DOCSLIB.ORG

(12) United States Patent (10) Patent No.: US 8,841,436 B2 Gorodeski Et Al

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
(12) United States Patent (10) Patent No.: US 8,841,436 B2 Gorodeski Et Al USOO8841436B2 (12) United States Patent (10) Patent No.: US 8,841,436 B2 Gorodeski et al. (45) Date of Patent: Sep. 23, 2014 (54) SCREENING, DIAGNOSING, TREATING AND 5,139,941 A 8/1992 Muzyczka et al. ............ 435/456 PROGNOSIS OF PATHOPHYSIOLOGIC 5,252.479 A 10/1993 Srivastava .......... 435/235.1 5,427,916 A 6/1995 Gewirtz et al. ................... 435/5 STATUS BY RNA REGULATION 5,849,902 A 12/1998 Arrow et al. ... 536,245 2002fO086356 A1 7, 2002 TuSchlet al. ... ... 435/69.1 (75) Inventors: George Gorodeski, Beachwood, OH 2002/0173478 A1 11/2002 Gewirtz. ......... 514.f44 A (US); Judith Potashkin, Gurnee, IL 2004/0014113 A1 1/2004 Yang et al. ..... ... 435/6.11 (US); Bentley Cheatham, Durham, NC 2004/001817.6 A1 1/2004 Tolentino et al. .. 424.93.21 (US s s 2005/0022725 A1 2/2005 Jurgensen et al. ............ 117/104 2005. O153918 A1 7, 2005 Chabot et al. ...... 514.f44 A 2006/0105360 A1 5/2006 Croceet al. .... ... 435.6.18 (73) Assignees: University Hospitals Cleveland 2006/0292616 A1 12/2006 Neely et al. .................. 435/6.12 Medical Center, Cleveland, OH (US); 2007/00264.03 A1 2/2007 Hatzigeorgiou et al. ... 435/6.11 Rosalind Franklin University of 2008/0171715 A1 7/2008 Brown et al. ................... 514,44 Medicine and Science, an Illinois Corporation, North Chicago, IL (US) FOREIGN PATENT DOCUMENTS WO WO93/24641 12/1993 (*) Notice: Subject to any disclaimer, the term of this WO WO94f13788 6, 1994 patent is extended or adjusted under 35 WO WO 2005078139 A2 8, 2005 U.S.C. 154(b) by 54 days. WO WO 2005.1.18806 A2 12/2005 WO WO 2005.1.18806 A2 2, 2006 (21) Appl. No.: 12/450,124 WO WO 2005.1.18806 A 6, 2006 WO WO 2005.1.18806 B T 2006 (22) PCT Filed: Mar. 13, 2008 OTHER PUBLICATIONS (86). PCT No.: PCT/US2O08/OO3298 Kong et al. P2X7 nucleotide receptors mediate caspase-8/9/3-depen S371 (c)(1), dent apoptosis in rat primary cortical neurons. Purinergic Signaling (2), (4) Date: Apr. 14, 2010 2005, 1:337-347.* Lagos-Quintana et al. New microRNAS from mouse and human. (87) PCT Pub. No.: WO2008/115387 RNA 2003, 9; 175-179.* PCT Pub. Date: Sep. 25, 2008 Ambros, “miRNAS: tiny regulators with great potential” Cell, 107.823-826 (2001). (65) Prior Publication Data Ambros, “The functions of animal microRNAs.” Nature, 431:350 US 2010/O19688.6 A1 Aug. 5, 2010 355 (2004). Anderson, “Human gene therapy.” Nature, Supplement, 392:25-30 (1998). Related U.S. Application Data Bartel, et al., “MicroRNAs. At the Root of Plant Development?” (60) Provisional application No. 60/918,242, filed on Mar. Plant Physiol., 132:709-717 (2003). 15, 2007. (Continued) (51) Int. Cl. C7H 2L/04 (2006.01) Primary Examiner — Kimberly Chong CI2N IS/II3 (2010.01) CI2O I/68 (2006.01) (74) Attorney, Agent, or Firm — Medlen & Carroll, LLP (52) U.S. Cl. CPC ........ CI2N 15/1138 (2013.01); C12N 2320/11 (57) ABSTRACT (2013.01); C12O 2600/106 (2013.01): CI2O I/6809 (2013.01); C12N 23 10/14 (2013.01); A relationship between cancer and ribonucleic acid (RNA) CI2O 2600/178 (2013.01); C12N 2330/10 regulation is described by determining intracellular levels of (2013.01); C12O 2600/1 18 (2013.01): CI2O niRNA regulators. Generally, mRNA levels are decreased in I/6886 (2013.01) cancer cells that may be a reflection of either reduced mRNA USPC .......... 536/24.5:536/24.31:536/24.1; 435/6; expression and/or increased mRNA degradation. miRNAs 435/325; 435/375 are identified that hybridize to an mRNA that are suspected to (58) Field of Classification Search mediate intracellular mRNA steady state levels. Alterna None tively, ribonucleic acid binding protein (RBP) levels may also See application file for complete search history. mediate intracellular mRNA steady state levels. In particular, (56) References Cited this invention demonstrates an effective clinical management strategy for uterine cell cancers may be implemented by U.S. PATENT DOCUMENTS taking advantage of an exemplary relationship between P2X, mRNA and miRNAs including, but not limited to, miR-186 4,235,871 A 11/1980 Papahadjopoulos et al. 424/450 and/or miR-150. 4,501,728 A 2, 1985 Geho et al. .................... 424/450 4,837,028 A 6, 1989 Allen ........................... 424f1.21 4,987,071 A 1/1991 Cech et al. ... ... 435,91.31 5,019,369 A 5/1991 Presant et al. ............... 424f1.21 9 Claims, 18 Drawing Sheets US 8,841436 B2 Page 2 (56) References Cited Gerlach, et al., “Multidrug resistance.” Cancer Surveys, 5:25-46 (1986). OTHER PUBLICATIONS Goldie and Coldman, “The Genetic Origin of Drug Resistance in Neoplasms: Implications for Systemic Therapy.” Cancer Research, Bartel, et al., “MicroRNAS: genomics, biogenesis, mechanism, and 44:3643-3653 (1984). function.” Cell, 116:281-297 (2004). Gorodeski, et al., “Retinoids, sex steroids, and glucocorticoids regu Brummelkamp, et al., “A System for Stable Expression of Short late ectocervical cell envelope formation but not the level of the Interfering RNAs in Mammalian Cells.” Science, 296:550-553 envelope precursor, involucrin.” Differentiation, 42:75-80 (1989). (2002). Gorodeski, et al., “Characterization of paracellular permeability in Brummelkamp, et al., “A System for Stable Expression of Short cultured human cervical epithelium: regulation by extracellular Interfering RNAs in Mammalian Cells.” Supplemental Data. Sci ATPJ Soc Gynecol Investig., 1:225-233 (1994a). ence, 296:550-553 (2002). Gorodeski, et al., “Human uterine cervical epithelial cells grown on Brummelkamp, et al., “A System for Stable Expression of Short permeable support-a new model for the study of differentiation and Interfering RNAS in Mammalian Cells.” Supplemental Data Figure. transepithelial transport.” Differentiation, 56: 107-118 (1994b). Science, 296:550-553 (2002). Guhaniyogi, et al., “Regulation of mRNA stability in mammalian Buell, et al., “Gene structure and chromosomal localization of the cells.” Gene, 265:11-23 (2001). human P2X7 receptor.” Receptors Channels 5:347-354 (1998). Hammann, et al., "Length variation of helix III in a hammerhead Burd, et al., “Conserved structures and diversity of functions of ribozyme and its influence on cleavage activity.” Antisense and RNA-binding proteins.” Science, 265:615-621 (1994). Nucleic Acid Drug Dev, 9:25-31 (1999). Calin, et al., “Frequent deletions and down-regulation of miRNA Hentze, “Translational regulation: versatile mechanisms for meta genes miR-15 and miR-16 at 13q14 in chronic lymphocytic leuke bolic and developmental control.” Curr: Op. Biol. 7:393-398 (1995). mia.” Proc. Natl Acad. Sci. USA, 99:15524-15529 (2002). Higgins, et al., “CLUSTAL: a package for performing multiple Chen, et al., “MicroRNAS Modulate Hematopoietic Lineage Differ sequence alignment on a microcomputer.” Gene, 73:237-244 (1988). entiation.” Science, 303:83-86 (2004). Huang, et al., “Dynamic programming algorithms for restriction map Chen, et al., “MicroRNAS Modulate Hematopoietic Lineage Differ comparison.” Computer Applications in the Biosciences, 8:1-6 entiation.” Science, 303:83-86 Supplemental Online Material (1992). Revised (2004). Hutvagner, et al., “A microRNA in a multiple-turnover RNAi enzyme Cheng, et al., “Antisense inhibition of human mRNAs and indications complex” Science, 297:2056-2060 (2002). for an involvement of miRNA in cell growth and apoptosis.” Nucleic James, "Nucleic acid and polypeptide aptamers: a powerful approach Acids Research, 33:1290-1297 (2005). Colas, et al., “Genetic selection of peptide aptamers that recognize to ligand discovery.” Current Opinion in Pharmacology, 1:540-546 and inhibit cyclin-dependent kinase 2.” Nature, 380:548-550 (1996). (2001). Corpet, "Multiple sequence alignment with hierarchical clustering.” Kidner, et al., “Macro effects of microRNAs in plants.” Trends Nucleic Acids Research, 16:10881-90 (1988). Genet., 19:13-16 (2003). Couzin, “Breakthrough of the Year. Small RNAS Make Big Splash.” Kohler, et al., “Continuous cultures of fused cells secreting antibody Science, 298:2296-2297 (2002). of predefined specificity.” Nature, 256:495-497 (1975). Croce, et al., “miRNAs, cancer, and stem cell division.” Cell, 122:6-7 Kozbor, et al., “The Production of Monoclonal Antibodies From (2005). Human Lymphocytes.” Immunology Today, 4:72 (1983). Dennis, "Small RNAS: The genome's guiding hand?' Nature, Lee, et al., “The C. elegans heterochronic gene lin-4 encodes Small 420:732 (2002). RNAs with antisense complementarity to lin-14.” Cell, 75:843-854 Doench, et al., “siRNAs can function as miRNAs.” Genes Dev., (1993). 17:438-442 (2003). Lee, et al., “Expression of Small interfering RNAS targeted against Doench, et al., “Specificity of microRNA target selection in transla HIV-1 rev transcripts in human cells.” Nat. Biotechnol. 20:500-505 tional repression.” Genes, Dev. 18:504-511 (2004). (2002). Dornburg, “Reticuloendotheliosis viruses and derived vectors.” Gene Lewis, et al., “Prediction of mammalian miRNA targets.” Cell, Therap., 2:301-310 (1995). 115:787-798 (2003). Eglitis, et al., “Retroviral Vectors for Introduction of Genes into Lewis, et al., "Conserved seed pairing, often flanked by adenosines, Mammalian Cells.” Biotechniques, 6(7):608-614 (1988). indicates that thousands of human genes are microRNA targets.” Elbashir, et al., “RNA interference is mediated by 21- and Cell, 120:15-20 (2005). 22-nucleotide RNAs.” Genes Dev., 15:188-200 (2001). Li, et al., “The P2X, Receptor. A novel biomarker of uterine Fienberg, et al., "A technique for radiolabeling DNA restriction epithelial cancers.” Cancer Epidemiology Biomarkers and Preven endonuclease fragments to high specific activity.” Anal. Biochem.. tion, 15: 1-8 (2006a). 132:6-13 (1983). Li, et al., “The P2X, receptor. A novel biomarker of uterine epithelial Fienberg, et al., “A technique for radiolabeling DNA restriction cancers.” Cancer Epidemiology Biomarkers and Prevention, endonuclease fragments to high specific activity.” Addendum. Anal. 15:1906-1913 (2006b). Biochem., 137(1):266-7 (1983). Llave, et al., “Cleavage of Scarecrow-like mRNA targets directed by Feng, et al., “ATP ligation stimulates GRK-3-mediated phosphoryla a class of Arabidopsis miRNA.” Science, 297:2053-2056 (2002).
Load more

Recommended publications
  • Large-Scale Analysis of Genome and Transcriptome Alterations in Multiple Tumors Unveils Novel Cancer-Relevant Splicing Networks
    Downloaded from genome.cshlp.org on September 28, 2021 - Published by Cold Spring Harbor Laboratory Press Research Large-scale analysis of genome and transcriptome alterations in multiple tumors unveils novel cancer-relevant splicing networks Endre Sebestyén,1,5 Babita Singh,1,5 Belén Miñana,1,2 Amadís Pagès,1 Francesca Mateo,3 Miguel Angel Pujana,3 Juan Valcárcel,1,2,4 and Eduardo Eyras1,4 1Universitat Pompeu Fabra, E08003 Barcelona, Spain; 2Centre for Genomic Regulation, E08003 Barcelona, Spain; 3Program Against Cancer Therapeutic Resistance (ProCURE), Catalan Institute of Oncology (ICO), Bellvitge Institute for Biomedical Research (IDIBELL), E08908 L’Hospitalet del Llobregat, Spain; 4Catalan Institution for Research and Advanced Studies, E08010 Barcelona, Spain Alternative splicing is regulated by multiple RNA-binding proteins and influences the expression of most eukaryotic genes. However, the role of this process in human disease, and particularly in cancer, is only starting to be unveiled. We system- atically analyzed mutation, copy number, and gene expression patterns of 1348 RNA-binding protein (RBP) genes in 11 solid tumor types, together with alternative splicing changes in these tumors and the enrichment of binding motifs in the alter- natively spliced sequences. Our comprehensive study reveals widespread alterations in the expression of RBP genes, as well as novel mutations and copy number variations in association with multiple alternative splicing changes in cancer drivers and oncogenic pathways. Remarkably, the altered splicing patterns in several tumor types recapitulate those of undifferen- tiated cells. These patterns are predicted to be mainly controlled by MBNL1 and involve multiple cancer drivers, including the mitotic gene NUMA1. We show that NUMA1 alternative splicing induces enhanced cell proliferation and centrosome am- plification in nontumorigenic mammary epithelial cells.
    [Show full text]
  • A 475 Years-Old Founder Effect Involving IL12RB1: a Highly Prevalent Mutation Conferring Mendelian Susceptibility to Mycobacterial Diseases in European Descendants
    Infection, Genetics and Evolution 9 (2009) 574–580 Contents lists available at ScienceDirect Infection, Genetics and Evolution journal homepage: www.elsevier.com/locate/meegid A 475 years-old founder effect involving IL12RB1: A highly prevalent mutation conferring Mendelian Susceptibility to Mycobacterial Diseases in European descendants J. Yancoski a, C. Rocco a, A. Bernasconi a, M. Oleastro a, L. Bezrodnik b, C. Vra´tnica c, F. Haerynck d, S.D. Rosenzweig a,* a Hospital Nacional de Pediatrı´a J. P. Garrahan, Buenos Aires, Argentina b Hospital de Nin˜os Ricardo Gutierrez, Buenos Aires, Argentina c Hospital de Nin˜os Juan Pablo II, Corrientes, Argentina d Ghent University Hospital, Ghent, Belgium ARTICLE INFO ABSTRACT Article history: Mutations in IFNGR1, IFNGR2, IL12RB1, IL12B, STAT1 and NEMO result in a common clinical phenotype Received 11 December 2008 known as Mendelian Susceptibility to Mycobacterial Diseases (MSMD). Interleukin-12 receptor b1 (IL- Received in revised form 13 February 2009 12Rb1) deficiency is the most common genetic etiology for MSMD. Known mutations affecting IL12RB1 Accepted 16 February 2009 are recessively inherited and are associated with null response to both IL-12 and IL-23. Mutation IL12RB1 Available online 9 March 2009 1623_1624delinsTT was originally described in 5 families from European origin (2 from Germany; 1 from Cyprus, France and Belgium). Interestingly, this same mutation was found in an unexpectedly high Keywords: prevalence among IL-12Rb1 deficient patients in Argentina: 5-out-of-6 individuals born to unrelated Hot spot families carried this particular change. To determine whether mutation 1623_1624delinsTT represents a Salmonella Bacillus Calmette Guerin DNA mutational hotspot or a founder effect, 34 polymorphic markers internal or proximal to IL12RB1 Interferon gamma were studied in the Argentinean and the Belgian patients.
    [Show full text]
  • Functional Annotation of Exon Skipping Event in Human Pora Kim1,*,†, Mengyuan Yang1,†,Keyiya2, Weiling Zhao1 and Xiaobo Zhou1,3,4,*
    D896–D907 Nucleic Acids Research, 2020, Vol. 48, Database issue Published online 23 October 2019 doi: 10.1093/nar/gkz917 ExonSkipDB: functional annotation of exon skipping event in human Pora Kim1,*,†, Mengyuan Yang1,†,KeYiya2, Weiling Zhao1 and Xiaobo Zhou1,3,4,* 1School of Biomedical Informatics, The University of Texas Health Science Center at Houston, Houston, TX 77030, USA, 2College of Electronics and Information Engineering, Tongji University, Shanghai, China, 3McGovern Medical School, The University of Texas Health Science Center at Houston, Houston, TX 77030, USA and 4School of Dentistry, The University of Texas Health Science Center at Houston, Houston, TX 77030, USA Received August 13, 2019; Revised September 21, 2019; Editorial Decision October 03, 2019; Accepted October 03, 2019 ABSTRACT been used as therapeutic targets (3–8). For example, MET has lost the binding site of E3 ubiquitin ligase CBL through Exon skipping (ES) is reported to be the most com- exon 14 skipping event (9), resulting in an enhanced expres- mon alternative splicing event due to loss of func- sion level of MET. MET amplification drives the prolifera- tional domains/sites or shifting of the open read- tion of tumor cells. Multiple tyrosine kinase inhibitors, such ing frame (ORF), leading to a variety of human dis- as crizotinib, cabozantinib and capmatinib, have been used eases and considered therapeutic targets. To date, to treat patients with MET exon 14 skipping (10). Another systematic and intensive annotations of ES events example is the dystrophin gene (DMD) in Duchenne mus- based on the skipped exon units in cancer and cular dystrophy (DMD), a progressive neuromuscular dis- normal tissues are not available.
    [Show full text]
  • Biochemical Characterization of DDX43 (HAGE) Helicase
    Biochemical Characterization of DDX43 (HAGE) Helicase A Thesis Submitted to the College of Graduate Studies and Research In Fulfillment of the Requirements For the Degree of Master of Science In the Department of Biochemistry University of Saskatchewan Saskatoon By Tanu Talwar © Copyright Tanu Talwar, March, 2017. All rights reserved PERMISSION OF USE STATEMENT I hereby present this thesis in partial fulfilment of the requirements for a postgraduate degree from the University of Saskatchewan and agree that the Libraries of this University may make it freely available for inspection. I further agree that permission for copying of this thesis in any manner, either in whole or in part, for scholarly purposes may be granted by the professor or professors who supervised this thesis or, in their absence, by the Head of the Department or the Dean of the College in which my thesis work was done. It is understood that any copying or publication or use of this thesis or parts of it for any financial gain will not be allowed without my written permission. It is also understood that due recognition shall be given to me and to the University of Saskatchewan in any scholarly use which may be made of any material in my thesis. Requests for permission to copy or to make other use of material in this thesis in whole or part should be addressed to: Head of the Department of Biochemistry University of Saskatchewan 107 Wiggins Road Saskatoon, Saskatchewan, Canada S7N 5E5 i ABSTRACT DDX43, DEAD-box polypeptide 43, also known as HAGE (helicase antigen gene), is a member of the DEAD-box family of RNA helicases.
    [Show full text]
  • Overlap of Quantitative Trait Loci for Early Growth Rate, and for Body
    REPRODUCTIONRESEARCH Functional reconstruction of NANOS3 expression in the germ cell lineage by a novel transgenic reporter reveals distinct subcellular localizations of NANOS3 Masashi Yamaji1, Takashi Tanaka2, Mayo Shigeta1, Shinichiro Chuma2, Yumiko Saga3 and Mitinori Saitou1,4,5 1Laboratory for Mammalian Germ Cell Biology, RIKEN Center for Developmental Biology, 2-2-3 Minatojima- Minamimachi, Chuo-ku, Kobe 650-0047, Japan, 2Department of Development and Differentiation, Institute for Frontier Medical Sciences, Kyoto University, Shogoin, Sakyo-ku, Kyoto 606-8507, Japan, 3Department of Genetics and Division of Mammalian Development, National Institute of Genetics, SOKENDAI, 1111 Yata, Mishima, Shizuoka 411-8540, Japan, 4Department of Anatomy and Cell Biology, Graduate School of Medicine, Kyoto University, Yoshida- Konoe-cho, Sakyo-ku, Kyoto 606-8501, Japan and 5JST, CREST, Yoshida-Konoe-cho, Sakyo-ku, Kyoto 606-8501, Japan Correspondence should be addressed to M Saitou at Department of Anatomy and Cell Biology, Graduate School of Medicine, Kyoto University; Email: [email protected] Abstract Mutations of RNA-binding proteins such as NANOS3, TIAL1, and DND1 in mice have been known to result in the failure of survival and/or proliferation of primordial germ cells (PGCs) soon after their fate is specified (around embryonic day (E) 8.0), leading to the infertility of these animals. However, the mechanisms of actions of these RNA-binding proteins remain largely unresolved. As a foundation to explore the role of these RNA-binding proteins in germ cells, we established a novel transgenic reporter strain that expresses NANOS3 fused with EGFP under the control of Nanos3 regulatory elements. NANOS3–EGFP exhibited exclusive expression in PGCs as early as E7.25, and continued to be expressed in female germ cells until around E14.5 and in male germ cells throughout the fetal period with declining expression levels after E16.5.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Genetic Analysis of Hereditary Sensory, Motor and Autonomic
    Genetic analysis of hereditary sensory, motor and autonomic neuropathies, including a rat model Ming-Jen Lee A thesis submitted to the University of London for the degree of Doctor of Philosophy August 2002 Institute of Neurology University of London ProQuest Number: 10016056 All rights reserved INFORMATION TO ALL USERS The quality of this reproduction is dependent upon the quality of the copy submitted. In the unlikely event that the author did not send a complete manuscript and there are missing pages, these will be noted. Also, if material had to be removed, a note will indicate the deletion. uest. ProQuest 10016056 Published by ProQuest LLC(2016). Copyright of the Dissertation is held by the Author. All rights reserved. This work is protected against unauthorized copying under Title 17, United States Code. Microform Edition © ProQuest LLC. ProQuest LLC 789 East Eisenhower Parkway P.O. Box 1346 Ann Arbor, Ml 48106-1346 To my wife and my parents Who supported me throughout my studies. Acknowledgements I would like to thank Dr. Mike Groves and Professor Francesco Scaravilli, for their help in the animal breeding and phenotype characterization. I am also indebted to Dr. Dennis Stephenson, MacLaughlin Institute, Grate Fall, Montana, USA. for advice on positional cloning and on the construction of the rat/mouse/human comparative genetic map. His idea on BLAST searches between Celera mouse genome database and rat markers, made a breakthrough in selecting candidate genes, which lead me to identify the m f gene. I am grateful to Dr. Pete Dixon and Dr. Mary Davis for their advice on genetic linkage and physical mapping.
    [Show full text]
  • The Role of Polyadenylation in the Induction of Inflammatory Genes
    The role of polyadenylation in the induction of inflammatory genes Raj Gandhi BSc & ARCS Thesis submitted for the degree of Doctor of Philosophy September 2016 Declaration Except where acknowledged in the text, I declare that this thesis is my own work and is based on research that was undertaken by me in the School of Pharmacy, Faculty of Science, The University of Nottingham. i Acknowledgements First and foremost, I give thanks to my primary supervisor Dr. Cornelia de Moor. She supported me at every step, always made time for me whenever I needed it, and was sympathetic during times of difficulty. I feel very, very fortunate to have been her student. I would also like to thank Dr. Catherine Jopling for her advice and Dr. Graeme Thorn for being so patient and giving me so much help in understanding the bioinformatics parts of my project. I am grateful to Dr. Anna Piccinini and Dr. Sadaf Ashraf for filling in huge gaps in my knowledge about inflammation and osteoarthritis, and to Dr. Sunir Malla for help with the TAIL-seq work. I thank Dr. Richa Singhania and Kathryn Williams for proofreading. Dr. Hannah Parker was my “big sister” in the lab from my first day, and I am very grateful for all her help and for her friendship. My project was made all the more enjoyable/bearable by the members of the Gene Regulation and RNA Biology group, especially Jialiang Lin, Kathryn Williams, Dr. Richa Singhania, Aimée Parsons, Dan Smalley, and Hibah Al-Masmoum. Barbara Rampersad was a wonderful technician. Mike Thomas, James Williamson, Will Hawley, Tom Upton, and Jamie Ware were some of the best of friends I could have hoped to make in Nottingham.
    [Show full text]
  • SFRS14 Antibody (Monoclonal) (M01) Mouse Monoclonal Antibody Raised Against a Partial Recombinant SFRS14
    苏州工业园区双圩路9号1幢 邮 编 ： 215000 电 话 ： 0512-88856768 SFRS14 Antibody (monoclonal) (M01) Mouse monoclonal antibody raised against a partial recombinant SFRS14. Catalog # AT3845a Specification SFRS14 Antibody (monoclonal) (M01) - Product info Application WB, IHC, IF, E Primary Accession Q8IX01 Other Accession NM_014884 Reactivity Human Host mouse Clonality monoclonal Isotype IgG2a Kappa Clone Names 3C5 Calculated MW 120207 SFRS14 Antibody (monoclonal) (M01) - Additional info Gene ID 10147 Antibody Reactive Against Recombinant Protein.Western Blot detection against Other Names Immunogen (36.3 KDa) . SURP and G-patch domain-containing protein 2, Arginine/serine-rich-splicing factor 14, Splicing factor, arginine/serine-rich 14, SUGP2, KIAA0365, SFRS14 Target/Specificity SFRS14 (NP_055699, 579 a.a. ~ 674 a.a) partial recombinant protein with GST tag. MW of the GST tag alone is 26 KDa. Dilution WB~~1:500~1000 Format Clear, colorless solution in phosphate buffered saline, pH 7.2 . Storage Store at -20°C or lower. Aliquot to avoid repeated freezing and thawing. SFRS14 monoclonal antibody (M01), Precautions clone 3C5 Western Blot analysis of SFRS14 Antibody (monoclonal) (M01) is for research use only SFRS14 expression in Hela S3 NE ( (Cat # and not for use in diagnostic or therapeutic procedures. AT3845a ) SFRS14 Antibody (monoclonal) (M01) - Protocols Provided below are standard protocols that you may find useful for product applications. • Western Blot • Blocking Peptides • Dot Blot • Immunohistochemistry • Immunofluorescence • Immunoprecipitation Immunoperoxidase of monoclonal • Flow Cytomety antibody to SFRS14 on formalin-fixed • Cell Culture paraffin-embedded human testis. SFRS14 Antibody (monoclonal) (M01) - Background [antibody concentration 3 ug/ml] This gene encodes a member of the arginine/serine-rich family of splicing factors.
    [Show full text]
  • HNRPH1 (HNRNPH1) (NM 005520) Human Tagged ORF Clone Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RC201834 HNRPH1 (HNRNPH1) (NM_005520) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: HNRPH1 (HNRNPH1) (NM_005520) Human Tagged ORF Clone Tag: Myc-DDK Symbol: HNRNPH1 Synonyms: hnRNPH; HNRPH; HNRPH1 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 6 HNRPH1 (HNRNPH1) (NM_005520) Human Tagged ORF Clone – RC201834 ORF Nucleotide >RC201834 ORF sequence Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGATGTTGGGCACGGAAGGTGGAGAGGGATTCGTGGTGAAGGTCCGGGGCTTGCCCTGGTCTTGCTCGG CCGATGAAGTGCAGAGGTTTTTTTCTGACTGCAAAATTCAAAATGGGGCTCAAGGTATTCGTTTCATCTA CACCAGAGAAGGCAGACCAAGTGGCGAGGCTTTTGTTGAACTTGAATCAGAAGATGAAGTCAAATTGGCC CTGAAAAAAGACAGAGAAACTATGGGACACAGATATGTTGAAGTATTCAAGTCAAACAACGTTGAAATGG ATTGGGTGTTGAAGCATACTGGTCCAAATAGTCCTGACACGGCCAATGATGGCTTTGTACGGCTTAGAGG ACTTCCCTTTGGATGTAGCAAGGAAGAAATTGTTCAGTTCTTCTCAGGGTTGGAAATCGTGCCAAATGGG ATAACATTGCCGGTGGACTTCCAGGGGAGGAGTACGGGGGAGGCCTTCGTGCAGTTTGCTTCACAGGAAA TAGCTGAAAAGGCTCTAAAGAAACACAAGGAAAGAATAGGGCACAGGTATATTGAAATCTTTAAGAGCAG TAGAGCTGAAGTTAGAACTCATTATGATCCACCACGAAAGCTTATGGCCATGCAGCGGCCAGGTCCTTAT
    [Show full text]
  • Triplet Repeat Length Bias and Variation in the Human Transcriptome
    Triplet repeat length bias and variation in the human transcriptome Michael Mollaa,1,2, Arthur Delcherb,1, Shamil Sunyaevc, Charles Cantora,d,2, and Simon Kasifa,e aDepartment of Biomedical Engineering and dCenter for Advanced Biotechnology, Boston University, Boston, MA 02215; bCenter for Bioinformatics and Computational Biology, University of Maryland, College Park, MD 20742; cDepartment of Medicine, Division of Genetics, Brigham and Women’s Hospital and Harvard Medical School, Boston, MA 02115; and eCenter for Advanced Genomic Technology, Boston University, Boston, MA 02215 Contributed by Charles Cantor, July 6, 2009 (sent for review May 4, 2009) Length variation in short tandem repeats (STRs) is an important family including Huntington’s disease (10) and hereditary ataxias (11, 12). of DNA polymorphisms with numerous applications in genetics, All Huntington’s patients exhibit an expanded number of copies in medicine, forensics, and evolutionary analysis. Several major diseases the CAG tandem repeat subsequence in the N terminus of the have been associated with length variation of trinucleotide (triplet) huntingtin gene. Moreover, an increase in the repeat length is repeats including Huntington’s disease, hereditary ataxias and spi- anti-correlated to the onset age of the disease (13). Multiple other nobulbar muscular atrophy. Using the reference human genome, we diseases have also been associated with copy number variation of have catalogued all triplet repeats in genic regions. This data revealed tandem repeats (8, 14). Researchers have hypothesized that inap- a bias in noncoding DNA repeat lengths. It also enabled a survey of propriate repeat variation in coding regions could result in toxicity, repeat-length polymorphisms (RLPs) in human genomes and a com- incorrect folding, or aggregation of a protein.
    [Show full text]
  • Snapshot: the Splicing Regulatory Machinery Mathieu Gabut, Sidharth Chaudhry, and Benjamin J
    192 Cell SnapShot: The Splicing Regulatory Machinery Mathieu Gabut, Sidharth Chaudhry, and Benjamin J. Blencowe 133 Banting and Best Department of Medical Research, University of Toronto, Toronto, ON M5S 3E1, Canada Expression in mouse , April4, 2008©2008Elsevier Inc. Low High Name Other Names Protein Domains Binding Sites Target Genes/Mouse Phenotypes/Disease Associations Amy Ceb Hip Hyp OB Eye SC BM Bo Ht SM Epd Kd Liv Lu Pan Pla Pro Sto Spl Thy Thd Te Ut Ov E6.5 E8.5 E10.5 SRp20 Sfrs3, X16 RRM, RS GCUCCUCUUC SRp20, CT/CGRP; −/− early embryonic lethal E3.5 9G8 Sfrs7 RRM, RS, C2HC Znf (GAC)n Tau, GnRH, 9G8 ASF/SF2 Sfrs1 RRM, RS RGAAGAAC HipK3, CaMKIIδ, HIV RNAs; −/− embryonic lethal, cond. KO cardiomyopathy SC35 Sfrs2 RRM, RS UGCUGUU AChE; −/− embryonic lethal, cond. KO deficient T-cell maturation, cardiomyopathy; LS SRp30c Sfrs9 RRM, RS CUGGAUU Glucocorticoid receptor SRp38 Fusip1, Nssr RRM, RS ACAAAGACAA CREB, type II and type XI collagens SRp40 Sfrs5, HRS RRM, RS AGGAGAAGGGA HipK3, PKCβ-II, Fibronectin SRp55 Sfrs6 RRM, RS GGCAGCACCUG cTnT, CD44 DOI 10.1016/j.cell.2008.03.010 SRp75 Sfrs4 RRM, RS GAAGGA FN1, E1A, CD45; overexpression enhances chondrogenic differentiation Tra2α Tra2a RRM, RS GAAARGARR GnRH; overexpression promotes RA-induced neural differentiation SR and SR-Related Proteins Tra2β Sfrs10 RRM, RS (GAA)n HipK3, SMN, Tau SRm160 Srrm1 RS, PWI AUGAAGAGGA CD44 SWAP Sfrs8 RS, SWAP ND SWAP, CD45, Tau; possible asthma susceptibility gene hnRNP A1 Hnrnpa1 RRM, RGG UAGGGA/U HipK3, SMN2, c-H-ras; rheumatoid arthritis, systemic lupus
    [Show full text]