Long-Range Histone Acetylation of the Ifng Gene Is an Essential Feature of T Cell Differentiation
Total Page：16
File Type：pdf, Size：1020Kb
Long-range histone acetylation of the Ifng gene is an essential feature of T cell differentiation Weisong Zhou*†, Shaojing Chang*, and Thomas M. Aune*‡§ *Division of Rheumatology, Department of Medicine, and ‡Department of Microbiology and Immunology, Vanderbilt University School of Medicine, Nashville, TN 37232 Edited by Laurie H. Glimcher, Harvard School of Public Health, Boston, MA, and approved December 30, 2003 (received for review September 17, 2003) Histone acetylation of promoters precedes activation of many Using a transgenic approach, we have also shown that distal genes. In addition, long-range histone acetylation patterns can be regulatory elements are required to achieve both high-level and established over many kilobases of the chromatin of linked families lineage-specific expression of the Ifng gene (20). Therefore, of genes that are under common transcriptional control. It is not long-range communication between distinct genomic regions is known whether establishment of long-range histone acetylation most likely a critical feature of Th1͞Tc1 differentiation. patterns is limited to gene families or is a common feature of many Studies in tissue culture models, by us and others, demonstrate genes. The Ifng gene is not known to be a member of a gene family that, in contrast to other murine strains, CD4ϩ T cells from the but exhibits complex strain-, cell lineage-, and stimulus-dependent autoimmune prone nonobese diabetic (NOD) strain are genet- regulation. For example, stimulation of naive T cells through their ically programmed to use IL-2 as a driving cytokine to differ- antigen receptor does not initiate Ifng gene transcription. How- entiate into IFN-␥-producing effector T cells (21–23). Thus, an ever, stimulation of naive T cells through their antigen and IL-12 antigen stimulus is sufficient to drive both T cell proliferation receptors initiates differentiation programs that yield effector cells and Th1 differentiation. We believe this property represents a with 100-fold greater rates of transcription of the Ifng gene after liability that may contribute to tissue inflammatory responses stimulation through the antigen receptor. Here, we demonstrate and development of autoimmune diabetes. that these differentiation programs establish long-range histone The purpose of studies presented here was to determine hyperacetylation patterns that extend at least 50 kb in both whether induction of histone hyperacetylation patterns during T upstream and downstream directions of the Ifng gene. Establish- cell differentiation was limited to the Ifng gene or exhibited ment of these histone acetylation patterns and Ifng gene expres- an extended long-range pattern. We also wanted to examine sion is relatively IL-12-independent in T cells from autoimmune- lineage- and strain-dependent regulation of histone acetylation. prone nonobese diabetic mice. These results indicate that gene We find that histone hyperacetylation of the Ifng promoter and expression programs that mediate T cell differentiation are regu- introns 1 and 3 depends on stimulation of C57BL͞6 CD8ϩ T cells lated by long-range histone acetylation patterns and that defective through both antigen and IL-12 receptors. In contrast, NOD control of these patterns may contribute to development of CD8ϩ T cells require stimulation only through their antigen autoimmunity. receptors to achieve a similar level of histone acetylation. Surprisingly, histone hyperacetylation of the Ifng gene region ssembly of an active transcriptional complex at the pro- extends far beyond the gene itself, and a discrete pattern of Ϸ Amoter is an essential feature of eukaryotic gene expression histone hyperacetylation is evident as far as 50 kb upstream (1–3). Histone acetylation of the promoter precedes the activa- and downstream of the Ifng gene. This finding argues that proper tion of many genes and is thought to establish a chromatin regulation of Ifng gene expression requires extended histone environment suitable for the assembly of the transcriptional acetylation patterns across relatively large chromatin domains. ␥ complex (4–7). Recent evidence indicates that genes that are Inhibition of histone deacetylases is sufficient to induce IFN- ͞ ϩ members of gene families, are located in relative close proximity production by C57BL 6 CD8 T cells in the presence of only a to each other, and are regulated in a coordinated fashion exhibit T cell receptor stimulus. Therefore, the major function of IL-12 long-range histone acetylation patterns that extend over many in T cell differentiation may be to coordinate the establishment kilobases of DNA (8–11). Establishment of long-range histone of long-range histone hyperacetylation patterns in the Ifng gene acetylation patterns appears to permit communication between region. regulatory regions and the genes they regulate over a distance of Materials and Methods many kilobases. In contrast, it is not known whether genes that ͞ are not members of gene families but exhibit complex forms of Mice. NOD, nonobese diabetes-resistant (NOR), and C57BL 6 regulation exhibit long-range histone acetylation patterns or mice were obtained from The Jackson Laboratory, bred in the whether histone acetylation is limited to the promoter or gene Vanderbilt University animal facilities, and used between 4 and region. 6 wk of age. Naive T cells do not efficiently transcribe the Ifng gene in response to activation of the T cell receptor. Under appropriate Cell Purification and Cultures. Splenic T cells were purified by conditions, naive T cells will differentiate into effector T helper negative selection by using specific mAbs essentially as described 1 (Th1)͞T cytotoxic 1 (Tc1) cells that transcribe the Ifng gene at (24). A magnetic-activated cell sorting system (Miltenyi Biotec, 100-fold greater rates than naive T cells in response to stimu- lation of their antigen receptor. A limiting step in the differen- This paper was submitted directly (Track II) to the PNAS office. tiation of naive T cell precursors into effector cells that produce ␥ Abbreviations: Th1, T helper 1; Tc1, T cytotoxic 1; ChIP, chromatin immunoprecipitation; IFN- is the requirement for both an antigen stimulus to drive NOD, nonobese diabetic; NOR, nonobese diabetes-resistant. cell division and an inflammatory signal to stimulate IL-12 ͞ †Present address: Division of Pulmonary Medicine, Vanderbilt University Medical Center, production that drives T cell differentiation toward the Th1 Tc1 MCN T1218, 1161 21st Avenue South, Nashville, TN 37232. lineage (12, 13). Epigenetic events, including chromatin remod- §To whom correspondence should be addressed at: MCN T3219, Vanderbilt University eling of promoter and introns, histone acetylation of the pro- Medical Center, 1161 21st Avenue South, Nashville, TN 37232. E-mail: thomas.aune@ moter, and nuclear positioning of the Ifng locus, contribute to vanderbilt.edu. successful completion of this differentiation program (7, 14–19). © 2004 by The National Academy of Sciences of the USA 2440–2445 ͉ PNAS ͉ February 24, 2004 ͉ vol. 101 ͉ no. 8 www.pnas.org͞cgi͞doi͞10.1073͞pnas.0306002101 Downloaded by guest on September 27, 2021 Auburn, CA) was used to separate memory and naive CD8ϩ T cells (anti-CD62L). Purified T cells were stimulated with immo- bilized anti-CD3 (2C11, American Type Culture Collection) as outlined in the text essentially as described in ref. 24. IFN-␥ assays were performed by ELISA with mAbs recommended by BD Pharmingen. Chromatin Immunoprecipitation (ChIP) Assays. For ChIP assays (acetyl-histone H4 ChIP assay kit, Upstate Biotechnology, Lake Placid, NY), Ϸ1 ϫ 107 T cells were processed following the manufacturer’s protocol. Briefly, cells were fixed with 1% para- formaldehyde and lysed in 1% SDS͞10 mM EDTA͞50 mM Tris-HCl, pH 8.1. Lysates were sonicated to achieve an average length of genomic DNA of Ϸ500 bp. Protein–DNA complexes were immunoprecipitated overnight at 4°C with anti-acetyl- histone H4 Ab or normal rabbit IgG as control. Ab–histone– DNA complexes were purified with protein A agarose. Aliquots (20 l) were processed without immunoprecipitation as input controls. DNA was purified after reversal of crosslinks at 65°C. PCR primers for the ChIP assay spanned nonrepetitive con- served (mouse and human) genomic sequences from Ϸ60 kb upstream to Ϸ60 kb downstream of the Ifng gene. Sequence Fig. 1. Lineage-dependent H4 histone hyperacetylation of the Ifng gene reflects gene activity. C57BL͞6 CD8ϩ T cells were purified and stimulated with conservation was identified by using the Pipmaker web server anti-CD3 under neutral or Tc1 conditions (5 ng͞ml IL-12 and 10 g͞ml anti-IL-4 (25). PCR primers were as follows: promoter, ctgtgctctgtggat- mAb). Cells were harvested on day 3 and processed for ChIP assay. The gagaaat and aagatggtgacagataggtggg (PCR product, 254 bp); approximate positions of the PCR primers used in the ChIP assay are shown at intron 1a, ggtccaaggtacaaagatgct and gaactttgcctcccattacttta the top. The Actb gene served as a positive control. All PCR products were of (184 bp); intron 1b, cctgcagctaaaagaatgtaaca and ttccacatctat- the expected size (see Materials and Methods). gccacttgag (223 bp); intron 3, tgtggcctaattactcatgctc and atg- gaaaggcagaagcaaagtc (161 bp); Ϫ53 kb, gcccacagatgccagtttaga and agggccacggttgtcaga (144 bp); Ϫ40 kb, gagggctttgggtgaactgtt ChIP assay. These regions were relatively H4 histone- and cccctattaaacatggtctcaaga (188 bp); Ϫ28 kb, aactgcttatgctg- hypoacetylated in cells cultured without IL-12 and anti-IL-4 gatttgagat