DOCSLIB.ORG

Incorporating Molecular Data in Fungal Systematics: a Guide for Aspiring Researchers

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Incorporating Molecular Data in Fungal Systematics: a Guide for Aspiring Researchers Current Research in Environmental & Applied Mycology Doi 10.5943/cream/3/1/1 Incorporating molecular data in fungal systematics: a guide for aspiring researchers Hyde KD1,2, Udayanga D1,2, Manamgoda DS1,2, Tedersoo L3,4, Larsson E5, Abarenkov K3, Bertrand YJK5, Oxelman B5, Hartmann M6,7, Kauserud H8, Ryberg M9, Kristiansson E10, Nilsson RH 5,* 1Institute of Excellence in Fungal Research, 2School of Science, Mae Fah Luang University, Chiang Rai, 57100, Thailand 3Institute of Ecology and Earth Sciences, University of Tartu, Tartu, Estonia 4Natural History Museum, University of Tartu, Tartu, Estonia 5Department of Biological and Environmental Sciences, University of Gothenburg, Box 461, 405 30 Göteborg, Sweden 6Forest Soils and Biogeochemistry, Swiss Federal Research Institute WSL, Birmensdorf, Switzerland 7Molecular Ecology, Agroscope Reckenholz-Tänikon Research Station ART, Zurich, Switzerland 8 Department of Biosciences, University of Oslo, PO Box 1066, Blindern, N-0316, Oslo, Norway 9Department of Organismal Biology, Uppsala University, Norbyvägen 18D, 75236 Uppsala, Sweden 10Department of Mathematical Statistics, Chalmers University of Technology, 412 96 Göteborg, Sweden Hyde KD, Udayanga D, Manamgoda DS, Tedersoo L, Larsson E, Abarenkov K, Bertrand YJK, Oxelman B, Hartmann M, Kauserud H, Ryberg M, Kristiansson E, Nilsson RH. 2013 – Incorporating molecular data in fungal systematics: a guide for aspiring researchers. Current Research in Environmental & Applied Mycology 3(1), 1–32, Doi 10.5943/cream/3/1/1 The last twenty years have witnessed molecular data emerge as a primary research instrument in most branches of mycology. Fungal systematics, taxonomy, and ecology have all seen tremendous progress and have undergone rapid, far-reaching changes as disciplines in the wake of continual improvement in DNA sequencing technology. A taxonomic study that draws from molecular data involves a long series of steps, ranging from taxon sampling through the various laboratory procedures and data analysis to the publication process. All steps are important and influence the results and the way they are perceived by the scientific community. The present paper provides a reflective overview of all major steps in such a project with the purpose to assist research students about to begin their first study using DNA-based methods. We also take the opportunity to discuss the role of taxonomy in biology and the life sciences in general in the light of molecular data. While the best way to learn molecular methods is to work side by side with someone experienced, we hope that the present paper will serve to lower the learning threshold for the reader. Key words – biodiversity – molecular marker – phylogeny – publication – species – Sanger sequencing – taxonomy Article Information Received 12 March 2013 Accepted 26 March 2013 Published online 29 April 2013 * Corresponding author: R. Henrik Nilsson – email – [email protected] 1 Current Research in Environmental & Applied Mycology Doi 10.5943/cream/3/1/1 Introduction requirement as an effective tool in terms of Morphology has been the basis of time and resource consumption (Horn et al. nearly all taxonomic studies of fungi. Most 1996; Frisvad et al. 2008). species were previously introduced because Molecular data was first used in their morphology differed from that of other taxonomic studies of fungi in the 1970's (cf. taxa, although in many plant pathogenic genera DeBertoldi et al. 1973), which marked the the host was given a major consideration beginning of a new era in fungal research. The (Rossman and Palm-Hernández 2008; Hyde et last twenty years have seen an explosion in the al. 2010; Cai et al. 2011). Genera were use of molecular data in systematics and introduced because they were deemed taxonomy, to the extent where many journals sufficiently distinct from other groups of will no longer accept papers for publication species, and the differences typically amounted unless the taxonomic decisions are backed by to one to several characters. Groups of genera molecular data. DNA sequences are now used were combined into families and families into on a routine basis in fungal taxonomy at all orders and classes; the underlying reasoning levels. Molecular data in taxonomy and for grouping lineages was based on single to systematics are not devoid of problems, several characters deemed to be of particular however, and there are many concerns that are discriminatory value. However, the whole not always given the attention they deserve system hinged to no small degree on what (Taylor et al. 2000; Hibbett et al. 2011). We characters were chosen as arbiters of regularly meet research students who are inclusiveness. These characters often varied unsure about one or more steps in their nascent among mycologists and resulted in molecular projects. Much has been written disagreement and constant taxonomic about each step in the molecular pipeline, and rearrangements in many groups of fungi there are several good publications that should (Hibbett 2007; Shenoy et al. 2007; Yang 2011). be consulted regardless of the questions The limitations of morphology-based arising. What is missing, perhaps, is a wrapper taxonomy were recognized early on, and for these papers: a freely available, easy-to- numerous mycologists tried to incorporate read yet not overly long document that other sources of data into the classification summarizes all major steps and provides process, such as information on biochemistry, references for additional reading for each of enzyme production, metabolite profiles, them. This is an attempt at such an overview. physiological factors, growth rate, We have divided it into six sections that span pathogenicity, and mating tests (Guarro et al. the width of a typical molecular study of fungi: 1999; Taylor et al. 2000; Abang et al. 2009). 1) taxon sampling, 2) laboratory procedures, 3) Some of these attempts proved successful. For sequence quality control, 4) data analysis, 5) instance, the economically important plant the publication process, and 6) other pathogen Colletotrichum kahawae was observations. The target audience is research distinguished from C. gloeosporioides based students ("the users") about to undertake a on physiological and biochemical characters (Sanger sequencing-based) molecular (Correll et al. 2000; Hyde et al. 2009). mycological study with a systematic or Similarly, relative growth rates and the taxonomic focus. production of secondary metabolites on defined media under controlled conditions are valuable Sampling and compiling a dataset in studies of complex genera such as The dataset determines the results. If Aspergillus, Penicillium, and Colletotrichum there is anything that the user should spend (Frisvad et al. 2007; Samson and Varga 2007; valued time completing, it is to compile a rich, Cai et al. 2009). In many other situations, meaningful dataset of specimens/sequences however, these data sources proved (Zwickl and Hillis 2002). Right from the onset, inconclusive or included a signal that varied it is important to consider what hypotheses will over time or with environmental and be tested with the resulting phylogeny. If the experimental conditions. In addition, the hypothesis is that one taxon is separate from detection methods often did not meet the one or several other taxa, then all those taxa 2 Current Research in Environmental & Applied Mycology Doi 10.5943/cream/3/1/1 should be sampled along with appropriate Sampling through herbaria, culture outgroups; consultation of taxonomic expertise collections, and the literature – Mining world (if available) is advisable. It is paramount to herbaria for species and specimens of any consider previous studies of both the taxa given genus is not as straightforward as one under scrutiny and closely related taxa to might think. Many herbaria (even in the achieve effective sampling. It is usually a Western countries) are not digitized, and no mistake to think that one knows about the centralized resource exists where all digitized relevant literature already, and the users are herbaria can be queried jointly. GBIF advised to familiarize themselves with how to (http://www.gbif.org/) nevertheless represents search the literature efficiently (cf. Conn et al. a first step in such a direction, and the user is 2003 and Miller et al. 2009). In particular, it advised to start there. Larger herbaria not often pays off to establish a set of core covered by GBIF may have their own publications and then look for other papers that databases searchable through web interfaces cite these core papers (through, e.g., “Cited by” but otherwise are best queried through an email in Google Scholar). If there is an opportunity to to the curator. Type specimens have a special sequence more than one specimen per taxon of standing in systematics (Hyde and Zhang 2008; interest, this is highly preferable and Ko Ko et al. 2011; McNeill et al. 2012), and particularly important when it comes to poorly the inclusion of type specimens in a study defined taxa and/or at low taxonomic levels. In lends extra weight and credibility to the results most cases it will not be enough to use and to unambiguous naming of generated whatever specimens the local herbarium or sequences. Herbaria may be unwilling to loan culture collection has to offer; rather the user type specimens (particularly for sequencing or should consider the resources available at the any other activity that involves destroying a national and international levels. Ordering part of the specimen, i.e., destructive sampling) specimens or cultures may prove expensive, and may offer to sequence them locally instead and the user may want to consider inviting – or may in fact already have done so. researchers with easy access to such specimens Specimens collected by particularly as co-authors of the study. The invited co- professional taxonomists or that are covered in authors may even oversee the local sequencing reference works should similarly be prioritized. of those specimens, to the point where more For cultures, we recommend the user to start at specimens does not have to mean more costs the CBS culture collection for the researcher.
Load more

Recommended publications
  • Selecting Molecular Markers for a Specific Phylogenetic Problem
    MOJ Proteomics & Bioinformatics Review Article Open Access Selecting molecular markers for a specific phylogenetic problem Abstract Volume 6 Issue 3 - 2017 In a molecular phylogenetic analysis, different markers may yield contradictory Claudia AM Russo, Bárbara Aguiar, Alexandre topologies for the same diversity group. Therefore, it is important to select suitable markers for a reliable topological estimate. Issues such as length and rate of evolution P Selvatti Department of Genetics, Federal University of Rio de Janeiro, will play a role in the suitability of a particular molecular marker to unfold the Brazil phylogenetic relationships for a given set of taxa. In this review, we provide guidelines that will be useful to newcomers to the field of molecular phylogenetics weighing the Correspondence: Claudia AM Russo, Molecular Biodiversity suitability of molecular markers for a given phylogenetic problem. Laboratory, Department of Genetics, Institute of Biology, Block A, CCS, Federal University of Rio de Janeiro, Fundão Island, Keywords: phylogenetic trees, guideline, suitable genes, phylogenetics Rio de Janeiro, RJ, 21941-590, Brazil, Tel 21 991042148, Fax 21 39386397, Email [email protected] Received: March 14, 2017 | Published: November 03, 2017 Introduction concept that occupies a central position in evolutionary biology.15 Homology is a qualitative term, defined by equivalence of parts due Over the last three decades, the scientific field of molecular to inherited common origin.16–18 biology has experienced remarkable advancements
    [Show full text]
  • An Automated Pipeline for Retrieving Orthologous DNA Sequences from Genbank in R
    life Technical Note phylotaR: An Automated Pipeline for Retrieving Orthologous DNA Sequences from GenBank in R Dominic J. Bennett 1,2,* ID , Hannes Hettling 3, Daniele Silvestro 1,2, Alexander Zizka 1,2, Christine D. Bacon 1,2, Søren Faurby 1,2, Rutger A. Vos 3 ID and Alexandre Antonelli 1,2,4,5 ID 1 Gothenburg Global Biodiversity Centre, Box 461, SE-405 30 Gothenburg, Sweden; [email protected] (D.S.); [email protected] (A.Z.); [email protected] (C.D.B.); [email protected] (S.F.); [email protected] (A.A.) 2 Department of Biological and Environmental Sciences, University of Gothenburg, Box 461, SE-405 30 Gothenburg, Sweden 3 Naturalis Biodiversity Center, P.O. Box 9517, 2300 RA Leiden, The Netherlands; [email protected] (H.H.); [email protected] (R.A.V.) 4 Gothenburg Botanical Garden, Carl Skottsbergsgata 22A, SE-413 19 Gothenburg, Sweden 5 Department of Organismic and Evolutionary Biology, Harvard University, 26 Oxford St., Cambridge, MA 02138 USA * Correspondence: [email protected] Received: 28 March 2018; Accepted: 1 June 2018; Published: 5 June 2018 Abstract: The exceptional increase in molecular DNA sequence data in open repositories is mirrored by an ever-growing interest among evolutionary biologists to harvest and use those data for phylogenetic inference. Many quality issues, however, are known and the sheer amount and complexity of data available can pose considerable barriers to their usefulness. A key issue in this domain is the high frequency of sequence mislabeling encountered when searching for suitable sequences for phylogenetic analysis.
    [Show full text]
  • "Phylogenetic Analysis of Protein Sequence Data Using The
    Phylogenetic Analysis of Protein Sequence UNIT 19.11 Data Using the Randomized Axelerated Maximum Likelihood (RAXML) Program Antonis Rokas1 1Department of Biological Sciences, Vanderbilt University, Nashville, Tennessee ABSTRACT Phylogenetic analysis is the study of evolutionary relationships among molecules, phenotypes, and organisms. In the context of protein sequence data, phylogenetic analysis is one of the cornerstones of comparative sequence analysis and has many applications in the study of protein evolution and function. This unit provides a brief review of the principles of phylogenetic analysis and describes several different standard phylogenetic analyses of protein sequence data using the RAXML (Randomized Axelerated Maximum Likelihood) Program. Curr. Protoc. Mol. Biol. 96:19.11.1-19.11.14. C 2011 by John Wiley & Sons, Inc. Keywords: molecular evolution r bootstrap r multiple sequence alignment r amino acid substitution matrix r evolutionary relationship r systematics INTRODUCTION the baboon-colobus monkey lineage almost Phylogenetic analysis is a standard and es- 25 million years ago, whereas baboons and sential tool in any molecular biologist’s bioin- colobus monkeys diverged less than 15 mil- formatics toolkit that, in the context of pro- lion years ago (Sterner et al., 2006). Clearly, tein sequence analysis, enables us to study degree of sequence similarity does not equate the evolutionary history and change of pro- with degree of evolutionary relationship. teins and their function. Such analysis is es- A typical phylogenetic analysis of protein sential to understanding major evolutionary sequence data involves five distinct steps: (a) questions, such as the origins and history of data collection, (b) inference of homology, (c) macromolecules, developmental mechanisms, sequence alignment, (d) alignment trimming, phenotypes, and life itself.
    [Show full text]
  • New Syllabus
    M.Sc. BIOINFORMATICS REGULATIONS AND SYLLABI (Effective from 2019-2020) Centre for Bioinformatics SCHOOL OF LIFE SCIENCES PONDICHERRY UNIVERSITY PUDUCHERRY 1 Pondicherry University School of Life Sciences Centre for Bioinformatics Master of Science in Bioinformatics The M.Sc Bioinformatics course started since 2007 under UGC Innovative program Program Objectives The main objective of the program is to train the students to learn an innovative and evolving field of bioinformatics with a multi-disciplinary approach. Hands-on sessions will be provided to train the students in both computer and experimental labs. Program Outcomes On completion of this program, students will be able to: Gain understanding of the principles and concepts of both biology along with computer science To use and describe bioinformatics data, information resource and also to use the software effectively from large databases To know how bioinformatics methods can be used to relate sequence to structure and function To develop problem-solving skills, new algorithms and analysis methods are learned to address a range of biological questions. 2 Eligibility for M.Sc. Bioinformatics Students from any of the below listed Bachelor degrees with minimum 55% of marks are eligible. Bachelor’s degree in any relevant area of Physics / Chemistry / Computer Science / Life Science with a minimum of 55% of marks 3 PONDICHERRY UNIVERSITY SCHOOL OF LIFE SCIENCES CENTRE FOR BIOINFORMATICS LIST OF HARD-CORE COURSES FOR M.Sc. BIOINFORMATICS (Academic Year 2019-2020 onwards) Course
    [Show full text]
  • Molecular Phylogenetics Suggests a New Classification and Uncovers Convergent Evolution of Lithistid Demosponges
    RESEARCH ARTICLE Deceptive Desmas: Molecular Phylogenetics Suggests a New Classification and Uncovers Convergent Evolution of Lithistid Demosponges Astrid Schuster1,2, Dirk Erpenbeck1,3, Andrzej Pisera4, John Hooper5,6, Monika Bryce5,7, Jane Fromont7, Gert Wo¨ rheide1,2,3* 1. Department of Earth- & Environmental Sciences, Palaeontology and Geobiology, Ludwig-Maximilians- Universita¨tMu¨nchen, Richard-Wagner Str. 10, 80333 Munich, Germany, 2. SNSB – Bavarian State Collections OPEN ACCESS of Palaeontology and Geology, Richard-Wagner Str. 10, 80333 Munich, Germany, 3. GeoBio-CenterLMU, Ludwig-Maximilians-Universita¨t Mu¨nchen, Richard-Wagner Str. 10, 80333 Munich, Germany, 4. Institute of Citation: Schuster A, Erpenbeck D, Pisera A, Paleobiology, Polish Academy of Sciences, ul. Twarda 51/55, 00-818 Warszawa, Poland, 5. Queensland Hooper J, Bryce M, et al. (2015) Deceptive Museum, PO Box 3300, South Brisbane, QLD 4101, Australia, 6. Eskitis Institute for Drug Discovery, Griffith Desmas: Molecular Phylogenetics Suggests a New Classification and Uncovers Convergent Evolution University, Nathan, QLD 4111, Australia, 7. Department of Aquatic Zoology, Western Australian Museum, of Lithistid Demosponges. PLoS ONE 10(1): Locked Bag 49, Welshpool DC, Western Australia, 6986, Australia e116038. doi:10.1371/journal.pone.0116038 *[email protected] Editor: Mikhail V. Matz, University of Texas, United States of America Received: July 3, 2014 Accepted: November 30, 2014 Abstract Published: January 7, 2015 Reconciling the fossil record with molecular phylogenies to enhance the Copyright: ß 2015 Schuster et al. This is an understanding of animal evolution is a challenging task, especially for taxa with a open-access article distributed under the terms of the Creative Commons Attribution License, which mostly poor fossil record, such as sponges (Porifera).
    [Show full text]
  • Molecular Homology and Multiple-Sequence Alignment: an Analysis of Concepts and Practice
    CSIRO PUBLISHING Australian Systematic Botany, 2015, 28, 46–62 LAS Johnson Review http://dx.doi.org/10.1071/SB15001 Molecular homology and multiple-sequence alignment: an analysis of concepts and practice David A. Morrison A,D, Matthew J. Morgan B and Scot A. Kelchner C ASystematic Biology, Uppsala University, Norbyvägen 18D, Uppsala 75236, Sweden. BCSIRO Ecosystem Sciences, GPO Box 1700, Canberra, ACT 2601, Australia. CDepartment of Biology, Utah State University, 5305 Old Main Hill, Logan, UT 84322-5305, USA. DCorresponding author. Email: [email protected] Abstract. Sequence alignment is just as much a part of phylogenetics as is tree building, although it is often viewed solely as a necessary tool to construct trees. However, alignment for the purpose of phylogenetic inference is primarily about homology, as it is the procedure that expresses homology relationships among the characters, rather than the historical relationships of the taxa. Molecular homology is rather vaguely defined and understood, despite its importance in the molecular age. Indeed, homology has rarely been evaluated with respect to nucleotide sequence alignments, in spite of the fact that nucleotides are the only data that directly represent genotype. All other molecular data represent phenotype, just as do morphology and anatomy. Thus, efforts to improve sequence alignment for phylogenetic purposes should involve a more refined use of the homology concept at a molecular level. To this end, we present examples of molecular-data levels at which homology might be considered, and arrange them in a hierarchy. The concept that we propose has many levels, which link directly to the developmental and morphological components of homology.
    [Show full text]
  • Incorporating Molecular Data Into Your Phylogenetic Tree Activity Adapted from Bishop Museum ECHO Project Taxonomy Module and ENSI/SENSI Making Cladograms Lesson
    Incorporating Molecular Data into your Phylogenetic Tree Activity adapted from Bishop Museum ECHO Project Taxonomy Module and ENSI/SENSI Making Cladograms Lesson In addition to morphological data, molecular data, such as DNA sequences, can also tell us about the evolutionary relationships between organisms. For example, in the DNA sequence data below, we can see that the E. coli sequence is very different from the sequences of humans, yeast and corn (this sequence data comes from one slowly evolving gene, called the 16S rRNA gene). This makes sense considering that bacteria are in their own domain, and so their DNA sequences are very different than the other organisms. Your job is to incorporate the DNA sequence data in the following table into your morphological phylogeny from last class. You can consider the tunicate to be the most ancestral species. Examine the sequences, and determine how many DNA bases each organism has in common with the tunicate. It may help to highlight common sequences in different colors. Organism Genotype # of Bases in Common Tunicate (Ancestor) GTAAGCCGTTTAGCGTTAACGTCCGTAGCTAAGGTCCGTAGC 42 Yellowfin 33 tuna GTAAAATTTTTAGCGTTAATTCATGTAGCTAAGGTCCGTAGC Coqui frog GTAAAATTAAAAGCGTTAATTCATGTAGCTAAGGTCCGGCGC 28 Green sea 24 turtle GTATAATTAAAAGCGTTAATTCATGTAGCTTCCGTCCGGCGC Wallaby 18 GTTTAATTAAAAGCGTTCCTTCATGTAGCTTCCACGCGGCGC Hoary bat 16 GTTTAATTAAAAGATTTCCTTCATGTAGCTTCCACGCGGCGC Human 15 GTTTAATTAAAAGATTTCCTTCATGTGGCTTCCACGCGGCGC Material developed for the University of Hawaii-Manoa GK-12 program (NSF grant #05385500). Website: www.hawaii.edu/gk-12/evolution. Duplication for educational purposes only. Enter the number of bases each organism has in common with the tunicate into the phylogeny below: Tunicate Tuna Frog Turtle Wallaby Bat Human ____ bases ____ bases ____ bases ____ bases ____ bases ____ bases Does the molecular data agree with the morphological data? What would you do if the molecular and morphological data do not agree? Material developed for the University of Hawaii-Manoa GK-12 program (NSF grant #05385500).
    [Show full text]
  • Molecular Phylogenetics: Principles and Practice
    REVIEWS STUDY DESIGNS Molecular phylogenetics: principles and practice Ziheng Yang1,2 and Bruce Rannala1,3 Abstract | Phylogenies are important for addressing various biological questions such as relationships among species or genes, the origin and spread of viral infection and the demographic changes and migration patterns of species. The advancement of sequencing technologies has taken phylogenetic analysis to a new height. Phylogenies have permeated nearly every branch of biology, and the plethora of phylogenetic methods and software packages that are now available may seem daunting to an experimental biologist. Here, we review the major methods of phylogenetic analysis, including parsimony, distance, likelihood and Bayesian methods. We discuss their strengths and weaknesses and provide guidance for their use. statistical Systematics Before the advent of DNA sequencing technologies, phylogenetics, creating the emerging field of 2,18,19 The inference of phylogenetic phylogenetic trees were used almost exclusively to phylogeography. In species tree methods , the gene relationships among species describe relationships among species in systematics and trees at individual loci may not be of direct interest and and the use of such information taxonomy. Today, phylogenies are used in almost every may be in conflict with the species tree. By averaging to classify species. branch of biology. Besides representing the relation- over the unobserved gene trees under the multi-species 20 Taxonomy ships among species on the tree of life, phylogenies
    [Show full text]
  • Molecular Phylogenetics: State-Of-The- Art Methods for Looking Into the Past
    262 Review TRENDS in Genetics Vol.17 No.5 May 2001 Molecular phylogenetics: state-of-the- art methods for looking into the past Simon Whelan, Pietro Liò and Nick Goldman As the amount of molecular sequence data in the public domain grows, so occurrence at each sequence site is mathematically does the range of biological topics that it influences through evolutionary modelled by a MARKOV PROCESS. Typically, the same considerations. In recent years, a number of developments have enabled Markov process model is applied to each sequence molecular phylogenetic methodology to keep pace. Likelihood-based inferential site. Different models are distinguished by their techniques, although controversial in the past, lie at the heart of these new assumptions or PARAMETERIZATIONS regarding the methods and are producing the promised advances in the understanding of average rates of occurrence of all the possible sequence evolution. They allow both a wide variety of phylogenetic inferences replacements3. It is now well established that from sequence data and robust statistical assessment of all results. It cannot more complex models, often describing replacement remain acceptable to use outdated data analysis techniques when superior rates in terms of a variety of biological phenomena, alternatives exist. Here, we discuss the most important and exciting methods generally give a statistically better fit to observed currently available to the molecular phylogeneticist. patterns of sequence evolution4–9, giving more accurate and robust estimates both of phylogeny10–12 Only through MOLECULAR PHYLOGENETIC (see Glossary) and the statistical confidence in the phylogeny13. The studies can we understand fully the rapidly development of more accurate models of sequence accumulating genomic sequence data and evolution has been a particularly active and fertile information regarding proteins’ structure and area of research in recent years, in the expectation function.
    [Show full text]
  • Annonex2embl: Automatic Preparation of Annotated DNA Sequences for Bulk Submissions to ENA Michael Gruenstaeudl1
    bioRxiv preprint doi: https://doi.org/10.1101/820480; this version posted October 28, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. annonex2embl: automatic preparation of annotated DNA sequences for bulk submissions to ENA Michael Gruenstaeudl1 1Institut f ¨urBiologie, Freie Universitat¨ Berlin, 14195 Berlin, Germany Email address: [email protected] ABSTRACT Motivation: The submission of annotated sequence data to public sequence databases constitutes a central pillar in biological research. The surge of novel DNA sequences awaiting database submission due to the application of next-generation sequencing has increased the need for software tools that facilitate bulk submissions. This need has yet to be met with a concurrent development of tools to automate the preparatory work preceding such submissions. Results: I introduce annonex2embl, a Python package that automates the preparation of complete sequence flatfiles for large-scale sequence submissions to the European Nucleotide Archive. The tool enables the conversion of DNA sequence alignments that are co-supplied with sequence annotations and metadata to submission-ready flatfiles. Among other features, the software automatically accounts for length differences among the input sequences while maintaining correct annotations, automatically interlaces metadata to each record, and displays a design suitable for easy integration into bioinformatic workflows. As proof of its utility, annonex2embl is employed in preparing a dataset of more than 1,500 fungal DNA sequences for database submission.
    [Show full text]
  • Inferring Biological Networks from Genome-Wide Transcriptional And
    INFERRING BIOLOGICAL NETWORKS FROM GENOME-WIDE TRANSCRIPTIONAL AND FITNESS DATA By WAZEER MOHAMMAD VARSALLY A thesis submitted to The University of Birmingham for the degree of Doctor of Philosophy College of Life and Environmental Sciences School of Biosciences The University of Birmingham July 2013 I University of Birmingham Research Archive e-theses repository This unpublished thesis/dissertation is copyright of the author and/or third parties. The intellectual property rights of the author or third parties in respect of this work are as defined by The Copyright Designs and Patents Act 1988 or as modified by any successor legislation. Any use made of information contained in this thesis/dissertation must be in accordance with that legislation and must be properly acknowledged. Further distribution or reproduction in any format is prohibited without the permission of the copyright holder. ABSTRACT In the last 15 years, the increased use of high throughput biology techniques such as genome-wide gene expression profiling, fitness profiling and protein interactomics has led to the generation of an extraordinary amount of data. The abundance of such diverse data has proven to be an essential foundation for understanding the complexities of molecular mechanisms and underlying pathways within a biological system. One approach of extrapolating biological information from this wealth of data has been through the use of reverse engineering methods to infer biological networks. This thesis demonstrates the capabilities and applications of such methodologies in identifying functionally enriched network modules in the yeast species Saccharomyces cerevisiae and Schizosaccharomyces pombe. This study marks the first time a mutual information based network inference approach has been applied to a set of specific genome-wide expression and fitness compendia, as well as the integration of these multi- level compendia.
    [Show full text]
  • Molecular Phylogenetics Next Two Lectures
    Next two lectures: • What is a phylogenetic tree? • How are trees inferred using molecular data? Molecular phylogenetics • How do you assess confidence in trees and clades on trees? Michael Worobey • Why do trees for different data sets sometimes conflict? • What can you do with trees beyond simply inferring relatedness? Molecular phylogenetics fundamentals Tree terminology All of life is related by common ancestry. Recovering this pattern, the "Tree of Life", is one of the primary goals of evolutionary biology. Even at the A tree is a mathematical structure which is used to model the actual evolutionary population level, the phylogenetic tree is indispensable as a tool for estimating history of a group of sequences or organisms. This actual pattern of historical parameters of interest. Likewise at the among species level, it is relationships is the phylogeny or evolutionary tree which we try and indispensable for examining patterns of diversification over time. First, you estimate. A tree consists of nodes connected by branches (also called need to be familiar with some tree terminology. edges). Terminal nodes (also called leaves, OTUs [Operational Taxonomic Units], external nodes or terminal taxa) represent sequences or organisms for which we have data; they may be either extant or extinct. Phylogenetics interlude Phylogenetics interlude • It’s all about ancestor and All the phylogenetics offspring populations, • Mutations happen when you need to know, in lineages branching genetic material is copied 5 minutes… • The ancestor could
    [Show full text]