection and localization of fluorescently labeled bacteria 17-4); Nutrient Broth +Sea Salts (Fisher DF0003-07-0); facilitates visualizing the process. Brain-Heart Infusion Broth +Sea Salts (Fisher DF0037-15-0); Tryptic Soy Broth +Sea Salt (Fisher DF0369-15-8); Sea Salts MATERIALS AND EQUIPMENT (Sigma S9883) added at approximately 40 g/L where required, adjusting concentration to minimize precipitation) Bench-top cleanroom fitted with HEPA-filter ventilation (two Stepwise Procedures separate cleanrooms are optimal but not required; available A) Reagents setup positive pressure/laminar flow is ideal as long as it can be turned on/off to control evaporation) as depicted in Figure 1 (1) Preparing and maintaining a germ-free environment (The following should be within or near the cleanroom) All decontamination and subsequent maintenance of GF juveniles under aseptic conditions occurs within the - pipets and tips confines of a bench-top cleanroom equipped with a HEPA - automatic pipet filter that has been thoroughly sanitized and UV-treated - large waste beaker prior to starting any of the procedures. To help maintain - serological pipets aseptic conditions in the cleanroom, all activities are - labeling marker performed while wearing disposable lab coats with tight, - 50 mL and microcentrifuge tube rack elastic, closures at wrists, and disposable nitrile gloves - 500mL or 1L bottle top filters (0.22 µm) that fit over the elastic fitted sleeve. Before entering the - vacuum pump cleanroom environment, gloved hands, and any other - stereo microscope or equivalent object, should be rigorously cleaned by rubbing in the - 10 mL syringes for filtering smaller volumes presence of 70% isopropanol. - 0.22 µm syringe filters (2) ASW preparation ASW working solution should be prepared, using Instant Additional equipment: OceanR or equivalent, at least 2 days prior to fertilization - refractometer to allow salts to equilibrate. Optional: while it as advised

Frontiers in Microbiology | www.frontiersin.org 2 December 2016 | Volume 7 | Article 2092 Leigh et al. Generating Germ-Free Ciona

FIGURE 1 | Schematic illustration of cleanroom with incorporated stereoscope and layout of other materials; cleanroom should have the ability to maintain positive pressure by HEPA ﬁltration while in use and a UV light should be available to help sterilize environment between experiments.

that one always follow manufacturer’s recommendations, agarose by pouring a small amount and tilting plate to saturated salt solutions can be made as long as the final cover. Generally, two dishes are sufficient for plating one target salinity, after dilution, is approximately 33 parts per batch of fertilized eggs. The lid is replaced and plates are thousand (ppt). Filter the ASW through a 0.45 µm filter dried, upside down, in the cleanroom for about 20 min. to remove large particulates and autoclave; because of the Plates should be prepared not more than 1 h prior to potential for evaporation during the autoclaving process, fertilization since the thin layer of agarose will dry out the final salinity must be confirmed with small aliquots quickly. using a refractometer. Be sure to use acid washed bottles (4) Preparation of sterilization solutions—timing 15–30 min to prepare and store ASW as any remnants of soap will (4.1) Antibiotic ASW: 1L of ASW supplemented with 1x final reduce fertilization rates. The ASW is then stored at room concentration of Pen/Strep and 10 µL of 0.1% Methylene temperature until use. All instances below that utilize ASW blue is prepared and filter-sterilized using a 0.22 µm filter refer to this sterilized version. within the cleanroom. The solution is aliquotted (50 mL (2.1) Before use, the ASW is filter-sterilized using 0.22 µm- each) with a serological pipet into two large 1% agarose- bottle-top filters within the cleanroom environment. The coated petri dishes. prepared ASW remains in the cleanroom. (4.2) 0.1% PVP-I solution: 10 mL of 0.1% PVP-I working (3) Dish preparation for larval development- timing 40 min solution in ASW is prepared through serial dilution from a To generate and maintain GF animals, sterilization steps stock solution. The solution is filter-sterilized using a 0.22 are included that alter chorion integrity; embryos with µm filter and 10mL syringe into a small petri dish (60mm) disrupted chorions can stick to plastic dishes, a process within the cleanroom. Three additional dishes (60 mm) that can significantly decrease viability. To keep the with 10 mL ASW each are prepared for subsequent wash developing embryos from sticking to the plastic dishes, steps. the plates are coated with a thin layer of sterilized 1% (4.3) 0.003% bleach solution: 10 mL of a 0.003% bleach working agarose. Once the larvae hatch, animals are transferred solution is prepared in ASW through serial dilutions from to non-coated/non-treated dishes for attachment and a stock solution. The solution is filter-sterilized using a 0.22 metamorphosis. Agarose is dissolved in ASW to a final µm filter and 10mL syringe into a small petri dish (60mm) concentration of 1% and autoclaved (it is not critical that within the cleanroom. Three additional dishes (60 mm) the agarose remain at exactly 1%). In the cleanroom, large with 10 mL ASW each are prepared for subsequent wash petri dishes (150mm) are coated with a thin layer of 1% steps.

Frontiers in Microbiology | www.frontiersin.org 3 December 2016 | Volume 7 | Article 2092 Leigh et al. Generating Germ-Free Ciona

(4.4) 0.001% methylene blue solution: 10mL of a 0.001% methylene blue working solution is prepared in ASW through serial dilution from a stock solution. The solution is filter-sterilized using a 0.22 µm filter and 10mL syringe into a small petri dish (60 mm) within the cleanroom. An additional dish (60 mm) with 10 mL ASW is prepared for the final wash step. B) Fertilization and sterilization protocol From here onwards, there are no stopping points within the protocol. (5) Fertilization procedure—timing 15–30 min The isolation and fertilization of eggs is performed on the bench-top outside of the cleanroom. Adult animals, harvested from the wild, arrive in the lab and are held in ASW until in vitro fertilization is performed. Individual animals, which are hermaphroditic, are surgically dissected for eggs and sperm collection. (5.1) Freshly harvested Ciona with visibly mature gametes (eggs are reddish and high in the oviduct) are placed on their sides in a new plastic dish. The outside of the animal tunic is wiped gently with iodine and alcohol solutions, and the tunic is opened with a fresh scalpel to expose the inside near the oviduct and spermiduct, which run parallel to the intestines (Figure 2). Under the tunic, a thin, clear, membrane must be torn to expose the oviduct. (5.2) Five to ten animals are used for extraction of gametes. FIGURE 2 | Anatomy of the Ciona intestinalis reproductive organs. The The top of the oviduct is pierced with sterile tweezers, and animals, once opened, show the gut, oviduct and spermiduct running parallel to each other along Ciona body axis. using a Pasteur pipet the eggs are extracted and deposited into a 50 mL conical tube containing 40 mL ASW. Sperm are collected, preferably with the least amount of water possible to keep them inactivated and concentrated, and pooled in a 1.5 mL tube. (5.3) The egg mixture (in a 50mL conical) is then fertilized by adding a small amount of sperm mix (1–2 drops) and placed on a rotating wheel to allow adequate mixing. After 5min, the fertilized eggs are strained through a sterile 70 µm basket to remove excess sperm and washed in ASW. (5.4) Some fertilized eggs are separated into a small petri dish on the bench-top to serve as a fertilization control, prior to starting the sterilization procedure. Monitoring the development of these embryos is important for evaluation of fertilization success and percent viability; it is also an important control for the sterilization procedure, which can impact embryo viability. FIGURE 3 | Embryo handling during sterilization procedure. Once eggs (6) Sterilization procedure- timing 30–35 min are fertilized, they are placed into a 70 µm basket for handling. Embryos The entire sterilization process should be finished before remain in this basket to facilitate transfer between solutions. the eggs reach the two-cell stage, approximately 50 min from the moment of fertilization in step (5.2). This time frame is essential because the damage to the During the entire sterilization procedure, the fertilized eggs chorion inflicted by the sterilization procedure makes the are maintained in a 70 µm basket to facilitate solution changes embryos particularly fragile. Hence, it is important to (Figure 3). plate them before the advancement of cleavage to avoid (6.1) The fertilized eggs are gently submersed into 0.1% PVP-I excessive manipulation during these critical phases of solution for 2 min, minimizing air bubble formation; any development. longer at this step, and viability of the embryos drops

Frontiers in Microbiology | www.frontiersin.org 4 December 2016 | Volume 7 | Article 2092 Leigh et al. Generating Germ-Free Ciona

significantly. Embryos are washed three times in ASW, (7.1) New, uncoated, petri dishes (6, 10, or 15cm) with antibiotic agitating lightly to thoroughly wash. ASW solution (4.1) are prepared. (6.2) The fertilized eggs are gently immersed in 0.003% bleach (7.2) Each dish is labeled to adequately track them for sterility solution for 20 min, agitating the embryos every few checks and animal development. minutes and avoiding air bubble formation to ensure that (7.3) Swimming larvae are gently transferred with a large bore all the embryos are in contact with the solution. The sterile tip and spread out onto new dishes and allowed to embryos are washed three times in ASW, again agitating attach overnight. Minimal water is added to ensure the gently. After this step, most of the chorions, with follicle larvae do not attach on the sides of the dishes where they cells removed, should be damaged and/or coming loose become difficult to observe. Larvae that are not attached from the embryos (Figure 4B). by the following morning will be removed from the plates (6.3) The fertilized eggs are gently immersed in 0.001% during the first water change. methylene blue solution for 10–30 s followed by a quick C) Verifying and maintaining germ-free animals rinse in ASW. This step should effectively treat fungal contamination that may have been carried over by the eggs. (8) ASW Changes and Sterility Tests (6.4) Using a 1mL (or P1000 type) personal pipet with large After larval settlement, ASW is changed every 48 h using bore sterile tips, the embryos are gently transferred onto aseptic conditions and sterile serological pipets. Waste ASW agarose-coated petri dishes containing antibiotic ASW is collected within the cleanroom, a small aliquot saved for prepared as described above in (3) Dish preparation sterility test (see #2 below), and the remainder disposed; for larval development and (4.1) Sterilization solution all transfers of fluid should be done with careful pipetting preparation sections. Minimize any additional disturbance technique as one would use in standard cell culture. During to the plates to prevent shearing of the eggs after the the first week of development, animals are maintained in chorions are damaged. antibiotic ASW; after this period they are transferred to ASW (6.5) Approximately 18 h are allowed for larval development without any supplementation. Before each water change, to proceed, until the eggs hatch and release swimming sterility checks are performed on each individual plate using tadpoles. three different approaches: (7) Larva settlement-timing 30–45 min 1) Spot plating on various media plates (see reagent prep). ASW Once larvae hatch, they will begin to stick to each other or (10 µL) from each dish is spotted onto a media plate that shed egg debris if plated densely. Thus, one should work has been warmed to room temperature (Figure 5A). Some quickly to transfer freshly hatched, swimming tadpoles, preferred plates are marine agar, nutrient agar + sea salts, onto fresh dishes. Larvae that have attached to each other brain-heart infusion + sea salts and tryptic soy agar + sea or to debris are difficult to separate and should simply salts. Cultures are maintained at room temperature for a be discarded. However, if larvae are transferred before minimum of 72 h, or the duration of the experiment. they hatch or begin swimming, viability again will be 2) Pelleting of spent culture media (used ASW) to detect significantly compromised. bacteria by PCR. During water changes, spent ASW from

FIGURE 4 | Developmental stages of GF Ciona intestinalis. Eggs before (A) and after (B) sterilization show a compromised chorion. The development of juveniles after fertilization (C–F) is similar to conventionally-reared animals described previously in FABA developmental tables. Scale bars: 100 µm; (C) 250 µm.

Frontiers in Microbiology | www.frontiersin.org 5 December 2016 | Volume 7 | Article 2092 Leigh et al. Generating Germ-Free Ciona

each dish is collected into 1.5 mL microcentrifuge tubes and spun at maximum speed for 10 min to pellet any potential contaminant present. The supernatant is replaced with 50 µL of nuclease-free water because salt water inhibits the PCR reaction; the redissolved material becomes template for PCR using the 16S rRNA gene and ITS primers defined above. 3) Total genomic DNA is isolated from randomly sampled animals on each GF dish and used as template for PCR. Before experimental colonization, animals are randomly sampled with a sterile prick and recovered with a large bore pipet tip. Total DNA is isolated using an equivalent DNA extraction kit (the Zymo kit described above works well with our small tissue samples); each plate is done individually to verify that GF animals have remained bacteria-free. The 16S rRNA and actin primers described above are used on the isolated DNA to confirm absence of bacteria and the presence of animal tissue, respectively. Water from the plates can be checked for fungal contamination by plating and by PCR with ITS-specific primers (Figure 5B). Some of the ITS primers cross-amplify host DNA; however, additional ITS primer options exist (Martin and Rygiewicz, 2005). Sterility tests are performed every 48 h during development. If all the sterility tests are negative, germ-free animals have been generated and they can be used experimentally for microbial colonization.

D) Development and Colonization of Germ-Free Animals (9) Determination of developmental stages Germ-free animals take approximately 4 days to reach stage 4 where the siphons open; subsequently, the animals can begin to filter water. Refer to the FABA developmental table (http://chordate.bpni.bio.keio.ac.jp/ faba/1.4/top.html) to determine phenotype for stage 4 animals. Prior to this stage, the gut remains sterile (uncolonized). Plates may develop at different rates depending on animal density; therefore, it is imperative to check every plate for stage 4 animals before beginning exposures. (10) Experimental Colonization with Fluorescent bacteria (10.1) A freshly isolated colony from a bacterial strain of interest is grown overnight in its preferred culture media and FIGURE 5 | Sterility tests of the GF procedure. (A) ASW or FSW from conditions. dishes of GF or conventionally-reared animals, respectively, is spotted on two different media plates (left: marine agar, right: nutrient agar + sea salts). (10.2) The optical density (OD600) is then measured and Cultures from GF animals (top) show no bacterial growth except for one plate. adjusted to the desired concentration relative to the final Water from conventional animals (bottom) shows a diverse microbial volume of the petri dish to be exposed. Normally 106 community. (B) PCR using DNA isolated from GF and conventional juveniles cells/mL is well tolerated by the animals (depending on shows no 16S rRNA gene amplification in GF animals. The CiActin gene bacterial strain); when the bacteria are labeled with vital amplification is used as a control for DNA extraction of the animal. PCR on ASW or FSW using ITS primers demonstrates the presence of fungi in dyes at this cell density, they can be visualized if they conventional and not in GF dishes. become concentrated in the gut. The amounts to use can be correctly estimated by OD600 once a growth curve is generated; colony-forming units (CFU) of bacterial starting dye because it provides the least amount of abundance can be performed at respective intervals. background in the live, whole-mount, animals. The (10.3) Example vital dye: The bacteria are stained for 15 bacteria are then washed twice in ASW and resuspended min using BacLight green (Invitrogen Molecular Probes in a final volume of ASW to cover entire petri dish. The B-35000), as per manufacturer’s instructions. Green culture media (spent ASW) from the GF animal dishes (Absorbance: 480 nm; Emission: 516 nm) is used as a is then replaced according to ASW Changes and Sterility

Frontiers in Microbiology | www.frontiersin.org 6 December 2016 | Volume 7 | Article 2092 Leigh et al. Generating Germ-Free Ciona

FIGURE 6 | Bacterial exposure to GF animals. Bacteria stained with BacLight green and then exposed to stage 4 GF juveniles. Three different bacterial strains (A. Vibrio, B. Pseudoalteromonas, and C. Shewanella) were each concentrated within the gut of the animal within 1 h of exposure with little to no detectable signal in any other tissue outside the gut. Scale bars: 100 µm.

Tests section above; in short, the plate is removed from the are thereafter mostly undetectable anywhere other than the gut cleanroom, and the resuspended, labeled bacteria in ASW of the animal by ﬂuorescent microscopy. This is independent are added to the culture dishes. The dishes are incubated of the type of bacteria used and is shown in Figure 6 where at room temperate under low light conditions. The three separate BacLight stained bacterial genera (a. Vibrio, b. animals, when observed under a stereoscope equipped Pseudoalteromonas, and c. Shewanella) were exposed to the GF with a ﬂuorescent light source and camera, can be animals. After the desired time of exposure and after the dosing seen to immediately uptake the bacteria and concentrate water has been removed and the dishes washed thoroughly, it is the signal in their guts. Movement, and presumably possible to remove animals, perform CFU counts, isolate DNA, settlement of some bacteria, can be visualized along the and determine bacterial abundance (i.e., estimate colonization); gut wall within 1 h after exposure begins and also detected RNA isolation can also be used to observe host transcriptional in the days that follow. behaviors in response to the bacterial exposures.

ETHICS STATEMENT ANTICIPATED RESULTS AND DISCUSSION The research described here was performed on the marine Normally, the fertilization controls will have a hatching invertebrate, Ciona intestinalis, and did not involve human or percentage of approximately 95% during spawning seasons. The other vertebrate animals of any form. Ciona is not protected eggs maintain their chorion structure with intact follicles as by any environmental agency in the United States (US). The shown in Figure 4A. After sterilization, the chorion becomes collection services (M-Rep, Steve LePage) contracted in this damaged, resulting in loss of follicles (Figure 4B) and egg study maintain current permits and licenses for collection and viability drops to approximately 60–70% of embryos hatching. distribution of marine invertebrates to academic institutions; Compared to conventional animals grown in normal seawater, special permission was not required to collect these animals. GF embryo development and timing of metamorphosis remains Animals were recovered and brought to the laboratory alive quite similar (Figures 4C–F; compare to Ciona developmental and maintained in clean water with aeration. Handling of live tables at FABA1 (http://chordate.bpni.bio.keio.ac.jp/faba/1.4/top. animals was in accordance with the guidelines of our academic html) and FABA2 (http://chordate.bpni.bio.keio.ac.jp/faba2/2.2/ institutions, and the use of specific bacteria in Ciona colonization top.html; Hotta et al., 2007). Success in the generation of GF experiments is approved by the USF Biosafety Committee under Ciona varies between fertilization events and can result in 70– protocol, 1199-IA. Animal waste products were disposed of 100% sterile animals, but the amount of eggs and time of appropriately. year are crucial. An example of a successful sterility check is shown in Figure 5. After 3–4 days, animals reach stage 4 of AUTHOR CONTRIBUTIONS 1st ascidian juvenile, and it is at this stage that the digestive tract opens to the external environment initiating the process BL developed the methods and drafted the manuscript; AL of microbial colonization. Animals will remain at stage 4 until generated figures, helped refine the methods, and edited the they are fed. Similar to previously described observations of manuscript; LJD oversaw experiments and edited manuscript. developmental delays in zebrafish, GF Ciona do not proceed through stage 4 without additional dietary supplementation FUNDING (Rawls et al., 2004; Semova et al., 2012), e.g., Nannochloropsis commercial paste (Cat# PM36N, Pentairaes.com). Once bacteria These studies were supported by the National Science (or other microbes) are included in the water for colonization Foundation (IOS1456301) to LJD and by a National Science experiments, the juvenile Ciona initiate feeding and will begin Foundation Graduate Research Fellowship (Award No. 1144244) to concentrate the bacteria within its gut. The stained bacteria to BL.

Frontiers in Microbiology | www.frontiersin.org 7 December 2016 | Volume 7 | Article 2092 Leigh et al. Generating Germ-Free Ciona

REFERENCES Round, J. L., and Mazmanian, S. K. (2009). The gut microbiota shapes intestinal immune responses during health and disease. Nat. Rev. Immunol. 9, 313–323. Azumi, K., De Santis, R., De Tomaso, A., Rigoutsos, I., Yoshizaki, doi: 10.1038/nri2515 F., Pinto, M. R., et al. (2003). Genomic analysis of immunity in a Semova, I., Carten, J. D., Stombaugh, J., Mackey, L. C., Knight, R., Urochordate and the emergence of the vertebrate immune system: Farber, S. A., et al. (2012). Microbiota regulate intestinal absorption and “waiting for Godot”. Immunogenetics 55, 570–581. doi: 10.1007/s00251-003- metabolism of fatty acids in the zebrafish. Cell Host Microbe 12, 277–288. 0606-5 doi: 10.1016/j.chom.2012.08.003 Chiba, S., Sasaki, A., Nakayama, A., Takamura, K., and Satoh, N. (2004). Sommer, F., and Backhed, F. (2013). The gut microbiota–masters of Development of Ciona intestinalis juveniles (through 2nd ascidian stage). Zool. host development and physiology. Nat. Rev. Microbiol. 11, 227–238. Sci. 21, 285–298. doi: 10.2108/zsj.21.285 doi: 10.1038/nrmicro2974 Dunn, C. W., Hejnol, A., Matus, D. Q., Pang, K., Browne, W. E., Smith, S. A., et al. Tlaskalová-Hogenová, H., Stepànkovà, R., Kozàkovà, H., Hudcovic, T., Vannucci, (2008). Broad phylogenomic sampling improves resolution of the animal tree L., Tuckovà, L., et al. (2011). The role of gut microbiota (commensal bacteria) of life. Nature 452, 745–749. doi: 10.1038/nature06614 and the mucosal barrier in the pathogenesis of inflammatory and autoimmune Hotta, K., Mitsuhara, K., Takahashi, H., Inaba, K., Oka, K., Gojobori, T., diseases and cancer: contribution of germ-free and gnotobiotic animal models et al. (2007). A web-based interactive developmental table for the ascidian of human diseases. Cell. Mol. Immunol. 8, 110–120. doi: 10.1038/cmi.2010.67 Ciona intestinalis, including 3D real-image embryo reconstructions: I. From White, T. J. B. T., Lee, S., and Taylor, J. W. (eds.). (1990). “Amplification and direct fertilized egg to hatching larva. Dev. Dyn. 236, 1790–1805. doi: 10.1002/dvdy. sequencing of fungal ribosomal RNA genes for phylogenetics. PCR Protocols,” 21188 in A Guide to Methods and Applications (New York, NY: Academic Press Inc.), Martin, K. J., and Rygiewicz, P. T. (2005). Fungal-specific PCR primers developed 315–322. for analysis of the ITS region of environmental DNA extracts. BMC Microbiol. 5:28. doi: 10.1186/1471-2180-5-28 Conflict of Interest Statement: The authors declare that the research was Nicholson, J. K., Holmes, E., Kinross, J., Burcelin, R., Gibson, G., Jia, W., et al. conducted in the absence of any commercial or financial relationships that could (2012). Host-gut microbiota metabolic interactions. Science 336, 1262–1267. be construed as a potential conflict of interest. doi: 10.1126/science.1223813 Pham, L. N., Kanther, M., Semova, I., and Rawls, J. F. (2008). Methods for Copyright © 2016 Leigh, Liberti and Dishaw. This is an open-access article generating and colonizing gnotobiotic zebrafish. Nat. Protoc. 3, 1862–1875. distributed under the terms of the Creative Commons Attribution License (CC BY). doi: 10.1038/nprot.2008.186 The use, distribution or reproduction in other forums is permitted, provided the Rawls, J. F., Samuel, B. S., and Gordon, J. I. (2004). Gnotobiotic zebrafish reveal original author(s) or licensor are credited and that the original publication in this evolutionarily conserved responses to the gut microbiota. Proc. Natl. Acad. Sci. journal is cited, in accordance with accepted academic practice. No use, distribution U.S.A. 101, 4596–4601. doi: 10.1073/pnas.0400706101 or reproduction is permitted which does not comply with these terms.

Frontiers in Microbiology | www.frontiersin.org 8 December 2016 | Volume 7 | Article 2092

Appendix C: The gut virome of the protochordate model organism, Ciona

intestinalis

This appendix is a primary research paper just accepted at Virus Research in the

special issue Virus metagenomics and its impacts on evolutionary biology and the

taxonomy of viruses.

Leigh, B.A., Djurhuus, A., Breitbart, M. and L.J. Dishaw, 2017. The gut virome of the

protochordate model organism, Ciona intestinalis.

The gut virome of the protochordate model organism, Ciona intestinalis

Brittany A. Leigha, b, Anni Djurhuusa, Mya Breitbarta and Larry J. Dishawb^

a. University of South Florida, College of Marine Science, St. Petersburg, FL, USA b. University of South Florida, Department of Pediatrics, Children’s Research Institute, St. Petersburg, FL, USA ^ Corresponding author; [email protected]

Abstract

The identification of host-specific bacterial and viral communities associated with diverse animals has led to the concept of the metaorganism, which defines the animal and all of its associated microbes as a single unit. Here we sequence the viruses found in the gut (i.e., the gut virome) of the marine invertebrate model system, Ciona intestinalis, in samples collected one year apart. We present evidence for a host- associated virome that is distinct from the surrounding seawater and contains some temporally stable members. Comparison of gut tissues before and after starvation in virus-free water enabled the differentiation between the Ciona-specific virome and transient viral communities associated with dietary sources. The Ciona gut viromes were dominated by double-stranded DNA tailed phages (Order Caudovirales) and sequence assembly yielded a number of complete circular phage genomes, most of which were highly divergent from known genomes. Unique viral communities were found in distinct gut niches (stomach, midgut and hindgut), paralleling the compartmentalization of bacterial communities. Additionally, integrase and excisionase genes, including many that are similar to prophage sequences within the genomes of bacterial genera belonging to the Ciona core microbiome, were prevalent in the viromes, indicating the active induction of prophages within the gut ecosystem.

Knowledge of the gut virome of this model organism lays the foundation for studying the interactions between viruses, bacteria, and host immunity.

Keywords: Ciona, gut, microbiome, viral metagenome, phage

1. Introduction

In recent years, numerous studies have defined the importance of host- associated microorganisms, including both bacteria and viruses. The bacterial component of this ‘microbiome’ often outnumbers host cells by an order of magnitude

(Turnbaugh et al., 2007) and can influence host nutrient acquisition and metabolism

(Nicholson et al., 2012; Tremaroli and Backhed, 2012). The increased recognition of the contributions of bacterial communities to the biology and physiology of animals has motivated our perception of animals as complex metaorganisms (Rohwer et al., 2002;

Rosenberg and Zilber-Rosenberg, 2011; Theis et al., 2016). This concept was first introduced into biology to describe the coral animal and all of its associated microbes

(Rohwer et al., 2002). Since then, many animal models, including humans, have been documented to contain a stable, core community of bacteria on or within their bodies

(Dishaw et al., 2014; Roeselers et al., 2011; Sabree et al., 2012; Schmitt et al., 2012;

Turnbaugh and Gordon, 2009), the disruption of which often results in disease (Cho and

Blaser, 2012; Sobhani et al., 2011; Tamboli et al., 2004). While bacteria have historically predominated microbiome studies, recent efforts are recognizing a vital role for viruses as well (Abeles and Pride, 2014; Grasis et al., 2014; Minot et al., 2011;

Reyes et al., 2010; Thurber et al., 2017). The viruses associated with animal hosts are

present as both free viral particles and/or stably integrated proviruses (Feschotte and

Gilbert, 2012) and can shape the health of the metaorganism through pathogenesis

(Davies et al., 2016) or through influencing the metabolic potential of both the animal host and its associated microbes (Roossinck, 2011). In addition to host immunity

(Cullender et al., 2013; Thaiss et al., 2016), nutrient availability (Cohen et al., 2015), and bacterial competition (Flint et al., 2007), viruses, the majority of which are bacteriophages (i.e. phages), likely affect the structure of animal-associated bacterial communities through lytic infection and prophage integration and/or induction. In this report, we describe the gut virome of a marine filter-feeding invertebrate protochordate,

Ciona intestinalis, cataloging for the first time the viral communities associated with these early extant chordates and establishing a tractable model system in which to pursue future studies examining the complex dynamics between metazoan hosts and their associated bacterial and viral communities.

Ciona is a well-known developmental model system that has been adapted recently for studies of host-microbe interactions within the gut ecosystem (Dishaw et al.,

2014; Dishaw et al., 2011; Dishaw et al., 2016; Liberti et al., 2014). This animal is a marine filter-feeding protochordate that derives nutrients from particulates in the water column, including phytoplankton (Coleman, 1991). Ciona is amenable to germ-free mariculture (Leigh et al., 2016) and has been shown previously to maintain a core bacterial community in its gut (Dishaw et al., 2014). Here we report the presence of temporally stable viruses within this metabolically active environment. We also describe evidence for compartmentalization of both viruses and bacteria, with distinct members occupying the stomach, midgut, and hindgut. The observation that Ciona maintains a

virome with many predicted hosts matching members of the core microbiome and a prevalence of prophages indicates a role for phages as major players in shaping host- associated bacterial communities within the dynamic gut ecosystem of these animals.

2. Materials and Methods

2.1 Tissue collections

Adult Ciona intestinalis were wild-harvested in San Diego, California, USA, and shipped overnight to the laboratory in Florida. Upon arrival, ten animals were randomly selected, five of which were immediately harvested for gut tissue while gut contents were cleared from the remaining five in 100 kD filtered virus-free seawater for 24 h, with water changes every 3 h for the first 12 h. In 2014, entire guts were dissected and snap- frozen in liquid nitrogen, while in 2015, guts were trisected (stomach, midgut and hindgut; refer to Figure 1A for anatomy) using sterile surgical tools, snap-frozen in liquid nitrogen and maintained at -80°C until processing. Additionally, two water samples of 1 L each were acquired in 2015, one from surrounding seawater in Mission

Bay (MB; main collection site) and the other from holding tank water in which they were shipped (CB).

2.2 Viral and bacterial DNA extraction and sequencing

Each tissue pool from five animals was disrupted using the GentleMACS dissociator (Miltenyi Biotec, Bergisch Gladbach, Germany) in 3 mL of sterile 0.02 µm- filtered suspension medium (SM) buffer (100 mM NaCl, 16 mM MgSO4, 4.5 mM Tris

Base, pH 7.4). The tissue fragments were pelleted at 6,000 RCF for 10 min, and the

supernatant containing the microbial fraction of the pooled tissues was subsequently filtered through a 0.45 µm syringe filter (Merck Millipore, Darmstadt, Germany). The filtrate was then filtered again through a 0.22 µm Sterivex filter (Merck Millipore,

Darmstadt, Germany) and the resulting viral effluent collected. To determine specificity of the Ciona viromes, each liter of surrounding seawater was 0.22 µm-filtered, and the viruses concentrated using a 100 kD Amicon filter (EMD, Merck Millipore, Darmstadt,

Germany). The presence of virus-like particles was verified in 0.22 µm-filtered samples from Ciona tissues and water samples using epifluorescence microscopy (EFM) with

SYBR Gold (Invitrogen, Carlsbad, CA, USA) staining as previously described (Patel et al., 2007). Each filtrate, including the Amicon concentrate, was then loaded onto a CsCl gradient to purify viral particles as previously described (Thurber et al., 2009). Briefly, each sample was spun at 61,000 RCF for 3 h, and the 1.2 - 1.5 g/mL fraction was collected using a sterile syringe and needle in a 2 mL sterile tube. To remove bacterial vesicles and free DNA, this fraction was then treated with chloroform (at a final concentration of 20% vol/vol) for 10 min at room temperature, centrifuged for 30 sec at max speed (20,000 RCF), and the top aqueous layer was removed and treated with

DNase I (2.5 U/µL final concentration) for 3 h at 37°C, vortexing occasionally. Each sample was then treated with EDTA pH 8.0 (20 mM final concentration) to neutralize the

DNase I enzyme. The treated sample was verified to be free of bacterial cells by EFM, and free of bacterial DNA through 16S rDNA PCR. Briefly, each sample was tested for bacterial contamination using PCR with 16S rDNA primers (27F and 1492R) (Weisburg et al., 1991) using the following PCR conditions: denature at 95°C for 5 min, cycle 35 times through 94°C for 30 sec, 56°C for 30 sec, 72°C for 90 sec, and end with a final

extension at 72°C for 10 min. Once each sample was confirmed negative for bacteria and positive for viruses, viral DNA was extracted using the Qiagen MinElute Virus Spin

Kit (Qiagen, Inc., Valencia, CA, USA). Viral DNA was amplified using a GenomiPhi V2

DNA amplification kit (GE Healthcare Life Sciences, USA) to generate adequate template for sequencing (~1 µg). To minimize bias introduced by Phi29 DNA polymerase, three separate reactions were prepared and pooled. DNA concentrations were then determined using a Qubit and products were visualized using a 1% agarose gel to confirm amplification. Final amplified products were purified using a MinElute

PCR Purification Kit (Qiagen, Inc., Valencia, CA, USA). The quality was also assessed using a BioAnalyzer 2100 (Agilent Technologies, Santa Clara, CA, USA). Each sample was sequenced with the Illumina MiSeq platform generating mate-pair (2 x 250) libraries

(Eurofins MWG Operon LLC, Huntsville, AL, USA). From the 2015 trisected gut samples, bacterial DNA was extracted from the 0.22 µm Sterivex filters using the MoBio

DNeasy PowerSoil Kit (MoBio, Inc., Carlsbad, CA, USA), and the V4-V5 regions of the

16S rDNA gene were amplified using the Fluidigm protocol through the Michigan State

University Genomics Core with the primers outlined in Parada et al. (2016). The amplification parameters were as follows: 95°C for 3 min, followed by 30 cycles of 95°C for 45 sec, 50°C for 45 sec and 68°C for 90 sec, and a final extension of 68°C for 5 min.

The amplicons were verified on an agarose gel and diluted 1:100 for sequencing on the

Illumina MiSeq platform.

2.3 Bioinformatics

2.3.1 Viral bioinformatics

Mate-pair reads from the viromes were analyzed using the iVirus pipeline (Bolduc et al., 2017). First the sequences were trimmed using Trimmomatic 0.35.0, and reads were mapped to the PhiX genome through Geneious 8.1.7 (Kearse et al., 2012) to removed all PhiX associated reads. All unused reads were quality checked using

FastQC to ensure a PHRED score of 20 and a minimum read length of 100 bp. To assess the amount of shared sequence content between each of the viromes using

Bayesian network analyses, the trimmed reads were run through Fizkin implemented through Jellyfish (Marcais and Kingsford, 2011) using default parameters. The resulting ordination plot was used to initially distinguish the viromes based on k-mer similarity among reads (Figure 2).

De novo assembly of mate-pair reads was completed using SPAdes 3.6.0 with a k-mer value of 57 and default parameters. Assembly quality was determined by QUAST

(Gurevich et al., 2013). Because the rolling circle amplification step utilized in library construction biases towards small, circular single-stranded DNA (ssDNA) templates

(Kim and Bae, 2011), contigs smaller than 5 kilobases (kb) were removed from the contig-based analyses in this manuscript and will be described elsewhere. Contigs larger than 5 kb were examined with VirSorter, a program used to predict viral sequences based on a number of parameters such as the presence of hallmark viral genes or other known viral-like sequences (Roux et al., 2015). Additionally, all samples were co-assembled with SPAdes 3.6.0 with a k-mer of 57 to generate a single reference file and run through VirSorter. Reads were then mapped back to the VirSorter viral

contig outputs greater than 5 kb to estimate the relative abundance of each contig for each sample. BowtieBatch was used to run bowtie2 on all samples of the co-assembled contigs and produced BAM output files read by Read2RefMapper to generate relative abundance and coverage plots for each viral contig within each metagenome (Bolduc et al., 2017). To consider a contig present within an individual sample, reads from that sample had to cover 75% of the viral contig from the co-assembled virome. Venn diagrams were generated using the VennDiagram package (Chen and Boutros, 2011) through R v 3.3.2 software (R Core Team, 2016) to display the overlap of contigs in different gut compartments using the mapping data from Read2RefMapper.

VirSorter also detected linear contigs with matching k-mers at the ends and assumed them to be complete circular genomes. Relative abundance matrices of each of these circular viral genomes within each of the viromes were determined using

BowtieBatch and Read2RefMapper as described above. These complete genomes, 29 in total, were then imported into Geneious 8.1.7 (Kearse et al., 2012) and open reading frames (ORFs) were determined using Glimmer3 (Delcher et al., 2007). ORF annotations were improved with the BLASTx algorithm against the non-redundant (NR) protein database in GenBank. For those genomes with the majority of ORFs matching a single known virus, synteny of the full genomes was compared using Mauve progressive genome aligner (Darling et al., 2010) with default parameters.

The VirSorter output for single assemblies was used as input for MetaVir-based taxonomic classification using the RefSeq protein database of complete viral sequences

(Roux et al., 2014) and to MG-RAST for functional characterization using Subsystems

technology (Keegan et al., 2016). All taxonomic classifications were determined using the top BLASTx hits, with a threshold score of 50 on BLAST bitscore through MetaVir.

2.3.2 Bacterial bioinformatics

To determine the number of shared bacterial operational taxonomic units (OTUs; determined by a 97% identity cutoff) between the different gut compartments, 16S rDNA amplicon sequences were trimmed and quality filtered using the DADA2 pipeline

(Callahan et al., 2016) through the R v 3.3.2 software (R Core Team, 2016). The SILVA database was utilized to assign taxonomy (Quast et al., 2013) to the resulting OTUs, and data were rarefied to 39,577 reads per sample to produce OTU Venn diagrams as described above for viral contigs.

3. Results

3.1 Ciona gut virome

The seven following Ciona gut virome samples were sequenced: SDC 14

(cleared guts from 2014); cleared stomach (SC), midgut (MC), and hindgut (HC) tissues from 2015 (referred to as SDC 15 when pooled); and uncleared (“full”) stomach (SF), midgut (MF), and hindgut (HF) tissues from 2015 (referred to as SDF 15 when pooled).

The virome sequencing and single sample assembly statistics are shown in Table 1. In

2015, additional viromes were sequenced from the surrounding seawater from the collection site in Mission Bay (MB) and the holding tank water that the animals were shipped in (CB).

Initially, Fizkin k-mer analysis was performed on all trimmed and decontaminated reads to provide an overall view of the degree of similarity between the samples. The

Ciona gut viromes were distinct from the surrounding seawater (Figure 2) and the uncleared gut viromes (SDF 15) were more similar to the water (MB and CB) than the cleared gut viromes (SDC 14 and SDC 15) were, indicating the contribution of viruses of dietary origin in the full gut virome. Although temporal variability between the cleared gut viromes from 2014 (SDC 14) and 2015 (SDC 15) is evident, these communities have a similar composition.

Due to the higher confidence in taxonomic assignment of longer contigs than short individual reads, the remaining analyses focused on the 3,940 contigs (also referred to as nodes) greater than 5 kb that were obtained from separate assembly of each sample (Table 1). Additionally, all Ciona viromes were co-assembled to generate a reference list of contigs, with a contig considered present in an individual sample if reads from that sample covered 75% of the viral contig, in which case the coverage

(normalized to the total number of reads) was calculated.

To examine the temporal variability of the virome, contigs recovered from cleared

Ciona gut samples collected one year apart were compared. Strikingly, 453 contigs were shared between cleared gut tissues over two separate years (Figure 3). None of these shared contigs were found to be circular genomes. The top 10 viral contigs in each group shared sequence identity with phages infecting described members of the

Ciona core microbiome, including Flavobacteria, Shewanella, Pseudoalteromonas, and

Vibrio (Dishaw et al., 2014).

In an effort to distinguish between Ciona-associated viruses and those that originate from dietary contents, the 2015 trisected gut compartments were either sampled immediately (uncleared stomach (SF), midgut (MF), and hindgut (HF)) or after the animal was allowed to clear its gut contents (cleared stomach (SC), midgut (SC), and hindgut (HC)). Although some contigs were shared between the cleared and uncleared samples, each of the states maintained a large number of unique contigs

(Figure 4). While the majority of the identifiable dsDNA viruses in both cleared and full guts belonged to the Caudovirales order (Figure 5A), differences in phage types were seen on finer taxonomic scales. The unclassified dsDNA phages in cleared guts were similar to a number of Vibrio phages, mostly to Vibrio phage henriette 12B8 which infects Vibrio splendidus, and also Pseudomonas phages PA11 and vp_PaeP_Tr60_Ab31, both of which infect Pseudomonas aeruginosa (Kwan et al.,

2006). In contrast, the majority of unclassified dsDNA phages present in uncleared gut samples were most similar to cyanophages and Persicivirga phages. The Persicivirga phages P12024L and P12024S infect bacteria that degrade polysaccharides from green algae (Barbeyron et al., 2011; Kang et al., 2012), and while contigs related to these phages were present in all gut samples, they were markedly higher in the uncleared samples, perhaps due to the fact that Ciona eat fine detritus and phytoplankton

(Coleman, 1991). Cellulophaga phages were also more abundant in uncleared than in cleared trisected guts from 2015. This recently discovered group of phages was shown to be widespread in low abundances among marine viral metagenomes (Holmfeldt et al., 2013).

In addition, the relative abundance of Phycodnaviridae, viruses that infect eukaryotic algae, was 5-6x lower in cleared than uncleared guts, consistent with removal of dietary contents through the clearing process. All uncleared samples had large numbers of sequences related to Chrysochromulina ericina virus CeV-01B, an algal virus with a 510 kb genome that belongs to the Phycodnaviridae (Sandaa et al.,

2001). The Mimiviridae family of giant viruses, which infect the genus Acanthamoeba, were also less abundant in cleared gut samples compared to uncleared.

3.2 Evidence for viral and bacterial compartmentalization in the Ciona gut

Taxonomic comparisons of the contigs highlighted both similarities and differences between gut compartments (Figure 5A). Although a large number of contigs were found to be present in all gut compartments (601), each possessed a number of unique contigs (SC: 172, MC: 333, HC: 73), with the midgut containing the largest number of unique contigs (Figure 6A). All compartments were dominated by the

Caudovirales order of dsDNA viruses, and most of the Caudovirales contigs were nearly twice as abundant in the midgut compared to the two other compartments (Figure 5A).

The Siphoviridae was the most abundant virus family in the midgut, followed by

Podoviridae and then Myoviridae (Figure 5B). The same three phage families dominated the other two compartments, but were present at much lower abundances.

The midgut also possessed the highest number of unclassified dsDNA phages, some most closely related to the Vibrio phage henriette 12B8, Persicivirga phages P12024L and P12024S, Idiomarinaceae phage 1N2-2, and Marinomonas phage P12026.

Consistent with the high number of viral contigs unique to the midgut, the midgut also

possessed the largest number of distinct bacterial OTUs compared to the other two compartments (Figure 6C). The number of reads from each compartment matching the top 50 viral contigs (Figure 6B) or bacterial OTUs (Figure 6D) from all three compartments were mapped to assess compartmentalization of viruses and bacteria.

While each of the viral contigs shown in Figure 6B was among the top 50 most abundant viral contigs for one or more of the compartments, their relative abundance in the other compartments often varied dramatically. Some viral contigs that were highly abundant in one compartment were often rare or absent in other compartments, revealing a great degree of spatial organization in the Ciona gut virome. For example, the Streptococcus phage SOCP, which infects a Gram-positive bacteria belonging to

Firmicutes, a phyla present in over 75% of previously surveyed Ciona gut samples

(Dishaw et al., 2014), was the most abundant viral contig in the stomach, while it was much less abundant in the midgut and the hindgut. Phages with sequence similarity to the uvMED dataset and Idiomarinaceae phage Phi1M2-2 also showed differing abundances, increasing in relative abundance in the midgut and hindgut compared to the stomach. The large changes in the relative abundance of specific viral contigs in the different gut compartments parallels differences in the bacterial communities, with the stomach, midgut and hindgut each maintaining OTUs that were not found in the other two compartments (Figure 6D). Interestingly, OTUs belonging to the Flavobacteraceae family were among the most abundant in the stomach; however, viruses that likely use these bacteria as their host were most abundant in the mid and hindgut. Among the top

50 viral contigs of the hindgut, the two most abundant were only similar to viral sequences in the metagenomic (env_nr) database from NCBI, indicating the presence

of a novel yet abundant group of phages in the Ciona gut. Additionally,

Pseudoalteromonas phage PHS3 and hypothetical viral contigs sharing nucleotide identity with Pseudoalteromonas appear to be abundant in the hindgut (ranks 7-9) and the midgut (ranks 3-5) and decreasing in abundance in the stomach (rank 197). An OTU matching Pseudoalteromonas spp. was only detectable in the hindgut (36th most abundant OTU in HC). Lastly, a contig with sequence similarity to an integrase gene from Vibrio vulnificus (6th most abundant viral contig in HC) was only detectable in the midgut and the hindgut, while no reads mapped back to this contig in the stomach.

Correspondingly, OTUs sharing sequence identity with Vibrio spp. were also only detectable within the midgut and the hindgut. Large increases in the relative abundance of sequences similar to prophages within the midgut and hindgut suggest these tissues as a site for prophage induction.

3.3 Prophages within the Ciona virome

Prophages are viruses that are stably integrated within bacterial genomes.

However, because our methods involved purification of virions, only prophages that were present as free viral particles, presumably as the result of induction, would be identified. Integrases and excisionases, which are hallmark prophage genes, were detected in all of the Ciona viromes by comparison to the MG-RAST Subsystems database. All cleared viromes consistently possessed more of these genes than their uncleared counterparts, perhaps due to the clearing process (Figure S1). Many of these prophages shared sequence identity to phage-like genes within the genomes of bacteria belonging to the core Ciona gut microbiome genera and also in this study,

including Vibrio, Shewanella, Pseudoalteromonas and Flavobacteria (Dishaw et al.,

2014).

3.4 Assembly of complete dsDNA viral genomes

A number of recent studies have assembled full-length viral genomes from metagenomic data, largely due to improvements in sequencing and assembly technology (Bolduc et al., 2017; Duhaime and Sullivan, 2012; Nishimura et al., 2017).

Here we report 29 circular viral genomes greater than 10 kb (from 18,608 – 114,157 bp), which we refer to as environmental viral genomes (EVGs) (Table 2) (Nishimura et al., 2017). Uncleared gut compartments yielded the highest number of EVGs (HF: 15;

HC: 0; MF: 4; MC: 2; SF: 4; SC: 3); the cleared, entire gut sample from 2014 (SDC 14) yielded only one.

To verify the EVG assemblies, all reads were mapped back to the available circular genomes using Read2RefMapper and BowtieBatch in the iVirus pipeline

(Bolduc et al., 2017). Interestingly, the majority of these EVGs encoded ORFs most closely related to “uncultured uvMED phages” sequenced from fosmids constructed from a deep chlorophyll maximum sample from the Mediterranean Sea (Mizuno et al.,

2013). Coverage of these EVGs as determined by read mapping varied across samples, with the most abundant (75x average in cleared and 229x average in uncleared) being an EVG with shared sequence identity to an uncultured Mediterranean phage uvMED that also included a number of Endozoicomonas sp. host genes. Several species of Endozoicomonas are among the most abundant bacteria in Ciona (Dishaw et al., 2014). Additionally, a circular phage genome (Node 14) that displayed sequence

similarity and synteny to Thalassamonas phage BA3 (51% aa similarity, BLOSUM62, threshold 0) was present in all compartments of the 2015 samples, but absent in the

SDC 14 sample (Figure 7A). This particular phage, whose host is the known coral pathogen Thalassamonas loyana, has been utilized in phage therapy to treat ‘white plague’ disease in coral (Efrony et al., 2009). The ‘Node 13’ contig possessed a number of ORFs similar to Flavobacterium phage 11b, which was isolated from Arctic sea ice

(Borriss et al., 2007), with an amino acid sequence similarity of 40% (BLOSUM62, threshold 0), mostly matching capsid structural genes (Figure 7B). The EVGs that did not match the uvMED sample set (total of 12) either had no similar sequences in the database or possessed ORFs related to various Bacteroidetes phages, such as

Flavobacteria and Cellulophaga phages. The largest circular contig (Node 1) detected initially within the MF sample (114,157 bp), yielded predicted proteins related to

Cellulophaga phages, which infect algae-degrading bacteria; and the absence of these sequences in the cleared samples may indicate thorough purging of dietary material.

This circular contig also possessed two other large ORFs related to an uncultured crAssphage in the NR database, which was originally identified from human fecal material (Dutilh et al., 2014). Reads from all three uncleared compartments matched back to this large circular genome with the most reads recovered from the uncleared midgut compartment (MF) (25x coverage versus 5x coverage in SF and 17x in HF).

Interestingly, two circular contigs (Node 39 at 19,273 bp and Node 54 at 18,608 bp), which both possessed ORFs similar to previously described virophages, were only detected in the stomach (both Nodes present in cleared and only Node 54 in uncleared). Virophages are dsDNA viruses that are dependent on co-infection of

another virus, typically a giant virus (Fischer and Suttle, 2011). Node 54 encodes one

ORF with similarity to the Sputnik virophage V13 protein (81% of 2,517 bp ORF with

28% aa identity) and others similar to the Yellowstone virophage 5 hypothetical protein

YSLV5_orf11 (92% of 321 bp ORF with 35% aa identity) and the Qinghai Lake virophage hypothetical protein QLV_03 (71% of 603 bp ORF with 43% aa identity).

Node 39 also possessed an ORF similar to the hypothetical protein YSLV_orf11 in the

Yellowstone Lake virophage 5 (92% of 321 bp ORF with 34% aa identity) and another similar to the Phaeocystis globosa virophage hypothetical protein PGVV_00003 (76% of

816 bp ORF with 32% aa identity). These two virophages possessed 33% amino acid similarity to each other as determined by MUSCLE alignment (BLOSUM62, threshold

0). Although a few genes shared similarity to other known virophages, the majority of these gene sequences shared no sequence identity to other sequences in the databases, suggesting that these are novel virophages.

4. Discussion

Utilizing metagenomics, we report here on the gut virome of the filter-feeding marine protochordate, Ciona intestinalis, a close invertebrate relative of vertebrates.

Similar to other studied marine organisms, Ciona contains bacterial and viral communities that are distinct from the surrounding environment. In the extensively studied marine environment, phage outnumber bacteria approximately 10:1 (Suttle,

2005). However, within the gut mucus environment, phage numbers are estimated to be approximately equal to those of their hosts (Reyes et al., 2012), yet little is known about their ecological and biological roles in this complex and dynamic ecosystem.

The gut ecosystem of many animals encompasses a number of unique physical niches for bacteria, which utilize the various nutrients available in each location (Flint et al., 2008; Leach et al., 1973; Looft et al., 2014; Yang et al., 2005), a phenomenon that we also see in the Ciona gut. For example, in most animals, the colon or colonic cecum provides an anaerobic environment housing microbes that often form biofilms within the mucus layers and, aside from the mucins, have access to carbon sources not utilized by members of the foregut (Flint et al., 2008). However, this compartmentalization of the microbiome has only been documented for bacteria, and has not yet been shown for viruses, primarily because most viral studies have only examined fecal content (Minot et al., 2011; Norman et al., 2015; Shan et al., 2011). Fecal material often does not represent a complete picture of the bacteria that inhabit the mucosa (Codling et al.,

2010; Zoetendal et al., 2002); the same may be true of viruses. In this study, we found that the stomach possessed the lowest number of viral contigs and bacterial OTUs, possibly related to some biophysical restriction in this compartment (e.g., acidity or enzymatic activity) (Dishaw et al., 2016), while the midgut possessed the largest number of unique viral and bacterial sequences. The midgut also is the smallest compartment in the Ciona gut by volume, compared to the stomach and hindgut, yet possesses microvilli and thick mucus that serve as adequate surfaces and substrates for both microbial colonization and viral attachment (Barr et al., 2013; Yonge, 1924). In addition, the midgut is the segment of the digestive tract where the secretory immune molecule, VCBP-C, known to bind bacteria and influence biofilms (Dishaw et al., 2016), has limited expression (Liberti et al., 2014); this feature perhaps may facilitate proliferation and diversification of bacterial and therefore phage communities. In insects,

the midgut has been described as the compartment with the most diversity of bacteria

(Rani et al., 2009), including those with metabolic genes necessary for digestion (de O

Gaio et al., 2011). The hindgut possesses the lowest number of unique viral contigs in cleared samples and the highest in the uncleared samples. This region is also the longest of the digestive tract and seems to host more transient microbiota.

The large decrease in the abundance of algal viruses within the cleared gut samples supports a dietary origin for many of these viruses. The algal viruses detected here mostly belonged to the Phycodnaviridae family, and more specifically were similar to the Phaeocystis globosa virus, and to the Crysochromulina ericina virus, which infects dense and noxious bloom-forming species (Simonsen, 1997). Furthermore, large numbers of chloroviruses, viruses that have recently been proposed to affect neural activity in humans (Yolken et al., 2014), were detected in uncleared guts, comprising

12-25% of the reads with similarity to the Phycodnaviridae family. The Yellowstone lake mimivirus was also detected at a higher abundance in uncleared versus cleared guts, with the highest abundance in the uncleared midgut, comprising 4% of all dsDNA viral reads from this compartment compared to 0.1% in the cleared midgut. A number of virophages infecting the giant mimivirus have been described (Zhou et al., 2015) and quite a few virophages, some with affiliations to the Yellowstone Lake virophages 5, 6 and 7 as well as one similar to the Phaeocystis globosa virophage, were also discovered within the Ciona virome, including two full circular genomes.

Each of the circular genomes described here provides further evidence that the virosphere is still largely uncharacterized, and these genomes can serve as templates for comparisons of viromes sequenced in the future. Inadequate reference sequence

databases make it difficult to characterize these viruses further. The majority of these genomes are most closely related to the uvMED viruses sequenced from the

Mediterranean Sea (Mizuno et al., 2013). While the Mediterranean Sea is considerably distant from the Mission Bay site in San Diego, California where the Ciona were collected, some of the uvMED phages were found to be globally distributed in low to medium latitude oceanic metagenomes (Mizuno et al., 2013). In addition, a number of complete genomes similar to phages that infect Flavobacteria (and their close relatives) were found within the Ciona gut. Flavobacteria are highly abundant within aquatic habitats and are well-known for their ability to degrade biopolymers such as cellulose and chitin, which are highly abundant in ocean waters (Kirchman, 2002) and within

Ciona (Dishaw et al., 2016). Members of the core gut community in Ciona (Dishaw et al., 2014) such as Flavobacteria may serve as hosts for some viruses described here.

In this report, we describe the presence of recurring viral sequences in the gut of

Ciona intestinalis collected two years part, with distinct viral and bacterial distributions in different compartments of the digestive tract. While this study does not provide a complete picture of the gut virome due to the exclusion of viral contigs <5kb, data reported here serve as a foundation for understanding viral dynamics within the Ciona gut. This study provides an additional perspective on how bacterial and viral communities are distributed within the gut, with an advantage being that Ciona is a tractable model system in which future studies can experimentally test hypotheses targeting specific features of gut microbiome interactions. The animal host provides a highly dynamic gut environment through the expression of immune effectors and creation of niches with unique nutrient profiles. Host-driven influences, combined with

interspecific bacterial interactions (e.g., cooperation and/or competition) and viral infection are all important factors in determining the health and function of the metaorganism.

Conceptually, the idea that a gut virome plays important roles within the host microbiome is not new (Breitbart et al., 2003 Turnbaugh et al., 2007; Haynes and

Rohwer, 2011; Minot et al., 2011), but the difficulties of studying phage biology in vivo has largely hindered these whole-system studies, despite recent successes (Majewska et al., 2015; Maura et al., 2012; Reyes et al., 2013). Phages have been described, in vitro, as providing a form of indirect immunity on mucosal surfaces to modulate bacterial settlement and colonization (Barr et al., 2013). Additionally, many in vitro experiments have described a role for phages in bacterial biofilm formation (Carrolo et al., 2010;

Godeke et al., 2011; Leigh et al., 2017; Nanda et al., 2015; Rice et al., 2009; Tan et al.,

2015), a lifestyle often exhibited by resident bacteria within mucus layers. Lysogeny is known to be a prevalent viral state within the gut of healthy humans (Minot et al., 2011;

Minot et al., 2013; Reyes et al., 2013). By influencing gene expression or by lysis, prophages have the capacity to influence the outcome of bacterial settlement and biofilm formation during colonization (Carrolo et al., 2010; Godeke et al., 2011; Nanda et al., 2015; Rice et al., 2009; Wang et al., 2010). The presence of prophage hallmark genes, such as integrases and excisionases, which share sequence identity with core gut bacteria in Ciona implies that prophages could be serving important roles in the establishment or maintenance of these stable bacterial communities. The utilization of

Ciona as a model system in future studies will indeed shed light on the role of phages in shaping gut homeostasis.

Data availability

Viral data were deposited in both MetaVir (IDs 7811 (SF), 8143 (SC), 7815 (MF), 7814

(MC), 7812 (HF), 7910 (HC), 7816 (CB), 7819 (MB), and 8255 (SDC14)) and MG-RAST

(IDs 4707275.3 (SF), 4707280.3 (SC), 4707282.3 (MF), 4734670.3 (MC), 4707277.3

(HF), 4707278.3 (HC), 4707281.3 (CB), 4707279.3 (MB), 4734673.3 (SDC14)).

Bacterial data were deposited in MG-RAST (IDs 4751381.3 (SF), 4751379.3 (SC),

4751382.3 (MF), 4751386.3 (MC), 4751377.3 (HF), and 4751377.3 (HC)).

Acknowledgements

The authors would like to thank Matthew Sullivan and his group for training on the iVirus pipeline as well as Ben Bolduc in particular for his constant help in navigating iVirus.

The authors would also like to thank Ryan Schenck for his digital illustration of the

Ciona anatomy.

Funding

These studies were supported by a grant from the National Science Foundation (IOS-

1456301) to L.J.D. and M.B. and by a National Science Foundation Graduate Research

Fellowship (Award No. 1144244) to B.A.L.

References

Abeles, S.R., Pride, D.T., 2014. Molecular bases and role of viruses in the human microbiome. J Mol Biol 426(23), 3892-3906. Barbeyron, T., Lerat, Y., Sassi, J.F., Le Panse, S., Helbert, W., Collen, P.N., 2011. Persicivirga ulvanivorans sp. nov., a marine member of the family Flavobacteriaceae that degrades ulvan from green algae. Int J Syst Evol Microbiol 61(8), 1899-1905. Barr, J.J., Auro, R., Furlan, M., Whiteson, K.L., Erb, M.L., Pogliano, J., Stotland, A., Wolkowicz, R., Cutting, A.S., Doran, K.S., Salamon, P., Youle, M., Rohwer, F., 2013. Bacteriophage adhering to mucus provide a non-host-derived immunity. Proc Natl Acad Sci U S A 110(26), 10771-10776. Bolduc, B., Youens-Clark, K., Roux, S., Hurwitz, B.L., Sullivan, M.B., 2017. iVirus: facilitating new insights in viral ecology with software and community data sets imbedded in a cyberinfrastructure. ISME J 11(1), 7-14. Borriss, M., Lombardot, T., Glockner, F.O., Becher, D., Albrecht, D., Schweder, T., 2007. Genome and proteome characterization of the psychrophilic Flavobacterium bacteriophage 11b. Extremophiles 11(1), 95-104. Breitbart, M., Hewson, I., Felts, B., Mahaffy, J.M., Nulton, J., Salamon, P., Rohwer, F., 2003. Metagenomic analyses of an uncultured viral community from human feces. J Bacteriol 185(20), 6220-6223. Callahan, B.J., McMurdie, P.J., Rosen, M.J., Han, A.W., Johnson, A.J., Holmes, S.P., 2016. DADA2: High-resolution sample inference from Illumina amplicon data. Nat Methods 13(7), 581-583. Carrolo, M., Frias, M.J., Pinto, F.R., Melo-Cristino, J., Ramirez, M., 2010. Prophage spontaneous activation promotes DNA release enhancing biofilm formation in Streptococcus pneumoniae. PLoS One 5(12), e15678. Chen, H., Boutros, P.C., 2011. VennDiagram: a package for the generation of highly- customizable Venn and Euler diagrams in R. BMC Bioinformatics 12, 35. Cho, I., Blaser, M.J., 2012. The human microbiome: at the interface of health and disease. Nat Rev Genet 13(4), 260-270. Codling, C., O'Mahony, L., Shanahan, F., Quigley, E.M., Marchesi, J.R., 2010. A molecular analysis of fecal and mucosal bacterial communities in irritable bowel syndrome. Dig Dis Sci 55(2), 392-397. Cohen, L.J., Kang, H.S., Chu, J., Huang, Y.H., Gordon, E.A., Reddy, B.V., Ternei, M.A., Craig, J.W., Brady, S.F., 2015. Functional metagenomic discovery of bacterial effectors in the human microbiome and isolation of commendamide, a GPCR G2A/132 agonist. Proc Natl Acad Sci U S A 112(35), E4825-4834. Coleman, N., 1991. Encyclopedia of Marine Animals. Blandford, London. Cullender, T.C., Chassaing, B., Janzon, A., Kumar, K., Muller, C.E., Werner, J.J., Angenent, L.T., Bell, M.E., Hay, A.G., Peterson, D.A., Walter, J., Vijay-Kumar, M., Gewirtz, A.T., Ley, R.E., 2013. Innate and adaptive immunity interact to quench microbiome flagellar motility in the gut. Cell Host Microbe 14(5), 571-581. Darling, A.E., Mau, B. and Perna, N.T., 2010. progressiveMauve: multiple genome alignment with gene gain, loss and rearrangement. PloS One, 5(6), e11147.

Davies, E.V., James, C.E., Williams, D., O'Brien, S., Fothergill, J.L., Haldenby, S., Paterson, S., Winstanley, C., Brockhurst, M.A., 2016. Temperate phages both mediate and drive adaptive evolution in pathogen biofilms. Proc Natl Acad Sci U S A 113(29), 8266-8271. de O Gaio, A., Gusmao, D.S., Santos, A.V., Berbert-Molina, M.A., Pimenta, P.F., Lemos, F.J., 2011. Contribution of midgut bacteria to blood digestion and egg production in Aedes aegypti (Diptera: Culicidae) (L.). Parasit Vectors 4, 105. Delcher, A.L., Bratke, K.A., Powers, E.C., Salzberg, S.L., 2007. Identifying bacterial genes and endosymbiont DNA with Glimmer. Bioinformatics 23(6), 673-679. Dishaw, L.J., Flores-Torres, J., Lax, S., Gemayel, K., Leigh, B., Melillo, D., Mueller, M.G., Natale, L., Zucchetti, I., De Santis, R., Pinto, M.R., Litman, G.W., Gilbert, J.A., 2014. The gut of geographically disparate Ciona intestinalis harbors a core microbiota. PLoS One 9(4), e93386. Dishaw, L.J., Giacomelli, S., Melillo, D., Zucchetti, I., Haire, R.N., Natale, L., Russo, N.A., De Santis, R., Litman, G.W., Pinto, M.R., 2011. A role for variable region- containing chitin-binding proteins (VCBPs) in host gut-bacteria interactions. Proc Natl Acad Sci U S A 108(40), 16747-16752. Dishaw, L.J., Leigh, B., Cannon, J.P., Liberti, A., Mueller, M.G., Skapura, D.P., Karrer, C.R., Pinto, M.R., De Santis, R., Litman, G.W., 2016. Gut immunity in a protochordate involves a secreted immunoglobulin-type mediator binding host chitin and bacteria. Nat Commun 7, 10617. Duhaime, M.B., Sullivan, M.B., 2012. Ocean viruses: rigorously evaluating the metagenomic sample-to-sequence pipeline. Virology 434(2), 181-186. Dutilh, B.E., Cassman, N., McNair, K., Sanchez, S.E., Silva, G.G., Boling, L., Barr, J.J., Speth, D.R., Seguritan, V., Aziz, R.K., Felts, B., Dinsdale, E.A., Mokili, J.L., Edwards, R.A., 2014. A highly abundant bacteriophage discovered in the unknown sequences of human faecal metagenomes. Nat Commun 5, 4498. Efrony, R., Atad, I., Rosenberg, E., 2009. Phage therapy of coral white plague disease: properties of phage BA3. Curr Microbiol 58(2), 139-145. Feschotte, C., Gilbert, C., 2012. Endogenous viruses: insights into viral evolution and impact on host biology. Nat Rev Genet 13(4), 283-296. Fischer, M.G., Suttle, C.A., 2011. A virophage at the origin of large DNA transposons. Science 332(6026), 231-234. Flint, H.J., Bayer, E.A., Rincon, M.T., Lamed, R., White, B.A., 2008. Polysaccharide utilization by gut bacteria: potential for new insights from genomic analysis. Nat Rev Microbiol 6(2), 121-131. Flint, H.J., Duncan, S.H., Scott, K.P., Louis, P., 2007. Interactions and competition within the microbial community of the human colon: links between diet and health. Environ Microbiol 9(5), 1101-1111. Godeke, J., Paul, K., Lassak, J., Thormann, K.M., 2011. Phage-induced lysis enhances biofilm formation in Shewanella oneidensis MR-1. ISME J 5(4), 613-626. Grasis, J.A., Lachnit, T., Anton-Erxleben, F., Lim, Y.W., Schmieder, R., Fraune, S., Franzenburg, S., Insua, S., Machado, G., Haynes, M., Little, M., Kimble, R., Rosenstiel, P., Rohwer, F.L., Bosch, T.C., 2014. Species-specific viromes in the ancestral holobiont Hydra. PLoS One 9(10), e109952.

Gurevich, A., Saveliev, V., Vyahhi, N., & Tesler, G., 2013. QUAST: quality assessment tool for genome assemblies. Bioinformatics, 29(8), 1072-1075. Haynes, M., Rohwer, F., 2011. The Human Virome. Metagenomics of the Human Body, 63-77. Holmfeldt, K., Solonenko, N., Shah, M., Corrier, K., Riemann, L., Verberkmoes, N.C., Sullivan, M.B., 2013. Twelve previously unknown phage genera are ubiquitous in global oceans. Proc Natl Acad Sci U S A 110(31), 12798-12803. Kang, I., Jang, H., Cho, J.C., 2012. Complete genome sequences of two Persicivirga bacteriophages, P12024S and P12024L. J Virol 86(16), 8907-8908. Kearse, M., Moir, R., Wilson, A., Stones-Havas, S., Cheung, M., Sturrock, S., Buxton, S., Cooper, A., Markowitz, S., Duran, C., Thierer, T., Ashton, B., Meintjes, P., Drummond, A., 2012. Geneious Basic: an integrated and extendable desktop software platform for the organization and analysis of sequence data. Bioinformatics 28(12), 1647-1649. Keegan, K.P., Glass, E.M., Meyer, F., 2016. MG-RAST, a metagenomics service for analysis of microbial community structure and function. Methods Mol Biol 1399, 207-233. Kim, K.H., Bae, J.W., 2011. Amplification methods bias metagenomic libraries of uncultured single-stranded and double-stranded DNA viruses. Appl Environ Microbiol 77(21), 7663-7668. Kirchman, D.L., 2002. The ecology of Cytophaga-Flavobacteria in aquatic environments. FEMS Microbiol Ecol 39(2), 91-100. Kwan, T., Liu, J., Dubow, M., Gros, P., Pelletier, J., 2006. Comparative genomic analysis of 18 Pseudomonas aeruginosa bacteriophages. J Bacteriol 188(3), 1184-1187. Leach, W.D., Lee, A., Stubbs, R.P., 1973. Localization of bacteria in the gastrointestinal tract: a possible explanation of intestinal spirochaetosis. Infect Immun 7(6), 961- 972. Leigh, B.A., Liberti, A. and Dishaw, L.J., 2016. Generation of germ-free Ciona intestinalis for studies of gut-microbe interactions. Front Microbiol 7, 2092. Leigh, B., Karrer, C., Cannon, J.P., Breitbart, M., Dishaw, L.J., 2017. Isolation and characterization of a Shewanella phage-host system from the gut of the tunicate, Ciona intestinalis. Viruses 9(3), 60. Liberti, A., Melillo, D., Zucchetti, I., Natale, L., Dishaw, L.J., Litman, G.W., De Santis, R., Pinto, M.R., 2014. Expression of Ciona intestinalis variable region-containing chitin-binding proteins during development of the gastrointestinal tract and their role in host-microbe interactions. PLoS One 9(5), e94984. Looft, T., Allen, H.K., Cantarel, B.L., Levine, U.Y., Bayles, D.O., Alt, D.P., Henrissat, B., Stanton, T.B., 2014. Bacteria, phages and pigs: the effects of in-feed antibiotics on the microbiome at different gut locations. ISME J 8(8), 1566-1576. Majewska, J., Beta, W., Lecion, D., Hodyra-Stefaniak, K., Klopot, A., Kazmierczak, Z., Miernikiewicz, P., Piotrowicz, A., Ciekot, J., Owczarek, B., Kopciuch, A., Wojtyna, K., Harhala, M., Makosa, M., Dabrowska, K., 2015. Oral application of T4 phage induces weak antibody production in the gut and in the blood. Viruses 7(8), 4783- 4799.

Marcais, G., Kingsford, C., 2011. A fast, lock-free approach for efficient parallel counting of occurrences of k-mers. Bioinformatics 27(6), 764-770. Marhaver, K.L., Edwards, R.A., Rohwer, F., 2008. Viral communities associated with healthy and bleaching corals. Environ Microbiol 10(9), 2277-2286. Maura, D., Morello, E., du Merle, L., Bomme, P., Le Bouguenec, C., Debarbieux, L., 2012. Intestinal colonization by enteroaggregative Escherichia coli supports long- term bacteriophage replication in mice. Environ Microbiol 14(8), 1844-1854. Minot, S., Sinha, R., Chen, J., Li, H., Keilbaugh, S.A., Wu, G.D., Lewis, J.D., Bushman, F.D., 2011. The human gut virome: inter-individual variation and dynamic response to diet. Genome Res 21(10), 1616-1625. Minot, S., Bryson, A., Chehoud, C., Wu, G. D., Lewis, J. D., & Bushman, F. D., 2013. Rapid evolution of the human gut virome. Proc Natl Acad Sci U S A, 110(30), 12450-12455. Mizuno, C.M., Rodriguez-Valera, F., Kimes, N.E., Ghai, R., 2013. Expanding the marine virosphere using metagenomics. PLoS Genet 9(12), e1003987. Nanda, A.M., Thormann, K., Frunzke, J., 2015. Impact of spontaneous prophage induction on the fitness of bacterial populations and host-microbe interactions. J Bacteriol 197(3), 410-419. Nicholson, J.K., Holmes, E., Kinross, J., Burcelin, R., Gibson, G., Jia, W., Pettersson, S., 2012. Host-gut microbiota metabolic interactions. Science 336, 1262-1267. Nishimura, Y., Watai, H., Honda, T., Mihara, T., Omae, K., Roux, S., Blanc-Mathieu, R., Yamamoto, K., Hingamp, P., Sako, Y., Sullivan, M.B., Goto, S., Ogata, H., Yoshida, T., 2017. Environmental viral genomes shed new light on virus-host interactions in the ocean. mSphere 2(2), e00359-16. Norman, J.M., Handley, S.A., Baldridge, M.T., Droit, L., Liu, C.Y., Keller, B.C., Kambal, A., Monaco, C.L., Zhao, G., Fleshner, P., Stappenbeck, T.S., McGovern, D.P., Keshavarzian, A., Mutlu, E.A., Sauk, J., Gevers, D., Xavier, R.J., Wang, D., Parkes, M., Virgin, H.W., 2015. Disease-specific alterations in the enteric virome in inflammatory bowel disease. Cell 160(3), 447-460. Parada, A.E., Needham, D.M., Fuhrman, J.A., 2016. Every base matters: assessing small subunit rRNA primers for marine microbiomes with mock communities, time series and global field samples. Environ Microbiol 18(5), 1403-1414. Patel, A., Noble, R.T., Steele, J.A., Schwalbach, M.S., Hewson, I., Fuhrman, J.A., 2007. Virus and prokaryote enumeration from planktonic aquatic environments by epifluorescence microscopy with SYBR Green I. Nat Protoc 2(2), 269-276. Quast, C., Pruesse, E., Yilmaz, P., Gerken, J., Schweer, T., Yarza, P., Peplies, J., Glockner, F.O., 2013. The SILVA ribosomal RNA gene database project: improved data processing and web-based tools. Nucleic Acids Res 41(Database issue), D590-596. R Core Team, 2016. R: A Language and Environment for Statistical Computing. Vienna, Austria: R Foundation for Statistical Computing; 2014. R Foundation for Statistical Computing. Rani, A., Sharma, A., Rajagopal, R., Adak, T., Bhatnagar, R.K., 2009. Bacterial diversity analysis of larvae and adult midgut microflora using culture-dependent and culture-independent methods in lab-reared and field-collected Anopheles stephensi-an Asian malarial vector. BMC Microbiol 9, 96.

Reyes, A., Haynes, M., Hanson, N., Angly, F.E., Heath, A.C., Rohwer, F., Gordon, J.I., 2010. Viruses in the faecal microbiota of monozygotic twins and their mothers. Nature 466(7304), 334-338. Reyes, A., Semenkovich, N.P., Whiteson, K., Rohwer, F., Gordon, J.I., 2012. Going viral: next-generation sequencing applied to phage populations in the human gut. Nat Rev Microbiol 10(9), 607-617. Reyes, A., Wu, M., McNulty, N.P., Rohwer, F.L., Gordon, J.I., 2013. Gnotobiotic mouse model of phage-bacterial host dynamics in the human gut. Proc Natl Acad Sci U S A 110(50), 20236-20241. Rice, S.A., Tan, C.H., Mikkelsen, P.J., Kung, V., Woo, J., Tay, M., Hauser, A., McDougald, D., Webb, J.S., Kjelleberg, S., 2009. The biofilm life cycle and virulence of Pseudomonas aeruginosa are dependent on a filamentous prophage. ISME J 3(3), 271-282. Roeselers, G., Mittge, E.K., Stephens, W.Z., Parichy, D.M., Cavanaugh, C.M., Guillemin, K., Rawls, J.F., 2011. Evidence for a core gut microbiota in the zebrafish. ISME J 5(10), 1595-1608. Rohwer, F., Seguritan, V., Azam, F., & Knowlton, N., 2002. Diversity and distribution of coral-associated bacteria. Marine Ecol Pro Ser, 243, 1-10. Roossinck, M.J., 2011. The good viruses: viral mutualistic symbioses. Nat Rev Microbiol 9(2), 99-108. Rosenberg, E., Zilber-Rosenberg, I., 2011. Symbiosis and development: the hologenome concept. Birth Defects Res C Embryo Today 93(1), 56-66. Roux, S., Enault, F., Hurwitz, B.L., Sullivan, M.B., 2015. VirSorter: mining viral signal from microbial genomic data. PeerJ 3, e985. Roux, S., Tournayre, J., Mahul, A., Debroas, D., Enault, F., 2014. Metavir 2: new tools for viral metagenome comparison and assembled virome analysis. BMC Bioinformatics 15, 76. Sabree, Z.L., Hansen, A.K., Moran, N.A., 2012. Independent studies using deep sequencing resolve the same set of core bacterial species dominating gut communities of honey bees. PLoS One 7(7), e41250. Sandaa, R.A., Heldal, M., Castberg, T., Thyrhaug, R., Bratbak, G., 2001. Isolation and characterization of two viruses with large genome size infecting Chrysochromulina ericina (Prymnesiophyceae) and Pyramimonas orientalis (Prasinophyceae). Virology 290(2), 272-280. Schmitt, S., Tsai, P., Bell, J., Fromont, J., Ilan, M., Lindquist, N., Perez, T., Rodrigo, A., Schupp, P.J., Vacelet, J., Webster, N., Hentschel, U., Taylor, M.W., 2012. Assessing the complex sponge microbiota: core, variable and species-specific bacterial communities in marine sponges. ISME J 6(3), 564-576. Shan, T., Li, L., Simmonds, P., Wang, C., Moeser, A., Delwart, E., 2011. The fecal virome of pigs on a high-density farm. J Virol 85(22), 11697-11708. Simonsen, S.a.O.M., 1997. Toxicity tests in eight species of Chrysochromulina (Haptophyta). Canadian J Botany 75(1), 129-136. Sobhani, I., Tap, J., Roudot-Thoraval, F., Roperch, J.P., Letulle, S., Langella, P., Corthier, G., Tran Van Nhieu, J., Furet, J.P., 2011. Microbial dysbiosis in colorectal cancer (CRC) patients. PLoS One 6(1), e16393. Suttle, C.A., 2005. Viruses in the sea. Nature 437(7057), 356-361.

Tamboli, C.P., Neut, C., Desreumaux, P., Colombel, J.F., 2004. Dysbiosis as a prerequisite for IBD. Gut 53(7), 1057. Tan, D., Dahl, A., Middelboe, M., 2015. Vibriophages differentially influence biofilm formation by Vibrio anguillarum strains. Appl Environ Microbiol 81(13), 4489- 4497. Thaiss, C.A., Zmora, N., Levy, M., Elinav, E., 2016. The microbiome and innate immunity. Nature 535(7610), 65-74. Theis, K.R., Dheilly, N.M., Klassen, J.L., Brucker, R.M., Baines, J.F., Bosch, T.C., Cryan, J.F., Gilbert, S.F., Goodnight, C.J., Lloyd, E.A., Sapp, J., Vandenkoornhuyse, P., Zilber-Rosenberg, I., Rosenberg, E., Bordenstein, S.R., 2016. Getting the hologenome concept right: an eco-evolutionary framework for hosts and their microbiomes. mSystems 1(2), e00028-16. Thurber, R.V., Haynes, M., Breitbart, M., Wegley, L., Rohwer, F., 2009. Laboratory procedures to generate viral metagenomes. Nat Protoc 4(4), 470-483. Thurber, R. V., Payet, J. P., Thurber, A. R., & Correa, A. M., 2017. Virus-host interactions and their roles in coral reef health and disease. Nature Rev Microbiol, 15(4), 205-216. Tremaroli, V., Backhed, F., 2012. Functional interactions between the gut microbiota and host metabolism. Nature 489(7415), 242-249. Turnbaugh, P.J., Gordon, J.I., 2009. The core gut microbiome, energy balance and obesity. J Physiol 587(17), 4153-4158. Turnbaugh, P.J., Ley, R.E., Hamady, M., Fraser-Liggett, C.M., Knight, R., Gordon, J.I., 2007. The human microbiome project. Nature 449(7164), 804-810. Wang, X., Kim, Y., Ma, Q., Hong, S.H., Pokusaeva, K., Sturino, J.M., Wood, T.K., 2010. Cryptic prophages help bacteria cope with adverse environments. Nat Commun 1, 147. Weisburg, W.G., Barns, S.M., Pelletier, D.A., Lane, D.J., 1991. 16S ribosomal DNA amplification for phylogenetic study. J Bacteriol 173(2), 697-703. Yang, H., Schmitt-Wagner, D., Stingl, U., Brune, A., 2005. Niche heterogeneity determines bacterial community structure in the termite gut (Reticulitermes santonensis). Environ Microbiol 7(7), 916-932. Yolken, R.H., Jones-Brando, L., Dunigan, D.D., Kannan, G., Dickerson, F., Severance, E., Sabunciyan, S., Talbot, C.C., Jr., Prandovszky, E., Gurnon, J.R., Agarkova, I.V., Leister, F., Gressitt, K.L., Chen, O., Deuber, B., Ma, F., Pletnikov, M.V., Van Etten, J.L., 2014. Chlorovirus ATCV-1 is part of the human oropharyngeal virome and is associated with changes in cognitive functions in humans and mice. Proc Natl Acad Sci U S A 111(45), 16106-16111. Yonge, C.M., 1924. Studies on the comparative physiology of digestion. J Exp Biol 1(3), 343-389. Zhou, J., Sun, D., Childers, A., McDermott, T.R., Wang, Y., Liles, M.R., 2015. Three novel virophage genomes discovered from Yellowstone Lake metagenomes. J Virol 89(2), 1278-1285. Zoetendal, E.G., von Wright, A., Vilpponen-Salmela, T., Ben-Amor, K., Akkermans, A.D., de Vos, W.M., 2002. Mucosa-associated bacteria in the human gastrointestinal tract are uniformly distributed along the colon and differ from the community recovered from feces. Appl Environ Microbiol 68(7), 3401-3407.

Figures

A. B.

Figure 1: (A) Schematic of Ciona intestinalis highlighting anatomy of the gut compartments. (B)

Summary of tissue sampling approach.

Figure 2: Fizkin k-mer analysis of read similarity among viromes. Each color represents an entire gut or water sample. Compartments in 2015 were combined to form “SDC 15” and “SDF

15”.

SDC 14 SDC 15

308 453 1305

Figure 3: Virome of the cleared Ciona gut between collection years as determined by 75% contig coverage by reads to the co-assembled contigs. Cleared compartments from 2015 were combined to form “SDC 15”.

SC SF

391 957 726

MC MF 460 1530 1014

HC HF

423 1740 525

Figure 4: Shared contigs between cleared and uncleared compartments from 2015 tissues as determined by 75% contig coverage by read mapping.

Figure 5: Taxonomy and abundance of all affiliated contigs from trisected gut samples from (A) all dsDNA viruses and, more specifically, (B) Caudovirales. (SC=stomach cleared; MC=midgut cleared; HC=hindgut cleared; SF=stomach full; MF=midgut full; HF=hindgut full).

SC MC HC

A B

SC MC contigs Top 50 Top >10xabundance

HC <10xabundance

C D Absent SC MC HC Top 50 OTUs Top >100 OTUs <100 OTUs

Absent

Figure 6: (A) Compartmentalization of viral contigs from the Ciona gut determined by ≥ 75% contig coverage by reads. (B) Relative abundance of the top 50 viral contigs from each compartment, compared across subsequent compartments as determined by read mapping to contigs from the co-assembly. (C) Compartmentalization of bacterial OTUs from the Ciona gut.

(D) Relative abundance of the top 50 bacterial OTUs from each compartment, compared across subsequent compartments. (SC=stomach cleared; MC=midgut cleared; HC=hindgut cleared;

SF=stomach full; MF=midgut full; HF=hindgut full).

Figure 7: Whole genome comparison of synteny of two EVGs with their closest BLASTx match in the RefSeq database using Mauve genome alignment. (A) Node 14 to Thalassamonas phage

BA3. (B) Node 13 to Flavobacterium phage 11b. Colored boxes indicate sequence blocks with shared identity, and white regions indicate sequences lacking homology.

Figure S1: Number of reads from each virome mapping to contigs from the single sample assemblies of the Ciona virome that contained integrase and excisionase genes according to subsystem-based analysis in MG-RAST.

SDC 14 SC SF MC MF HC HF # Reads (Millions) 6.51 4.41 3.08 3.95 3.63 7.32 3.37 Avg read length (bp) 199 505 696 725 750 453 809 # conitgs (>500 bp) 17685 18662 29976 34433 36166 20368 32433 # contigs (>1000 bp) 5826 5887 8413 12101 10577 6656 9946 # contigs (>5000 bp) 324 363 602 670 901 128 952 Largest contig 37553 95916 65207 79274 114284 18907 114296 GC% 39.63 39.72 39.02 39.41 38.75 38.29 39.55 N50 1340 1517 1275 1448 1500 1113 1692 Affiliated Contigs >5 kb 305 328 545 615 826 116 883 Unaffiliated Contigs >5 kb 19 35 57 55 75 12 69 Affilitation Ratio >5 kb 0.94 0.9 0.91 0.92 0.92 0.91 0.93 Genes predicted 4026 5610 8415 9535 12898 1104 14610 Circular Contigs >10kb 1 3 4 2 4 0 15

Table 1: Virome sequencing and single sample assembly details. Only contigs >5 kb were analyzed in this study. The affiliation ratios refer to the percent of contigs with significant

BLASTx similarity to the RefSeq database (BLAST bitscore threshold 50).

Contig Length (bp) SC MC HC SDC 14 SF MF HF Closest BLASTx hit NODE_1 114157 0 0 0 0 4.92 25.13 17.94 uncultured Mediterranean ohage uvMED NODE_4 68049 0 2.37 0 0 5.38 17.89 37.1 uncultured marine virus NODE_6 66215 0 2.96 3.03 0 12.11 37.28 31.05 - NODE_5 66045 1.99 3.3 3.21 0 10.87 22.51 18.57 uncultured marine virus NODE_7 60707 0 0 0 0 1.69 10.97 21.1 uncultured marine virus NODE_11 39502 12.77 6.28 14.37 0 0 0 0 - NODE_158282 37496 0 0 0 79.71 0 0 0 uncultured Mediterranean phage uvMED NODE_14 36718 10.37 6.81 9.1 0 6.54 4.6 18.79 Thalassamonas phage BA3 NODE_26 36261 1.54 2.01 0 0 7.15 14.54 22.53 Flavobacterium phage NODE_31 33937 3.83 0 3.29 11.75 3.63 5.29 10.83 - NODE_34 32853 5.11 3.35 3.67 0 17.32 35.45 52.03 uncultured Mediterranean phage uvMED NODE_20 32650 6.03 46 72.2 0 82.09 260.49 328.01 - NODE_25 32410 0 0 0 0 3.11 4.16 5.62 uncultured Mediterranean phage uvMED NODE_39 31550 2.88 2.38 7.29 85.01 7.19 12.05 18.12 - NODE_13 31113 3.09 3.16 10.62 5.59 11.74 46.95 38.19 Flavobacterium phage 11b/ Cellulophaga phage phi 10:1 NODE_29 30928 0 0 0 0 4.51 9.87 7.31 uncultured Mediterranean phage uvMED NODE_42 30800 0 0 0 0 4.77 7.11 15.12 uncultured Mediterranean phage uvMED NODE_44 30535 78.38 88.92 58.12 0 265.68 197.3 224.28 uncultured Mediterranean phage uvMED/ Endozoicmoonas NODE_46 30268 2.44 7.81 7.3 0 55.92 91.57 124.66 uncultured Mediterranean phage uvMED NODE_33 29858 0 0 0 0 3.56 10.95 11.68 uncultured Mediterranean phage uvMED/ Synechococcus NODE_40 28217 2.22 2.32 0 0 7.04 10.54 4.26 uncultured Mediterranean phage uvMED NODE_53 28176 0 0 0 0 1.78 5.57 10.22 Flavobacterium phage NODE_60 27036 1.7 2.9 3.95 0 20.9 75.22 146.22 uncultured Mediterranean phage uvDeep NODE_38 24602 4.19 6.5 5.78 3.7 16.23 41.54 24.85 - NODE_27 24496 5.77 5.28 6.09 3.88 15.86 46.48 27.06 - NODE_73 24261 0 0 0 0 2.4 11.94 18.27 uncultured Mediterranean phage uvMED NODE_41 23894 0 8.22 14.26 0 93.19 292.75 430.37 - NODE_39 19273 13.1 0 0 0 0 0 0 virophage NODE_54 18608 2.09 0 0 0 10.63 0 0 virophage

Table 2: Relative abundance of all circular contigs from the Ciona virome and their closest

BLASTx match in the NR database as determined by the majority of ORFs. A single FASTA file with all circular genomes is available as a supplemental file, and annotated genomes are available in MetaVir.

94 Appendix D: Isolation and characterization of a Shewanella phage-host

system from the gut of the tunicate, Ciona intestinalis

This appendix is a primary research article published in Viruses in the special

issue Marine viruses.

Leigh, B.A., Karrer, C., Cannon, J.P., Breitbart, M. and Dishaw, L.J., 2017.

Isolation and characterization of a Shewanella phage–host system from the gut

of the tunicate, Ciona intestinalis. Viruses, 9(3), p.60.

95 viruses

Article Isolation and Characterization of a Shewanella Phage–Host System from the Gut of the Tunicate, Ciona intestinalis

Brittany Leigh 1, Charlotte Karrer 2, John P. Cannon 2, Mya Breitbart 1 and Larry J. Dishaw 2,*

1 College of Marine Science, University of South Florida, St. Petersburg, FL 33701, USA; [email protected] (B.L.); [email protected] (M.B.) 2 Department of Pediatrics, University of South Florida, St. Petersburg, FL 33701, USA; [email protected] (C.K.); [email protected] (J.P.C.) * Correspondence: [email protected]; Tel.: +1-727-553-3608

Academic Editors: Mathias Middelboe and Corina P. D. Brussaard Received: 29 January 2017; Accepted: 17 March 2017; Published: 22 March 2017

Abstract: Outnumbering all other biological entities on earth, bacteriophages (phages) play critical roles in structuring microbial communities through bacterial infection and subsequent lysis, as well as through horizontal gene transfer. While numerous studies have examined the effects of phages on free-living bacterial cells, much less is known regarding the role of phage infection in host-associated biofilms, which help to stabilize adherent microbial communities. Here we report the cultivation and characterization of a novel strain of Shewanella fidelis from the gut of the marine tunicate Ciona intestinalis, inducible prophages from the S. fidelis genome, and a strain-specific lytic phage recovered from surrounding seawater. In vitro biofilm assays demonstrated that lytic phage infection affects biofilm formation in a process likely influenced by the accumulation and integration of the extracellular DNA released during cell lysis, similar to the mechanism that has been previously shown for prophage induction.

Keywords: Shewanella; bacteriophage; bioﬁlm; extracellular DNA

1. Introduction A significant proportion of microbes in the marine environment, including both bacteria and bacteriophages (i.e., phages), are associated with eukaryotic hosts, where they form stable symbiotic relationships. These symbiotic relationships are often specific and necessary in maintaining animal health via carefully orchestrated exchanges (i.e., homeostasis). Although phages are the most abundant biological entities in the natural world [1,2], little is known about their role in structuring and maintaining host-associated microbial communities, or how they influence bacteria within a biofilm, a lifestyle many aquatic bacteria exhibit. Even less is known about how perturbation of these microbial communities influences the eukaryotic host. Many animals maintain a “core” assemblage of bacteria (i.e., a core microbiome) that likely provides advantages to the host [3–5]. Some of these bacteria are consistently found within the same environments (e.g., animal intestines) and across diverse animal hosts, where they are presumed to serve distinct functions for either the animal host and/or the surrounding microbes. One such bacterial genus is Shewanella [6–9]. Shewanella species from a wide range of environments are known for their highly versatile metabolic capabilities that utilize diverse electron acceptors including nitrate, nitrite, thiosulfate, elemental sulfur, iron oxide and manganese oxide [10–12]. Shewanella species shuttle electrons across their membranes during anaerobic respiration, resulting in electrical activity within their biofilms and the transformation of insoluble compounds to bioavailable ones. Interestingly, biofilms with electrical

Viruses 2017, 9, 60; doi:10.3390/v9030060 www.mdpi.com/journal/viruses Viruses 2017, 9, 60 2 of 16 activity have been documented to influence host cellular responses [13]. These bacteria make stable biofilms and because they can respire almost any compound, they likely represent important symbionts of animals as well. Despite extensive genomic rearrangements within Shewanella genomes [14], members of the genus retain a core set of metabolic genes that facilitate their survival in diverse environments [15], including the gut of a number of organisms [6–9]. Shewanella putrefaciens, which is closely related to S. fidelis, has shown promise as a probiotic for aquaculture [16], further emphasizing important roles for Shewanella in aquatic animal-microbe relationships. To date, a number of Shewanella phages (both lytic and temperate) have been described from marine and freshwater environments [17–21], and in Shewanella oneidensis, prophages have also been implicated as vital for biofilm formation through excision-mediated lysis [21]. Stably integrated prophage-like elements are common within the genomes of most marine bacterial species [22], and prophages are also thought to be important among bacteria that colonize the gut mucosa of animals [23], often forming biofilms [24,25]. These biofilms are thought to serve as physical structures that can enhance pathogen defense by contributing to physical barriers, and through the production of diverse antimicrobials [26,27]. To begin to understand the role of phages in shaping the microbiome of sessile, filter-feeding marine invertebrates, we isolated and characterized a core member of the gut microbiome in the tunicate, Ciona intestinalis [4]. This novel strain of Shewanella fidelis (3313) was sequenced, and its inducible prophages and a strain-specific lytic phage (SFCi1, which was isolated separately from seawater) were characterized. Previously, it has been shown that spontaneous prophage induction can augment biofilms in some strains of bacteria [28–31]; we demonstrate here that infection of S. fidelis 3313 by lytic phage SFCi1 also enhances biofilm formation in vitro in a similar DNA-dependent manner.

2. Materials and Methods

2.1. Bacterial Isolation from the Gut of Ciona Intestinalis Ciona intestinalis specimens were collected from Mission Bay in San Diego (M-REP Animal Collection Services, San Diego, CA, USA) during the Spring of 2014. Animals were cleared for 48 h in seawater filtered through a 0.22 µm pore size filter (Millipore Sterivex, Merck, Darmstadt, Germany) (with water changes every several hours), before the entire gut (stomach, midgut, hindgut) of five animals was dissected and homogenized using a dounce homogenizer. The gut homogenate was filtered through a 0.45 µm pore size filter (Millipore Sterivex, Merck) to remove host tissue, and the bacteria were pelleted by centrifugation at 12,500 xg for 10 min and washed three times through resuspension and centrifugation in 1 mL of sterile (filtered through a 0.22 µm pore size filter and autoclaved) artificial seawater (Instant Ocean AS9519, Marine Depot, Garden Grove, CA, USA). Serial dilutions of the bacterial homogenate were plated on marine agar (MA) 2216 (Becton Dickinson Company, Franklin Lakes, NJ, USA). Colonies displaying distinct phenotypes were randomly chosen, purified by streaking, and grown separately in the corresponding liquid broth (marine broth (MB) 2216, pH 7.6) at 20 ◦C; subsequently, a 20% glycerol stock was made for each isolate and stored at −80 ◦C. DNA was isolated using the PowerSoil DNA Kit (MoBio Laboratories, Carlsbad, CA, USA) and the 16S rRNA gene amplified using universal primers 27F and 1492R [32] (polymerase chain reaction (PCR) conditions: denature at 95 ◦C for 5 min, cycle 35 times through 94 ◦C for 30 s, 56 ◦C for 30 s, 72 ◦C for 1 min 30 s, and end with a final extension at 72 ◦C for 10 min), sequenced via the Sanger platform and identified using BLAST against the NCBI non-redundant database [33].

2.2. Phage Isolation, Propagation, and Purification for Transmission Electron Microscopy S. fidelis 3313 recovered from the Ciona gut homogenate was screened for lytic phages via standard plaque assays using seawater from which the animals were shipped (i.e., bag water) filtered through a 0.22 µm pore size filter. Approximately 500 mL of the filtered seawater was concentrated using Amicon Ultra-15 concentration units (molecular weight cut-off (MWCO) 100 kDa; EMD (Merck Millipore, Viruses 2017, 9, 60 3 of 16

Darmstadt, Germany) by centrifugation to a final volume of ~15 mL. Lytic phages were isolated with the double agar method (0.5% low-melt top agar) [34] using the prepared seawater concentrate and the bacterial host grown to log phase (OD600 = 0.25) in MB. Each plaque was then cored, plaque-purified three times and resuspended in 500 µL of sterile modified sodium magnesium (MSM) buffer (450 mM NaCl, 102 mM MgSO4, 50 mM Tris Base, pH 8). The purified phage was propagated on S. fidelis 3313 lawns on MA at room temperature. The resulting lysate was filtered through a 0.22 µm pore size filter and stored in MSM buffer at 4 ◦C. To estimate phage–host growth dynamics including the latent period and burst size, a one-step infection curve was performed according to Hyman and Abedon [35], with slight modifications. Latent period is defined as the period between the adsorption time and the initial phage lysis of the bacterial culture, prior to any significant rise in phage particles [35]. For this procedure, a 10 min adsorption step at a multiplicity of infection (MOI) of 1 was followed by centrifugation at 13,000× g for 30 s to pellet the bacteria with adsorbed phages. The pellet was then resuspended in 1 mL of sterile MB. Triplicate samples were taken at 10 min intervals for up to 2 h and directly plated using the double agar method to determine phage titer. Additionally, burst size was measured as the ratio of final phage particles to the number of bacterial cells at the onset of phage exposure. A portion of the lysate was further purified via cesium chloride (CsCl) gradient ultracentrifugation [36] for morphological analysis by transmission electron microscopy (TEM) using an Hitachi 7100 (Hitachi Ltd., Tokyo, Japan). The purified virus particles were prepared for imaging on a formvar grid (Electron Microscopy Sciences, Hatfield, PA, USA) using a negative stain with 2% uranyl acetate, as described previously [37]. Images were captured using an Orius SC600 bottom mount camera (Gatan Inc., Pleasanton, CA, USA) at 100 kV. A separate aliquot of this purified viral suspension was reserved for DNA extraction using the QIAmp MinElute Virus Spin Kit (Qiagen Inc., Valencia, CA, USA) and for sequencing, as described below.

2.3. DNA Extraction, Sequencing and Analysis Shewanella fidelis 3313 was cultured in MB overnight at 20 ◦C with shaking at 90 RPM, and its lytic phage was propagated and purified as described above. Bacterial DNA was extracted using the PowerSoil DNA Kit (MoBio Laboratories, Carlsbad, CA, USA) as described above. All viral DNA was amplified using a GenomiPhi V2 DNA amplification kit (GE Healthcare Life Sciences, Pittsburgh, PA, USA) to generate adequate template for sequencing (~1 µg). To minimize bias introduced by the amplification process, three identical reactions were prepared and pooled. Bacterial, phage and prophage DNA were sequenced with the Illumina MiSeq platform generating mate-pair (2 × 250) libraries (Operon, Eurofins MWG Operon LLC, Huntsville, AL, USA). The NuGen UltraLow DNA kit was used (Eurofins, Louisville, KY, USA) to prepare libraries, and DNA quality was assessed on a BioAnalyzer 2100 (Agilent Technologies, Santa Clara, CA, USA), with size selection (400–600 bp) conducted to remove outlier DNA fragments after sonication. The resulting mate-pair reads were assembled using approaches described in Deng et al. [38], first by a de Bruijn graph assembler (Velvet de novo assembler with a k-mer of 35 (phage) and 27 (bacteria) [39]), followed by the default consensus algorithm in Geneious 8.1.7 (Biomatters Ltd, Auckland, New Zealand) [40]. Viral genome open reading frames (ORFs) were identified using Glimmer3 [41] through Geneious 8.1.7; annotations were improved with the BLASTX algorithm against non-redundant protein databases in GenBank, Protein Data Bank (PDB), SwissProt, Protein Information Resource (PIR) and Protein Research Foundation (PRF) via Geneious 8.1.7. All resulting bacterial contigs were uploaded to the Rapid Annotation using Subsystem Technology (RAST) server [42,43] under sample ID mgs422948, with full annotations based on the SEED Database. All contigs passed Metagenomics (MG)-RAST quality control and all predicted proteins were annotated. The complete 16S rRNA gene of S. fidelis 3313 was compared via PHYML maximum likelihood trees to other described Shewanella species in the GenBank database (Figure S1). The closest species was determined to be Shewanella fidelis (ATCC BAA-318; GenBank ID: 17801). All assembled contigs greater than 1500 bp (a total of 24) were Viruses 2017, 9, 60 4 of 16 compared to this nearest neighbor to determine average nucleotide identity (ANI) of the entire genome using the ANI calculator [44]. Genomes with ANI values above 95% are considered to belong to the same species [45].

2.4. Prophage Induction and Identification Prophage regions were identified and annotated by screening all bacterial contigs using the VirSorter pipeline [46]. To determine if S. fidelis 3313 possessed any inducible prophages, mitomycin C was introduced to an early log-phase culture (OD600 of 0.025) at a final concentration of 1 µg/mL and incubated for 24 h [47]. The resulting culture, along with an untreated control culture, was then stained with SYBR Gold nucleic acid stain and induced phage particles were enumerated using epifluorescence microscopy, as described previously in Patel et al. [48]. Induced phage particles were then CsCl-purified and treated with 2U of DNase I Turbo (Invitrogen, Carlsbad, CA, USA), before DNA was extracted using the QIAmp MinElute Virus Spin Kit (Qiagen Inc.). Mate-pair (2 × 250) libraries were produced using the NuGen UltraLow DNA kit, quality controlled with the BioAnalyzer as previously stated (Operon, Eurofins MWG Operon LLC), and sequenced on the Illumina MiSeq platform. Reads were then mapped back to the assembled S. fidelis 3313 genome utilizing the Geneious 8.1.7 software, with default parameters to determine which of the predicted prophages were induced. Additionally, TEM analysis of the CsCl-purified induced prophage fraction was performed as described above.

2.5. Biofilm Assays Single colonies of S. fidelis 3313 were grown in MB at 20 ◦C overnight with shaking at 90 RPM. Concentration was estimated by optical density at OD600 based on previously-calibrated growth curves and colony forming units (data not shown). For biofilm assays, stationary cultures were diluted to a 6 −1 6 final concentration of 10 cells mL (early log phase OD600 of 0.025), and phages were added at 10 plaque forming units (PFUs) mL−1 immediately before plating. All bacterial treatments and controls were plated on 12-well plates (Thermo Scientific, Waltham, MA, USA) in triplicate; bacteria were also plated in duplicate on 35 mm glass bottom dishes (No. 1.5, uncoated; MatTek Corporation, Ashland, MA, USA) for extracellular DNA detection using the TOTO-1 Iodide 514/533 stain (Molecular Probes, Invitrogen) and counterstained for live cells using SYTO60 red (Molecular Probes, Invitrogen) [49]. Additionally, purified salmon sperm DNA (Invitrogen) was added to separate cultures at a final volume of 300 ng mL−1. All stationary culture dishes were incubated at 20 ◦C for up to two days to allow biofilm formation, before excess liquid and planktonic bacteria were removed by gentle pipetting. To quantify biofilm formation, culture dishes were allowed to dry, and then subsequently stained with a 0.1% crystal violet solution for 10 min, as per Merritt et al. [50]. Crystal violet was removed by decanting, and the dishes were washed twice with distilled water to remove excess stain and then allowed to dry completely. The dried crystal violet was resuspended in 30% acetic acid for ~10 min, and the OD590 was determined for each culture dish [50]. At each time point, biofilms in the 12-well dishes and one of the MatTek dishes at 24 h (when the difference was the most drastic) were treated with 2U of DNase I Turbo (Invitrogen), for 10 min at 37 ◦C. Both dishes for fluorescent microscopy staining were then washed once with 1× PBS before TOTO-1 staining for 10 min. Excess dye was then removed and the biofilm washed twice in 1× PBS before counterstaining with SYTO60 for 10 min. Excess dye was removed, washed once in 1× PBS and held in 1× PBS for imaging of 10 random fields using the Leica Application Suite (Leica Microsystems, Wetzlar, Germany) and the Metamorph version 7.5 software (Molecular Devices, LLC, Sunnyvale, CA, USA), using consistent exposure, aperture, and magnification settings. Images were exported as TIF files from Metamorph (Molecular Devices) and imported into ImageJ 1.48v [51]. Without any additional enhancements, the channels were separated, thresholds permanently set, signal intensity was averaged and standard deviations determined over the area selected. Viruses 2017, 9, 60 5 of 16

3. Results

3.1. Bacterial Cultivation and Genome Sequencing The 16S rRNA gene of S. fidelis 3313 is identical to the V3-V4 region of a core operational Viruses 2017, 9, 60 5 of 16 taxonomic unit (OTU) described previously from the Ciona gut [4]; members of the core microbiome likelylikely are are of of functional functional relevance relevance withinwithin thethe host,host, perhaps provisioning provisioning nutrients nutrients or or essential essential elements,elements, or contributingor contributing to the establishmentto the establishment of gut-associated of gut bacterial‐associated communities. bacterial Next-generationcommunities. sequencingNext‐generation of the S. sequencing fidelis 3313 of genome the S. fidelis resulted 3313 ingenome 5,940,000 resulted reads in which 5,940,000 assembled reads which into 129assembled scaffolds (Ninto50 = 129 937,903), scaffolds with (N an50 = average 937,903), coverage with an average of 527× coverageand a mean of 527× guanine-cytosine and a mean guanine (GC) content‐cytosine of (GC) 43.3%. Collectively,content of 43.3%. these scaffolds Collectively, contained these scaffolds 3,536 predicted contained ORFs, 3,536 all predicted of which ORFs, could all be of annotated which could through be at leastannotated one of through the four at MG-RAST least one of protein the four databases MG‐RAST [42 protein,43]. Pairwise databases sequence [42,43]. identity Pairwise comparisons sequence andidentity nearest comparisons neighbor analyses and nearest suggest neighbor that isolate analyses 3313 suggest from thethatCiona isolategut 3313 is related from the most Ciona closely gut is to a partially-sequencedrelated most closelyS. to fidelis a partiallyspecies‐sequenced previously S. fidelis isolated species from previously sediments isolated and seawater from sediments in the and South Chinaseawater Sea [ 52in ].the The South near-full-length China Sea [52]. 16S The rRNA near gene‐full‐length of the 16SS. fidelis rRNA3313 gene isolate of the is S. 99% fidelis identical 3313 isolate to this previously-describedis 99% identical to thisS. fidelis previously(Figure‐described S1), and S. was fidelis deposited (Figure separatelyS1), and was into deposited GenBank separately (ID: KY696838); into however,GenBank the (ID: assembled KY696838) genomic; however, contigs the revealassembled an averagegenomic overall contigs nucleotide reveal an identityaverage ofoverall 97.35% (Figurenucleotide S2), making identity isolate of 97.35% 3313 (Figure a novel S2), strain making of Shewanella isolate 3313 fidelis a[ 45novel,53]. strain of Shewanella fidelis [45,53]. 3.2. Prophage Induction and Genome Sequencing 3.2. Prophage Induction and Genome Sequencing VirSorter screening of the S. fidelis 3313 assembled genome revealed the presence of at least three VirSorter screening of the S. fidelis 3313 assembled genome revealed the presence of at least three genetic loci with sequence similarities to previously-described prophages. To determine if S. fidelis 3313 genetic loci with sequence similarities to previously‐described prophages. To determine if S. fidelis possessed inducible prophages, cultures in early log phase (OD600 = 0.025) were treated overnight with 3313 possessed inducible prophages, cultures in early log phase (OD600 = 0.025) were treated mitomycin C, a commonly-used mutagen for prophage induction; the resulting virus-like particles overnight with mitomycin C, a commonly‐used mutagen for prophage induction; the resulting (VLPs) were enumerated via epifluorescence microscopy (Figure1). Mitomycin C induction resulted virus‐like particles (VLPs) were enumerated via epifluorescence microscopy (Figure 1). Mitomycin C ininduction an increase resulted in VLPs in an (Figure increase1A), in concurrent VLPs (Figure with 1A), a concurrent decrease in with culture a decrease turbidity in culture as measured turbidity by opticalas measured density by (Figure optical1B). density (Figure 1B).

A B 1.4 1.0E+08 1.2 1.0E+06 1.0 0.8 600 1.0E+04

OD 0.6 VLPs/mL 0.4 1.0E+02 0.2 1.0E+00 0.0 Control Mitomycin C Control Mitomycin C Treated Treated

FigureFigure 1. 1.(A ()A Viral-like) Viral‐like particles particles (VLPs) (VLPs) enumerated enumerated via via epifluorescence epifluorescence microscopymicroscopy after mitomycin C C induction of Shewanella fidelis 3313. (B) Bacterial turbidity measured at OD600. All measurements induction of Shewanella fidelis 3313. (B) Bacterial turbidity measured at OD600. All measurements were were recorded at 24 h after treatment. recorded at 24 h after treatment. Imaging of the same supernatant after cesium chloride (CsCl)‐purification by transmission electronImaging microscopy of the same (TEM) supernatant confirmed two after morphologies cesium chloride of intact (CsCl)-purification phage particles (Figure by transmission 2). The electronDNA of microscopy these purified (TEM) phage confirmed particles two was morphologies then sequenced of and intact mapped phage to particles the S. fidelis (Figure 33132). genome, The DNA ofverifying these purified that they phage represent particles two wasintact then and sequencedactive prophage and elements. mapped toThe the firstS. prophage, fidelis 3313 detected genome, verifyingin contig that 6, spans they represent19,321 bp twoand is intact predicted and active to encode prophage 31 genes. elements. This prophage, The first hereby prophage, referred detected to as in contigSFPat, 6, encodes spans 19,321 mostly bp hypothetical and is predicted proteins. to The encode second 31 prophage, genes. This hereby prophage, referred hereby to SFMu1, referred was to asdetected SFPat, encodes in contig mostly 7, spans hypothetical 45,796 bp, and proteins. is predicted The second to encode prophage, 57 genes. hereby Phage referredSFMu1 possesses to SFMu1, several Mu‐like gene elements described previously in a number of Gram‐negative bacteria, including Shewanella oneidensis [54]. Annotations of predicted ORFs corresponding to each of these elements are outlined in Supplementary Materials Tables S1–S2.

Viruses 2017, 9, 60 6 of 16 was detected in contig 7, spans 45,796 bp, and is predicted to encode 57 genes. Phage SFMu1 possesses several Mu-like gene elements described previously in a number of Gram-negative bacteria, including Shewanella oneidensis [54]. Annotations of predicted ORFs corresponding to each of these elementsVirusesViruses are 2017, 2017, outlined 9,9, 6060 in Supplementary Materials Tables S1–S2. 6 of6 of 16 16

Figure 2. Representative transmission electron microscopy (TEM) images of mitomycin C‐induced Figure 2. Representative transmission electron microscopy (TEM) images of mitomycin C‐induced Figurephages 2. Representative recovered from transmission the supernatant electron of S. fidelis microscopy 3313. (TEM) images of mitomycin C-induced phages recovered from the supernatant of S. fidelis 3313. phages recovered from the supernatant of S. fidelis 3313. 3.3. Lytic Phage Isolation and Genome Sequencing 3.3. Lytic Phage Isolation and Genome Sequencing 3.3. Lytic PhageTo identify Isolation phages and Genomecapable of Sequencing lytic infection of S. fidelis 3313, water from the collection site (alsoTo used identify in shipping phages live capable animals) of was lytic sequentially infection offiltered, S. fidelis concentrated, 3313, water and from screened the collection by standard site To identify phages capable of lytic infection of S. fidelis 3313, water from the collection site (alsoplaque used assays. in shipping A candidate live animals) lytic phage was sequentially was identified, filtered, amplified, concentrated, purified, and and screened sequenced. by standard The (alsoplaque usedS. fidelis in assays. shipping3313 lytic A candidatephage, live animals) named lytic SFCi1, wasphage sequentially has was a circular,identified, filtered, double amplified,‐ concentrated,stranded purified, DNA andgenome and screened sequenced. consisting by standard Theof plaqueS.42,279 assays.fidelis bp 3313 (38,089× A candidatelytic phage,genome lytic named coverage), phage SFCi1, was and has identified,a GC a circular, content amplified, doubleof 59.1%‐stranded (Figure purified, 3). DNA and genome sequenced. consisting The S. of fidelis 331342,279 lytic phage, bp (38,089× named genome SFCi1, coverage), has a circular, and a GC double-stranded content of 59.1% DNA(Figure genome 3). consisting of 42,279 bp (38,089× genome coverage), and a GC content of 59.1% (Figure3).

Figure 3. (A) Circular genome of lytic phage SFCi1 depicts 40 open reading frames (ORFs). (B) Mauve alignmentFigure of 3. the(A) Circular SFCi1 genome genome againstof lytic phage two mostSFCi1 closelydepicts 40 related open reading phage frames genomes, (ORFs). VP16C (B) Mauve and VP16T. alignment of the SFCi1 genome against two most closely related phage genomes, VP16C and VP16T. ColoredFigure boxes 3. (A indicate) Circular sequencegenome of lytic blocks phage with SFCi1 shared depicts sequence 40 open reading identity; frames regions (ORFs). lacking (B) Mauve sequence Colored boxes indicate sequence blocks with shared sequence identity; regions lacking sequence homologyalignment are indicatedof the SFCi1 in genome white. against two most closely related phage genomes, VP16C and VP16T. homology are indicated in white. Colored boxes indicate sequence blocks with shared sequence identity; regions lacking sequence homology are indicated in white.

Viruses 2017, 9, 60 7 of 16 Viruses 2017, 9, 60 7 of 16 Viruses 2017, 9, 60 7 of 16

TheThe assembled assembled genome genome is predicted is predicted to possess to possess 40 ORFs, 40 summarizedORFs, summarized in Supplementary in Supplementary Materials The assembled genome is predicted to possess 40 ORFs, summarized in Supplementary TableMaterials S3. The Table infection S3. The curve infection generated curve by generated the SFCi1 by phage the SFCi1 revealed phage a revealed decline ina decline optical in density optical of Materials Table S3. The infection curve generated by the SFCi1 phage revealed a decline in optical thedensityS. ﬁdelis of3313 the S. culture fidelis 3313 within culture one-hour within post-infection one‐hour post (approximate‐infection (approximate latent period), latent withperiod), complete with density of the S. fidelis 3313 culture within one‐hour post‐infection (approximate latent period), with culturecomplete lysis culture by 4 h (Figure lysis by4 4). h Additionally, (Figure 4). Additionally, the average the burst average size was burst calculated size was calculated to be 62. to be 62. complete culture lysis by 4 h (Figure 4). Additionally, the average burst size was calculated to be 62.

Figure 4. One‐step growth curve of lytic phage SFCi1 with its host, S. fidelis 3313, as determined by FigureFigure 4. 4.One-step One‐step growth growth curve curve ofof lyticlytic phage SFCi1 with with its its host, host, S.S. fidelis ﬁdelis 3313,3313, as as determined determined by by plaque forming units (PFUs) and bacterial turbidity measurements (OD600). plaqueplaque forming forming units units (PFUs) (PFUs) and and bacterial bacterial turbidityturbidity measurements (OD (OD600600). ).

Figure 5. (A) TEM image of a pure culture of lytic phage, SFCi1, indicates that it is a myophage. FigureFigure 5. 5.( A(A)) TEM TEM image image ofof aa purepure cultureculture of lytic lytic phage, phage, SFCi1, SFCi1, indicates indicates that that it is it isa myophage. a myophage; (B) Magnified image of a single viral particle outlining the icosahedral head and details of the (B)(B Magniﬁed) Magnified image image of aof single a single viral viral particle particle outlining outlining the icosahedral the icosahedral head andhead details and ofdetails the contractile of the contractile tail and baseplate. tailcontractile and baseplate. tail and baseplate. Morphological analysis via TEM suggests that SFCi1 belongs to the Myoviridae family [55], with Morphological analysis via TEM suggests that SFCi1 belongs to the Myoviridae family [55], with a capsid diameter of approximately 70 nm (StDev: 7.4 nm), and a tail length of approximately 120 nm a capsidMorphological diameter of analysis approximately via TEM 70 suggests nm (StDev: that 7.4 SFCi1 nm), belongs and a tail to length the Myoviridae of approximatelyfamily [55 120], withnm a (StDev: 5.5 nm) (Figure 5). Members of this family possess a contractile tail through which DNA is capsid(StDev: diameter 5.5 nm) of (Figure approximately 5). Members 70 nmof this (StDev: family 7.4 possess nm), and a contractile a tail length tail ofthrough approximately which DNA 120 is nm

Viruses 2017, 9, 60 8 of 16

(StDev:Viruses 5.52017, nm) 9, 60 (Figure5). Members of this family possess a contractile tail through which8 DNA of 16 is inserted into the bacterial cell after degradation of surface structures by lysozyme, an enzyme alsoinserted encoded into in the the bacterial SFCi1 genome. cell after Phagedegradation SFCi1 of shares surface the structures greatest by sequence lysozyme, similarity an enzyme with also two siphophagesencoded in (VP16C the SFCi1 and genome. VP16T) Phage isolated SFCi1 from shares San Diego the greatest that infect sequenceVibrio similarity parahaemolyticus with two[56 ]. However,siphophages SFCi1 (VP16C is unable and to VP16T) infect isolated the Vibrio from parahaemolyticus San Diego thathost infect of Vibrio VP16C/T parahaemolyticus (data not shown). [56]. FigureHowever,3, which SFCi1 depicts is unable the regions to infect of nucleotide the Vibrio identityparahaemolyticus between host the three of VP16C/T phage genomes (data not via shown). Mauve alignmentFigure 3, [57 which], reveals depicts substantial the regions syntenic of nucleotide regions. identity It is notable between that the the three genes phage encoding genomes the tail via of Mauve alignment [57], reveals substantial syntenic regions. It is notable that the genes encoding the SFCi1 are more similar to that of Vibrio phage H188, a recently discovered myophage from the Yellow tail of SFCi1 are more similar to that of Vibrio phage H188, a recently discovered myophage from the Sea [58]. The tail proteins characteristic of myophages generally allow for a broader host range than Yellow Sea [58]. The tail proteins characteristic of myophages generally allow for a broader host range that seen for siphophages [59]. The SFCi1 phage genome was also placed onto the phage proteomic than that seen for siphophages [59]. The SFCi1 phage genome was also placed onto the phage tree [60], which approximated the closest viral relatives as VP16T/C (Figure S3). proteomic tree [60], which approximated the closest viral relatives as VP16T/C (Figure S3). 3.4. Similarity to Vibrio Phages 3.4. Similarity to Vibrio Phages Because phages utilize host machinery for protein translation during replication, their codon Because phages utilize host machinery for protein translation during replication, their codon usageusage tends tends to to evolve evolve towardstowards that that of of the the host host genome genome [61]. [ 61The]. codon The codon adaptation adaptation index (CAI), index which (CAI), whichis expected is expected to increase to increase upon phage–host upon phage–host coevolution, coevolution, was higher wasbetween higher S. fidelis between 3313 andS. ﬁdelis the three3313 andphages the three examined phages (SFCi1 examined (0.753), (SFCi1 VP16C (0.753), (0.747), VP16C and (0.747), VP16T and (0.758)), VP16T (0.758)),than between than betweenVibrio Vibrioparahaemolyticus parahaemolyticus (RIMD(RIMD 2210633) 2210633) and those and phages those phages (SFCi1 (0.624), (SFCi1 VP16C (0.624), (0.607), VP16C and (0.607), VP16T and (0.604)). VP16T (0.604)).No tRNAs No tRNAs were detected were detected in the SFCi1 in the phage SFCi1 genome phage genome that could that independently could independently influence inﬂuence the codon the codonusage usage bias bias[62]. [62].

3.5.3.5. Biofilm Biofilm Development Development In vitroIn vitro,, the the addition addition of of lytic lytic phage phage SFCi1 SFCi1 intointo purepure static cultures cultures of of S.S. fidelis fidelis 33133313 caused caused an an increaseincrease in biofilmin biofilm formation, formation, beginning beginning at 8at h 8 post h post addition, addition, and and led led to ato more a more robust robust biofilm biofilm by by 24 h, as detected24 h, as detected by crystal by violetcrystal staining violet staining of adherent of adherent biofilm biofilm structures structures (Figure (Figure6). 6).

Figure 6. Development of a biofilm by S. fidelis over 48 h in stationary culture, as measured by crystal Figure 6. Development of a biofilm by S. fidelis over 48 h in stationary culture, as measured by crystal violet staining of the biofilm, in the presence (Phage) and absence (Control) of lytic phage SFCi1 violet staining of the biofilm, in the presence (Phage) and absence (Control) of lytic phage SFCi1 and/or and/or DNase I treatment. DNase I treatment. Similar effects on biofilm formation could be achieved with the inclusion of foreign DNA, such asSimilar salmon effects sperm on DNA, biofilm into formation the cultures could (data be achieved not shown). with When the inclusion DNase ofI was foreign added DNA, to suchstatic as salmoncultures, sperm whether DNA, intoor not the culturesexposed (datato lytic not phages, shown). biofilm When DNase density I wasdecreased. added toThis static suggests cultures, whetherextracellular or not DNA exposed is an to important lytic phages, structural biofilm component density decreased. of the S. fidelis This 3313 suggests biofilms, extracellular seemingly as DNA a is anresult important of cell lysis. structural The extracellular component DNA of the wasS. fidelis quantified3313 biofilms,by measuring seemingly fluorescent as a result signal of (TOTO cell lysis.‐1 TheIodide extracellular 514/533 DNAstain, Molecular was quantified Probes), by and measuring determining fluorescent the percent signal area (TOTO-1 coverage Iodide represented 514/533 by the labeled extracellular DNA signal. Fluorescent microscopy images depicted an increase in

Viruses 2017, 9, 60 9 of 16 stain, Molecular Probes), and determining the percent area coverage represented by the labeled Viruses 2017, 9, 60 9 of 16 extracellular DNA signal. Fluorescent microscopy images depicted an increase in free extracellular DNA (80.96% ± 7.9% pixel area coverage) within the biofilm-rich cultures that include phage SFCi1 free extracellular DNA (80.96% ± 7.9% pixel area coverage) within the biofilm‐rich cultures that ± (Figureinclude7). phage Control SFCi1 cultures (Figure also 7). revealed Control cultures the presence also revealed of extracellular the presence DNA of (30.23% extracellular5.1% DNA pixel area(30.23% coverage), ± 5.1% suggesting pixel area that coverage), lysis by suggesting spontaneous that prophage lysis by spontaneous induction as prophage shown in induction controls in Figureas shown1) may in controls play a in role Figure in natural 1) may play biofilm a role formation in natural biofilm by this formation strain. Treatment by this strain. with Treatment DNase I resultedwith DNase in the I resulted depletion in ofthe extracellular depletion of extracellular DNA from DNA both thefrom control both the (0.754% control± (0.754%0.01% ±area) 0.01% and phagearea) SFCi1 and phage (0.772% SFCi1± 0.017% (0.772%area) ± 0.017% cultures. area) However, cultures. However, DNase I alone DNase was I alone not capable was not of capable completely of eliminatingcompletely detectable eliminating biofilms, detectable suggesting biofilms, that suggesting extracellular that DNAextracellular is not theDNA only is requirementnot the only for biofilmrequirement formation. for biofilm formation.

3.6.3.6. GenBank GenBank Accession Accession Numbers Numbers ShewanellaShewanella fidelis fidelis3313 3313 SFCi1 SFCi1 virusvirus waswas submitted to to GenBank GenBank under under the the Accession Accession ID ID number number KX196154.KX196154. The TheShewanella Shewanella fidelisfidelis 3313 16S rDNA gene gene has has been been submitted submitted to to GenBank GenBank under under the the AccessionAccession ID ID number number KY696838. KY696838. TheThe Shewanella fidelis fidelis 33133313 draft draft genome genome is isavailable available in inMG MG-RAST‐RAST underunder sample sample ID ID mgs422948. mgs422948.

FigureFigure 7. 7.TOTO-1 TOTO‐1 Iodide Iodide 514/533514/533 stain stain and and SYTO60 SYTO60 red red counterstain counterstain reveals reveals extracellular extracellular DNA DNA as a as major component of the stationary culture biofilm. (A) Untreated S. fidelis 3313 control culture (30.23% a major component of the stationary culture biofilm. (A) Untreated S. fidelis 3313 control culture ± 5.1% pixel area coverage); (B) S. fidelis 3313 exposed to SFCi1 lytic phage (80.96% ± 7.9% area); (30.23% ± 5.1% pixel area coverage); (B) S. fidelis 3313 exposed to SFCi1 lytic phage (80.96% ± 7.9% (C) control culture treated with DNase I (0.754% ± 0.01% area); and (D) lytic‐phage treated culture area); (C) control culture treated with DNase I (0.754% ± 0.01% area); and (D) lytic-phage treated co‐treated with DNase I (0.772% ± 0.017% area). culture co-treated with DNase I (0.772% ± 0.017% area). 4. Discussion 4. Discussion Despite being surrounded by abundant and diverse microbes, filter‐feeding sessile aquatic invertebratesDespite being maintain surrounded stable and by often abundant species and‐specific diverse resident microbes, microbial filter-feeding communities sessile (i.e., aquaticcore invertebratesmicrobiomes) maintain [3–5]. A stable stable and microbiome often species-specific can contribute resident gene products microbial of communitiesfunctional relevance, (i.e., core influencing metabolic pathways and nutrient acquisition [63]. Ciona intestinalis is a marine protochordate with a fully sequenced genome that is being developed for gut microbiome studies

Viruses 2017, 9, 60 10 of 16 microbiomes) [3–5]. A stable microbiome can contribute gene products of functional relevance, influencing metabolic pathways and nutrient acquisition [63]. Ciona intestinalis is a marine protochordate with a fully sequenced genome that is being developed for gut microbiome studies utilizing germ-free mariculture [64]; recent evidence also indicates the presence of a core microbiome [4]. Culturing members of the Ciona gut microbiome, along with corresponding lytic phages, is a first step in designing experimental approaches to study the processes governing bacterial colonization of mucosal surfaces. Mono-association studies in Ciona (e.g., with S. fidelis 3313) could provide key insights into host-bacterial interactions at the onset of colonization in naïve tissue surfaces. Furthermore, investigations of mixed community colonization could reveal patterns of succession that are influenced by the activity of phages, along with other external and host-derived factors [65–67]. The establishment and maintenance of homeostasis between a host and its gut microbiome is an exceedingly complex, multifaceted process, likely to be influenced by many parameters, including external factors (e.g., nutrient availability, other microbes and microbial products), viruses that infect these microbes (i.e., phages), and host factors (e.g., mucus, immunity). The abundance, ubiquity, and high genetic diversity of phages, together with their roles in shaping bacterial communities and their influences on horizontal gene transfer [2,68–70], suggest that phages are highly influential members of complex microbial communities [71]. Filter-feeding invertebrates come into contact with a continuous assortment of microbes and free phages, which have the potential to profoundly alter community dynamics in established microbiomes. In addition to the free phages in seawater (~107 phages per milliliter [2]), most marine bacterial species have been documented to possess stable and active prophages (i.e., phages integrated into bacterial genomes) [22]. While an increasing number of studies are examining the diversity and variability of phages within microbiomes [72–75], little is known about how these phages influence microbiomes and their role(s) in homeostasis. In the S. fidelis 3313 draft genome assembly, a total of three prophage regions were identified by VirSorter. Activity of two of these prophages was confirmed experimentally through the identification and sequencing of intact viral particles after induction of live cultures with the mutagen mitomycin C. Prophage SFPat (from contig 6) consists largely of hypothetical proteins. However, prophage SFMu1 (from contig 7) possesses genes more similar to those in public databases, facilitating annotation. For example, the Mu-like phages replicate via DNA transposition, and have evolved genes such as a cis-acting transposition enhancer and a centrally-located strong gyrase binding site [76], genes that also are present in SFMu1. From the animal’s surrounding seawater, this study also identified a lytic phage, SFCi1, which infects S. fidelis 3313. Placement of the SFCi1 genome on the phage proteomic tree identified the Vibrio phages VP16T and VP16C as the closest relatives. Genome comparisons of SFCi1 to all other known Shewanella phages indicated little to no similarity (data not shown), and with less than 95% ANI to any other phage, SFCi1 represents a new phage species. Codon usage assessments suggest that SFCi1 may have infected Shewanella long before it encountered and/or infected Vibrio parahaemolyticus, which is consistent with previous observations that VP16C/T only recently infected V. parahaemolyticus [56]. Both Shewanella and Vibrio species are abundant in the marine water column, and horizontal gene transfer between the two bacterial families has been described [77]. Genetic exchange between the VP16C/T phages and phage SFCi1 could represent similar examples. Previous studies have suggested that phages may influences bacterial competition in the environment [78], a phenomenon that likely also affects gut ecosystem dynamics. Activated prophages are known to influence biofilms by facilitating the transient liberation of extracellular DNA, which can then become a component of the biofilm matrix [21,31]. Biofilms can shelter microbial inhabitants from both physical and mechanical stressors, and consist mostly of microbially-derived polysaccharides, nucleic acids and lipids. Extracellular DNA has been shown to be an important component of biofilms in several species [79]. While the extracellular DNA is often composed of chromosomal DNA from the biofilm-producing bacteria [80], foreign extracellular DNA can similarly influence Viruses 2017, 9, 60 11 of 16 the growth and maturation of biofilms, suggesting that the origin of the DNA is less important than the structural support it lends [81]. Several sources of extracellular DNA within biofilms have been identified, including release in response to quorum sensing [82–84], autolysis [85], and prophage induction [21,30,86]. However, additional methods of extracellular DNA release by external factors such as lytic phages and host products (e.g., immune molecules, mucus) have yet to be elucidated in the context of biofilm formation. Previously, Vibrio anguillarum phages have been shown to have different influences on biofilm formation over long-term cultures, due mostly to varied microcolony morphologies with one strain having flat single layers (BA35), and the other forming complex 3D structures (PF430-3) [87]. This structural distinction resulted in differential penetrability of the biofilm structure by phages during the initial stages of biofilm formation, and ultimately impeded the formation of the BA35 single layer biofilm compared to the control. Phage infection of BA35 resulted in a large percentage of resistant mutants (~70% of isolated cells); however, PF430-3 formed more complex 3D structures in the presence of its lytic phage, resulting in fewer resistant mutants. This result suggested that aggregation within these structures could be reducing phage adsorption [87]. The phage particles appeared to be trapped within the aggregate matrix, a complex consortia of extracellular polymeric substances of unknown composition that seemingly provided physical protection against phage infection; the mechanism for this differential aggregation phenotype has yet to be elucidated. Lytic phage infection has also been shown to influence biofilm formation in Pseudomonas aeruginosa, Salmonella enterica and Staphylococcus aureus, with different outcomes in each bacteria-phage system; S. aureus was the only system where biofilm formation was enhanced [88], with S. aureus thought to transition to the biofilm phenotype as a means of physiological protection from phage infection. Enhanced formation of biofilms took place at early time points, with treated cultures returning to control levels over time, likely as a result of early biofilm dispersal. Although not investigated, the authors suggested that extracellular DNA released by lytic phage infection likely played a role in biofilm development [88]. The current study adds to this growing body of evidence regarding phage influence on biofilm formation, by demonstrating that lytic phage SFCi1 infection can similarly enhance biofilm formation in vitro by S. fidelis 3313. Fluorescence imaging shows that extracellular DNA is much more prominent in SFCi1 phage-exposed, biofilm-rich, cultures of S. fidelis 3313. The presence of some extracellular DNA in control cultures is consistent with spontaneous prophage induction. Treatment of phage-infected cultures with DNase I reduces biofilms, indicating that extracellular DNA is likely a major structural component of these biofilms. As seen for prophage induction, lytic phage dynamics can influence biofilm formation through the release of extracellular DNA. Additional mechanisms of biofilm enhancement have been described and include the generation of phage resistant mutants [89], quorum sensing [90], and the “wall effect”, whereby two subpopulations of the same strain co-exist with one protecting the other [91]. Whether any or all of these mechanisms are also involved in the phage-related biofilm increase described in S. fidelis 3313 remains to be demonstrated. Among mucus-rich tissues, it has also been suggested that lytic phages can directly associate with mucus, a process that appears to influence selection of microbiota and/or help protect against certain pathogens [92]. However, the role of these phages at the gut mucus interface in vivo, and the ability of phages to infiltrate established biofilms and modify community structure, is not yet clear. Biofilms derived from distinct bacterial species, and sometimes composed from mixed communities, can demonstrate unique physical and chemical compositions of exopolysaccharides that exert distinct influences on phages [24,93]. Once phages become integrated into biofilms, some can be rapidly incorporated into the bacterial genome as prophages and lie dormant, making the bacterium a reservoir of future phage particles [94]. A variety of effectors can influence the induction of prophages. For example, viral excision from bacterial genomes in response to environmental stress has been implicated in biofilm restructuring and dispersal [31,86,95]. Since a large number of bacteria within the gut contain prophages, their induction likely imposes a significant restructuring of the associated Viruses 2017, 9, 60 12 of 16 microbial communities in response to host and environmental factors. However, natural triggers for prophage induction among members of mucus-associated microbiomes remain to be defined. Phage manipulation of host mucosal epithelium-associated biofilms contributes to an already complex relationship between the host and its associated microbiome [96,97]. Characterizing members of the gut microbial community and their potential interactions is essential to understanding their influence on host health, and the establishment and maintenance of homeostasis. Deciphering these complex interactions is aided by carefully-designed in vitro and in vivo studies that enable careful control and observation of the dialogue between host immune factors and various members of the microbiome (including phages). Because bacteria in a biofilm often are recalcitrant to interventional therapies, dissection of the processes modulating the development and dispersal of biofilms in vivo within a natural host may aid in the development of new therapeutic approaches.

Supplementary Materials: The following are available online at www.mdpi.com/1999-4915/9/3/60/s1, Figure S1: A PHYML-based tree (100 bootstrap replicates; 70% stringency) of Shewanella sp. 16S rRNA gene comparisons. Figure S2: Average nucleotide identity (ANI) comparison between the S. fidelis ATCC genome (GI:655363240) and S. fidelis 3313 as determined by the ANI Calculator (http://enve-omics.ce.gatech.edu/ani/); Figure S3: S. fidelis SFCi1 phage placement on phage proteomic tree. Table S1: ORF table for SFPat prophage; Table S2: ORF table for SFMu1 prophage; Table S3: ORF table for SFCi1 lytic phage. Acknowledgments: These studies were supported by grant IOS-1456301 from the National Science Foundation to L.J.D. and M.B. and by a National Science Foundation Graduate Research Fellowship (Award No. 1144244) to B.A.L. The authors thank Tony Greco, University of South Florida College of Marine Science Electron Microscopy Suite, for assistance in sample imaging and Lauren McDaniel for lending her knowledge and expertise, assistance with flow cytometry, and providing the V. parahaemolyticus strain. The authors would also like to thank Terry F.F. Ng for bioinformatics assistance and Robert Edwards for SFCi1 assessment on the phage proteomic tree. The authors would also like to thank Gary W. Litman for constructive feedback on previous versions of the manuscript. Author Contributions: B.L., J.P.C., M.B. and L.D. conceived and designed the experiments; B.L. and C.K. performed the experiments; B.L., J.P.C., M.B. and L.J.D. analyzed the data; M.B. and L.D. contributed reagents/materials/analysis tools; B.L., M.B. and L.J.D. wrote the paper. All authors read and approved the final manuscript. Conflicts of Interest: The authors declare no conflict of interest.

References

1. Brussow, H.; Hendrix, R.W. Phage genomics: Small is beautiful. Cell 2002, 108, 13–16. [CrossRef] 2. Suttle, C.A. Viruses in the sea. Nature 2005, 437, 356–361. [CrossRef][PubMed] 3. Schmitt, S.; Tsai, P.; Bell, J.; Fromont, J.; Ilan, M.; Lindquist, N.; Perez, T.; Rodrigo, A.; Schupp, P.J.; Vacelet, J.; et al. Assessing the complex sponge microbiota: Core, variable and species-specific bacterial communities in marine sponges. ISME J. 2012, 6, 564–576. [CrossRef][PubMed] 4. Dishaw, L.J.; Flores-Torres, J.; Lax, S.; Gemayel, K.; Leigh, B.; Melillo, D.; Mueller, M.G.; Natale, L.; Zucchetti, I.; De Santis, R.; et al. The gut of geographically disparate Ciona intestinalis harbors a core microbiota. PLoS ONE 2014, 9, e93386. [CrossRef][PubMed] 5. Franzenburg, S.; Walter, J.; Kunzel, S.; Wang, J.; Baines, J.F.; Bosch, T.C.; Fraune, S. Distinct antimicrobial peptide expression determines host species-specific bacterial associations. Proc. Natl. Acad. Sci. USA 2013, 110, E3730–E3738. [CrossRef][PubMed] 6. Kim, D.; Baik, K.S.; Kim, M.S.; Jung, B.M.; Shin, T.S.; Chung, G.H.; Rhee, M.S.; Seong, C.N. Shewanella haliotis sp. Nov., isolated from the gut microflora of abalone, Haliotis discus hannai. Int. J. Syst. Evol. Microbiol. 2007, 57, 2926–2931. [CrossRef][PubMed] 7. Franchini, P.; Fruciano, C.; Frickey, T.; Jones, J.C.; Meyer, A. The gut microbial community of midas cichlid fish in repeatedly evolved limnetic-benthic species pairs. PLoS ONE 2014, 9, e95027. [CrossRef][PubMed] 8. Navarrete, P.; Espejo, R.T.; Romero, J. Molecular analysis of microbiota along the digestive tract of juvenile Atlantic salmon (Salmo salar L.). Microbial Ecol. 2009, 57, 550–561. [CrossRef][PubMed] 9. Li, M.; Yang, H.; Gu, J.D. Phylogenetic diversity and axial distribution of microbes in the intestinal tract of the polychaete Neanthes glandicincta. Microbial Ecol. 2009, 58, 892–902. [CrossRef][PubMed] Viruses 2017, 9, 60 13 of 16

10. Fredrickson, J.K.; Romine, M.F.; Beliaev, A.S.; Auchtung, J.M.; Driscoll, M.E.; Gardner, T.S.; Nealson, K.H.; Osterman, A.L.; Pinchuk, G.; Reed, J.L.; et al. Towards environmental systems biology of Shewanella. Nat. Rev. Microbiol. 2008, 6, 592–603. [CrossRef][PubMed] 11. Hau, H.H.; Gralnick, J.A. Ecology and biotechnology of the genus Shewanella. Ann. Rev. Microbiol. 2007, 61, 237–258. [CrossRef][PubMed] 12. Karpinets, T.V.; Romine, M.F.; Schmoyer, D.D.; Kora, G.H.; Syed, M.H.; Leuze, M.R.; Serres, M.H.; Park, B.H.; Samatova, N.F.; Uberbacher, E.C. Shewanella knowledgebase: Integration of the experimental data and computational predictions suggests a biological role for transcription of intergenic regions. Database 2010, baq012. [CrossRef][PubMed] 13. Ericsson, A.C.; Davis, D.J.; Franklin, C.L.; Hagan, C.E. Exoelectrogenic capacity of host microbiota predicts lymphocyte recruitment to the gut. Physiol. Genomics 2015, 47, 243–252. [CrossRef][PubMed] 14. Caro-Quintero, A.; Deng, J.; Auchtung, J.; Brettar, I.; Hofle, M.G.; Klappenbach, J.; Konstantinidis, K.T. Unprecedented levels of horizontal gene transfer among spatially co-occurring Shewanella bacteria from the Baltic Sea. ISME J. 2011, 5, 131–140. [CrossRef][PubMed] 15. Ong, W.K.; Vu, T.T.; Lovendahl, K.N.; Llull, J.M.; Serres, M.H.; Romine, M.F.; Reed, J.L. Comparisons of Shewanella strains based on genome annotations, modeling, and experiments. BMC Syst. Biol. 2014, 8, 31. [CrossRef][PubMed] 16. Lobo, C.; Moreno-Ventas, X.; Tapia-Paniagua, S.; Rodriguez, C.; Morinigo, M.A.; de La Banda, I.G. Dietary probiotic supplementation (Shewanella putrefaciens Pdp11) modulates gut microbiota and promotes growth and condition in Senegalese sole larviculture. Fish Physiol. Biochem. 2014, 40, 295–309. [CrossRef][PubMed] 17. Luhtanen, A.M.; Eronen-Rasimus, E.; Kaartokallio, H.; Rintala, J.M.; Autio, R.; Roine, E. Isolation and characterization of phage-host systems from the Baltic Sea ice. Extremophiles 2014, 18, 121–130. [CrossRef] [PubMed] 18. Jian, H.; Xiao, X.; Wang, F. Role of filamentous phage SW1 in regulating the lateral flagella of Shewanella piezotolerans strain WP3 at low temperatures. Appl. Environ. Microbiol. 2013, 79, 7101–7109. [CrossRef][PubMed] 19. Han, F.; Li, M.; Lin, H.; Wang, J.; Cao, L.; Khan, M.N. The novel Shewanella putrefaciens-infecting bacteriophage Spp001: Genome sequence and lytic enzymes. J. Ind. Microbiol. Biotechnol. 2014, 41, 1017–1026. [CrossRef] [PubMed] 20. Wang, F.; Wang, F.; Li, Q.; Xiao, X. A novel filamentous phage from the deep-sea bacterium Shewanella piezotolerans WP3 is induced at low temperature. J. Bacteriol. 2007, 189, 7151–7153. [CrossRef] [PubMed] 21. Godeke, J.; Paul, K.; Lassak, J.; Thormann, K.M. Phage-induced lysis enhances biofilm formation in Shewanella oneidensis MR-1. ISME J. 2011, 5, 613–626. [CrossRef][PubMed] 22. Paul, J.H. Prophages in marine bacteria: Dangerous molecular time bombs or the key to survival in the seas? ISME J. 2008, 2, 579–589. [CrossRef][PubMed] 23. Waller, A.S.; Yamada, T.; Kristensen, D.M.; Kultima, J.R.; Sunagawa, S.; Koonin, E.V.; Bork, P. Classification and quantification of bacteriophage taxa in human gut metagenomes. ISME J. 2014, 8, 1391–1402. [CrossRef] [PubMed] 24. Flemming, H.C.; Wingender, J. The biofilm matrix. Nat. Rev. Microbiol. 2010, 8, 623–633. [CrossRef][PubMed] 25. Jefferson, K.K. What drives bacteria to produce a biofilm? FEMS Microbiol. Lett. 2004, 236, 163–173. [CrossRef][PubMed] 26. Tlaskalova-Hogenova, H.; Stepankova, R.; Kozakova, H.; Hudcovic, T.; Vannucci, L.; Tuckova, L.; Rossmann, P.; Hrncir, T.; Kverka, M.; Zakostelska, Z.; et al. The role of gut microbiota (commensal bacteria) and the mucosal barrier in the pathogenesis of inflammatory and autoimmune diseases and cancer: Contribution of germ-free and gnotobiotic animal models of human diseases. Cell Mol. Immunol. 2011, 8, 110–120. [CrossRef][PubMed] 27. Sommer, F.; Backhed, F. The gut microbiota—Masters of host development and physiology. Nat. Rev. Microbiol. 2013, 11, 227–238. [CrossRef][PubMed] 28. Rice, S.A.; Tan, C.H.; Mikkelsen, P.J.; Kung, V.; Woo, J.; Tay, M.; Hauser, A.; McDougald, D.; Webb, J.S.; Kjelleberg, S. The biofilm life cycle and virulence of Pseudomonas aeruginosa are dependent on a filamentous prophage. ISME J. 2009, 3, 271–282. [CrossRef][PubMed] Viruses 2017, 9, 60 14 of 16

29. Wang, X.; Kim, Y.; Ma, Q.; Hong, S.H.; Pokusaeva, K.; Sturino, J.M.; Wood, T.K. Cryptic prophages help bacteria cope with adverse environments. Nat. Commun. 2010, 1, 147. [CrossRef][PubMed] 30. Carrolo, M.; Frias, M.J.; Pinto, F.R.; Melo-Cristino, J.; Ramirez, M. Prophage spontaneous activation promotes DNA release enhancing biofilm formation in Streptococcus pneumoniae. PLoS ONE 2010, 5, e15678. [CrossRef] [PubMed] 31. Binnenkade, L.; Teichmann, L.; Thormann, K.M. Iron triggers lambdaSo prophage induction and release of extracellular DNA in Shewanella oneidensis MR-1 biofilms. Appl. Environ. Microbiol. 2014, 80, 5304–5316. [CrossRef][PubMed] 32. Weisburg, W.G.; Barns, S.M.; Pelletier, D.A.; Lane, D.J. 16s ribosomal DNA amplification for phylogenetic study. J. Bacteriol. 1991, 173, 697–703. [CrossRef][PubMed] 33. Altschul, S.F.; Madden, T.L.; Schäffer, A.A.; Zhang, J.; Zhang, Z.; Miller, W.; Lipman, D.J. Gapped BLAST and PSI-BLAST: A new generation of protein database search programs. Nucleic Acids Res. 1997, 25, 3389–3402. [CrossRef] 34. Adams, M.H. Bacteriophages; Interscience Publishers: New York, NY, USA, 1959; p. 592. 35. Hyman, P.; Abedon, S.T. Practical methods for determining phage growth parameters. Methods Mol. Biol. 2009, 501, 175–202. [PubMed] 36. Thurber, R.V.; Haynes, M.; Breitbart, M.; Wegley, L.; Rohwer, F. Laboratory procedures to generate viral metagenomes. Nat. Protoc. 2009, 4, 470–483. [CrossRef][PubMed] 37. Ackermann, H.-W.; Heldal, M. Basic electron microscopy of aquatic viruses. Man Aquatic Viral Ecol. 2010, 182–192. [CrossRef] 38. Deng, X.; Naccache, S.N.; Ng, T.; Federman, S.; Li, L.; Chiu, C.Y.; Delwart, E.L. An ensemble strategy that significantly improves de novo assembly of microbial genomes from metagenomic next-generation sequencing data. Nucleic Acids Res. 2015, 43, e46. [CrossRef][PubMed] 39. Zerbino, D.R.; Birney, E. Velvet: Algorithms for de novo short read assembly using de Bruijn graphs. Genome Res. 2008, 18, 821–829. [CrossRef][PubMed] 40. Kearse, M.; Moir, R.; Wilson, A.; Stones-Havas, S.; Cheung, M.; Sturrock, S.; Buxton, S.; Cooper, A.; Markowitz, S.; Duran, C.; et al. Geneious basic: An integrated and extendable desktop software platform for the organization and analysis of sequence data. Bioinformatics 2012, 28, 1647–1649. [CrossRef][PubMed] 41. Delcher, A.L.; Bratke, K.A.; Powers, E.C.; Salzberg, S.L. Identifying bacterial genes and endosymbiont DNA with Glimmer. Bioinformatics 2007, 23, 673–679. [CrossRef][PubMed] 42. Aziz, R.K.; Bartels, D.; Best, A.A.; DeJongh, M.; Disz, T.; Edwards, R.A.; Formsma, K.; Gerdes, S.; Glass, E.M.; Kubal, M.; et al. The RAST server: Rapid annotations using subsystems technology. BMC Genomics 2008, 9, 75. [CrossRef][PubMed] 43. Overbeek, R.; Olson, R.; Pusch, G.D.; Olsen, G.J.; Davis, J.J.; Disz, T.; Edwards, R.A.; Gerdes, S.; Parrello, B.; Shukla, M.; et al. The SEED and the rapid annotation of microbial genomes using subsystems technology (RAST). Nucleic Acids Res. 2014, 42, D206–D214. [CrossRef][PubMed] 44. Goris, J.; Konstantinidis, K.T.; Klappenbach, J.A.; Coenye, T.; Vandamme, P.; Tiedje, J.M. DNA-DNA hybridization values and their relationship to whole-genome sequence similarities. Int. J. Syst. Evol. Microbiol. 2007, 57, 81–91, ANI Average Nucleotide Identity. Available online: http://enve-omics.ce.gatech.edu/ani/ (accessed on 12 May 2016). [CrossRef][PubMed] 45. Rodriguez-R, L.M.; Konstantinos, T. Bypassing cultivation to identify bacterial species. Microbe 2014, 9, 111–118. [CrossRef] 46. Roux, S.; Enault, F.; Hurwitz, B.L.; Sullivan, M.B. VirSorter: Mining viral signal from microbial genomic data. PeerJ 2015, 3, e985. [CrossRef][PubMed] 47. Jiang, S.C.; Paul, J.H. Significance of lysogeny in the marine environment: Studies with isolates and a model of lysogenic phage production. Microb. Ecol. 1998, 35, 235–243. [CrossRef][PubMed] 48. Patel, A.; Noble, R.T.; Steele, J.A.; Schwalbach, M.S.; Hewson, I.; Fuhrman, J.A. Virus and prokaryote enumeration from planktonic aquatic environments by epifluorescence microscopy with SYBR green I. Nat. Protoc. 2007, 2, 269–276. [CrossRef][PubMed] 49. Okshevsky, M.; Meyer, R.L. Evaluation of fluorescent stains for visualizing extracellular DNA in biofilms. J. Microbiol. Methods 2014, 105, 102–104. [CrossRef][PubMed] 50. Merritt, J.H.; Kadouri, D.E.; O’Toole, G.A. Growing and analyzing static biofilms. Curr. Protoc. Microbiol. 2005, 1B-1. Viruses 2017, 9, 60 15 of 16

51. Schneider, C.A.; Rasband, W.S.; Eliceiri, K.W. NIH image to ImageJ: 25 Years of image analysis. Nat. Methods 2012, 9, 671–675. [CrossRef][PubMed] 52. Ivanova, E.P.; Sawabe, T.; Hayashi, K.; Gorshkova, N.M.; Zhukova, N.V.; Nedashkovskaya, O.I.; Mikhailov, V.V.; Nicolau, D.V.; Christen, R. Shewanella fidelis sp. Nov., isolated from sediments and sea water. Int. J. Syst. Evol. Microbiol. 2003, 53, 577–582. [CrossRef][PubMed] 53. Zhang, W.; Du, P.; Zheng, H.; Yu, W.; Wan, L.; Chen, C. Whole-genome sequence comparison as a method for improving bacterial species definition. J. Gen. Appl. Microbiol. 2014, 60, 75–78. [CrossRef][PubMed] 54. Heidelberg, J.F.; Paulsen, I.T.; Nelson, K.E.; Gaidos, E.J.; Nelson, W.C.; Read, T.D.; Eisen, J.A.; Seshadri, R.; Ward, N.; Methe, B.; et al. Genome sequence of the dissimilatory metal ion-reducing bacterium Shewanella oneidensis. Nat. Biotechnol. 2002, 20, 1118–1123. [CrossRef][PubMed] 55. Fauquet, C.M.; Maniloff, J.; Desselberger, U.; Ball, A. Virus Taxonomy: Viiith Report of the International Committee on Taxonomy of Viruses; Elsevier Academic Press: New York, NY, USA, 2005. 56. Seguritan, V.; Feng, I.W.; Rohwer, F.; Swift, M.; Segall, A.M. Genome sequences of two closely related Vibrio parahaemolyticus phages, VP16T and VP16C. J. Bacteriol. 2003, 185, 6434–6447. [CrossRef][PubMed] 57. Darling, A.E.; Mau, B.; Perna, N.T. Progressive mauve: Multiple genome alignment with gene gain, loss and rearrangement. PLoS ONE 2010, 5, e11147. [CrossRef][PubMed] 58. Li, Y.; Wang, M.; Liu, Q.; Song, X.; Wang, D.; Ma, Y.; Shao, H.; Jiang, Y. Complete genomic sequence of bacteriophage H188: A novel Vibrio kanaloae phage isolated from Yellow Sea. Curr. Microbiol. 2016, 72, 628–633. [CrossRef][PubMed] 59. Sime-Ngando, T. Environmental bacteriophages: Viruses of microbes in aquatic ecosystems. Front. Microbiol. 2014, 5, 355. [CrossRef][PubMed] 60. Rohwer, F.; Edwards, R. The phage proteomic tree: A genome-based taxonomy for phage. J. Bacteriol. 2002, 184, 4529–4535. [CrossRef][PubMed] 61. Lucks, J.B.; Nelson, D.R.; Kudla, G.R.; Plotkin, J.B. Genome landscapes and bacteriophage codon usage. PLoS Comput. Biol. 2008, 4, e1000001. [CrossRef][PubMed] 62. Chithambaram, S.; Prabhakaran, R.; Xia, X. Differential codon adaptation between dsDNA and ssDNA phages in Escherichia coli. Mol. Biol. Evol. 2014, 31, 1606–1617. [CrossRef][PubMed] 63. Nicholson, J.K.; Holmes, E.; Kinross, J.; Burcelin, R.; Gibson, G.; Jia, W.; Pettersson, S. Host-gut microbiota metabolic interactions. Science 2012, 336, 1262–1267. [CrossRef][PubMed] 64. Leigh, B.A.; Liberti, A.; Dishaw, L.J. Generation of germ-free Ciona intestinalis for studies of gut-microbe interactions. Front. Microbiol. 2016, 7, 2092. [CrossRef][PubMed] 65. Hooper, L.V.; Macpherson, A.J. Immune adaptations that maintain homeostasis with the intestinal microbiota. Nat. Rev. Immunol. 2010, 10, 159–169. [CrossRef][PubMed] 66. Mazmanian, S.K.; Liu, C.H.; Tzianabos, A.O.; Kasper, D.L. An immunomodulatory molecule of symbiotic bacteria directs maturation of the host immune system. Cell 2005, 122, 107–118. [CrossRef][PubMed] 67. Fujimura, K.E.; Slusher, N.A.; Cabana, M.D.; Lynch, S.V. Role of the gut microbiota in defining human health. Expert Rev. Anti Infect Ther. 2010, 8, 435–454. [CrossRef][PubMed] 68. Breitbart, M. Marine viruses: Truth or dare. Ann. Rev. Mar. Sci. 2012, 4, 425–448. [CrossRef][PubMed] 69. Weitz, J.S.; Stock, C.A.; Wilhelm, S.W.; Bourouiba, L.; Coleman, M.L.; Buchan, A.; Follows, M.J.; Fuhrman, J.A.; Jover, L.F.; Lennon, J.T.; et al. A multitrophic model to quantify the effects of marine viruses on microbial food webs and ecosystem processes. ISME J. 2015, 9, 1352–1364. [CrossRef][PubMed] 70. Suttle, C.A. Marine viruses—Major players in the global ecosystem. Nat. Rev. Microbiol. 2007, 5, 801–812. [CrossRef][PubMed] 71. Ogilvie, L.A.; Jones, B.V. The human gut virome: A multifaceted majority. Front. Microbiol. 2015, 6, 918. [CrossRef][PubMed] 72. Stern, A.; Mick, E.; Tirosh, I.; Sagy, O.; Sorek, R. CRISPR targeting reveals a reservoir of common phages associated with the human gut microbiome. Genome Res. 2012, 22, 1985–1994. [CrossRef][PubMed] 73. Lepage, P.; Leclerc, M.C.; Joossens, M.; Mondot, S.; Blottiere, H.M.; Raes, J.; Ehrlich, D.; Dore, J. A metagenomic insight into our gut’s microbiome. Gut 2013, 62, 146–158. [CrossRef][PubMed] 74. Reyes, A.; Semenkovich, N.P.; Whiteson, K.; Rohwer, F.; Gordon, J.I. Going viral: Next-generation sequencing applied to phage populations in the human gut. Nat. Rev. Microbiol. 2012, 10, 607–617. [CrossRef][PubMed] 75. Modi, S.R.; Lee, H.H.; Spina, C.S.; Collins, J.J. Antibiotic treatment expands the resistance reservoir and ecological network of the phage metagenome. Nature 2013, 499, 219–222. [CrossRef][PubMed] Viruses 2017, 9, 60 16 of 16

76. Watson, M.A.; Chaconas, G. Three-site synapsis during Mu DNA transposition: A critical intermediate preceding engagement of the active site. Cell 1996, 85, 435–445. [CrossRef] 77. Erauso, G.; Lakhal, F.; Bidault-Toffin, A.; Le Chevalier, P.; Bouloc, P.; Paillard, C.; Jacq, A. Evidence for the role of horizontal transfer in generating Pvt1, a large mosaic conjugative plasmid from the clam pathogen, Vibrio tapetis. PLoS ONE 2011, 6, e16759. [CrossRef][PubMed] 78. Duerkop, B.A.; Clements, C.V.; Rollins, D.; Rodrigues, J.L.; Hooper, L.V. A composite bacteriophage alters colonization by an intestinal commensal bacterium. Proc. Nat. Acad. Sci. USA 2012, 109, 17621–17626. [CrossRef][PubMed] 79. Okshevsky, M.; Meyer, R.L. The role of extracellular DNA in the establishment, maintenance and perpetuation of bacterial biofilms. Crit. Rev. Microbiol. 2015, 41, 341–352. [CrossRef][PubMed] 80. Steinberger, R.E.; Holden, P.A. Extracellular DNA in single- and multiple-species unsaturated biofilms. Appl. Environ. Microbiol. 2005, 71, 5404–5410. [CrossRef][PubMed] 81. Liu, H.; Xie, Z.; Shen, P. Involvement of DNA in biofilm formation II: From bacterial adhesion to biofilm formation. J. Nat. Sci. Wuhan 2012, 17, 162–168. [CrossRef] 82. Allesen-Holm, M.; Barken, K.B.; Yang, L.; Klausen, M.; Webb, J.S.; Kjelleberg, S.; Molin, S.; Givskov, M.; Tolker-Nielsen, T. A characterization of DNA release in Pseudomonas aeruginosa cultures and biofilms. Mol. Microbiol. 2006, 59, 1114–1128. [CrossRef][PubMed] 83. Chandramohan, L.; Ahn, J.S.; Weaver, K.E.; Bayles, K.W. An overlap between the control of programmed cell death in Bacillus anthracis and sporulation. J. Bacteriol. 2009, 191, 4103–4110. [CrossRef][PubMed] 84. Rice, K.C.; Bayles, K.W. Death’s toolbox: Examining the molecular components of bacterial programmed cell death. Mol. Microbiol. 2003, 50, 729–738. [CrossRef][PubMed] 85. Webb, J.S.; Thompson, L.S.; James, S.; Charlton, T.; Tolker-Nielsen, T.; Koch, B.; Givskov, M.; Kjelleberg, S. Cell death in Pseudomonas aeruginosa biofilm development. J. Bacteriol. 2003, 185, 4585–4592. [CrossRef] [PubMed] 86. Nanda, A.M.; Thormann, K.; Frunzke, J. Impact of spontaneous prophage induction on the fitness of bacterial populations and host-microbe interactions. J. Bacteriol. 2015, 197, 410–419. [CrossRef][PubMed] 87. Tan, D.; Dahl, A.; Middelboe, M. Vibriophages differentially influence biofilm formation by Vibrio anguillarum strains. Appl. Environ. Microbiol. 2015, 81, 4489–4497. [CrossRef][PubMed] 88. Hosseinidoust, Z.; Tufenkji, N.; van de Ven, T.G. Formation of biofilms under phage predation: Considerations concerning a biofilm increase. Biofouling 2013, 29, 457–468. [PubMed] 89. Lacqua, A.; Wanner, O.; Colangelo, T.; Martinotti, M.G.; Landini, P. Emergence of biofilm-forming subpopulations upon exposure of Escherichia coli to environmental bacteriophages. Appl. Environ. Microbiol. 2006, 72, 956–959. [CrossRef][PubMed] 90. Spoering, A.L.; Gilmore, M.S. Quorum sensing and DNA release in bacterial biofilms. Curr. Opin. Microbiol. 2006, 9, 133–137. [CrossRef][PubMed] 91. Chao, L.; Ramsdell, G. The effects of wall populations on coexistence of bacteria in the liquid phase of chemostat cultures. J. Gen. Microbiol. 1985, 131, 1229–1236. [CrossRef][PubMed] 92. Barr, J.J.; Auro, R.; Furlan, M.; Whiteson, K.L.; Erb, M.L.; Pogliano, J.; Stotland, A.; Wolkowicz, R.; Cutting, A.S.; Doran, K.S.; et al. Bacteriophage adhering to mucus provide a non-host-derived immunity. Proc. Natl. Acad. Sci. USA 2013, 110, 10771–10776. [CrossRef][PubMed] 93. Sutherland, I. Biofilm exopolysaccharides: A strong and sticky framework. Microbiology 2001, 147, 3–9. [CrossRef][PubMed] 94. Moons, P.; Faster, D.; Aertsen, A. Lysogenic conversion and phage resistance development in phage exposed Escherichia coli biofilms. Viruses 2013, 5, 150–161. [CrossRef][PubMed] 95. Bayles, K.W. Are the molecular strategies that control apoptosis conserved in bacteria? Trends Microbiol. 2003, 11, 306–311. [CrossRef] 96. Backhed, F.; Ley, R.E.; Sonnenburg, J.L.; Peterson, D.A.; Gordon, J.I. Host-bacterial mutualism in the human intestine. Science 2005, 307, 1915–1920. [CrossRef][PubMed] 97. Thomas, A.D.; Parker, W. Cultivation of epithelial-associated microbiota by the immune system. Future Microbiol. 2010, 5, 1483–1492. [CrossRef][PubMed]

© 2017 by the authors. Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/). Appendix E: Induced prophages from resident lysogens cultured from the Ciona

intestinalis gut demonstrate lytic infection against co-occurring bacteria

Leigh, B.A.*, Graham, Z.*, Greco, A., Breitbart, M. and L.J. Dishaw, 2017. Induced prophages from resident lysogens cultured from the Ciona intestinalis gut demonstrate

lytic infection against co-occurring bacteria.

(*contributed equally)

112 Induced prophages from resident lysogens cultured from the Ciona intestinalis gut demonstrate lytic infection against co-occurring bacteria

Brittany A. Leigh*1,2 , Zachary Graham*2, Anthony Greco1, Mya Breitbart1 and Larry J. Dishaw2^

1. University of South Florida, College of Marine Science, St. Petersburg, FL, USA 2. University of South Florida, Department of Pediatrics, Tampa, FL, USA *Contributed equally; ^ Corresponding author; [email protected]

Abstract

Lysogeny, in which temperate phages integrate into bacterial genomes as prophages, is thought to be the dominant viral state within healthy host-associated mucosal communities. Despite the risk of potential lysis resulting from an induction event, carrying a prophage may be advantageous if competitor bacteria within a niche are susceptible to lytic infection by the same phage. Although the original host cell would be lost during the lysis event, related bacterial lysogens containing the prophage would be protected through superinfection exclusion and thus have a competitive advantage in the mucosal ecosystem. While the phenomenon of prophage-mediated warfare against competitors is frequently evoked in the literature as a putative advantage, experimental evidence is largely lacking. Here, we cultured 70 bacterial isolates from the gut of the marine invertebrate Ciona intestinalis and tested each bacterial isolate for prophage induction with the DNA damaging agent, mitomycin C.

Prophages were successfully induced from 22 of the bacterial isolates, and the induced phage particles were subsequently purified, imaged with transmission electron microscopy, and sequenced. Thirteen of these temperate phage demonstrated lytic activity against other members of the microbiome, in some cases with broad host

113 specificities. This study provides in vitro experimental support for the hypothesis that prophages provide bacterial lysogens with a competitive advantage through lytic infection of competitor bacteria, and Ciona intestinalis provides an excellent model system for future in vivo studies to determine the outcome of competition on microbiome composition within the gut mucosal environment.

Introduction

Bacteriophages (phages; viruses that infect bacteria) are the most abundant biological entities on the planet, with an estimated total of 1031 particles globally (Bergh

29 et al., 1989; Weinbauer, 2004). Within the ocean, approximately 10 phage infections occur per day, and this viral shunt recycles a vast amount of carbon and nutrients

(Suttle, 2007). Additionally, the global phage community serves as the largest reservoir of genetic diversity on the planet (Breitbart and Rohwer, 2005; Suttle, 2005). Decades of research has shown that phages serve as master manipulators of bacterial communities, and understanding these infection dynamics is even more important when considering the bacterial communities that animals often depend on for health and survival.

Most metazoans have now been shown to live in association with microbial communities whose cell numbers often far outnumber host cells. The animal gut is a major site of microbe colonization; e.g., the human intestine is considered one of the most populated ecosystems documented (Marchesi and Shanahan, 2007). These microbes form a diverse yet stable community in healthy individuals, with disruption

(i.e., dysbiosis) often resulting in disease (Cho and Blaser, 2012). This dysbiosis can

114 result from a number of environmental influences such as inflammation (Honda and

Littman, 2012), infection (Honda and Littman, 2012) or dietary shifts (Turnbaugh et al.,

2009). Phage infection also has been shown to alter host-associated bacterial community structure (Duerkop et al., 2012; Mirzaei and Maurice, 2017). The majority of bacteria within the gut microbiome have detectable prophage sequences in their genomes; these bacteria are known as lysogens (Minot et al., 2013; Minot et al., 2011;

Reyes et al., 2010). Prophages remain stably integrated within their host bacterial cell, replicating with the bacterial chromosome until a trigger leads to excision and induction of the lytic cycle. The lytic process involves replication and packaging of viral DNA, followed by cell lysis and release of infectious phage progeny into the external environment (Mirzaei and Maurice, 2017). Prophages can provide a number of advantages to their bacterial hosts including regulation of host gene expression (Feiner et al., 2015), introduction of virulence or metabolic genes and/or additional phage infection (Hargreaves et al., 2014). When lysogens are induced, the resulting phages can also infect and lyse competitor bacterial strains, serving as a form of prophage- mediated warfare (Duerkop et al., 2012).

Bacterial lysis releases intracellular contents that can provide additional nutrients

(Nanda et al., 2015) and materials such as extracellular DNA, which neighboring bacteria often utilize for biofilm formation (Godeke et al., 2011; Leigh et al., 2017;

Montanaro et al., 2011; Whitchurch et al., 2002). Biofilm formation is common among host-associated bacteria that colonize mucus-rich layers, since this strategy helps establish a stable hold within their desired gut niche. This immobilized yet dynamic existence puts bacteria in close contact with neighboring cells, providing a hot spot for

115 genetic exchange and prophage-mediated warfare. Understanding the dynamics of phage infection within host-associated bacterial communities will shed light on the establishment and maintenance of these complex and vital gut microbial communities.

The development of tractable model systems is imperative to studying these interactions in detail. Ciona intestinalis, a marine protochordate, has been developed for studies of host-microbe interactions (Dishaw et al., 2011; Dishaw et al., 2016) and has been shown to maintain a distinct bacterial (Dishaw et al., 2014) and viral (Leigh, 2017) community within its gut environment. Here, 70 bacterial isolates from the gut of Ciona were tested for prophage induction via exposure to the DNA damaging agent mitomycin

C, revealing 22 bacterial lysogens. Approximately half of the purified induced phages exhibited lytic activity against one or more of the other bacterial isolates, providing in vitro evidence supporting a role for prophage-mediated warfare in structuring the gut microbiome.

Methods

Bacterial isolation from the gut of Ciona intestinalis

Wild-harvested Ciona intestinalis from Mission Bay in San Diego, CA, were collected by M-REP Animal Collection Services (Carlsbad, CA). Animal guts were cleared to remove food-associated microbes (for 48-72 hours in 0.22 µm-filtered seawater with water changes every several hours) before the complete guts (stomach, midgut and hindgut) of ten animals were dissected and homogenized using a dounce homogenizer to release tissue-associated bacteria. The homogenate was then filtered through a 0.45 µm filter to remove host tissue, and the bacteria were pelleted in the

116 centrifuge at 12,500 x g for 10 minutes. Bacterial cells were washed three times in 1 mL of sterile artificial seawater (ASW) using the same pelleting technique. The bacterial mixture was then plated on marine agar (MA) 2216 (Becton Dickinson Company,

Franklin Lakes, NJ) and incubated overnight at 20°C. Resulting colonies were randomly selected based on differing phenotypes, streaked to verify single colony isolation and grown separately in the corresponding liquid broth (marine broth (MB) 2216, pH 7.6), of which a 20% glycerol stock was made and stored at -80°C. DNA was then isolated from the remaining culture using the MoBio PowerSoil DNA Kit (MoBio Laboratories,

Carlsbad, CA). The 16S rRNA gene was amplified using universal primers 27F and

1492R (Weisburg et al., 1991), sequenced via the Sanger platform and identified using

BLASTn (National Center for Biotechnology Information (NCBI); http://ncbi.nlm.nih.gov) and the RDP database (https://rdp.cme.msu.edu/).

Prophage induction and purification

A total of 70 bacterial isolates were identified by 16S rRNA amplicon sequencing.

Each of these isolates was grown in 50 mL of MB in a shaking incubator at 20°C to an

OD600 of 0.25, and cultures split in half (25 mL each tube). One half remained as the control, and the other half was induced with mitomycin C using previously established protocols (McDaniel et al., 2014). Briefly, mitomycin C was added to each culture at a final concentration of 1 µg/mL and incubated overnight with shaking at 130 RPM at

20°C. The following day, the OD600 was measured for all bacterial cultures. If the mitomycin C culture read a lower OD600 than the control, this indicated potential prophage lysis, and the bacteria were removed through centrifugation at 12,500 x g and

117 0.22 µm filtration from both the control and the mitomycin C cultures. A portion of the filtrate was then filtered onto a 0.02 µm glass Anodisc filter and stained with 4x SYBR

Gold for 11 minutes at room temperature in the dark (Patel et al., 2007). The production of viral-like particles (VLPs) in the mictomycin C- treated culture was confirmed by epifluorescence microscopy. For each culture where VLPs were detected, cesium chloride (CsCl) gradient ultracentrifugation was performed to purify viral particles as previously described (Thurber et al., 2009). Briefly, each sample was spun at 61,000 x g for 3 hours at 4°C, and the 1.2 - 1.5 g/mL fraction was collected into a 2 mL sterile tube using a sterile syringe and needle. The resulting purified phage fraction was then utilized for subsequent host range studies, transmission electron microscopy (TEM) and genome sequencing.

Transmission electron microscopy of induced phages

Shortly after purification, 25 µL of CsCl-purified viral particles were allowed to adhere to a formvar grid (Electron Microscopy Sciences, Hatfield, PA, USA) for 45 minutes, after which excess liquid was removed and the grid was negatively stained with 2% uranyl acetate as described previously (Ackermann and Heldal, 2010). Images were acquired using an Orius SC600 Gatan bottom mount camera (Gatan, Inc.,

Pleasanton, CA, USA).

DNA extraction and Illumina sequencing

A portion of the CsCl-purified phages was treated with 20% (vol/vol) chloroform for 10 minutes to destroy bacterial vesicles or contaminating cellular contents; this was

118 followed by a treatment with DNase I (2.5 units/µL final concentration) for 3 hours at

37°C, with occasional vortexing. The DNase I was neutralized using 20 mM final concentration EDTA pH 8.0. DNA was extracted from the resulting sample using the

QIAmp MinElute Virus Spin Kit (Qiagen Inc., Valencia, CA). Viral DNA was quantified and pooled to generate a library using the TruSeq DNA library preparation kit (Illumina

Inc., San Diego, CA). The sample was sequenced via the Illumina MiSeq platform, with

2 x 250 mate-pair reads. The resulting reads were processed through the iVirus (Bolduc et al., 2017) pipeline: trimmed using Trimmomatic 0.35 (Bolger et al., 2014), assembled using Spades 3.6.0 (Bankevich et al., 2012), and each contig analyzed by VirSorter

1.0.3 (Roux et al., 2015) to predict circular and complete viral sequences. Primers were generated to each of the contigs using the Primer3 software (Untergasser et al., 2007) and matched to DNA extracted from the phage particles purified from each of the induced cultures. Where possible, complete genomes were assembled from the viral contigs using de novo assembly methods described in Deng et al. (Deng et al., 2015).

Open reading frames (ORFs) of each assembled prophage genome were determined using Glimmer3 (Delcher et al., 1999) through the Geneious 9.1.4 (Kearse et al., 2012) platform, and annotations were determined using tBLASTx in NCBI against the non- redundant (nr) database.

Determination of host range for induced phages

Each of the 22 purified phage preparations was screened for lytic activity against all other cultured isolates from the Ciona gut. Initially, each purified phage was spotted onto a bacterial lawn according to previously described methods (Kutter, 2009). Briefly,

119 bacterial cultures were grown to log phase (~0.25 OD600), then 500 µL of bacteria were mixed with 3.5 mL of 0.5% low melt top agarose, vortexed slightly and poured onto MA plates and allowed to set for one hour at room temperature. Two microliters of CsCl- purified viral particles from each induction was spotted onto the surface, and the plates were incubated overnight at 20°C. The following day, zones of clearing were noted and positive samples from the spot assay were further investigated using traditional plaque assays (Adams, 1959). Briefly, 2 µL of purified phage particles were added to 500 µL of log phase (~0.25 OD600) bacterial culture, mixed with 3.5 mL of 0.5% low melt top agarose, vortexed slightly, poured onto MA plates and allowed to set for one hour at room temperature. The plates were incubated overnight at 20°C. Resulting plaques were cored in modified sodium magnesium (MSM) buffer (450 mM NaCl, 102 mM

MgSO4, 50 mM Tris Base, pH 8), 0.22 µm-filtered, and plated again for a total of three sequential plaque assays.

Results

Identification of active prophages from cultured isolates of the Ciona gut

A total of 70 isolates representing 16 bacterial genera (Table S1) were induced with mitomycin C, resulting in the identification of 22 lysogens within eight of the 16 genera (Table 1) and 24 active temperate phages (Figure 1).

The two Citrobacter spp. temperate phages both exhibited morphologies of the

Myoviridae family, with a contractile tail. Additionally, both of these phages possessed

ORFs with high similarity to known Citrobater freundii phage genes. Both temperate phages also possessed a NinG protein found in the Citrobacter freundii genome utilized

120 for recombination within the phage genomes during replication, identifying a potential hotspot of genetic diversity during the lytic switch (Poteete, 2001).

The temperate phage isolated from Halomonas sp. 5669 also exhibited morphology consistent with that of the Myoviridae family and a genome with similarities to phage structural genes from the Halomonas sp. S2151 bacteria previously sequenced (Machado et al., 2015). Additionally, this phage possessed a capsid similar to phage P2, a temperate myovirus infecting E. coli (Bertani and Bertani, 1971), as well as a protein containing a peptidoglycan-binding domain and a P2 tail completion protein.

Of the three Marinobacter prophages, two appeared small with no tail (5207,

6657) while the third (5339) exhibited morphology similar to the Podoviridae family, with a short tail. One non-tailed prophage (6713) was also discovered among the

Photobacterium isolates. Additionally, three Pseudovibrio spp. maintained active prophage-like particles, all non-tailed. None of these Pseudovibrio spp. genomes were recovered using the DNA sequencing method described here.

The three Pseudoalteromonas sp. temperate phages each represented a different viral family: Siphoviridae (5185), Myoviridae (5679) and Corticoviridae (6751).

This Corticoviridae genome induced from Pseudoalteromonas sp. 6751 had 85% nucleotide identity to the only member of this family, phage PM2 that is only lytic and possesses lipids within its protein capsid (Espejo and Canelo, 1968; Mannisto et al.,

1999). The only major difference between these genomes was in the spike protein of the newly described 6751 temperate phage that was more similar to a phage gene within the Pseudoalteromonas sp. P1-8 genome.

121 Four Shewanella isolates contained inducible prophages, including Shewanella sp. 3313, which had two active prophages that have already been described elsewhere

(Leigh et al., 2017). Morphology assigned the remaining three temperate phages to the

Siphoviridae family. Shewanella sp. 5683 maintained a siphovirus whose genome showed similarity to a number of hypothetical protein genes to Shewanella baltica and

Shewanella psychrophila, suggesting many un-annotated prophages within known

Shewanella genomes. This phage also possessed a gene with a diguanylate cyclase, an enzyme that participates in the formation of cyclic-di-GMP that is intimately involved in bacterial biofilm formation and maintenance (Haeusser et al., 2014). The Shewanella sp. 6719 temperate phage genome encompassed genes with the most similarity to

Shewanella psychrophila and a group of genes belonging to the glycosyl hydrolase family, genes that have only recently been described in a phage genome (Li et al.,

2016).

Five Vibrio isolates were shown to have inducible prophages, with one strain

(5199) having two different prophages. The temperate phages induced from both Vibrio sp. 5181 and Vibrio sp. 5333 were both myoviruses, with the vast majority of genes from 5333 sharing similarity to a prophage within Vibrio cyclotrophicus, a hydrocarbon- degrading marine bacterium (Hedlund and Staley, 2001). The prophage from Vibrio sp.

6647 exhibited the morphology of a podovirus, while the temperate phage from isolate

5649 had a non-tailed morphology. The two prophages from the Vibrio sp. 5199 isolate had different morphologies; one was a tailed myovirus and the other a rod-like phage.

122 Induced prophages exhibit lytic activity on other bacterial isolates from the Ciona gut microbiome

After CsCl purification, each induced phage was spotted on lawns of each of the

70 isolates. Positive spot test results are reported in the matrix illustrated in Figure S1.

Many turbid spots indicated a potential for integration of the prophage into a new bacterial host. To verify lytic activity, each positive spot was tested using traditional plaque assays since spot assays often over-estimate infection (Kutter, 2009). The majority of these positive spots did not reproduce on plaque assays, suggesting possible integration or lysis from without (Delbruck, 1940). However, thirteen of the prophages were capable of lytic infection of other bacterial isolates (Figure 2).

Shewanella sp. 3313 (class Gammaproteobacteria, order Alteromonasdales, family

Shewanellaceae) was successfully infected by phages induced from Pseudovibrio sp.

5337 and Pseudovibrio sp. 5189 (class Alphaproteobacteria), as well as by phages induced from Pseudoalteromonas sp. 6751 and Pseudoalteromonas sp. 5679 within the family Pseudoalteromonadaceae and class Gammaproteobacteria. Additionally,

Pseudoalteromonas sp. 6751 (class Gammaproteobacteria, order Alteromonasdales, family Pseudoalteromonadaceae) was successfully infected by phages induced from

Vibrio sp. 5199 and 6647 within the order Vibrionales, from Halomonas sp. 5669 within the order Oceanspirillales, and from Citrobacter sp. 6731 within the order

Enterobacteriales. Cross-order infections were also observed when Shewanella sp.

6325 (order Alteromonadales) was successfully infected by a phage induced from Vibrio sp. 5199, and Vibrio sp. 5655 (order Vibrionales) was infected by a phage induced from

Shewanella sp. 6321. Vibrio sp. 5673 was also successfully infected by a phage

123 induced from Vibrio sp. 5333. Lastly, Pseudovibrio sp. 5321 was successfully infected by phages induced from Pseudovibrio sp. 5337 and Shewanella sp. 5683, again showing infection across classes.

Discussion

The gut environment provides a highly dynamic environment in which we are still attempting to decipher phage-bacteria interactions. In the gut, phages are thought to be at more of a 1:1 ratio with bacteria (Reyes et al., 2012), compared to the 10:1 seen in other environments (Suttle, 2005), and many metagenomic studies indicate that the temperate phage lifestyle is more prominent within the gut (Knowles et al., 2016; Minot et al., 2013; Minot et al., 2011; Reyes et al., 2010; Reyes et al., 2012; Silveira, 2016).

However, very little is known about the role that prophages play within this highly dynamic ecosystem. The presence of prophages within host-associated bacterial communities may have a variety of advantages for the bacterial host including dominance of a particular niche in the presence of related strains (Duerkop et al., 2012), super-immunity exclusion providing protection against infection by closely related phages (Hargreaves et al., 2014) and the ability to successfully form biofilms (Nanda et al., 2015). Various environmental triggers such as UV light and chemical agents like mitomycin C have been shown to cause the switch from the lysogenic to lytic cycle through the induction of the cell’s SOS response (Weinbauer and Suttle, 1999).

Additionally, in the gut environment, antibiotics (Allen et al., 2011; Zhang et al., 2000) as well as local inflammation (Diard et al., 2017) have been shown to induce prophages.

Modi et al. (Modi et al., 2013) showed that antibiotic treatment caused prophage

124 induction that then, through phage-mediated horizontal gene transfer, enhanced the resilience of the microbiome. However, little else is known about natural processes that induce prophages in the gut environment, and the role(s) of prophages in bacterial colonization of the gut.

Ciona intestinalis, a marine protochordate, offers the opportunity to study the biology of prophages during the colonization and establishment of a stable microbiome within naïve gut tissues, especially because Ciona maintains a core gut bacterial community across global populations (Dishaw et al., 2014). The 70 cultured bacterial isolates analyzed in this study comprise 8 of the 13 families in the core microbiome, and

22 of these isolates had prophages that were inducible by mitomycin C. Additionally, the virome of Ciona has been characterized (Leigh, 2017), and the presence of many prophage hallmark genes such as integrases and excisionases highlight the large amount of prophage activity within the gut environment.

Traditionally, phages are thought to have very narrow host ranges, infecting only closely related bacterial cells (Hyman and Abedon, 2010). Although uncommon, phages have previously been shown to infect bacteria from different phyla isolated from the same environment (Malki et al., 2015; Tyutikov et al., 1980), as well as across families in isolates from sewage (Jensen et al., 1998; Yu et al., 2015). This study aims to provide additional support that these broad host range infection dynamics can also occur among bacteria from the gut microbiome. We show here that phages induced from a bacterial member of one order are capable of lytic infection of bacteria in another order, and even in one instance, infection occurred across a class (Pseudovibrio sp. to

Shewanella sp.). Host ranges in phages from host-associated mucosal communities

125 may exhibit polyvalency in order to ensure subsequent infection in the highly diverse gut mucosal environment in both humans and Ciona (Dishaw et al., 2014; Eckburg et al.,

2005). Broad host ranges for prophages in particular would provide an additional competition strategy among co-localizing bacteria, or to thwart invasion by incoming pathogens (Silveira and Rohwer, 2016) (Figure 3). Additionally, a recent study has demonstrated through analysis of physical contact between phage particles and bacteria, most phages, although they had a preferred host, were often times associated with more than one taxonomic group (Marbouty et al., 2017).

Phage-bacteria cross-infections with lytic phages have been investigated for decades in the natural environment; yet, no consensus on patterns or drivers of the range of phage cross-infection has been achieved. Using these types of host range data, phage-bacteria infection networks (PBINs) have been modeled to account for four different types of potential phage-bacteria interactions: random, one-to-one, nested and modular (Weitz et al., 2013). A one-to-one PBIN accounts for highly specific interactions with single phages only capable of infecting of a single bacterial species, and a modular

PBIN contends that successful infections occur within distinct groups. However, the data shown here are more in line with the random or nested PBINs that include more broad host ranges. A random PBIN asserts that all cross-infection within a community occurs solely by chance, whereas the nested PBIN accounts for the presence of both generalist (capable of infecting large numbers of distantly related bacterial taxa) and specialist (capable of infecting a small number of bacteria taxa) phages that infect a range of permissive and non-permissive bacteria (Poullain et al., 2008). Infection dynamics described here show bacteria such as Shewanella sp. 3313 and

126 Pseudoalteromonas sp. 6751 to be more permissive bacteria, infected by more polyvalent phages, while bacteria such as Vibrio sp. 5673 as more non-permissive, infected only by a phage from another Vibrio sp. Meta-analysis of a number of metagenomes utilizing these networks to predict host range shows that PBINs are normally nested (Weitz et al., 2013), in agreement with our subset of cultured isolates from the Ciona gut microbiome. Additional experimental evidence in both Ciona and other systems may further show that the gut phage community is composed phages with a spectrum of host ranges including both specialists and generalists.

Compared to lytic phages, the host ranges of prophages have been much less explored. Although temperate phages are abundant within the gut microbiome (Minot et al., 2013; Minot et al., 2011; Reyes et al., 2010; Reyes et al., 2012), no other studies that we know of to date have examined host range of induced temperate phages within the gut environment. Temperate phages in the gut could serve, in addition to other methods such as bacteriocins (Cotter et al., 2013) and antimicrobial compounds

(Hibbing et al., 2010), as a weapon to compete with neighboring bacteria within the highly dynamic mucosal environment. This tactic has been shown successfully between bacterial strains (Duerkop et al., 2012), but the ability of temperate phages to lytically infect diverse bacterial groups as a form of competition has yet to be described.

Although evolution of a broad host range for lytic phages often comes with fitness costs such as decreased infection efficiency (Koskella and Meaden, 2013), the ability for prophages to infect a variety of distantly related bacteria might provide an advantage during colonization within a diverse community dominated by lysogens. Models such as the bacteriophage adherence to mucus (BAM) model (Barr et al., 2013) and the

127 piggyback-the-winner hypothesis (Knowles et al., 2016; Silviera and Rohwer, 2016) describe the utility of free phages in protection against incoming pathogens within the mucus environment, but prophage competition among symbiotic bacteria within the mucus needs further investigation.

Understanding the role of prophages within the microbiome in vivo has been difficult due to the lack of tractable systems. Ciona intestinalis, a marine protochordate with gut morphology similar to that of vertebrates, can serve as a model system for extending these studies to animal hosts. Prophages likely play a role in the establishment of a stable, core microbiome, especially in light of the elevated amount of lysogeny within healthy microbiomes. Advantages in biofilm formation, gene transfer and competition with other bacterial groups provide evolutionary advantages for bacteria to maintain prophages within their genomes. The in vitro evidence for prophage-mediated warfare between cultured isolates presented here sets the stage for future in vivo studies exploring the roles of prophages during initial colonization and subsequent maintenance of the Ciona gut microbiome.

Acknowledgements

The authors thank Charlotte Karrer for successful culturing of all bacterial isolates used here as well as Katherine Bruder, Kema Malki and Alexandria Creasy for technical assistance. Additionally, the authors thank Dr. Lauren McDaniel for her invaluable guidance in generating protocols and expertise in prophage biology.

128 Funding

These studies were supported by a grant from the National Science Foundation (IOS-

1456301) to L.J.D. and M.B. and by a National Science Foundation Graduate Research

Fellowship (Award No. 1144244) to B.A.L.

References

Ackermann, H.W., Heldal, M., 2010. Basic electron microscopy of aquatic viruses. Manual of Aquatic Viral Ecology. Amer Soc Limnol Ocean, 182-192. Adams, M.H., 1959. Bacteriophages, 592 p. pp. Interscience Publishers, New York,. Allen, H.K., Looft, T., Bayles, D.O., Humphrey, S., Levine, U.Y., Alt, D., Stanton, T.B., 2011. Antibiotics in feed induce prophages in swine fecal microbiomes. MBio 2(6). Bankevich, A., Nurk, S., Antipov, D., Gurevich, A.A., Dvorkin, M., Kulikov, A.S., Lesin, V.M., Nikolenko, S.I., Pham, S., Prjibelski, A.D., Pyshkin, A.V., Sirotkin, A.V., Vyahhi, N., Tesler, G., Alekseyev, M.A., Pevzner, P.A., 2012. SPAdes: a new genome assembly algorithm and its applications to single-cell sequencing. J Comput Biol 19(5), 455-477. Bergh, O., Borsheim, K.Y., Bratbak, G., Heldal, M., 1989. High abundance of viruses found in aquatic environments. Nature 340(6233), 467-468. Bertani, L.E., Bertani, G., 1971. Genetics of P2 and related phages. Adv Genet 16, 199- 237. Bolduc, B., Youens-Clark, K., Roux, S., Hurwitz, B.L., Sullivan, M.B., 2017. iVirus: facilitating new insights in viral ecology with software and community data sets imbedded in a cyberinfrastructure. ISME J 11(1), 7-14. Bolger, A.M., Lohse, M., Usadel, B., 2014. Trimmomatic: a flexible trimmer for Illumina sequence data. Bioinformatics 30(15), 2114-2120. Breitbart, M., Rohwer, F., 2005. Here a virus, there a virus, everywhere the same virus? Trends Microbiol 13(6), 278-284. Cho, I., Blaser, M.J., 2012. The human microbiome: at the interface of health and disease. Nat Rev Genet 13(4), 260-270. Delbruck, M., 1940. The Growth of Bacteriophage and Lysis of the Host. J Gen Physiol 23(5), 643-660. Delcher, A.L., Harmon, D., Kasif, S., White, O., Salzberg, S.L., 1999. Improved microbial gene identification with GLIMMER. Nucleic Acids Res 27(23), 4636- 4641. Deng, X., Naccache, S.N., Ng, T., Federman, S., Li, L., Chiu, C.Y., Delwart, E.L., 2015. An ensemble strategy that significantly improves de novo assembly of microbial genomes from metagenomic next-generation sequencing data. Nucleic Acids Res 43(7), e46.

129 Diard, M., Bakkeren, E., Cornuault, J.K., Moor, K., Hausmann, A., Sellin, M.E., Loverdo, C., Aertsen, A., Ackermann, M., De Paepe, M., Slack, E., Hardt, W.D., 2017. Inflammation boosts bacteriophage transfer between Salmonella spp. Science 355(6330), 1211-1215. Dishaw, L.J., Flores-Torres, J., Lax, S., Gemayel, K., Leigh, B., Melillo, D., Mueller, M.G., Natale, L., Zucchetti, I., De Santis, R., Pinto, M.R., Litman, G.W., Gilbert, J.A., 2014. The gut of geographically disparate Ciona intestinalis harbors a core microbiota. PLoS One 9(4), e93386. Dishaw, L.J., Giacomelli, S., Melillo, D., Zucchetti, I., Haire, R.N., Natale, L., Russo, N.A., De Santis, R., Litman, G.W., Pinto, M.R., 2011. A role for variable region- containing chitin-binding proteins (VCBPs) in host gut-bacteria interactions. Proc Natl Acad Sci U S A 108(40), 16747-16752. Dishaw, L.J., Leigh, B., Cannon, J.P., Liberti, A., Mueller, M.G., Skapura, D.P., Karrer, C.R., Pinto, M.R., De Santis, R., Litman, G.W., 2016. Gut immunity in a protochordate involves a secreted immunoglobulin-type mediator binding host chitin and bacteria. Nat Commun 7, 10617. Duerkop, B.A., Clements, C.V., Rollins, D., Rodrigues, J.L., Hooper, L.V., 2012. A composite bacteriophage alters colonization by an intestinal commensal bacterium. Proc Natl Acad Sci U S A 109(43), 17621-17626. Eckburg, P.B., Bik, E.M., Bernstein, C.N., Purdom, E., Dethlefsen, L., Sargent, M., Gill, S.R., Nelson, K.E., Relman, D.A., 2005. Diversity of the human intestinal microbial flora. Science 308(5728), 1635-1638. Espejo, R.T., Canelo, E.S., 1968. Properties of bacteriophage PM2: a lipid-containing bacterial virus. Virology 34(4), 738-747. Feiner, R., Argov, T., Rabinovich, L., Sigal, N., Borovok, I., Herskovits, A.A., 2015. A new perspective on lysogeny: prophages as active regulatory switches of bacteria. Nat Rev Microbiol 13(10), 641-650. Godeke, J., Paul, K., Lassak, J., Thormann, K.M., 2011. Phage-induced lysis enhances biofilm formation in Shewanella oneidensis MR-1. ISME J 5(4), 613-626. Haeusser, D.P., Hoashi, M., Weaver, A., Brown, N., Pan, J., Sawitzke, J.A., Thomason, L.C., Court, D.L., Margolin, W., 2014. The Kil peptide of bacteriophage lambda blocks Escherichia coli cytokinesis via ZipA-dependent inhibition of FtsZ assembly. PLoS Genet 10(3), e1004217. Hargreaves, K.R., Kropinski, A.M., Clokie, M.R., 2014. Bacteriophage behavioral ecology: How phages alter their bacterial host's habits. Bacteriophage 4, e29866. Hedlund, B.P., Staley, J.T., 2001. Vibrio cyclotrophicus sp. nov., a polycyclic aromatic hydrocarbon (PAH)-degrading marine bacterium. Int J Syst Evol Microbiol 51(Pt 1), 61-66. Hibbing, M.E., Fuqua, C., Parsek, M.R., Peterson, S.B., 2010. Bacterial competition: surviving and thriving in the microbial jungle. Nat Rev Microbiol 8(1), 15-25. Honda, K., Littman, D.R., 2012. The microbiome in infectious disease and inflammation. Annu Rev Immunol 30, 759-795. Hyman, P., Abedon, S.T., 2010. Bacteriophage host range and bacterial resistance. Adv Appl Microbiol 70, 217-248. Jensen, E.C., Schrader, H.S., Rieland, B., Thompson, T.L., Lee, K.W., Nickerson, K.W., Kokjohn, T.A., 1998. Prevalence of broad-host-range lytic bacteriophages of

130 Sphaerotilus natans, Escherichia coli, and Pseudomonas aeruginosa. Appl Environ Microbiol 64(2), 575-580. Kearse, M., Moir, R., Wilson, A., Stones-Havas, S., Cheung, M., Sturrock, S., Buxton, S., Cooper, A., Markowitz, S., Duran, C., Thierer, T., Ashton, B., Meintjes, P., Drummond, A., 2012. Geneious Basic: an integrated and extendable desktop software platform for the organization and analysis of sequence data. Bioinformatics 28(12), 1647-1649. Knowles, B., Silveira, C.B., Bailey, B.A., Barott, K., Cantu, V.A., Cobian-Guemes, A.G., Coutinho, F.H., Dinsdale, E.A., Felts, B., Furby, K.A., George, E.E., Green, K.T., Gregoracci, G.B., Haas, A.F., Haggerty, J.M., Hester, E.R., Hisakawa, N., Kelly, L.W., Lim, Y.W., Little, M., Luque, A., McDole-Somera, T., McNair, K., de Oliveira, L.S., Quistad, S.D., Robinett, N.L., Sala, E., Salamon, P., Sanchez, S.E., Sandin, S., Silva, G.G., Smith, J., Sullivan, C., Thompson, C., Vermeij, M.J., Youle, M., Young, C., Zgliczynski, B., Brainard, R., Edwards, R.A., Nulton, J., Thompson, F., Rohwer, F., 2016. Lytic to temperate switching of viral communities. Nature 531(7595), 466-470. Kutter, E., 2009. Phage host range and efficiency of plating. Methods Mol Biol 501, 141- 149. Leigh, B., Karrer, C., Cannon, J.P., Breitbart, M., Dishaw, L.J., 2017. Isolation and characterization of a Shewanella phage-host system from the gut of the tunicate, Ciona intestinalis. Viruses 9(3). Leigh, B.A., A. Djurhuus, M. Breitbart and L.J. Dishaw, in review. The gut virome of the protochordate model organims, Ciona intestinalis. Virus Research. Li, W., Fan, H., He, C., Zhang, X., Wang, X., Yuan, J., Fang, Z., Fang, W., Xiao, Y., 2016. PspAG97A: A Halophilic alpha-glucoside hydrolase with wide substrate specificity from glycoside hydrolase family 97. J Microbiol Biotechnol 26(11), 1933-1942. Machado, H., Sonnenschein, E.C., Melchiorsen, J., Gram, L., 2015. Genome mining reveals unlocked bioactive potential of marine Gram-negative bacteria. BMC Genomics 16, 158. Malki, K., Kula, A., Bruder, K., Sible, E., Hatzopoulos, T., Steidel, S., Watkins, S.C., Putonti, C., 2015. Bacteriophages isolated from Lake Michigan demonstrate broad host-range across several bacterial phyla. Virol J 12, 164. Mannisto, R.H., Kivela, H.M., Paulin, L., Bamford, D.H., Bamford, J.K., 1999. The complete genome sequence of PM2, the first lipid-containing bacterial virus to be isolated. Virology 262(2), 355-363. Marbouty, M., Baudry, L., Cournac, A., Koszul, R., 2017. Scaffolding bacterial genomes and probing host-virus interactions in gut microbiome by proximity ligation (chromosome capture) assay. Sci Adv 3(2), e1602105. Marchesi, J., Shanahan, F., 2007. The normal intestinal microbiota. Curr Opin Infect Dis 20(5), 508-513. McDaniel, L.D., Rosario, K., Breitbart, M., Paul, J.H., 2014. Comparative metagenomics: natural populations of induced prophages demonstrate highly unique, lower diversity viral sequences. Environ Microbiol 16(2), 570-585.

131 Minot, S., Bryson, A., Chehoud, C., Wu, G.D., Lewis, J.D., Bushman, F.D., 2013. Rapid evolution of the human gut virome. Proc Natl Acad Sci U S A 110(30), 12450- 12455. Minot, S., Sinha, R., Chen, J., Li, H., Keilbaugh, S.A., Wu, G.D., Lewis, J.D., Bushman, F.D., 2011. The human gut virome: inter-individual variation and dynamic response to diet. Genome Res 21(10), 1616-1625. Mirzaei, M.K., Maurice, C.F., 2017. Menage a trois in the human gut: interactions between host, bacteria and phages. Nat Rev Microbiol 15(7), 397-408. Modi, S.R., Lee, H.H., Spina, C.S., Collins, J.J., 2013. Antibiotic treatment expands the resistance reservoir and ecological network of the phage metagenome. Nature 499(7457), 219-222. Montanaro, L., Poggi, A., Visai, L., Ravaioli, S., Campoccia, D., Speziale, P., Arciola, C.R., 2011. Extracellular DNA in biofilms. Int J Artif Organs 34(9), 824-831. Nanda, A.M., Thormann, K., Frunzke, J., 2015. Impact of spontaneous prophage induction on the fitness of bacterial populations and host-microbe interactions. J Bacteriol 197(3), 410-419. Patel, A., Noble, R.T., Steele, J.A., Schwalbach, M.S., Hewson, I., Fuhrman, J.A., 2007. Virus and prokaryote enumeration from planktonic aquatic environments by epifluorescence microscopy with SYBR Green I. Nat Protoc 2(2), 269-276. Poteete, A.R., 2001. What makes the bacteriophage lambda Red system useful for genetic engineering: molecular mechanism and biological function. FEMS Microbiol Lett 201(1), 9-14. Poullain, V., Gandon, S., Brockhurst, M.A., Buckling, A., Hochberg, M.E., 2008. The evolution of specificity in evolving and coevolving antagonistic interactions between a bacteria and its phage. Evolution 62(1), 1-11. Reyes, A., Haynes, M., Hanson, N., Angly, F.E., Heath, A.C., Rohwer, F., Gordon, J.I., 2010. Viruses in the faecal microbiota of monozygotic twins and their mothers. Nature 466(7304), 334-338. Reyes, A., Semenkovich, N.P., Whiteson, K., Rohwer, F., Gordon, J.I., 2012. Going viral: next-generation sequencing applied to phage populations in the human gut. Nat Rev Microbiol 10(9), 607-617. Roux, S., Enault, F., Hurwitz, B.L., Sullivan, M.B., 2015. VirSorter: mining viral signal from microbial genomic data. PeerJ 3, e985. Silveira, C.B., and F.L. Rohwer, 2016. Piggyback-the-Winner in host-associated microbial communities. npj Biofilms Microbiomes 2, 16010. Suttle, C.A., 2005. Viruses in the sea. Nature 437(7057), 356-361. Suttle, C.A., 2007. Marine viruses--major players in the global ecosystem. Nat Rev Microbiol 5(10), 801-812. Thurber, R.V., Haynes, M., Breitbart, M., Wegley, L., Rohwer, F., 2009. Laboratory procedures to generate viral metagenomes. Nat Protoc 4(4), 470-483. Turnbaugh, P.J., Ridaura, V.K., Faith, J.J., Rey, F.E., Knight, R., Gordon, J.I., 2009. The effect of diet on the human gut microbiome: a metagenomic analysis in humanized gnotobiotic mice. Sci Transl Med 1(6), 6ra14. Tyutikov, F.M., Bespalova, I.A., Rebentish, B.A., Aleksandrushkina, N.N., Krivisky, A.S., 1980. Bacteriophages of methanotrophic bacteria. J Bacteriol 144(1), 375-381.

132 Untergasser, A., Nijveen, H., Rao, X., Bisseling, T., Geurts, R., Leunissen, J.A., 2007. Primer3Plus, an enhanced web interface to Primer3. Nucleic Acids Res 35(Web Server issue), W71-74. Weinbauer, M.G., 2004. Ecology of prokaryotic viruses. FEMS Microbiol Rev 28(2), 127-181. Weinbauer, M.G., Suttle, C.A., 1999. Lysogeny and prophage induction in coastal and offshore bacterial communities. Aquat Microb Ecol 18(3), 217-225. Weisburg, W.G., Barns, S.M., Pelletier, D.A., Lane, D.J., 1991. 16S ribosomal DNA amplification for phylogenetic study. J Bacteriol 173(2), 697-703. Whitchurch, C.B., Tolker-Nielsen, T., Ragas, P.C., Mattick, J.S., 2002. Extracellular DNA required for bacterial biofilm formation. Science 295(5559), 1487. Yu, P., Mathieu, J., Li, M., Dai, Z., Alvarez, P.J., 2015. Isolation of polyvalent bacteriophages by sequential multiple-host approaches. Appl Environ Microbiol 82(3), 808-815. Zhang, X., McDaniel, A.D., Wolf, L.E., Keusch, G.T., Waldor, M.K., Acheson, D.W., 2000. Quinolone antibiotics induce Shiga toxin-encoding bacteriophages, toxin production, and death in mice. J Infect Dis 181(2), 664-670.

133 Figures

Isolate genera # isolates # lysogens Aliivibrio 1 0 Bacillus 2 0 Balneola 2 0 Citrobacter 2 2 Halomonas 1 1 Maricurvus 1 0 Muricauda 1 0 Marinobacter 6 3 Marinobacterium 1 0 Microbulbifer 1 0 Micrococcus 1 0 Photobacterium 6 1 Pseudoalteromonas 4 3 Pseudovibrio 7 3 Shewanella 10 4 Vibrio 25 5

Table 1: Number of lysogens from genera of induced bacterial isolates.

Figure 1: TEM images of prophages induced from bacterial isolates (scale bar = 20 nm). 134 Prophage Bacterial Host Pseudovibrio sp. 5337 Pseudovibrio sp. 5189 Pseudoalteromonas sp. 6751 Shewanella sp. 3313 Pseudoalteromonas sp. 5679

Vibrio sp. 5199 Vibrio sp. 6647 Halomonas sp. 5669 Pseudoalteromonas sp. 6751 Citrobacter sp. 6731

Vibrio sp. 5199 Shewanella sp. 6325

Shewanella sp. 6321 Vibrio sp. 5655 Vibrio sp. 5333 Vibrio sp. 5673 Shewanella sp. 5683 Pseudovibrio sp. 5337 Pseudovibrio sp. 5321

Cross-class Cross-order Cross-family Cross-genera Cross-species

Figure 2: Confirmed cross-infections via plaque assays depicting lytic infection across orders and even classes of bacterial isolates from the Ciona gut microbiome.

135 Coloniza(on of naïve …that form bioﬁlms, …that have the capacity to ly(cally gut (ssue by bacteria… releasing prophages into infect other colonizers. the environment... Lumen Outer mucus Outer Inner mucus

AMPs Epithelium Epithelium

Figure 3: Schematic illustration of the prophage warfare hypothesis in the gut environment.

136

Seq ID Bacteria Genus Seq ID Bacteria Genus Seq ID Bacteria Genus 5179 Aliivibrio 6751 Pseudoalteromonas 6269 Vibrio 6725 Bacillus 5315 Pseudoalteromonas 6277 Vibrio 6999 Bacillus 5679 Pseudoalteromonas 6279 Vibrio 6651 Balneola 5185 Pseudoalteromonas 6623 Vibrio 6661 Balneola 5321 Pseudovibrio 6631 Vibrio 6313 Citrobacter 5337 Pseudovibrio 6647 Vibrio 6731 Citrobacter 6947 Pseudovibrio 5309 Vibrio 5669 Halomonas 6965 Pseudovibrio 5313 Vibrio 5323 Maricurvus 6977 Pseudovibrio 5317 Vibrio 6639 Marinobacter 5183 Pseudovibrio 5333 Vibrio 6657 Marinobacter 5189 Pseudovibrio 5335 Vibrio 5339 Marinobacter 6311 Shewanella 5649 Vibrio 5169 Marinobacter 6321 Shewanella 5651 Vibrio 5171 Marinobacter 6325 Shewanella 5655 Vibrio 5207 Marinobacter 6719 Shewanella 5673 Vibrio 5665 Marinobacterium 3313 Shewanella 5685 Vibrio 7069 Microbulbifer 5307 Shewanella 5693 Vibrio 6767 Micrococcus 5311 Shewanella 5177 Vibrio 6319 Photobacterium 5683 Shewanella 5181 Vibrio 6681 Photobacterium 5187 Shewanella 5199 Vibrio 6705 Photobacterium 6491 Shewanella 5217 Vibrio 6713 Photobacterium 6251 Vibrio 6507 Vibrio 6739 Photobacterium 6257 Vibrio 5661 Photobacterium 6265 Vibrio

Supplemental Table 1: All bacterial isolates used in this study. Identity determined by sequencing of the 16S rRNA gene. Purple shading indicates inducible prophage.

137 Aliivibrio 5179 Bacillus 6725 6999 Balneola 6651 6661 Citrobacter 6313 6731 Halomonas 5669 Maricurvus 5323 Marinobacter 6639 6657 5339 5169 5171 5207 Marinobacterium 5665 Microbulbifer 7069 Micrococcus 6767 Photobacterium 6319 6681 6705 6713 6739 5661 Pseudoalteromonas 6751 5315 5679 5185 Pseudovibrio 5321 5337 6947 6965 6977 5183 5189 Shewanella 6311 6321 6325 6719 3313 5307 5311

Bacterialhost 5683 5187 6491 Vibrio 6251 6257 6265 6269 6277 6279 6623 6631 6647 5309 5313 5317 5333 5335 5649 5651 5655 5673 5685 5693 5177 5181 5199 5217 6507 6313 6731 5669 6657 5339 5207 6713 6751 5679 5185 5337 6947 5189 6321 6719 3313 5687 6647 5333 5647 5181 5199 Purified prophage

Supplemental Figure 1: Spot test results between all isolated phage particles and cultured bacteria. Green boxes indicate a positive spot, while blue indicate no clearing.

138 Appendix F: Secretory immune effector-mediated induction of prophages

from lysogenic gut bacteria

Leigh, B.A., Liberti, A., Graham, Z., Zhang, L., Breitbart, M., Cannon, J.P.,

Litman, G.W. and L.J. Dishaw, 2017. A secretory immune molecule with limited

variation induces prophage release from gut bacteria.

139 Secretory immune effector-mediated induction of prophages from lysogenic gut bacteria

Brittany A. Leigh1,2, Assunta Liberti2, Zachary Graham2, Linlin Zhang3, John P. Cannon2, Mya Breitbart1,Gary W. Litman2 and Larry J. Dishaw2

1. University of South Florida, College of Marine Science, St. Petersburg, FL, USA 2. University of South Florida, Department of Pediatrics, Tampa, FL, USA 3. Cornell University, Department of Ecology and Evolutionary Biology, Ithaca, NY, USA

Abstract

The role of the immune system in maintaining the dynamic ecosystem of the gut is becoming increasingly clearer. Furthermore, it is now recognized that this ecosystem not only involves bacteria but also phages, the viruses that infect bacteria, and some are integrated in bacterial genomes as prophages (lysogenic state). A secretory immune effector in protochordates comprised of immunoglobulin V-type domains and a chitin-binding domain is secreted into gut mucus where it can bind to bacteria and influence bacterial colonization, through an undefined mechanism. The binding of this immune effector to lysogenic bacteria is shown here to influence both the induction of prophages and biofilm formation in vitro. Colonization of germ-free animals in vivo with single bacterial strains (Pseudoalteromonas sp. or Shewanella sp.) results in increased

VCBP expression, decreased retention of bacteria and a simultaneous increase in prophage induction. Prophage induction in lysogenic strains of bacteria by interaction with an immunoglobulin-related effector molecule may represent an essential dynamic that is critical to maintaining gut homeostasis.

140

Introduction

The mechanisms underlying the influences of immunity on gut homeostasis are of broad general interest (1), and understanding them at the molecular level will benefit from studies of model systems that provide different tactical advantages.

Protochordates, the closest extant invertebrate relatives to the vertebrates, provide a unique vantage point from which to examine this dialogue. The compartmentalized gut of Ciona intestinalis (subtype A, now known as Ciona robusta) possesses similar anatomic structures, e.g., crypt-like regions, and barriers in which the layered mucus and epithelial cells are continuously replenished as in the vertebrates (2). However, as a filter feeder, the Ciona gut barriers experience an uninterrupted connection with the microbe-rich external environment, relying exclusively on innate immune mechanisms to mediate microbial homeostasis.

A small multi-gene family of soluble immune effectors termed, variable region- containing chitin-binding proteins (VCBPs), and consisting of two N-terminal immunoglobulin-type variable (V) domains and a C-terminal chitin-binding domain

(CBD), has been described in both Branchiostoma floridae, a cephalochordate, and

Ciona intestinalis and C. robusta, both urochordates (3). Three forms of VCBPs (A, B and C) exhibited distinct patterns of temporal-spatial expression during development of the gut that may relate to bacterial colonization and subsequent microbiome structuring

(4). VCBP-C co-localizes to a matrix of chitin-rich mucus beginning at the earliest stages of gut development and through direct binding of bacteria, facilitates phagocytosis (i.e., opsonic) by granulocytic amoebocytes (5) and influences biofilm formation in vitro through an undefined mechanism (6).

141

An often-overlooked component of the microbiome are prophages, which are bacteriophages (i.e., phages) that lie dormant within a bacterial genome, and render the bacteria a lysogen. Stably integrated prophages can be induced to form temperate phage particles in response to external triggers such as DNA damage and oxidative stress (7). The SOS response, in which the cell cycle is suspended, is activated, often resulting in prophages excising from the genome and virion production (8). Induction of prophages stimulates lysis of its bacterial host and release of newly formed temperate virions into the surrounding environment, an event that has been implicated in biofilm formation in vitro due, in part, to the release of extracellular DNA that can act as a structural matrix (8). Occurrences impacting biofilms are physiologically relevant since this phenotype is most often exhibited by bacteria inhabiting mucus that layers gut epithelium (9); biofilms are often species-rich and thus changes can impact community dynamics (10).

Here, we show that VCBP-C enhancement of biofilm formation under static growth conditions is mediated by prophage induction. In vitro biofilm assays of lysogens incubated with VCBP-C protein demonstrated enhanced biofilm formation and significantly more free temperate phage particles compared to control cultures. Germ- free (GF) Ciona, exposed in vivo to a single bacterial isolate (isolates of two genera tested), results in distinct VCBP-C expression patterns; in each case, enhanced expression of VCBP-C was followed by a decrease in live bacteria and an increase in free temperate phage particles. These collected data suggest that host immunity may leverage different ecological mechanisms to control microbial community dynamics.

142

Results

VCBP-C favors bacterial growth in biofilms and influences prophage induction in vitro

VCBP-C binding has been shown previously to influence the formation of biofilms among some bacterial isolates from the gut of Ciona (6). Immunofluorescent staining shows that VCBP-C preferentially recognized end-to-end chains, a precursor to biofilm formation, in Shewanella sp. 3313. Binding to individual cells in suspension was not observed, suggesting that when Shewanella sp. 3313 cells begin to interact in an end- to-end fashion, distinct membrane components are expressed and recognized by

VCBP-C (Figure 1A). In marked contrast, VCBP-C protein interacts with large aggregates of Pseudoalteromonas sp. 6751, a genus exhibiting rapid biofilm formation, although some binding also can be observed on a few individual cells (Fig. 1B).

To better understand the influence of prophage induction on biofilm formation, we identified two complete and active prophages, SFMu1 and SFPat, in the previously sequenced Shewanella sp. 3313 genome (11); we also sequenced the genome of one mitomycin C-inducible prophage particle from Pseudoalteromonas sp. 6751, referred to as 39582 (Table 1). Shewanella sp. 5307 and Pseudoalteromonas sp. 5315, two additional isolates lacking mitomycin C-inducible prophages (i.e., presumed non- lysogens), also were included in these studies. In both Shewanella sp. 3313 and

Pseudoalteromonas sp. 6751, the observed effects on growth and biofilm development were time-dependent, which can be expected from prophage-specific induction dynamics. Exposure of lysogens to VCBP-C (50 µg/mL) in static cultures at 20°C also resulted in reduced growth in the supernatant (measured by CFUs) and an increase in prophage-derived virion release. No effect on growth was observed when these strains

143 were grown in orbital shaker incubators at 20°C (rotation speeds of 120-150 rpm) with the same concentration of VCBP-C (Fig. S1). Importantly, no significant difference in growth (measured in CFUs) between VCBP-C-incubated cultures and controls was noted in either the supernatant or the biofilms of the non-lysogens, Shewanella sp. 5307 and Pseudoalteromonas sp. 5315, consistent with the involvement of prophage induction in the observed decrease in growth among the lysogens (Fig. 2E-F).

VCBP-C-bound bacteria up-regulate expression of biofilm-associated genes

The Shewanella sp. 3313 isolate, for which a near-complete genome now exists

(11), demonstrates enhanced biofilm formation four hours after incubation with VCBP-C, compared to untreated controls. Increases in virion abundance (by qPCR), derived from two inducible prophages (SFMu1 and SFPat), are generally detectable 4 hours and 12 hours, respectively, after in vitro incubation with VCBP-C (Fig. 2A). To identify potential signaling pathways associated with this prophage-induction phenotype, we performed a transcriptomic analysis (i.e., RNAseq) two hours after VCBP-C incubation in Shewanella sp. 3313. A significant up-regulation of genes that may be associated with the onset of biofilm formation (relative to untreated controls) was observed (Fig. S2). No significant increase, however, in the transcriptional activity of any of the prophage-associated genes was noted within two hours of VCBP-C incubation (Fig. S2).

A number of biofilm-associated genes, including competence ComEA and phosphohistadine phosphatase SixA, important in Fe-S clustering, were up-regulated.

Fe-S clustering, defined as molecular aggregation of iron and sulfide that participate in a variety of biological processes including DNA repair and gene expression, is a

144 widespread phenomenon in biofilm-forming cells that are undergoing oxidative stress

(12), a phenotype commonly observed in the transition to biofilm formation (13). Nine additional hypothetical or uncharacterized genes also were up-regulated, in addition to an ABC transporter permease protein, which plays a role in transportation of a variety of substrates across the cell membrane (14), and a TonB-dependent receptor, which lies directly upstream of the SFMu1 prophage. The presence of TonB just upstream of the

SFMu1 prophage, and its presumed importance during biofilm formation, virulence, and/or quorum sensing in some bacteria (15-17) suggests a potential linkage of SFMu1 and TonB during biofilm formation.

In vivo bacterial exposure induces distinct VCBP-C expression patterns and correlates with prophage induction among lysogens

Throughout development and during metamorphosis into the adult phenotype,

VCBP-C is highly expressed within the gut of Ciona (4); here, we show that VCBP-C can influence prophage induction and enhance biofilm formation in vitro, phenomena likely essential to the colonization process. To examine if prophages are induced in vivo during colonization of the gut, stage 4 Ciona juveniles reared germ-free (18,19) were exposed to a variety of bacterial isolates (Table 1). All strains of the Shewanella and

Pseudoalteromonas concentrated predominately in the gut (Fig. 3) with no evidence for bacteria collecting or colonizing on the tunic, in the branchial basket (i.e., the pharynx), or other body surfaces.

Colonization of GF animals with lysogenic bacteria, Shewanella 3313 and

Pseudoalteromonas 6751, led to a decrease in bacterial retention (or abundance) over

145 time, a decline that correlated with increased host gene expression of VCBP-C, and the induction of prophages by the lysogen (as quantified by qPCR) (Fig. 4). For example,

Shewanella isolate 3313 mediated the sharpest increase in VCBP-C expression at 12 hours post inoculation; this correlated with a dramatic decrease in bacterial abundance as well as a sharp increase in detectable prophage DNA. This increase in VCBP-C expression was also noted in the non-lysogenic isolate, Shewanella 5307. In concordance with in vitro experiments exposing these lysogens to VCBP-C, the induction of the SFPat prophage occurred later in the colonization process than SFMu1.

When GF animals were exposed either to Pseudoalteromonas 6751 or a non- lysogenic isolate 5315, VCBP-C expression peaked within 4 hours. The 5315 strain resulted in a 10-fold increase in VCBP-C expression compared to the 6751 strain. The same pattern of VCBP-C expression and prophage induction was observed in the lysogenic isolate 6751; however, induction of its one known prophage (39582) occurred well after the observed decrease in bacteria. Both prophages (SFMu1 and SFPat) from

Shewanella 3313, can be induced in vitro by either mitomycin C or VCBP-C (as confirmed by qPCR). However, TEM images from Pseudoalteromonas sp. 6751 supernatants revealed that in addition to prophage 39582, a second particle was detectable following VCBP-C incubation that was not present in the mitomycin-C inductions (Fig. 5). This preliminary observation suggests that VCBP-C may induce the production of additional biologically active particles that may influence growth and/or colonization dynamics.

146

Discussion

The gut mucus layer is a highly dynamic environment that is the primary site of communication between host immunity and bacteria (23, 24). Animals have evolved to successfully maintain diverse yet specific communities of bacteria within the gut mucus layers (25), large numbers of which are found to be lysogens (26). Prophages impart a variety of advantages to their hosts including dominance of a particular niche in the presence of related strains (27), super-immunity exclusion providing protection against other phage infection (28) and the ability to successfully form biofilms (8). Resident bacteria maintain their stationary existence within the gut by forming biofilms; nonpathogenic biofilms can often impart enhanced physical barriers against pathogenic invasion (29). While the influence of prophages in biofilm formation, often through the induction of the SOS responses in lysogens, has been studied extensively in vitro (8), whether prophages exhibit similar behaviors in vivo (i.e., in the context of an animal host and its associated microbiome) remains largely unexplored.

Ciona intestinalis is an informative model system for investigating the complex dialogue among host immunity, bacteria (21) and viral (phage) communities (22).

Specific selection mechanisms at the Ciona gut epithelial surface may provide insight into the conserved processes of gut immunity in establishing microbial homeostasis.

Numerous prophages have been identified within the Ciona-associated viral community

(22), the majority of which show similarity to previously annotated phage genes present in bacteria defined to be part of the Ciona gut microbiome, such as Shewanella and

Pseudoalteromonas spp. Ciona VCBP-C interacts directly with isolates from these

147 genera, significantly enhancing biofilm formation (6), a process that ultimately results in the induction of prophages to release temperate virions.

Within healthy host-associated gut microbial communities, metagenomics indicates that integration of viruses into bacterial genomes is common (30-32). One interpretation of the results presented here is that during initial bacterial exposure to juvenile Ciona, bacteria concentrate in the gut and encounter VCBP-C molecules localized in the chitin-rich mucus. Subsequent up-regulation of VCBP-C expression in response to bacterial colonization, and perhaps early stages of biofilm formation, results in prophage-induced lysis. This lysis event releases bacterial DNA as extracellular DNA in vitro, which becomes incorporated as a scaffold for biofilms (35); in vivo, this process may enhance biofilm formation by neighboring cells, with the simultaneous release of free phage particles into the mucosal environment that have the potential to infect other members of the microbiome. The bacteriophage adherence to mucus (BAM) model, as interpreted in the context of these observations, proposes that these free phage particles adhere to mucins via immunoglobulin-like domains on their capsids, providing a form of indirect immunity within the mucus of metazoans through prevention of colonization by pathogens (20).

Prophages can be induced to produce lytic particles by various stressors or triggers, such as antibiotics (36, 37) or local inflammatory processes (38). Overall, relatively little is known about natural inducers of prophages or whether or not they influence colonization in vivo. As shown here, colonization of GF Ciona with bacteria induces a substantial up-regulation of VCBP-C expression that, in lysogens, correlates with an increase in the induction and release of prophage particles into the gut lumen.

148

We previously have noted that VCBP-C is expressed at an early stage of development

(4). VCBPs may induce prophage release from lysogens during early biofilm formation that may shape colonization of naïve host mucosal tissue surfaces in young juveniles.

Although biofilm formation by mucosal immune effectors has been documented in vitro previously with E. coli (a human gut isolate) and secretory immunoglobulin A (sIgA) (39-

41), it is unclear if and how the induction of prophages relates to these observations.

The observations described here are the first to show that the interaction of a lysogen with an immune effector protein can result in prophage induction.

VCBP-C-mediated induction of lysogens did not occur in shaking cultures, and immunofluorescent staining also found VCBP-C preferentially bound to aggregated bacterial cells (42). Both of these observations indicate that biofilm formation correlates strongly with prophage induction. The increased interaction of VCBP-C with bacteria actively forming biofilms is an observation that likely is important in vivo. The conserved timing in expression patterns of VCBP-C in response to species of the same bacterial genera is consistent with a role in biofilm formation. Pseudoalteromonas spp. are highly effective and rapid biofilm formers (43, 44); the induction of VCBP-C during colonization of GF animals occurred at four hours post inoculation compared to 12 hrs when colonized by the Shewanella spp.

Biofilms within the mucus of the human gut have been shown to produce an environment with limited oxygen (45), often inducing the oxidative stress response, a well-known trigger of prophages via the SOS pathways in vitro (8). Other proposed routes of induction in the mucosal environment include mucus spatial structure as hypothesized by the piggyback-the-winner model (33,34). However, limited studies on

149 prophage activity in vivo preclude full understanding of the role for prophages within the gut mucus layer. Evidence for the induction of a unique bioactive particle by VCBP-C, not induced by mitomycin C in Pseudoalteromonas sp. 6751, may indicate the existence of unique activation pathways for VCBP-C.

The dynamic interplay between host immune effectors and bacterial lysogens, along with their induced prophages, likely are critical to our understanding of microbial homeostasis in the gut of all animals. Because colonization of the animal gut is an ancient process likely governed by interactions with distinct co-evolving bacterial taxa, it is reasonable to assume that host effectors with limited variation (like the VCBPs) interface these roles. It is likely that induced prophage particles, if broadly active on other members of the microbiome, likely serve as an indirect form of protection for the host. Further studies on the role of VCBPs and prophages within a more complex, mixed community scenario, could reveal an ecological phenomena leveraged by host effectors that may be more widely applicable than recognized previously.

Methods

Isolation and characterization of resident gut bacteria. Upon arrival, wild-harvested animals from Mission Bay near San Diego, CA (M-REP, Carlsbad, CA, USA) were allowed to clear fecal contents in 0.22 µm-filtered ASW with continuous water changes for 24 hours. Gut tissues were removed surgically (aseptically) and disrupted using a

Dounce homogenizer to liberate the associated bacteria. Host tissue was removed using a 40 µm filter, and the filtrate centrifuged at 1,500 x g for 10 minutes to pellet bacteria, which was washed and resuspended in 0.22 µm-filtered ASW. Approximately

150

10 µL of this bacterial suspension was plated onto Marine Agar 2216 (MA; BD Difco), and clonal growth was established, maintained and expanded a maximum of three times. Bacterial identification was determined using Sanger sequencing of the 16S rRNA amplicon products (27F and 1492R primed).

Prophage induction, purification and sequencing. Each of the isolated bacteria was induced using established methods with mitomycin C to determine the presence of active prophages (50). Briefly, each bacteria was grown to log phase in Marine Broth

2216 (MB) and the culture divided in two. One portion was induced with 1 µg/mL of mitomycin C for 24 hours and the other (control) with no chemical addition. The following day, both cultures were filtered using a 0.22 µm syringe filter and the viral-like particles (VLPs) were enumerated using the SYBR Gold DNA stain (51). If more VLPs were detected in the treated cultures, the bacterial isolate was classified as possessing an active prophage. Each of the induced fractions containing a prophage was purified using CsCl gradient ultracentrifugation (52) and the morphology was characterized by transmission electron microscopy (TEM). Purified viral particles were prepared on a formvar grid with a 2% uranyl acetate negative stain as described previously (53) and imaged on a Hitachi 7100 TEM. A fraction of each purified virus was then sequenced on an Illumina MiSeq platform generating mate-pair libraries (2 x 250). The TruSeq DNA

Kit (Illumina) was used to prepare libraries, the quality of which was assessed on a

BioAnalyzer 2100 (Agilent Technologies). Resulting mate-pair reads were assembled using approaches described in Deng et al. (54), with both de Brujin graph assembly

(SPAdes 3.8.0 (55)) followed by the default consensus algorithm in Geneious 8.1.7 (56)

151 after the original conitgs were input through the VirSorter program to identify complete viral contigs (57). Viral open reading frames (ORFs) were determined using Glimmer3

(58) for all resulting circular viral contigs, and each ORF was annotated using the

BLASTx algorithm against the non-redundant (nr) protein databases in GenBank.

Primers to each of these prophages were generated using the Primer3 software (59) and were validated to have an efficiency of >95% on the qPCR using a DNA standard curve.

Expression of recombinant VCBP-C protein. Recombinant VCBP-C protein was expressed, refolded and purified with slight modification of previously established conditions (3). Briefly, the cDNA encoding the secreted form of VCBP-C was expressed in E. coli Tuner cells (Novagen) and inclusion bodies were released after bacterial exposure to a detergent containing lysozyme and nuclease (BugBuster and Lysonase;

Novagen). Inclusion bodies were washed thoroughly and denatured in 8 M guanidine, reduced using immobilized TCEP (Pierce Biotechnology), refolded and dialyzed overnight at 4°C in 10 mM Tris and 50 mM NaCl, pH 8.0. The dialyzed protein was then concentrated 10-fold in an Amicon ultrafilter before purification with fast protein liquid chromatography using a HiLoad 16/60 Superdex 75 gel filtration column (GE Healthcare

Life Sciences). Purified protein was then verified with SDS-PAGE and quantified using the BCA Protein Assay (Pierce Biotechnology). The protein was 0.22 µm-filtered, and aliquots fixed to 1 mg/mL were stored at -80°C in 10 mM Tris/50 mM NaCl, pH 8.0.

Immunohistochemistry on isolated bacteria. Overnight culture of

Pseudoalteromonas sp. 6751 or Shewanella sp. 3313 bacteria was diluted to ~106

152 cells/mL and each one incubated with 100 µg/mL VCBP-C recombinant protein in marine broth medium for 2 hours on gentle agitation. Control experiments were established incubating diluted bacteria with only the protein buffer (10mM Tris/50 mM

NaCl, pH 8.0). Excess protein was removed and bacteria were collected by centrifugation at 2,600 x g for 10 minutes, re-suspended in 4% formaldehyde in 1x phosphate-buffered saline (PBS) and fixed for 30 minutes on gentle agitation. After two washes in 1x PBS, bacteria were re-suspended in 300 mL of 1x PBS; 100 ml was placed on circular cover glasses previously coated with poly-L-lysine (1 mg/mL) and allowed to adsorb for 10 minutes. Cover glasses were washed twice with 1x PBS and incubated for 30 minutes in blocking buffer (PBS-serum). Rabbit anti-VCBP-C antibody was diluted in blocking buffer and added overnight at 4°C. After three PBS washes cover glasses were incubated in PBS-BSA 1% for 30 minutes and then incubated with goat anti-rabbit Alexa Fluor 488 antibody in PBS for 2 hours at room temperature.

Bacteria nuclei were stained with Hoechst diluted in PBS for 10 minutes. After two washes in 1x PBS, cover glasses were mounted on slides and observed on a Zeiss fluorescent microscope using Zeiss imaging software (Zeiss).

In vitro biofilm assay. Bacterial isolates from freshly streaked MA plates were grown in

MB with continuous shaking at 130 RPM, and growth curves were determined at OD600.

Each culture was diluted to ~106 bacterial cells/mL, protein added at 50 µg/mL and plated (1 mL per well) into 12-well uncoated plastic cell culture dishes in triplicate for stationary growth in a humid chamber at 20°C. Biofilms were allowed to form for up to

48 hours with sampling at 4, 8, 12, and 24 hours after plating. At each collection point,

153 the supernatant was removed gently via pipetting and stored in a 1.5 mL sterile tube.

Bacteria from the wells containing the biofilm were removed following addition of 500 µL of sterile MB and the well scraped excessively with a sterile 1 mL pipet tip for one minute before placing in a 1.5 mL sterile tube. CFU counts were performed on each of the fractions. DNA extractions used the MinElute Virus Spin Kit (Qiagen) to enumerate prophage induction via qPCR.

Transcriptome analysis. Shewanella sp. 3313 was inoculated into a biofilm dish as described above with 50 µg/mL of VCBP-C protein. After 2 hours of static incubation, the entire culture (including biofilm) was removed and RNA was extracted using the

Direct-zol RNA kit (Zymo), quality checked and sequenced with an Illumina MiSeq platform (Argonne Labs, Chicago, IL, USA). The Shewanella fidelis 3313 draft genome sequence (11) was downloaded from MG-RAST. Homology-based methods were applied to perform gene annotation. Gene sequences of S. fidelis ATCC BAA-318 were downloaded from PATRIC database and aligned to the S. fidelis 3313 genome using tBLASTn (E-value 1e-5). The homologous sequences were aligned against the matching genes using Genewise for annotation. After RNA sequencing, a Cornell in- house generated script (LZ) removed PCR primers, adaptors, and low quality reads.

Filtered RNA-Seq reads from each sample were mapped to the genome reference using Bowtie2. Gene expression was normalized using FPKM. GFOLD was used to rank differential expressed genes (60). Functional enrichment was performed further by identifying GO terms enriched in differential expressed gene data sets (61).

154 qPCR of induced viral particles. All prophage primers were validated using a standard curve generated through DNA extracted from a known number of CFUs, due to the inability for these strains to reliably form plaques. Briefly, bacterial cultures were grown to log phase, cells pelleted at 12,000 x g for 10 minutes, and all excess debris and broth was removed. The pellet was resuspended in 1 mL of sterile ASW to wash a total of three times, before the final resuspension was plated to assess live bacterial number through CFU counts. DNA from a volume of 200 µL of this suspension also was extracted using the MinElute Virus Spin Kit (Qiagen). Additionally, this standard curve was used to determine a relative quantity of each of the prophages using SYBR Green reagents (Fisher Scientific) on the 7500 Real Time PCR machine (Applied Biosystems).

All RT-qPCR reactions were performed using amplification steps with differing annealing temperatures: 50°C for 2 min, 95°C for 10 min, and 40 cycles of 95°C for 15 sec and 1 min of annealing at the following temperatures: 3313 prophage SFMu1 56°C,

3313 prophage SFPat 58°C, and 6751 prophage 39582 55°C. Melt curves were performed on each sample after amplification. The average quantity was taken for three replicates within three separate colonization experiments to determine prophage activation. The number of CFUs was subtracted from the viral counts to only account for phage genomes as particles and not those remaining stably integrated into the bacterial genome. For in vitro data, VCBP-C treated cultures were statistically compared to the controls using a parametric t-test between cultures for each time point with a confidence interval of 95%. Significant differences for all in vivo data were assessed using a

Welch’s t-test with a confidence interval of 95%.

155

Animals. Wild-harvested Ciona intestinalis were obtained from the Mission Bay area near San Diego, CA (M-REP, Carlsbad, CA, USA) and were handled as previously described (4-6, 18, 21). Germ-free (GF) Ciona intestinalis were derived using the methods described in Leigh et al. (18). Briefly, eggs were collected from 5-10 animals and sperm from 1-2 animals, and were mixed continuously for 5 minutes to allow fertilization. Sperm was removed and the fertilized eggs were treated to remove microbial contamination of the chorion. After treatment, all embryos were plated on sterile petri dishes in 1x Penicillin-Streptomycin (Fisher Scientific, 100x) and 0.001%

Methylene blue (Fisher Scientific) with daily water changes for four days. On day 5 post- fertilization, all treatments were replaced with sterile ASW; random animals were chosen, together with some water, and screened for contamination. Confirmed GF dishes then were used for colonization and experiments.

GF colonization. Stage 4 GF animals were colonized by exposure to bacteria in otherwise sterile ASW. All selected strains used in colonization experiments were grown overnight at 20°C while shaking at 130 RPM; growth was monitored by measuring optical density (OD600). Cultures were adjusted with ASW to an OD600 of 0.025, which corresponds ~106 cells/mL. Exposure duration of animals to 10 mL of adjusted bacterial cultures was for one hour before culture was removed and replaced by fresh ASW.

Bacterial retention was estimated by counting CFUs from 30 randomly selected animals. In time-course sampling, 30 animals were recovered for CFU counts and 30 animals were sampled for DNA at 4, 8, 12, 24, and 48 hours and 1 and 2 weeks after initial exposure. DNA was isolated with the MinElute Virus Spin Kit (Qiagen); additional

156 samples from the same petri dishes were recovered and preserved in RNA later

(Invitrogen) for VCBP-C gene expression analyses. Bacterial isolates also were stained with bacterial-specific vital dyes such as BacLight (Invitrogen) to localize bacteria, in real-time, within the animals in the first hour after colonization.

Gene expression via RTqPCR. For RNA, animals were selected randomly from the dishes and processed with the RNA XS kit (Macherey-Nagel) and transcribed into cDNA using the SuperScript III kit (Invitrogen). The VCBP-C primers used were as follows: 5’-

AGACCAACGCCAACACAGTA-3’ and 5’-CCCATACATTGCAGCATTTC-3’. VCBP-C expression was normalized through the measurement of the housekeeping actin gene with the following primers: 5’- TATCCTTACTCTGAAATACCCAATTGAG -3’ and 5’-

CGGAGTCGTTGTAGAAAGTGTGAT -3’. All RT-qPCR was performed on the 7500

Real Time PCR system (Applied Biosystems) detecting the Comparative CT (ΔΔCT) with

SYBR Green Reagenets (Fisher Scientific). The following amplification steps were used: 50°C for 2 min, 95°C for 10 min, and 40 cycles of 95°C for 15 sec and 60°C for 1 min. Melt curves were performed on each sample after amplification. VCBP-C induction was statistically compared to the GF controls using a parametric t-test between time points with a confidence interval of 95%. Significant differences were assessed using a

Welch’s t-test with a confidence interval of 95%.

Acknowledgements

The authors thank Charlotte Karrer for successful culturing of all bacterial isolates used here. Additionally, the authors thank Dr. Lauren McDaniel for her invaluable guidance

157 and expertise in prophage biology as well as Stephanie Lawler for her time analyzing preliminary experiments detecting viral induction on the flow cytometer.

Funding

These studies were supported by a grant from the U.S. National Science Foundation

(IOS-1456301) to L.J.D. and M.B., the U.S. National Institutes of Health (R01AI2338) to

G.W.L., and by a National Science Foundation Graduate Research Fellowship (Award

No. 1144244) to B.A.L.

References

1. Round JL, Mazmanian SK. 2009. The gut microbiota shapes intestinal immune responses during health and disease. Nat Rev Immunol 9:313-323. 2. Burighel P. 1997. Urochordata: ascidiacea. Microscopic Anat Invert 221-347. 3. Prada JAH, Haire RN, Allaire M, Jakoncic J, Stojanoff V, Cannon JP, Litman GW, Ostrov DA. 2006. Ancient evolutionary origin of diversified variable regions demonstrated by crystal structures of an immune-type receptor in amphioxus. Nature Immunol 7:875-882. 4. Liberti A, Melillo D, Zucchetti I, Natale L, Dishaw LJ, Litman GW, De Santis R, Pinto MR. 2014. Expression of Ciona intestinalis variable region-containing chitin-binding proteins during development of the gastrointestinal tract and their role in host-microbe interactions. PLoS One 9:e94984. 5. Dishaw LJ, Giacomelli S, Melillo D, Zucchetti I, Haire RN, Natale L, Russo NA, De Santis R, Litman GW, Pinto MR. 2011. A role for variable region-containing chitin-binding proteins (VCBPs) in host gut-bacteria interactions. Proc Natl Acad Sci U S A 108:16747-16752. 6. Dishaw LJ, Leigh B, Cannon JP, Liberti A, Mueller MG, Skapura DP, Karrer CR, Pinto MR, De Santis R, Litman GW. 2016. Gut immunity in a protochordate involves a secreted immunoglobulin-type mediator binding host chitin and bacteria. Nat Commun 7:10617. 7. Krupovic M, Prangishvili D, Hendrix RW, Bamford DH. 2011. Genomics of bacterial and archaeal viruses: dynamics within the prokaryotic virosphere. Microbiol Mol Biol Rev 75:610-635. 8. Nanda AM, Thormann K, Frunzke J. 2015. Impact of spontaneous prophage induction on the fitness of bacterial populations and host-microbe interactions. J Bacteriol 197:410-419. 158

9. Sonnenburg JL, Angenent LT, Gordon JI. 2004. Getting a grip on things: how do communities of bacterial symbionts become established in our intestine? Nat Immunol 5:569-573. 10. Donaldson GP, Lee SM, Mazmanian SK. 2016. Gut biogeography of the bacterial microbiota. Nat Rev Microbiol 14:20-32. 11. Leigh B, Karrer C, Cannon JP, Breitbart M, Dishaw LJ. 2017. Isolation and characterization of a Shewanella phage-host system from the gut of the tunicate, Ciona intestinalis. Viruses 9 (3): 60. 12. Vranova E, Inze D, Van Breusegem F. 2002. Signal transduction during oxidative stress. J Exp Bot 53:1227-1236. 13. Gambino M, Cappitelli F. 2016. Mini-review: Biofilm responses to oxidative stress. Biofouling 32:167-178. 14. Higgins CF. 2001. ABC transporters: physiology, structure and mechanism--an overview. Res Microbiol 152:205-210. 15. Abbas A, Adams C, Scully N, Glennon J, O'Gara F. 2007. A role for TonB1 in biofilm formation and quorum sensing in Pseudomonas aeruginosa. FEMS Microbiol Lett 274:269-278. 16. Torres AG, Redford P, Welch RA, Payne SM. 2001. TonB-dependent systems of uropathogenic Escherichia coli: aerobactin and heme transport and TonB are required for virulence in the mouse. Infect Immun 69:6179-6185. 17. Cursino L, Li Y, Zaini PA, De La Fuente L, Hoch HC, Burr TJ. 2009. Twitching motility and biofilm formation are associated with tonB1 in Xylella fastidiosa. FEMS Microbiol Lett 299:193-199. 18. Leigh BA, Liberti A, Dishaw LJ. 2016. Generation of germ-free Ciona intestinalis for studies of gut-microbe interactions. Front Microbiol 7:2092. 19. Chiba S, Sasaki A, Nakayama A, Takamura K, Satoh N. 2004. Development of Ciona intestinalis juveniles (through 2nd ascidian stage). Zoolog Sci 21:285-298. 20. Barr JJ, Auro R, Furlan M, Whiteson KL, Erb ML, Pogliano J, Stotland A, Wolkowicz R, Cutting AS, Doran KS, Salamon P, Youle M, Rohwer F. 2013. Bacteriophage adhering to mucus provide a non-host-derived immunity. Proc Natl Acad Sci U S A 110:10771-10776. 21. Dishaw LJ, Flores-Torres J, Lax S, Gemayel K, Leigh B, Melillo D, Mueller MG, Natale L, Zucchetti I, De Santis R, Pinto MR, Litman GW, Gilbert JA. 2014. The gut of geographically disparate Ciona intestinalis harbors a core microbiota. PLoS One 9:e93386. 22. Leigh BA, A. Djurhuus, M. Breitbart and L.J. Dishaw. 2017. The gut virome of the protochordate model organims, Ciona intestinalis. Virus Research. 23. Li H, Limenitakis JP, Fuhrer T, Geuking MB, Lawson MA, Wyss M, Brugiroux S, Keller I, Macpherson JA, Rupp S, Stolp B, Stein JV, Stecher B, Sauer U, McCoy KD, Macpherson AJ. 2015. The outer mucus layer hosts a distinct intestinal microbial niche. Nat Commun 6:8292. 24. Johansson ME, Larsson JM, Hansson GC. 2011. The two mucus layers of colon are organized by the MUC2 mucin, whereas the outer layer is a legislator of host- microbial interactions. Proc Natl Acad Sci U S A 108 Suppl 1:4659-4665.

159

25. Dishaw LJ, Cannon JP, Litman GW, Parker W. 2014. Immune-directed support of rich microbial communities in the gut has ancient roots. Dev Comp Immunol 47:36-51. 26. Waller AS, Yamada T, Kristensen DM, Kultima JR, Sunagawa S, Koonin EV, Bork P. 2014. Classification and quantification of bacteriophage taxa in human gut metagenomes. ISME J 8:1391-1402. 27. Duerkop BA, Clements CV, Rollins D, Rodrigues JL, Hooper LV. 2012. A composite bacteriophage alters colonization by an intestinal commensal bacterium. Proc Natl Acad Sci U S A 109:17621-17626. 28. Hargreaves KR, Kropinski AM, Clokie MR. 2014. Bacteriophage behavioral ecology: How phages alter their bacterial host's habits. Bacteriophage 4:e29866. 29. Swidsinski A, Loening-Baucke V, Theissig F, Engelhardt H, Bengmark S, Koch S, Lochs H, Dorffel Y. 2007. Comparative study of the intestinal mucus barrier in normal and inflamed colon. Gut 56:343-350. 30. Minot S, Sinha R, Chen J, Li H, Keilbaugh SA, Wu GD, Lewis JD, Bushman FD. 2011. The human gut virome: inter-individual variation and dynamic response to diet. Genome Res 21:1616-1625. 31. Minot S, Bryson A, Chehoud C, Wu GD, Lewis JD, Bushman FD. 2013. Rapid evolution of the human gut virome. Proc Natl Acad Sci U S A 110:12450-12455. 32. Reyes A, Haynes M, Hanson N, Angly FE, Heath AC, Rohwer F, Gordon JI. 2010. Viruses in the faecal microbiota of monozygotic twins and their mothers. Nature 466:334-338. 33. Silveira CB, and F.L. Rohwer. 2016. Piggyback-the-Winner in host-associated microbial communities. Biofilms Microbiomes 2:16010. 34. Knowles B, Silveira CB, Bailey BA, Barott K, Cantu VA, Cobian-Guemes AG, Coutinho FH, Dinsdale EA, Felts B, Furby KA, George EE, Green KT, Gregoracci GB, Haas AF, Haggerty JM, Hester ER, Hisakawa N, Kelly LW, Lim YW, Little M, Luque A, McDole-Somera T, McNair K, de Oliveira LS, Quistad SD, Robinett NL, Sala E, Salamon P, Sanchez SE, Sandin S, Silva GG, Smith J, Sullivan C, Thompson C, Vermeij MJ, Youle M, Young C, Zgliczynski B, Brainard R, Edwards RA, Nulton J, Thompson F, Rohwer F. 2016. Lytic to temperate switching of viral communities. Nature 531:466-470. 35. Flemming HC, Wingender J. 2010. The biofilm matrix. Nat Rev Microbiol 8:623- 633. 36. Allen HK, Looft T, Bayles DO, Humphrey S, Levine UY, Alt D, Stanton TB. 2011. Antibiotics in feed induce prophages in swine fecal microbiomes. MBio 2. 37. Zhang X, McDaniel AD, Wolf LE, Keusch GT, Waldor MK, Acheson DW. 2000. Quinolone antibiotics induce Shiga toxin-encoding bacteriophages, toxin production, and death in mice. J Infect Dis 181:664-670. 38. Diard M, Bakkeren E, Cornuault JK, Moor K, Hausmann A, Sellin ME, Loverdo C, Aertsen A, Ackermann M, De Paepe M, Slack E, Hardt WD. 2017. Inflammation boosts bacteriophage transfer between Salmonella spp. Science 355:1211-1215. 39. Bollinger RR, Everett ML, Wahl SD, Lee YH, Orndorff PE, Parker W. 2006. Secretory IgA and mucin-mediated biofilm formation by environmental strains of Escherichia coli: role of type 1 pili. Mol Immunol 43:378-387. 160

40. Thomas AD, Parker W. 2010. Cultivation of epithelial-associated microbiota by the immune system. Future Microbiol 5:1483-1492. 41. Pratt LA, Kolter R. 1998. Genetic analysis of Escherichia coli biofilm formation: roles of flagella, motility, chemotaxis and type I pili. Mol Microbiol 30:285-293. 42. Branda SS, Vik S, Friedman L, Kolter R. 2005. Biofilms: the matrix revisited. Trends Microbiol 13:20-26. 43. Rao D, Webb JS, Kjelleberg S. 2005. Competitive interactions in mixed-species biofilms containing the marine bacterium Pseudoalteromonas tunicata. Appl Environ Microbiol 71:1729-1736. 44. Saravanan P, Nancharaiah YV, Venugopalan VP, Rao TS, Jayachandran S. 2006. Biofilm formation by Pseudoalteromonas ruthenica and its removal by chlorine. Biofouling 22:371-381. 45. De Weirdt RaTVdW. 2015. Micromanagement in the gut: microenvironmental factors govern colon mucosal biofilm structure and functionality. Biofilms Microbiomes 1. 46. Simmons M, Drescher, K., Nadell, C. and Bucci, V. 2017. Phage mobility is a core determinant of phage-bacteria coexistence in biofilms. bioRxiv 086462. 47. Madsen JS, Burmolle M, Hansen LH, Sorensen SJ. 2012. The interconnection between biofilm formation and horizontal gene transfer. FEMS Immunol Med Microbiol 65:183-195. 48. Molin S, Tolker-Nielsen T. 2003. Gene transfer occurs with enhanced efficiency in biofilms and induces enhanced stabilisation of the biofilm structure. Curr Opin Biotechnol 14:255-261. 49. Bille E, Meyer J, Jamet A, Euphrasie D, Barnier JP, Brissac T, Larsen A, Pelissier P, Nassif X. 2017. A virulence-associated filamentous bacteriophage of Neisseria meningitidis increases host-cell colonisation. PLoS Pathog 13:e1006495. 50. Ackermann H-W, DuBow MS. 1987. Viruses of prokaryotes. CRC Press, Boca Raton, Fla. 51. Patel A, Noble RT, Steele JA, Schwalbach MS, Hewson I, Fuhrman JA. 2007. Virus and prokaryote enumeration from planktonic aquatic environments by epifluorescence microscopy with SYBR Green I. Nat Protoc 2:269-276. 52. Thurber RV, Haynes M, Breitbart M, Wegley L, Rohwer F. 2009. Laboratory procedures to generate viral metagenomes. Nat Protoc 4:470-483. 53. Ackermann H-W, M. Heldal. 2010. Basic electron microscopy of aquatic viruses. Man Aquatic Viral Ecol:182-192. 54. Deng X, Naccache SN, Ng T, Federman S, Li L, Chiu CY, Delwart EL. 2015. An ensemble strategy that significantly improves de novo assembly of microbial genomes from metagenomic next-generation sequencing data. Nucleic Acids Res 43:e46. 55. Bankevich A, Nurk S, Antipov D, Gurevich AA, Dvorkin M, Kulikov AS, Lesin VM, Nikolenko SI, Pham S, Prjibelski AD, Pyshkin AV, Sirotkin AV, Vyahhi N, Tesler G, Alekseyev MA, Pevzner PA. 2012. SPAdes: a new genome assembly algorithm and its applications to single-cell sequencing. J Comput Biol 19:455- 477. 161

56. Kearse M, Moir R, Wilson A, Stones-Havas S, Cheung M, Sturrock S, Buxton S, Cooper A, Markowitz S, Duran C, Thierer T, Ashton B, Meintjes P, Drummond A. 2012. Geneious Basic: an integrated and extendable desktop software platform for the organization and analysis of sequence data. Bioinformatics 28:1647-1649. 57. Roux S, Enault F, Hurwitz BL, Sullivan MB. 2015. VirSorter: mining viral signal from microbial genomic data. PeerJ 3:e985. 58. Delcher AL, Bratke KA, Powers EC, Salzberg SL. 2007. Identifying bacterial genes and endosymbiont DNA with Glimmer. Bioinformatics 23:673-679. 59. Untergasser A, Cutcutache I, Koressaar T, Ye J, Faircloth BC, Remm M, Rozen SG. 2012. Primer3--new capabilities and interfaces. Nucleic Acids Res 40:e115. 60. Feng J, Meyer CA, Wang Q, Liu JS, Shirley Liu X, Zhang Y. 2012. GFOLD: a generalized fold change for ranking differentially expressed genes from RNA-seq data. Bioinformatics 28:2782-2788. 61. Chen S, Yang P, Jiang F, Wei Y, Ma Z, Kang L. 2010. De novo analysis of transcriptome dynamics in the migratory locust during the development of phase traits. PLoS One 5:e15633.

162

Figures

Prophage Prophage Prophage Bacterial Isolate status morphology genome size SFMu1 SFPat Myoviridae, 45,796 bp, Shewanella sp. 3313 Yes (2) unknown 19,368 bp

Shewanella sp. 5307 No - - 39582 Pseudoalteromonas sp. 6751 Yes (1) Cor5coviridae 10,584 bp Pseudoalteromonas sp. 5315 No - -

Table 1: Description of isolates utilized in this study. Prophages from lysogens are imaged via TEM on the right of the table with Shewanella sp. 3313 maintaining two active phages by mitomycin C (A) and Pseudolateromonas sp . 6751 maintaining only one by mitomycin C induction (B).

A. B.

Shewanella sp. 3313 Pseudoalteromonas sp. 6751 An+-VCBP An+body An+-VCBP An+body

Figure 1: Immunofluorescence of anti-VCBP-C antibody (green) with Shewanella sp.

3313 (A) and Pseudoalteromonas sp. 6751 (B); both stained with DAPI (blue).

163

A Shewanella3313 Prophages sp. 3313 inprophages vitro B Pseudoalteromonas6751 Prophage 39582sp. 6751 in prophagevitro 108 107 * * Control * * Contol 107 VCBP VCBP-C 106 106 105 105 VLPs/mL VLPs/mL 104 104

103 103 4 4 4 4 0 4 4 12 24 48 12 24 48 12 24 48 12 24 48 12 24 48 12 24 48 SFPat SFMu1 SFPat SFMu1 Supernatant Biofilm Supernatant Biofilm Hours post-inoculation Hours post-inoculation C Shewanella3313 in vitro sp. 3313 D Pseudoalteromonas6751 in vitro sp. 6751 109 * * 1010 * * Control Control 109 VCBP VCBP-C 108 108

107

CFUs/mL 6 CFUs/mL 107 10

105

106 104 0 4 4 0 4 4 12 24 48 12 24 48 12 24 48 12 24 48 Supernatant Biofilm Supernatant Biofilm E Hours post-inoculation F Hours post-inoculation Shewanella5307 in vitro sp. 5307 Pseudoalteromonas5315 in vitro sp. 5315 108 108 Control Control VCBP-C VCBP-C 107 107 CFUs/mL CFUs/mL 106 106

105 105 0 4 4 0 4 4 12 24 48 12 24 48 12 24 48 12 24 48 Supernatant Biofilm Supernatant Biofilm Hours post-inoculation Hours post-inoculation

Figure 2: VCBP-C protein on bacterial isolates in vitro shows decreases in live bacteria colony-forming units (CFUs) of lysogens with increases in viral-like particles (VLPs).

Induced prophage particle numbers from the lysogens in both the supernatant and biofilm fractions (A-B) as well as CFUs for all bacteria in both fractions (C-F). Asterisks

164 denote significant differences between control and VCBP-C treated cultures (P value >

.05).

Figure 3: Bacterial colonization of GF Ciona juveniles with bacteria labeled by fluorescent BacLight stain show concentration to the gut for all isolates: Shewanella sp.

3313 (A); Shewanella sp. 5307 (B); Pseudoalteromonas sp. 6751 (C);

Pseudoalteromonas sp. 5315 (D). Brightfield image on right illustrates bacterial localization to the gut of the animals.

165

A 60 * B 400 * Shewanella sp. 5307 Pseudoalteromonas sp. 5315 300 40

200 ddCt ddCt 20 100

0 0 0 4 0 4 100 12 24 48 40 12 24 48 C 168 336 D 168 336 * Shewanella sp. 3313 Pseudoalteromonas sp. 6751 Hours post-inoculation Hours post-inoculation 80 30 * 60 20 ddCt 40 ddCt

20 10

0 0 0 4 0 4 12 24 48 12 24 48 E 168 336 3313F 168 336 6751 7 7Hours post-inoculation6 3313 33134 4 7 4 7Hours post-inoculation7 3 3 3 1×10 1×10 7 1×10 1×103313 1×104 SFPat 10 1×10 10 10 1×10 1×10 1×10 1×10 1×10 6751 6751 6751 Prophage 39582 107 SFPat SFPatSFPat 1×103 SFMu 6 6 6 3 8×103 3 10 3 10 Prophage10 39582Prophage Prophage8×102 8×102 8×102 6 8×10 8×10 VLPs/animal 8×10 VLPs/animal VLPs/animal VLPs/animal VLPs/animal 6 6 SFMuVLPs/animal VLPs/animal 1×10 1×10 1×10106 SFMu SFMu 5 5 5 539582 839582×102

1×10 3 10 10 10 VLPs/animal 3 6×10 3 3 2 2 2 1×105 5 6×10 6×10 6×10 6×10 6×10 6×10 5 5 10 4 4 4 1×10 1×10 4×103 10 10 10 6×102 4 3 3 3 2 2 2 CFUs/animal 4×10 4×10 4×10 4×10 4×10 4×10 1×10410 4 3 3 3 1×10 2×103 10 10 10 2 CFUs/animal CFUs/animal CFUs/animal CFUs/animal CFUs/animal 4 4 CFUs/animal 4×10 1×10 1×10 103 3 3 3 2 2 2 3 2×10 2×10 2 2×10 2 2 2×10 2×10 2×10 1×10CFUs/animal 0 10 10 10 0 5 10 2 102 2×10 1×103 1×103 1×103 Hours post-inoculation0 0 101 0 101 101 0 0 0 0 05 101 0 510 10 10 20 30 40 500 05 0 510 10 0 10 20 30 40 50 Hours post-inoculationHours0 post-inoculation10Hours post-inoculation 20 30 Hours post-inoculation40 Hours post-inoculation50 Hours post-inoculation Hours post-inoculation Figure 4: VCBP-C expression of GF Ciona juveniles during mono-colonization with the single isolates Shewanella sp. 5307 (A), Pseudoalteromonas sp. 5315 (B), Shewanella sp. 3313 (C) and Pseudoalteromonas sp. 6751 (D). The bacteria and prophages also were enumerated during the colonization process of both lysogens: Shewanella sp.

3313 (E) and Pseudoalteromonas sp. 6751 (F). Asterisks indicate significance (P value

> 0.05) as determined by Welch’s t-test with a confidence interval of 95%.

166

Figure 5: TEM images of the purified viral fraction of 6751 cultures induced by both mitomycin C (A) and VCBP-C (B).

3313Shewanella VCBP-C Suspension sp. 6751Pseudoalteromonas VCBP-C Suspension sp. 3313 6751 A. 1.5 B. 1.5 Control Control VCBP VCBP 1.0 1.0 600 600 OD OD 0.5 0.5

0.0 0.0 0 5 0 5 10 15 10 15 5307Hours ShewanellaVCBP-C post-inoculation Suspsension sp. 5315PseudoalteromonasHours VCBP-C post-inoculation Suspension sp. C. 5307 D. 5315 1.5 1.5 Control Control VCBP-C VCBP-C 1.0 1.0 600 600 OD OD 0.5 0.5

0.0 0.0 0 5 10 150 5 10 15 Hours post-inoculation Hours post-inoculation

Figure S1: Bacterial growth in suspension of cultures in the presence of VCBP-C shows no significant decrease in bacterial turbidity with any isolate.

167

A. B. *

0.2 40.0 100.0 200.0 0.3 600.0 1000.0 2000.0 Normalized expression Normalized expression

Figure S2: Shewanella sp. 3313 transcriptome of genes up-regulated (A) and down- regulated (B) in VCBP-C treated stationary cultures compared to the control at two hours post-inoculation. Asterisks denote the genes discussed in results.

168