Molecular Interactions Between PVT1 Transcripts and C-Myc

City University of New York (CUNY) CUNY Academic Works

School of Arts & Sciences Theses Hunter College

Summer 8-9-2018

Molecular interactions between PVT1 transcripts and c-Myc

Onayemi Titilayo Onagoruwa CUNY Hunter College

How does access to this work benefit ou?y Let us know!

More information about this work at: https://academicworks.cuny.edu/hc_sas_etds/364 Discover additional works at: https://academicworks.cuny.edu

This work is made publicly available by the City University of New York (CUNY). Contact: [email protected] Molecular interactions between PVT1 transcripts and c-Myc

Onayemi Titilayo Onagoruwa

Submitted in partial fulfillment of the requirements for the degree of Master of Arts in Biology, Hunter College The City University of New York

2018

Thesis Sponsor:

August 9, 2018 Olorunseun Ogunwobi, MD, PhD Date

August 9, 2018 Jill Bargonetti, PhD Date

Dedication

To the Ultimate Source of Wisdom, Knowledge and Understanding.

2 Acknowledgements

This research was made possible by the support and guidance that I have received from the

Ogunwobi Laboratory. I would like to express my deepest gratitude to Dr. Olorunseun

Ogunwobi for allowing me to conduct this research in his laboratory. I thank him for his support, guidance, mentorship, and encouragement.

Many, many thanks to the lab’s post doc (Gargi Pal), and the PhD candidates (Jeannette

Huaman, Michelle Naidoo, and Trisheena Harricharran ) for always taking out time to answer all my questions and show me how to do things. I would also like to thank all the other lab members

(both current and past) for their support and cooperation.

I’m very fortunate to have wonderful people always supporting me. To my mother and father

(Mr and Mrs Kayode and Adebowale Onagoruwa)- “modupe pupo, e jeun omo pe”, my siblings and their families (my late sister Sola - always in my memory, Seyi and Ebun, Ayodele, Nike,

Ayoku), my Aunt and Uncle (Funmi and Ariyo), my ever-supportive mentor (Dr. Lynne Glasser of Mount Sinai Hospital, New York), friends and co-workers who helped made this possible.

Thank you so much for all your financial and moral support.

3 Table of Contents

1 Abstract…………………………………………………………………………………6

2 List of Abbreviations……………………………………………………………………8

3 List of Figures…………………………………………………………………………...9

4 Introduction

a. Background………………………………………………………………………...10

b. PVT1 structure and transcripts…………………………………………………….13

c. PVT1 and prostate cancer………………………………………………………….13

d. MYC and prostate cancer…………………………………………………………14

e. PVT1 and c-Myc network in prostate cancer……………………………………...18

f. Project Rationale…………………………………………………………………...19

g. Experimental Workflow……………………………………………………………20

5 Materials and Methods……………………………………………………………...... 22

6 Results

a. Silencing PVT1 exon 9 decreases the expression of PVT1 exons 4A and exon

4B; and c-Myc………………………………………………………………………26

b. Overexpression of PVT1 exon 4A, exon 4B, and 9 validates the molecular

relationship between these exons and c-Myc………………………………………28

c. PVT1 exon 9 is abundantly expressed in RWPE1 cells and is a regulatory portion of

the PVT1 gene……………………………………………………………………...30

d. c-Myc is regulated by PVT1 exon 9 transcriptionally……………………………...32

7 Discussion………………………………………………………………………………34

4 8 Future Directions……………………………………………………………………….35

9 References………………………………………………………………………………36

5 Abstract

Molecular interactions between PVT1 transcripts and c-Myc It is crucial to understand the interactions of the molecular participants underlying prostate cancer. Prostate cancer (PCa), which is one of the leading causes of death in men worldwide, has been shown to be associated with an overexpression of the PVT1 gene. Aggressive prostate cancer (PCa) disproportionately affects males of African ancestry (MoAA). The PVT1 gene has a strong positive correlation with c-Myc and are both located in close proximity at chromosome

8q24 in humans. This site is among the top targets of copy number gain and alterations in cancer. A previous study done in the Ogunwobi Laboratory demonstrated that PVT1 exon 9 may be associated with aggressive PCa in MoAA. Additionally, in another unpublished study by the Ogunwobi Laboratory, overexpression of PVT1 exons 4A, 4B and 9 is peculiar of PCa in

MoAA. However, previous works have not investigated the molecular interrelationships between

PVT1 exons 4A, 4B and 9, regulate and c-Myc located immediately upstream of PVT1 at chromosome 8q24. In particular, the PVT1 transcripts that perform the major regulatory tasks in this network have not been investigated. This study focused on determining the molecular relationships between PVT1 exons 4A, 4B, 9 and c-Myc.

To explore this, RWPE-1 cells (non-tumorigenic human prostate epithelial cells) were transfected with siRNAs specifically targeting PVT1 exons 4A, or 4B, or 9. The transfected cells were then analyzed in turn for the relative expression of PVT1 exons 4A, 4B, 9 and c-Myc by quantitative polymerase chain reaction (qPCR). This initial result was validated by the transfection of RWPE1 cells with plasmids of PVT1 exons 4A, 4B and 9. Western blots were also performed to assess the corresponding effects on c-Myc protein expression.

6 There is significant regulatory interaction between PVT1 exons 4A, 4B and 9; and c-Myc which is strongest between PVT1 exon 9 and c-Myc. Interestingly, the knockdown of PVT1 exons 4A, 4B and 9 by siRNAs did not suppress c-Myc protein level in RWPE1 cells.

Nevertheless, PVT1 exon 9 appears to be a major regulatory part of the PVT1 gene.

Understanding the roles of the different PVT1 exons, and their regulatory functions in relation to c-Myc will likely have implications for prostate cancer and other diseases where

PVT1 or c-Myc are dysregulated.

7 List of Abbreviations PVT1 Plasmacytoma variant translocation 1 c-MYC Cellular Myelocytomatosis

PCa Prostate cancer

CRPC Castration-resistant prostate cancer

MoAA Males of African Ancestry qPCR Quantitative polymerase chain reaction

PSA Prostate-specific antigen

TNM Tumor Node and Metastasis

SNP Single nucleotide polymorphisms

ChIP Chromatin Immunoprecipitation

8 List of figures Fig. 1. PVT1 is located on the 8q24 region downstream of MYC……………………………16

Fig. 2. Silencing PVT1 exon 9 decreases the expression of PVT1 exons 4A and exon

4B; and c-Myc………………………………………………………………………………27-28

Fig. 3. Overexpression of PVT1 exon 4A, exon 4B and exon 9 validates the molecular relationship between these exons and c-Myc………………………………………………..29-30

Fig. 4 PVT1 exon 9 is abundantly expressed in RWPE1 cells and contributes to the regulatory portion of PVT1 gene………………………………………………………………………..30-31

Fig. 5 c-Myc is regulated by PVT1 exon 9 transcriptionally…………………………………33

9 Introduction

Background One in nine men will be diagnosed with prostate cancer during his lifetime [ 1]. Prostate cancer is the second leading cause of cancer death in American men, behind lung cancer. About one in 41 men will die of prostate cancer. In 2018, there will be about 164,690 new cases of prostate cancer and about 29,430 deaths from prostate cancer in the United States based on the

American Cancer Society’s estimates for prostate cancer for 2018 [1]. The incidence of prostatic cancer increases with age. Any man with circulating androgens who lives long enough will develop microscopic prostate cancer. The increasing growth in the number and proportion of individuals aged 60 years and above means there will be more men diagnosed with prostate cancer.

The current methods to predict the outcome of prostate cancer are based on PSA levels at diagnosis, Gleason score, clinical TNM stage and tumor markers (DNA or RNA). Normograms and multifactor classification schemes, based on common factors (age, PSA, Gleason score, stage) are used to assess for biochemical relapse (rising PSA and local recurrence) [ 2]. Most of those diagnosed will not die of prostate cancer and some may not even need to be treated.

Current treatment options for localized prostate cancer include watchful waiting, depletion of androgens through radical prostatectomy, radiotherapy or pharmacotherapy. While nearly all patients respond to androgen deprivation, the response in some patients is short-lived, and the disease recurs as castration-resistant prostate cancer (CRPC) [3].

Many risk factors including endogenous (age, ethnicity, hormones, family history, oxidative stress) and exogenous factors (diet, environmental agents, lifestyle) have been attributed to PCa (prostate cancer) [4]. The highest incidence rates for prostate cancer are among

10 African-American men, who have a higher risk of prostate cancer than white American men [4].

However, racial disparity may be subsequent to healthcare access dissimilarity, delay in seeking medical attention and follow-up, and variations in allelic frequencies of microsatellites at the androgen receptor (AR) locus [4].

Molecular genetics has also proved to be an invaluable tool in the understanding of PCa.

Differentiating between aggressive and non-aggressive PCa is required for effective intervention in the treatment of PCa. Patients at high risk will be promptly identified and treated appropriately. The many prediction tools of PCa survival which are being utilized currently have limitations. They are all generally poor prognosticators. Genetic susceptibility studies as well as gene expression panels can provide additional tools for the status of PCa progression [5], [6]. For example, methylation status of APC, GSTP1, and MDR-1 gene promoters have proven to be significantly correlated with clinicopathologic findings in prostate cancer and can be combined with the current biomarkers [6].

Multiple molecular mechanisms have been implicated in the progression of PCa. They include prostate-cancer susceptibility loci, loss of suppressor genes, chromosomal translocation, and more importantly, the androgen receptor [7]. Genome-wide analyses have implicated several genes and loci associated with risk and progression to PCa. Multiple genome-wide approaches can identify genotype germline variants, including both SNPs and CNVs, detect somatic DNA copy number changes, and assess DNA methylation status. Genome wide association study

(GWAS) using blood DNA samples from individuals with clinically detected prostate cancer identified 8q24 and 17q as common loci associated with prostate cancer [8].

Many studies have confirmed 8q24 as the most frequently gained chromosomal region in prostate tumors [9], [10], and there is great possibility that the associated risk variants and SNPs

11 could predispose to prostate cancer through increased genomic instability [11]. This region is home to the MYC proto-oncogene, a well-known protein coding gene. Although MYC is frequently found to be amplified across many cancers [12], there appears to be an interplay with other 8q24 transcripts. Besides MYC, other transcripts from chromosome 8q24 include

POU5F1B, PRNCR1 (prostate cancer non‐coding RNA 1), PVT1 (plasmacytoma variant translocation; also a non-coding RNA) and a host of PVT1-encoded micro-RNAs ((miR-1204, miR-1205, miR-1206, miR-1207-3p, miR-1207-5p, miR-1208) [13]. SNPs studies of chromosomes 8q24 have revealed many sites of susceptibility to prostate cancer [8], [11].

Non-coding RNAs (ncRNAs) are RNA transcripts from genes not encoding for a protein

[14]. Non-coding RNAs can be grouped into two major classes based on the transcript size: (1) small ncRNAs less than 200 bp, such as piRNAs (Piwi-associated RNAs), miRNAs

(microRNAs), and snoRNAs (small nucleolar RNAs), and (2) long ncRNAs (lncRNAs), greater than 200 bp. Many studies have demonstrated that the lncRNAs are involved in the regulation of many biological processes involving regulation of gene expression, transcription, translation, cell cycle control, chromatin modification and cellular differentiation [15], [16], [17], [18], [19], [20], [21],

[22]. Aberrant expression of lncRNAs have been observed in cancer and may serve as predicting tools for patient outcomes [23], [24].

Plasmacytoma variant translocation 1 (PVT1), a long non-coding RNA encoded by the human PVT1 gene, is in the well-known cancer-related region, 8q24. Chromosome 8q24 copy- number amplification is one of the most frequent occurrences in many malignant conditions, and therefore, PVT1 is an oncogene for many cancers. PVT1 frequently acts as an inducer of cell proliferation and an inhibitor of apoptosis. Overall, the expression levels of PVT1 appear to be higher (up to 100 times) in cancer cells and tissues than in normal human primary cells and

12 tissues [25], [26]. An increased expression of PVT1 was observed when the risk allele of rs378854 at chromosome 8q24 is present in prostate tissue, thereby increasing the risk for prostate cancer

[27].

PVT1 structure and transcripts

The human PVT1 gene is a large locus (>30 kb), spanning from 128806779 to

129113499, 57 kb downstream of the MYC gene. The PVT1 locus encodes alternative transcripts but there are no proteins produced [28], [29]. The PVT1 locus contains a variety of exons (12 annotated ones) and are termed 1a, 1b, 1c, 2, 3a, 3b, 4a, 4b, 5, 6, 7, 8, 9 and 10 [30],

[Figure 1]. Some of the exons are more commonly used than the others. Lots of questions still need to be answered regarding the functions of PVT1, though strong suggestions point to its role as a regulatory RNA [31]. MicroRNAs have garnered much interest in the past few years especially in relation to cancer biogenesis and progression. MicroRNAs (miRNAs) are 19-24 nucleotide non-coding RNA molecules that regulate the expression of target mRNAs both at the transcriptional and translational level [32], [33]. PVT1 encodes six miRNAs, that is miR-1204, miR-1205, miR-1206, miR-1207-3p, miR-1207-5p, and miR-1208. PVT1 and miR-1204 have a strong correlation of expression as they share promoters and are probably under the same regulatory circuit [34], [35]. The other miRNAs have shown possible correlation with different cancers but appears to be distinctively regulated [34], [27].

PVT1 transcripts and prostate cancer

Although many studies have been carried out on the role of PVT1 in cancer, nonetheless, the specific roles of PVT1 transcripts in prostate cancer have been examined by very few groups.

13 The Ogunwobi Laboratory reported that PVT1 exon 9 is significantly overexpressed in PCa cell lines derived from men of African Ancestry (MoAA) [36]. This observation was made from comparing the relative expression of PVT1 exons in different cell lines derived from men of different ethnic and racial backgrounds. This novel discovery, if explored, can lead to more insights into the molecular mechanisms of the deadly aggressive PCa.

Furthermore, the Ogunwobi Laboratory also described correlation between miR-1207-3p expression and clinicopathological features of PCa [37]. Increased expression of miR-1207-3p was found in PCa tissue samples of patients who succumbed to PCa specific death.

Paradoxically, the expression of miR-1207-3p in PCa tissues of MoAA (men of African

Ancestry) was significantly decreased and might explain the genetic differences underlying racial disparity in PCa. Although these studies have opened the possibilities of new diagnostic biomarkers in PCa, further clarification are needed to explore how these transcripts are regulated and if they regulate each other.

MYC and prostate cancer

MYC is one of the well-known oncogenes. The MYC gene encodes for a basic-helix- loop-helix leucine zipper (bHLH-Zip) transcription factor that can act as an activator and repressor. The MYC proto-oncogene family, comprising c-MYC (8q24), n-MYC (2p24) and l-

MYC (1p34), has been shown to be involved in many cellular processes including cell growth and proliferation, cell cycle, differentiation, cell adhesion and migration, angiogenesis and metabolism [38], [39], [40]. The c-MYC proto-oncogene encodes a transcription factor, c-MYC, the cellular homologue to the viral oncogene (v-MYC) of the avian myelocytomatosis retrovirus

[38]. c-MYC, located at chromosome 8q24, is normally tightly controlled by external signals 14 including growth factors, mitogens and β-catenin, which promote cell proliferation and factors such as TGF-β, which inhibit. c-MYC activates a variety of known target genes as part of a heterodimeric complex with its partner protein, MAX. MYC–MAX heterodimers bind specific

DNA sequences, such as the E-box sequence CACGTG found in promoter of the target genes

[41]. MYC-MAX heterodimers can then regulate transcription of target genes.

While many target genes are upregulated by MYC, some genes, particularly those participating in cell cycle arrest are downregulated by MYC. c-Myc overexpression is mainly due to gene amplification, and it is associated with aggressive PCa and poor clinical prognosis

[42], [43], [44], [45]. Nevertheless, finding consistent correlation between risk alleles and c-Myc expression has proved to be a daunting task in PCa. Studies have revealed conflicting results. For example, a study reported upregulated c-Myc expression in association with a risk allele [46], while another failed to observe such correlation [47].

A more promising and convincing feature is the association of epigenetic markers with risk alleles in a tissue specific manner [48], [49]. These studies have demonstrated that regulatory elements such as the enhancers in risk loci have cell type specific histone modifications which correlate with cell type specific gene expression, and these appear to be tissue specific regulators of c-MYC [50], [51], [52]. Sotelo et al, demonstrated that the same mechanism occurs in prostate cancer where an enhancer element interacts with the MYC promoter via transcription factor Tcf-

4 binding and operates in a tissue specific manner to regulate MYC expression [53]. But some studies have reported conflicting results as well, for instance a risk allele enhancer had significant binding activity to both MYC and the nearby PVT1 promoters in a study of the 8q24

PCa risk locus and MYC expression [54].

Activation of the proto-oncogene c-Myc is one of the earliest somatic molecular alterations that occur at the transition in benign prostatic epithelial cells to PIN (prostatic intraepithelial neoplasia) and adenocarcinoma. Other epigenetic changes at this stage may include GSTP1 promoter hypermethylation, and telomere shortening [55], [ 56]. In prostate cancer, studies have shown highly consistent upregulation of c-Myc at the mRNA level in most patient samples [57], [58], [59]. Similarly, c-Myc protein was frequently overexpressed in PIN, incrementally from normal to low-grade PIN to high-grade PIN [55]. Additionally, overexpression of c-Myc in mouse models suggests that c-Myc is sufficient to transform normal prostatic cells into PIN [60], [61], however, some studies demonstrated that such transformation occur only when c-Myc acted in conjunction with other genes [62], [63].

Direct inhibition of the overexpression of c-Myc in cancers has been difficult to achieve because of the numerous factors affecting its high turnover rate in cells. While there are many potential pathways to targeting c-Myc in cancers, it has not proved to be effective in clinical treatment. One of the emerging paths of evaluating c-Myc is by its regulation of the non- coding

RNAs, particularly the lncRNAs (long non-coding RNAs) [64], [65], [66]. c-Myc has been shown to have pronounced effect on lncRNA transcription in the MYC-inducible cell line P493-6 [67],

[68]. Several lncRNAs have been implicated in the regulation of c-Myc in prostate cancer. PVT1 can also be transcriptionally activated by c-Myc [69]. Other examples of lncRNAs regulated by c-

Myc in PCa cancer cells include PCAT1 [70], and PCGEM1 [71]. lncRNAs are certainly not the only group of non-coding RNAs regulating c-Myc. In an unpublished study by the Ogunwobi

Laboratory, miR-1207-3p which is encoded at the PVT1 gene locus suppressed c-Myc

17 expression in aggressive CRPC cell lines suggesting an example of the regulation of c-Myc by a microRNA in PCa [72]. As better understanding of the roles of non-coding RNAs in cancer regulation is being unraveled, their potentials as biomarkers will likely become better appreciated.

PVT1 and c-Myc interactions in prostate cancer

Molecular interactions between PVT1 and c-Myc are inevitable given their proximity on the 8q24 chromosomal locus. Many studies have long established the co-amplification of c-Myc and PVT1 in many cancers [73], [74], [75]. PVT1 has been shown to be an activator of c-Myc transcription, and likewise, c-Myc has also been implicated as a PVT1 activator in cancer cells

[28], [74], [76]. The human PVT-1 gene contains two non-canonical MYC-binding sites (E-box

CACGCG) in the promoter region proximal to the transcriptional start site [77]. In a study by

Carramusa and colleagues, it was indicated that one of the two E-boxes is important for PVT1 promoter transcriptional regulation by c-Myc proteins [77]. ChIP analysis of the same region in neuroblastoma cells revealed a novel network between PVT1 and N-Myc.

The possibility of common functional pathways has been described, yet, there is also evidence for independent contribution of PVT1 and MYC to tumorigenesis. By utilizing transgenic mice models, it was demonstrated that a combination of PVT1 and MYC is essential to the formation of tumors [78]. In this instance, PVT1 might be regulating and stabilizing the

MYC protein by preventing MYC from proteolytic degradation. Alternatively, PVT1 contribution to tumorigenesis may be independent of MYC [25]. This suggests different mechanisms of PVT1 and MYC cooperation in different cancers.

18 In prostate cancer cell lines, PVT1 knockdown significantly downregulated the expression of c-Myc as compared to the control [79]. A similar regulation of c-Myc protein by

PVT1 was observed upon PVT1 knockdown by RNA interference in acute promyelocytic leukemia [80]. PVT1 knockdown had no effect on c-Myc RNA but led to the suppression of the

MYC protein level in NB4 cells. Using genome-wide association studies (GWAS), MYC and

PVT1 at 8q24.21 were identified as physically interacting genes at risk SNP loci in most prostate cancer cell lines [81]. The interaction of the chromatin at this risk loci suggests that several regulatory elements are aggregated in multiple fragments to enable gene expression. This might provide some explanation for the PVT1 and MYC interaction in PCa.

A very recent study has brought better illumination to the PVT1 and MYC regulatory network. It showed that the PVT1 promoter, as a DNA element, constrains MYC transcription, whereas the PVT1 RNA product sustains the MYC protein level [82]. The mechanisms of PVT1 and MYC interactions are still not very clear but as more research is being done, better understanding of the processes involved are being gained.

Project Rationale

A previous study done in the Ogunwobi Laboratory [36] has shown that PVT1 exon 9 expression in aggressive PCa cell lines derived from MoAA (men of African Ancestry) was significantly higher than in less aggressive PCa cell lines and PCa cell lines derived from men of other ancestry. This suggests that PVT1 exon 9 may be associated with aggressive PCa, which disproportionately affects MoAA. Furthermore, in another study from the Ogunwobi Laboratory,

PVT1 exons 4A, 4B and 9 were found to be overexpressed in PCa tissues from MoAA [83].

Based on these previous studies, this project seeks to address the molecular interactions between

19 the transcripts from PVT1 exons 4A, 4B, and 9, and if there is any positive correlation with c-

Myc in non-tumorigenic prostate epithelial cells. A better understanding of the interplay between

PVT1 transcripts and c-Myc in non-tumorigenic prostate epithelial cells will provide valuable insights to the underlying mechanisms of dysregulation in PCa.

Based on the above, we hypothesize that one or more of the transcripts from PVT1 exons

4A, 4B, or 9 may be positively correlated with the other in prostate epithelial cells, and that one or more of these transcripts may have a major regulatory role in PVT1 and c-Myc function in prostate epithelial cells.

Experimental Workflow

RWPE1 cells derived from non-tumorigenic prostate epithelial cells were transfected separately with siRNAs specifically targeting PVT1 exons 4A, 4B, and 9. For each PVT1 exon knockdown, the expression of the silenced exon was verified by RNA extraction and qPCR using custom-designed primers All mRNA expression for PVT1 exons and for c-Myc were determined using RNA extraction, cDNA synthesis, and qPCR.

Subsequently, the roles of PVT1 exons 4A, 4B and 9 were confirmed by transfecting

RWPE1 cells with plasmid vectors expressing PVT1 exons 4A, or 4B, or 9, separately. The mRNA expression of the PVT1 exons and c-Myc was then determined by RNA extraction, cDNA synthesis, and qPCR, as before.

Western blotting was also carried out to examine the expression of c-Myc protein in both

RWPE-1 cells transfected with above mentioned siRNAs. All the experiments described included appropriate negative controls at each step.

20 Next, the individual expression of PVT1 exons 4A, 4B and 9 in (non-transfected)

RWPE1 cells was examined. The PCR products were then run on a 1.5% agarose gel and sent out for sequencing to verify the identity of the exons. The PCR sequence of each exon was then run through Blast (Basic Local Alignment Search Tool) to check for sequence similarity

(homology) among the exons.

21 Materials and Methods

Cell Line RWPE1 cells were used for this study. RWPE1 cells are epithelial cells derived from the peripheral zone of a histologically normal prostate from a 54-year-old Caucasian male (CM).

The cells were transfected with a single copy of the human papilloma virus 18 (HPV-18) to establish the cell line. RWPE1 is non-tumorigenic. The cells were purchased from the American

Type Culture Collection (ATCC, Manassas, VA, USA).

Cell Culture and Cell Culture Reagents RWPE1 cells were maintained in Keratinocyte-Serum Free Medium (Life Technologies, Grand

Island, NY, USA), supplemented with 0.05 mg/mL bovine pituitary extract and 5 ng/mL human

Epidermal Growth Factor and, 1% Penicillin/Streptomycin.

PVT1 Exons 4A, 4B and 9 knockdown using small interfering RNA (siRNA) RWPE1 cells were grown in a monolayer in 6-well plates until 70%–80% confluent. SiRNA

(Small interfering RNA) transfection was performed. Cells were transfected with PVT1 exon 9 siRNA, PVT1 exon 4A siRNA, PVT1 exon 4B siRNA with 30 pmol final concentration per well using lipofectamine RNAiMax (Invitrogen Inc., Carlsbad, CA) in Opti-MEM (1X) reduced serum media (Gibco). A non-specific (scramble) control siRNA was also transfected at the same concentration as the negative control. Cells were incubated at 37° C for 72 hours. The cells were then harvested and lysed.

22 Over-expression of PVT1 Exons 4A, 4B and 9 PVT1 exons 4A, 4B and 9 were subcloned into vector pcDNA3.1(+). RWPE1 cells were transfected with the positive vector or with the empty vector as control. Transfection was conducted utilizing Lipofectamine 3000 (Invitrogen) according to the manufacturer’s instructions.

RNA Extraction and qPCR Total RNA was extracted from transfected cells using RNeasy Mini Kit (Qiagen, Germany, cat#

74104). After quantification with Nanodrop1000 spectrophotometer (NanoDrop, Madison, WI,

USA), 1 μg of RNA was reverse-transcribed into cDNA using QuantiTect Reverse Transcription kit (Qiagen, Germany, cat# 205311). Amplification reactions were performed in 25 μL reaction volume using SYBR Green PCR master Mix (Life Technologies, Grand Island, NY, USA cat#

4309155), cDNA template and 0.4 _M final concentration for primers. The thermal cycle profile employed was as follows: 50 _C for 2 min, 10 min initial denaturation at 95 °C, and 40 cycles of

15 s denaturation at 94 °C, 1 min annealing at 65 °C. A dissociation curve was also added at the end of the cycle. The amplifications were carried out on the 7500 Real Time PCR machine

(Applied Biosystems instruments, Grand Island, NY, USA). Messenger RNA (mRNA) expression was assessed in quadruplicates in at least 3 independent experiments and normalized to GAPDH mRNA expression. Relative expression levels were calculated by the Ct method (DD

Ct).

Primer Design and Sequences All primer Design and Sequences are as previously described [36].

23 Agarose gel electrophoresis of PCR products of amplified PVT1 exons 4A, 4B and 9. Agarose gel electrophoresis was performed in 1.5% agarose gels (Amresco) containing 15 μg of ethidium bromide per ml. The gels were electrophoresed on Shelton Scientific IBI® Horizontal

Gel Systems: High Resolution & High Throughput Design, 20 x 25 cm, for 40 minutes at a constant voltage of 100 V and were analyzed by photographing them as they were exposed to

UV light (UVP Inc., Upland, Calif.). Gels were photographed and digitized with the

FOTO/Analyst Archiver system (Fotodyne, Inc., Hartland, Wis.).

Direct Sequencing of PCR products of amplified PVT1 exon 9, exon 4A and exon 4B PCR products of amplified exons were purified by QIAquick PCR Purification Kit (Qiagen,

Valencia, CA) and sent for sequencing at Eton Bioscience, Inc.

Western blot analysis RWPE1 cells were transfected with specific siRNAs for PVT1 exons 4A, or 4B or 9 separately or siRNA controls and lysed using RIPA buffer (Pierce) containing a protease inhibitor cocktail

(Sigma-Aldrich). Equivalent amounts of total protein were separated on SDS/PAGE gels and blotted to a nitrocellulose membrane. The membranes were blocked with 5% BSA and then incubated with primary antibodies probing for c-Myc (Proteintech Group Inc) and α-tubulin

(Rockland antibodies and assays) separately at 4°C overnight. Membranes were later incubated with the appropriate secondary antibodies after washes with TBST. The western blots were analyzed and quantified with Odyssey imager, Image Studio version 5.

Bioinformatics BLAST (Basic Local Alignment Search Tool) at NCBI (http:// www.ncbi.nlm.nih.gov) was done to confirm the identity of the amplified PVT1 exons and examine for sequence homology. 24 Statistical analysis Data are presented as mean ± standard error of the mean (S.E.M) of at least three independent experiments. Statistical significance of differences was assessed using two-tailed Student’s t test. p values less than 0.05 were deemed significant.

25 Results

A. Silencing PVT1 exon 9 decreases the expression of exon 4A, exon 4B and c-Myc To examine the molecular relationship between PVT1 exons 4A, 4B, 9, and c-Myc in prostate cells, the relative expression of transcripts was assessed after knocking down the PVT1 exons.

Each PVT1 exon was knocked down by siRNA specifically targeting it. Using qPCR, the expression of each exon knocked down was confirmed to be lower than that in cells transfected with the negative control. Figure 2 showed a significant decrease in the expression level of the exons after siRNA transfection compared with the matching negative control. As shown in figure

2A, the relative expression of PVT1 exon 4B and PVT1 exon 9, was not statistically significant

(p value=0.22 and p value=0.10 respectively) after knocking down PVT1 exon 4A. However, there is a 30% decrease in the relative expression of c-Myc observed with PVT1 exon 4A knock down (fig. 2A) which is statistically significant at p value=0.04. PVT1 exon 4B knock down produced a decrease in the expression level of the other exons. But this decrease in the relative level of expression is not statistically significant for PVT1 exon 9 (fig. 2B) and PVT1 exon 4A

(fig. 2B) (p value=0.07, and p value=0.17 respectively). C-Myc level of expression was found to be slightly higher than the control (fig. 2B; approximately 1% increase). Taken together, PVT1 exon 4B seems to modulate the expression of PVT1 exon 4A, PVT1 exon 9; and c-Myc through some as yet unknown mechanisms.

PVT1 exon 9 silencing (fig. 2C) revealed a consistent pattern of more than 50% decrease in the relative expression of PVT1 exon 4A (p value=0.005) and PVT1 exon 4B (p value=0.001).

Effect of PVT1 exon 9 silencing on the relative expression of c-Myc is also significant (p value=0.05) (fig. 2C). Consequently, PVT1 exon 9 appears to regulate PVT1 exons 4A and 4B

26 and c-Myc. This finding suggests that PVT1 exon 9 is a major regulatory component of the

PVT1 gene.

Figure 2. Silencing PVT1 exon 9 decreases the expression of exon 4A, exon 4B, and c-Myc. Transfection of siRNA Control or siRNA targeting PVT1 exon 4A, 4B and 9 in RWPE1 cells. Each exon knockdown was initially assessed and verified by qPCR. (A) The effect of PVT1 exon 4A knockdown on mRNA levels of exon 9, 4B and c-Myc. Data shows that there is no consistent pattern in relative expression of these exons compared with the control. (B) The effect of PVT1 exon 4B knockdown on mRNA levels of exon 9, 4A and c-Myc. The relative expression level of these exons was not statistically significant. (C) The effect of PVT1 exon 9 knockdown on mRNA levels of exon 4A, 4B and c-Myc was generally consistent and significant. (Three independent qPCR experiments were performed, and every experiment was set up in quadruplicates. All values are mean ± SD. p < 0.05 is statistically significant).

B. Overexpression of PVT1 exon 4A, exon 4B, and 9 validates the molecular relationship between these exons and c-Myc.

To confirm the regulatory roles of the PVT1 exons as suggested by siRNA studies, PVT1 exons

4A, 4B, and 9 were subcloned into plasmid vectors and transfected separately into RWPE-1

cells. The relative expression of each exon and c-Myc was then verified by qPCR. PVT1 exons

4A and 4B overexpression induced a significant increase in c-Myc expression at p

value=0.001(fig. 3A) and p value=0.04 (fig. 3B) respectively. This suggests a positive

correlation between these exons and c-Myc. Overall, PVT1 exons 4A, 4B, and 9 all

28 significantly induced c-Myc expression. However, PVT1 exons 4A and 4B might contribute more to the regulation of c-Myc.

Figure 3. Overexpression of PVT1 exon 4A, exon 4B, and exon 9 validates the molecular relationship between these exons and c-Myc.

Transfection of control (empty vector) or Plasmid PVT1 exon 4A, 4B and 9 in RWPE-1 cells. The expression of each transfected exon was initially assessed and verified by qPCR. (A) The effect of transfected plasmid PVT1 exon 4A resulted in more than 20% increase in the mRNA expression level of exon 4B, 9 and c-Myc. (B) The effect of transfected plasmid PVT1 exon 4B resulted in an average of 15% increase in the mRNA expression level of exon 4B, and exon 9 compared with the control. The effect on c-Myc is about 50% increase, is statistically significant and appears to have a positive correlation. (C) Transfection of plasmid PVT1 exon 9 resulted in an increase of about 15% in the mRNA expression level of exon 4A, exon 4B, and c-Myc compared with the control. (Three independent qPCR experiments were performed, and every experiment was set up in quadruplicates. All values are mean ± SD. p < 0.05 is statistically significant).

C. PVT1 exon 9 is abundantly expressed in RWPE1 cells and is a regulatory portion of the PVT1 gene. Further characterization of PVT1 exons 4A, 4B and 9 was carried out based on the observations above. Analysis of the relative expression of PVT1 exons 4A, 4B and 9 by qPCR showed PVT1 exon 9 as the most abundantly expressed of the three exons in the non-tumorigenic RWPE1 prostate epithelial cell line. PVT1 exon 9 is about 50% more in expression level compared with

PVT1 exon 4A (fig. 4A), while it is about 25% more compared to PVT1 exon 4B (fig. 4A).

Additionally, the PCR products of these exons were subjected to 1.5% agarose gel electrophoresis which revealed that exon 9 is about 250 bp in size (fig. 4B), while exon 4A and 30 exon 4B are about 230 bp and 120 bp respectively (fig. 4B). Next, the PCR products were sequenced, and the exon DNA sequences were analyzed for homology and identity with BLAST

(Basic Local Alignment Search Tool). PVT1 exon 9 was identified by BLAST as

[>NR_003367.3 Homo sapiens Pvt1 oncogene (non-protein coding) (PVT1), long non-coding

RNA] and identity of 83%. Exon 4A did not reveal any significant homology. However, it produced significant alignment when compared with PVT1 exon 4A in the database.

Exon 4B sequence revealed an identity of 83% and was reported as >NR_003367.3 Homo sapiens Pvt1 oncogene (non-protein coding) (PVT1), long non-coding RNA

[GCAGCAAGCACCTGTTACCTGTCCACCCCCACCCCTTCCCCCAAACTGCCTTTGAAA

AATCCCT] >NR_003367.3 Homo sapiens Pvt1 oncogene (non-protein coding) (PVT1), long non-coding RNA [CCTGTTACCTGTCCACCCCCACCCCTTCCCCCAAACTG]

>NR_003367.3 Homo sapiens Pvt1 oncogene (non-protein coding) (PVT1), long non-coding

RNA[CCTTATGGCTCCACCCAGAAGCAATTCAGCCCAACAGGAGGACAGCTTCA]

Comparisons by BLAST between exon 4A, 4B and 9 revealed no significant similarity. This suggests very distinct identities for these PVT1 exons.

Figure 4. PVT1 exon 9 is abundantly expressed in RWPE-1 and is a regulatory portion of the PVT1 gene. (A) Relative expression of PVT1 expression exon 9, exon 4A and exon 4B. Exon 9 has the highest level of expression among these exons in RWPE1 cells and is a regulatory portion of the PVT1 gene. (B) PCR products of the exons on 1.5% agarose gel revealed the individual bp lengths. (Three independent qPCR experiments were performed, and every experiment was set up in quadruplicates. All values are mean ± SD. p < 0.05 is statistically significant).

D c-Myc is regulated by PVT1 exon 9 transcriptionally.

To further evaluate the association between PVT1 exons 4A, 4B and 9, and c-Myc , RWPE-1 cells were transfected with siRNAs specifically targeting the exons, in addition to a control siRNAs. c-Myc protein level was then analyzed by Western blot. This was also performed to verify if PVT1 exon 9 regulates c-Myc at the post-transcriptional level. Western blot analyses done with repeated experiments showed some correlation between PVT1 exon 9 and c-Myc protein (fig. 5). However, this correlation is not statistically significant. c-Myc appears to be regulated by PVT1 exons, notably exon 9 at the transcriptional level in RWPE1 cells.

Figure 5. c-Myc is regulated by PVT1 exon 9 transcriptionally. Western blot analysis of c-Myc protein in RWPE1 cells. RWPE1 cells were transfected with siRNA PVT1 exon 9, exon 4A and 4B, in addition to siRNA Control. No significant correlation between the exons and c-Myc protein was found. Western blot experiments were performed three separate times.

33 Discussion This study will bring better understanding of the roles played by the different PVT1 exons in prostate cancer. PVT1 is one of the well-known lncRNA genes associated with cancer.

Many studies support the hypothesis that c-Myc and PVT1 form part of an interactive network in many cancers, whereby PVT1 regulates c-Myc post-translationally [78], [80]. But the question of which PVT1 exon plays a regulatory role in this participation with c-Myc still remains.

This study was carried out to elucidate the associations between the PVT1 exons 4A, 4B,

9, and c-Myc in RWPE-1 cells. RWPE-1 cells are derived from normal human prostate epithelial cells. The basis for using RWPE-1 cells is to observe the molecular relationships between these exons and c-Myc in the normal prostate. It is believed that knowledge of these processes will facilitate our understanding of PVT1 dysregulation in prostate cancer. In this study, silencing

PVT1 exons 4A, 4B and 9 decreased the level of expression of each exon and c-Myc at the transcriptional level. PVT1 exon 9 was found to have a more significant correlation compared with PVT1 exon 4A and PVT1 exon 4B. The strongest evidence for the role of PVT1 exon 9 is the statistically significant decrease in the level of expression of PVT1 exon 4A, PVT1 exon 4B and c-Myc when it was silenced. PVT1 exon 9 was also found to have the highest level of expression among these exons in RWPE-1 cells. This suggests that PVT1 exon 9 is a major regulatory part of the PVT1 gene.

There was no significant regulatory effect found between these exons and c-Myc protein.

This may be attributed to many factors including the fact that RWPE1 cells are not transformed

(not cancerous), c-Myc protein might be low in these cells and may even be degraded rapidly.

Silencing PVT1 exon 9 decreases the level of c-Myc protein slightly and appears to regulate c-

Myc at the post-transcriptional level, as well as at the transcriptional level. This will need additional studies to confirm. 34 Identifying these molecular relationships will assist in furthering our understanding of

PVT1 and c-Myc, and their roles in prostate cancer and other diseases where they are dysregulated.

Future Directions Additional studies will need to be carried out for more detailed explanation for the roles of these

PVT1 exons, particularly for exon 9. Utilizing CRISPRi to silence the exons will yield better results in these experiments. Identifying the sites of PVT1 exons–c-Myc protein interactions may determine the mechanisms of regulation involved. Determining the half-life studies of c-Myc protein in RWPE-1 cells can highlight how these exons regulate c-Myc protein. In vivo studies involving PVT1 exons 4A, 4B, and 9 can be very helpful in translating these interactions to clinical strategies. Furthermore, the role of the PVT1 exons in the stability of c-Myc protein, if examined, will expand the understanding of PVT1 and c-Myc interactions.

References

1 Key Statistics for Prostate Cancer. Available at https://www.cancer.org/cancer/prostate-cancer/ about/key-statistics.html

2 Ohori, Makoto, et al. "Predicting the presence and side of extracapsular extension: a nomogram for staging prostate cancer." The Journal of urology 171.5 (2004): 1844-1849.

3 Karantanos, Theodoros, Paul G. Corn, and Timothy C. Thompson. "Prostate cancer progression after androgen deprivation therapy: mechanisms of castrate resistance and novel therapeutic approaches." Oncogene 32.49 (2013): 5501.

4 Bostwick, David G., et al. "Human prostate cancer risk factors." Cancer: Interdisciplinary International Journal of the American Cancer Society 101.S10 (2004): 2371-2490.

5 Varambally S, Yu J, Laxman B, Rhodes DR, Mehra R, Tomlins SA, Shah RB, Chandran U, Monzon FA, Becich MJ, Wei JT, Pienta KJ, Ghosh D, Rubin MA, Chinnaiyan AM. Integrative genomic and proteomic analysis of prostate cancer reveals signatures of metastatic progression. Cancer Cell 2005 Nov;8(5):393-406

6 Enokida, Hideki, et al. "Multigene methylation analysis for detection and staging of prostate cancer. “Clinical Cancer Research 11.18 (2005): 6582-6588.

7 Shand, Randi L., and Edward P. Gelmann. "Molecular biology of prostate-cancer pathogenesis. “Current opinion in urology16.3 (2006): 123-131.

8 Eeles, Rosalind A., et al. "Multiple newly identified loci associated with prostate cancer susceptibility. " Nature genetics 40.3 (2008): 316.

9 van Duin, Mark, et al. "High‐resolution array comparative genomic hybridization of chromosome arm 8q: evaluation of genetic progression markers for prostate cancer." Genes, Chromosomes and Cancer 44.4 (2005): 438-449.

10 Haiman, Christopher A., et al. "Multiple regions within 8q24 independently affect risk for prostate cancer." Nature genetics39.5 (2007): 638.

11 Gudmundsson, Julius, et al. "Genome-wide association study identifies a second prostate cancer susceptibility variant at 8q24." Nature genetics 39.5 (2007): 631. 36

12 Beroukhim, Rameen, et al. "The landscape of somatic copy-number alteration across human cancers. " Nature 463.7283 (2010): 899.

13 Huppi, Konrad, et al. "The identification of microRNAs in a genomically unstable region of human chromosome 8q24." Molecular Cancer Research 6.2 (2008): 212-221.

14 Kapranov, Philipp, et al. "RNA maps reveal new RNA classes and a possible function for pervasive transcription " Science316.5830 (2007): 1484-1488.

15 Wang, Kevin C., and Howard Y. Chang. "Molecular mechanisms of long noncoding RNAs." Molecular cell 43.6 (2011): 904-914.

16 Wang, Xiangting, et al. "Induced ncRNAs allosterically modify RNA-binding proteins in cis to inhibit transcription." Nature454.7200 (2008): 126.

17 Schwartz, Jacob C., et al. "Antisense transcripts are targets for activating small RNAs. " Nature structural & molecular biology 15.8 (2008): 842.

18 Kino, Tomoshige, et al. "Noncoding RNA gas5 is a growth arrest–and starvation-associated repressor of the glucocorticoid receptor." Sci. Signal. 3.107 (2010): ra8-ra8.

19 Lin, Daisy, et al. "Translational control by a small RNA: dendritic BC1 RNA targets the eukaryotic initiation factor 4A helicase mechanism." Molecular and cellular biology 28.9 (2008): 3008-3019.

20 Mourtada-Maarabouni, Mirna, et al. "Growth arrest in human T-cells is controlled by the non- coding RNA growth-arrest-specific transcript 5 (GAS5)." Journal of cell science 121.7 (2008): 939-946.

21 Rinn, John L., et al. "Functional demarcation of active and silent chromatin domains in human HOX loci by noncoding RNAs." cell 129.7 (2007): 1311-1323.

22 Yu, Wenqiang, et al. "Epigenetic silencing of tumor suppressor gene p15 by its antisense RNA. " Nature 451.7175 (2008): 202.

23 Prensner, John R., et al. "Transcriptome sequencing across a prostate cancer cohort identifies PCAT-1, an unannotated lincRNA implicated in disease progression." Nature biotechnology 29.8 37(2011): 742.

24 Gupta, Rajnish A., et al. "Long non-coding RNA HOTAIR reprograms chromatin state to promote cancer metastasis." Nature 464.7291 (2010): 1071.

25 Guan, Yinghui, et al. "Amplification of PVT1 contributes to the pathophysiology of ovarian and breast cancer." Clinical cancer research 13.19 (2007): 5745-5755.

26 Grisanzio, Chiara, and Matthew L. Freedman. "Chromosome 8q24–associated cancers and MYC. " Genes & cancer 1.6 (2010): 555-559.

27 Meyer, Kerstin B., et al. "A functional variant at a prostate cancer predisposition locus at 8q24 is associated with PVT1 expression." PLoS genetics 7.7 (2011): e1002165.

28 Huppi, K., et al. "Pvt-1 transcripts are found in normal tissues and are altered by reciprocal (6; 15) translocations in mouse plasmacytomas." Proceedings of the National Academy of Sciences 87.18 (1990): 6964-6968.

29 Shtivelman, Emma, et al. "Identification of a human transcription unit affected by the variant chromosomal translocations 2; 8 and 8; 22 of Burkitt lymphoma." Proceedings of the National Academy of Sciences 86.9 (1989): 3257-3260.

30 Huppi, Konrad, et al. "The 8q24 gene desert: an oasis of non-coding transcriptional activity. " Frontiers in genetics 3 (2012): 69.

31 Huppi, Konrad, and David Siwarski. "Chimeric transcripts with an open reading frame are generated as a result of translocation to the Pvt‐1 region in mouse B‐cell tumors." International journal of cancer 59.6 (1994): 848-851.

32 Bartel, David P. "MicroRNAs: genomics, biogenesis, mechanism, and function." cell 116.2 (2004): 281-297.

33 Denli, Ahmet M., et al. "Processing of primary microRNAs by the Microprocessor complex. " Nature 432.7014 (2004): 231.

34 Huppi, K., Volfovsky, N., Runfola, T., Jones, T. L., Mackiewicz, M., Martin, S. E., Mushinski, J. F., Stephens, R., and Caplen, N. J. (2008). The identification of microRNAs in a genomically unstable region of human chromosome 8q24. Mol. Cancer Res. 6, 212–221.

35 Barsotti, A., Beckerman, R., Laptenko, O., Huppi, K., Caplen, N. J., and Prives, C. (2011). P53-dependent induction of PVT1 and MIR-1204. J. Biol. Chem. 287, 2509–2519.

36 Ilboudo, Adeodat, et al. "PVT1 exon 9: a potential biomarker of aggressive prostate cancer?. " International journal of environmental research and public health 13.1 (2015): 12.

37 Das, Dibash K., et al. "miR-1207-3p is a novel prognostic biomarker of prostate cancer. " Translational oncology 9.3 (2016): 236-241.

38 Vennstrom, B., et al. "Isolation and characterization of c-myc, a cellular homolog of the oncogene (v-myc) of avian myelocytomatosis virus strain 29." Journal of virology 42.3 (1982): 773-779.

39 Dang, Chi V., et al. "Function of the c-Myc oncogenic transcription factor." Experimental cell research 253.1 (1999): 63-77.

40 Cole MD, McMahon SB. The Myc oncoprotein: a critical evaluation of transactivation and target gene regulation. Oncogene 1999 May 13;18(19):2916-24.

41 Blackwood, Elizabeth M., and Robert N. Eisenman. "Max: a helix-loop-helix zipper protein that forms a sequence-specific DNA-binding complex with Myc." Science 251.4998 (1991): 1211-1217.

42 Qian, Junqi, et al. "Loss of p53 and c-myc overrepresentation in stage T 2-3 N 1-3 M 0 prostate cancer are potential markers for cancer progression." Modern pathology 15.1 (2002): 35.

43 Buttyan, Ralph, et al. "Enhanced expression of the c‐myc protooncogene in high‐grade human prostate cancers." The Prostate 11.4 (1987): 327-337.

44 Sato, Kazunari, et al. "Clinical significance of alterations of chromosome 8 in high-grade, advanced, nonmetastatic prostate carcinoma." Journal of the National Cancer Institute 91.18 (1999): 1574-1580.

45 Bubendorf, Lukas, et al. "Survey of gene amplifications during prostate cancer progression by high-throughput fluorescence in situ hybridization on tissue microarrays." Cancer research 59.4 (1999): 803-806.

46 Solé, Xavier, et al. "Genetic and genomic analysis modeling of germline c-MYC overexpression and cancer susceptibility." BMC genomics 9.1 (2008): 12.

47 Pomerantz, Mark M., et al. "Evaluation of the 8q24 prostate cancer risk locus and MYC expression. " Cancer research69.13 (2009): 5568-5574.

48 Wright, Jason B., Seth J. Brown, and Michael D. Cole. "Upregulation of c-MYC in cis through a large chromatin loop linked to a cancer risk-associated single-nucleotide polymorphism in colorectal cancer cells." Molecular and cellular biology 30.6 (2010): 1411-1420.

49 Pomerantz, Mark M., et al. "The 8q24 cancer risk variant rs6983267 shows long-range interaction with MYC in colorectal cancer." Nature genetics 41.8 (2009): 882.

50 Ahmadiyeh, Nasim, et al. "8q24 prostate, breast, and colon cancer risk loci show tissue specific long-range interaction with MYC." Proceedings of the National academy of sciences107.21 (2010): 9742-9746.

51 Heintzman, Nathaniel D., et al. "Histone modifications at human enhancers reflect global cell- type-specific gene expression." Nature 459.7243 (2009): 108.

52 Visel, Axel, et al. "ChIP-seq accurately predicts tissue-specific activity of enhancers." Nature 457.7231 (2009): 854.

53 Sotelo, Jose, et al. "Long-range enhancers on 8q24 regulate c-Myc." Proceedings of the National Academy of Sciences107.7 (2010): 3001-3005.

54 Pomerantz, Mark M., et al. "Evaluation of the 8q24 prostate cancer risk locus and MYC expression. " Cancer research69.13 (2009): 5568-5574.

55 Gurel, Bora, et al. "Nuclear MYC protein overexpression is an early alteration in human prostate carcinogenesis." Modern pathology 21.9 (2008): 1156.

56 Nelson WG, De Marzo AM, Yegnasubramanian S. Epigenetic alterations in human prostate cancers. Endocrinology. 2009;150(9):3991-4002.

57 Buttyan, Ralph, et al. "Enhanced expression of the c‐myc protooncogene in high‐grade human prostate cancers." The Prostate 11.4 (1987): 327-337.

58 Rhodes, Daniel R., et al. "Oncomine 3.0: genes, pathways, and networks in a collection of 18,000 cancer gene expression profiles." Neoplasia 9.2 (2007): 166-180.

59 Tomlins, Scott A., et al. "Integrative molecular concept modeling of prostate cancer progression. " Nature genetics39.1 (2007): 41.

60 Zhang, Xuejun, et al. "Prostatic neoplasia in transgenic mice with prostate‐directed overexpression of the c‐myc oncoprotein." The Prostate 43.4 (2000): 278-285. 40

61 Ellwood-Yen, Katharine, et al. "Myc-driven murine prostate cancer shares molecular features with human prostate tumors." Cancer cell 4.3 (2003): 223-238.

62 Nandana, Srinivas, et al. "Hepsin cooperates with MYC in the progression of adenocarcinoma in a prostate cancer mouse model." The Prostate 70.6 (2010): 591-600.

63 Porkka, Kati P., and Tapio Visakorpi. "Molecular mechanisms of prostate cancer. " European urology 45.6 (2004): 683-691.

64 Ma, Ming-zhe, et al. "Long non-coding RNA HOTAIR, a c-Myc activated driver of malignancy, negatively regulates miRNA-130a in gallbladder cancer." Molecular cancer 13.1 (2014): 156.

65 Yang, Feng, et al. "Long non‐coding RNA GHET1 promotes gastric carcinoma cell proliferation by increasing c‐Myc mRNA stability." The FEBS journal 281.3 (2014): 802-813.

66 Hung, Chiu-Lien, et al. "A long noncoding RNA connects c-Myc to tumor metabolism. " Proceedings of the National Academy of Sciences 111.52 (2014): 18697-18702.

67 Hart, Jonathan R., et al. "MYC regulates the non-coding transcriptome." Oncotarget 5.24 (2014): 12543.

68 Winkle, Melanie, et al. "Long noncoding RNAs as a novel component of the Myc transcriptional network." The FASEB Journal 29.6 (2015): 2338-2346.

69 Carramusa, Letizia, et al. "The PVT‐1 oncogene is a Myc protein target that is overexpressed in transformed cells." Journal of cellular physiology 213.2 (2007): 511-518.

70 Prensner, John R., et al. "The long non-coding RNA PCAT-1 promotes prostate cancer cell proliferation through cMyc." Neoplasia 16.11 (2014): 900-908.

71 Hung, Chiu-Lien, et al. "A long noncoding RNA connects c-Myc to tumor metabolism. " Proceedings of the National Academy of Sciences 111.52 (2014): 18697-18702.

72 Dibash K. Das, Olorunseun O. Ogunwobi. miR-1207-3p regulates c-Myc in aggressive prostate cancer [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2017; 2017 Apr 1-5; Washington, DC. Philadelphia (PA): AACR; Cancer Res 2017;77(13 Suppl):Abstract nr 1473. doi:10.1158/1538-7445.AM2017-1473

73 Bakkus, M. H., et al. "Amplification of the c-myc and the pvt-like region in human multiple myeloma. " Oncogene 5.9 (1990): 1359-1364.

74 Shtivelman, E., and J. MICHAEL Bishop. "The PVT gene frequently amplifies with MYC in tumor cells. " Molecular and cellular biology 9.3 (1989): 1148-1154.

75 Rao, Pulivarthi H., et al. "Coamplification of M yc/P vt1 and homozygous deletion of N lrp1 locus are frequent genetics changes in mouse osteosarcoma." Genes, Chromosomes and Cancer 54.12 (2015): 796-808.

76 Shtivelman, E., and J. M. Bishop. "Effects of translocations on transcription from PVT. " Molecular and cellular biology 10.4 (1990): 1835-1839.

77Carramusa, Letizia, et al. "The PVT‐1 oncogene is a Myc protein target that is overexpressed in transformed cells." Journal of cellular physiology 213.2 (2007): 511-518.

78 Tseng, Yuen-Yi, et al. "PVT1 dependence in cancer with MYC copy-number increase. " Nature 512.7512 (2014): 82.

79 Yang, Jin, et al. "LncRNA PVT1 predicts prognosis and regulates tumor growth in prostate cancer. " Bioscience, biotechnology, and biochemistry 81.12 (2017): 2301-2306.

80 Zeng, Chengwu, et al. "Overexpression of the long non-coding RNA PVT1 is correlated with leukemic cell proliferation in acute promyelocytic leukemia." Journal of hematology & oncology 8.1 (2015): 126.

81 Du, Meijun, et al. "Chromatin interactions and candidate genes at ten prostate cancer risk loci. " Scientific reports 6 (2016): 23202.

82 Cho, Seung Woo, et al. "Promoter of lncRNA gene PVT1 is a tumor-suppressor DNA boundary element. " Cell 173.6 (2018): 1398-1412.

83 Orunmuyi, Akintunde T., et al. "PVT1 exons 4A, 4B, and 9 are overexpressed in aggressive prostate cancer, and PVT1 exon 4B may distinguish between indolent and aggressive prostate cancer." (2017): 3507-3507.