The Regulation and Function of Cyclin Dependent Kinase 11 (CDK11): Analysis of the Cdc2L1 PPromoter and Elucidation of CDK11p58 Function During Mitosis
Item Type text; Electronic Dissertation
Authors Kahle, Amber C
Publisher The University of Arizona.
Rights Copyright © is held by the author. Digital access to this material is made possible by the University Libraries, University of Arizona. Further transmission, reproduction or presentation (such as public display or performance) of protected items is prohibited except with permission of the author.
Download date 02/10/2021 10:07:03
Link to Item http://hdl.handle.net/10150/193606 THE REGULATION AND FUNCTION OF CYCLIN DEPENDENT KINASE 11
(CDK11): ANALYSIS OF THE CDC2L1 PROMOTER AND
ELUCIDATION OF CDK11P58 FUNCTION DURING MITOSIS
By
Amber Christine Kahle
A Dissertation Submitted to the Faculty of the
GRADUATE INTERDISCIPLINARY PROGRAM IN CANCER BIOLOGY
In Partial Fulfillment of the Degree Requirements For the Degree of
DOCTOR OF PHILOSOPHY
In the Graduate College
THE UNIVERSITY OF ARIZONA
2006 2
THE UNIVERSITY OF ARIZONA GRADUATE COLLEGE
As members of the Dissertation Committee, we certify that we have read the dissertation
prepared by Amber Christine Kahle
entitled The Regulation and Function of Cyclin Dependent Kinase 11 (CDK11): Analysis of the Cdc2L1 Promoter and Elucidation of CDK11p58 Function During Mitosis.
and recommend that it be accepted as fulfilling the dissertation requirement for the
Degree of Doctor of Philosophy
______Date: 11/03/06 Mark A. Nelson, Ph.D
______Date: 11/03/06 Giovanni Bosco, Ph.D
______Date: 11/03/06 Jesse Martinez, Ph.D
______Date: 11/03/06 Joyce Schroeder, Ph.D
______Date: 11/03/06 Roy Parker, Ph.D
Final approval and acceptance of this dissertation is contingent upon the candidate’s submission of the final copies of the dissertation to the Graduate College.
I hereby certify that I have read this dissertation prepared under my direction and recommend that it be accepted as fulfilling the dissertation requirement.
______Date: 11/03/06 Dissertation Director: Mark A. Nelson, Ph.D 3
STATEMENT BY AUTHOR
This dissertation has been submitted in partial fulfillment of requirements for an advanced degree at the University of Arizona and is deposited in the University Library to be made available to borrowers under rules of the Library.
Brief quotations from this dissertation are allowable without special permission, provided that accurate acknowledgment of source is made. Requests for permission for extended quotation or for reproduction of this manuscript in whole or in part may be granted by the head of the major department or the Dean of the Graduate College when in his or her judgment that the proposed use of material is in the interest of scholarship. In all other instances, however, permission must be obtained from the author.
SIGNED: Amber Christine Kahle 4
ACKNOWLEDGEMENTS
I would like to acknowledge all of the people who made the work of my dissertation possible. First, I would like to thank my advisor Dr. Mark A. Nelson for his mentoring and guidance that led to my development as a scientist. Second, I would like to thank Dr. G. Tim Bowden, the chairperson of the Cancer Biology Program, for all his help and guidance. In addition, I am grateful to the members of my graduate committee for valuable discussions about my research project. All of the members of the Nelson laboratory deserve a great deal of acknowledgment for their help and tutelage during my dissertation project. I am very thankful to Anne Cione and the Cancer Biology students for the help I received. I especially want to thank my friends that I have gained during this experience. I hope they are forever in my life because they have been instrumental to my success. Finally, I would like to express my gratitude to all my family members and friends who have been supportive to me throughout my entire life. 5
DEDICATION
This dissertation is dedicated to all those individuals who have helped to shape the person that I have become and that continue to support the person that I aspire to be.
I dedicate this dissertation to all my family and friends, especially my parents, my sister
Anna and the love of my life, John. Thank you for everything.
6
TABLE OF CONTENTS
LIST OF TABLES 9
LIST OF FIGURES 10
ABSTRACT 12
I. INTRODUCTION 14 Melanoma epidemiology 14 Melanoma treatment and complications 16 The genetics of malignant melanoma 19 Chromosome 1p36.3 alterations in cancer 24 Cdc2L gene structure 26 Kinase activity during normal cell physiology and cancer 29 Overview of CDK11 isoforms 32 CDK11 during RNA transcription and splicing 35 Cyclin L proteins 38 CDK11 in apoptosis 41 Mammalian cell cycle 45 CDK11 in the cell cycle 50 CDK11: a target for molecular cancer therapeutics? 55 Statement of the problem 57
II. MATERIALS AND METHODS 60 Cell culture, transfection and synchronization 60 Construction of plasmids for promoter constructs 60 Site-directed mutagenesis of promoter constructs 62 Database to identify possible transcription factor sites 62 Transient transfection of promoter constructs and luciferase reporter gene assay 63 Nuclear extract preparation 63 Electrophoretic mobility shift assay (EMSA) 64 Chromatin immunoprecipitation (ChIP) assay 65 Construction of plasmids for CDK11p58 experiments 67 Antibodies 68 Protein lysis and immunoprecipitation 69 Western blotting 70 Proteomic analysis 71 Immunofluorescence confocal microscopy 71 In vitro kinase assay 72 Identification of DDX15 phosphorylation sites 73 Knockdown of endogenous DDX15 and CDK11 73 Cell cycle analysis via flow cytometry 74 7
TABLE OF CONTENTS-Continued
Apoptosis assay via flow cytometry and ethidium bromide-acriding orange staining 74 Cancer-profiling array 75 Real-time PCR analysis of renal carcinomas 76
III. CDC2L1 PROMOTER ANALYSIS 77 Introduction 77 Results 78 Basal promoter activity of the Cdc2L1 gene 78 Ets-1 and Skn-1 are required to promote Cdc2L1 transcription 81 Electrophoretic mobility shift assay of Ets-1 and Skn-1 binding sites within the Cdc2L1 promoter 84 Chromatin immunoprecipitation of the Ets-1 and Skn-1 binding sites on the Cdc2L1 promoter 88 Discussion 89
IV. CDK11P58 ASSOCIATES WITH DDX15 95 Introduction 95 Results 100 Cyclin D3 associates with ectopically expressed CDK11p58 in A375 cells 100 CDK11p58 proteomic analysis identifies two different proteins, Hsp90α and DDX15 102 CDK11p58 associates with DDX15 proteins exogenously and endogenously 105 CDK11p58 proteins are colocalized within A375 cells with DDX15 proteins 107 CDK11p58 phosphorylates recombinant DDX15 protein 109 Ectopic expression of CDK11p58 and DDX15 leads to halt of the cell cycle during G2/M 111 Knock down of CDK11 and DDX15 expression permits cells to cycle through the cell cycle 114 Ectopic expression of DDX15 and CDK11p58 induces apoptosis 118 DDX15 expression is downregulated in several human tumors 120 DDX15 is reduced in human renal carcinomas compared to normal tissue 124 Discussion 125
V. CDK11P58 INTERACTS WITH VARIOUS CYTOSKELETAL PROTEINS AND HSP70 133 Introduction 133 Results 136 Proteomic analysis of CDK11p58 bound immunoprecipitates yielded many different potential binding partners 136 8
TABLE OF CONTENTS-Continued
CDK11p58 associates with cytoskeletal proteins 138 CDK11p58 associates with Hsp70 142 Discussion 144
VI. CONCLUDING DISCUSSION 149
APPENDIX A: PUBLISHED MANUSCRIPTS AND ABSTRACTS 170
REFERENCES 171 9
LIST OF TABLES
Table 1: Primers used for creating deletion constructs, substitution mutants, and oligonucleotides used in gel mobility shift assay 61
Table 2: Overexpression of CDK11p58, DDX15 and CDK11p58 + DDX15 leads to delay of the cell cycle at G2/M phase 111
Table 3: Knock down of DDX15 and CDK11 expression leads to increased ability of cell to cycle into G1/S phase 117
Table 4: Ectopic expression of CDK11p58 and DDX15 induce apoptosis 118
Table 5: DDX15 cancer-profiling array data 122
Table 6: Tissues with statistically significant decreases in DDX15 expression in tumors compared to normal tissues 123
Table 7: Proteins identified from proteomic analysis of CDK11p58 immunoprecipitates 138
10
LIST OF FIGURES
Figure 1: Melanoma progression and key genetic alterations that occur 15
Figure 2: The hallmarks of melanoma 23
Figure 3: Cdc2L gene diagram 35
Figure 4: The mammalian cell cycle is regulated by CDK-cyclin activity 50
Figure 5: Diagrammatic representation of published CDK11 protein activities 54
Figure 6: 5’ upstream region of the Cdc2L1 gene and putative transcription factor binding sites 78
Figure 7: Promoter activity of serial deletion constructs of the Cdc2L1 promoter 79
Figure 8: Mutational analysis of the transcription factor binding sites in the Cdc2L1 promoter 83
Figure 9: Electrophoretic mobility shift assay for the Ets-1A and Ets-1B binding sites in the Cdc2L1 promoter 85
Figure 10: EMSA for the Skn-1 binding site in the Cdc2L1 promoter 87
Figure 11: Chromatin immunoprecipitation of Ets-1, Skn-1 and E2F-1 interaction with the Cdc2L1 promoter in vivo 89
Figure 12: Alignment of Cdc2L1 promoter with the Cdc2L2 promoter 93
Figure 13: Schematic diagram of proteomic approach to identifying CDK11p58 associated proteins 98
Figure 14: Exogenously expressed CDK11p58 associates with cyclin D3 in A375 cells 101
Figure 15: Identification of potential binding partners of CDK11p58 104
Figure 16: CDK11p58 immunoprecipitation with DDX15 proteins with exogenous expression of CDK11p58 105
Figure 17: CDK11p58 immunoprecipitation with DDX15 proteins with endogenous production of CDK11p58 106
11
LIST OF FIGURES-Continued
Figure 18: In vivo colocalization of CDK11p58 and DDX15 in A375 cells 108
Figure 19: In vitro kinase assay of CDK11p58 with recombinant DDX15 110
Figure 20: Cell cycle analysis of A375 cells that overexpress CDK11p58 and DDX15 112
Figure 21: Western analysis of A375 cells with enforced expression of DDX15 and CDK11p58 and in combination 114
Figure 22: Flow cytometry of cells with knocked down expression of CDK11 and DDX15 116
Figure 23: Overexpression of CDK11p58, DDX15 and CDK11p58 + DDX15 induces apoptosis 119
Figure 24: Expression of DDX15 transcripts in normal and cancer cells 121
Figure 25: Real-time PCR results from 6 different normal kidney tissues and nearby renal carcinomas of DDX15 levels 125
Figure 26: Coomassie stain of c-myc immunopreciptates of pCMV-myc and pCMV-myc-CDK11p58 transfected lysates 137
Figure 27: Vimentin immunoprecipitates with CDK11p58 139
Figure 28: α-tubulin immunoprecipitation of CDK11p58 141
Figure 29: Lamin A immunoprecipitates with myc-tagged CDK11p58 142
Figure 30: Hsp70 proteins associate with myc-tagged CDK11p58 143
Figure 31: Diagram of CDK11p58 potential activity and findings 148
Figure 32: Proposed role of CDK11p58 as a scaffolding protein that modulates cell division and chromosome separation 163 12
ABSTRACT
Cancer is a disease that is characterize by genetic mutations that occur leading to an increased propensity for abnormal cellular growth. Chromosome 1p36.3 is lost or aberrant in several tumor types, including neuroblastoma and melanoma. In order to understand the functional significance of chromosome 1p36.3 loss in tumors, our research has been focused on elucidating the function of cyclin dependent kinase 11
(CDK11), a gene that is located within this chromosomal region. CDK11 is a serine/threonine kinase and is a member of the p34cdc2-related family of kinases. CDK11 has multiple isoforms that are involved RNA processing, apoptosis and the cell cycle.
CDK11 proteins are encoded by two different genes (Cdc2L1 and Cdc2L2), which are highly homologous to each other and are evolutionarily conserved. Our studies originated from investigating the regulation of the expression of CDK11 genes by isolating and characterizing the Cdc2L1 promoter region. We identified the basal promoter region and found that Cdc2L1 is regulated by transcription factors Ets-1, Skn-1 and E2F-1. Conversely, Cdc2L2 was shown to be regulated by TCF11/Nrf2, Ets-1 and
CREB, displaying differential regulation of the two different CDK11 genes.
p58 CDK11 is generated during the G2/M phase of the cell cycle because of an internal ribosome entry site found within the full-length CDK11 transcript. The generation of CDK11p58 during the cell cycle had previously been shown to be a regulatory event; however the actual function of CDK11p58 remained unknown. Our research focused on determining potential interaction partners of CDK11p58 and elucidating the role of these interactions in the regulation of the cell cycle. Utilizing 13 proteomic technology, we were able to find multiple potential interacting proteins with
CDK11p58, including a RNA-dependent RNA helicase protein, DDX15. DDX15 is phosphorylated by CDK11p58 and both proteins are directly involved in cell cycle regulation. Additionally, CDK11p58 was found to associate with several cytoskeletal proteins, α- and β-tubulin, lamin A, and vimentin, and heat shock proteins, Hsp70 and
Hsp90α. These investigations are only preliminary but provide a novel insight into the possible function of CDK11p58 during mitosis. 14
I. INTRODUCTION
Melanoma epidemiology
Cancer of the skin is by far the most prevalent type of cancer in humans in the
United States and accounts for nearly half of all cancers. The number of cases of nonmelanoma skin cancer diagnosed in 2006 will be greater than one million in the
United States alone. American Cancer Society estimates that about 62,190 new cases of melanoma will be diagnosed in the United States by the end of 2006 (1). Cutaneous malignant melanoma arises from melanocytes, the pigment-synthesizing cells found below the dermis in skin. Melanoma is the second most rapidly increasing cancer type in the Caucasian population. The incidence of melanoma is highly prevelant in sun-rich regions of the globe such as Australia, southern Europe, South Africa, and the southern sunbelt states in the USA where light skinned people populate (2). Melanoma, even though it can spread to other body parts quickly, is highly curable if detected early and treated properly. The 5-year relative survival rate for patients with melanoma is 92%.
For localized melanoma, the 5-year survival rate is 98%; survival rates for regional and distant stage diseases are 64% and 16% respectively. About 83% of melanomas are diagnosed at a localized stage (3). The American Cancer Society estimates there will be about 10,710 deaths from skin cancer in 2006 – 7,910 from melanoma and 2,800 from other skin cancers (1). Risk factors for melanoma have been intensively analyzed and include: a changing nevus, xeroderma pigmentosum, familial atypical mole-melanoma syndrome, atypical nevi, giant congenital nevi, prior melanoma, immunosuppression, 15 sun-sensitive phenotype, excessive sun exposure and melanoma in a first degree relative
(4). The epidemiological data on melanoma has shown that finding the disease in early stages is the most successful way to increase the probability of survival. This has led to a push for public education about how to detect early growths and lesions that might progress into melanoma. Patient education regarding the warning signs of early melanoma has successfully been acheieved using the A, B, C, D criteria: asymmetry (A), border-notching (B), color variegation (C), and diameter (D) (4). The disease progression of melanoma from normal to metastatic cancer occurs in a stepwise fashion that is characterized by key genetic changes (figure 1) (5).
Figure 1.
Malignant NormalBenign Premalignant Local Invasive Metastasis
p16, p53 E-cadherin bFGF, IL-8 N-cadherin MMP-2, EGFR
Radial Vertical Dysplastic Metastasic Normal Growth Growth Atypical nevi nevi Melanoma Melanocyte Phase Phase
MITF AP-2 CREB/ATF-1 Terminal MUC-1, c-Kit Differentiation SNAIL, ATF-2
16
Figure 1. Melanoma progression and key genetic alterations that occur. Adapted from Nyormoi, et. al paper that looked specifically at the transcriptional regulation of metastasis-related genes in human melanoma (5). These molecules are diverse with diverse functions but the underlying effects lead to an increased capacity for cells to grow and survive and evade the process of apoptosis and finally during the latter stages of progression, to invade and metastasize. This is a common set of changes in tumorigenesis although the individual genes involved may vary depending on the cancer type, similar to the Vogelstein model of tumor progression (6). As a normal melanocyte differentiates in the skin it has increased levels of micropthalmia transcription factor (MITF), which is a differentiating transcription factor. From normal to dysplasia to radial growth phase (RGP) melanoma there are decreases in CDK inhibitor p16 and checkpoint protein p53 that help evade apoptosis, and a shift from E-cadherin to N- cadherin as the epithelial-mesenchymal transition occurs. RGP progression to vertical growth phase (VGP) has several transcription factor changes including the increase of CREB and ATF-1/2 and decreases in AP-2, a key hallmark in metastatic melanoma progression. Alterations to membrane molecules like MUC-1 and cellular signaling through c-Kit tyrosine kinase also facilitate the progression to a metastatic phenotype. The final steps from VGP to metastatic melanoma encompass changes to bFGF and IL-8 that facilitate signaling and increased angiogenesis and survival. MMP-2 is a matrix metalloproteinase that helps manipulate the invasion of the extracellular membrane. Epidermal growth factor receptor (EGFR) signaling is an important component in extracellular signaling that leads to a variety of downstream effects including increased survival (5).
Melanoma treatment and complications
Malignant melanoma and treatment failure are both intertwined clinical problems.
The lifetime risk of melanoma continues to increase, up to greater than 1 in 75 people, but the current therapies have been relatively ineffective to date in the latter stages of the disease (7). Surgery of the primary tumor in the earlier stages of the disease leads to the high 5-year survival rate in those patients and even though most patients find their lesions within the beginning stages, there still remains a large amount of tumors that do not fall under this category. Many melanocytic lesions go undetected for long periods of time 17 and malignant melanomas tend to be a highly aggressive disease that advances quickly through the different stages outlined in figure 1. Therefore, there exists a significant population of people that develop stage IV metastatic melanoma as a consequence of late detection and the aggressive phenotype (8). Malignant melanoma when it arises does not always occur in the exact same fashion and there exist four major clinical subtypes or growth patterns. These subtypes include: superficial spreading melanoma, nodular melanoma, acral lentiginous melanoma and lentigo maligna melanoma (4). The highly progressive and unpredictable nature of melanoma lesions is also due to the many genetic changes that occur during both normal disease progression and additionally in response to chemotherapy. Melanoma cells in essence become “bullet proof” against many chemotherapeutic drugs and so even those that are detected early and undergo treatment may still progress into a highly dangerous disease that cannot be treated effectively.
Melanomas are characterized by their ability to evade apoptosis and by increases in proliferation and survival pathways (7, 9). The molecular pathways that become altered in melanomas have been the focus of melanoma research for the last several decades. As the incidence of melanoma continues to increase, researchers and clinicians continue onward to help combine the current knowledge of the genetic, functional, and biochemical alterations found in melanoma with cancer therapeutics.
Current malignant melanoma treatments begin with surgical excision of the lesion. External radiation therapy has little role in the treatment of primary melanomas but is employed to treat distant disease in brain and bone metastases, the two most common sites for melanoma spreading (10). After surgery the systematic use of 18 chemotherapeutic drugs is employed. The results of these treatments on the metastatic are minimal because of high levels of chemoresistance and overall nonresponsiveness (4,
10). This problem has led to much controversy in the methods of dealing with melanoma. The average survival rate of metastatic melanoma is only 6 to 10 months (7).
Multiple clinical trials and different treatment combinations have been employed to help combat metastatic disease and yet the incidence to mortality ratio of those melanomas that are detected at a late stage remains still very high. The alkylating agent dacarbazine
(DTIC) is the only FDA-approved drug for the treatment of malignant melanoma, only leads to 5-10% remission in patients (7). Temozolomide is another anticancer agent similar to dacarbazine that has shown some initial responses (21% response rate) in clinical trials (11). Other treatments have included immunological approaches that involve the use of interferon-α (IFNα) as an adjuvant or also vaccines to melanoma tumor antigens (7, 11). High-dose IFN-α2b has emerged as a standard for adjuvant therapy of several tumor types, including melanoma, and has shown some survival benefit in stage III pre-metastatic melanoma (10). The relative effectiveness of vaccine treatments has proven to be minor and relatively insignificant. Part of the hindrance of vaccine effectiveness is the inability of the vaccines to breach the blood-brain barrier to help combat the brain metastases (10, 11). Another set of ongoing studies includes the drug Sorafenib (BAY 43-9006) that is a B-raf kinase inhibitor, which came into prominence in recent years when the level of B-raf mutation in melanoma was correlated with increased disease (11-13). B-raf is upstream in the mitogen-activated protein kinase
(MAPK)/ extracellular signal-regulated kinase kinase (MEK)/ extracellular signal 19 regulated kinase signaling pathway (ERK) that is commonly associated with most tumor types because of its ability to increase cell proliferation and other necessary pathway deregulation that occurs in tumorigenesis (14, 15). B-raf in melanoma is mutated at residue 599 leading to a valine to glutamine mutation, which is polymorphism that predisposes melanocytes to form tumors and evade cancer-immune cell evasion (16).
However, the effectiveness of these studies with Sorafenib has yet to be certified and appears to be low (11). Hence, the production of an efficient treatment (combined or singular) for metastatic melanoma is crucial to solving the escalating amounts of melanoma related fatalities. The overlying concept that has delayed treatment of metastatic melanoma is the capacity for these tumors to become chemoresistent over time
(7). Novel treatment approaches to help combat this drug resistance, which is often tied to reduced levels of apoptosis and increased cell survival, have taken many different approaches. The different genetic and epigenetic changes that occur in malignant melanoma help to provide avenues of research to help identify how the drug resistance occurs in response to standard treatments.
The genetics of malignant melanoma
The apparent need for effective treatment protocols to battle the increasing levels of melanoma has prompted researchers to evaluate all areas of disease formation and progression. In the past decade, significant advancements in determining the genetic components of melanoma have been made (12). Self-sufficiency in growth signals is one 20 of the key processes that occurs in cancer (9). As mentioned previously, one area of targeted research on melanoma has involved the observation that greater than 66% of melanomas harbor mutations that affect B-raf activity. The mutations in B-raf exhibit constitutive activity in the MAPK pathway (13, 17). Basic research has validated that inhibition of the B-raf/MEK/ERK cell survival pathway can be used to reduce cell viability in those tumors with increased levels of signaling (14, 18). This, alone, however cannot be a full solution for the many different signaling changes that occur in melanomas. Although much of the recent melanoma therapy research has focused on the
B-raf/MEK/ERK pathway because of its prominent levels of alteration in melanomas, there are several other pathways that play key roles in melanomas including: the phosphatidylinositol 3-kinase (PI3K)/Akt pathway, nuclear factor κB (NF-κB) pathway,
Janus-activated kinase/signal transducers and activators of transcription pathway
(JAK/STAT), and β-catentin pathway (17). Primary research in these particular signaling pathways has shown that combined treatment of both the B-raf/MEK/ERK and the
PI3K/Akt pathways can decrease cell survival in melanoma metastases cell lines. Since the PI3K/Akt pathway is important for the suppression of apoptosis and cell cycle control, these studies show that there are multiple steps involved in treating melanomas.
Therefore, given that multiple signaling pathways and multiple cellular processes are involved in melanoma development and melanoma chemoresistence, there are multiple targets that must be considered and treated (17, 18). The oncogenic pathways mentioned above are involved in the increased cell survival and proliferation and can be suppressors of apoptosis. These pathways illustrate that cancers become insensitive to anti-growth 21 signals, which is another of the hallmarks of cancer (9). The PI3K/Akt and
MAPK/MEK/ERK pathways are just some of the commonly up-regulated processes in tumors but there exists evidence of other pathways that are down regulated in melanomas
(13). Other genes related to metastasis in human melanoma include a transcription factors like AP-2, ATF-2, SNAIL, ATF-1, CREB and MITF, cell cycle checkpoint proteins like p53, integrins and cadherins, matrix metalloproteases (MMPs). The roles of these different molecules are variable and they only comprise a small portion of a very large list of genetic alterations that occur in melanoma (5).
The genetics of melanoma includes an entire area that contains several different alterations, which are all related to the process of apoptosis or programmed cell death.
One of the hallmarks of cancer is the ability of tumors to evade apoptosis (9). The process of apoptosis is in essence a fail-safe mechanism for cells. It is designed to ensure that those cells under severe stress or damaged cells with aberrant cell characteristics beyond those of normal are terminated within the body. This ensures that homeostasis is upheld within the body and that tissues are maintained in their proper growth and development. Therefore, when a tumor cell expresses characteristics that are not within the realm of normal tissue physiology, these cells are targeted for cell death to guarantee a normal, healthy organ function (19, 20). The process of apoptosis begins with the detection of the aberration, whether it is cell damage or abnormal cell survival. p53 is often involved in sensing the damage or abnormalities and causing either repair pathways to be activated by inducing a halt to cell cycle progression or inducing cell death by stimulating mitochondrial factors involved in the execution of apoptosis (20-23). 22
Apoptosis involves the activation of a complex array of cysteine aspartate proteases, termed caspases. The caspase cascade is activated either through death receptors or mitochondrial mediated apoptotic events. The external signals through different death receptors and the internal signals from internal sensory molecules are modified in melanoma cells (24). Molecules that positively regulate apoptosis (pro-apoptotic factors) such as p53, Bid, Noxa, PUMA, Bax, TNF, TRAIL, Fas/FasL, PITSLRE, interferons, and c-KIT/SCF are characteristically reduced or mutated to show decreased function within melanomas (24). Whereas negative regulators of apoptosis (anti-apoptotic factors) like
Bcl-2, Bcl-XL, Mcl-1, surviving, livin, ML-IAP, and other inhibitors of apoptosis (IAP), are commonly increased in melanomas to increase cell survival (24-26). The roles of these different factors depend upon where they act within the process of apoptosis and what molecules they in turn interact with to cause their effects. Since these molecules are either activated or inactivated in tumors they are the subject of great interest to researchers to help elucidate their individual activities and to translate this information into therapeutics interventions (7, 12). The list of potential therapeutic targets, i.e. molecules involved in causing melanoma, is on the rise at a faster pace than the clinical development of agents against them. This presents a great deal of work that still needs to be done to help determine how the most effectively treat melanomas, whether it be their inherent ability to evade apoptosis or their drug resistant acquired capacity (25, 27). The genetics of melanoma are diverse. Three of the six hallmarks of cancer have been described in detail above, however melanomas display all six of the hallmarks including the enabling characteristic of genome instability that is described more thoroughly below 23
(9). The six different hallmarks of cancer are described in figure 2 with specific
examples in melanoma detailed for each (24, 28-36).
Melanoma genes: hallmarks of cancer
Ex. B-raf MAPK
Ex. bFGF Ex. PITSLRE p53
Ex. bFGF Ex. MMP-2 VEGF N-cadherin E-cadherin Ex. p53 p16
Figure 2. The hallmarks of melanoma. The above figure is derived from Hanahan et. al (9). Melanoma has characteristics that fulfill all the hallmarks of cancer. Self- sufficiency in growth signals includes changes to the cell growth and survival pathways of B-raf and MAPK. BFGF expression and loss of p53 can remove the ability of cells to respond to antigrowth signals. Melanomas evade apoptosis via several different means but PITSLRE protein kinases play important roles in apoptosis and are lost in several melanomas as described in greater detail further. bFGF and VEGF also increase the tumor angiogenesis supplying nutrients and oxygen to the tumor. Loss of p53 and p16 release checkpoints and allow replication to occur limitlessly. Also hTERT telomerase has been linked to melanomas ability to replicate without senescence. Lastly, invasion and metastasis is facilitated by changes to extracellular matrix proteins and the ability of melanoma cells to migrate and invade through MMP-2 and N-cadherin switching from E-cadherin during EMT (24, 28-36). 24
The initial studies of the mechanisms by which changes occur between normal
melanocytes to the notoriously drug resistant metastatic malignant melanomas began with
observations of chromosomal alterations. Researchers have identified recurrent break
points and translocations that occur in melanomas and this has provided the foundation
for investigations in the genes that are likely involved at those recurrent sites. Using
multiple techniques such as chromosome banding, fluorescence in situ hybridization
(FISH), comparative genomic hybridization (CGH) and spectral karyotyping (SKY),
chromosomes 1, 3, 6, 7, 9, 10, and 11 have been frequently reported in the literature to
have common cytogenetic aberrations in malignant melanomas (35, 36). Previously
mentioned there exists evidence of familial involvement within certain melanomas and
this has been linked strongly to chromosome 9p21 (37). These observations have been
the foundation for much research to understand the significance of each of these
chromosome changes that occur recurrently within malignant melanoma and often times
within other tumor types (13).
Chromosome 1p36.3 alterations in cancer
A fundamental principle underlying our understanding of tumorigenesis arises from the sequential acquisition of genetic alterations of specific genes depending upon the tumor type. One of the most common properties of tumors is aneuploidy, alterations to the number of chromosomes (38). The terminal end of the short arm of human chromosome 1 is frequently altered in a number of tumors, including melanomas as 25 mentioned above. Specifically, deletion of the 1p36.3 is found in neuroblastomas, malignant melanomas, ductal carcinoma of the breast, ovarian cancers, Non-Hodgkin’s lymphomas, early childhood sinus tumors (33, 39-47). This region of the genome is linked not only to cancer but also to a genetic disorder termed monosomy 1p36, which is becoming increasingly known as one of the most common chromosomal deletion syndromes. Monosomy 1p36 leads to developmental delay in patients affected with this disease and potentially may be the cause of congenital heart failure in these patients (48).
The significance of these different chromosome 1p36 abnormalities is due to the genes that are located within this chromosome. The high frequency of loss of chromosome
1p36.3 in tumors and the relative correlation of loss of heterozygosity of this chromosome band region to poor prognosis in several tumors, especially neuroblastomas, suggests that human chromosome 1p36.3 may be the site of tumor suppressor genes (36,
49, 50). Tumor suppressor genes refer to those genes whose loss of function results in the promotion of malignancy. Tumor suppressor genes are usually negative regulators of growth or other functions that may affect invasive and metastatic potential of cells (51).
The different genes located on human chromosome 1p36 include many apoptosis related genes such as, Cdc2L1, Cdc2L2, DR3, DR3L, TNFR2, CD30, OX40, the 4-1BB ligand, and also p73, a p53-related gene (49). Recently, five novel genes (XBX1, PTPRZ2,
FRAP2, ENO1, and C1ofr1) were identified as well (50). Many groups have utilized these observations to delve further into the function of each gene in their respective tumor types of significance. One example of this research showed that one allele of the Cdc2L1 gene complex on chromosome 1 was either deleted or translocated in 8 of 14 different 26
melanoma cell lines using fluorescence in situ hybridization (FISH) and that the alterations in these alleles correlate with differences in sensitivity of melanoma cells to apoptotic stimuli (33).
Cdc2L gene structure
Chromosome 1p36.3 contains the Cdc2L gene locus that encodes two duplicated and tandemly linked genes, Cdc2L1 and Cdc2L2 (52). Both the Cdc2L genes span about
140 kb on human chromosome 1 band p36.3. The high degree of similarity between these two genes has made studies of the individual genes difficult (49). Gene duplication has occurred throughout history and has played an important role in creating gene families that provide necessary amounts of functional redundancy (53). Also duplicated with the Cdc2L genes are both of the MMP21 and MMP22 genes (52, 54). MMPs have long been associated with cancer-cell invasion and metastasis. There are greater than 23 different MMPs with varied functions. The significance of these MMP21-22 genes being duplicated and also located on the same region as the Cdc2L genes is yet unknown (55).
Both of the Cdc2L genes are comprised of 20 exons and 19 introns that undergo extensive alternative splicing in the N-terminal portion of the molecule to generate more than 20 distinct CDK11 mRNA and potentially that many different protein CDK11 isoforms (49, 56). A single nucleotide variation in exon 17, which generates an Eco RI
site in Cdc2L2 was able to delineate between the different Cdc2L genes. Overall, only 16
amino acids are different between the different protein products of Cdc2L1 and Cdc2L2
(49, 52). 27
Both Cdc2L genes remain transcriptionally active and are ubiquitously expressed
in all the tested human tissues (49, 52). Initial mutational analysis studies showed that
mutations in both the Cdc2L1 and Cdc2L2 genes are rare in melanoma cell lines, but
several polymorphisms are present in the 5′ promoter region of Cdc2L1 (57). Another report showed that neither loss of whole exons nor any mutation is found in the coding region of Cdc2L1 in malignant melanomas (45). All these previous studies suggest that differential expression of the Cdc2L gene rather than the mutant protein itself may be significant to determining the importance of the Cdc2L gene variations in cancer. Studies to understand the significance of this gene duplication and the allelic variation have included those that evaluated the alternate promoter usage from each of both of the
Cdc2L genes (58). Initial studies of the basal promoter activity for both the Cdc2L1 and
Cdc2L2 gene promoters found that they are subject to differential regulation based upon
the dissimilar transcription factors that bind to the nearly identical promoters. The
Cdc2L1 promoter is regulated by the Ets-1 and Skn-1 transcription factors and also
contains an E2F-1 binding site (59). The Cdc2L2 promoter is regulated by Ets-1, CREB
and TCF11/LCR-F1/Nrf1 (60). The importance of these different genes and their relative
gene products still remains unknown.
The Cdc2L genes are shown to have between 30-80% homology with genes
thought to be functionally similar in many eukaryotic organisms. These CDK11 gene
homologs are found in humans, mouse, chicken, rat, Caenorhabditis elegans,
Saccharomyces cerevisiae, Xenopus laevis, and Drosophila melanogaster and many other 28 organisms (49, 61, 62). The fact that CDK11 genes are evolutionarily conserved indicates an important function for CDK11 proteins within cells.
One interesting point of mention regarding the importance of the CDK11 genes,
Cdc2L1 and Cdc2L2, includes studies in mice that have confirmed an essential role of
CDK11 during development. Homozygous knockout of the Cdc2L genes
(CDK11p110/p58-/-) is early embryonic lethal and fetuses are not able to survive past the blastocyst phase of development between 3.5 to 4 days postcoitus, due to increased levels of apoptosis as the result of proliferative defects and mitotic arrest. The heterozygotes
(CDK11p110/p58+/-) are viable and appear to develop normally (63). Relating these data back to the possibility that CDK11 is a tumor suppressor gene, which typically requires a mutation in one allele and a deletion of the remaining allele in keeping with the long- standing "two-hit" hypothesis formulated by the Knudson hypothesis, the results of the heterozygotes are of interest (64, 65). Mutations to the coding region of CDK11 are not seen appreciably in several malignant melanomas and melanoma cell lines that have been investigated (57). However there is much evidence to confirm that many neuroblastomas do often have deletion of only one allele of the Cdc2L gene and that correlates with a poor prognosis and a reduced responsiveness to chemotherapy (41). The dichotomy between these observations makes an interesting case for potential haploinsufficiency of the Cdc2L genes on chromosome 1p36 playing a role in tumorigenesis of differentiated cells (66). Haploinsufficiency is the loss of only one allele that may cause effects directly attributable to a reduction in gene dosage or may act in concert with other oncogenic or haploinsufficient events (66). There are varying degrees of haploinsufficiency, which 29 may occur depending upon the specific gene and its effects within cells (67, 68). There have yet to be confirmatory studies to determine whether CDK11 proteins are causal in tumorigenesis due to the altered gene dosage of CDK11 genes within cells and it is unknown how significant these altered levels may be on tumorigenesis. Studies of the p18INK4c tumor suppressor gene show that haploinsufficiency of this gene in mice sensitizes them to carcinogen-induced tumorigenesis (69). These studies illustrate the need for further experiments to determine exactly how the haploinsufficiency of Cdc2L genes can increase tumor progression. These results overall are consistent with the known and proposed roles of CDK11 proteins within cells and their necessity for cellular viability.
Kinase activity during normal cell physiology and cancer
Kinases are crucial to the regulation and function of normal cell physiology in several different ways. Phosphorylation of substrates is involved in regulation and modulation of every known cellular process, including cell growth, differentiation, metabolism, transcription, cell cycle progression, cytoskeletal rearrangement and cell movement, and cell death. Phosphorylation is known as the key regulatory post- translational modification that is responsible for the majority of signaling pathways, both intracellular and intercellularly (70-72). Phosphatases also comprise a significant area of cancer research because of their counter role to kinases and their often deregulation in many different cancer types, including melanoma (73-75). Of the 291 cancer-causing genes identified, 27 (6%) encode protein kinases, which is far higher than the predicted 6 30
(2%) that would be predicted based upon random selection. The human genome has found 518 genes that belong to the “kinome” (approximately 1.7% of the human genome) and at least 187 of those protein kinases are specific for a variety of different malignant tissues (72). Serine-threonine kinases (STKs) phosphorylate serine or threonine residues on their substrate molecules and are found in most abundance (approximately 400).
Tyrosine kinases are in less abundance within cells and with their relatively low numbers they are found in key signaling mechanisms that are crucial to cell functions, such as transduction of external stimuli to the cell nucleus (75, 76). Although much of the focus in cancer has been on the critical role of tyrosine kinases because of their exclusivity in cellular signaling, STKs also are found as essential components of tumorigenesis. One example mentioned previously includes the members of the MAPK pathway, like MEK and ERK, which are deregulated in several tumor types (14).
Cancer research has shown that alterations to kinases, in terms of mutations, translocation, amplification, overexpression, and post-translational modification, are among the many changes that occur in the progression from normal to tumor states (75,
77). The obviously crucial role of kinases in cancer has created a goal for modern molecular therapeutic research to develop drugs to target the aberrant kinase activity found in cancer cells (77, 78). Researchers and clinicians are focused on drugging the cancer kinome but there has been mixed success to date (77). One of the clinical successes has been the use of the small molecule tyrosine kinase inhibitor imatinib
(Gleevec) that is used in chronic myeloid leukemia (CML) and gastrointestinal stromal tumors (GIST). Gleevec is targeted specifically to the Brc-Abl mutant kinase fusion 31 protein in CML and c-Kit or PDGF proteins in with activating mutations GIST.
Although the success of this treatment has been well publicized recent reports have shown that some drug resistance does arise (79). Therefore, research is ongoing to determine how to effectively target kinases within cells and to prevent the inherent ability of tumors to acquire chemoresistance.
One key group of STKs that have been identified as crucial regulators of the cell cycle is the cyclin dependent kinase (CDK) family of proteins (80-82). CDKs play an essential role in not only cell cycle manipulation but additionally in other cellular processes including control of gene processing, apoptosis, neuronal regulation, and senescence (81, 82). Deregulation of these critical regulatory proteins occurs commonly in cancers and has led to an entire area of therapeutic targeting where inhibition of abnormal CDK activity is key (82). CDKs are the catalytic subunits of a family of STKs that require the binding of a positive regulatory subunit known as the cyclin. There are
12 identified CDKs that have each been found through varied methods but were classified due to their level of homology to the original member, CDK1. Some of the new members of the CDKs were designated by PSSALRE or PLSTIRE because of a common amino acid sequence found in a conserved domain (80, 82). One more recently identified members of this family is PITSLRE, now designated CDK11, which is the
Cdc2L1 and Cdc2L2 gene product. CDK11 has been found to have multiple activities in cells including cell cycle regulation, RNA transcription and splicing, neuronal signaling and apoptosis (49). Of the 12 known human CDKs, greater than half have been shown to be involved in activities besides control of the cell cycle (49, 82). Since CDKs have 32 multiple activities within cells that are important to cell division and growth, their activities are often deregulated in human cancers. They are not commonly mutated in these cancer but the upstream molecules involved regulating CDK activity are common targets for alterations within tumors. These alterations include increased expression or availability of cyclins, such as the D-type and E-type cyclins that are essential to entry into the cell cycle (82-84). Tumors also show a reduction in CDK inhibitors, such as the
INK4, Cip and Kip inhibitors that are known tumor suppressor genes (69, 82, 83).
Cancer therapeutics in recent years have focused on the apparent need to regulate CDK function on the cell cycle within tumor cells and have created several small molecule inhibitors that are producing mixed results in clinical trials (77, 78, 82).
Overview of CDK11 isoforms
Alternative splicing is an important mechanism to control gene expression and leads to a large proteomic complexity from a limited number of genes (85, 86). There are probably greater than 100,000 different proteins expressed at any one time in a human cell but the human genome only contains around 30,000 genes. Alternative splicing of genes leads to increased functions and variable protein activity depending upon the absence or inclusion of certain exons within mRNAs and the creation of specific gene products has also been tied to several disease types including cancer (86-88). One study of chicken testis development and regression was designed to analyze the expression of different CDK11 transcripts because alternative splicing of mRNAs has also been strongly correlated to the marked changes that occur during spermatogenesis. CDK11 33 transcripts were diversely expressed within testis tissue based upon differential splicing and alternative usage of polyadenylation, which may implicate specific CDK11 proteins with roles in spermatogenesis (89). So with the alternative usage of the promoters and the high level of alternative splicing that occurs, there are 16 amino acid residues within
CDK11 that differ between the two different full-length transcripts produced from the
Cdc2L genes (49, 52). These amino acid changes occur predominantly in the amino terminal region of the protein, in part due to the more selective amounts of alternative splicing in this regions, but may be involved in altered capacity for binding with additional proteins such as the 14-3-3 family of proteins (49, 90). It is unknown how the different Cdc2L transcripts and their corresponding proteins are significant to the activities of CDK11 within the cells. Yet there are at least 20 distinct mRNA isoforms
(six from Cdc2L1 and twelve from Cdc2L2 have been characterized thus far (49)) so it is apparent that the many different isoforms created play an important role in CDK11 function.
CDK11 proteins are part of p34cdc2-related family of kinases and displays a significant homology to the prototypical CDKs, CDK1 and CDK2 (49). CDK11 has several different isoforms that have been shown to regulate a variety of different cellular activities, including RNA processing, mitosis, and apoptosis (49, 91-93). CDK11 is comprised of an N-terminal regulatory region. The amino-terminal (N-terminal) portion of the CDK11 molecule has multiple nuclear localization signals (NLS) and a fourteen- three-three (14-3-3) consensus site. 14-3-3 proteins are involved in protein transport
(94). Two separate domains, an arginine/glutamic acid domain (RE domain) and a poly- 34 glutamic acid domain (poly-E domain) are located in the center of the CDK11 protein.
RE domains are linked to association with RNA processing factors and poly-E domains are emerging as potential cytoskeletal interacting domains that support RE domain function and aide in keeping these proteins subnuclear (49, 95, 96). Within the poly-E region is an internal ribosome entry site (IRES) element that is used to create an essential
p58 p58 isoform, CDK11 , expressed exclusively during G2/M. The regulation of the CDK11
IRES sequence is done by a purine-rich region and a unr-consensus binding site within the CDK11 mRNA. The CDK11 IRES sequence interacts with the Upstream of N-ras
(Unr) protein, whose expression increases during G2/M (97, 98). The phosphorylation of eukaryotic initiation factor 2 alpha (eIF2α) is increased during G2/M and this leads to a permissive effect on the efficiency of the CDK11 and the ODC IRES element, another cell cycle related gene (97). There are several caspase cleavage sites located throughout the molecule that have been identified as important sites during the apoptosis activity of
CDK11 proteins (49, 92). Finally, the full-length CDK11 protein has a carboxy-terminal
(C-terminal) catalytic domain that is responsible for its kinase activity (49). The most important conserved amino acids in CDK11 to both CDK1 and CDK2 include the
PSTAIRE α-helix and three phosphorylation sites that are involved in the activation and repression of CDK kinase activity (49). 35
Amino Terminal Domain Ser/Thr Protein Kinase Catalytic Domain
ATP-binding ATG 14-3-3 Caspase-3 Caspase-3 NLS binding sites Poly-E sites PITSLRE
Cdc2L1 R R A RR KE V EEE S L D Cdc2L2 C W V CH F L Q E Exon 2 2’ 3 4 4’ 5 5’ 6 6’ 7 7’ 8 9 10 11 11’ 12 13 14 15 16 17 18 19 20
Figure 3. Cdc2L gene diagram. The diagram was derived from Gujururan et al. (52). Both the Cdc2L genes have 19 introns and 20 exons that undergo alternative splicing. The different domains are N-terminal and C-terminal catalytic domain. There are nuclear localization signals and caspase-3 cleavage sites. 14-3-3 proteins bind to the N-terminal region. The different amino acid changes between the two genes are pinpointed below for both Cdc2L1 and Cdc2L2. The poly-glutamate (poly-E) region is the sight of the internal ribosome entry site (IRES). PITSLRE amino acid sequence is located in the C-terminal portion near the ATP-binding site, which helps to characterize it as a CDK (52).
CDK11 during RNA transcription and splicing
The predominant protein that is produced ubiquitously in all cells and cell lines examined thus far is the approximated 110 kDa sized protein, termed CDK11p110 (49, 52,
56, 92). The majority of studies have delved into understanding the function of
CDK11p110. CDK11p110 is the most extensively studied CDK11 isoform, and data collected over a decade demonstrate its role in transcription and pre-mRNA splicing
(49). CDK11p110 localizes to both splicing factor compartments (SFCs) and to the nucleoplasm via immunofluorescence (99). Two distinct pools of CDK11p110 protein were found within “soluble” (nucleoplasmic) and “insoluble” (SFC-associated) nuclear fractions in cell fractionation experiments (99). Using yeast two-hybrid analysis, several 36
putative partners were identified including the splicing factors RNPS1 and 9G8, and the
transcription elongation factor ELL2, verifying the link between CDK11p110 and mRNA
production (91, 99, 100). Chromatographic purifications of CDK11p110 protein
complexes combined with co-immunoprecipitation experiments demonstrated a role of
p110 p110 CDK11 in transcription. CDK11 associates with hypo-(IIA) and
hyperphosphorylated forms (IIO) of the largest subunit of RNAP II carboxy-terminal domain (CTD) and with the basic transcription factors TFIIF and TFIIS (100). A direct interaction between CK2 and CDK11p110 was demonstrated involving the RE domain of
CDK11p110 and CDK11p110 immunoprecipitate complexes contain a CTD kinase activity
that was shown to be due to CK2 (101, 102). These observations confirm previous
evidence of CTD phosphorylation by CK2 (103-105). CK2 is a highly ubiquitous and
conserved protein that is involved in cell growth and proliferation and suppression of
apoptosis. It is uniformly dysregulated in every cancer that has been examined thus far
making it a target for cancer therapy (106). In addition, CK2 was shown to
phosphorylate CDK11p110 in vitro, confirming the previous observation that CK2
phosphorylates in vitro bacterially produced CDK11p130, the murine homologue of the
human CDK11p110 (103-105, 107). This CK2-mediated phosphorylation allowed
CDK11p130 to act as an SH2 ligand (107). The direct role of CDK11p110 in transcription
was validated using a standard in vitro transcription assay of RNA transcripts produced
from both TATA-like and GC-rich promoters. CDK11p110 protein–protein interactions
and catalytic domain are important for transcriptional activity, and that the association of
CDK11p110 with transcription complexes is functionally significant. Another interesting 37
study using comparative genomics identified that during the evolution of the RNAP II
CTD there appeared to be a linked co-evolution of necessary CDKs, including PITSLRE
proteins, which just further illustrates the significance of this relationship throughout
time (108).
As mentioned in the text above, CDK11p110 was also found associated with at
least two splicing factors, RNPS1 and 9G8 (91, 99). RNPS1 is an SR protein-related
protein that is a highly versatile alternative pre-mRNA splicing regulator that is
phosphorylated by CK2, similar to CDK11p110, and has verified activity in vivo (109,
110). RNPS1 is also found in different forms of the protein complex apoptosis- and splicing-associated proteins (ASAP), which links RNA processing to apoptosis (111).
9G8 is a general splicing factor that shuttles between the nucleus and the cytoplasm and promotes the nucleocytoplasmic export of mRNA (111-113). 9G8 is regulated by its phosphorylation status and was recently reported to be a potential substrate of CDK11p110
and cyclin L1a, therefore indicating that CDK11p110-cyclin L1α-9G8 may be essential to
splicing and mRNA export from the nucleus (112, 114). Using conventional in vitro
splicing assays with β-globin pre-mRNA as substrate, immunodepletion of the
CDK11p110 kinase from nuclear extracts greatly reduces the splicing activity, while re-
addition of the CDK11p110 immunoprecipitates rescued the splicing activity. The addition
of recombinant protein encoding the N-terminal domain of the CDK11p110 known to be
involved in protein–protein interactions also significantly inhibits splicing activity in the
same assay (91, 99-101, 114). Taken together, these data show that CDK11p110 kinase is
involved in the regulation of gene expression at the level of transcription and splicing. 38
Cyclin L proteins
Another major interaction to note is that between CDK11p110 and the cyclin L family of proteins. As with other CDKs, CDK11p110 has been found to have a cyclin partner. Cyclin L1 and cyclin L2 proteins are found in complex with CDK11p110 and these complexes have been localized to the nuclear speckle region, a site of pre-mRNA splicing within cells (115-117). The activity of both members of the cyclin L family has been directly correlated to the previously known RNA splicing activities of the
CDK11p110 proteins (115-117). CDK12 has also recently been found to associate with
cyclin L1 and they are involved in alternative splicing (118). Research on the
CDK11p110 isoforms has yielded much information about the importance of these
molecules during the production of viable mRNA (49).
Recent evidence has determined that cyclin L proteins are involved in pre-mRNA
splicing events within cells. Homologs of the cyclin L family of proteins exist within
several different species including human, mouse, Drosophila melanogaster and
Caenorhabditis elegans (115-117, 119, 120). Cyclin L proteins share a high homology
with other cyclins K, T1, T2, and C (115). The highly conserved nature of these proteins
indicates an important role for them in normal cell function. The cyclin L1 gene,
CCNL1, is located on chromosome 3q band region 23.2-3 and has 14 exons (117). The
cyclin L2 gene, CCNL2, is located on chromosome 1p36.33 and spans approximately 13
kb comprising 11 exons (115, 116). Both CCNL1 and CCNL2 transcripts have been
found in nearly every tissue (115-117). 39
Both CCNL genes undergo alternative splicing to form three different transcripts.
Each transcript is distinctly different in size from the others. The largest sized transcript is approximately 4.3 kb in size and contains an early stop codon so it translates into a truncated form of the protein that is predicted to be around 30 kD in size. A
2.3 kb transcript does not contain an early stop codon and is able to read through to produce a larger sized protein that varies between ~55-60 kD. Finally, the smallest transcript includes an early polyadenylation signal leading to the formation of an approximately 1.2 kb sized mRNA. The smallest transcript is likely translated into the smaller ~30 kD protein (115-117, 121).
Immunofluorescence of cells transfected with GFP tagged cyclin L2 showed that the larger protein localizes to the nucleus, specifically the nuclear speckle region (115,
116, 121). It is well known that the nucleus is a highly compartmentalized organelle that is highly dynamic. The nucleus contains distinct regions where specific nuclear processes are proposed to occur based upon the localization of nuclear factors with known functions. The nuclear speckles are enriched in pre-mRNA splicing factors and are localized within the nucleus to interchromatin regions of the nucleoplasm. Therefore, nuclear speckles are hypothesized to be the primary region where pre-mRNA undergoes splicing to form mRNA that contains only exons (122). Cyclin L proteins are unique proteins. They have homology to the splicing regulatory (SR) family of proteins that are involved in RNA splicing (115-117, 120). SR proteins contain arginine-serine (RS) rich domains that serve as interaction sites between different RNA processing factors (115-
117, 119, 120). Cyclin L proteins are unique to all other RS domain splicing factors 40
because of their cyclin box. Cyclin boxes are the regions within cyclins that associate
with their respective cyclin dependent kinases. Cyclin L proteins are the first cyclins
ever to contain an RS domain, which is a region involved in splicing (115-117, 119, 120).
The unique nature of this protein structure may help to identify how different cellular
processes are linked. In mice, ania-6 is the homolog of human cyclin L. Ania-6 was
found to be the cyclin partner of the orphan mouse CDK11 homolog, PITSLRE (120,
121, 123). In addition to interacting with PITSLRE, ania-6 was also shown to colocalize
within mouse cells with hyperphophorylated RNA polymerase II (RNAP IIo) and to SC-
35, a known splicing factor (120). Based upon the findings in mouse cells, human cyclin
L proteins have subsequently been shown to associate with human RNAP IIo CTD, SC-
35, 9G8, histone H1, and CDK11p110 (115-117).
Essential cellular processes, such as production of functional mRNA molecules
via RNA processing, often become deregulated during disease development. Both
alterations to the splicing of individual proteins and alterations to the levels and functions
of individual splice factors have been linked to a wide range of diseases including cancer
(86, 88). Cyclin L2 has also uniquely been shown to induce apoptosis in human
hepatocellular carcinoma cells in culture and in xenograft mouse models (115). This
reiterates the previously mentioned fact that evasion of apoptosis is a hallmark of cancer
cells and is achieved by the cancer cells because of several different alterations from
normal cells. Loss of key genes involved in apoptosis is one way that cancer cells are
able to overcome cell death (9). Cyclin L2 is located on chromosome 1p36.3, near the
Cdc2L genes (115, 116). The fact that cyclin L2 and CDK11 genes are both located on 41 the same chromosome that is often a target of alteration in cancers makes them interesting subjects to study.
CDK11 in apoptosis
The life and death of cells in the human body maintains a highly choreographed balance during the many stages of human development and differentiation. A fail safe mechanism to prevent the anomalous existence of certain cells within the body is programmed cell death or apoptosis (20). Through both extrinsic and intrinsic signaling, normal cells respond and create a homeostatic balance of survival and death depending upon the threshold of the signal (124). Evasion of apoptosis is one of the hallmarks of cancer but that in itself involves a complex process because many different molecules are responsible for the process of apoptosis within cells and the functions (9, 24). The intrinsic process of apoptosis requires a signaling cascade that utilizes proteolytic cleavage of specific proteins in order to potentiate the signal. Those proteins that are cleaved include the procaspase-8 and procaspase-9, which are zymogens that when cleaved are able to further cleave procaspase-3 into caspase-3. Caspase-3 is the effector caspase that has many different substrates that are cleaved by it and the subsequent cleavage leads to their individual protein functions within apoptosis (24). One example of a protein that is a terminal part of the caspase cascade is CDK11p110 (92).
CDK11p110 is processed during apoptosis into both the CDK11p46 and the
CDK11p60 protein products (92, 125, 126). There are multiple caspase-1 and caspase-3 sites located on the CDK11p110 molecule and these sites are discriminately used to 42
produce both the CDK11p46 and the CDK11p60 proteins (49, 127). Cleavage immediately
downstream of the CDK11p58 translation start site methionine residue removes 52 amino
acids from the N-terminal domain leaving intact catalytic domain and the CDK11p46 isoform (49, 127). Expression of CDK11p46 is associated with activation of caspases and
cleavage of a pre-existing pool of CDK11p110 during apoptosis (92). TNFα and Fas are
both death receptor proteins that can induce apoptosis, in Jurkat T cells and the human
melanoma cell line A375, leading to subsequent activation of CDK11p46 (126-129).
Chinese hamster ovary (CHO) cells expressing an N-terminal truncated CDK11, very
similar to CDK11p46, undergo apoptosis, which requires the catalytically active form of
the kinase (92). Several recent publications have identified putative partner proteins for
CDK11p46 during apoptosis (130-133). CDK11p46 is induced and associated with PAK1
during anoikis, a distinct form of cell death induced by disruption of cell–matrix
interaction but interestingly, neither CDK11p58 nor CDK11p110 were found to interact
with PAK1. The activity of PAK1 is inhibited by the interaction with CDK11p46 and that
ectopic expression of CDK11p46 significantly increases anoikis in NIH3T3 cells (134).
Inhibtion of PAK1 activity by CDK11p46 leads to reduced phosphorylation of BAD at
ser-112 and ser-136. The hypophosphorylated BAD, a member of the Bcl-2 proapoptotic
family of proteins, is able to translocate to the mitochondria and in turn induce the release
of cytochrome c (135). Cycloheximide induced apoptosis involves another isoform of
CDK11, CDK11p58, which is also catalytically active. The downregulation of β1,4- galactosyltransferase 1 (β1,4-GT) inhibits the catalytic CDK11p58-mediated apoptosis
(136). 43
Three different molecules have been identified to interact with CDK11p46 using a
yeast two-hybrid screen with CDK11p46 as bait. These molecules are NOT2, RanBPM
and the p47 subunit of eukaryotic initiation factor 3 (eIF3f) (130, 132, 133). These
interactions were further confirmed by pull-down assays and co-immunoprecipitation
experiments using transiently expressed tagged CDK11p46. The CCR4-NOT complex
includes NOT2 protein and the function of this complex is the major enzyme catalyzing
mRNA deadenylation in Saccharomyces cerevisiae (137, 138). Overexpression of NOT2 led to mRNA degradation and contributed to apoptosis (133). The RanBPM interaction was not determined to be specific for CDK11p46; however, there is evidence that
CDK11p46 immunoprecipitate complexes can phosphorylate RanBPM in vitro making it a
potential substrate (130). RanBPM is a 90-kDa protein localized in both nucleus and
cytoplasm whose function remains unclear. It is involved in SOS recruitment to the
Hepatocyte Growth Factor receptor (MET) and in regulation of androgen and
glucocorticoid receptor activity and also the overexpression of RanBPM induces
activation of the Ras/ERK pathway (139, 140). RanBPM also interacts with the nuclear
serine/threonine Homeodomain-Interacting protein Kinase-2 (HIPK2), which regulates
p53-dependent UV-induced apoptosis by phosphorylation of ser-46 on p53 (141, 142).
In more detailed studies it was found that the interaction CDK11p46 with eIF3f
during apoptosis is very strong. Endogenous CDK11p46 produced by apoptotic
stimulation (Fas and staurosporine) can phosphorylate recombinant eIF3f in vitro (132,
143). In addition, it was shown in vitro and in vivo that recombinant wild-type
CDK11p46, but not a dead kinase mutant, inhibits translation (132). eIF3f was recently 44
shown to have decreased expression in tumor cells, which led to deregulated translation
and increased levels of apoptsis in A375 melanoma cells (144). Taken together, these
results strongly suggest that CDK11p46 participates in the apoptotic process through
phosphorylation of downstream protein targets involved in protein synthesis and
apoptotic signaling pathways. Aberrant mRNA translation is an old concept in cancer
pathogenesis that is currently being revisited due to the obvious involvement of several
important regulators in several different tumor types (145-147). There are multiple
translation initiation factors that have modifications in cancers that have been linked
directly to activities in apoptosis, which in turn no longer is responsive in those cells
(145, 147). Evidence of these associations is seen with the eIF2 proteins that are cleaved
during apoptosis and whose cleavage products exert regulatory effects on translation
machinery (147, 148). eIF2α expression is often higher in tumor cells than their normal
counterparts (147-153). eIF2α phosphorylation levels are also responsible for the
regulation of the CDK11p58 translation from the IRES sequence (97).
Induction of apoptosis also leads to the creation of the more N-terminal cleavage
product of CDK11p110, termed CDK11p60. CDK11p60 only recently was verified to exist
and it was found that during Fas induced apoptosis in A375 cells it is translocated from
the nucleus to the mitochondria. Overexpression of CDK11p60 led to partial breakdown
of the mitochondrial membrane potential and induction of cytochrome c release, which further promoted the apoptotic cascade. Additionally CDK11p60 was also found to bind
to members of the 14-3-3 family of transport proteins. There are 14-3-3 consensus-
binding sites found within the CDK11 amino-terminal portion that were able to interact 45
with 14-3-3 gamma (14-3-3γ). The interaction of 14-3-3γ with CDK11p110 occurs
throughout the entire cell cycle and reaches a maximum at the G2/M phase. 14-3-3γ
interacts strongly with CDK11p60 after Fas treatment. Collectively, these results suggest
that CDK11 kinases could be regulated by interaction with 14-3-3 proteins during cell
cycle and apoptosis (154). 14-3-3 protein binding sites are found on the CDK11 protein,
but this is the first time that an association was validated. One previous report showed
that indirectly, the CDK11p110-CK2 complex inhibited the association of tyrosine
hydroxylase with its particular 14-3-3 isoforms (155). All of these data combined
illustrate that both a CDK11p46 and a CDK11p60 molecule are involved in apoptosis and
that the function of these proteins is unique to the other known functions of CDK11
proteins within cells.
Mammalian cell cycle
Cell division consists of two consecutive processes, mainly characterized by DNA
replication and segregation of replicated chromosomes into two separate cells. Originally,
cell division was divided into two stages: M (mitosis), which is the process of nuclear
division; and interphase, the interlude between two M phases. Stages of mitosis include
prophase, metaphase, anaphase and telophase. Under the microscope, interphase cells
appear to simply grow in size, but different techniques revealed that the interphase
includes G1 (gap 1), DNA replication/synthesis S phase and G2 (gap 2) phases. G1, S, G2
and M phases are the traditional subdivisions of the standard cell cycle. Cells in G1 can, before commitment to DNA replication, enter a resting state called G0 where the major 46
part of the non-growing, non-proliferating cells in the human body reside (156, 157).
The transition from one cell cycle phase to another occurs in an orderly fashion and is
regulated by different cellular proteins. Molecules involved in the cell cycle are vast and
have multiple functions. As mentioned previously, CDKs are key regulatory proteins that
are activated at specific points of the cell cycle. Until now, 12 different CDKs have been
identified and, of these, five are classically thought to be those that are active during the
cell cycle, i.e. during G1 (CDK4, CDK6 and CDK2), S (CDK2), G2 and M (CDK1) (82,
118, 156, 157). Although the classical literature only finds those CDKs to be directly
involved in the cell cycle there is evidence to support the function of other CDK proteins
within the cell cycle, including the CDK11p58 isoform (158, 159). CDK levels remain
stable during the cell cycle, in contrast to their activating proteins, the cyclins. Cyclin
protein levels rise and fall during the cell cycle and in this way they periodically activate
CDK (82, 156, 157, 160). Different cyclins are required at different phases of the cell
cycle. The three D type cyclins bind to CDK4 and to CDK6 and CDK-cyclin D
complexes are essential for entry in G1. Another G1 cyclin is cyclin E which associates
with CDK2 to regulate progression from G1 into S phase, then cyclin A binds with CDK2
and this complex is required during S phase. During late G2 and early M, cyclin A complexes with CDK1 to promote entry into M. Mitosis is further regulated by cyclin B in complex with CDK1 (82, 156, 157, 160). Sixteen cyclins have been identified so far and like the CDKs not all of them are cell cycle related, as seen by cyclin L proteins
(115-117, 156). Cyclins A and B contain a destruction box and cyclins D and E contain a
PEST sequence that lead to efficient ubiquitin-mediated cyclin proteolysis at the end of a 47
cell cycle phase (156, 161). In addition to cyclin binding, CDK activity is also regulated
by phosphorylation on conserved threonine and tyrosine residues. Those residues were
previously alluded to as very important sites on CDK11 that help to verify the homology
with CDK1 and CDK2 proteins. CDK activity can also be counteracted by cell cycle
inhibitory proteins, called CDK inhibitors (CKI). Two distinct families of CDK
inhibitors have been discovered, the INK4 family and Cip/Kip family (162). CKI are
regulated both by internal and external signals, including the well characterized
regulation of p21 protein expression by p53 (22). Lastly, the intracellular localization of
different cell cycle-regulating proteins also contributes to a correct cell cycle progression
(80, 156, 157, 160). CDK substrates are key target proteins that become phosphorylated
on CDK consensus sites, resulting in changes that are physiologically relevant for cell
cycle progression. The originally studied target is the substrate of CDK4/6-cyclin D, the
product of the retinoblastoma tumour suppressor gene (pRb) whose significance to cancer
has been well documented (163, 164). There are staggering numbers of known substrates
for CDKs and the numbers of newly identified substrates continues to grow.
Quality control of the cell cycle includes the restriction point (R point) that allows
reentry of cells into the cell cycle from G0, and cell cycle checkpoints, which are
commonly studied in relationship to cancer because of their high levels of deregulation
(156). The restriction point (R) is defined as a point of no return in G1, following which the cell is committed to enter the cell cycle and is regulated by pRb (163, 164).
Additional controls or checkpoints exist further in the cell cycle, ensuring an orderly sequence of events in the cell cycle. There are proteins responsible for identifying the 48 errors (signal initiators like ATM and ATR) and those that perform the actions to halt the cell cycle (signal effectors like p53) (22). During mitosis the 'spindle checkpoint' brings about detection of improper alignment of the chromosomes on the mitotic spindle and stops the cell cycle in metaphase (165, 166). Initially identified in budding yeast, several mammalian spindle checkpoint-associated proteins have been identified and characterized. Mitotic arrest deficient (Mad) and budding uninhibited by benomyl (Bub) proteins are activated when defects in microtubule attachment occur and inhibit the
Cdc20 subunit of the anaphase-promoting complex (APC), resulting in the prevention of metaphase-anaphase transition (167). Other molecules involved in mitosis include aurora
A kinase and polo-like kinase-1 which are important to correct spindle formation and are essential for mitosis entry and exit. The key feature of these proteins is their highly modified activities in cancer were they have been shown to act as oncogenes aiding in tumor cell exit from the cell cycle prior to the correct completion of segregation leading to increased aneuploidy and chromosomal damage (38, 166, 168-170).
These examples illustrate how the cell cycle is a finely organized and highly regulated process to ensure that cells are properly divided at the correct time and in the correct context (157). In cancer, there are fundamental alterations in the genetic control of cell division, resulting in an unrestrained cell proliferation. Cell cycle deregulation associated with cancer occurs through mutation of proteins important at different levels of the cell cycle. In cancer, mutations have been observed in genes encoding CDK, cyclins, CDK-activating enzymes, CKI, CDK substrates, and checkpoint proteins (156).
These different activities that undergo alterations during tumorigenesis have laid the 49 foundation for research to understand exactly how oncogenes and tumor suppressor genes arise within tumors. Much of the current research concentrate on the studies to characterize where the proteins that are known to be involved in the cell cycle are deregulated, the epidemiology of these alterations and more importantly, how these proteins can be targets of therapy. CDK11p58 is a cell cycle related protein that is described in greater detail in the following section. The relative significance of
CDK11p58 during the cell cycle and the deregulation of this protein during cancer remain relatively unknown.
50
CDK1 Cyclin B
CDK1 CDK11p58 Cyclin A Cyclin D3 CDK4/6 Cyclin D CDK2 Cyclin A
G0 CDK2 Cyclin E
Figure 4. The mammalian cell cycle is regulated by CDK-cyclin activity. As cells enter the cell cycle at G0/G1 phase they use CDK4/6-cyclin D and the G1/S phase progression requires CDK2-cyclin E. S phase exit to G2 involves CDK2- cyclin A and cyclin A then binds to CDK1 to transition to G2. G2/M phase employs CDK1-cyclin B and this is crucial activity that is modulated during mitosis. p58 CDK11 -cyclin D3 may be a part of the G2/M phase passage through the cell cycle (157).
CDK11 in the cell cycle
Global cellular protein synthesis is down regulated during the G2/M phase of the
cell cycle, during programmed cell death and during a variety of different stress situations
(171). During these times of reduced cap-dependent translation, alternative ways of
protein synthesis become more predominant. The use of internal ribosome entry sites
(IRES) located in some cellular mRNAs is a non-traditional mode of protein synthesis.
IRES sequences are cis-acting elements that allow cap-independent translation by the 51
ribosome landing nearby to the initiation AUG. Genes involved in the control of cellular
proliferation, survival and death have been shown as preferential sites of IRES sequences
(171). Transcription of CDK11 genes occur consistently throughout the cell cycle and
levels of the larger isoforms are measurably detectable during all phases of the cell cycle
(172). Within both the Cdc2L1 and the Cdc2L2 genes an IRES sequence is located just
upstream of the kinase domain. One unique isoform, CDK11p58, is produced exclusively
during the G2/M phase of the cell cycle from the IRES sequence of the Cdc2L genes
creating a 20-fold increase in CDK11p58 protein levels (158, 159, 173). Other genes that
IRES sequences which are expressed during G2/M include c-myc, ornithine
decarboxylase (ODC), protein kinase Cδ (PKCδ), and nucleosome assembly protein 1
like (NAP1L1) (97, 174). As previously described, the CDK11 IRES element is regulated
by Unr and eIF2α phosphorylation (97). Members of the poly (rC) binding protein
family stimulate the c-myc IRES element in multiple myeloma cells (174). These studies
are among the first that are found to be directly involved in increasing the ability for an
IRES sequence to translate and they also occur in a highly specific manner during the cell
cycle (97). Since the amount of translation from different IRES elements varies
depending upon the sequence and location, the use of Unr to regulate CDK11p58
expression is a novel finding (97, 98, 173). Another interesting pattern of CDK11p58 expression was measured in mouse testis during development. CDK11p58 protein is
detected in proliferating germ cells in the early stages of the developing testes and was
expressed specifically in the pachytene primary spermatocytes from stage VII to XI of
spermatogenesis and also in postmeiotic spermatids in all stages at varied levels (175). 52
This shows that there is a developmentally specific expression pattern of CDK11p58
protein, which may be due in part to its regulatory molecules.
CDK11p58 was originally isolated from a human liver cDNA library and was
found to have 68% homology to the p34cdc2 protein kinase alone. It was the homology to
the CDC2/CDC28 cell-division-control protein kinases of yeast and humans that sent
researchers to originally investigate the CDK11p58 kinase and its ability to regulate
cellular proliferation (49, 58, 159). In proliferating cells, CDK11p58 is very similar to
CDK1, a crucial protein regulating mitosis. Enforced expression of wild-type
CDK11p58, but not the kinase dead form, in CHO cells results in a longer cell-doubling
time as measured by a delay in the incorporation of 3[H]-thymidine, telophase delay,
aneuploidy, abnormal cytokinesis and increased cell death due to apoptosis (158). These
data directly linked the role of CDK11p58 to a significant role in modulation of the exit
through the cell cycle. As mentioned above CDK11p110/p58-/- knockout led to early
embryonic death. The CDK11p110/p58-/- knockout blastocysts stain positive for phospho-
ser10 histone H3, a marker for mitotic chromosome condensation, at a level 5-fold
higher than wild type or heterozygous blastocysts. Moreover, caspase-3 activity and
TUNEL staining indicated apoptotic death of CDK11 knock-out blastocyst cells, most
likely as a result of mitotic cell cycle arrest (63). Conversely, recent studies utilizing
CDK11 RNAi in HeLa cells, verified the necessity of CDK11 during mitosis. The
knockdown of CDK11 led to mitotic checkpoint activation and mitotic cell arrest with
shortened monopolar spindles. The levels of key centrosome molecules, γ-tubulin, Plk1,
and Aurora A, were greatly reduced in CDK11 reduced cells. Rescue experiments with 53 the mitotic CDK11p58 but not the CDK11p110 isoform were able to revert the phenotypic changes seen in CDK11 RNAi cells. These experiments clearly showed that CDK11p58 is involved directly in centrosome maturation and bipolar spindle morphogenesis and more essentially, that CDK11p58 is essential to mitotic cell cycle progression (176). The critical role of CDK11p58 during the cell cycle has been fully established in previous investigations; however the mechanism by which CDK11p58 directly modulates these activities is still unclear. Other possible activities of CDK11p58 include data from previous papers that identified two different proteins to interact with ectopically expressed CDK11p58, cyclin D3 and HBO1, a histone acetyltransferase and that the association was able to enhance the activity of HBO1 in HeLa cells (93, 177). HBO1 is a member of the MYST family of proteins that have a long evolutionary history of RNA production and replication (178-180). Cyclin D3 is one of three D-cyclins that are responsible for G1 cell cycle entry. It has prognostic value as an overexpressed protein within several different tumor types, including pancreatic duct cell carcinomas, bladder cancer and testicular cancer (83, 181-183). The colocalization of CDK11p58 with cyclin
D3 was confirmed in mouse testes development but the techniques utilized only ectopic protein expression of CDK11p58 and this has never been confirmed when CDK11p58 is produced endogenously within cells (175). Since CDK11p58 proteins have unknown function and the different characteristics thus identified have not provided a clear picture about the mechanism of action, other studies are necessary to identify CDK11p58 activity.
54
Translation RNA trancription 9G8 RNAPII and splicing o TFIIF TFIIS eIF3f Bipolar spindle morphogenesis CDK11p46 RanBPM Centrosome maturation CDK11p110 Signaling CK2 Apoptosis NOT2 Cyclin L1 Cyclin L2 CDK11p58 CDK11p60 mRNA degradation
14-3-3γ Mitochondrial membrane potential release
Figure 5. Diagrammatic representation of published CDK11 protein activities. CDK11p110 binds to CK2 and either cyclin L1 or cyclin L2 proteins. CDK11p110 activity depends upon the factors that it associates with but the role is distinct in RNA processes. During apoptosis, CDK11p110 is proteolytically cleaved into CDK11p46 and CDK11p60. CDK11p46 is involved with RanBPM, NOT2, and eIF3f that blocks translation. CDK11p60 proteins are directed to the mitochondria where they can lead to loss of the mitochondrial membrane potential allowing for the apoptotic cascade p58 through the intrinsic pathway. CDK11 is generated during G2/M phase and has recently been shown to be involved in bipolar spindle morphogenesis and centrosome maturation (49, 91, 92, 101, 125, 130, 132, 133, 154, 172, 176). 55
CDK11: a target for molecular cancer therapeutics?
CDK11 proteins belong to the family of p34cdc2 family of proteins that are classically known to be cell cycle regulatory proteins (49). Many of the CDKs have different functions; however CDK11 proteins are distinctly unique due to their multiple isoforms and the capacity of the different isoforms to perform diverse tasks within cells
(figure 4). CDK11 proteins are not only involved in permissivity of the cell cycle but also in RNA transcription and splicing as well as during apoptosis. These events are essential to cellular growth and viability and therefore this indicates that CDK11 is a crucial molecule for investigation. Another possible function for CDK11 proteins was hinted in a recent genome-wide RNA interference (RNAi) screen in Drosophila melanogaster cells, where a PITSLRE homolog has previously been identified, showed the potential to be involved in regulation of the Hedgehog signaling pathway, although nothing more is known about the mechanism by which it mediates the signaling (62,
184). Most proteins do not fit into a discrete box where they can be categorized by a single function. The diversity of different protein families and even different isoforms of an individual protein can be very vast. This is seen in other molecules such as protein kinase C, where different isoforms of the same protein have been linked to functions in proliferation, survival and differentiation (185). Another example of two well- characterized tumor suppressor genes with multiple different functions is BRCA1 and
BRCA2. These two molecules have made some prominent interest because the mutant phenotypes of these genes lead to a predisposition for both breast and ovarian cancer.
These proteins play important roles as regulators of DNA repair, transcription and the cell 56 cycle in response to DNA damage (186). Similar to the BRCA1 and BRCA2 proteins,
CDK11 proteins are essential to the correct function of many different processes within cells and in cells with a mutant CDK11 phenotype there is an increased correlation with cancer.
The use of CDK inhibitors in cancer therapy has been proposed for several years and has shown varying levels of success. The ideas that support CDK inhibitors to treat cancer are based upon the observations that many of the CDK family members act as oncogenes and repression of the activity of these molecules would help to decrease the survival of tumors (77, 78, 82). CDK11 has an obvious link to cancers but the evidence supports its role in tumor suppression. Whether or not CDK11 can be a potential target for use in treatment of tumors is unclear. Tumor suppressor genes have not been extremely useful in diagnostic applications, with the exception of inherited susceptibility genes. Likewise, therapeutic approaches that would entail replacing the function of a lost gene have been hindered by the technical hurdles of efficient gene delivery (51). In addition to the characteristics that help to indicate that CDK11 is a tumor suppressor gene
(chromosome deletion seen frequently in tumors, induction of apoptosis), there is significant evidence to support a role for CDK11 in survival and promotion of cell growth (embryonic lethality of gene knock-outs, RNAi studies of CDK11 leading to delayed cell cycle) (49). Therefore, the different caveats of CDK11 activities do not provide a clear indication of how all CDK11 proteins are involved in tumorigenesis, but the evidence is irrefutable to support that CDK11 proteins are altered in tumors and may have a direct role in tumor progression (33, 35, 40, 42-44, 187). As researchers continue 57 to investigate the different functions of this inimitable protein, it will be interesting to see whether CDK11 will be put to use as a possible therapeutic target in cancers.
Statement of the problem
The fundamental changes that facilitate the progression of a normal tissue into a cancer are genetic alterations (9). During melanomagenesis, there occur many different changes to multiple genes and the effects of those genetic alterations are vast (12). The loss or translocation of chromosome 1 band region p36.3 in many different tumor types, including melanoma was commonly seen (33, 39-44, 188). These observations prompted researchers to investigate the genes located on this chromosome region and to further derive how the tumor might opportunistically utilize this gene loss. The two genes belonging to CDK11 were found on chromosome 1p36.3 (52, 54). The function of
CDK11 protein was relatively unknown, which led researchers down a path of discovery to elucidate how CDK11 proteins function within cells. CDK11 did not have one single function but was involved in multiple crucial processes within cells including, RNA transcription and splicing, cell cycle regulation, apoptosis, and some indications as a role in neuronal regulation (49). Each of these functions is linked to a particular CDK11 protein but the mechanisms of actions of certain isoforms remain to be clarified. The
CDK11p58 isoform was proven to be an essential regulatory protein during the mitotic phase of the cell cycle (158). Yet, it has not been distinguished exactly how this protein can modify cell division. Understanding CDK11 activity during tumorigenesis must begin first with the understanding of how it functions in normal cell physiology and 58
correlatively, how the loss of these actions within tumors affects the tumors ability to
grow and survive.
The work detailed in further chapters was designed to help identify the
significance of CDK11 within melanomas and other cancers. The initial experiments of
this work were aimed at discovering the regulation of CDK11 expression at the basal
promoter region. The hypothesis for these experiments was: The Cdc2L1 promoter
region undergoes basal transcriptional regulation by multiple transcription factors. The
aims to investigate this hypothesis were: (1) Determine the basal promoter region of
Cdc2L1. (2) Identify the transcription factors that bind to and regulate the Cdc2L1
promoter both in vitro and in vivo. The basal promoter region was determined in these
Cdc2L1 promoter studies and three different transcription factor-binding sites were found
to be directly involved in the regulaton of the Cdc2L1 promoter (59).
The next studies took a more specific look at the cell cycle specific isoform,
CDK11p58. These secondary experiments aimed at determining how CDK11p58
functioned within cells by identifying proteins that associated with CDK11p58. The
hypothesis for the second set of experiments was: The association of CDK11p58 with
DDX15 protein is involved in cell cycle regulation. The four different aims for these
experiments were: (1) Identify possible binding partners of CDK11p58. (2) Verify the
association of DDX15 with exogenous and endogenous CDK11p58. (3) Resolve whether
DDX15 is phosphorylated by CDK11p58. (4) Determine whether CDK11p58 and DDX15 can regulate the cell cycle. Overall, it was found that DDX15 does associate with
CDK11p58. The significance of this is described in further detail later. 59
The final series of experiments were designed to further determine potential interactions with CDK11p58 in order to help characterize and identify the function of
CDK11p58. The hypothesis for these final experiments was: CDK11p58 binds with several different proteins involved in the regulation of mitosis. These studies combined were designed to help identify how CDK11 is regulated and how it performs its functional activities during certain cellular processes. The aims for this hypothesis were: (1)
Identify possible proteins that associate with CDK11p58. (2) Validate those associations and determine the implications of those associations. The observations made here, combined with current literature aide in the understanding of CDK11 activity, where it was previously unclear. In tumors like melanoma, the loss of CDK11 may significantly affect cellular phenotypes and these studies were designed to help determine the exact mechanisms how.
60
II. MATERIALS AND METHODS
Cell culture, transfection and synchronization
A375 human melanoma cells were obtained from American Type Culture
Collection (ATCC, Manassas, VA, USA). The cells were cultured at 37°C with 5% CO2 in RPMI 1640 medium (Mediatech Inc., Herndon, VA, USA), supplemented with 10% fetal bovine serum (Omega Scientific Inc, Tarzana, CA, USA), 1% L-glutamine and 1% penicillin/streptomycin (Invitrogen, Carlsbad, CA, USA). Human cervical adenocarcinoma cells (Hela) were grown in Minimum Essential Medium Eagle (MEME)
+ L-glutamine with 10% fetal bovine serum and 1% penicillin-streptomycin. Human embryonic kidney cells (HEK293) were grown in Dulbecco’s Modified Essential
Medium (DMEM) with 10% fetal bovine serum and 1% penicillin-streptomycin. Jurkat
T cells were obtained from ATCC and were cultured in RPMI 1540 medium. All cells
o were grown at 37 C in a 5% CO2, 95% air incubator. All transfections were carried out using LipofectAMINE 2000 (Invitrogen) according to the manufacturer's instructions.
G2/M phase synchronization of cells was done using 0.4 mg/mL nocodazole (Sigma-
Aldrich, St. Louis, MO, USA) resuspended in. All cell pellets were harvested using trypsin digestion and a 1X PBS wash.
Construction of plasmids for promoter constructs
Cdc2L1 promoter analysis: Based on the published sequence of chromosome 1p36.21-
36.33 (AL031282), a 1.7-kb fragment spanning –1591 to +98 (relative to the first nucleotide of exon 1) upstream of Cdc2L1 gene was obtained by PCR using A375 61 genomic DNA as template. The 1.7-kb fragment of the Cdc2L1 gene was cloned into the pCRII-TOPO vector using TOPO TA cloning kit (Invitrogen) in accordance with the manufacturer’s instructions. This TOPO/-1591 construct was then sequenced and an internal XhoI site (ctcgag) was found from bases –48 to –43. This XhoI site was mutated as detailed below and the mutant XhoI TOPO/-1591 was then used as PCR template to generate a series of deletion constructs TOPO/-501, TOPO/-152, TOPO/-69, and
TOPO/+11. Correct gene orientation of the cloned fragments was determined by sequence analysis. Primers for upstream PCR and a common downstream primer are listed in table 1. The deletion fragments were then cloned into pGL3 basic luciferase reporter vector (Promega, Madison, WI, USA) using KpnI and XhoI.
Table 1. Primers used for creating deletion constructs, substitution mutants, and oligonucleotides used in gel mobility shift assay
Name Sequence Position Primers for deletion constructs -1591 (sense) -501 (sense) 5’-GTGTAGTGTAGACATTCTCGAGAA-3’ -501/-475 -152 (sense) 5’-ACCGGGCTGTTTCTTCTGGCG-3’ -152/-131 -69 (sense) 5’-TGTCGTTGTCTAGAGAGTTC-3’ -69/-49 +11 (sense) 5’-GACGATACTTTTGGCGCG-3’ +11/+29 +98 (antisense) 5’-CCGCATCCCCACTCAAGGCT-3’ +79/+98
Primers for site- directed mutagenesis and gel shift assay
Ets-1A-M (sense) 5’-CGCAGACACATTAAGTGCCGCACA-3’ -93/-70 Ets-1A-M (antisense) 5’-GCGTCTGTGTAATTCACGGCGTGT-5’ -93/-70 Skn-1-M (sense) 5’-GAGGTCGGCTATTATATCATGGTTACGCGCAATAC-3’ -42/-7 Skn-1-M (antisense) 5’-CTCAGCCGATAATATAGTACCAATGCGCGTTATG-3’ -42/-7 Ets-1B-M (sense) 5’-GAGCCAATACATTAAGTGACGATAC-3’ -6/+19 Ets-1B-M (antisense) 5’-GATATCGTCACTTAATGTATTGGCGC-3’ -6/+19 E2F-1-M (sense) 5’-AGTGACGATACTTAAGGCGCGCCGGTTGCT-3’ +9/+34 62
E2F-1-M (antisense) 5’-TCACTGCTATGAATTCCGCGCGC-3’ +9/+31
Primers for gel shift assay Ets-1A-WT (sense) 5’-CGCAGACACAGGAAGTGCCGCACA-3’ -93/-70 Ets-1A-WT (antisense) 5’-GCGTCTGTGTCCTTCACGGCGTGT-5’ -93/-70 Skn-1-WT (sense) 5’-GAGGTCGGCTATTATATCATCATTACGCGCAATAC-3’ -42/-7 Skn-1-WT (antisense) 5’-CTCAGCCGATAATATAGTAGTAATGCGCGTTATG-3’ -42/-7 Ets-1B-WT (sense) 5’-GAGCCAATACAGGAAGTGACGATAC-3’ -6/+19 Ets-1B-WT (antisense) 5’-GATATCGTCACTTCCTGTATTGGCGC-3’ -6/+19 E2F-1-WT (sense) 5’-AGTGACGATACTTTTGGCGCGC-3’ +9/+28 E2F-1-WT (antisense) 5’-GCGCGCGCCAAAAGTATCGTCACT-3’ +9/+28
Mutated bases are bolded.
Site-directed mutagenesis of promoter constructs
Substitution mutation of the XhoI site to ctagag, which is no longer identifiable by the XhoI restriction enzyme, was done using Quick-Change Site Directed Mutagenesis
Kit (Stratagene, Cedar Creek, TX, USA) as per manufacturer’s instructions. Site-directed mutagenesis was confirmed by DNA sequence analysis. Site-specific mutations of pGL3-152 construct were made using oligonucleotides listed in table 1 in order to alter predicted transcription factor bindings sites that were found as detailed below.
Database to identify possible transcription factor sites
TRANSFAC database (MatInspector software) and BCM Search Launcher
(Baylor College of Medicine) were both used to search for the sequences of regulatory elements within the Cdc2L1 promoter region.
63
Transient transfection of promoter constructs and luciferase reporter gene assay
Twenty-four hours prior to transfection, cells were seeded into 24-well plates with varying amounts of cells per well. A375 and Hela cells were seeded at a density of 1 x
105 cells per well and HEK293 cells were seeded at a density of 2.7 x 105 cells per well in
0.5 ml of corresponding media. The cells were co-transfected at ~90-95% confluence with the different Cdc2L1 promoter constructs (200 ng) or pGL3-basic (200 ng) and pRL-null vector (10 ng). The Renilla luciferase reporter vector served as a transfection efficiency control. LipofectAMINE 2000 (Invitrogen) was used to transfect cells according to the manufacturer’s instructions. Cells were transfected for 24 h and then lysed and assayed for luciferase activity using the Dual Luciferase Assay (Promega).
Nuclear extract preparation
A375 cells at ~70-80% confluence were harvested from culture and washed twice in phosphate buffered saline (PBS). The cell pellet was lysed in nuclear lysis buffer (10 mM HEPES (pH 7.9), 60 mM KCl, 1 mM EDTA, 0.5% NP-40) containing 1 mM sodium orthovanadate, 1 mM phenylmethylsulfonyl fluoride (PMSF), and 1% protease inhibitor mixture (Sigma) for 5 min on ice. Nuclei were isolated by centrifugation at 13 000 x g for 1 min at 4oC. Removal of supernatant separated cell debris and pellet was washed with same buffer excluding NP-40. Finally, the pellet was resuspended in nuclear resuspension buffer (250 mM Tris-HCl (pH 7.8), 60 mM KCl, 1 mM sodium orthovanadate, 1 mM PMSF, and 1% protease inhibitor mixture). Homogenates were frozen/thawed for 3-minute intervals in liquid nitrogen and 37oC water bath, followed by 64
15 sec of vortexing. The freeze/thaw/vortex procedure was repeated an additional two
times. Following centrifugation at 13 000 x g for 10 min at 4oC, the supernatant was
resuspended with glycerol to a final concentration of 20% glycerol. The nuclear extract
was then frozen at –80oC until used. Protein concentration was quantified using the bicinchoninic acid assay (Pierce, Rockford, IL, USA).
Electrophoretic mobility shift assay (EMSA)
Electrophoretic mobility shift assays were performed as follows. Sense and
antisense oligonucleotides (sequences found in table 1) were end labeled with γ-[32P]
ATP by T4 polynucleotide kinase (MBI Fermentas, Hanover, MD, USA). The labeled
probe was purified using the QIAquick Nucleotide Removal Kit (Qiagen, Valencia, CA,
USA) as per manufacturer’s instruction. The purified sense and antisense
oligonucleotides were combined and incubated at RT for 10 min to anneal. 32P-labeled
double-stranded oligonucleotide probes were incubated for 30 min at RT in 10 µl of
binding buffer (10 mM Tris-HCl (pH 7.5), 50 mM NaCl, 1 mM MgCl, 0.5 mM
dithiotreitol, 0.5 mM EDTA, 5% glycerol, and 1 µg of poly (dI*dC)) containing 10 µg of
nuclear extract. For competition experiments the competing unlabeled probes were
preincubated for 20 min at RT with the nuclear extracts before the addition of
radiolabeled probe. Supershift antibodies used were, anti-Ets-1 and anti-Skn-1a/i (Santa
Cruz Biotechnology, Santa Cruz, CA) were preincubated as done in competition
experiments. The DNA-protein complexes were resolved on a 5% non-denaturing 65 polyacrylamide gel for 3 hours at 150 V in 0.5X TBE. After electrophoresis, the gel was dried and exposed to autoradiography film at –80oC overnight.
Chromatin immunoprecipitation (ChIP) assay
Chromatin immunoprecipitation assays were performed using methods previously described by our group (60). Essentially, the protocol used was described by Upstate
Biotechnology (Lake Placid, NY) but incorporated slight modifications. A375 cells (1 X
107) were cross-linked by incubation with 1% formaldehyde for 10 min at 37oC in phosphate buffered saline (PBS). Cells were washed with ice-cold 1X PBS containing
0.1% EDTA and 1 mM sodium orthovanadate, 1 mM phenylmethylsulfonyl fluoride
(PMSF), and 1% protease inhibitor mixture (Sigma) and gently scraped into collection tube and centrifuged at 700 x g for 5 minutes. Pelleted cells were lysed using 600 µl of lysis buffer (10 mM HEPES (pH 7.9), 60 mM KCl, 0.5% (v/v) NP-40) with protease inhibitors and incubated on ice for 10 min. The nuclei were recovered with centrifugation at 1 200 x g for 10 minutes at 4oC and then resuspended in 600 µl of SDS lysis buffer (1% SDS, 10 mM EDTA, 50 mM Tris-HCl (pH 8.1)) with protease inhibitors. The lysate were then incubated on ice for 10 minutes prior to sonication seven times for 10 sec intervals in order to shear the genomic DNA into 0.2-1 kb lengths.
Lysates were centrifuged at 13 000 x g for 10 minutes and pelleted debris was discarded.
Lysates were diluted 10 times using CHIP dilution buffer (0.01% SDS, 1.1% Triton X-
100, 1.2 mM EDTA, 16.7 mM NaCl, pH 8.0) with protease inhibitors. A portion (500 µl,
5%) of diluted lysates was kept at –80oC to use as input control. The chromatin solution 66
was precleared with 80 µl of salmon sperm DNA/protein A agarose for 1 hour at 4oC
with rotation. Anti-Ets-1 and anti-Skn-1a/i (Santa Cruz Biotechnology, Santa Cruz, CA)
and anti-E2F-1 (Upstate Biotechnology) antibodies were added to the precleared
supernatant and incubated overnight at 4oC with rotation. The next day, 60 µl of salmon
sperm DNA/protein agarose slurry was added to the chromatin solution for 1 h at 4oC
with rotation. Rabbit IgG (Santa Cruz) was used as a negative control to verify that
specific antibody interactions are not due to the IgG. Additional negative controls
included a no antibody sample that underwent immunoprecipitation to ensure that non-
specific interactions are not occurring. Also, a mock control containing no cellular
components was used to ensure no contamination occurred. The protein A
agarose/antibody/histone/DNA complex was pelleted at 1 000 x g for 1 minute. The
pellet was washed one time each for 3 minutes at 4oC on a rotating platform using 1 mL
of the following buffers: low salt immune complex wash buffer, high salt immune
complex wash buffer, LiCL immune complex wash buffer, 1X TE, and 1X TE. After the
final wash, the beads were incubated two times for 15 minutes with 250 µl of freshly
made elution buffer (1% SDS, 50 mM NaHCO3). To the combined eluates, 20 µl of 5 M
NaCl was added and heated to 65oC for 4 h to reverse DNA-protein crosslinks. Samples
were then incubated with 10 µl of 0.5 mM EDTA, 20 µl of 1 M Tris-HCl pH 6.5, and 1
µl of 20 mg/mL Proteinase K for 2 hours at 45 oC. The DNA was extracted via
phenol/chloroform extraction and ethanol precipitation. The DNA pellet was
resuspended in 40 µl of H2O. A portion (5 µl) of the resuspended DNA was used for
PCR analysis. The conditions for PCR are as follows: 94oC for 5 minutes, 30 cycles of 67
94oC for 30 seconds, 62oC for 30 seconds, and 72oC for 1 minute using primers
previously used in cloning the –152 to +98 nt of Cdc2L1. Samples were run on a 1%
agarose gel for analysis.
Construction of plasmids for CDK11p58 experiments
Full length CDK11p58 cDNA was cloned into pCMV-myc (Clontech, Mountain
View, CA, USA) and pCDNA3 vector (Invitrogen). pCMV-myc-CDK11p58 containing
the CDK11p58 coding sequence (GenBankTM accession number U04824; nucleotides
1131-2465) with a c-myc tag at the amino terminus was constructed. pcDNA3-CDK11p58 was constructed by cloning the PCR amplified CDK11p58 into the EcoRI site of a
eukaryotic expression vector pcDNA3 (Invitrogen). The kinase mutations (K111N and
D224N) were generated by polymerase chain reaction using a QuikChangeTM site-
directed mutagenesis kit (Stratagene) with CDK11p58 wild type construct as template.
Primers used were: K111N fwd
(5’- ATTGTGGCTCTAAAGCGGCTGAAGATG-3’) and K111N rev
(5’- ATTGTGGCTCTAAAGCGGCTGAAGATG-3’), D224N fwd
(5’- ATTGTGGCTCTAAAGCGGCTGAAGATG-3’) and D224N rev
(5’- CGCCAGCCCGAAGTTACCCACCTTGAG-3’). Sequencing analysis was used to confirm the mutations. This mutation has been shown to cause CDK11 to lose its kinase
activity (92). Full-length DDX15 was cloned into the pCDNA3 vector from a full-length 68
clone in pDNR-LIB vector from a cDNA library database that was purchased from Open
Biosystems (Huntsville, AL, USA) (Cat. # MHS1011-9199113). XhoI and HindIII sites
were used to insert the full-length gene into the vector. pET-DDX15 contained a full-
length clone with an N-terminal his tag that was received as a kind gift from Dr. Ger J.M.
Pruijn from the University of Nijmegen, Nijmegen, The Netherlands. pEGFP, pEGFP-
CCNL1, pEGFP-CCNL2 were kind gifts from Dr. Walter Becker from the Institut für
Pharmakologie und Toxikologie, Medizinische Fakultät der RWTH Aachen, Germany.
Antibodies
Supershift antibodies used were, anti-Ets-1 and anti-Skn-1a/i (Santa Cruz
Biotechnology, Santa Cruz, CA, USA) and anti-E2F-1 (Upstate Biotechnology).
Monoclonal anti-c-myc antibody (clone 9E10) was purchased from Sigma and was used at 1:1000 for western blotting. GN1 is an affinity-purified rabbit polyclonal antibody raised by injection of rabbit with purified recombinant glutathione S-transferase (GST)
fused with the sequence coding for amino acids 341-413 of CDK11p110 (Rockland,
Gilbertsville, PA, USA) and is used at 1:1000 for western analysis. Rabbit anti-DDX15
antibodies were received as a kind gift from Dr. C.L. Will at the Max Planck Institute for
Biophysical Chemistry, Göttingen, Germany and were used at a 1:2000 concentration for
western blotting. Anti-α-tubulin antibody (Oncogene, La Jolla, CA, USA) is used at
1:1000 concentration for western blotting. Anti-cyclin D3 antibody was purchaced from
Oncogene. Anti-cyclin D1 antibody (2926; Cell Signaling, Beverly, MA, USA), anti- 69
cyclin E antibody (Ab-1; Calbiochem, San Diego, CA, USA), anti-cyclin A antibody
(Oncogene), anti-cyclin B1 antibody (Oncogene), anti-p21 antibody (sc-817; Santa Cruz
Biotechnology Inc. Santa Cruz, CA, USA), and anti-p27 antibody (sc-528; Santa Cruz
Biotechnology) were used with manufacturer recommended concentrations. Anti-Hsp70
antibody was purchased from Upstate. Anti-vimentin and anti-lamin A/C antibodies
were purchased from Santa Cruz. eIF3 p47 antibody is a polyclonal antibody raised by injection of goat with purified recombinant GST-fused full-length eIF3 p47 (Rockland).
eIF3 antibody was raised in a goat as described (189). Goat polyclonal eIF3b antibody
was purchased from Santa Cruz. Rabbit polyclonal anti-HA antibody was purchased
from Sigma.
Protein lysis and immunoprecipitation
Cells were harvested, washed twice with cold PBS, and lysed in lysis buffer
(10 mM Hepes, pH 7.2, 142.5 mM KCl, 5 mM MgCl2, 1 mM EGTA, 0.2% Nonidet P-40)
containing 1 mM sodium orthovanadate, 1 mM phenylmethylsulfonyl fluoride, and 1%
protease inhibitor mixture (Sigma) for 30 min on ice. Following lysis, cells were
centrifuged at 13 000 × g for 10 min at 4 °C, and the protein content was determined
using the bicinchoninic acid assay (Pierce Biotechnology, Rockford, IL, USA). Total cell
lysate (500 µg) was precleared with protein A- or G-agarose beads (Oncogene) and rabbit
IgG or mouse IgG (Santa Cruz Biotechnology) at 4 °C for 1 h. Myc-CDK11p58 fusion
protein or DDX15 was then immunoprecipitated using anti-c-myc monoclonal antibody 70
or DDX15 polyclonal antibody and protein A- or G-agarose overnight at 4 °C. The
immune complex was then washed four times with lysis buffer and subjected to SDS-
PAGE. For the immunoprecipitation of endogenous levels of CDK11p58 an alternative
technique was used to help reduce the amount of IgG detection at the same band size as
CDK11p58. Lysates were immunoprecipitated using the Catch and Release ™
Immunoprecipitation System as per manufacter’s instructions (Upstate, now part of
Millipore, Billerica, MA, USA). Immunoprecipitation followed by 2-dimensional SDS-
PAGE was performed on in vivo phosphorylated proteins following manufacturer’s
instructions for the Bio-Rad PROTEAN IEF with ReadyStrip IPG strips ranging from pH
3-11 and pH 5-8 depending upon the pI of the protein (Bio-Rad Laboratories, Hercules,
CA, USA).
Western blotting
The proteins in the SDS PAGE gel were transferred to a polyvinylidene difluoride
membrane (Millipore) overnight at 4ºC. After transfer, the blots were blocked in 5%
non-fat dry milk in 1X PBST for at least 30 min at RT. Membranes were probed as per
specific requirements for each primary antibody overnight at 4ºC. After three washes in
1X PBST, a secondary probe with horseradish peroxidase-labeled antibodies (Sigma) was added for at least 1 h at RT. The membranes were again washed three times and secondary antibodies were detected by enhanced chemiluminescence (ECL) (GE
Healthcare, Piscataway, NJ, USA). Membranes were exposed with varying time points to Blue Autoradiography Film by GeneMate (ISC Bioexpress, Kaysville, UT, USA). 2- 71 dimensional western blots were run following the same protocol for 1-dimensional western blots but used 30 mL of antibody solution due to the large membrane size.
Proteomic analysis
A375 melanoma cells were transiently transfected with either pCMV-myc or pCMV-myc-CDK11p58. The cell pellets generated we immunoprecipitated using anti-c- myc antibody and total associated proteins were run on a 10% SDS PAGE. The gels were silver stained to increase the visualization of less abundant bands within the gel.
Bio-Safe Coomassie stain (Bio-Rad Laboratories) or Imperial Protein Stain (Pierce
Biotechnology) was used to stain total proteins in gels that were submitted to the
University of Arizona Proteomics Core for analysis by LC-MS/MS. Bands were identified and excised prior to in gel digest with trypsin before analysis. The results were given as peptide sequence and these results were further analyzed using BLAST tools.
Immunofluorescence confocal microscopy
pCMV-myc-CDK11p58 transiently transfected into A375 cells were grown on coverslips, washed twice with cold 1X PBS, and fixed in 4% paraformaldehyde in 1X
PBS for 20 min at room temperature. Cells were rinsed three times with 1X PBS and permeabilized with 100% methanol at 20 °C for 6 min. The coverslips were washed with PBS again and incubated with 5% bovine serum albumin in 1X PBS for 10 min at room temperature, and then the bovine serum albumin was removed. The coverslips were 72
then incubated with mouse anti-c-myc monoclonal antibody (1:1000 dilution) and rabbit
anti-DDX15 antibody (1:1000 dilution) for 1 h at room temperature. Coverslips were washed three times with 1X PBS for 5 min each and then incubated with fluorescence- labeled secondary antibodies fluorescein isothiocyanate-conjugated (FITC-conjugated)
anti-mouse IgG + IgM (1:100 dilution) and Cy5-conjugated anti-rabbit IgG (1:100
dilution) in darkness for 1 h at room temperature. Following incubation, the coverslips
were washed three times with 1X PBS, mounted with ProLong® Gold mounting medium
with DAPI to stain nuclei (Invitrogen), and stored at 4°C overnight for
immunofluorescence confocal microscopy analysis. Confocal microscopy was performed
at the Arizona Cancer Center imaging core facility on a C1si spectral confocal instrument
(Nikon Instruments, Melville, NY, USA) with help from Gerald S. Benham, Nikon
Instruments.
In vitro Kinase Assay
A375 cells were treated with pCDNA3 and pCDNA3-CDK11p58 and pellets were lysed. Samples were immunoprecipitated using anti-CDK11 antibody, GN1, following the protocol detailed above. The resultant immunoprecipitates were analyzed for in vitro
kinase activity using kinase buffer (50 mM Tris-HCl (pH 7.5), 15 mM MgCl2, 1 mM
DDT), 50 µM ATP, 8 µCi [γ-32P]ATP (>3000 Ci/mM), and 5 µg of histidine-tagged recombinant DDX15 protein. Histidine-tagged recombinant DDX15 was created from the full-length pET-DDX15 vector following instructions from the HisTrapTM Column 73
Purification Kit (GE Healthcare, Cat# 27-4770-01). Total protein was stained to verify
that the recombinant DDX15 protein being evaluated is the correct size. Phosphorylation
of recombinant DDX15 protein was analyzed by 10% SDS-PAGE and autoradiography.
The gels were exposed overnight at 80°C to autoradiography film. Quantitation of
phosphorylation by CDK11p58 kinase was determined by phosphoimaging. The gels were
visualized with a Molecular Dynamics 400A PhosphorImagerTM, and the relative kinase
activity was estimated by quantitating the labeled protein bands using the Molecular
Dynamic ImageQuant software.
Identification of DDX15 phosphorylations sites
CDK11p58 was immunoprecipitated from pCDNA3-CDK11p58 transfected.
Recombinant his-tagged DDX15 was then phosphorylated by CDK11p58 previously
described above and was separated by SDS-PAGE. The recombinant his-tagged DDX15
was excised from the gel, digested with pepsin, and analyzed for phosphoamino acids by mass spectrometry as previously described by the Arizona Cancer Center Proteomic Core
Facility (107, 190).
Knockdown of endogenous DDX15 and CDK11 by siRNA
Pre-designed DDX15 siRNA oligos (siRNA ID# 145807 and 145806) and
Silencer® Negative Control #1 siRNA were purchased from Ambion (Ambion Inc., 74
Austin, TX, USA) and were transfected at 100 nM concentration. CDK11 RNAi was
generated using full-length CDK11 RNA (GenBankTM accession number U04824) that
was subjected to BLOCK-iT™ Dicer RNAi Kit (Invitrogen) as per manufacturer’s
instructions (Lac Z negative control was created in the same manner). These RNAi
conditions were transfected into A375 cells growing at 30% confluency. Untransfected
cells, LipofectAMINE 2000 alone, control transfected cells, DDX15 siRNA transfected,
and CDK11 RNAi transfected cells were harvested at 48 h after transfection.
Cell cycle analysis via flow cytometry
Cells were washed in 1X PBS and then fixed in 75% ethanol overnight at –20ºC.
Cells were washed in 1X PBS and stained with propidium iodide (0.1% sodium citrate,
0.02 mg/ml RNase A, 0.3% v/v NP-40 and 50 µg/ml propidium iodide) at a pH of 7.4 for
at least 20 min at room temperature before being analyzed by quantitative flow cytometry
with standard optics in a FACScan flow cytometer (Becton Dickinson, San Jose, CA,
USA). Cell samples were analyzed at the Flow Cytometry Service of the Arizona Cancer
Center for analysis of cell-cycle phases using the ModFit program. Results are expressed
as percentages.
Apoptosis analysis via flow cytometry and ethidium bromide-acridine orange
staining
Cells were stained with 7-aminoactinomycin D (7-AAD) (200 µg/ml, Sigma) in
PBS and incubated for 20 min at 4 °C in the dark (191). Cells were harvested by low 75
speed centrifugation, resuspended in PBS, and analyzed for apoptosis using a FACStar
flow cytometer (Becton Dickinson). Unstained A375 cells were used as negative
controls. Discrimination of the three populations (dead cells as 7AAD-bright, apoptotic
cells as 7AAD-dim, and live cells as 7AAD-negative) was validated by cell sorting and
morphological examination (129). Quantification of apoptotic index and cell viability
was performed by using the fluorescent dyes 3-(4,5-dimethylthiazol-2-yl)-2,5-
diphenyltetrazolium bromide (100 g/mL of each dye) and fluorescent microscopy (129).
For analysis of nuclear morphological change in apoptosis was characterized by scoring condensed and fragmented nuclei. Each set of experiments was repeated at least three times, with at least 300 cells counted in each instance.
Cancer-profiling array
A radioactive probe was generated using a human DDX15 cDNA fragment that was cloned by PCR (using full-length DDX15 as template, nucleotides 1955-3013) as per recommendations in cancer profiling array handbook (BD Biosciences; Clontech). The probe was BLAST searched to ensure that it would been specific to the NM_001358 gene
ID. The probe was labeled with [α-32P]dCTP and hybridized against a cancer profiling array (BD Biosciences; Clontech) according to the manufacturer's instructions. Ubiquitin
probe provided by the manufacturer was used as control. Gels were imaged and
quantitated as detailed in the in vitro kinase materials and methods section.
76
Real-time PCR analysis of renal carcinomas
These studies were performed in collaboration with Dr. Harry Drabkin, UCHSC,
Aurora, CO. The use of all human materials was done by Dr. Harry Drabkin. Six separate renal carcinoma cases and the uninvolved normal tissue were used to further validate the results from the DDX15 cancer-profiling array. The total cell RNA from these tumors and normal tissue was isolated and reverse transcribed into cDNAs. The standardized amount of cDNA from the tissues was used in a real-time PCR experiment with the following conditions: 95C x 15sec, 60 C x 1 min, 35 cycles. The primers used to amplify DDX15 were from bases 383-403 forward primer
(5’- TGTACGCCAGCAGCTATCTCG-3’) and 575-595 reverse primer
(5’- GGGATGCAACTGAACCACCTG-3’). These primers yielded a 193 bp product that was verified by sequencing. Primers for GAPDH were as follows: forward
(5’-AGGTGAAGGTCGGAGTCAACG-3’) and reverse
(5’-CGTTCTCAGCCTTGACGGTG-3’). Samples were run in triplicate and results were calculated using delta-delta CT ± standard deviation. P-value was calculated following the student t-test and was determined to be significant with values below p-value = 0.05.
77
III. CDC2L1 PROMOTER ANALYSIS
Introduction
Chromosome 1p36.3 contains the Cdc2L gene locus that encodes two duplicated and tandemly linked CDK11 genes, Cdc2L1 and Cdc2L2, that both remain transcriptionally active and are ubiquitously expressed in all the tested human tissues
(52). Deletions or translocations of chromosome 1p36 are seen in a number of different human tumors, including neuroblastoma and melanoma (33, 41, 192). This region has been proposed as the location of at least two tumor suppressor genes (33, 187, 193).
CDK11 proteins are involved in RNA transcription and splicing, cell cycle modulation, and apoptosis (49). Although the function of CDK11 proteins is becoming clearer, exactly how CDK11 expression is regulated at the transcriptional level is not well understood. Previous studies by our group have identified that the transcription factors
Ets-1, CREB, and Tcf11/Nrf2 are important for the basal transcription of the Cdc2L2 gene (60). Since both Cdc2L1 and Cdc2L2 are highly similar and the promoter regions are nearly identical, we questioned whether they undergo gene expression regulation in the same ways. The production of different gene products from these two genes may have significance depending upon the functional variations between the different proteins that are translated from the two different mRNAs. In the present studies, we characterized the Cdc2L1 promoter region in order to elucidate the basal mechanisms of
Cdc2L1 gene regulation. Our results show that Cdc2L1 is regulated by a basal promoter region that is between bases –152 and +11 of the 5’ region of the gene. This region 78 contains recognized transcription factor binding sites for Ets-1 and Skn-1 that are necessary for Cdc2L1 gene expression. The binding of Ets-1 and Skn-1 proteins to these sites was confirmed by both in vitro and in vivo assays (59). Therefore, Cdc2L1 is subject to transcriptional regulation that varies from the nearly identical Cdc2L2 gene.
The significance of these findings is discussed more thoroughly below.
Results
Basal promoter activity of the Cdc2L1 gene
In order to understand the underlying mechanisms important for Cdc2L1 transcription, we determined the upstream sequences of the Cdc2L1 gene involved in regulation of gene expression at the transcriptional level. We cloned 1.7 kb of the 5’ upstream sequence of the Cdc2L1 gene. The 5’ upstream region, spanning nt –150 to
+98 of the Cdc2L1 is depicted in figure 6.
-150 GTTTCTTCTG GCGTCCTGGA CCTGAGCAAG CGCTGTTTTA TCGCTTATCA GATA-1 -100 TCCCGCGCAG ACACAGGAAG TGCCGCACAG AGCGAGCCCC TGTCCCAGTT ETS-1A -50 GTCTCGAGTT CTGGGCCGGA GGTCGGCTAT TATATCATCA TTACGCGCCA SKN-1 +1 ATACAGGAAG TGACGATACT TTTGGCGCGC GCCGGTTGCT GTTTCTTCTC ETS-1B E2F-1 +51 TGGCTCCGGG ACCGGCGGCG GCGGCGGCGG CAGCGGCGGC GGCGTAG………
………………………… TGTTTTAACT CAAATGGGTG Intron 1
Figure 6. 5’ upstream region of the Cdc2L1 gene and putative transcription factor binding sites. Indicated are the potential transcription factor binding sites between – 150 and +98 (MatInspector V2.2). The translation initiation codon is boldface. 79
Database searches revealed several different consensus or near consensus transcription factor binding sites within the 1.7-kb fragment that we cloned. Human melanoma A375 cells were transiently transfected with a plasmid containing –1591 to
+98 of Cdc2L1 5’-flanking region that was fused to pGL3-basic promoterless Firefly luciferase gene. Promoter activity was determined by measuring luciferase levels in transfected cells and normalized to cotransfected pRL-null Renilla luciferase activity.
This 1.7-kb construct expressed very high levels of luciferase activity in A375 cells
(3000-fold more than empty vector), indicating high levels of Cdc2L1 transcription derived from this sequence within the Cdc2L1 gene (figure 7).
pGL3Cdc2L1 -1591 bp
pGL3Cdc2L1 -501 bp
pGL3Cdc2L1 -152 bp
pGL3Cdc2L1 -69 bp
pGL3Cdc2L1 +11 bp HEK 293 HeLa A375 pGL3 Basic
0 500 1000 1500 2000 2500 3000 3500 4000 4500 Activation Fold
Figure 7. Promoter activity of serial deletion constructs of the Cdc2L1 promoter. A375 cells, HeLa, and HEK293 cells were transfected with indicated constructs and assayed for luciferase activity 24 hours later. Luciferase activity is a ratio of the indicated construct over the promoterless vector (pGL3-basic) and corrected for transfection efficiency by cotransfection with the Renilla expression vector (pRL- null). Assays were performed three times in triplicate and expressed above as means ± S.D. 80
The sequence of the Cdc2L1 promoter responsible for basal transcription was determined using a series of reporter constructs containing various deletions within the
Cdc2L1 gene. The constructs all have a common 3’ end at nt +98 but with various 5’ end deletions from nt –1591 (table 1). Deletion of nt –1591 to –501 led to reduced levels of promoter activity by 24%, implying the possible role of positive regulatory factors within the –1591/-501 region of Cdc2L1. Additional deletion from nt –501 to –152 increased promoter activity greater than both the –1591 and –501 constructs in A375 cells (3700- fold more than empty vector). Further deletion analysis of a construct containing nt –69 had much lower levels (57%) of activity compared to the –152 construct in A375 cells
(only 1800-fold over empty vector) (figure 7). This indicates that the sequence between nt –152 and -69 contains the essential regulatory elements that drive expression of
Cdc2L1 gene. Promoter activity from a construct containing nt +11 to +98 was significantly less than the –152 construct suggesting that the regions between –69 to +11 are also very important for transcription of Cdc2L1 gene.
The transfections with the deletion constructs into two other cell lines, HeLa and
HEK293 cells, produced similar results as in A375 cells with a few variations. The activation fold of HeLa cells was low compared to A375 cells but the profile was similar.
The activation fold of Cdc2L1 in HEK293 cells, although higher than HeLa cells, was still much lower than A375 cells. The deletion from nt –501 to –152 did not increase the promoter activity of Cdc2L1 as seen with HeLa and A375 cells but further deletion to nt
–69 did show reduced activation of the promoter (figure 7). Collectively, these data 81 indicate that the region of nt –152 to +11 is necessary for optimal levels of transcription of the Cdc2L1 gene.
Ets-1 and Skn-1 are required to promote Cdc2L1 transcription
The –152 construct contains sequence of Cdc2L1 that has two potential Ets-1 protein binding sites (Ets-1A and Ets-1B), a Skn-1 binding site and a potential E2F-1 binding site (figure 6). Site-directed mutagenesis of the core transcription factor binding sites was used to create different mutant reporter plasmids with mutations of the individual Ets-1, Skn-1 and E2F-1 sites. In addition, combinations of mutations for some of these different binding sites were also created. Mutation combinations include the following: Ets-1A plus Skn-1, Ets-1B plus Skn-1, Ets-1A plus Ets-1B, Ets-1A plus Skn-1 plus Ets-1B, and lastly, Ets-1A plus Skn-1 plus Ets-1B plus E2F-1 (represented diagrammatically in figure 8). Wild type –152/+98 construct and the different mutant constructs were transfected into A375 cells and reporter activity was determined.
Mutation of Ets-1A decreased luciferase levels to 54% whereas Ets-1B mutation reduced the luciferase levels to 35% of wild type, indicating that the Ets-1B site may play a more significant role in Cdc2L1 gene regulation. When both Ets-1A and Ets-1B were mutated the levels of luciferase are reduced to 18% of wild type (figure 8). Mutation of the Skn-1 site reduced luciferase activity by 58% compared to wild type construct. Whereas, mutation of the different Ets-1 sites with Skn-1 led to a marked decrease in luciferase levels. The combination of Ets-1A and Skn-1 mutation suppressed luciferase activity to
18% relative to the wild type construct. The combination of Skn-1 and Ets-1B almost 82 completely eliminated transcription to only 2% of wild type. The combination of Ets-1A,
Skn-1, and Ets-1B mutations reduced luciferase levels completely (0.4%) (figure 8).
Finally, when mutation of all four transcription factor binding sites (Ets-1A, Skn-1, Ets-
1B, and E2F-1) was done, luciferase levels were reduced even further to only 0.2% of wild type (figure 8). These data verify that both Ets-1 sites are crucial for Cdc2L1 transcription in addition to the Skn-1 site.
The additional transcription factor binding sites (GATA-1 and E2F-1) within the
Cdc2L1 promoter were also mutated and assayed for their luciferase levels. GATA-1 is a transcription factor that plays an essential role in hematopoiesis and is linked predominantly to those genes involved in erythrocyte development (194, 195). Mutation of this site did not significantly affect Cdc2L1 transcriptional levels (data not shown) and therefore does not appear to contribute to the basal transcriptional regulation of this gene in the cell lines tested. The transcription factor E2F-1 is a central regulator of cellular proliferation because is helps to control the expression of several genes involved in the cell cycle as well as those involved in apoptosis (196). Mutation of the E2F-1 binding site on Cdc2L1 reduced luciferase levels to 67% of wild type in A375 cells. However, in
HEK293 cells, E2F-1 mutations lead to increased luciferase activity greater than that of wild type (118%) (figure 8). Similar effects were seen when E2F-1 was mutated in combinations with other transcription factor binding sites (data not shown). Collectively, these data indicate that both Ets-1 sites and Skn-1 site are critical in the transcription of the Cdc2L1 gene. In addition, E2F-1 could possibly contribute to regulation of the
Cdc2L1 promoter. 83
10 LUC 100%
9 LUC 54%
8 LUC 58%
7 LUC 35%
LUC6 67%
5 LUC 18%
4 LUC 2% HEK293 3 Hela Hela LUC 18% A375 A375
2 LUC 0.4%
1 LUC 0.2% Ets-1A Skn-1 Ets-1B E2F-1 0 50 100 Relative Luciferase Activity (%)
Figure 8. Mutational analysis of the transcription factor binding sites in the Cdc2L1 promoter. Above is a schematic diagram of wild type and different mutant reporter constructs with their corresponding luciferase activities in A375, HeLa, and HEK293 cells. The potential transcription factor binding sites are boxed and wild type is indicated in white and mutants are black. Specified constructs were transiently transfected into cells and assayed for luciferase activities. Activity of the wild type construct with nucleotides –152 to +98 is set to 100% and remaining results are expressed as a mean percent of the wild type promoter activity ± S.D. Percentage of wild type is given for A375 cell data for each construct.
84
Based on our observations that Ets-1, Skn-1 and E2F-1 could potentially regulate basal transcription of the Cdc2L1 promoter, we investigated the ability of these transcription factors to bind to a DNA sequence derived from the Cdc2L1 promoter both in vitro and in vivo. First, we investigated the interaction of these proteins directly with the 5’ promoter region of Cdc2L1 using electrophoretic mobility shift assays and chromatin immunoprecipitation.
Electrophoretic mobility shift assay of Ets-1 and Skn-1 binding sites within the Cdc2L1 promoter
Since it was found that the Ets-1, Skn-1, and E2f-1 binding sites within the 5’ flanking region of the Cdc2L1 gene play an important role in regulation of its gene expression, we performed electrophoretic mobility shift assays (EMSA) in order to help determine the proteins that are interacting with these sites. A labeled double stranded oligonucleotide probe of Ets-1A, Ets-1B, and Skn-1 was incubated with A375 nuclear extracts and analyzed by EMSA. Specific protein-DNA complexes were present for each of the different transcription factor binding sites (figures 9 and 10). Unlabeled wild type oligonucleotide at 10-fold and 50-fold excess was able to compete for the different protein-DNA complex bands as visualized by the disappearance of specific bands.
Competition with an unlabeled mutant oligonucleotide did not affect the protein-DNA bands. Supershifting with antibodies specific to these sites verified that Ets-1A (figure
9A), Ets-1B (figure 9B), and Skn-1 (figure 10) were complexed with the specific transcription factors at those regions of the Cdc2L1 promoter. The E2F-1 transcription 85 factor binding site was also assayed with both competition and supershifting but the antibodies were unable to shift the complex at all (data not shown). Consequently, E2F-1 does not appear to bind to the Cdc2L1 promoter in vitro. These experiments confirm that protein-DNA complexes do exist for Ets-1A, Skn-1, and Ets-1B on the Cdc2L1 promoter.
A) -++++ Nuclear Extract Nuclear Extract +++ Labeled wildtype Ets-1B Oligo +++++Labeled wildtype Ets-1B Oligo +++ Nonlabeled WT Oligo --+--++-+ - Anti-Ets-1 antibody - 1mg 2 mg Nonlabeld MUT Oligo (10×) (50×) ----+ 123 (50×) 12345
86
B) -++++ Nuclear Extract Nuclear Extract +++ Labeled wildtype Ets-1B Oligo +++++Labeled wildtype Ets-1B Oligo +++ Nonlabeled WT Oligo --+--++-+ - Anti-Ets-1 antibody - 1mg 2 mg Nonlabeld MUT Oligo (10×) (50×) ----+ 123 (50×) 12345
Figure 9. Electrophoretic mobility shift assay for the Ets-1A and Ets-1B binding sites in the Cdc2L1 promoter. Assays were performed using 10 µg of A375 nuclear extracts and oligonucleotide probes containing (A) Ets-1A and (B) Ets-1B binding sites within the Cdc2L1 promoter. Competition analysis was done in the presence of 10- or 50-fold excess of unlabeled oligos. The sequences of the oligos used are found in Table 1. Supershifted bands are indicated with an arrow
87
Nuclear Extract -++++++ Labeled wildtype Skn-1 Oligo +++++++ --+--+++ - - - Nonlabeled WT Oligo (10×) (50×) ----+- - Nonlabeld MUT Oligo (50×) ------1 mg 2 mg Anti-Skn-1 antibody 1234567
Figure 10. EMSA for the Skn-1 binding site in the Cdc2L1 promoter. Assays were performed using 10 µg of A375 nuclear extracts and oligonucleotide probes containing Skn-1 binding site within the Cdc2L1 promoter. Competition analysis was done in the presence of 10- or 50-fold excess of unlabeled oligos. The sequences of the oligos used are found in table 1. Supershifted bands are indicated with an arrow 88
Chromatin immunoprecipitation of Ets-1 and Skn-1 binding sites on the Cdc2L1 promoter.
Next, we performed chromatin immunoprecipitation analysis in order to confirm that the binding of Ets-1 and Skn-1 to the Cdc2L1 promoter occurs in vivo. We also wanted to rule out that binding of E2F-1 to the endogenous Cdc2L1 promoter does not occur. For these experiments, A375 cells were crosslinked with formaldehyde to maintain DNA-protein complexes. Next, sonication to correctly shear the DNA fragments and immunoprecipitation with antibodies specific to Ets-1, Skn-1 and E2F-1 were performed. Finally, the crosslinks were reversed, the DNA purified, and used as template for PCR amplification. The primers used were from nt –151 to +98 (table 1) of the Cdc2L1 gene that contains the putative Ets-1, Skn-1 and E2F-1 binding sites (figure
6). The Ets-1 and Skn-1 antibodies could immunoprecipitate the Cdc2L1 promoter region but the E2F-1 antibody was unable to immunoprecipitate the Cdc2L1 promoter region (figure 11). These data indicate that both Ets-1 and Skn-1 proteins are able to bind to the Cdc2L1 promoter endogenously in A375 cells. The E2F-1 protein is not bound to the Cdc2L1 promoter in assayed A375 cells (figure 11).
8899 ) p
b IP antibody ( r e r 1 1 k t e - k e 1 - c t r u - n F n a s a o G p o 2 t k g n S E M I E N M W I
500 bp
250 bp
Figure 11. Chromatin immunoprecipitation of Ets-1, Skn-1, and E2F-1 interaction with Cdc2L1 promoter in vivo. Formaldehyde crosslinked chromatin from A375 cells was immunoprecipitated with specified antibodies and subjected to PCR as described under Materials and methods. PCR products were electrophoresed on a 1.5% agarose gel. Input represents 0.5% of total chromatin applied for immunoprecipitation. None, rabbit IgG, Ets-1, Skn-1 and E2F-1 used specified antibodies against said proteins. Mock is a negative control of the CHIP assay that did not have any chromatin. Water is the negative PCR control without any template in the reaction.
Discussion
In order to understand the regulation of Cdc2L gene expression, our group has characterized the different features necessary for basal transcription of both Cdc2L1, shown here, and Cdc2L2 (59, 60). CDK11 gene transcripts have been shown to be upregulated during apoptosis and certain CDK11 isoforms are able to induce apoptosis.
Conversely, down regulation of CDK11 proteins have been shown to occur in malignant melanoma specimens and melanoma and neuroblastoma cell lines (33, 41).
Previous results have implicated the need for CREB, Ets-1 and TCF11/Nrf2 in basal transcription of the Cdc2L2 gene (60). In present study, we found that Ets-1 and 90
Skn-1 transcription factors are both necessary for basal transcription of Cdc2L1 gene
(59). Based on observations from these two studies, we propose that both the Cdc2L1 and Cdc2L2 genes produce CDK11 transcripts during normal cell growth situations.
However, variations in transcription factors binding to the different promoters can lead to differential regulation and levels of specific CDK11 transcripts.
The Ets (E26 transforming-specific) family of transcription factors regulates gene expression leading to a variety of different cellular functions including growth, apoptosis, development, differentiation and oncogenesis (197-199). The Ets family of proteins include Ets-1 that is one of the principle transcription factors of endothelial cells that regulates angiogenesis (200). In addition to promoting angiogenesis, Ets-1 overexpression has also been shown to promote apoptosis in human umbilical vein endothelial cells (HUVEC) under serum deprived conditions due to its transcriptional modulation of different genes responsible for apoptosis (200, 201). Ets-1 recruits p300/CBP to the human stromelysin promoter involving multiple protein-protein interactions (202). In embryonic stem cells undergoing UV-induced apoptosis, Ets-1 is essential for p53 transcriptional activity (203). The various roles of Ets-1 is dependent upon cellular context, which may be highly important in understanding how it affects the expression of several different oncogenes and tumor suppressor genes alike, by direct association with genes or by protein-protein interactions.
The POU domain family of transcription factors has been observed to regulate different genes predominantly those involved in development in a tissue-restricted manner based upon their diverse pattern of expression (204-206). Skn-1 (Epoc-1/Oct-11) 91 is one member of this family of transcription factors that is expressed during embryogenesis as well as in specific adult tissues (207). Expression of Skn-1 is limited to mostly the skin were it mediates transcription of genes linked to the state of epithelial cell differentiation (208). Skn-1 appears to play a significant role in human papilloma virus 16 and 18 expression, which may implicate a possible role in cervical cancer development (205, 208, 209). To our knowledge we show for the first time regulation of a gene (i.e. Cdc2L1) by Skn-1 in a non-epithelial cell type.
Ets-1 can interact with different proteins to increase association with DNA on various gene promoters and further regulate gene expression (202, 210). Pit-1 is a POU- domain transcription factor similar to Skn-1 that has been shown to bind with Ets-1. The
Ets-1/Pit-1 interaction is required for Ras-dependent activation of the PRL promoter
(210). Skn-1a, the primary isoform of Skn-1, has been shown to interact with CREB- binding protein/p300 to repress the keratin 14 promoter independent of DNA binding by interfering with CBP/p300 co-activation (204). During keratinocyte terminal differentiation, the SPRR2A gene has been shown to be subject to Skn-1a regulation via cooperation with an epithelial specific transcription factor, Ese-1/Elf-3 (211).
The association of different POU-domain transcription family members with Ets family of transcription factors has been confirmed in a variety of different systems. A similar interaction may be occurring during Cdc2L1 promoter activation between Skn-1 and Ets-1. These data implicate that the interaction between Ets-1 and Skn-1 may be more critical to regulate transcription from the Ets-1B site than the Ets-1A site because transcription decreases more appreciably when the Ets-1B site is mutated with Skn-1 than 92 the Ets-1A site mutated with Skn-1. Verification of this interaction on the Cdc2L1 promoter requires further experimentation.
In the present study, we found a consensus E2F-1 binding site within the Cdc2L1 promoter. We also found that mutation of the E2F-1 site increased luciferase activity.
However, both EMSA and CHIP assays were unable to implicate E2F-1 in the regulation of basal transcription of Cdc2L1 promoter. It is possible that E2F-1 could have a repressive role on Cdc2L1 or only binds under conditions of stress (i.e. apoptosis).
Further studies on the role of E2F-1 in the regulation of Cdc2L1 may be warranted.
Both Skn-1 and E2F-1 transcription factor binding sites are not present on the
Cdc2L2 promoter, which contains CREB and TCF11/Nrf2 sites alternatively (60). These variations between the different promoters of Cdc2L1 and Cdc2L2, two nearly identical genes, may help to elucidate the molecular pathways by which CDK11 gene expression is regulated beyond the level of basal transcription. Figure 12 is the alignment of Cdc2L1 to Cdc2L2 promoter region and compares the different transcription factor binding sites.
One study of melanoma cell lines and melanoma tissues identified four polymorphisms within the Cdc2L1 promoter at -48, -53, -108, and -210 that are not seen in the Cdc2L2 promoter (57). Polymorphisms in the promoter region of genes are able to alter the capacity of these genes to undergo transcription because they may increase or decrease the capacity of transcription factors or repressor elements to bind to and transactivate. One tumor suppressor gene, CDKN2A, has a polymorphism in the 5’ UTR that has been found in Canadian families of melanoma. This polymorphism predisposes those individuals to melanoma (212). We wanted to determine whether the identified 93 polymorphisms were located at sites of transcription factor binding and whether the mutation of these polymorphic sites altered the transactivation capacity of Cdc2L1 promoter. Using site-directed mutagenesis we were unable to identify any changes in the level of transcription of luciferase in our constructs that had the non-polymorphic sequence compare to those with the polymorphisms (data not shown). Therefore the role of those polymorphisms in the Cdc2L1 promoter in melanoma pathogenesis remains unknown regardless of initial promoter analysis.
GATA 2L1-promoter C-GCTCACCGGGCTGTTTCTTCTGGCGTCCTGGACCTGAGCAAGCGCTGTTTTATGCGTT 2L2-promoter CAGCTCAGGGCGCAGTTTCTTTTGGAGTCCTGGACCTGAGCAAGCGCTGTTTTATGCGTC * ***** * ** ******* *** ********************************* TCF11 ETS-1 2L1-promoter ATCATCCCGCGCAGACACAGGAAGTGCCGCACAGAGCGAGCCCCTGTCGTTGTCTCGAGT 2L2-promoter ATCATCCCGCGCAGACACAGGAAGTGCCGCACAGAGCGAGCCCCTGTCGT---CTTGAGT ************************************************** ** **** ETS-1 SKN-1 ETS-1 2L1-promoter TCTGGGCCGGAGGTCGGCTATTATATCATCATTACGCGCCAATACAGGAAGTGACGATAC 2L2-promoter TCTGGGCCAGAGGTCGGCTATTATATCATCATTAGGCGTCAACACAGGAAGTGAGGATAC ******** ************************* *** *** *********** ***** CREB ETS-1
E2F-1 ADF-1 2L1-promoter TTTTGGCGC-GCGCCGGTTGCTGTTTCTTCTCTGGCTCCGGGACCGGCGGCGGCGGCGGC 2L2-promoter TTCTGGCGAAGCGCCGGTTGCTGTTTCTTCTCAGGCTCAGGGACCGGCCGCGGC------** ***** ********************** ***** ********* *****
Figure 12. Alignment of Cdc2L1 promoter with Cdc2L2 promoter. Transcription factor binding sites on the Cdc2L1 promoter are GATA-1, Ets-1A, Skn-1, Ets-1B, E2F01 and ADF-1 (unstudied because of high upstream location of +1). Cdc2L2 is regulated by TCF11/Nrf2, Ets-1A, CREB, and Ets-1B. 94
In summary, our data indicates that nt –152 to +98 of the Cdc2L1 5’ flanking region is critical for the basal transcription of the Cdc2L1 gene. Transcription of CDK11 transcripts appears to be regulated by both Ets-1 and Skn-1 transcription factors (59).
Isolation and characterization of the Cdc2L1 promoter region may lead to insights into the regulation of CDK11 transcripts during the cell cycle and apoptosis and more essentially in cancers, which are discussed further in the final chapter. 95
IV. CDK11p58 ASSOCIATES WITH DDX15
Introduction
CDK11p110 and CDK11p58 are translated from a single transcript that is
transcribed from either the Cdc2L1 or the Cdc2L2 gene, whereas other isoforms of the
CDK11 family are produced by alternative splicing of the larger 110 kDa isoforms (49,
172). CDK11p58 is unlike the other isoforms of CDK11 because it is specifically
produced during the G2/M phase of the cell cycle by an internal ribosome entry site
(IRES) (159). Initial studies of the CDK11p58 isoform were done in Chinese hamster
ovary fibroblasts and showed that overexpression of CDK11p58 led to late telophase
delay, abnormal cytokinesis, and reduced levels of cell growth. These studies were
further elaborated upon to show that the reduced cell growth when CDK11p58 is
ectopically expressed is due to increased levels of apoptosis (158). Conversely, recent
studies utilizing CDK11 RNAi in HeLa cells, verified the necessity of CDK11 during
mitosis. The knockdown of CDK11 led to mitotic checkpoint activation and mitotic cell
arrest with shortened monopolar spindles. The levels of key centrosome molecules, γ-
tubulin, Plk1, and Aurora A, were greatly reduced in CDK11 reduced cells. Rescue
experiments with the mitotic CDK11p58 but not the CDK11p110 isoform were able to revert the phenotype changes seen in CDK11 RNAi cells. These experiments clearly showed that CDK11p58 is involved directly in centrosome maturation and bipolar spindle
morphogenesis and more essentially, that CDK11p58 is essential to mitotic cell cycle
progression (176). 96
Other studies that verify the essential role of CDK11 proteins in survival and cell
growth disrupted the Cdc2L gene locus in mouse embryonic stem cells and therefore
disrupted expression of the CDK11p110/p58 protein kinases. Homozygous knock-outs of the CDK11p110/p58 were embryonic lethal at the blastocyst stage, confirmed that the
CDK11 proteins are important for proper cellular proliferation and cell cycle progression
during early embryonic development (63). The critical role of CDK11p58 during the cell
cycle has been fully established in previous investigations; however the mechanism by
which CDK11p58 directly modulates these activities is still unclear. In order to determine
the exact mechanisms of CDK11p58 activity during the cell cycle, we set out to determine
other proteins that associate with CDK11p58 and may be responsible for modulation of its
activities within cells. Previous studies identified two different proteins to interact with
ectopically expressed CDK11p58, cyclin D3 and HBO1, a histone acetyltransferase and
that the association was able to enhance the activity of HBO1 in HeLa cells (93, 177).
Cyclin D3 is one of the three D-cyclins that are crucial regulators of G1/S phase. These
cyclins and their corresponding CDKs (CDK4/6) have been strongly correlated to
expression changes during tumors (213). Cyclin D1 is commonly discussed in tumors
but there is evidence that cyclin D3 overexpression has been noted in pancreatic
intraepithelial neoplasia and is still seen overexpressed in the more advanced stages of
ductal cancer for one example (181, 213). It has prognostic value in bladder cancers as
well (83). The studies that found cyclin D3 associated with CDK11p58 were performed
with exogenous expression of CDK11p58 protein and the endogenous CDK11p58 protein
has never been confirmed to bind with cyclin D3 (93). Cyclin D3 mRNA is present 97
throughout the cell cycle and does not undergo cyclic regulation like cyclin D1 or cyclin
D2 (214). One study found that cyclin D3-CDK4 activity is required for G2 progression
however evidence to support a role for cyclin D3 in mitosis has yet to be identified (215).
We worked to verify that cyclin D3 can associate with exogenously and endogenously
produced CDK11p58 in our cells and these experiments are detailed below.
Our current studies were performed to identify additional proteins that associate
with CDK11p58 in cells and determine whether this association is responsible for the
affects of CDK11p58 on the cell cycle. In order to determine potential binding partners
for CDK11p58 we employed a novel technique involving the use of liquid chromatography-mass spectrometry-mass spectrometry (LC-MS/MS) analysis (216, 217).
We used a tagged-CDK11p58 molecule to specifically pull out possible proteins that bind
to CDK11p58 cells and digested the potential proteins before sending through LC-MS/MS
analysis to determine peptides of the unknown proteins (figure 13). This technique has
previously been employed to identify proteins involved in complexes, such as those
proteins that comprise the pre-ribosomal ribonucleoprotein complexes (216). 98
Transiently transfect A375 cells with pCMV-myc or pCMV-myc-CDK11p58 ↓ Lyse cells, IP with anti-c-myc antibody ↓ SDS-PAGE ↓ Bio-Safe Coomassie staining ↓ Cut bands that are present in CDK11p58 transfected cells but are absent in vector control ↓ Trypsin in-gel digestion ↓ LC-MS/MS ↓ Peptide BLAST
Figure 13. Schematic diagram of proteomic approach to identifying CDK11p58 associated proteins. To identify potential binding partners of CDK11p58 protein, we transfected a pCMV-myc-CDK11p58 and a pCMV-myc control vector into A375 melanoma cells. 24 hours post-transfection, we harvested cells and lysed them for immunoprecipitation using anti-c-myc antibody. CDK11p58 specific bands were digested and underwent LC-MS/MS.
This process identified a new protein, DDX15 or DHX15 or hPrp43, which associated with CDK11p58. DDX15 was originally identified in yeast but has subsequently studied and characterized in other systems, including humans (218).
DDX15 is a member of the DEAD-box family of proteins that are RNA-dependent RNA helicases (219). RNA helicases are able to unwind RNA and are the driving force behind 99
RNA metabolism mediating several functions within cells that have downstream effects on differentiation, development, cell survival, and have implications in cancer by directing several cellular processes, including transcription, splicing, translation, and
RNA degradation. These molecules use the energy from ATP hydrolysis to rearrange inter- or intra-molecular RNA structures and format the interaction of RNA-protein complexes (220-224). The role of these proteins is varied but studies on DDX15 have shown that it is an essential component of the spliceosome that is necessary for disassembly (219, 225, 226). Additional studies have recently shown that DDX15 is also a necessary factor in ribosome biogenesis (227, 228). One network study of yeast genes identified that based on yeast Prp43 gene characteristics, it was likely involved in ribosome biogenesis (229). Ribosome biogenesis, which occurs in the nucleolus, implies the transcription of rRNA from rDNA, processing a cleavages of the 47S rRNA and assembly with ribosomal proteins and the 5S RNA forming the small and large pre- ribosomal units (230). One example of another similar molecule with dual function is eIF4E, an essential translation initiation factor, that has also been found at the nuclear speckle region where splicing occurs and it associates with splicing factors (231). There are evidence of other proteins that have dual roles not only in cell cycle progression and mRNA processing, such as CDC5 which is essential for G2 progression and mitosis entry but also is a core component of the spliceosome and another RNA helicase, PRP17 that is a second-step pre-mRNA splicing factor that functions in cell division (232, 233). Many other DEAD-box proteins are essential for translation initiation including yeast Ded1p
(234-237). DDX15 had previously been shown to associate with the human La (SS-B) 100 autoantigen, an RNA chaperone protein that is likely involved in RNA transcription (238,
239). RNA chaperone proteins exist to give DEAD-box proteins an activity by ensuring that they bind to RNA and facilitate the necessary function correctly (240). Another role of La autoantigen is its ability to bind to a specific site (GCAC) near the initiator AUG codon in the Hepatitis C virus RNA and to influence ribosome assembly at that site allowing translation from its IRES sequence (241). The further characterization of the
CDK11p58-DDX15 association and their effects on the cell cycle is the purpose of these studies. Furthermore, we have additionally characterized the expression profile of
DDX15 in a variety of different tumors and compared that expression to normal tissues.
Some previous studies using microarray based techniques that were not further validated, indicated that DDX15 levels may increase in malignant peripheral nerve sheath tumors and Barrett’s adenocarcinomas (192, 242). This provides the first initial profile of the expression of DDX15 in many cancers.
Results
Cyclin D3 associates with ectopically expressed CDK11p58 in A375 cells
In addition to identifying new binding partners of CDK11p58, we wanted to confirm the ability for CDK11p58 to associate with cyclin D3, which was previously published (93). We evaluated the ability of ectopically expressed CDK11p58 to bind with cyclin D3. After multiple experiments we only found a slight association of these proteins within our cells when CDK11p58 was overexpressed (figure 14). These results confirmed the published data that the proteins do associate. However, we were unable to 101 verify the association with endogenously produced CDK11p58 or any other isoform of
CDK11 (data not shown). These data do not support that cyclin D3 is the primary cyclin partner of CDK11p58 in our cells because only under conditions that are not physiologically relevant for CDK11p58 can the association be found. Future work will require identifying exactly which cyclin is the partner of CDK11p58.
IP: IgG IP: Cyclin D3 c c c y y y m m m - - - 8 8 8 5 5 5 p p p 1 1 1 1 1 1 K K K c c c y y D D y D C C m C m m ------V V V V V V M M M M M M C C C C C C p p p p p p IB: myc
Figure 14. Exogenously expressed CDK11p58 associates with cyclin D3 in A375 cells. We expressed CDK11p58 in our cells and immunoprecipitated with anti-cyclin D3 antibody and western blotted for myc-tagged CDK11p58.
Based upon the data acquired from our multiple cyclin D3 experiments, we set out to determine whether the recent reports that found cyclin L proteins associate with full- length CDK11p110 could correlate to the other isoforms of CDK11 including CDK11p46,
CDK11p58, and CDK11p60 . We wanted to determine whether cyclin L proteins could associate with these other isoforms. We generated a cyclin L antibody using chicken as 102
the host animal but were unable to clearly blot for cyclin L protein (data not shown).
Since a direct western analysis was unavailable, we overexpressed cyclin L1 and cyclin
L2 protein in A375 melanoma cells and tried to use a GFP-tag on these proteins to pull
out CDK11p58. Unfortunately, were unable to clearly demonstrate that CDK11p46,
CDK11p58 or CDK11p60 associated with tagged cyclin L1 or cyclin L2 protein in our cells
(data not shown). Therefore, the results of these investigations are inconclusive however
they do indicate that neither cyclin D3 nor cyclin L1 or cyclin L2 proteins are the cyclin
partners of CDK11p58.
CDK11p58 proteomic analysis identified two different proteins, Hsp90α and DDX15.
A schematic diagram of the protocol used to identify CDK11p58 interacting proteins is
found in figure 13. To identify potential binding partners of CDK11p58 protein, we
transfected a pCMV-myc-CDK11p58 and a pCMV-myc control vector into A375
melanoma cells. 24 hours post-transfection, we harvested cells and lysed them for
immunoprecipitation using anti-c-myc antibody. We verified the expression of myc-
tagged CDK11p58 in our cells compared to the pCMV-myc control lysates (figure 15A).
All immunoprecipitated proteins were run on an acrylamide gel and the myc-tagged
CDK11p58 protein bands were compared to the vector control lane. The use of a myc-
tagged CDK11p58 was done to ensure that the proteins identified as binding partners were specific to CDK11p58. The use of CDK11 specific antibody would not ensure that the
associations found were specific to CDK11p58 and not the other isoforms of CDK11
present in our cells. A band that migrated at approximately 90 kDa was found in the 103 myc-tagged CDK11p58 lane but was absent in the pCMV-myc control vector lane (figure
15B). The band was removed from the gel and was subjected to in-gel trypsin digestion and then LC-MS-MS analysis. Peptide results from the LC-MS-MS of the CDK11p58 specific band identified two different potential proteins within that band. The first protein found was Hsp90α, heat shock protein 90α. Hsp90 interacts with proteins to protect them from ubiquitination and proteasome-dependent degradation (243). Hsp90 chaperone protein was previously shown to associate and stabilize other isoforms of
CDK11 and the importance of these interactions had previously been characterized (131).
Therefore, further investigations into the role of Hsp90α interacting with CDK11p58 were not a priority for our research. The second protein found in the CDK11p58 specific band was found to be a RNA-dependent RNA helicase termed DDX15, DEAD-box protein 15.
There was approximately 6% peptide coverage of the total protein sequence, which is relatively important due to the large size of the protein. 104
A) B) pCMV-CDK11p58-myc + pCMV-Myc p
5 + 8
210 125 101
56
36 p p C C M M p58 29
V WB: c-myc-CDK11 V - - m m y y
c 21 c - C
D WB: α-tubulin K 1 1 Figure 15. Identification of potential binding partners of CDK11p58. (A) Western blot analysis of myc-tagged CDK11p58 transfected into A375 melanoma cells. pCMV-myc and pCMV-myc-CDK11p58 were transfected into A375 melanoma cells. Anti-c-myc antibody was used to western blot the membrane and α-tubulin was used as a loading control. (B) Silver staining of pCMV-myc and pCMV-myc-CDK11p58 immunoprecipitates. pCMV-myc and pCMV-myc-CDK11p58 were transfected into A375 melanoma cells and were harvested 24-hours post-transfection. The cells were lysed and the lysates were immunoprecipitated with anti-c-myc antibody. The gel was stained using silver nitrate staining and a band of approximately 90 kDa was identified. Peptides from Hsp90α and DDX15 were found in the band from LC- MS/MS analysis. 105
CDK11p58 associates with DDX15 proteins exogenously and endogenously.
To confirm that DDX15 interacts directly with CDK11p58, we performed immunoprecipitation of pCMV-myc and pCMV-myc-CDK11p58 transfected lysates with anti-DDX15 antibody. We then performed a western blot using anti-c-myc antibody to confirm the association (figure 16A). We additionally performed an immunoprecipitation using the same lysates and anti-c-myc antibody. We then blotted using anti-DDX15 antibody to further ensure that the proteins did interact when
CDK11p58 was exogenously expressed in cells (figure 16B). These immunoprecipitation results confirmed that myc-tagged CDK11p58 does associate with DDX15.
IP: myc IP:DDX15 IP: IgG c A) c y y c
c c B) y m y y m - - 8 m 8 m m 5 - 5 - - p 8 8 8 p 5 5 5 1 1 p p p 1 1 1 1 1 1 1 1 K K c c c c K K K D c y y D y y y D D D C C m m - m m - C - - C C m ------V V V V V V V V V V M M M M M M M M M M C C C C C C C C C C p p p p p p p p p p
IB: myc IB: DDX15
Figure 16. CDK11p58 immunoprecipitation with DDX15 proteins with exogenous expression of CDK11p58. (A) Exogenous expression of CDK11p58 and immunoprecipitation with anti-DDX15 antibody. A375 melanoma cells were transfected with pCMV-myc and pCMV-myc- CDK11p58 and lysates were immunoprecipitated with anti-DDX15 antibody and control rabbit IgG antibody. Lysates and immunoprecipitates were western blotted using anti-c- myc antibody. (B) Exogenous expression of CDK11p58 and immunoprecipitation with anti-c-myc antibody. Cells were treated as in (A) but lysates were immunoprecipitated with anti-c-myc antibody and later western blotted using anti-DDX15 antibody.
106
In order to verify that these interactions are not an artifact of overexpression of
CDK11p58 within cells, we synchronized our cells within the cell cycle in order to achieve
p58 endogenous expression of CDK11 during the G2/M phase (figure 17A). Using these synchronized lysates, we immunoprecipitated using the anti-DDX15 antibody and blotted with anti-CDK11 antibody (figure 17B). These blots confirmed that DDX15 protein does interact with CDK11p58 specifically in cells with both ectopic and endogenous levels of protein expression.
A) B)
IP: DDX15 IP: IgG N 0 . o 4 t m N r U U N U p58 N e g o
WB: CDK11 a n n o n o / c t s s m c s c m o y y y o o L c c d c e d d h h a h p58 n a a r r z r
N WB: CDK11 t z z o o o
WB: Cyclin B1 o o o o n n n l l l e c i i e i e z z z o e e e d d d d a
WB: α-tubulinz o l e
Figure 17. CDK11p58 immunoprecipitation with DDX15 proteins with endogenous production of CDK11p58. (A) Endogenous production of CDK11p58 in synchronous A375 melanoma cells. A375 melanoma cells were seeded to approximately 70% confluency and then were treated with 0.4 µg/mL of nocodazole for 22 hours. The cells were then harvested and lysed and run on a western blot using anti-CDK11 antibody, GN1. Production of CDK11p58 was detected specifically in treated cells and was not found in untreated cells. (B) Endogenous expression of CDK11p58 and immunoprecipitation with anti-DDX15 antibody. Lysates from (A) were used to immunoprecipitate with anti-DDX15 antibody and rabbit IgG using the Catch and Release columns. Lysates and immunoprecipitates were blotted with anti-CDK11 antibody and the CDK11p58 specific band was identified. 107
CDK11p58 proteins are colocalized within A375 cells with DDX15 proteins
In order to visualize the location of these proteins within A375 cells, we transiently transfected pCMV-myc-CDK11p58 and pCMV-myc empty vector into cells that were seeded on coverslips. These cells were fixed onto the coverslips and were stained with anti-c-myc and anti-DDX15 antibodies and both in order to look at the in vivo protein localization. Using fluorescent secondary antibodies, we were able to visualize the cellular location of c-myc (Figure 18A) and c-myc-tagged CDK11p58 (figure
18F), DDX15 (figures 18B and 18G) and the nucleus with DAPI staining (figures 18C and 18H). The CDK11p58 and DDX15 images were combined (figures 18D and 18I) and the colocalization of these proteins was visualized by the overlap of the proteins within cells. The combination of all three images clearly showed that CDK11p58 and DDX15 overlap within the nucleus in pCMV-myc-CDK11p58 transfected cells (figure 18J) but not within the vector control cells (figure 18E). The localization of the DDX15 is more nuclear in cells with CDK11p58 than without. CDK11 antibodies are able to identify the many different isoforms of CDK11 and are therefore unable to specifically look at
CDK11p58 unless a tag, such as a myc peptide, are used to distinguish this protein from the other isoforms. Additional staining with anti-CDK11 antibodies showed similar results although there was more diffuse cytoplasmic staining in addition to nuclear staining, which concurs with previous results (data not shown) (61, 172). Collectively, these data show a specific nuclear localization of these proteins within our cells and both the CDK11p58 and DDX15 proteins appear to overlap their locations within the nucleus. 108
Figure 18
pCMV-myc pCMV-myc-CDK11p58
A D F I
B EGJ
C H
pCMV-myc transfectants (A-E) A. Anti-myc (red) B. Anti-DDX15 (green) C. DAPI (blue) D. CDK11p58/DDX15 overlap (yellow) E. CDK11p58/DDX15/DAPI overlap
pCMV-myc-CDK11p58 transfectants (F-J) F. Anti-myc (red) G. Anti-DDX15 (green) H. DAPI (blue) I. CDK11p58/DDX15 overlap (yellow) J. CDK11p58/DDX15/DAPI overlap
109
Figure 18. In vivo colocalization of CDK11p58 and DDX15 in A375 melanoma cells. (A-J) pCMV-myc and pCMV-myc-CDK11p58 transiently transfected A375 cells were grown on coverslips, washed twice with cold PBS, and fixed in 4% paraformaldehyde. Cells were rinsed three times with PBS and permeabilized with 100% methanol at 20 °C. Coverslips were washed with PBS again and incubated with 5% bovine serum albumin in PBS and then the coverslips were then incubated with (A, F) anti-c-myc antibody to identify myc-tagged CDK11p58 and (B, G) anti-DDX15 antibody. Coverslips were washed three times with PBS for 5 min each and then incubated with fluorescence- labeled secondary antibodies fluorescein isothiocyanate-conjugated anti-mouse IgG + IgM (1:100 dilution) and Cy5-conjugated anti-rabbit IgG (1:100 dilution) in darkness for 1 h at room temperature. Following incubation, coverslips were washed three times with PBS, mounted with (C, H) DAPI nuclear staining mounting medium, and stored at 4 °C overnight for immunofluorescence confocal microscopy analysis. The combined resolution of myc-tagged CDK11p58 with DDX15 is seen in Figures 18D and 18I. Figures 18E and 18J are the combined images of myc-tagged CDK11p58 with DDX15 and the DAPI nuclear stain.
CDK11p58 phosphorylates recombinant DDX15 protein
Since the primary function of kinases is to phosphorylate substrates, we assayed whether DDX15 is a substrate of CDK11p58 in vitro. We transiently transfected A375 cells with pCDNA3 empty vector, pCDNA3-CDK11p58 (figure 19A verifies the expression of CDK11p58). The cells were harvested 24 hours post-transfection and lysates were immunoprecipitated using anti-CDK11 antibody. Recombinant his-tagged
DDX15 protein was then added to the immunoprecipitated beads and in the presence of kinase buffer 32P-γATP was used to label the phosphoproteins. A Coomassie stain verified the production of the recombinant his-tagged DDX15 in BL21 E. coli in the presence of isopropyl-β-D-thiogalactopyranoside (IPTG) stimulation but not in the absence (figure 19B). Autoradiography was done to visualize the presence of 110 phosphorylated DDX15 (figure 19C). Recombinant DDX15 was phosphorylated by
CDK11p58 in vitro. G
B) T
A) P G I 8 T 5 r p P u I o 1 h o 1 N 6 K D C - 3 3 His -DDX15 A A N N D D C C p p IB: CDK11p58p58 IB: αα-tubulin-tubulin 8 5 p
C) 1 1 K D C - 3 3 A A N N D D C C p p
[γ-32P]ATP His-tagged DDX15 Figure 19. In vitro kinase assay of CDK11p58 with recombinant DDX15. (A) Western blot of CDK11p58 expression in A375 cells transfected with pCDNA3 and pCDNA3-CDK11p58. A375 cells were transfected with pCDNA3 empty vector and pCDNA3-CDK11p58 and cells were harvested 24-hours later. Membrane was probed with anti-CDK11 antibody, GN1 and α-tubulin. (B) Biosafe protein stain of recombinant DDX15 protein after purification with his-tag purification columns. His- tagged recombinant DDX15 protein was produced in BL21 E. coli after 6 hour stimulation with IPTG. Protein was purified from bacterial pellets using his columns as per manufacturer’s instructions. The products were run on SDS PAGE and gel was stained for total cell protein using Pierce stain as per manufacturer’s instruction. (C) In vitro kinase assay of recombinant DDX15 protein by CDK11p58 protein. Pellets made like (A) were lysed and lysates were immunoprecipitated using GN1 plus Protein G beads. Beads were washed in kinase buffer and in vitro kinase assay was run as detailed in Materials and Methods section. Size of radioactive band was compared to (B) to ensure that recombinant DDX15 was being evaluated.
111
p58 Ectopic expression of CDK11 and DDX15 leads to halt of cell cycle during G2/M.
In order to determine whether the overexpression of CDK11p58 or DDX15 in our cell system leads in an increased accumulation of cells within the G2/M phase of the cell cycle similar to previously published data (158), we transfected our A375 melanoma cells with pCDNA3, pCDNA3-CDK11p58, pCDNA3-DDX15, or both pCDNA3-CDK11p58 and pCDNA3-DDX15. 24-hours post-transfection we harvested these cells and stained their DNA with propidium iodide. We then sorted the cells using flow cytometry to determine the DNA content of each cell (figure 20). The experiments were repeated in triplicate and the results showed the different levels of cells in each phase of the cell cycle varied between the control pCDNA3 cells and the various other conditions. The results are detailed more thoroughly in table 2. These data show for the first time that overexpression of DDX15 in A375 melanoma cells leads to a delay of cells during the
p58 G2/M phase of the cell cycle, which is similar to previously known CDK11 data.
Table 2. Overexpression of CDK11p58, DDX15 and CDK11p58 + DDX15 leads to delay of the cell cycle at G2/M phase.
G0/G1 phase S phase G2/M phase
pCDNA3 69.57±0.65 29.16±2.49 1.21±2.20
pCDNA3-CDK11p58 56.71±8.98 34.86±7.41 8.43±1.68 pCDNA3-DDX15 55.61±9.34 34.37±7.39 10.01±1.97
pCDNA3-CDK11p58 + 54.42±8.20 31.92±5.87 13.41±2.91 pCDNA3-DDX15 112
pCDNA3
Debris Aggregates Dip G1 Dip G2 Dip S
0 50 100 150 200 250 DNA Content
pCDNA3-DDX15 + pCDNA3-CDK11p58 pCDNA3-DDX15 pCDNA3-CDK11p58
0 50 100 150 200 250 0 50 100 150 200 250 0 50 100 150 200 250 DNA Content DNA Content DNA Content
Figure 20. Cell cycle analysis of A375 cells that overexpress CDK11p58 and DDX15. Flow cytometry analysis of A375 cells transfected with pCDNA3, pCDNA3- CDK11p58, pCDNA3-DDX15, and pCDNA3-CDK11p58 + pCDNA3-DDX15. Cells were transfected with above vectors and 24-hours after transfection were harvested. Cells were washed in PBS and then fixed in 75% ethanol overnight. Cells were washed in PBS and stained with propidium iodide and analyzed by quantitative flow cytometry with standard optics of FACScan flow cytometer. Flow diagrams are representative histograms of the experiments and table 2 provides data analysis of triplicate experiments.
In addition to the flow cytometry analysis, we set out to determine the relative protein levels of certain cell cycle related proteins within our cells with each of the overexpression conditions. These proteins are variable during the cell cycle but they will be a good measurement of the ability for our protein alterations to impact other cell cycle connected proteins. To verify expression CDK11p58 and DDX15 were probed. Western 113
blot analysis shows that the levels of cyclin D1, a G0/G1 specific cyclin, and cyclin E, a
p58 p58 G1/S phase cyclin, were slightly reduced when CDK11 , DDX15, and CDK11 plus
DDX15 proteins were overexpressed (figure 21). The levels of cyclin A that is involved in the G2/M transition and cyclin B1, which is a mitotic specific cyclin, were very slightly increased when the levels of cyclin D1 and cyclin E appeared slightly reduced. The two
WAF1 KIP different CDK inhibitors, p21 (G1/S phase) and p27 (S phase), were studied and the western blot did not show appreciable changes to p21 proteins and only a very slight increase in p27 levels. α-tubulin was used as a loading control (figure 21). The increase of those molecules associated with S phase and G2/M is not highly visible or a reduction in the levels of the early phase molecules. However there appears to be a slight elevation in the levels of cyclin A, cyclin B1 and p27 and a small decrease in cyclin D1 and cyclin
E expression, which is in line with the cell cycle analysis via flow cytometry when the cells are transfected with CDK11p58, DDX15, and CDK11p58 plus DDX15. In total, these data are able to confirm a role for not only CDK11p58 but also DDX15 proteins within the cell cycle when they are overexpressed in A375 cells. 114 8 8 5 5 5 p p 1 5 1 1 X 1 1 1 D X K K D D D D - C D 3 C - - - A 3 3 3 3 N A A A A D N N N N C D D D D p C C C C p p p p + CDK11p58 DDX15 Cyclin D1 Cyclin E Cyclin A Cyclin B1 p21 p27 α-tubulin
Figure 21. Western analysis of A375 cells with enforced expression of DDX15 and CDK11p58 and in combination. Western blotting of cell cycle related proteins were done on pellets from A375 cells transfected with pCDNA3, pCDNA3-CDK11p58, pCDNA3-DDX15, and pCDNA3-CDK11p58 + pCDNA3-DDX15. List of molecules p58 probed: CDK11 , DDX15, Cyclin D1-G0/G1 phase cyclin, cyclin E-G1/S phase cyclin, cyclin A-G2 phase cyclin, cyclin B1-G2/M phase cyclin, p21-G1/S phase checkpoint protein, p27-S phase checkpoint protein, and α-tubulin as a loading control.
Knock down of CDK11 and DDX15 expression permits cells to cycle through the cell cycle.
The overexpression of CDK11p58 is a common technique used to investigate the possible functions of this protein. The highly specific expression of CDK11p58 during mitosis makes it more difficult to study so the common practice has been to ectopically 115 express this protein and investigate the effects. Recently one analysis has utilized RNAi of CDK11 and this proved a useful method to investigate the protein function (176). We also noted the relatively abundant levels of DDX15 protein within our cells so we wanted to knock down DDX15 protein levels and determine the effects on the cell cycle. We transfected A375 cells with DDX15 siRNA or CDK11 siRNA generated by DICER and both conditions at once. The proper controls were also transfected into the cells and the cells were harvested 48 hours after transfection. Our conditions included: no treatment
(none), transfection reagent only control (LF2000), scrambled oligo control for DDX15
RNAi (SCR), Lac Z DICER control for CDK11 RNAi (LacZ), and scrambled plus Lac Z for the double knock down of DDX15 and CDK11 RNAi. We measured the level of protein expression at 48 and 72 hours post-transfection to determine the efficiency of knock down with the different conditions and determined that 48 hours was the most reduced time point (data not shown). We performed cell cycle flow cytometry analysis of the cells treated with the above controls and the RNAi conditions (figure 22). These data indicate that the reduced expression of DDX15, CDK11, and DDX15 + CDK11 combined was permissive to the exit from the cell cycle because more cells were accumulated in G0/G1 than the control samples (table 3). 116
AggregatesAggregates AggregatesAggregates DDipip G1 DDipip G1 Dip G2 Dip G2 Dip S Dip S
None LF 2000 Debris Aggregates Dip G1 Dip G2 Dip S
0 50 100 150 200 250 0 50 100 150 200 250 DDNANA Content DDNANA Content
Aggregates Aggregates Aggregates Dip G1 Dip G1 Dip G1 DipDip G2 Dip G2 Dip G2 Dip S Dip S Dip S
SCR control LacZ control SCR control + LacZ control
0 50 100 150 200 250 0 5050 100100 150150 200200 250250 0 50 100 150 200 250 DNA Content DNA Content DNA Content
AggregatesAggregates Aggregates Aggregates Dip G1 Dip G1 Dip G1 Dip G2 Dip G2 Dip G2 Dip S Dip S Dip S
DDX15 RNAi CDK11 RNAi DDX15 RNAi + CDK11 RNAi
0 50 100 150 200 250 0 50 100 150 200 250 0 50 100 150 200 250 DNA Content DNA Content DNA Content
Figure 22. Flow cytometry of cells with knocked down expression of CDK11 and DDX15. Flow cytometry of cells treated with CDK11 and DDX15 RNAi. A375 cells were seeded to approximately 30% confluency prior to transfection for 48- hours (identified as optimal period of knock down for each RNAi condition). Conditions: None, no treatment; LF2000, transfection reagent only; SCR, scrambled oligo control for DDX15 siRNA; Lac Z, DICER treated Lac Z used as control for CDK11 DICER RNAi; SCR + Lac Z, control for double knock down condition (CDK11 DICER + DDX15 oligo); DDX15 siRNA; CDK11 DICER; CDK11 DICER + DDX15 siRNA. Cells were harvested and analyzed as detailed in figure 20. 117
Table 3. Knockdown of DDX15 and CDK11 expression leads to increased ability of cells to cyclin into G1/S phase.
G0/G1 phase S phase G2/M phase
None 63.64±6.86 30.10±5.68 6.23±3.15 LF2000 68.29±10.50 24.18±8.6 7.52±2.39 SCR oligo 67.43±14.04 23.19±11.38 9.37±4.22 LacZ DICER 66.8±9.92 24.06±7.35 9.14±2.82
SCR oligo + LacZ DICER 68.22±5.92 24.02±7.36 7.76±1.97 DDX15 RNAi oligo 73.91±12.81 20.6±12.11 5.52±0.91 CDK11 DICER RNAi 68.88±12.37 24.95±13.22 6.17±1.03 DDX15 RNAi + CDK11 64.95±6.22 30.04±5.65 5.01±1.60 RNAi
These data point towards a more cell cycle permissive phenotype when CDK11 and
DDX15 proteins are knocked down in our cells. The changes to the cell cycle when
CDK11 and DDX15 proteins are reduced did not yield highly detectable changes to the levels of the cell cycle related proteins (cyclin D1, cyclin E, cyclin A, cyclin B1, p21 and p27) probed in the previous section (data not shown). The cell cycle related protein changes are very slight but there is a reduction in the level of cyclin A and cyclin B1 expression and a slight increase in p21, p27 and cyclin D1 in the CDK11 + DDX15 knock down conditions (data not shown). To summarize these data, a reduction in the levels of CDK11 and DDX15 expression is permissive to entry into G0/G1. 118
Ectopic expression of DDX15 and CDK11p58 induces apoptosis.
Previous studies have found that overexpression of CDK11p58 can induce apoptosis in cells potentially because of mitotic catastrophe (158). We wanted to determine whether CDK11p58 could induce apoptosis in our A375 melanoma cells and whether DDX15 had similar properties. Other DEAD-box proteins can induce both cell cycle delay and apoptosis in cells when their levels are manipulated so it is feasible to assume that DDX15 may have some effect (221, 244, 245). We transiently transfected our cells with CDK11p58 and DDX15 and CDK11p58 + DDX15 and pCDNA3 control vector. 24-hours after transfection we stained our cells with 7-AAD (detailed in materials and methods) for DNA damage associated with apoptosis. Flow cytometry of these cells found that expression of CDK11p58, DDX15 and both together induced apoptosis at higher levels compared to control cells (table 4 and figure 24).
Table 4. Ectopic expression of CDK11p58 and DDX15 induce apoptosis.
Cells Live cells Early Late Total apoptosis apoptosis apoptosis
pCDNA3 70% 27% 2% 29%
pCDNA3-DDX15 59% 27% 14% 41%
pCDNA3-CDK11p58 62% 25% 14% 39%
pCDNA3-DDX15 + 57% 24% 19% 43% pCDNA3-CDK11p58 119
pCDNA3
R4 R3
R3 R2
R2 R1
0 200 400 600 800 1000 FSC-Height pCDNA3-DDX15 + pCDNA3-DDX15 pCDNA3-CDK11p58 pCDNA3-CDK11p58
R4 R4 R4 R3 R3 R3
R3 R2 R3 R2 R3 R2
R2 R1 R2 R1 R2 R1
0 200 400 600 800 1000 0 200 400 600 800 1000 0 200 400 600 800 1000 FSC-Height FSC-Height FSC-Height
Figure 23. Overexpression of CDK11p58, DDX15, and CDK11p58 + DDX15 induces apoptosis. A375 melanoma cells were transfected with pCDNA3, pCDNA3- CDK11p58, pCDNA3-DDX15, and pCDNA3-CDK11p58 + pCDNA3-DDX15. The cells were harvested and washed before 7-AAD was added for 30 min in the dark. Cells were rewashed and were resuspended for FACS analysis. R1-live cells, R2- early apoptotic cells, R3-late apoptotic cells. Representative histograms are shown. 120
DDX15 expression is downregulated in several human tumors
We investigated the expression of DDX15 in human tumors compared to nearby normal tissues by hybridizing a DDX15 probe (described in materials and methods) to a cancer-profiling array from Clontech (figure 24A). The cancer-profiling array contained
154 normalized cDNA pairs from tumors and the corresponding normal tissues of individual patients, which allows the direct comparison of normal and tumor tissue cDNA. The ratio of the signal intensity of each pair of normal and tumor cDNA-probe hybridization and the statistical analysis of each tumor type are listed in table 5. A ubiquitin probe was used as control for the cDNA levels on the array and was hybridized to the same membrane after it was stripped clear of our DDX15 probe (figure 24B).
These results were used to normalize the DDX15 array data. 121
A) DDX15
Breast Ovary ColonStomachLung Kidney Bladder Vulva Prostate
N T Trachea Liver
N TNN T N T N T TN T N T N T Thyroid Small Uterus Cervix Rectum Testis Skin Pancreas Gland Intestine Hela Dauudi K562 HL60 G361 A549 MOLT4 SW480 N T N T Raji
N TNN T N T N T TN T
B) Ubiquitin
Figure 24. Expression of DDX15 transcripts in normal and cancer cells. (A)Cancer profiling array of DDX15 transcripts. A probe for DDX15 transcripts was designed and cloned from pDNR clone in materials and methods (Open Biosystems) using PCR. The probe was labeled and hybridized as per Materials and Methods. Tissue types are labeled on figure. Results were analyzed using phosphorimager and results are given in tabular form in table 4. (B) Cancer profiling array of ubiquitin transcripts. Ubiquitin probe was provided by manufacturer and experiment was performed as per Materials and Methods. Array was analyzed using previously described methods and was used to standardize the DDX15 array from (A).
122
Table 5. DDX15 Cancer-profiling array data.
Breast Ovary Colon Stomach Lung* Kidney* Bladder* Vulva* Prostate Trachea
T/N ratio
0.90 0.55 0.70 1.26 0.46 0.64 0.41 0.77 0.37 0.34 1.80 1.10 0.45 0.26 1.01 0.45 0.55 0.76 1.59 1.15 1.07 2.13 1.51 0.54 0.49 0.37 0.55 0.49 0.69 0.68 1.36 1.02 0.55 0.65 1.82 1.00 0.94 0.33 0.81 0.28 1.00 1.25 0.41 0.36 0.48 0.55 0.82 0.44 1.25 0.55 1.00 0.20 0.92 0.61 0.80 2.08 1.06 0.09 0.10 0.52 0.68 0.48 1.21 0.86 0.26 2.48 0.69 0.39 0.69 0.33 0.40 1.07 0.57 0.82 1.47 0.84 0.60
P-value
0.31 0.91 0.46 0.63 0.05 0.05 0.05 0.07 0.37 0.50
Liver Uterus* Cervix Rectum Thyroid Testis* Skin Small Pancreas gland* intestine*
T/N ratio
0.75 0.36 0.82 0.98 0.25 0.81 0.32 0.43 0.74 0.45 0.94 1.03 0.49 0.39 0.29 1.12 0.44 1.19 0.75 0.88 1.87 1.22 0.70 0.84 1.08 0.72 0.89 0.66 0.40 0.50 1.17 0.16 2.10 0.31 1.35 0.37 0.58 0.41 0.24 0.61 0.33 0.71 1.46 0.25 1.65 2.70 0.91 1.06 0.81 0.88 0.88 0.02 0.81 0.98 0.70 0.27 0.42 0.01 1.63 0.39 1.47 1.08 0.22 0.44 0.63 0.86 1.65 0.94 0.33 0.32 0.56 0.19 1.45 1.06 0.59 0.65 0.84
P-value
0.37 0.03 0.74 0.73 0.01 0.01 0.25 0.03 0.72
123
Our results displayed that DDX15 was markedly reduced in several of the tumors on the array as compared to the normal cDNA nearby. The tumors that showed significantly reduced levels of included bladder, kidney, lung, testis, thyroid gland, uterus and vulva
(table 6).
Table 6. Tissues with statistically significant decreases in DDX15 expression in tumors compared to normal tissue.
Tissue % patients with No. of patients decreased DDX15 Bladder 100 5
Kidney 90 10
Lung 80 10
Testis 90 10
Thyroid gland 90 10
Uterus 100 10
Vulva 100 5
Values are given as a percentage of decrease from the total number of cases. Statistical significance was determined based upon a p-value of below 0.05 from the student t test of results found in table 5. 124
DDX15 is reduced in human renal carcinomas compared to normal tissue.
In order to confirm the array data, we collaborated with Dr. Harry Drabkin at
UCHSC (Aurora, CO) to perform real-time PCR of DDX15 on six different renal carcinomas cDNAs and to compare the results to the corresponding uninvolved normal tissue cDNAs. The collection of the tissues, RNA isolation and real-time analysis was performed by Dr. Harry Drabkin using primers designed for DDX15 and control
GAPDH. Five of the six different cancers that were analyzed showed a reduction of
DDX15 expression and the overall decrease was statistically significant with a p-value of
0.0115 (figure 25). These results verify that the initial studies of DDX15 expression in the cancer-profiling array is able to correlate directly with additional cases of kidney tumors that were analyzed using an alternative means of measuring gene expression. 125
) 0.007 n i t c a
/ 0.006 5 1
X 0.005 D D ( 0.004 t N p i r
c 0.003 T s n a
r 0.002 t e v
i 0.001 t a l e 0.000 R 123456
Figure 25. Real-time PCR results from 6 different normal kidney tissues and nearby renal carcinomas of DDX15 levels. Graph of real-time PCR of DDX15 standardized to GAPDH in different renal cancer biopsies (see Materials and Methods for primers and PCR conditions). Experiments were repeated in triplicates and values in graph are given as relative transcript levels based upon a delta-delta CT ± standard deviation.
Discussion
The investigations detailed above were all designed to characterize the role of
CDK11p58 in cells and particularly the activity during the cell cycle. We first investigated whether cyclin D3 associated with CDK11p58 in our cells. We were able to confirm the association with myc-tagged CDK11p58 (figure 14) but were unable to show that endogenous
CDK11p58 interacts with cyclin D3 (data not shown). Additionally, we looked into the possible association of cyclin L1 or cyclin L2 binding with CDK11p58. The associations with both GFP-tagged cyclin L1 and GFP-tagged cyclin L2 were negative but this may be in part 126 due to the conditions because of the stress it places on cells to overexpress multiple proteins at once (data not shown). Additionally, our GFP-tagged cyclin L1 and cyclin L2 were not clearly western blotted unless high concentration of antibody was used. This may belay a problem with the antibody because the cells did visually express these proteins when viewed under the microscope. These data do not support or refute the possibility that cyclin L1 or cyclin L2 proteins may be the partner of CDK11p58 within cells. Future experiments may utilize additional techniques to verify the associations and subsequent to these experiments, antibodies for both cyclin L proteins have been generated and may be of further use in these experiments. We performed these cyclin studies based upon the disconcordance of published data of CDK11 cyclins. The necessary role of cyclins for CDK activity has been clearly illustrated with the other members of the CDK family and these studies were designed to help clarify the particular cyclin for CDK11 proteins and how this might impact CDK11 function. Unfortunately, it is still not completely clear what the correct cyclin partner is for
CDK11p58.
Proteomics are being increasingly used in current research practices to help identify unknown binding partners to a known protein and are able to replace more traditional methods like a yeast-two hybrid screen (217, 246). By using a proteomic approach in this investigation we found that CDK11p58 associates with and phosphorylates DDX15 in cells. The in vitro phosphorylation of recombinant DDX15 was clearly shown but ongoing research is being done to alter the kinase domain of the
CDK11p58 molecule creating a kinase mutant that can no longer phosphorylate substrates.
We initially performed our analysis with a mutant construct however the kinase activity 127 was not completely turned off by mutation of a few sites so an additional construct is being created. This kinase mutant will confirm that the phosphorylation by CDK11p58 is specific. Since it was determined that cells transfected with CDK11p58 but not the empty vector was able to phosphorylate DDX15, we are to looking further into the specific residues on DDX15 that were sites of phosphorylation. By performing another kinase assay with the use of only nonradioactive ATP and digesting only the recombinant
DDX15 band prior to LC-MS/MS, the specific residues that are phosphorylated can be determined. The data from these experiments are currently being analyzed (data not shown). Identifying the specific residues on DDX15 that are phosphorylated by
CDK11p58 is an important component to validating DDX15 as a specific substrate of
CDK11p58, which would provide the first known substrate of CDK11p58 kinase.
Other experiments to help confirm that DDX15 is a substrate of CDK11p58 have been inconclusive. We performed a couple of different in vivo phosphorylation assays with mixed results. The in vivo radiolabeling of proteins in our cells transfected with
CDK11p58 or empty vector and a secondary assay using 2-dimensional SDS-PAGE combined with western blotting using anti-DDX15 antibody were both unclear (data not shown). These assays were not able to confirm that endogenous DDX15 was an in vivo substrate of CDK11p58. The results are not definitive but further experimentation will involve additional in vivo kinase assays with the use of a more specific anti-DDX15 antibody for immunoprecipitation may help increase the clarity of these results. In vivo phosphorylation would verify that CDK11p58 does phosphorylate not only the recombinant DDX15 but also occurs endogenously within cells. 128
We also showed the in vivo colocalization of DDX15 with CDK11p58 in A375 melanoma cells that were transfected with pCMV-myc and pCMV-myc-CDK11p58. The nuclear localization of both proteins had a very clear overlap in the myc-tagged
CDK11p58 cells. The vector control cells had a more diffuse staining of DDX15 protein throughout the entire cell, which occurred in the absence of CDK11p58 (figure 18).
Evidence from other factors involved with translation initiation show that they are shuttled within cellular locations by cell cycle related means. eIF3e/INT6, a eukaryotic translation initiation factor that is implicated strongly in carcinogenesis because of it being a site for MMTV virus integration in tumors, moves between the nucleus and cytoplasm more than the other eIF3 factors during early S phase (247). eIF4E is also shuttled between the cytoplasm and nucleas during the cell cycle because of 4E-T shuttling protein. Studies have shown that eIF4E phosphorylation facilitates the association of eIF4E with 4E-T (248, 249). It is possible that CDK11p58 may regulate the localization of DDX15 proteins during mitosis to the nucleus.
CDK11p58 had previously been shown to directly affect the cell cycle progression in several cell types, including CHO, Jurkat and HeLa cells (158, 159, 176, 250).
Functional genomic analysis of Drosophila cell morphology found that cells with dsRNA interference of PITSLRE, the Drosophila homolog of CDK11, had aberrant frequent spindles and round non-adherent morphologies (251). Initial investigations from our laboratory to evaluate RNA interference of PITSLRE in Drosophila cell culture did implicate a potential role in the cell cycle but the results were inconclusive (data not shown). After confirming the association of CDK11p58 with DDX15 in our cells, we set 129 out to determine whether the overexpression of CDK11p58 and DDX15 could alter the cell cycle progression of our A375 melanoma cells. The results confirmed the previously
p58 reported data that overexpression of CDK11 can halt the cells during G2/M.
Overexpression of DDX15 also led to cell cycle delay during G2/M, which was unique to these findings (table 3). Conversely, we also reduced the expression of both CDK11 and
DDX15 in our cells and found that reduced expression of either of these proteins or in combination led to increased levels of cells in G0/G1 (table 4). These results although preliminary, do verify that not only the level of CDK11p58 protein but also the level of
DDX15 manipulates the cell cycle. The mechanism by which CDK11p58-DDX15 can regulate the cell cycle remains unknown but the activity of DDX15 proteins has been more clearly defined by previous investigations. Whether its association with CDK11p58 affects the ability of DDX15 during splicing or ribosome biogenesis during mitosis is an area of further investigation based upon these preliminary findings. It is possible that the activity of CDK11p58-DDX15 is independent of the known DDX15 activities as well.
Further elaborations regarding the activity of DDX15 during mitosis and the implications of its association with CDK11p58 are detailed in the final chapter.
In addition to cell cycle analysis, we also evaluated the capacity for overexpression of CDK11p58 and DDX15 to induce apoptosis. Previously published results have found the overexpression of CDK11p58 can increase the levels of cell death.
The increased levels of cell death may be due in part to the ability for CDK11 proteins to induce apoptosis when overexpressed and CDK11p58 does include several caspase cleavage sites that create the smaller CDK11p46 protein (52, 135, 172). Another 130 possibility is that CDK11p58 induced cell death occurs due to a mitotic catastrophe. We found that CDK11p58 and DDX15 overexpression could induce apoptosis as well in our cells (figure 23). Other DEAD-box proteins have been linked to roles in apoptosis however this is the first time DDX15 levels were linked to increased levels of cell death
(221, 245). Whether the overexpression of DDX15 leads to cell cycle alterations that cause checkpoint induced apoptosis or DDX15 activity is directly related to apoptotic cascades remains to be determined. The combination of CDK11p58 and DDX15 overexpression did not significantly increase the level of apoptosis above the amounts seen by the individual proteins alone (figure 23). Therefore, the future direction of these experiments should include determining whether CDK11p58 activity is necessary for
DDX15 to induce apoptosis. The implications of DDX15 induced apoptosis are important to understanding the significance of DDX15 during normal cell physiology and during tumorigenesis.
These studies were carried out using A375 melanoma cells because of the previous correlation of CDK11 proteins with malignant melanomas and our laboratory’s previous success with transfection of these cells (33, 129). The previous experiments clearly define that not only CDK11p58 but also DDX15 plays essential roles in the cell cycle and apoptosis (tables 2, 3 and 4). Whether the levels of DDX15 are altered in tumors compared to normal tissues was evaluated using a cancer-profiling array with
DDX15 as a probe. Several different tumors showed decreased levels of DDX15 expression compared to normal tissues (tables 5 and 6). The loss of DDX15 in cancer may be advantageous for the tumors based upon the previously shown role of DDX15 in 131 regulation of apoptosis and the cell cycle. How exactly cancer cells benefit from the loss of DDX15 is unclear. The data from the cancer-profiling array indicates that studies to determine the function of DDX15 in cancers may be more efficacious in tumors that showed differential expression levels. Other DEAD-box RNA helicases are directly involved in tumorigenesis by dysregulation of expression and the involvement in the regulation of molecules that are implicated in cancer (221, 252). Some studies in yeast have identified that specific mutations within the Prp43 molecule can uncouple its
NTPase activity during pre-mRNA splicing and alter the ability of cells to splice (253).
These studies are only preliminary investigations into the effects of mutations on DDX15 function but the possibility of DDX15 mutation in cancers could also be evaluated because it is clear that mutations do alter the ability of DDX15 to splice (253).
Additional work to characterize the role of DDX15 in certain cancers should employ additional cell types because they may provide a more complete picture of the events that are occurring during tumorigenesis.
The use of modern array techniques to evaluate the expression of specific molecules within several different samples at one time is becoming increasingly common. Array-based comparative genomic hybridization of many different
Barrett’sadenocarcinomas showed a gain of DDX15 DNA copy number (242). Yet these results were not validated and did not provide a clear picture about the possible alterations of DDX15 expression in diseased states. We also looked more specifically at the levels of DDX15 in some renal carcinomas and their nearby normal tissue by real- time PCR analysis (figure 25). Additional validation studies should incorporate not 132 only an evaluation of the mRNA expression levels of DDX15 but also the translated protein levels to help understand what is happening in tumors. Taken altogether, DDX15 expression appears to decrease in a significant number of several solid tumors including many investigated cases of renal carcinoma. Discussion of the significance of reduced
DDX15 levels in cancers is detailed in the final chapter.
133
V. CDK11p58 INTERACTS WITH VARIOUS CYTOSKELETAL PROTEINS AND HSP70
Introduction
CDK11p58 is undoubtedly crucial protein to proper cell division. The regulation of CDK11p58 expression is related to not only basal transcription by several transcription factors but also to IRES translation during mitosis, which is modulated at least in part by
Unr and eIF2α activity (97). Our studies have confirmed the previous findings that
p58 overexpression of CDK11 protein can increase G2/M delay and induce apoptosis (92,
158, 250). The use of LC-MS/MS has identified DDX15 and Hsp90 as binding partners of CDK11p58 and DDX15 is a substrate of CDK11p58 in vitro. Although these studies were clearly able to identify on possible function of CDK11p58 proteins through DDX15 activity, we wanted to continue identifying other mechanisms of CDK11p58 action. In addition to our proteomics we performed preliminary cyclin studies to help clarify the role of cyclin D3 and the cyclin L proteins with CDK11p58.
The other studies in this chapter were done to identify other binding partners of
CDK11p58 using the same proteomic technique done previously. Our findings were quite unique to previously known CDK11p58 associations. We found that bands migrating at approximately 70, 55, and 50 kDa were exclusive to immunopreciptation with CDK11p58 protein but were not present in the vector control lanes. The unanticipated results of our proteomics found one heat shock protein, Hsp70, and four different cytoskeletal proteins interact with CDK11p58. Hsp90 has been previously shown to interact with other CDK11 isoforms but this was the first time that CDK11p58 was linked to any chaperone proteins 134
(131). The cytoskeletal proteins that bind CDK11p58 included α-tubulin, β-tubulin, vimentin and lamin A. α-tubulin and β-tubulin are microtubule proteins that were also shown to associate with CDK11p58 in our cells. The role of microtubules during mitosis has been well established and it is evidenced that microtubule proteins are essential to the events from G2 through all mitotic processes (254). Vimentin, an intermediate filament
(IF) that undergoes a phosphorylation-dependent disassembly during mitosis (255), was also identified as a protein that interacts with CDK11p58. Lastly, lamin A was identified to bind with CDK11p58. Lamin A is a nuclear envelope IF that undergoes some significant restructuring as the nuclear envelope dissolves during mitosis and reforms the nuclear lamina in the newly formed daughter cells (256, 257). The highly dynamic nature of the cytoskeleton in normal cells and tumor cells has been under investigation for decades based upon the absolute necessity for the cell structural components in survival, growth, development, differentiation, movement, signaling and virtually any other process of cellular activity. These unique results preliminarily indicate that
CDK11p58 is involved with the structural components of the cell and these ideas are further elaborated on in the following chapter. Future research is ongoing to help understand the complete significance of these interactions in both normal cell growth as well as in the diseased state of cancer.
The studies presented in this chapter help to support the initial research observations that showed that the overexpression of CDK11p58 causes a delayed telophase and abnormal cytokinesis in CHO cells. The ectopic expression of CDK11p58 led to reduced cell growth and that was later determined to be due to increased levels of 135 apoptosis (158). These results have helped to illustrate that CDK11p58 may be involved with eukaryotic chromosomes but the significance of these observations is still under investigation. Recent studies have linked CDK11p58 directly to the centromeres in HeLa cells treated with CDK11 RNAi; the mitotic cells are arrested and displayed reduced levels of γ-tubulin, Plk-1, and Aurora A kinase at the centromeres. Rescue experiments with CDK11p58 showed that it associates with the centromeres itself and that CDK11p58 promotes centrosome maturation and bipolar spindle formation (176). These studies illustrated for the first time that CDK11p58 is involved directly in the movement of the chromosomes during mitosis.
Mitosis is a highly choreographed process that requires a systematic series of events that are tightly regulated within cells to prevent any errors. There are several different checkpoints that are designed to ensure the proper and equal segregation of materials within cells into their identical daughter cells. Deregulation of this process is related to a variety of different disease situations including cancer. Many mitotic specific proteins have been identified and the functions of those proteins are well known (170).
However, there remain many other proteins that have been linked to regulation of mitosis but the mechanisms by which they direct the cell cycle remain unknown. CDK11p58 is one of the latter groups of molecules and our research presented here helps to further elaborate on previous publications to aide in the more complete understanding of the role of CDK11p58 during the process of mitosis.
136
Results
Proteomic analysis of CDK11p58 bound immunoprecipitates yielded many different potential binding partners.
In order to identify potential unknown binding partners of CDK11p58, we transiently transfected A375 melanoma cells with pCMV-myc-CDK11p58 or pCMV-myc control vector. These cells were then lysed and anti-c-myc antibody was used to immunoprecipitate myc-tagged CDK11p58 and any additional proteins that are bound to it. The immunoprecipitates that were run on a SDS PAGE and the total protein was stained using a biosafe stain. Two bands that were visible in the pCMV-myc-CDK11p58 transfected lane but not in the control pCMV-myc lane were located at approximately 50-
60 kDa (figure 26#1, arrows for both bands selected). An additional repeat of this experiment identified an additional band in the pCMV-myc-CDK11p58 transfected lane
(figure 26#2, arrow indicates band selected as well as band is circled in gel with a tag) at approximately 70 kDa. All bands were excised and digested in-gel with trypsin. The samples were then sent through LC-MS/MS and peptides for proteins within those bands were identified. The peptide coverage of each potential protein is detailed in table 7.
Based upon the size of the bands selected for analysis, we anticipated that one of the approximately 50-60 kDa bands would contain the myc-tagged CDK11p58. CDK11p58 peptides were identified in band one with a high degree of protein coverage, (Genbank #
189481). Band 2 contained three different proteins based upon the peptides identified.
β-tubulin peptides had 33.5% coverage (Genbank # 1297274) and α-tubulin (18.2% coverage, Genbank # 2119266), which are microtubule proteins that were both found in 137 band 2. Vimentin, an intermediate filament, was found with the second highest abundance and 28.8% coverage (Genbank # 138535). Band 3 contained two different proteins; Hsp70, a heat shock protein chaperone (10.1% coverage, Genbank # 6729803), and lamin A (6.5% coverage, Genbank # 1072002), a nuclear envelope protein. These data provide the first known direct association of CDK11p58 with any cytoskeletal proteins.
#1 #2 p p p p C C C C M M M M V V V V - - - - p m p m 5 5 y y 8 8 c c 3 1 2
Figure 26. Coomassie stain of c-myc immunoprecipitates of pCMV-myc and pCMV-myc-CDK11p58 transfected lysates. A375 melanoma cells were transfected with vector control pCMV-myc or pCMV-myc-CDK11p58. Cells were harvested 24- hours post-transfection and lysates were immunoprecipitated with anti-c-myc antibody overnight at 4ºC. The immunoprecipitates were run on a 10% SDS PAGE and the gels were stained using Pierce stain. The arrows point to bands that were present in the pCMV-myc-CDK11p58 lane but were absent in the pCMV-myc control lane. These bands were trypsin in-gel digested and were liquid chromatography-mass spectroscopy/mass spectroscopy analysis. Peptides that were identified from each of these bands are listed in table 7. 138
Table 7. Proteins identified from proteomic analysis of CDK11p58 immunoprecipitates.
Band Protein Coverage Function during mitosis
1 CDK11p58 Unknown
2 β-tubulin 33.5% Chromosome orientation/segregation, nuclear organization
2 Vimentin 28.8% Disassembled during mitosis, coupled to reorganization of intracellular membrane
1,2 α-tubulin 18.2% Chromosome orientation/segregation, nuclear organization
3 Hsp70 10.1% Chaperone protein
3 Lamin A 6.5% Nuclear envelope size and shape, chromatin organization
CDK11p58 associates with cytoskeletal proteins.
Based upon the peptides identified via LC-MS/MS analysis, we wanted to verify that these associations do occur. We used immunoprecipitation of lysates transfected with pCMV-myc and pCMV-myc-CDK11p58 to look at the association of the newly identified partners with CDK11p58. We immunoprecipitated myc-tagged CDK11p58 with vimentin (figure 27A). The reverse immunoprecipitation of vimentin found that myc- tagged CDK11p58 can be pulled down by vimentin antibody (figure 27B). These data 139
verify that CDK11p58 can interact with vimentin and the implications of this association
are discussed later.
IP: vimentin IP: mouse IgG A) B) IP: myc p p 5 p 5 8 5 8 p 8 p 5 5 8 8 p p p p p p C C C C C C p p p p M M M M C C M M C C V V M M V V M M V V - - - - V V m m V V - - m m m m - - - - y y y y m m m m y y c WB: myc c c c c c - y y - y WB: vimentiny C - C c c c c C - D D - C D C K K D D K 1 1 K K 1 1 1 1 1 1 1 1 Figure 27. Vimentin immunoprecipitation with CDK11p58. We transiently transfected our cells with pCMV-myc and pCMV-myc-CDK11p58 as done for the proteomic analysis. We were able to immunoprecipitate CDK11p58 with anti-vimentin antibody (A) and the reverse condition of immunoprecipitating vimentin with myc- tagged CDK11p58 verified the association (B). 140
Another set of proteins found in our proteomic analysis were both parts of the microtubule dimers, α- and β-tubulin. We used an α-tubulin antibody to confirm these associations. Although β-tubulin was identified with a high level of protein coverage, it is reasonable to use α-tubulin to help confirm these associations because α- and β-tubulin are clearly defined to dimerize in cells as crucial building blocks of the microtubules. We immunoprecipitated using anti-α-tubulin antibody to pull-down myc-tagged CDK11p58
(figure 28). The association of myc-tagged CDK11p58 with α-tubulin and vimentin are therefore confirmed. Immunoglobulin G (IgG) light and heavy chain molecules
(approximately 55 kDa) migrate to approximately the same position on SDS PAGE gel as
CDK11p58, vimentin, and α-tubulin. Therefore the blots from vimentin and α-tubulin confirmations display bands in the control IgG lanes. However, the experimental results do confirm the immunoprecipitation of vimentin and α-tubulin with CDK11p58 does occur in the pCMV-myc-CDK11p58 transfected lysates but is not present in the pCMV- myc control lanes. 141
IP: α-tubulin IP:mouseIgG 8 8 8 5 5 5 p p p 1 1 1 1 1 1 K K K D D D C C C - - - c c c c c c y y y y y y m m m m m m ------V V V V V V M M M M M M C C C C C C p p p p p p
WB: myc
Figure 28. α-tubulin immunoprecipitation of CDK11p58. Similar to the approach for vimentin in figure 31, we immunoprecipitated CDK11p58 using anti-α-tubulin antibody and western analysis with anti-c-myc antibody. These experiments confirm the association of myc-tagged CDK11p58 with the microtubules.
We also wanted to confirm that lamin A immunoprecipitated with myc-tagged
CDK11p58. Anti-lamin A antibody pulled down myc-tagged CDK11p58 (figure 29A).
Anti-c-myc antibody was able to immunoprecipitate lamin A in the myc-tagged
CDK11p58 lysates but not in the control lysates (figure 29B). Therefore lamin A does associate with myc-tagged CDK11p58. 142
IP: lamin A IP: mouse IgG IP: myc A) B) p p 5 p 5 5 8 8 p 8 p 5 5 8 8 p p p p p p C C C C C C p p p p M M M M C C M M C C V V M M V V M M V V V V V V ------m m m m m m
WB: myc - - - - y y y y m m m m y y
c WB: lamin A c c c c c y y y y - - c c c c C - C C - D - D C D C K K D D K 1 1 K K 1 1 1 1 1 1 p58 1 Figure 29. Lamin A immunoprecipitates with myc-tagged1 CDK11 . Following the protocol for figures 31 and 32, we immunoprecipitated lamin A with CDK11p58. (A) Anti-lamin A antibody immunoprecipitated myc-tagged CDK11p58. (B) Anti-c- myc antibody immunoprecipitated lamin A with CDK11p58.
CDK11p58 associates with Hsp70.
The final immunoprecipitation and western analysis performed to confirm the novel proteomic findings showed that Hsp70 proteins also associate with CDK11p58 in our cells (figure 30). 143
IP: myc 8 8 5 5 p p 1 1 1 1 K K D D C C - - c c c c y y y y m m m m - - - - V V V V M M M M C C C C p p p p
WB: Hsp70
Figure 30. Hsp70 proteins associate with myc-tagged CDK11p58. We confirmed the association of Hsp70 with myc-tagged CDK11p58 by immunoprecipitating with anti-c-myc antibody and western analysis with anti-Hsp70 antibody. This direction of immunoprecipitation reduces the ability for the IgG band to interfere with results and it clearly demonstrates a binding of Hsp70 to CDK11p58 in our system.
These results combined confirm the peptide results acquired from the LC-MS/MS analysis. CDK11p58 proteins do associate with crucial cytoskeletal proteins that are directly involved in manipulation of mitosis. Initial experiments to ensure that these associations occur with endogenous protein levels have been performed but the results are not completed. Further experimentation will follow along these lines to ensure the association can occur with more physiologically relevant levels of protein expression as discussed below. 144
Discussion
Research in the area of CDK11p58 has been accumulating at an increasing rate in recent years; however a thorough understanding of its function is still to be determined.
Our results provide an initial look into the possibility that CDK11p58 may be directly linked to the cytoskeleton. These data show that CDK11p58 interacts with vimentin, α- tubulin, β-tubulin and lamin A. The potential impact of these observations may be significant to the understanding of CDK11p58 activity. Since CDK11p58 is a kinase, it is reasonable to assume that these cytoskeletal proteins may be substrates. Vimentin, lamin
A and microtubules activities have been directly shown to be affected by their levels of phosphorylation or the phosphorylation of their associated proteins, specifically during mitosis (254-258).
There is some previously published experimental evidence that helps to corroborate the data presented in this chapter. CDK11p58 protein levels are specifically regulated during the highly ordered cell division process and this belays an essential role to the progression of cells through G2/M (158, 159). These data presented indicate that
CDK11p58 interacts with both molecules that comprise the microtubule dimers, α-tubulin and β-tubulin, which are the building blocks of microtubules within cells. Initial studies of CDK11p58 showed that aberrant levels of this protein in cells result in delayed telophase and increased levels of tubulin midbodies (158). A series of experiments that strongly supports the evidence presented in this paper was recently published. In these studies, the researchers were able to characterize a necessary role of CDK11p58 in centrosome maturation and during bipolar spindle morphogenesis. Additionally, the 145 absence of CDK11p58 in cells leads to mitotic cell arrest because of defective microtubule nucleation (176). These data robustly maintain a possible function of CDK11p58 in modulation of microtubule positioning during the cell cycle and specifically during mitosis. One interesting point of notice involves another CDK11 protein, CDK11p46, which is a C-terminal specific protein that is generated during apoptosis from either full- length CDK11p110 or from CDK11p58 due to caspase cleavage. CDK11p46 interacts with
RanBPM, a centrosomal protein that has been shown to cause ectopic microtubule nucleation (130, 259). Since CDK11p46 contains the same kinase domain and is only a shortened version of the CDK11p58 molecule, it is reasonable to assume that these molecules may associate with the same molecules. This provides a link from a previously established interaction between CDK11p46 and RanBPM and the newly identified associations of CDK11p58 with microtubule proteins. The role of these associations within cells still needs to be determined but the preliminary findings can be interrelated to previously identified activities of CDK11p58.
In addition to chromosomal segregation properties, microtubules play important roles in the nuclear envelope breakdown during mitosis. This occurs in a stepwise fashion following lamina disassembly leading to microtubule-drive deformation of the nuclear membrane (260). The three major cytoskeletal protein networks are the actin, microtubule and intermediate filament networks. The association of these protein networks with each other helps to facilitate the essential dynamics of the cytoskeleton during every cellular process including cell movement, division, and signaling (258, 261-
264). CDK11p58 proteins associate not only with microtubules but also lamin A, type V 146
IFs, and vimentin, type III IFs. The dynamics of these relationships is discussed in greater detail in the following chapter. The key aspect of CDK11p58 is the central role that it plays in several different cytoskeletal activities.
These findings present for the first time a connection of the mitotic regulatory protein CDK11p58 to proteins that are fundamental components of the cell cytoskeleton.
Additionally, Hsp70, a well-characterized stabilizing chaperone protein, was found to associate with CDK11p58. In the studies performed with CDK11 and Hsp90 it was proven that Hsp90 is important to the maintenance and stabilization of multiple CDK11 isoforms
(131). Hsp70 plays an essential role in mitosis by localizing to and stabilizing the fibres of spindles and asters in metaphase in an ATP-dependent manner (265). It is also found at the centrosomes of dividing HeLa cells (266). Loss of Hsp70 and Hsp40 chaperone activity has been found to cause abnormal nuclear distribution and aberrant microtubule formation in M-phase S. cerevisiae (267). Hsp70 is a protector of mitosis and is an essential component to proper chromosomal division in part due to the many associations it has with microtubules and with the chromosomes themselves. Hsp70 protects the cells from heat-induced centrosome damage and prevents division abnormalities in hamster lung fibroblasts (268). Hsp70 can also promoter cancer cell growth because knockdown experiments showed that survival of tumorigenic and nontumorigenic cells was dependent upon the presence of Hsp70 (269). Members of the heat shock protein family are linked to virtually every type of protein known and therefore the significance of these findings may be variable, however Hsp70 likely plays a similar role to Hsp90 in its 147 interactions with the CDK11 family of proteins and also combines with Hsp70 proteins essential role in correct cell division.
We hypothesize that CDK11p58 manipulates the process of mitosis by phosphorylating proteins that comprise the cytoskeleton and are involved in the correct separation of cells during mitosis and to ensure that the proper chromosomes are divided
(figure 31). Supplementary research to determine the nature of these theories is necessary to help determine functionally how CDK11p58 proteins are able to exert their effects on the cell cycle.
This research was supported by NIH CA 70145 and Cancer Biology Training
Grant T32CA09213. 148
N-terminal C-terminal
Poly-E Kinasedomain
AUG
G2/M phase
DDX15 Hsp70 Cyclin L CDK11p58 ? Ribosome biogenesis Spindle pole body Cyclin D3
Lamin A HBO1 Vimentin
α-tubulin Spindle morphogenesis β-tubulin Histone modification Cytoskeletal manipulation Microtubule dynamics Nuclear envelope Cell separation formation/dissolution Chromosome sorting
Figure 31. Diagram of CDK11p58 potential activity and findings. This diagram illustrates the many different aspects of CDK11p58 that have been identified and are p58 outlined here within. CDK11 is generated during G2/M from an IRES and contains the catalytic kinase domain. Previous publications found it interacted with cyclin D3 but the discussion within supports to possibility that this is not the only cyclin partner and cyclin L proteins may also interact (as denoted by the question mark). HBO1 activity is modulated by CDK11p58 and this affects histones and chromosomal material. Spindle bipole morphogenesis is regulated by CDK11p58 providing evidence that the separation of chromosomes may be regulated by CDK11p58. This was further confirmed with α- and β-tubulin association in addition to vimentin and lamin A intermediate filaments. The majority of the experiments detailed within found that DDX15, a RNA- dependent RNA helicase involved in splicing and ribosome biogenesis interacts with CDK11p58 and modulates cell cycle progression potentially through translation and/or hypothesized roles in the spindle pole body. 149
VI. CONCLUDING DISCUSSION
The complex nature of the CDK11 molecule and its various isoforms has prompted much research to date. CDK11 studies have revolutionized the way that the
CDK family of proteins is thought of. From the genome location of the Cdc2L genes to the activities in RNA processing, apoptosis, and the cell cycle, CDK11 remains a unique molecule that plays a role in disease physiology in several tumor types, especially melanomas (49). The ideas and studies presented here provide a novel insight into how
CDK11 is regulated at the level of gene expression and how CDK11 molecules affect the processes of apoptosis and the cell cycle. More significantly, the implications of these findings in relation to cancer are discussed more thoroughly below.
Initially, CDK11 gene expression was hypothesized to be significant because of the gene duplication that occurred on chromosome 1 band region 36.3, which was a well defined area of alteration in tumors (33, 40, 41, 43, 52, 188, 270, 271). The fact that
CDK11 genes are nearly identical and lie inverted side by side with virtually indistinguishable 5’ promoter regions has prompted several questions including: why do cells need two separate genes for CDK11 and do cells utilize the Cdc2L1 gene promoter preferentially to the Cdc2L2 promoter? Only the human and chicken homologs of
CDK11 have multiple copies but the remaining homologs are only produced from a single gene copy in other species (49). In order to help answer these questions, it is important to first evaluate the mechanism of Cdc2L gene expression. The data presented in chapter three showed that Cdc2L1 is expressed by associations of Ets-1 and Skn-1 150 transcription factors on the basal promoter region (59). This is different from the Cdc2L2 promoter, which is regulated by Ets-1, CREB, and TCF11/Nrf2 (60). The variation of transcription factors that bind to either the Cdc2L1 or Cdc2L2 promoter verify that these genes are differentially regulated.
Yet these observations are highly preliminary in understanding how CDK11 transcription from two separate gene promoters affects their cellular activities. Full- length CDK11 transcripts are ubiquitously expressed throughout the body and this likely occurs from both Cdc2L genes (49, 52). There is some evidence that shows variable expression of CDK11 genes depending upon stages of development within specific tissues including the testis, and during certain cellular processes, like apoptosis where
CDK11 gene transcripts are upregulated (89, 92). Whether the variations in transcription factors binding to the different promoters are essential to regulation of CDK11 transcripts and subsequently the expression of certain protein product during development or apoptosis has yet to be determined. It can be hypothesized that the upstream molecules involved in transcription factor regulation may be involved in the fine-tuned expression of either Cdc2L1 or Cdc2L2 gene transcripts. It is possible that cells manipulate the different transcription factors responsible for Cdc2L basal transcription in order to specify which CDK11 proteins are needed for certain cellular processes.
As mentioned previously, the Ets family of transcription factors regulates gene expression leading to a variety of different cellular functions including growth, apoptosis, development, differentiation and oncogenesis (197-199). Although Ets-1 is commonly associated with its role in promoting angiogenesis, Ets-1 overexpression has also been 151 shown to promote apoptosis in HUVEC cells under serum deprived conditions (200,
201). A recent publication found that caspase-1 is a direct target gene of Ets-1 and plays a role in Ets-1-induced apoptosis in colon carcinoma cells and xenograft mouse models
(272). In embryonic stem cells undergoing UV-induced apoptosis, Ets-1 is essential for p53 transcriptional activity (203). Ets-1 can interact with multiple transcriptional proteins to increase their associations with DNA to further regulate gene expression, including CREB-binding protein/p300 (CBP/p300) and CREB itself (202, 210, 273).
These studies show that Ets-1, the common factor in the regulation of both Cdc2L genes, has multiple roles dependent upon the cellular context but clearly is involved in the transcription of genes involved in apoptosis, by direct association with oncogenes or tumor suppressor genes or by Ets-1 protein complexes.
The regulation of Ets-1 activity is dependent upon its phosphorylation status that has been mitigated by the Ras/MAPK/ERK1/2 pathways making Ets-1 a downstream target (274-276). Skn-1, the other transcriptional regulator of Cdc2L1, activity has also recently been shown to be regulated by the p38 MAPK pathway in C. elegans (277).
Since both Ets-1 and Skn-1 modulate Cdc2L gene transcription, it is important to understand what is upstream of their activity (59). These studies indicate that Cdc2L1 and Cdc2L2 are both regulated by the MAPK/ERK1/2 pathway, Cdc2L1 potentially more so. This provides the first conjecture regarding upstream regulation of CDK11 expression beyond the level of basal transcription. The triggers of the MAPK/ERK1/2 pathway are vast and determination of how that directly affects CDK11 gene expression requires a significant amount of additional research (14, 15, 278). 152
To confirm the role of the MAPK/ERK1/2 pathway in Cdc2L gene regulation during tumorigenesis, HaCaT cells that are immortalized but nontumorigenic human keratinocytes could be used to help provide a skin tumor model (279). Previous investigations have found that cellular Harvey-ras (c-H-ras), the upstream activator of the
MAPK/ERK1/2 signaling pathway, transfected HaCaT cells had increased levels of benign and malignant cell transformation. Expression of the c-H-ras oncogene in these human epithelial cells significantly altered growth regulation, resulting in varying degrees of growth potential in vivo, ranging from benign to malignant tumors (279). As a model for skin tumorigenesis, these cells could be used compared with wild type HaCaT cells as a measure of the effects of the MAPK/ERK1/2 signaling on the level of Cdc2L transcription using the luciferase tagged constructs for a measure of expression levels.
Similarly, the activation of the MAPK/ERK1/2 signaling pathway can be performed using EGF ligand and various drugs (14, 280-283). Since this is pathway of common deregulation at the site of B-raf in human melanomas, we could use melanoma cells that either have a B-raf mutation or are more susceptible to MAPK activation and measure the effects on Cdc2L transcription within those cells. Since MAPK/ERK1/2 signaling is an upstream modulator of Cdc2L transcription, activation of this pathway will in turn regulate the level of Cdc2L transcripts produced.
A mouse model with activated H-ras activated and dominant negative p53 had reduced levels of Cdc2L2 compared to wildtype mice in skin carcinomas induced by benzo(a)pyrene (BaP) (284). These studies provide the first initial proof that the level of
Cdc2L gene expression is affected by the status of H-ras within cells. We hypothesize 153 that H-ras regulates Cdc2L transcription during skin tumorigenesis. Another series of experiments to support this hypothesis are ongoing in our laboratory. Previous reports found that homozygous Cdc2L gene knockout mice are embryonic lethal and display proliferative defects and undergo mitotic arrest. Yet the heterzygotes (Cdc2L+/-) are able to proliferate and develop normally (63). These studies verify an essential role for
CDK11 during developments and the absence of Cdc2L transcripts makes mouse embryos unable to survive. Other studies have shown that loss of CDK11 expression by
RNAi attenuates apoptosis (125, 132). Since abnormalities to CDK11 genes are common in melanomas and many other cancers, the relative expression of CDK11 may be significant to tumorigenesis (33, 41, 45). Our laboratory has generated a ‘gene-trapped’ mouse model that inserted the β-Geo gene into the splice acceptor site of intron 12 in the murine Cdc2L gene allowing for a transcriptional fusion that disrupts the normal message. Using this Cdc2L gene trap (Cdc2LGT) mouse model, our laboratory has induced skin tumors using a treatment with the carcinogen di-methyl-benzanthracene
(DMBA) followed by application of the phorbole ester (TPA) causing ras-dependent formation of papillomas that in part progress into squamous cell carcinomas (SCCs)
(285). Nearly twice as many tumors were formed in the Cdc2LGT mice compared to
Cdc2L+/+ wild type mice. The tumors formed in the both the Cdc2L+/+ and the Cdc2LGT mice displayed reduced levels of Cdc2L transcripts and protein and displayed mutations in H-ras (manuscript in preparation). Cdc2L gene expression is reduced in several types of tumors, including melanomas, and more recently evidence by our findings with skin carcinomas. The significance of Cdc2L reductions in cancers compared to normal tissues 154 displays that CDK11 plays an important role as a possible tumor suppressor gene that may exert its effects in part due to haploinsufficiency. These studies support the hypothesis that H-ras modulates the expression of Cdc2L genes and this is a key process during skin tumorigenesis.
The regulation of Cdc2L expression in tumors may also be affect by the other transcription factors involved in the basic transactivation of Cdc2L genes include CREB and TCF11/Nfr2 in Cdc2L2 regulation and possibly E2F-1 on Cdc2L1 (59, 60). How the variations in these different protein associations with CDK11 DNA affect CDK11 proteins remains unclear. One interesting observation regarding the activity of CREB during the regulation of Cdc2L2 but not Cdc2L1 involves its activity during apoptosis
(60). CREB is a cofactor of p53 transactivation of many genes during apoptosis and this has been found invaluable to p53 activity during its critical role in many cell processes including the cell cycle and DNA damage detection during apoptosis. It helps to provide a finely specific response to the many different upstream signals that p53 receives (21,
286). One paper treated human hepatocellular carcinomas with different agents to induce apoptosis and it was found that different agents have different levels of apoptosis when
CDK11p58 protein was added into cells. Treatment with cycloheximide, a known translation inhibitor, and serum deprivation were able to further increase the levels of apoptosis when CDK11p58 was overexpressed. However, the DNA damaging etoposide induced apoptosis was blocked by the expression of CDK11p58, illustrating for the first time a potentially protective role for CDK11p58 expression within cells (287). Since these studies used different means of inducing apoptosis that operated through different 155 apoptotic pathways, this may indicate that the expression CDK11p58 may regulate, process and function differently in response to alternative stimuli. The activity of CREB- p53 on the Cdc2L2 promoter may be the key way that Cdc2L genes are differentially regulated during apoptosis. The dominant negative p53 and activated H-ras mouse model had decreased transcript levels of Cdc2L2 indicating that Cdc2L2 expression is disrupted by the loss of wild type p53 function and during tumorigenesis these processes may be deregulated (284).
The cell cycle specific production of CDK11p58 occurs through IRES site mediated translation from both Cdc2L transcripts (52, 158, 159). During mitosis the production of protein by cap-dependent translation is greatly reduced and the level of
IRES translation increases (248). Genes that have IRES sites often produce proteins during mitosis that are then linked back to specific roles in the regulation of the cell cycle
(173). Turning off cap-dependent translation is a process that still remains highly unknown (248, 288). Evidence to show that Cdc2L1 is selectively chosen over Cdc2L2 does not exist. It is possible however that certain CDK11p58 proteins would be more efficient in their roles during the cell cycle and since the translation of different CDK11 transcripts has been shown to yield up to a 16 amino acid variants, this is a likely event
(49). One interesting observation that provides a cell cycle mediated transcription involves E2F-1 repression activities on the B-myb promoter. B-myb transcription is repressed during G0/early G1 because of E2F-1 binding to the promoter in concert with a contiguous corepressor element similar to CHR (158, 289, 290). This line of evidence supports the possibility that binding of E2F-1 is dependent on the cell process that is 156 occurring and that it may serve a regulatory role on Cdc2L1 transcription. However, the cell cycle dependent activity of E2F-1 repression is unknown but at least some previous studies have shown E2F-1 can transactivate or repress during discrete phases of the cell cycle. Other observations about CDK11 regulation involves CK2, which interacts with
CDK11p110 and facilitates its phosphorylation of RNA processing factors (101, 109).
CK2 proteins interact with other proteins to mediate cell cycle regulatory events including G1 and G2/M phase transitions. eIF5 is phosphorylated by CK2 and this potentiates cell cycle progression (291, 292). CK2 also phosphorylates La autoantigen and regulates it RNA processing capacity (293). La autoantigen may also have a role in ribosome assembly at IRES sites to facilitated translation initiation, as is evidenced by the ability for it to influence Hepatitis C virus IRES mediated translation (241). CDK11p58 modifies DDX15 and this may alter its binding to the La protein may help to assemble the ribosome at IRES sites within certain genes, such as the Cdc2L genes, and facilitate the ability of those IRES sites to initiate translation (239). In order to test the activities of
CREB, E2F-1 and CK2-La autoantigen on the different Cdc2L promoter regions during either apoptosis or during the cell cycle, similar to previous studies, the use of reporter constructs in conjunction with apoptosis inducing stimuli or cell cycle synchronization could verify these possible regulatory events.
Other DExD/H proteins have been identified as nucleation/bridging factors in transcription complexes, such as DDX5 (p68) (294). DDX5 was shown to interact with the transcriptional coactivators CBP/p300 stimulating transcriptional activation (295).
DDX5 is also a novel transcriptional coactivator of the p53 tumor suppressor (245, 294). 157
Although, DDX15 has not previously been identified to bind with any transcription factors, the possibility that it does, has not been ruled out. This could provide a potential positive feedback loop of regulation from the CDK11 protein level to transcriptionally activate a specific Cdc2L gene. These multiple theories provide several lines of future research to help understand the significance of the differential regulation of Cdc2L1 from
Cdc2L2. The possibility that certain CDK11 transcripts are produced in a cell cycle or apoptotic specific manner helps to support the functional value in having multiple copies of the same gene within the human genome. Since these transcripts and their relative levels within cells are not identical due to differential promotion and alternative splicing, the activity of CDK11 proteins translated from the different CDK11 transcripts is likely important (49, 296).
During mitosis the nucleolus, the site of nuclear assembly of rRNA and ribosome components, is compartmentalized and components are stored inactive until reassembly after mitosis leads to the resumption of translation initiation (297, 298). CDKs govern the formation and maintenance of the nucleolus. During mitosis exit CDK1-cyclin B inhibition sufficiently induces the first event of nucleogenesis by allowing transcription of rRNA to occur and the pre-rRNA is preserved by CKI activity until interphase when the assembly of the ribosome is resumed (299). When cells are commited to apoptosis, a remarkable inhibition of the rate of overall protein synthesis is observed in a variety of cell types (148, 300). A ribosome biogenesis related protein, protein B23 also binds to the centrosome during early prometaphase and is phosphorylated by CDK2/cyclin E and
Plk-1 in order to duplicate the centrosomes (301). This is one example of a protein with 158 multiple roles in both ribosome biogenesis and centrosomes during mitosis, similar to the proposed activities of CDK11p58 and DDX15. The studies present herein may provide insight into the mechanisms by which translation is regulated during mitosis and may help to understand how ribosome biogenesis, a process that is also reduced during mitosis, is regulated based upon the association between CDK11p58 and DDX15. The regulation of protein synthesis is an essential cellular function that when deregulated can lead to malignant transformation (145-148).
Gene regulation of CDK11 alone does not provide for the high variability of the different CDK11 isoforms functions. The larger CDK11 isoform, CDK11p110 is essential to RNA transcription and splicing and also provides the cleavage sites for the smaller
CDK11p60 and CDK11p46 proteins that are crucial to apoptosis (49, 92, 125). CDK11p58 proteins are unique to the other isoforms of CDK11 because of their activity in
p58 modulation of the cell cycle at G2/M (158). Although, CDK11 activity is more in line with the other classical CDK family members (CDK1-4, 6), it is only one of many functions for the CDK11 proteins (49). The presence of CDK11p58 during mitosis is apparent but the actual mechanism of its activity on the cell cycle is only beginning to be determined. The activity of CDK11p58 during mitosis is in part due to the activity of
DDX15 proteins. CDK11p58 interacts and potentially regulates DDX15 activity, a member of the DExD/H family of RNA helicases that has proven roles in splicing and ribosome biogenesis (226, 227). Other DEAD-box RNA helicases have activities in cell- shape changes, including one Drosophila protein, Abstrakt, that is the ortholog of human
DDX41. Abstrakt plays a role in cell-shape changes including ensuring proper cell 159 polarity and spindle orientation (302, 303). The yeast DDX15 protein, Prp43, associates with SPC42, a yeast core spindle pole binding (SPB) protein (304). SPC42 is modulated by phosphorylation from MPS1, a kinase that regulates spindle pole assembly in yeast
(305). Analysis of SPC42 revealed that regulation of SPB duplication is modulated by
CDKs at multiple levels: CDK1 directly phosphorylates SPC42 to promote its assembly into the duplicating SPB, CDK1 indirectly regulates the phosphorylation state of SPC42 through its role in stabilizing the MPS1 kinase and CDK1 control of a transcription factor restricts SPC42 expression to G1 phase of the cell cycle (306-308). The importance of cell cycle regulated expression and phosphorylation of SPC42 on the timing of SPB duplication and mitotic spindle assembly is unknown. In addition to SPC42, CDK1 phosphorylates a number of other SPB components but CDK1 and MPS1 are not the only possible kinases that could phosphorylate SPB components and regulate SPB duplication, which leave the possibility that CDK11p58 could be another factor in this regulation based upon its kinase activity (306, 307).
The association of yeast Prp43 with SPC42 and its interaction with MPS1 implicates that CDK11p58 may all be a part of a complex of proteins in the SPB. The ultrastructure of the SPB is clearly different from the centrosome because centrioles are not present and the SPB is inserted into the nuclear envelope during mitosis (306).
SPC42 is a component of the outer plaque and it binds to other proteins within the SPB linking them to the cytoplasm. SPC42 links the SPB to where the astral microtubules nucleate from γ-tubulin (306). Lamin A is an intermediate filament that is located within the nuclear envelope and the association of CDK11p58 with both DDX15 and lamin A 160 may comprise another component of the SPB activity during mitosis (258). Previous evidence also found that in cells without CDK11p58, γ-tubulin, Plk-1, and Aurora kinase are reduced at the centrosomes (309, 310). γ-tubulin is the microtubule nucleation center where the α- and β-tubulin dimers originate from to form microtubule chains (309, 310).
α- and β-tubulin were identified to bind with CDK11p58 proteins. Microtubules arising from the SPB are responsible for correct alignment and separation of chromosomes during mitosis and cytokinesis. Plk-1 is involved in mitotic entry, spindle formation and cytokinesis (170). Plk-1 overexpression is seen in primary colorectal tumors because cells need Plk-1 to proliferate (311). Aurora-A kinases activity is amplified in tumors leading to a highly dynamic association with the centrosome and mitotic spindle (168,
169). These different associations help to regulate how cells get the right chromosomes during cell division and deregulation of these events occurs often in cancers (22, 165,
166, 309). The essential choreography of these events is necessary to ensure that cells are properly divided and CDK11p58 proteins are definitively involved in these activities
(166, 176). The cell cycle checkpoints are in place in order to ensure that cells divide properly and deregulation of these checkpoints is seen often in tumors because this allows for cell cycle passage under conditions that would normally be nonpermissive (22,
165). The chromosomal changes that enable tumorigenesis are due in part to incorrect separation of the genetic material and often leads to aneuploidy within tumor cells that predispose them to a growth advantage (22, 38, 165, 166). Further studies to determine how these associations modulate chromosome segregation will involve investigating the
CDK11p58 dependent phosphorylation of these molecules and the downstream 161 modulation of those events. Seeing as previous evidence links CDK11p58 with an essential role in bipolar spindle assembly and centrosome maturation, the mechanism of
CDK11p58 regulation of mitosis may be its crucial role in chromosomal segregation
(176).
The loss of CDK11p58 due to aberrations of chromosome 1p36.3 in tumors may allow release of cells through mitosis prior to the correct assembly of the SPB and therefore may enable changes to the genetic material that confer an increased ability to grow and survive beyond the normal cell physiology (33, 41). In addition to loss of
CDK11p58 in cancer, we have presented some initial evidence that DDX15 expression levels are reduced in most of the tumors analyzed in the cancer-profiling array described above. The phosphorylation status and expression of other DDX proteins have been found important to cell growth and proliferation and the relative levels are specifically regulated during normal cell physiology (220, 221, 224). Deregulation of DEAD-box protein phosphorylation or expression profile is implicated in carcinogenesis (221). Gain of phosphorylation at certain residues within the DEAD box p68 protein were seen in all tested cancer cells but not in the normal cells and tissues, including lung, liver, breast cancers and more (312). Downregulation of DDX3 in hepatocellular carcinomas that are hepatitis B virus positive is associated with pathogenesis (252). Since the signaling control of translation from the level of ribosome biogenesis to mRNA decay is mediated by several tumor suppressor genes and oncogenes, the ribosome may in essence
“translate” to cancer (313). 162
Based upon the observations of DDX15 activities during the cell cycle and its reduction in cancers compared to normal tissues, it is apparent that DDX15 plays a significant role in tumorigenesis that may be completely exempt of its previously identified functions. We hypothesize that CDK11p58 phosphorylates DDX15 and modulates its association with SPC42 that in turn alters the ability of SPC42 to perform its activities in SPB formation during mitosis. When CDK11p58 and DDX15 are lost in tumors, this deregulates SPB formation during mitosis allowing improper cell division to occur. When the SPB is misformed this will allow chromosomes to segregate unevenly and this in turn leads to genomic instability within the tumor cells allowing for further tumor progression (figure 32). Experiments to test this hypothesis could include the use of tandem affinity purification (TAP) expression system to verify the protein-protein complex formation between CDK11p58-DDX15 and SPC42 in nontumorigenic cells undergoing mitosis. The association with other SPB proteins would also help to confirm this complex. Then further use of RNAi techniques for both DDX15 and SPC42 would help to verify that loss of these proteins impacts SPB formation and potential cellular transformation. These experiments are preliminary to testing our hypothesis but would provide the framework for validating the role of DDX15 in cancers that does not involve the previously known activities during splicing and ribosome biogenesis. It is possible that DDX15 exerts its effects during mitosis completely exempts of its RNA associations and that deregulation of DDX15 expression in tumors allows for cells to bypass mitotic checkpoints allowing for cells to cycle through cell division prematurely.
163
Nuclear Envelope
Lamin A SPC42 MTOC SPB γ-tubulin Hsp70 CDK11p58 DDX15 P α-tubulin
β-tubulin Vimentin
Cell Division
Chromosome Separation
Figure 32. Proposed role of CDK11p58 as a scaffolding protein that modulates cell division and chromosome separation. CDK11p58 is central in bridging the activities of the spindle pole body (SPB) with the microtubule organizing center (MTOC) that occur near the nuclear envelope. CDK11p58 associates with Hsp70, α- and β-tubulins, vimentin, lamin A, and DDX15. DDX15 further associates with SPC42 and this regulates the SPB formation in mitotic cells. CDK11p58 interactions facilitate correct cell division and are important to ensuring chromosomal segregation is properly done. 164
The final set of investigations discussed in the previous chapter illustrated that
CDK11p58 interacts with cytoskeletal proteins in a fashion that may manipulate the ability of the cells to divide and chromosomes to separate (figure 32). Hsp70 the only non- cytoskeletal protein has previously been found to have essential interactions with microtubules and centrosomes (314, 315). This chaperone protein has roles not only in protein stabilization and folding but also in alignment of the chromosomes during metaphase and also proper cell division (265, 266). Therefore, the findings from the previous chapter all relate in part to the regulation of cytoskeletal organization with key roles in mitosis and cytokinesis. Microtubules are comprised of α- and β-tubulin dimers that arise from γ-tubulin nucleation. Both α- and β-tubulin were found to associate with
CDK11p58 and α-tubulin was additionally verified (261). The role of microtubules during cell division has been well characterized and previously discussed. These findings illustrate that CDK11p58 interacts with the microtubules and this may be a factor in its abilities to direct cellular movement during mitosis. There are several proteins that have been found to associate with microtubules and direct their activities, some of which can modulate the dynamics by post-translational modifications (316). CDK11p58 may interact with the microtubules in an effort to direct their activities and possibly their polymerization (261). When CDK11p58 protein is lost in cancers, the organization of the microtubules may become deregulated during mitosis allowing for altered cell separation and altered centrosome directed chromosome alignment. 165
Lamin A and vimentin were also shown in bind with CDK11p58 and these interactions carry great significance to understanding the activity of CDK11p58 during mitosis. The A-type lamins include lamin A and lamin C that are products of the same gene from alternative splicing. B-type lamins are key components of the nuclear lamina and are found around the periphery of the chromosomes throughout mitosis (256, 262).
The lamin B receptor (LBR) is critically phosphorylated during mitosis to facilitate the networking of the lamin meshwork within cells to dictate nuclear lamina disassembly during mitosis (317). The LBR is a docking station for chromatin at the nuclear envelope in interphase cells and is important to correct DNA replication during S phase (318).
Lamin A assembly is dictated by post-translational isoprenylation of a conserved cysteine residue in the C-terminus that may also dictate its location within cells. Lamin A is located near the nuclear envelope components near the spindle pole body during initial phases of mitosis and is present at the chromosomes during cytokinesis (306). The dynamic nature of lamins helps to facilitate the structure and organization of the nuclear components during mitotic breakdown and G1 reassembly (256-258). Whether
CDK11p58 can affect lamin A distribution and activity during the cell cycle remains unknown. It is clear that the lamin proteins comprise one component of the IF network in cells that work in conjunction with the other cytoskeletal networks to facilitate cellular processes. It is possible that CDK11p58 may associate and phosphorylate lamin A or one of the lamin associated proteins and facilitate their activities and organization. The underlying characteristics of the nuclear lamins are their highly interactive nature with 166 other proteins in the nucleus during normal cell growth and their specific activities during cell division.
Vimentin is similar to lamin A in the aspect that is comprises a part of the IF network that is highly dynamic during cell division and is reorganized significantly during mitosis (263, 319). There exists a significant relationship between mitosis- specific vimentin-associated vesicles and the nuclear lamina (320, 321). The phosphorylation of vimentin by PKC specifically during mitosis is a precursor in the reorganization of the nuclear envelope (319, 322). Vimentin is disassembled during mitosis in a nestin dependent manner based upon specific phosphorylation events at ser-
55 (255). The dynamics of the vimentin networks are unique but they are found to be highly similar to and highly integrated with the other cytoskeletal systems including other
IF networks like the nuclear envelope and microtubules (261, 323, 324). CDK11p58 uniquely associates with four different cytoskeletal proteins, not the least of which is vimentin. Cell division and cell migration are crucially regulated by the activities of the cell cytoskeleton. The regulation of cytoskeletal protein dynamics occurs via several different means including protein associations and phosphorylation events (319). Crucial not only to normal cell physiology, the cytoskeleton is also essential to disease physiology and plays an essential role in the capacity for a normal cell to become tumorigenic. Changes to the levels of vimentin and lamin networks have been strongly correlated to cancer profiles because of the essential roles that they play in growth and remodeling during cell division and cell movement (262, 325, 326). The cytoskeleton is so integral to every cellular process but none more than cell movement. As tumors 167 become metastatic they undergo several changes including the increased capacity for cell motility and invasion (9). The role of CDK11p58 has expanded to include the knowledge that several crucial regulators of cell division and subsequently tumorigenic phenotypes are associated with CDK11p58. We hypothesize that CDK11p58 is a scaffolding protein that bridges the microtubules and IF proteins to the SPB during cell division and that when CDK11p58 is lost in cancers the cells undergo altered cell division (figure 32).
Future studies of CDK11p58 should encompass this vast area of research to understand how CDK11p58 can impact cytoskeletal reorganization during mitosis and during tumorigenesis. In order to assess the direct role of CDK11p58 in modulating the cytoskeletal interactions during mitosis, several different experimental models could be employed. Loss of CDK11 proteins alters spindle bipole morphogenesis in HeLa cells ad this model could be employed to assay the effects on microtubule organization as well as the bridge between the nuclear envelope and the SPB during mitosis. Microtubule polymerization/depolymerization is manipulated using several different drugs including taxol, an anti-cancer drug that stabilizes microtubules, colchicine that blocks polymerization, and vinblastine and nocodazole that block microtubule depolymerization.
These are used to treat cancers because of their abilities to block cellular proliferation
(327, 328). These drugs can also be used as control conditions to ensure that CDK11p58 activities directly alter microtubule movements during mitosis. Using CDK11 negative cells to measure the mitotic errors in segregation could also assess the ability for Cdc2L deficient tumors to overcome mitotic checkpoints. Overcoming the reduced levels of
CDK11p58 in CDK11 deficient cells with either recombinant protein or transfection 168 techniques could be done to measure the levels of genomic instability. Karyotyping of tumor chromosomes in cells with and without CDK11p58 could help to determine if increased genomic changes occur in CDK11p58-null cells that no longer have the regulation of the cytoskeletal components.
It is possible that all the factors identified herein are related to the previously known activities of CDK11p58 in mitosis and that reduced CDK11p58 expression in tumors causes a disruption of these activities. DDX15 is a RNA-dependent RNA helicase that is essential to ribosome biogenesis and splicing and more importantly may be a functional component of the spindle pole body during mitosis (226, 304). DDX15 expression is decreased in several tumors indicating loss of this protein is advantageous for cancer cell division. Hsp70 proteins are chaperone protein that involved in mitosis by stabilizing mitotic protein and microtubules (268). α- and β-tubulins are microtubule proteins that are a highly integral part of cell division and chromosomal segregation (261). Lamin A is a component of the nuclear envelope that is associated with the spindle pole body. Lamin
A undergos remodeling during mitosis as the nuclear envelope is broken down and reassembled (258). Lastly, vimentin is an IF that is a phosphorylated during mitosis, which leads to restructuring of the IF network in cells (263). The significance of all these findings is great due to the fact that they provide an initial understanding of CDK11p58 as a scaffolding protein between many different cellular processes. The loss of CDK11p58 in tumors impacts many different pathways and processes within cells. There are several areas where this research can progress further and the various experiments involved will lead to a great understanding of the highly integrated networks of CDK11 regulation and 169 function. Originally, studies of CDK11p58 were merely observation based but these experiments help to provide a mechanistic outlook on CDK11p58 activity during the cell cycle and during tumorigenesis. 170
APPENDIX A. PUBLISHED MANUSCRIPTS AND ABSTRACTS
Manuscripts
Kahle A, Shi J, Drabkin H, and Nelson MA. Cyclin Dependent Kinase 11p58 p58 (CDK11 ) associates with RNA-dependent RNA helicase, DDX15, during G2/M. In preparation, submission anticipated 2006.
Kahle A and Nelson MA. Review: Cyclin Dependent Kinase 11 (CDK11) during the cell cycle and apoptosis. In preparation, submission anticipated October 2006.
Kahle A and Nelson MA. Short report: Novel protein interactions with CDK11 p58 isoform. In preparation, submission anticipated October 2006.
Shi J, Kahle A, Hershey JW, Honchak BM, Warneke JA, Leong SP, and Nelson MA. Decreased expression of eukaryotic initiation factor 3f deregulates translation and apoptosis in tumor cells. Oncogene, 2006 March 13 [Epub ahead of print].
Kahle A, Feng Y, and Nelson MA. Isolation and characterization of the human Cdc2L1 gene promoter. Gene, 2005 Jan 3; 344; 53-60.
Abstracts
Kahle A, Feng Y, and Nelson MA. Isolation and characterization of the human Cdc2L1 promoter. Student Showcase at University of Arizona, Tucson, AZ (October 2003)
Kahle A, Feng Y, and Nelson MA. Isolation and characterization of the human Cdc2L1 promoter. 95th Annual AACR meeting, Orlando, FL. (April 2004)
Kahle A, Shi J, and Nelson MA. Elucidation of the role of cyclin dependent kinase 11p58 in mitosis. 96th Annual AACR meeting, Anaheim, CA. (April 2005)
171
REFERENCES
1. www.cancer.gov.
2. Bush, J. A. and Li, G. The role of Bcl-2 family members in the progression of cutaneous melanoma. Clin Exp Metastasis, 20: 531-539, 2003.
3. seer.cancer.gov.
4. Swetter, S. M. Dermatological perspectives of malignant melanoma. Surg Clin North Am, 83: 77-95, vi, 2003.
5. Nyormoi, O. and Bar-Eli, M. Transcriptional regulation of metastasis-related genes in human melanoma. Clin Exp Metastasis, 20: 251-263, 2003.
6. Vogelstein, B., Fearon, E. R., Hamilton, S. R., Kern, S. E., Preisinger, A. C., Leppert, M., Nakamura, Y., White, R., Smits, A. M., and Bos, J. L. Genetic alterations during colorectal-tumor development. N Engl J Med, 319: 525-532, 1988.
7. Soengas, M. S. and Lowe, S. W. Apoptosis and melanoma chemoresistance. Oncogene, 22: 3138-3151, 2003.
8. Baruch, A. C., Shi, J., Feng, Y., and Nelson, M. A. New developments in the staging of melanoma. Cancer Invest, 23: 561-567, 2005.
9. Hanahan, D. and Weinberg, R. A. The hallmarks of cancer. Cell, 100: 57-70, 2000.
10. Tsao, H. and Sober, A. J. Melanoma treatment update. Dermatol Clin, 23: 323- 333, 2005.
11. Danson, S. and Lorigan, P. Improving outcomes in advanced malignant melanoma: update on systemic therapy. Drugs, 65: 733-743, 2005.
12. Takata, M. and Saida, T. Genetic alterations in melanocytic tumors. J Dermatol Sci, 43: 1-10, 2006.
13. Curtin, J. A., Fridlyand, J., Kageshita, T., Patel, H. N., Busam, K. J., Kutzner, H., Cho, K. H., Aiba, S., Brocker, E. B., LeBoit, P. E., Pinkel, D., and Bastian, B. C. Distinct sets of genetic alterations in melanoma. N Engl J Med, 353: 2135-2147, 2005.
172
14. Gollob, J. A., Wilhelm, S., Carter, C., and Kelley, S. L. Role of Raf kinase in cancer: therapeutic potential of targeting the Raf/MEK/ERK signal transduction pathway. Semin Oncol, 33: 392-406, 2006.
15. Roux, P. P. and Blenis, J. ERK and p38 MAPK-activated protein kinases: a family of protein kinases with diverse biological functions. Microbiol Mol Biol Rev, 68: 320-344, 2004.
16. Sumimoto, H., Imabayashi, F., Iwata, T., and Kawakami, Y. The BRAF-MAPK signaling pathway is essential for cancer-immune evasion in human melanoma cells. J Exp Med, 203: 1651-1656, 2006.
17. Smalley, K. S., Haass, N. K., Brafford, P. A., Lioni, M., Flaherty, K. T., and Herlyn, M. Multiple signaling pathways must be targeted to overcome drug resistance in cell lines derived from melanoma metastases. Mol Cancer Ther, 5: 1136-1144, 2006.
18. Smalley, K. S. and Herlyn, M. Towards the targeted therapy of melanoma. Mini Rev Med Chem, 6: 387-393, 2006.
19. Jaattela, M. Multiple cell death pathways as regulators of tumour initiation and progression. Oncogene, 23: 2746-2756, 2004.
20. Evan, G. and Littlewood, T. A matter of life and cell death. Science, 281: 1317- 1322, 1998.
21. Coutts, A. S. and La Thangue, N. The p53 response during DNA damage: impact of transcriptional cofactors. Biochem Soc Symp 181-189, 2006.
22. Kastan, M. B. and Bartek, J. Cell-cycle checkpoints and cancer. Nature, 432: 316- 323, 2004.
23. van Loo, G., Saelens, X., van Gurp, M., MacFarlane, M., Martin, S. J., and Vandenabeele, P. The role of mitochondrial factors in apoptosis: a Russian roulette with more than one bullet. Cell Death Differ, 9: 1031-1042, 2002.
24. Hussein, M. R., Haemel, A. K., and Wood, G. S. Apoptosis and melanoma: molecular mechanisms. J Pathol, 199: 275-288, 2003.
25. Ivanov, V. N., Bhoumik, A., and Ronai, Z. Death receptors and melanoma resistance to apoptosis. Oncogene, 22: 3152-3161, 2003.
26. Hersey, P. and Zhang, X. D. How melanoma cells evade trail-induced apoptosis. Nat Rev Cancer, 1: 142-150, 2001. 173
27. Flaherty, K. T. Chemotherapy and targeted therapy combinations in advanced melanoma. Clin Cancer Res, 12: 2366s-2370s, 2006.
28. Rodeck, U., Becker, D., and Herlyn, M. Basic fibroblast growth factor in human melanoma. Cancer Cells, 3: 308-311, 1991.
29. Rodeck, U., Melber, K., Kath, R., Menssen, H. D., Varello, M., Atkinson, B., and Herlyn, M. Constitutive expression of multiple growth factor genes by melanoma cells but not normal melanocytes. J Invest Dermatol, 97: 20-26, 1991.
30. Qu, X. J., Yuan, Y. X., Tian, Z. G., Xu, W. F., Chen, M. H., Cui, S. X., Guo, Q., Gai, R., Makuuchi, M., Nakata, M., and Tang, W. Using caffeoyl pyrrolidine derivative LY52, a potential inhibitor of matrix metalloproteinase-2, to suppress tumor invasion and metastasis. Int J Mol Med, 18: 609-614, 2006.
31. Loffek, S., Zigrino, P., Steiger, J., Kurschat, P., Smola, H., and Mauch, C. Melanoma cell-derived vascular endothelial growth factor induces endothelial tubulogenesis within fibrin gels by a metalloproteinase-mediated mechanism. Eur J Cell Biol, 2006.
32. Carvalho, L., Lipay, M., Belfort, F., Santos, I., Andrade, J., Haddad, A., Brunstein, F., and Ferreira, L. Telomerase activity in prognostic histopathologic features of melanoma. J Plast Reconstr Aesthet Surg, 59: 961-968, 2006.
33. Nelson, M. A., Ariza, M. E., Yang, J. M., Thompson, F. H., Taetle, R., Trent, J. M., Wymer, J., Massey-Brown, K., Broome-Powell, M., Easton, J., Lahti, J. M., and Kidd, V. J. Abnormalities in the p34cdc2-related PITSLRE protein kinase gene complex (CDC2L) on chromosome band 1p36 in melanoma. Cancer Genet Cytogenet, 108: 91-99, 1999.
34. Shay, J. W. and Roninson, I. B. Hallmarks of senescence in carcinogenesis and cancer therapy. Oncogene, 23: 2919-2933, 2004.
35. Sargent, L. M., Nelson, M. A., Lowry, D. T., Senft, J. R., Jefferson, A. M., Ariza, M. E., and Reynolds, S. H. Detection of three novel translocations and specific common chromosomal break sites in malignant melanoma by spectral karyotyping. Genes Chromosomes Cancer, 32: 18-25, 2001.
36. Okamoto, I., Pirker, C., Bilban, M., Berger, W., Losert, D., Marosi, C., Haas, O. A., Wolff, K., and Pehamberger, H. Seven novel and stable translocations associated with oncogenic gene expression in malignant melanoma. Neoplasia, 7: 303-311, 2005.
174
37. Goldstein, A. M., Goldin, L. R., Dracopoli, N. C., Clark, W. H., Jr., and Tucker, M. A. Two-locus linkage analysis of cutaneous malignant melanoma/dysplastic nevi. Am J Hum Genet, 58: 1050-1056, 1996.
38. Rajagopalan, H. and Lengauer, C. Aneuploidy and cancer. Nature, 432: 338-341, 2004.
39. Perlman, E. J., Valentine, M. B., Griffin, C. A., and Look, A. T. Deletion of 1p36 in childhood endodermal sinus tumors by two-color fluorescence in situ hybridization: a pediatric oncology group study. Genes Chromosomes Cancer, 16: 15-20, 1996.
40. Thompson, F. H., Taetle, R., Trent, J. M., Liu, Y., Massey-Brown, K., Scott, K. M., Weinstein, R. S., Emerson, J. C., Alberts, D. S., and Nelson, M. A. Band 1p36 abnormalities and t(1;17) in ovarian carcinoma. Cancer Genet Cytogenet, 96: 106-110, 1997.
41. Lahti, J. M., Valentine, M., Xiang, J., Jones, B., Amann, J., Grenet, J., Richmond, G., Look, A. T., and Kidd, V. J. Alterations in the PITSLRE protein kinase gene complex on chromosome 1p36 in childhood neuroblastoma. Nat Genet, 7: 370- 375, 1994.
42. Dave, B. J., Hess, M. M., Pickering, D. L., Zaleski, D. H., Pfeifer, A. L., Weisenburger, D. D., Armitage, J. O., and Sanger, W. G. Rearrangements of chromosome band 1p36 in non-Hodgkin's lymphoma. Clin Cancer Res, 5: 1401- 1409, 1999.
43. Dave, B. J., Pickering, D. L., Hess, M. M., Weisenburger, D. D., Armitage, J. O., and Sanger, W. G. Deletion of cell division cycle 2-like 1 gene locus on 1p36 in non-Hodgkin lymphoma. Cancer Genet Cytogenet, 108: 120-126, 1999.
44. Nelson, M. A., Radmacher, M. D., Simon, R., Aickin, M., Yang, J., Panda, L., Emerson, J., Roe, D., Adair, L., Thompson, F., Bangert, J., Leong, S. P., Taetle, R., Salmon, S., and Trent, J. Chromosome abnormalities in malignant melanoma: clinical significance of nonrandom chromosome abnormalities in 206 cases. Cancer Genet Cytogenet, 122: 101-109, 2000.
45. Poetsch, M., Dittberner, T., and Woenckhaus, C. Does the PITSLRE gene complex contribute to the pathogenesis of malignant melanoma of the skin? A study of patient-derived tumor samples? Cancer Genet Cytogenet, 128: 181-182, 2001.
46. Nishimura, T., Nishida, N., Itoh, T., Komeda, T., Fukuda, Y., Ikai, I., Yamaoka, Y., and Nakao, K. Discrete breakpoint mapping and shortest region of overlap of 175
chromosome arm 1q gain and 1p loss in human hepatocellular carcinoma detected by semiquantitative microsatellite analysis. Genes Chromosomes Cancer, 42: 34- 43, 2005.
47. White, P. S., Thompson, P. M., Seifried, B. A., Sulman, E. P., Jensen, S. J., Guo, C., Maris, J. M., Hogarty, M. D., Allen, C., Biegel, J. A., Matise, T. C., Gregory, S. G., Reynolds, C. P., and Brodeur, G. M. Detailed molecular analysis of 1p36 in neuroblastoma. Med Pediatr Oncol, 36: 37-41, 2001.
48. Slavotinek, A., Shaffer, L. G., and Shapira, S. K. Monosomy 1p36. J Med Genet, 36: 657-663, 1999.
49. Trembley, J. H., Loyer, P., Hu, D., Li, T., Grenet, J., Lahti, J. M., and Kidd, V. J. Cyclin dependent kinase 11 in RNA transcription and splicing. Prog Nucleic Acid Res Mol Biol, 77: 263-288, 2004.
50. Onyango, P., Lubyova, B., Gardellin, P., Kurzbauer, R., and Weith, A. Molecular cloning and expression analysis of five novel genes in chromosome 1p36. Genomics, 50: 187-198, 1998.
51. Osborne, C., Wilson, P., and Tripathy, D. Oncogenes and tumor suppressor genes in breast cancer: potential diagnostic and therapeutic applications. Oncologist, 9: 361-377, 2004.
52. Gururajan, R., Lahti, J. M., Grenet, J., Easton, J., Gruber, I., Ambros, P. F., and Kidd, V. J. Duplication of a genomic region containing the Cdc2L1-2 and MMP21-22 genes on human chromosome 1p36.3 and their linkage to D1Z2. Genome Res, 8: 929-939, 1998.
53. Hughes, A. L. Gene duplication and the origin of novel proteins. Proc Natl Acad Sci U S A, 102: 8791-8792, 2005.
54. Gururajan, R., Grenet, J., Lahti, J. M., and Kidd, V. J. Isolation and characterization of two novel metalloproteinase genes linked to the Cdc2L locus on human chromosome 1p36.3. Genomics, 52: 101-106, 1998.
55. Egeblad, M. and Werb, Z. New functions for the matrix metalloproteinases in cancer progression. Nat Rev Cancer, 2: 161-174, 2002.
56. Xiang, J., Lahti, J. M., Grenet, J., Easton, J., and Kidd, V. J. Molecular cloning and expression of alternatively spliced PITSLRE protein kinase isoforms. J Biol Chem, 269: 15786-15794, 1994.
176
57. Feng, Y., Shi, J., Goldstein, A. M., Tucker, M. A., and Nelson, M. A. Analysis of mutations and identification of several polymorphisms in the putative promoter region of the P34CDC2-related CDC2L1 gene located at 1P36 in melanoma cell lines and melanoma families. Int J Cancer, 99: 834-838, 2002.
58. Easton, J. and Kidd, V. J. Analysis of the 5' flanking sequences from the human protein kinase p58 (PITSLRE beta 1)-encoding gene. Gene, 145: 279-282, 1994.
59. Kahle, A., Feng, Y., and M, A. N. Isolation and characterization of the human Cdc2L1 gene promoter. Gene, 344: 53-60, 2005.
60. Feng, Y., Goulet, A. C., and Nelson, M. A. Identification and characterization of the human Cdc2l2 gene promoter. Gene, 330: 75-84, 2004.
61. Li, H., Grenet, J., Valentine, M., Lahti, J. M., and Kidd, V. J. Structure and expression of chicken protein kinase PITSLRE-encoding genes. Gene, 153: 237- 242, 1995.
62. Sauer, K., Weigmann, K., Sigrist, S., and Lehner, C. F. Novel members of the cdc2-related kinase family in Drosophila: cdk4/6, cdk5, PFTAIRE, and PITSLRE kinase. Mol Biol Cell, 7: 1759-1769, 1996.
63. Li, T., Inoue, A., Lahti, J. M., and Kidd, V. J. Failure to proliferate and mitotic arrest of CDK11(p110/p58)-null mutant mice at the blastocyst stage of embryonic cell development. Mol Cell Biol, 24: 3188-3197, 2004.
64. Knudson, A. G. Two genetic hits (more or less) to cancer. Nat Rev Cancer, 1: 157-162, 2001.
65. Payne, S. R. and Kemp, C. J. Tumor suppressor genetics. Carcinogenesis, 26: 2031-2045, 2005.
66. Santarosa, M. and Ashworth, A. Haploinsufficiency for tumour suppressor genes: when you don't need to go all the way. Biochim Biophys Acta, 1654: 105-122, 2004.
67. Quon, K. C. and Berns, A. Haplo-insufficiency? Let me count the ways. Genes Dev, 15: 2917-2921, 2001.
68. Cook, W. D. and McCaw, B. J. Accommodating haploinsufficient tumor suppressor genes in Knudson's model. Oncogene, 19: 3434-3438, 2000.
177
69. Bai, F., Pei, X. H., Godfrey, V. L., and Xiong, Y. Haploinsufficiency of p18(INK4c) sensitizes mice to carcinogen-induced tumorigenesis. Mol Cell Biol, 23: 1269-1277, 2003.
70. Toogood, P. L. The kinome is not enough. Chem Biol, 12: 1057-1058, 2005.
71. Niedner, R. H., Buzko, O. V., Haste, N. M., Taylor, A., Gribskov, M., and Taylor, S. S. Protein kinase resource: an integrated environment for phosphorylation research. Proteins, 63: 78-86, 2006.
72. Manning, G., Whyte, D. B., Martinez, R., Hunter, T., and Sudarsanam, S. The protein kinase complement of the human genome. Science, 298: 1912-1934, 2002.
73. Deleris, P., Bacqueville, D., Gayral, S., Carrez, L., Salles, J. P., Perret, B., and Breton-Douillon, M. SHIP-2 and PTEN are expressed and active in vascular smooth muscle cell nuclei, but only SHIP-2 is associated with nuclear speckles. J Biol Chem, 278: 38884-38891, 2003.
74. Alonso, A., Sasin, J., Bottini, N., Friedberg, I., Osterman, A., Godzik, A., Hunter, T., Dixon, J., and Mustelin, T. Protein tyrosine phosphatases in the human genome. Cell, 117: 699-711, 2004.
75. Arena, S., Benvenuti, S., and Bardelli, A. Genetic analysis of the kinome and phosphatome in cancer. Cell Mol Life Sci, 62: 2092-2099, 2005.
76. Paul, M. K. and Mukhopadhyay, A. K. Tyrosine kinase - Role and significance in Cancer. Int J Med Sci, 1: 101-115, 2004.
77. Workman, P. Drugging the cancer kinome: progress and challenges in developing personalized molecular cancer therapeutics. Cold Spring Harb Symp Quant Biol, 70: 499-515, 2005.
78. Vieth, M., Sutherland, J. J., Robertson, D. H., and Campbell, R. M. Kinomics: characterizing the therapeutically validated kinase space. Drug Discov Today, 10: 839-846, 2005.
79. Sawyers, C. Targeted cancer therapy. Nature, 432: 294-297, 2004.
80. Obaya, A. J. and Sedivy, J. M. Regulation of cyclin-Cdk activity in mammalian cells. Cell Mol Life Sci, 59: 126-142, 2002.
81. Morgan, D. O. Cyclin-dependent kinases: engines, clocks, and microprocessors. Annu Rev Cell Dev Biol, 13: 261-291, 1997. 178
82. Malumbres, M. and Barbacid, M. Mammalian cyclin-dependent kinases. Trends Biochem Sci, 30: 630-641, 2005.
83. Lopez-Beltran, A., Luque, R. J., Alvarez-Kindelan, J., Quintero, A., Merlo, F., Carrasco, J. C., Requena, M. J., and Montironi, R. Prognostic factors in stage T1 grade 3 bladder cancer survival: the role of G1-S modulators (p53, p21Waf1, p27kip1, Cyclin D1, and Cyclin D3) and proliferation index (ki67-MIB1). Eur Urol, 45: 606-612, 2004.
84. Solomon, D. A., Wang, Y., Fox, S. R., Lambeck, T. C., Giesting, S., Lan, Z., Senderowicz, A. M., Conti, C. J., and Knudsen, E. S. Cyclin D1 splice variants. Differential effects on localization, RB phosphorylation, and cellular transformation. J Biol Chem, 278: 30339-30347, 2003.
85. Graveley, B. R. Alternative splicing: increasing diversity in the proteomic world. Trends Genet, 17: 100-107, 2001.
86. Caceres, J. F. and Kornblihtt, A. R. Alternative splicing: multiple control mechanisms and involvement in human disease. Trends Genet, 18: 186-193, 2002.
87. Goldstrohm, A. C., Greenleaf, A. L., and Garcia-Blanco, M. A. Co-transcriptional splicing of pre-messenger RNAs: considerations for the mechanism of alternative splicing. Gene, 277: 31-47, 2001.
88. Stoilov, P., Meshorer, E., Gencheva, M., Glick, D., Soreq, H., and Stamm, S. Defects in pre-mRNA processing as causes of and predisposition to diseases. DNA Cell Biol, 21: 803-818, 2002.
89. Francone, V. P. and Mezquita, J. Diversification of CDK11 transcripts during chicken testis development and regression. Mol Reprod Dev, 72: 273-280, 2005.
90. Aitken, A. 14-3-3 and its possible role in co-ordinating multiple signalling pathways. Trends Cell Biol, 6: 341-347, 1996.
91. Hu, D., Mayeda, A., Trembley, J. H., Lahti, J. M., and Kidd, V. J. CDK11 complexes promote pre-mRNA splicing. J Biol Chem, 278: 8623-8629, 2003.
92. Lahti, J. M., Xiang, J., Heath, L. S., Campana, D., and Kidd, V. J. PITSLRE protein kinase activity is associated with apoptosis. Mol Cell Biol, 15: 1-11, 1995.
179
93. Zhang, S., Cai, M., Xu, S., Chen, S., Chen, X., Chen, C., and Gu, J. Interaction of p58(PITSLRE), a G2/M-specific protein kinase, with cyclin D3. J Biol Chem, 277: 35314-35322, 2002.
94. Mrowiec, T. and Schwappach, B. 14-3-3 proteins in membrane protein transport. Biol Chem, 387: 1227-1236, 2006.
95. Nagy, A., Cacciafesta, P., Grama, L., Kengyel, A., Malnasi-Csizmadia, A., and Kellermayer, M. S. Differential actin binding along the PEVK domain of skeletal muscle titin. J Cell Sci, 117: 5781-5789, 2004.
96. Yanagisawa, H., Bundo, M., Miyashita, T., Okamura-Oho, Y., Tadokoro, K., Tokunaga, K., and Yamada, M. Protein binding of a DRPLA family through arginine-glutamic acid dipeptide repeats is enhanced by extended polyglutamine. Hum Mol Genet, 9: 1433-1442, 2000.
97. Tinton, S. A., Schepens, B., Bruynooghe, Y., Beyaert, R., and Cornelis, S. Regulation of the cell-cycle-dependent internal ribosome entry site of the PITSLRE protein kinase: roles of Unr (upstream of N-ras) protein and phosphorylated translation initiation factor eIF-2alpha. Biochem J, 385: 155-163, 2005.
98. Cornelis, S., Tinton, S. A., Schepens, B., Bruynooghe, Y., and Beyaert, R. UNR translation can be driven by an IRES element that is negatively regulated by polypyrimidine tract binding protein. Nucleic Acids Res, 33: 3095-3108, 2005.
99. Loyer, P., Trembley, J. H., Lahti, J. M., and Kidd, V. J. The RNP protein, RNPS1, associates with specific isoforms of the p34cdc2-related PITSLRE protein kinase in vivo. J Cell Sci, 111 ( Pt 11): 1495-1506, 1998.
100. Trembley, J. H., Hu, D., Hsu, L. C., Yeung, C. Y., Slaughter, C., Lahti, J. M., and Kidd, V. J. PITSLRE p110 protein kinases associate with transcription complexes and affect their activity. J Biol Chem, 277: 2589-2596, 2002.
101. Trembley, J. H., Hu, D., Slaughter, C. A., Lahti, J. M., and Kidd, V. J. Casein kinase 2 interacts with cyclin-dependent kinase 11 (CDK11) in vivo and phosphorylates both the RNA polymerase II carboxyl-terminal domain and CDK11 in vitro. J Biol Chem, 278: 2265-2270, 2003.
102. Sachs, N. A. and Vaillancourt, R. R. Cyclin-dependent kinase 11(p110) activity in the absence of CK2. Biochim Biophys Acta, 1624: 98-108, 2003.
103. Payne, J. M., Laybourn, P. J., and Dahmus, M. E. The transition of RNA polymerase II from initiation to elongation is associated with phosphorylation of 180
the carboxyl-terminal domain of subunit IIa. J Biol Chem, 264: 19621-19629, 1989.
104. Dahmus, M. E. Phosphorylation of eukaryotic DNA-dependent RNA polymerase. Identification of calf thymus RNA polymerase subunits phosphorylated by two purified protein kinases, correlation with in vivo sites of phosphorylation in HeLa cell RNA polymerase II. J Biol Chem, 256: 3332-3339, 1981.
105. Dahmus, M. E. Phosphorylation of mammalian RNA polymerase II. Methods Enzymol, 273: 185-193, 1996.
106. Ahmad, K. A., Wang, G., Slaton, J., Unger, G., and Ahmed, K. Targeting CK2 for cancer therapy. Anticancer Drugs, 16: 1037-1043, 2005.
107. Malek, S. N. and Desiderio, S. A cyclin-dependent kinase homologue, p130PITSLRE is a phosphotyrosine-independent SH2 ligand. J Biol Chem, 269: 33009-33020, 1994.
108. Guo, Z. and Stiller, J. W. Comparative genomics and evolution of proteins associated with RNA polymerase II C-terminal domain. Mol Biol Evol, 22: 2166- 2178, 2005.
109. Trembley, J. H., Tatsumi, S., Sakashita, E., Loyer, P., Slaughter, C. A., Suzuki, H., Endo, H., Kidd, V. J., and Mayeda, A. Activation of pre-mRNA splicing by human RNPS1 is regulated by CK2 phosphorylation. Mol Cell Biol, 25: 1446- 1457, 2005.
110. Sakashita, E., Tatsumi, S., Werner, D., Endo, H., and Mayeda, A. Human RNPS1 and its associated factors: a versatile alternative pre-mRNA splicing regulator in vivo. Mol Cell Biol, 24: 1174-1187, 2004.
111. Schwerk, C., Prasad, J., Degenhardt, K., Erdjument-Bromage, H., White, E., Tempst, P., Kidd, V. J., Manley, J. L., Lahti, J. M., and Reinberg, D. ASAP, a novel protein complex involved in RNA processing and apoptosis. Mol Cell Biol, 23: 2981-2990, 2003.
112. Huang, Y., Yario, T. A., and Steitz, J. A. A molecular link between SR protein dephosphorylation and mRNA export. Proc Natl Acad Sci U S A, 101: 9666- 9670, 2004.
113. Huang, Y. and Steitz, J. A. Splicing factors SRp20 and 9G8 promote the nucleocytoplasmic export of mRNA. Mol Cell, 7: 899-905, 2001.
181
114. Loyer, P., Trembley, J. H., Katona, R., Kidd, V. J., and Lahti, J. M. Role of CDK/cyclin complexes in transcription and RNA splicing. Cell Signal, 17: 1033- 1051, 2005.
115. Yang, L., Li, N., Wang, C., Yu, Y., Yuan, L., Zhang, M., and Cao, X. Cyclin L2, a novel RNA polymerase II-associated cyclin, is involved in pre-mRNA splicing and induces apoptosis of human hepatocellular carcinoma cells. J Biol Chem, 279: 11639-11648, 2004.
116. de Graaf, K., Hekerman, P., Spelten, O., Herrmann, A., Packman, L. C., Bussow, K., Muller-Newen, G., and Becker, W. Characterization of cyclin L2, a novel cyclin with an arginine/serine-rich domain: phosphorylation by DYRK1A and colocalization with splicing factors. J Biol Chem, 279: 4612-4624, 2004.
117. Dickinson, L. A., Edgar, A. J., Ehley, J., and Gottesfeld, J. M. Cyclin L is an RS domain protein involved in pre-mRNA splicing. J Biol Chem, 277: 25465-25473, 2002.
118. Chen, H. H., Wang, Y. C., and Fann, M. J. Identification and characterization of the CDK12/cyclin L1 complex involved in alternative splicing regulation. Mol Cell Biol, 26: 2736-2745, 2006.
119. Boucher, L., Ouzounis, C. A., Enright, A. J., and Blencowe, B. J. A genome-wide survey of RS domain proteins. Rna, 7: 1693-1701, 2001.
120. Berke, J. D., Sgambato, V., Zhu, P. P., Lavoie, B., Vincent, M., Krause, M., and Hyman, S. E. Dopamine and glutamate induce distinct striatal splice forms of Ania-6, an RNA polymerase II-associated cyclin. Neuron, 32: 277-287, 2001. 121. Sgambato, V., Minassian, R., Nairn, A. C., and Hyman, S. E. Regulation of ania-6 splice variants by distinct signaling pathways in striatal neurons. J Neurochem, 86: 153-164, 2003.
122. Lamond, A. I. and Spector, D. L. Nuclear speckles: a model for nuclear organelles. Nat Rev Mol Cell Biol, 4: 605-612, 2003.
123. Nairn, A. C. and Greengard, P. A novel cyclin provides a link between dopamine and RNA processing. Neuron, 32: 174-176, 2001.
124. Lowe, S. W., Cepero, E., and Evan, G. Intrinsic tumour suppression. Nature, 432: 307-315, 2004.
125. Feng, Y., Ariza, M. E., Goulet, A. C., Shi, J., and Nelson, M. A. Death-signal- induced relocalization of cyclin-dependent kinase 11 to mitochondria. Biochem J, 392: 65-73, 2005. 182
126. Tang, D., Gururajan, R., and Kidd, V. J. Phosphorylation of PITSLRE p110 isoforms accompanies their processing by caspases during Fas-mediated cell death. J Biol Chem, 273: 16601-16607, 1998.
127. Beyaert, R., Kidd, V. J., Cornelis, S., Van de Craen, M., Denecker, G., Lahti, J. M., Gururajan, R., Vandenabeele, P., and Fiers, W. Cleavage of PITSLRE kinases by ICE/CASP-1 and CPP32/CASP-3 during apoptosis induced by tumor necrosis factor. J Biol Chem, 272: 11694-11697, 1997.
128. Fiers, W., Beyaert, R., Boone, E., Cornelis, S., Declercq, W., Decoster, E., Denecker, G., Depuydt, B., De Valck, D., De Wilde, G., Goossens, V., Grooten, J., Haegeman, G., Heyninck, K., Penning, L., Plaisance, S., Vancompernolle, K., Van Criekinge, W., Vandenabeele, P., Vanden Berghe, W., Van de Craen, M., Vandevoorde, V., and Vercammen, D. TNF-induced intracellular signaling leading to gene induction or to cytotoxicity by necrosis or by apoptosis. J Inflamm, 47: 67-75, 1995.
129. Ariza, M. E., Broome-Powell, M., Lahti, J. M., Kidd, V. J., and Nelson, M. A. Fas-induced apoptosis in human malignant melanoma cell lines is associated with the activation of the p34(cdc2)-related PITSLRE protein kinases. J Biol Chem, 274: 28505-28513, 1999.
130. Mikolajczyk, M., Shi, J., Vaillancourt, R. R., Sachs, N. A., and Nelson, M. The cyclin-dependent kinase 11(p46) isoform interacts with RanBPM. Biochem Biophys Res Commun, 310: 14-18, 2003.
131. Mikolajczyk, M. and Nelson, M. A. Regulation of stability of cyclin-dependent kinase CDK11p110 and a caspase-processed form, CDK11p46, by Hsp90. Biochem J, 384: 461-467, 2004.
132. Shi, J., Feng, Y., Goulet, A. C., Vaillancourt, R. R., Sachs, N. A., Hershey, J. W., and Nelson, M. A. The p34cdc2-related cyclin-dependent kinase 11 interacts with the p47 subunit of eukaryotic initiation factor 3 during apoptosis. J Biol Chem, 278: 5062-5071, 2003.
133. Shi, J. and Nelson, M. A. The cyclin-dependent kinase 11 interacts with NOT2. Biochem Biophys Res Commun, 334: 1310-1316, 2005.
134. Chen, S., Yin, X., Zhu, X., Yan, J., Ji, S., Chen, C., Cai, M., Zhang, S., Zong, H., Hu, Y., Yuan, Z., Shen, Z., and Gu, J. The C-terminal kinase domain of the p34cdc2-related PITSLRE protein kinase (p110C) associates with p21-activated kinase 1 and inhibits its activity during anoikis. J Biol Chem, 278: 20029-20036, 2003. 183
135. Chen, C., Yan, J., Sun, Q., Yao, L., Jian, Y., Lu, J., and Gu, J. Induction of apoptosis by p110C requires mitochondrial translocation of the proapoptotic BCL-2 family member BAD. FEBS Lett, 580: 813-821, 2006.
136. Li, Z., Wang, H., Zong, H., Sun, Q., Kong, X., Jiang, J., and Gu, J. Downregulation of beta1,4-galactosyltransferase 1 inhibits CDK11(p58)-mediated apoptosis induced by cycloheximide. Biochem Biophys Res Commun, 327: 628- 636, 2005.
137. Collart, M. A. Global control of gene expression in yeast by the Ccr4-Not complex. Gene, 313: 1-16, 2003.
138. Collart, M. A. and Timmers, H. T. The eukaryotic Ccr4-not complex: a regulatory platform integrating mRNA metabolism with cellular signaling pathways? Prog Nucleic Acid Res Mol Biol, 77: 289-322, 2004.
139. Rao, M. A., Cheng, H., Quayle, A. N., Nishitani, H., Nelson, C. C., and Rennie, P. S. RanBPM, a nuclear protein that interacts with and regulates transcriptional activity of androgen receptor and glucocorticoid receptor. J Biol Chem, 277: 48020-48027, 2002.
140. Wang, D., Li, Z., Messing, E. M., and Wu, G. Activation of Ras/Erk pathway by a novel MET-interacting protein RanBPM. J Biol Chem, 277: 36216-36222, 2002.
141. Hofmann, T. G., Moller, A., Sirma, H., Zentgraf, H., Taya, Y., Droge, W., Will, H., and Schmitz, M. L. Regulation of p53 activity by its interaction with homeodomain-interacting protein kinase-2. Nat Cell Biol, 4: 1-10, 2002.
142. D'Orazi, G., Cecchinelli, B., Bruno, T., Manni, I., Higashimoto, Y., Saito, S., Gostissa, M., Coen, S., Marchetti, A., Del Sal, G., Piaggio, G., Fanciulli, M., Appella, E., and Soddu, S. Homeodomain-interacting protein kinase-2 phosphorylates p53 at Ser 46 and mediates apoptosis. Nat Cell Biol, 4: 11-19, 2002.
143. Zhang, X. D., Gillespie, S. K., and Hersey, P. Staurosporine induces apoptosis of melanoma by both caspase-dependent and -independent apoptotic pathways. Mol Cancer Ther, 3: 187-197, 2004.
144. Shi, J., Kahle, A., Hershey, J. W., Honchak, B. M., Warneke, J. A., Leong, S. P., and Nelson, M. A. Decreased expression of eukaryotic initiation factor 3f deregulates translation and apoptosis in tumor cells. Oncogene, 25: 4923-4936, 2006.
184
145. Watkins, S. J. and Norbury, C. J. Translation initiation and its deregulation during tumorigenesis. Br J Cancer, 86: 1023-1027, 2002.
146. Pandolfi, P. P. Aberrant mRNA translation in cancer pathogenesis: an old concept revisited comes finally of age. Oncogene, 23: 3134-3137, 2004.
147. Clemens, M. J. Targets and mechanisms for the regulation of translation in malignant transformation. Oncogene, 23: 3180-3188, 2004.
148. Clemens, M. J., Bushell, M., Jeffrey, I. W., Pain, V. M., and Morley, S. J. Translation initiation factor modifications and the regulation of protein synthesis in apoptotic cells. Cell Death Differ, 7: 603-615, 2000.
149. Wang, S., Lloyd, R. V., Hutzler, M. J., Rosenwald, I. B., Safran, M. S., Patwardhan, N. A., and Khan, A. Expression of eukaryotic translation initiation factors 4E and 2alpha correlates with the progression of thyroid carcinoma. Thyroid, 11: 1101-1107, 2001.
150. Rosenwald, I. B., Hutzler, M. J., Wang, S., Savas, L., and Fraire, A. E. Expression of eukaryotic translation initiation factors 4E and 2alpha is increased frequently in bronchioloalveolar but not in squamous cell carcinomas of the lung. Cancer, 92: 2164-2171, 2001.
151. Rosenwald, I. B., Pechet, L., Han, A., Lu, L., Pihan, G., Woda, B., Chen, J. J., and Szymanski, I. Expression of translation initiation factors elF-4E and elF-2alpha and a potential physiologic role of continuous protein synthesis in human platelets. Thromb Haemost, 85: 142-151, 2001.
152. Rosenwald, I. B., Wang, S., Savas, L., Woda, B., and Pullman, J. Expression of translation initiation factor eIF-2alpha is increased in benign and malignant melanocytic and colonic epithelial neoplasms. Cancer, 98: 1080-1088, 2003.
153. Rosenwald, I. B. Upregulated expression of the genes encoding translation initiation factors eIF-4E and eIF-2alpha in transformed cells. Cancer Lett, 102: 113-123, 1996.
154. Feng, Y., Qi, W., Martinez, J., and Nelson, M. A. The cyclin-dependent kinase 11 interacts with 14-3-3 proteins. Biochem Biophys Res Commun, 331: 1503-1509, 2005.
155. Sachs, N. A. and Vaillancourt, R. R. Cyclin-dependent kinase 11p110 and casein kinase 2 (CK2) inhibit the interaction between tyrosine hydroxylase and 14-3-3. J Neurochem, 88: 51-62, 2004.
185
156. Vermeulen, K., Van Bockstaele, D. R., and Berneman, Z. N. The cell cycle: a review of regulation, deregulation and therapeutic targets in cancer. Cell Prolif, 36: 131-149, 2003.
157. Schafer, K. A. The cell cycle: a review. Vet Pathol, 35: 461-478, 1998. 158. Bunnell, B. A., Heath, L. S., Adams, D. E., Lahti, J. M., and Kidd, V. J. Increased expression of a 58-kDa protein kinase leads to changes in the CHO cell cycle. Proc Natl Acad Sci U S A, 87: 7467-7471, 1990.
159. Cornelis, S., Bruynooghe, Y., Denecker, G., Van Huffel, S., Tinton, S., and Beyaert, R. Identification and characterization of a novel cell cycle-regulated internal ribosome entry site. Mol Cell, 5: 597-605, 2000.
160. Pines, J. Four-dimensional control of the cell cycle. Nat Cell Biol, 1: E73-79, 1999.
161. Hershko, A. Roles of ubiquitin-mediated proteolysis in cell cycle control. Curr Opin Cell Biol, 9: 788-799, 1997.
162. Sherr, C. J. and Roberts, J. M. CDK inhibitors: positive and negative regulators of G1-phase progression. Genes Dev, 13: 1501-1512, 1999.
163. Park, C., Lee, I., and Kang, W. K. E2F-1 is a critical modulator of cellular senescence in human cancer. Int J Mol Med, 17: 715-720, 2006.
164. Bartek, J., Bartkova, J., and Lukas, J. The retinoblastoma protein pathway in cell cycle control and cancer. Exp Cell Res, 237: 1-6, 1997.
165. Lukas, J. and Bartek, J. Cell division: the heart of the cycle. Nature, 432: 564- 567, 2004.
166. Nicklas, R. B. How cells get the right chromosomes. Science, 275: 632-637, 1997.
167. Chan, G. K. and Yen, T. J. The mitotic checkpoint: a signaling pathway that allows a single unattached kinetochore to inhibit mitotic exit. Prog Cell Cycle Res, 5: 431-439, 2003.
168. Bolanos-Garcia, V. M. Aurora kinases. Int J Biochem Cell Biol, 37: 1572-1577, 2005.
169. Stenoien, D. L., Sen, S., Mancini, M. A., and Brinkley, B. R. Dynamic association of a tumor amplified kinase, Aurora-A, with the centrosome and mitotic spindle. Cell Motil Cytoskeleton, 55: 134-146, 2003. 186
170. van Vugt, M. A. and Medema, R. H. Getting in and out of mitosis with Polo-like kinase-1. Oncogene, 24: 2844-2859, 2005.
171. Hellen, C. U. and Sarnow, P. Internal ribosome entry sites in eukaryotic mRNA molecules. Genes Dev, 15: 1593-1612, 2001.
172. Lahti, J. M., Xiang, J., and Kidd, V. J. The PITSLRE protein kinase family. Prog Cell Cycle Res, 1: 329-338, 1995.
173. Kozak, M. A second look at cellular mRNA sequences said to function as internal ribosome entry sites. Nucleic Acids Res, 33: 6593-6602, 2005.
174. Evans, J. R., Mitchell, S. A., Spriggs, K. A., Ostrowski, J., Bomsztyk, K., Ostarek, D., and Willis, A. E. Members of the poly (rC) binding protein family stimulate the activity of the c-myc internal ribosome entry segment in vitro and in vivo. Oncogene, 22: 8012-8020, 2003.
175. Niu, Z., Shen, A., Shen, H., Jiang, J., Zong, H., and Gu, J. Protein expression pattern of CDK11(p58) during testicular development in the mouse. Mol Cell Biochem, 270: 99-106, 2005.
176. Petretti, C., Savoian, M., Montembault, E., Glover, D. M., Prigent, C., and Giet, R. The PITSLRE/CDK11p58 protein kinase promotes centrosome maturation and bipolar spindle formation. EMBO Rep, 7: 418-424, 2006.
177. Zong, H., Li, Z., Liu, L., Hong, Y., Yun, X., Jiang, J., Chi, Y., Wang, H., Shen, X., Hu, Y., Niu, Z., and Gu, J. Cyclin-dependent kinase 11(p58) interacts with HBO1 and enhances its histone acetyltransferase activity. FEBS Lett, 579: 3579- 3588, 2005.
178. Sharma, M., Zarnegar, M., Li, X., Lim, B., and Sun, Z. Androgen receptor interacts with a novel MYST protein, HBO1. J Biol Chem, 275: 35200-35208, 2000.
179. Sanjuan, R. and Marin, I. Tracing the origin of the compensasome: evolutionary history of DEAH helicase and MYST acetyltransferase gene families. Mol Biol Evol, 18: 330-343, 2001.
180. Iizuka, M., Matsui, T., Takisawa, H., and Smith, M. M. Regulation of replication licensing by acetyltransferase Hbo1. Mol Cell Biol, 26: 1098-1108, 2006.
187
181. Al-Aynati, M. M., Radulovich, N., Ho, J., and Tsao, M. S. Overexpression of G1- S cyclins and cyclin-dependent kinases during multistage human pancreatic duct cell carcinogenesis. Clin Cancer Res, 10: 6598-6605, 2004.
182. Bartkova, J., Lukas, J., Strauss, M., and Bartek, J. Cyclin D3: requirement for G1/S transition and high abundance in quiescent tissues suggest a dual role in proliferation and differentiation. Oncogene, 17: 1027-1037, 1998.
183. Bartkova, J., Rajpert-de Meyts, E., Skakkebaek, N. E., and Bartek, J. D-type cyclins in adult human testis and testicular cancer: relation to cell type, proliferation, differentiation, and malignancy. J Pathol, 187: 573-581, 1999.
184. Nybakken, K., Vokes, S. A., Lin, T. Y., McMahon, A. P., and Perrimon, N. A genome-wide RNA interference screen in Drosophila melanogaster cells for new components of the Hh signaling pathway. Nat Genet, 37: 1323-1332, 2005.
185. Zeidman, R., Pettersson, L., Sailaja, P. R., Truedsson, E., Fagerstrom, S., Pahlman, S., and Larsson, C. Novel and classical protein kinase C isoforms have different functions in proliferation, survival and differentiation of neuroblastoma cells. Int J Cancer, 81: 494-501, 1999.
186. Yoshida, K. and Miki, Y. Role of BRCA1 and BRCA2 as regulators of DNA repair, transcription, and cell cycle in response to DNA damage. Cancer Sci, 95: 866-871, 2004.
187. Nelson, M. A., Thompson, F. H., Emerson, J., Aickin, M., Adair, L., Trent, J. M., Leong, S. P., and Taetle, R. Clinical implications of cytogenetic abnormalities in melanoma. Surg Clin North Am, 76: 1257-1271, 1996.
188. Thompson, F. H., Emerson, J., Olson, S., Weinstein, R., Leavitt, S. A., Leong, S. P., Emerson, S., Trent, J. M., Nelson, M. A., Salmon, S. E., and et al. Cytogenetics of 158 patients with regional or disseminated melanoma. Subset analysis of near-diploid and simple karyotypes. Cancer Genet Cytogenet, 83: 93- 104, 1995.
189. Meyer, L. J., Milburn, S. C., and Hershey, J. W. Immunochemical characterization of mammalian protein synthesis initiation factors. Biochemistry, 21: 4206-4212, 1982.
190. Zhang, X., Herring, C. J., Romano, P. R., Szczepanowska, J., Brzeska, H., Hinnebusch, A. G., and Qin, J. Identification of phosphorylation sites in proteins separated by polyacrylamide gel electrophoresis. Anal Chem, 70: 2050-2059, 1998.
188
191. Philpott, N. J., Turner, A. J., Scopes, J., Westby, M., Marsh, J. C., Gordon-Smith, E. C., Dalgleish, A. G., and Gibson, F. M. The use of 7-amino actinomycin D in identifying apoptosis: simplicity of use and broad spectrum of application compared with other techniques. Blood, 87: 2244-2251, 1996.
192. Nakagawa, Y., Yoshida, A., Numoto, K., Kunisada, T., Wai, D., Ohata, N., Takeda, K., Kawai, A., and Ozaki, T. Chromosomal imbalances in malignant peripheral nerve sheath tumor detected by metaphase and microarray comparative genomic hybridization. Oncol Rep, 15: 297-303, 2006.
193. Schwab, M., Praml, C., and Amler, L. C. Genomic instability in 1p and human malignancies. Genes Chromosomes Cancer, 16: 211-229, 1996.
194. Weiss, M. J. and Orkin, S. H. GATA transcription factors: key regulators of hematopoiesis. Exp Hematol, 23: 99-107, 1995.
195. Gallagher, P. G., Liem, R. I., Wong, E., Weiss, M. J., and Bodine, D. M. GATA-1 and Oct-1 are required for expression of the human alpha-hemoglobin-stabilizing protein gene. J Biol Chem, 280: 39016-39023, 2005.
196. Stevens, C. and La Thangue, N. B. E2F and cell cycle control: a double-edged sword. Arch Biochem Biophys, 412: 157-169, 2003.
197. Oikawa, T. ETS transcription factors: possible targets for cancer therapy. Cancer Sci, 95: 626-633, 2004.
198. Oikawa, T. and Yamada, T. Molecular biology of the Ets family of transcription factors. Gene, 303: 11-34, 2003.
199. Wasylyk, B., Hahn, S. L., and Giovane, A. The Ets family of transcription factors. Eur J Biochem, 211: 7-18, 1993.
200. Sato, Y., Teruyama, K., Nakano, T., Oda, N., Abe, M., Tanaka, K., and Iwasaka- Yagi, C. Role of transcription factors in angiogenesis: Ets-1 promotes angiogenesis as well as endothelial apoptosis. Ann N Y Acad Sci, 947: 117-123, 2001.
201. Teruyama, K., Abe, M., Nakano, T., Iwasaka-Yagi, C., Takahashi, S., Yamada, S., and Sato, Y. Role of transcription factor Ets-1 in the apoptosis of human vascular endothelial cells. J Cell Physiol, 188: 243-252, 2001.
202. Jayaraman, G., Srinivas, R., Duggan, C., Ferreira, E., Swaminathan, S., Somasundaram, K., Williams, J., Hauser, C., Kurkinen, M., Dhar, R., Weitzman, S., Buttice, G., and Thimmapaya, B. p300/cAMP-responsive element-binding 189
protein interactions with ets-1 and ets-2 in the transcriptional activation of the human stromelysin promoter. J Biol Chem, 274: 17342-17352, 1999.
203. Xu, D., Wilson, T. J., Chan, D., De Luca, E., Zhou, J., Hertzog, P. J., and Kola, I. Ets1 is required for p53 transcriptional activity in UV-induced apoptosis in embryonic stem cells. Embo J, 21: 4081-4093, 2002.
204. Sugihara, T. M., Kudryavtseva, E. I., Kumar, V., Horridge, J. J., and Andersen, B. The POU domain factor Skin-1a represses the keratin 14 promoter independent of DNA binding. A possible role for interactions between Skn-1a and CREB-binding protein/p300. J Biol Chem, 276: 33036-33044, 2001.
205. Andersen, B., Hariri, A., Pittelkow, M. R., and Rosenfeld, M. G. Characterization of Skn-1a/i POU domain factors and linkage to papillomavirus gene expression. J Biol Chem, 272: 15905-15913, 1997.
206. Andersen, B., Weinberg, W. C., Rennekampff, O., McEvilly, R. J., Bermingham, J. R., Jr., Hooshmand, F., Vasilyev, V., Hansbrough, J. F., Pittelkow, M. R., Yuspa, S. H., and Rosenfeld, M. G. Functions of the POU domain genes Skn-1a/i and Tst-1/Oct-6/SCIP in epidermal differentiation. Genes Dev, 11: 1873-1884, 1997.
207. Goldsborough, A. S., Healy, L. E., Copeland, N. G., Gilbert, D. J., Jenkins, N. A., Willison, K. R., and Ashworth, A. Cloning, chromosomal localization and expression pattern of the POU domain gene Oct-11. Nucleic Acids Res, 21: 127- 134, 1993.
208. Yukawa, K., Butz, K., Yasui, T., Kikutani, H., and Hoppe-Seyler, F. Regulation of human papillomavirus transcription by the differentiation-dependent epithelial factor Epoc-1/skn-1a. J Virol, 70: 10-16, 1996.
209. Hietala, K. A., Kosma, V. M., Syrjanen, K. J., Syrjanen, S. M., and Kellokoski, J. K. Correlation of MIB-1 antigen expression with transcription factors Skn-1, Oct- 1, AP-2, and HPV type in cervical intraepithelial neoplasia. J Pathol, 183: 305- 310, 1997.
210. Augustijn, K. D., Duval, D. L., Wechselberger, R., Kaptein, R., Gutierrez- Hartmann, A., and van der Vliet, P. C. Structural characterization of the PIT- 1/ETS-1 interaction: PIT-1 phosphorylation regulates PIT-1/ETS-1 binding. Proc Natl Acad Sci U S A, 99: 12657-12662, 2002.
211. Cabral, A., Fischer, D. F., Vermeij, W. P., and Backendorf, C. Distinct functional interactions of human Skn-1 isoforms with Ese-1 during keratinocyte terminal differentiation. J Biol Chem, 278: 17792-17799, 2003. 190
212. Harland, M., Holland, E. A., Ghiorzo, P., Mantelli, M., Bianchi-Scarra, G., Goldstein, A. M., Tucker, M. A., Ponder, B. A., Mann, G. J., Bishop, D. T., and Newton Bishop, J. Mutation screening of the CDKN2A promoter in melanoma families. Genes Chromosomes Cancer, 28: 45-57, 2000.
213. Massague, J. G1 cell-cycle control and cancer. Nature, 432: 298-306, 2004.
214. Eward, K. L., Van Ert, M. N., Thornton, M., and Helmstetter, C. E. Cyclin mRNA stability does not vary during the cell cycle. Cell Cycle, 3: 1057-1061, 2004.
215. Gabrielli, B. G., Sarcevic, B., Sinnamon, J., Walker, G., Castellano, M., Wang, X. Q., and Ellem, K. A. A cyclin D-Cdk4 activity required for G2 phase cell cycle progression is inhibited in ultraviolet radiation-induced G2 phase delay. J Biol Chem, 274: 13961-13969, 1999.
216. Hayano, T., Yanagida, M., Yamauchi, Y., Shinkawa, T., Isobe, T., and Takahashi, N. Proteomic analysis of human Nop56p-associated pre-ribosomal ribonucleoprotein complexes. Possible link between Nop56p and the nucleolar protein treacle responsible for Treacher Collins syndrome. J Biol Chem, 278: 34309-34319, 2003.
217. Lewis, T. S., Hunt, J. B., Aveline, L. D., Jonscher, K. R., Louie, D. F., Yeh, J. M., Nahreini, T. S., Resing, K. A., and Ahn, N. G. Identification of novel MAP kinase pathway signaling targets by functional proteomics and mass spectrometry. Mol Cell, 6: 1343-1354, 2000.
218. Gee, S., Krauss, S. W., Miller, E., Aoyagi, K., Arenas, J., and Conboy, J. G. Cloning of mDEAH9, a putative RNA helicase and mammalian homologue of Saccharomyces cerevisiae splicing factor Prp43. Proc Natl Acad Sci U S A, 94: 11803-11807, 1997.
219. Martin, A., Schneider, S., and Schwer, B. Prp43 is an essential RNA-dependent ATPase required for release of lariat-intron from the spliceosome. J Biol Chem, 277: 17743-17750, 2002.
220. Abdelhaleem, M. RNA helicases: regulators of differentiation. Clin Biochem, 38: 499-503, 2005.
221. Abdelhaleem, M. Do human RNA helicases have a role in cancer? Biochim Biophys Acta, 1704: 37-46, 2004.
222. Luking, A., Stahl, U., and Schmidt, U. The protein family of RNA helicases. Crit Rev Biochem Mol Biol, 33: 259-296, 1998. 191
223. Rocak, S. and Linder, P. DEAD-box proteins: the driving forces behind RNA metabolism. Nat Rev Mol Cell Biol, 5: 232-241, 2004.
224. Rocak, S., Emery, B., Tanner, N. K., and Linder, P. Characterization of the ATPase and unwinding activities of the yeast DEAD-box protein Has1p and the analysis of the roles of the conserved motifs. Nucleic Acids Res, 33: 999-1009, 2005.
225. Tsai, R. T., Fu, R. H., Yeh, F. L., Tseng, C. K., Lin, Y. C., Huang, Y. H., and Cheng, S. C. Spliceosome disassembly catalyzed by Prp43 and its associated components Ntr1 and Ntr2. Genes Dev, 19: 2991-3003, 2005.
226. Arenas, J. E. and Abelson, J. N. Prp43: An RNA helicase-like factor involved in spliceosome disassembly. Proc Natl Acad Sci U S A, 94: 11798-11802, 1997.
227. Combs, D. J., Nagel, R. J., Ares, M., Jr., and Stevens, S. W. Prp43p is a DEAH- box spliceosome disassembly factor essential for ribosome biogenesis. Mol Cell Biol, 26: 523-534, 2006.
228. Granneman, S. and Baserga, S. J. Ribosome biogenesis: of knobs and RNA processing. Exp Cell Res, 296: 43-50, 2004.
229. Lee, I., Date, S. V., Adai, A. T., and Marcotte, E. M. A probabilistic functional network of yeast genes. Science, 306: 1555-1558, 2004.
230. Hernandez-Verdun, D. Nucleolus: from structure to dynamics. Histochem Cell Biol, 125: 127-137, 2006.
231. Dostie, J., Lejbkowicz, F., and Sonenberg, N. Nuclear eukaryotic initiation factor 4E (eIF4E) colocalizes with splicing factors in speckles. J Cell Biol, 148: 239- 247, 2000.
232. Chawla, G., Sapra, A. K., Surana, U., and Vijayraghavan, U. Dependence of pre- mRNA introns on PRP17, a non-essential splicing factor: implications for efficient progression through cell cycle transitions. Nucleic Acids Res, 31: 2333- 2343, 2003.
233. Liu, L., Graub, R., Hlaing, M., Epting, C. L., Turck, C. W., Xu, X. Q., Zhang, L., and Bernstein, H. S. Distinct domains of human CDC5 direct its nuclear import and association with the spliceosome. Cell Biochem Biophys, 39: 119-132, 2003.
234. Linder, P. Yeast RNA helicases of the DEAD-box family involved in translation initiation. Biol Cell, 95: 157-167, 2003. 192
235. Iost, I., Dreyfus, M., and Linder, P. Ded1p, a DEAD-box protein required for translation initiation in Saccharomyces cerevisiae, is an RNA helicase. J Biol Chem, 274: 17677-17683, 1999.
236. Zakowicz, H., Yang, H. S., Stark, C., Wlodawer, A., Laronde-Leblanc, N., and Colburn, N. H. Mutational analysis of the DEAD-box RNA helicase eIF4AII characterizes its interaction with transformation suppressor Pdcd4 and eIF4GI. Rna, 11: 261-274, 2005.
237. Chuang, R. Y., Weaver, P. L., Liu, Z., and Chang, T. H. Requirement of the DEAD-Box protein ded1p for messenger RNA translation. Science, 275: 1468- 1471, 1997.
238. Fairley, J. A., Kantidakis, T., Kenneth, N. S., Intine, R. V., Maraia, R. J., and White, R. J. Human La is found at RNA polymerase III-transcribed genes in vivo. Proc Natl Acad Sci U S A, 102: 18350-18355, 2005.
239. Fouraux, M. A., Kolkman, M. J., Van der Heijden, A., De Jong, A. S., Van Venrooij, W. J., and Pruijn, G. J. The human La (SS-B) autoantigen interacts with DDX15/hPrp43, a putative DEAH-box RNA helicase. Rna, 8: 1428-1443, 2002.
240. Lorsch, J. R. RNA chaperones exist and DEAD box proteins get a life. Cell, 109: 797-800, 2002.
241. Pudi, R., Srinivasan, P., and Das, S. La protein binding at the GCAC site near the initiator AUG facilitates the ribosomal assembly on the hepatitis C virus RNA to influence internal ribosome entry site-mediated translation. J Biol Chem, 279: 29879-29888, 2004.
242. Albrecht, B., Hausmann, M., Zitzelsberger, H., Stein, H., Siewert, J. R., Hopt, U., Langer, R., Hofler, H., Werner, M., and Walch, A. Array-based comparative genomic hybridization for the detection of DNA sequence copy number changes in Barrett's adenocarcinoma. J Pathol, 203: 780-788, 2004.
243. Kim, T. S., Jang, C. Y., Kim, H. D., Lee, J. Y., Ahn, B. Y., and Kim, J. Interaction of Hsp90 with ribosomal proteins protects from ubiquitination and proteasome-dependent degradation. Mol Biol Cell, 17: 824-833, 2006.
244. Sekiguchi, T. and Fukumura, J. Phosphorylation of dead-box RNA helicase DDX3 by mitotic cyclin B/CDC2, but not cyclin A/CDK2. J Biol Chem, 2005.
245. Bates, G. J., Nicol, S. M., Wilson, B. J., Jacobs, A. M., Bourdon, J. C., Wardrop, J., Gregory, D. J., Lane, D. P., Perkins, N. D., and Fuller-Pace, F. V. The DEAD 193
box protein p68: a novel transcriptional coactivator of the p53 tumour suppressor. Embo J, 24: 543-553, 2005.
246. Guarguaglini, G., Duncan, P. I., Stierhof, Y. D., Holmstrom, T., Duensing, S., and Nigg, E. A. The forkhead-associated domain protein Cep170 interacts with Polo- like kinase 1 and serves as a marker for mature centrioles. Mol Biol Cell, 16: 1095-1107, 2005.
247. Watkins, S. J. and Norbury, C. J. Cell cycle-related variation in subcellular localization of eIF3e/INT6 in human fibroblasts. Cell Prolif, 37: 149-160, 2004.
248. Pyronnet, S., Dostie, J., and Sonenberg, N. Suppression of cap-dependent translation in mitosis. Genes Dev, 15: 2083-2093, 2001.
249. Dostie, J., Ferraiuolo, M., Pause, A., Adam, S. A., and Sonenberg, N. A novel shuttling protein, 4E-T, mediates the nuclear import of the mRNA 5' cap-binding protein, eIF4E. Embo J, 19: 3142-3156, 2000.
250. Lahti, J. M., Xiang, J., and Kidd, V. J. Cell cycle-related protein kinases and T cell death. Adv Exp Med Biol, 376: 247-258, 1995.
251. Clemens, J. C., Worby, C. A., Simonson-Leff, N., Muda, M., Maehama, T., Hemmings, B. A., and Dixon, J. E. Use of double-stranded RNA interference in Drosophila cell lines to dissect signal transduction pathways. Proc Natl Acad Sci U S A, 97: 6499-6503, 2000.
252. Chang, P. C., Chi, C. W., Chau, G. Y., Li, F. Y., Tsai, Y. H., Wu, J. C., and Wu Lee, Y. H. DDX3, a DEAD box RNA helicase, is deregulated in hepatitis virus- associated hepatocellular carcinoma and is involved in cell growth control. Oncogene, 25: 1991-2003, 2006.
253. Tanaka, N. and Schwer, B. Mutations in PRP43 that uncouple RNA-dependent NTPase activity and pre-mRNA splicing function. Biochemistry, 45: 6510-6521, 2006.
254. Cimini, D., Wan, X., Hirel, C. B., and Salmon, E. D. Aurora kinase promotes turnover of kinetochore microtubules to reduce chromosome segregation errors. Curr Biol, 16: 1711-1718, 2006.
255. Chou, Y. H., Khuon, S., Herrmann, H., and Goldman, R. D. Nestin promotes the phosphorylation-dependent disassembly of vimentin intermediate filaments during mitosis. Mol Biol Cell, 14: 1468-1478, 2003.
194
256. Moir, R. D., Yoon, M., Khuon, S., and Goldman, R. D. Nuclear lamins A and B1: different pathways of assembly during nuclear envelope formation in living cells. J Cell Biol, 151: 1155-1168, 2000.
257. Moir, R. D., Spann, T. P., and Goldman, R. D. The dynamic properties and possible functions of nuclear lamins. Int Rev Cytol, 162B: 141-182, 1995.
258. Moir, R. D. and Goldman, R. D. Lamin dynamics. Curr Opin Cell Biol, 5: 408- 411, 1993.
259. Nakamura, M., Masuda, H., Horii, J., Kuma, K., Yokoyama, N., Ohba, T., Nishitani, H., Miyata, T., Tanaka, M., and Nishimoto, T. When overexpressed, a novel centrosomal protein, RanBPM, causes ectopic microtubule nucleation similar to gamma-tubulin. J Cell Biol, 143: 1041-1052, 1998
260. Georgatos, S. D., Pyrpasopoulou, A., and Theodoropoulos, P. A. Nuclear envelope breakdown in mammalian cells involves stepwise lamina disassembly and microtubule-drive deformation of the nuclear membrane. J Cell Sci, 110 ( Pt 17): 2129-2140, 1997.
261. Valiron, O., Caudron, N., and Job, D. Microtubule dynamics. Cell Mol Life Sci, 58: 2069-2084, 2001.
262. Moir, R. D. and Spann, T. P. The structure and function of nuclear lamins: implications for disease. Cell Mol Life Sci, 58: 1748-1757, 2001.
263. Helfand, B. T., Chang, L., and Goldman, R. D. Intermediate filaments are dynamic and motile elements of cellular architecture. J Cell Sci, 117: 133-141, 2004.
264. Helfand, B. T., Chou, Y. H., Shumaker, D. K., and Goldman, R. D. Intermediate filament proteins participate in signal transduction. Trends Cell Biol, 15: 568-570, 2005.
265. Agueli, C., Geraci, F., Giudice, G., Chimenti, L., Cascino, D., and Sconzo, G. A constitutive 70 kDa heat-shock protein is localized on the fibres of spindles and asters at metaphase in an ATP-dependent manner: a new chaperone role is proposed. Biochem J, 360: 413-419, 2001.
266. Rattner, J. B. hsp70 is localized to the centrosome of dividing HeLa cells. Exp Cell Res, 195: 110-113, 1991.
267. Oka, M., Nakai, M., Endo, T., Lim, C. R., Kimata, Y., and Kohno, K. Loss of Hsp70-Hsp40 chaperone activity causes abnormal nuclear distribution and 195
aberrant microtubule formation in M-phase of Saccharomyces cerevisiae. J Biol Chem, 273: 29727-29737, 1998.
268. Hut, H. M., Kampinga, H. H., and Sibon, O. C. Hsp70 protects mitotic cells against heat-induced centrosome damage and division abnormalities. Mol Biol Cell, 16: 3776-3785, 2005.
269. Rohde, M., Daugaard, M., Jensen, M. H., Helin, K., Nylandsted, J., and Jaattela, M. Members of the heat-shock protein 70 family promote cancer cell growth by distinct mechanisms. Genes Dev, 19: 570-582, 2005.
270. Eipers, P. G., Barnoski, B. L., Han, J., Carroll, A. J., and Kidd, V. J. Localization of the expressed human p58 protein kinase chromosomal gene to chromosome 1p36 and a highly related sequence to chromosome 15. Genomics, 11: 621-629, 1991.
271. Eipers, P. G., Lahti, J. M., and Kidd, V. J. Structure and expression of the human p58clk-1 protein kinase chromosomal gene. Genomics, 13: 613-621, 1992.
272. Pei, H., Li, C., Adereth, Y., Hsu, T., Watson, D. K., and Li, R. Caspase-1 is a direct target gene of ETS1 and plays a role in ETS1-induced apoptosis. Cancer Res, 65: 7205-7213, 2005.
273. Quinn, C. O., Rajakumar, R. A., and Agapova, O. A. Parathyroid hormone induces rat interstitial collagenase mRNA through Ets-1 facilitated by cyclic AMP response element-binding protein and Ca(2+)/calmodulin-dependent protein kinase II in osteoblastic cells. J Mol Endocrinol, 25: 73-84, 2000.
274. Foulds, C. E., Nelson, M. L., Blaszczak, A. G., and Graves, B. J. Ras/mitogen- activated protein kinase signaling activates Ets-1 and Ets-2 by CBP/p300 recruitment. Mol Cell Biol, 24: 10954-10964, 2004.
275. Gardner, K. H. and Montminy, M. Can you hear me now? Regulating transcriptional activators by phosphorylation. Sci STKE, 2005: pe44, 2005.
276. Wasylyk, B., Hagman, J., and Gutierrez-Hartmann, A. Ets transcription factors: nuclear effectors of the Ras-MAP-kinase signaling pathway. Trends Biochem Sci, 23: 213-216, 1998.
277. Inoue, H., Hisamoto, N., An, J. H., Oliveira, R. P., Nishida, E., Blackwell, T. K., and Matsumoto, K. The C. elegans p38 MAPK pathway regulates nuclear localization of the transcription factor SKN-1 in oxidative stress response. Genes Dev, 19: 2278-2283, 2005.
196
278. Krens, S. F., Spaink, H. P., and Snaar-Jagalska, B. E. Functions of the MAPK family in vertebrate-development. FEBS Lett, 580: 4984-4990, 2006.
279. Boukamp, P., Stanbridge, E. J., Foo, D. Y., Cerutti, P. A., and Fusenig, N. E. c- Ha-ras oncogene expression in immortalized human keratinocytes (HaCaT) alters growth potential in vivo but lacks correlation with malignancy. Cancer Res, 50: 2840-2847, 1990.
280. Meier, F., Schittek, B., Busch, S., Garbe, C., Smalley, K., Satyamoorthy, K., Li, G., and Herlyn, M. The RAS/RAF/MEK/ERK and PI3K/AKT signaling pathways present molecular targets for the effective treatment of advanced melanoma. Front Biosci, 10: 2986-3001, 2005.
281. Jost, M., Folgueras, A. R., Frerart, F., Pendas, A. M., Blacher, S., Houard, X., Berndt, S., Munaut, C., Cataldo, D., Alvarez, J., Melen-Lamalle, L., Foidart, J. M., Lopez-Otin, C., and Noel, A. Earlier onset of tumoral angiogenesis in matrix metalloproteinase-19-deficient mice. Cancer Res, 66: 5234-5241, 2006.
282. Jost, M., Huggett, T. M., Kari, C., and Rodeck, U. Matrix-independent survival of human keratinocytes through an EGF receptor/MAPK-kinase-dependent pathway. Mol Biol Cell, 12: 1519-1527, 2001.
283. Jost, M., Kari, C., and Rodeck, U. The EGF receptor - an essential regulator of multiple epidermal functions. Eur J Dermatol, 10: 505-510, 2000.
284. Zhang, Z., Yao, R., Li, J., Wang, Y., Boone, C. W., Lubet, R. A., and You, M. Induction of invasive mouse skin carcinomas in transgenic mice with mutations in both H-ras and p53. Mol Cancer Res, 3: 563-574, 2005.
285. Boukamp, P. Non-melanoma skin cancer: what drives tumor development and progression? Carcinogenesis, 26: 1657-1667, 2005.
286. Coutts, A. S. and La Thangue, N. B. The p53 response: emerging levels of co- factor complexity. Biochem Biophys Res Commun, 331: 778-785, 2005.
287. Cai, M. M., Zhang, S. W., Zhang, S., Chen, S., Yan, J., Zhu, X. Y., Hu, Y., Chen, C., and Gu, J. X. Different effects of p58PITSLRE on the apoptosis induced by etoposide, cycloheximide and serum-withdrawal in human hepatocarcinoma cells. Mol Cell Biochem, 238: 49-55, 2002.
288. Pyronnet, S. and Sonenberg, N. Cell-cycle-dependent translational control. Curr Opin Genet Dev, 11: 13-18, 2001.
197
289. Liu, N., Lucibello, F. C., Zwicker, J., Engeland, K., and Muller, R. Cell cycle- regulated repression of B-myb transcription: cooperation of an E2F site with a contiguous corepressor element. Nucleic Acids Res, 24: 2905-2910, 1996.
290. Lucibello, F. C., Liu, N., Zwicker, J., Gross, C., and Muller, R. The differential binding of E2F and CDF repressor complexes contributes to the timing of cell cycle-regulated transcription. Nucleic Acids Res, 25: 4921-4925, 1997.
291. Homma, M. K., Wada, I., Suzuki, T., Yamaki, J., Krebs, E. G., and Homma, Y. CK2 phosphorylation of eukaryotic translation initiation factor 5 potentiates cell cycle progression. Proc Natl Acad Sci U S A, 102: 15688-15693, 2005.
292. Homma, M. K. and Homma, Y. Regulatory role of CK2 during the progression of cell cycle. Mol Cell Biochem, 274: 47-52, 2005.
293. Schwartz, E. I., Intine, R. V., and Maraia, R. J. CK2 is responsible for phosphorylation of human La protein serine-366 and can modulate rpL37 5'- terminal oligopyrimidine mRNA metabolism. Mol Cell Biol, 24: 9580-9591, 2004.
294. Fuller-Pace, F. V. DExD/H box RNA helicases: multifunctional proteins with important roles in transcriptional regulation. Nucleic Acids Res, 2006.
295. Rossow, K. L. and Janknecht, R. Synergism between p68 RNA helicase and the transcriptional coactivators CBP and p300. Oncogene, 22: 151-156, 2003.
296. Pyronnet, S., Pradayrol, L., and Sonenberg, N. Alternative splicing facilitates internal ribosome entry on the ornithine decarboxylase mRNA. Cell Mol Life Sci, 62: 1267-1274, 2005.
297. Dundr, M. and Olson, M. O. Partially processed pre-rRNA is preserved in association with processing components in nucleolus-derived foci during mitosis. Mol Biol Cell, 9: 2407-2422, 1998.
298. Dundr, M., Misteli, T., and Olson, M. O. The dynamics of postmitotic reassembly of the nucleolus. J Cell Biol, 150: 433-446, 2000.
299. Sirri, V., Hernandez-Verdun, D., and Roussel, P. Cyclin-dependent kinases govern formation and maintenance of the nucleolus. J Cell Biol, 156: 969-981, 2002.
300. Holcik, M. and Sonenberg, N. Translational control in stress and apoptosis. Nat Rev Mol Cell Biol, 6: 318-327, 2005.
198
301. Huang, N., Negi, S., Szebeni, A., and Olson, M. O. Protein NPM3 interacts with the multifunctional nucleolar protein B23/nucleophosmin and inhibits ribosome biogenesis. J Biol Chem, 280: 5496-5502, 2005.
302. Irion, U., Leptin, M., Siller, K., Fuerstenberg, S., Cai, Y., Doe, C. Q., Chia, W., and Yang, X. Abstrakt, a DEAD box protein, regulates Insc levels and asymmetric division of neural and mesodermal progenitors. Curr Biol, 14: 138- 144, 2004.
303. Irion, U. and Leptin, M. Developmental and cell biological functions of the Drosophila DEAD-box protein abstrakt. Curr Biol, 9: 1373-1381, 1999.
304. Lebaron, S., Froment, C., Fromont-Racine, M., Rain, J. C., Monsarrat, B., Caizergues-Ferrer, M., and Henry, Y. The splicing ATPase prp43p is a component of multiple preribosomal particles. Mol Cell Biol, 25: 9269-9282, 2005.
305. Castillo, A. R., Meehl, J. B., Morgan, G., Schutz-Geschwender, A., and Winey, M. The yeast protein kinase Mps1p is required for assembly of the integral spindle pole body component Spc42p. J Cell Biol, 156: 453-465, 2002.
306. Jaspersen, S. L. and Winey, M. The budding yeast spindle pole body: structure, duplication, and function. Annu Rev Cell Dev Biol, 20: 1-28, 2004.
307. Jaspersen, S. L., Huneycutt, B. J., Giddings, T. H., Jr., Resing, K. A., Ahn, N. G., and Winey, M. Cdc28/Cdk1 regulates spindle pole body duplication through phosphorylation of Spc42 and Mps1. Dev Cell, 7: 263-274, 2004.
308. Palframan, W. J., Meehl, J. B., Jaspersen, S. L., Winey, M., and Murray, A. W. Anaphase inactivation of the spindle checkpoint. Science, 313: 680-684, 2006.
309. Doxsey, S., Zimmerman, W., and Mikule, K. Centrosome control of the cell cycle. Trends Cell Biol, 15: 303-311, 2005.
310. Zimmerman, W. C., Sillibourne, J., Rosa, J., and Doxsey, S. J. Mitosis-specific anchoring of gamma tubulin complexes by pericentrin controls spindle organization and mitotic entry. Mol Biol Cell, 15: 3642-3657, 2004.
311. Takahashi, T., Sano, B., Nagata, T., Kato, H., Sugiyama, Y., Kunieda, K., Kimura, M., Okano, Y., and Saji, S. Polo-like kinase 1 (PLK1) is overexpressed in primary colorectal cancers. Cancer Sci, 94: 148-152, 2003.
199
312. Yang, L., Lin, C., and Liu, Z. R. Phosphorylations of DEAD box p68 RNA helicase are associated with cancer development and cell proliferation. Mol Cancer Res, 3: 355-363, 2005.
313. Ruggero, D. and Pandolfi, P. P. Does the ribosome translate cancer? Nat Rev Cancer, 3: 179-192, 2003.
314. Garnier, C., Barbier, P., Gilli, R., Lopez, C., Peyrot, V., and Briand, C. Heat- shock protein 90 (hsp90) binds in vitro to tubulin dimer and inhibits microtubule formation. Biochem Biophys Res Commun, 250: 414-419, 1998.
315. Sanchez, C., Padilla, R., Paciucci, R., Zabala, J. C., and Avila, J. Binding of heat- shock protein 70 (hsp70) to tubulin. Arch Biochem Biophys, 310: 428-432, 1994.
316. Gache, V., Louwagie, M., Garin, J., Caudron, N., Lafanechere, L., and Valiron, O. Identification of proteins binding the native tubulin dimer. Biochem Biophys Res Commun, 327: 35-42, 2005.
317. Nikolakaki, E., Meier, J., Simos, G., Georgatos, S. D., and Giannakouros, T. Mitotic phosphorylation of the lamin B receptor by a serine/arginine kinase and p34(cdc2). J Biol Chem, 272: 6208-6213, 1997.
318. Pyrpasopoulou, A., Meier, J., Maison, C., Simos, G., and Georgatos, S. D. The lamin B receptor (LBR) provides essential chromatin docking sites at the nuclear envelope. Embo J, 15: 7108-7119, 1996.
319. Takai, Y., Ogawara, M., Tomono, Y., Moritoh, C., Imajoh-Ohmi, S., Tsutsumi, O., Taketani, Y., and Inagaki, M. Mitosis-specific phosphorylation of vimentin by protein kinase C coupled with reorganization of intracellular membranes. J Cell Biol, 133: 141-149, 1996.
320. Maison, C., Horstmann, H., and Georgatos, S. D. Regulated docking of nuclear membrane vesicles to vimentin filaments during mitosis. J Cell Biol, 123: 1491- 1505, 1993.
321. Maison, C., Pyrpasopoulou, A., and Georgatos, S. D. Vimentin-associated mitotic vesicles interact with chromosomes in a lamin B- and phosphorylation-dependent manner. Embo J, 14: 3311-3324, 1995.
322. Tsujimura, K., Ogawara, M., Takeuchi, Y., Imajoh-Ohmi, S., Ha, M. H., and Inagaki, M. Visualization and function of vimentin phosphorylation by cdc2 kinase during mitosis. J Biol Chem, 269: 31097-31106, 1994.
200
323. Correia, I., Chu, D., Chou, Y. H., Goldman, R. D., and Matsudaira, P. Integrating the actin and vimentin cytoskeletons. adhesion-dependent formation of fimbrin- vimentin complexes in macrophages. J Cell Biol, 146: 831-842, 1999.
324. Panorchan, P., Schafer, B. W., Wirtz, D., and Tseng, Y. Nuclear envelope breakdown requires overcoming the mechanical integrity of the nuclear lamina. J Biol Chem, 279: 43462-43467, 2004.
325. Sommers, C. L., Walker-Jones, D., Heckford, S. E., Worland, P., Valverius, E., Clark, R., McCormick, F., Stampfer, M., Abularach, S., and Gelmann, E. P. Vimentin rather than keratin expression in some hormone-independent breast cancer cell lines and in oncogene-transformed mammary epithelial cells. Cancer Res, 49: 4258-4263, 1989.
326. Takemura, K., Hirayama, R., Hirokawa, K., Inagaki, M., Tsujimura, K., Esaki, Y., and Mishima, Y. Expression of vimentin in gastric cancer: a possible indicator for prognosis. Pathobiology, 62: 149-154, 1994.
327. Torres, K. and Horwitz, S. B. Mechanisms of Taxol-induced cell death are concentration dependent. Cancer Res, 58: 3620-3626, 1998.
328. Jordan, M. A. and Wilson, L. Microtubules and actin filaments: dynamic targets for cancer chemotherapy. Curr Opin Cell Biol, 10: 123-130, 1998.