Mrna Destabilization Triggered by Premature Translational Termination Depends on at Least Three Cis-Acting Sequence Elements and One Trans-Acting Factor

Downloaded from genesdev.cshlp.org on October 2, 2021 - Published by Cold Spring Harbor Laboratory Press mRNA destabilization triggered by premature translational termination depends on at least three cis-acting sequence elements and one trans-acting factor

Stuart W. Pehz, 1 Agneta H. Brown, and Allan Jacobson 2 Department of Molecular Genetics and Microbiology, University of Massachusetts Medical School, Worcester, Massachusetts 01655 USA

Nonsense mutations in a gene can accelerate the decay rate of the mRNA transcribed from that gene, a phenomenon we describe as nonsense-mediated mRNA decay. Using amber (UAG) mutants of the yeast PGK1 gene as a model system, we find that nonsense-mediated mRNA decay is position dependent, that is, nonsense mutations within the initial two-thirds of the PGKl-coding region accelerate the decay rate of the PGK1 transcript ~<12-fold, whereas nonsense mutations within the carboxy-terminal third of the coding region have no effect on mRNA decay. Moreover, we find that this position effect reflects (1) a requirement for sequences 3' to the nonsense mutation that may be necessary for translational reinitiation or pausing, and (2) the presence of an additional sequence that, when translated, inactivates the nonsense-mediated mRNA decay pathway. This stabilizing element is positioned within the coding region such that it constitutes the boundary between nonsense mutations that do or do not affect mRNA decay. Rapid decay of PGK1 nonsense-containing transcripts is also dependent on the status of the UPF1 gene. Regardless of the position of an amber codon in the PGK1 gene, deletion of the UPF1 gene restores wild-type decay rates to nonsense-containing PGK1 transcripts. [Key Words: Nonsense mutations; mRNA decay; translational termination; protein-coding region; UPF1 gene]

Received April 21, 1993; revised version accepted June 22, 1993.

To a first approximation, changes in the expression of nipulation, we have focused on the yeast Saccharomyces specific genes are manifested by changes in the steady- cerevisiae, developed simple and reliable procedures for state levels of individual mRNAs. Although such measuring mRNA decay rates, and begun to characterize changes are assumed generally to result primarily from the cis-acting sequences and trans-acting factors that differential transcription or RNA processing activities, regulate the rapid decay of inherently unstable mRNAs differences in the decay rates of individual mRNAs can (Herrick et al. 1990; Jacobson et al. 1990; Parker and also have profound effects on the overall levels of expres- Jacobson 1990; Heaton et al. 1992; Herrick and Jacobson sion of specific genes. Although the potential impor- 1992). As in similar studies in higher eukaryotes (for re- tance of mRNA stability as a mechanism for regulating view, see Peltz et al. 1991), we find that unstable yeast gene expression has been recognized (for reviews, see mRNAs contain cis-acting sequences that dictate their Ross 1988; Cleveland and Yen 1989; Atwater et al. 1990; instability and are capable of promoting rapid decay Hentze 1991; Peltz et al. 1991; Peltz and Jacobson 1993), when transferred to appropriate locations within stable the structures and mechanisms involved in the determi- mRNAs (for review, see Pehz and Jacobson 1993). For nation of individual mRNA decay rates have yet to be five different genes (i.e., MATal, HIS3, STE3, STE2, and elucidated. CDC4) we find that such "instabilty elements" can be To address the problem of mRNA stability in an or- found within the coding regions of the respective ganism amenable to both biochemical and genetic ma- mRNAs, an observation suggesting that the processes of mRNA translation and mRNA turnover may be intimately linked. This conclusion is supported further by tPresent address: Department of Molecular Genetics and Microbiology, experiments in yeast demonstrating that (1) the coding University of Medicine and Dentistry of New Jersey, Robert Wood Johnson Medical School, Piscataway, New Jersey 08854-5635 USA. region instability element from the MATal mRNA will 2Corresponding author. destabilize chimeric transcripts unless it is preceded by a

GENES & DEVELOPMENT 7:1737-1754 91993 by Cold Spring Harbor Laboratory Press ISSN 0890-9369/93 $5.00 1737 Downloaded from genesdev.cshlp.org on October 2, 2021 - Published by Cold Spring Harbor Laboratory Press

Peltz et al. nonsense codon that blocks translation through the ele- tations on the decay rate of the PGK1 transcript, a DNA ment (Parker and Jacobson 1990); (2) drugs and muta- tag was inserted into the 3'-untranslated region (UTR) tions that inhibit translational elongation also inhibit (3'-UTR) of the PGK1 gene. Therefore, the mRNA decay mRNA decay (Herrick et al. 1990; Peltz et al. 1992); and rates of wild-type and mutant PGK1 alleles could be (3) nonsense mutations in the URA3, URA1, HIS4, and monitored by RNA blot analysis, hybridizing with a ra- LEU2 genes accelerate the decay rates of the mRNAs dioactive probe specific for only the tag sequence (see transcribed from these genes (Losson and Lacroute 1979; Materials and methods). Insertion of the DNA tag into Pelsy and Lacroute 1984; Leeds et al. 1991). The latter the PGK1 gene or into a pGAL--lacZ fusion neither altered phenomenon, nonsense-mediated mRNA decay, is the the decay rate of the PGK1 transcript nor the f~-galac- focus of this study. tosidase activity of the gene fusion when compared with Previous studies of nonsense-mediated mRNA decay the same genes lacking the tagged sequence (Jacobson et in yeast showed that (1) mRNA destabilization is linked al. 1990; S.W. Peltz, A.H. Brown, and A. Jacobson, un- to premature translational termination, because non- publ.). sense-containing URA3 mRNA is stabilized in a strain To investigate the relationship between the location of containing an amber suppressor tRNA (Losson and La- a nonsense mutation in the PGK1 protein-coding region croute 1979); (2) the extent of destabilization is position and its effect on mRNA half-life, a linker harboring an dependent, because 5' proximal nonsense mutations de- amber codon was inserted (in separate constructs) into stabilize transcripts to a greater degree than those that six restriction sites of the PGK1 gene (Fig. 1B). The mu- are 3' proximal (Losson and Lacroute 1979; Pelsy and tant alleles were transferred to yeast centromere plas- Lacroute 1984; Leeds et al. 1991; Peltz and Jacobson mids and transformed into yeast cells harboring the 1993); and (3) the products of the UPF1 and UPF3 genes rpbl-1 temperature-sensitive allele of RNA polymerase are involved in this degradative pathway, as mutations II (Nonet et al. 1987). The abundance and decay rates of in these genes stabilize mRNAs with nonsense muta- the wild-type and mutant PGK1 mRNAs were deter- tions without affecting the half-lives of most wild-type mined by RNA blotting analyses of RNA isolated at dif- transcripts (Leeds et al. 1991,1992; Peltz and Jacobson ferent times after inhibiting transcription by shifting the 1993). culture to the nonpermissive temperature (36~ The In this paper we have analyzed amber mutants of the results of these experiments indicate that 5' proximal yeast PGK1 gene to delineate further the cis-acting ele- nonsense mutations accelerate the PGK1 mRNA decay ments and trans-acting factors essential for nonsense- rate more than 3' proximal mutations, although the re- mediated mRNA decay. Our analysis focused on the fol- lationship is nonlinear (Fig. 1). Nonsense mutations that lowing four aspects of the nonsense-mediated mRNA de- terminate translation after 455% of the PGKl-coding cay pathway (1) the relationship between the physical sequence accelerate the PGK1 mRNA decay rate -12- position of a nonsense mutation and its effect on mRNA fold. A nonsense mutation that allows translation of turnover; (2) the identification of sequences, in addition 67% of the protein-coding region still decreases the to the nonsense codon, that are required for rapid mRNA PGK1 mRNA half-life fourfold, whereas nonsense muta- decay; (3) an understanding of the basis for the position tions inserted in the last quarter of the PGK1 transcript effect, that is, the resistance of 3' proximal nonsense had no effect (Fig. 1). As internal controls, we measured mutations to nonsense-mediated decay; and (4) the effect the decay rate of an unrelated, stable mRNA encoded by of mutations in the trans-acting factor, Upflp, on the the CYH2 gene and also measured the relative steady- half-lives of PGK1 mRNAs with nonsense mutations lo- state levels of mutant and wild-type PGK1 mRNAs. The cated at various positions within the coding region. decay rate of the CYH2 mRNA was essentially identical in all cells (tl/2 -- 40-44 min), regardless of the nature of their respective PGK1 alleles (Fig. 1B). Steady-state lev- Results els of the wild-type and nonsense-containing PGK1 alleles were compared by RNA blot analysis of equal Destabilization of the PGK1 transcript is dependent amounts of RNA from the time zero points from each of on the position of a nonsense codon within the PGK1 the decay measurements, normalizing to the abundance protein-coding region of the CYH2 mRNA in each sample. The results of these The PGK1 gene was chosen for analysis because it en- experiments demonstrate that the mRNA abundance of codes an abundant, stable mRNA with a half-life of 60 each PGK1 nonsense allele is related directly to the de- min and, therefore, small changes in its decay rate are cay rates of the respective nonsense-containing mRNAs readily detected (Herrick et al. 1990; Parker and Jacobson (Fig. 1B). 1990; Heaton et al. 1992). The transcript of the PGK1 The product of the yeast UPF1 gene is required for the gene is -1400 nucleotides in length with a protein-cod- rapid turnover of mRNAs containing a premature trans- ing region of 1251 nucleotides (Hitzeman et al. 1982). For lational termination codon (Leeds et al. 1991; for review, the purposes of this study, the location of a nonsense see Peltz and Jacobson 1993). Either the upfl-2 mutation mutation in the PGK1 gene is expressed in terms of the or the deletion of the UPF1 gene from the yeast genome percentage of the coding region that will be translated (upflA), will selectively stabilize mRNAs containing before the ribosome's rendezvous with the respective early nonsense mutations, whereas the decay rates of nonsense codon. To monitor the effects of nonsense mu- most other mRNAs are unaffected (Leeds et al. 1991;

1738 GENES & DEVELOPMENT Downloaded from genesdev.cshlp.org on October 2, 2021 - Published by Cold Spring Harbor Laboratory Press

Nonsense-mediated decay of the yeast PGK1 mRNA

Figure 1. RNA blot analysis of the decay of PGK1 nonsense-containing mRNAs. A DNA linker containing amber mutations in all three reading frames was inserted into six restriction sites of a modified PGK1 gene containing an oligonucleotide tag sequence in its 3'-UTR. These linker insertions promote translational termination after PGK1 codons 23, 164, 229, 282, 317, and 385, respectively. For simplicity, the location of each nonsense mutation in the PGK1 transcript is presented as the percentage of the PGK1 protein-coding region that is translated before the amber mutation is encountered, mRNA turnover rates for wild-type and nonsense-containing PGK1 alleles were determined by RNA blot analysis of RNAs isolated at different times after transcription was inhibited by a shift to 36~ (A) Decay of the PGK1 mRNAs was measured in strains RY262 {UPFI+), SWP154(+) (UPFI+), and SWP154(-) (upfl-)(see Materials and methods). The numbers at left correspond to the various PGK1 alleles represented in B: (1) the wild-type PGK1 gene; (2) the PCK1 gene with a nonsense mutation at 92.6% of the coding region (inserted at the BgIII site; 385 PGK1 codons translated); {3) the PGKI gene with a nonsense mutation at 76.2% of the coding region (inserted at the XbaI site; 317 PGK1 codons translated); (4) the PGK1 gene with a nonsense mutation at 67.7% of the coding region [inserted at the H2(1) site; 282 PGK1 codons translated[; [5) the PGK1 gene with a nonsense mutation at 55% of the coding region [inserted at the H2{2) site; 229 PGK1 codons translated]; (6) the PGK1 gene with a nonsense mutation at 39% of the coding region (inserted at the Asp718 site; 164 PGK1 codons translated); (7) the PGK1 gene with a nonsense mutation at 5.6% of the coding region [inserted at the H2{3) site; 23 PGK1 codons translated]. The decay assay, RNA blotting, hybridization, and quantitation of the blots were performed as described previously (Herrick et al. 1990; Parker et al. 1991). (B) mRNA abundance and decay rates for the wild-type and mutant PGK1 alleles in SWP154( + ) (wild-type for the UPF1 gene) or SWP154( - ) (UPFI(-) (a deletion of the UPF1 gene), mRNA abundance was measured by RNA blot analysis of equal amounts of RNA from the time zero points from each of the mRNA decay measurements, normalizing to the abundance of the CYH2 transcript. The decay rate of the CYH2 transcript was determined in the UPF1 § strain. In the schematics, the PGK1 protein-coding sequence is represented by a thick solid bar, noncoding sequences (5' and 3' UTRs) are represented by a thin solid bar, and the oligonucleotide tag is represented by the stippled boxes. {H2) HincII; (Asp) Asp718; (X) XbaI.

Peltz and Jacobson 1993). The effects of the UPF1 gene upflA mutation (Fig. 1). In a upflh strain, all mRNAs on the mRNA decay rates of the six PGK1 nonsense were stable and the extent of mRNA stabilization was alleles were determined in a strain harboring both the position independent. Transcripts from the PGK1 alleles temperature-sensitive RNA polymerase II allele and the containing early nonsense mutations were stabilized

GENES & DEVELOPMENT 1739 Downloaded from genesdev.cshlp.org on October 2, 2021 - Published by Cold Spring Harbor Laboratory Press

Peltz et al.

-12-fold, with half-lives on the order of 60 rain (see Fig. 1A, B; UPFI(-)). The decay rate of the transcript from the PGK1 gene harboring a nonsense mutation located at 67% of the coding region was also -60 min, as were the half-lives of the PGK1 mRNAs whose decay rates were originally unaffected by the insertion of 3'-proximal nonsense codons. The stabilization of the PGK1 mRNAs harboring nonsense mutations in a upflA strain indicates that loss of UPF1 function restores wild-type decay rates. These results also rule out the possibility that insertion of the linker containing the amber codon created an instability element, as the half-lives of wild-type mRNAs that are inherently unstable are not altered in a upflA strain (Leeds et al. 1991; Peltz and Jacobson 1993). Thus, we conclude that destabilization of the mRNAs encoded by PGK1 nonsense alleles was a consequence of the nonsense-mediated mRNA decay pathway. In all subsequent experiments, we exploit these observations to identify cis-acting elements that specifically promote nonsense-mediated mRNA decay, that is, we define such elements as sequences that accelerate mRNA decay in wild-type cells but that are inactivated in strains deleted for the UPF1 gene.

Why should the mRNA-destabilizing effects of nonsense mutations be limited to those that occur "early" in the coding region? The mechanisms by which nonsense mutations promote rapid mRNA decay are not known. Four models that attempt to explain this phenomenon and take into ac- count the observed position effects and a role for translation are considered in Figure 2. Model 1 suggests that an early nonsense codon promotes premature transla- Figure 2. Models for the mechanism of nonsense-mediated tional termination which, in turn, creates a ribosome- mRNA decay. Possible mechanisms by which a nonsense mutation may promote rapid mRNA turnover are depicted. Details free zone on the mRNA that is a target for cellular nu- are provided in the text. (Top) A schematic of a wild-type tran- cleases. In this case, the position effect would be attrib- script with its complement of ribosomes. (Model 1 ) A nonsense- utable to a nuclease requirement for a minimum size of containing mRNA with a ribosome-free zone that is a substrate ribosome-free target. Model 2 suggests that the ribosome for cytoplasmic nucleases (lightning bolts); (Model 2) a non- (or one of its subunits) plays an active role in the decay sense-containing mRNA in which a downstream ribosome (or process. It is proposed that a small fraction of the termi- subunit) seeks a specific simple sequence required to trigger nating ribosomes (or a newly bound ribosome) scan the decay; (Model 3) two nonsense-containing mRNAs, one with an mRNA downstream of the nonsense codon seeking a early nonsense mutation and one with a late nonsense muta- simple sequence (drawn arbitrarily as AGUC). An en- tion, are depicted. A factor (shown as a ball) required for non- counter with the simple sequence would then trigger sense-mediated decay falls off {or is ejected from) ribosomes before they reach the late nonsense codon; (Model 4) a combi- rapid decay, possibly as a consequence of translational nation of models 2 and 3; rapid mRNA decay is depicted as reinitiation or any other form of ribosome pause. The requiring both a downstream sequence and a bound factor (in position effect would be explained as stochastic, that is, addition to a nonsense codon). the likelihood of encountering the simple sequence would diminish as the nonsense codons approach the 3' terminus of the mRNA. Model 3 suggests that rapid mRNA decay is dependent on the concurrence of two the nonsense-mediated mRNA decay pathway. Model 4 events: a ribosome encounter with a nonsense codon and combines the tenets of models 2 and 3, suggesting that a the presence of a specific factor on that ribosome. The ribosome downstream of the nonsense codon requires position effect is explained by proposing that the ribo- both a specific downstream sequence and a bound factor some-associated factor is inactivated as a function of to promote rapid mRNA decay. These models make spe- translational distance. Specific inactivation of the factor cific predictions about cis-acting sequences and trans- would be dependent on translocation through a specific acting factors that are tested in the experiments that sequence and would constitute a mode of regulation for follow.

1740 GENES & DEVELOPMENT Downloaded from genesdev.cshlp.org on October 2, 2021 - Published by Cold Spring Harbor Laboratory Press

Nonsense-mediated decay of the yeast PGK1 mRNA

Nonsense-mediated decay of the PGK1 mRNA struct 7). With this nonsense mutation, removal of requires both a nonsense codon and sequences downstream sequences between 55% and 76% of the downstream of the nonsense codon PGK1 protein-coding region prevented nonsense-mediated mRNA decay (Fig. 3B). Differences in mRNA decay To test whether sequences 3' of a nonsense mutation are rates were confirmed by measurement of mRNA steady- required to promote rapid mRNA decay, we deleted var- state levels. These measurements showed that the abun- ious amounts of the PGK1 protein-coding sequence dance of the mRNAs encoded by the different PGK1 non- downstream of a nonsense mutation located at the PGK1 sense alleles correlated directly with their half-lives H2(3) site (i.e., at 5% of the PGK1 protein-coding region). (data not shown). Moreover, the rapid decay of each of It is important to note that in all of these PGK1 alleles the PGK1 nonsense-containing mRNAs was a conse- ribosomes translate an equivalent amount of the PGK1 quence of the nonsense-mediated mRNA decay path- protein-coding region and that only the quantity of se- way, as these transcripts were stabilized in a upfl- quence downstream of the amber mutation was varied. strain (summarized in the legend to Fig. 3A, B). These PGK1 alleles were transformed into a strain har- The transcripts from the PGK1 alleles containing large boring the temperature-sensitive RNA polymerase II deletions in the coding region had half-lives of 30 min, mutation and mRNA half-lives, and abundances were rather than the 60-min half-life observed for either a determined as before. The results are summarized in Fig- wild-type PGK1 m RNA (cf. Figs. 3 and 1) or nonsense- ure 3A. containing PGK1 mRNAs in a upfl - strain (Fig. 3). This Deletions of the PGK1 protein-coding region that re- result may reflect partial activity of the nonsense-medi- moved sequences between 5.6% and 67.7% (Fig. 3A; ated mRNA decay pathway or the possibility that a de- construct 3), 5.6% and 55% (construct 4), and 5.6% and leted version of a PGK1 gene may be less stable for rea- 39% of the PGK1 protein-coding sequence (construct 5) sons that are not presently understood. Consistent with did not inactivate the nonsense-mediated mRNA decay the latter hypothesis, it has been reported that a PGK1 pathway. The mRNAs encoded by these constructs all transcript with a large in-frame deletion of its coding had half-lives of 5 min. However, mRNA decay rates for region has a 27-min half-life (Heaton et al. 1992). two PGK1 nonsense alleles that deleted either between Results from the deletion analyses indicated that se- 5.6% and 92% or 5.6% and 76.2% of the PGK1 protein- quences downstream of the amber codon are necessary coding region downstream of the amber mutation were for nonsense-mediated mRNA decay. These sequences stabilized - 10-fold (constructs 1,2, respectively). Simi- may encode a specific element or, alternatively, a mini- lar results were observed when sequences downstream of mum amount of nonspecific sequence that is required the nonsense mutation located at 55% of the PGK1 pro- downstream of a nonsense mutation to promote decay. tein-coding region [in the H2(2) site] were deleted (con- We noticed that mRNA from a PGK1 nonsense allele

t 1;2(mln.) Figure 3. Decay rates for PGK1 mRNAs A containing deletions downstream of a non- H2 Asp H2 142 X BDIII UPF(.) UPF(-) (3) (2) (I) sense codon. (A) PGK1 nonsense alleles containing a 5' proximal nonsense muta- 3 63 tion [located in the H2(3) site] and deletions of various amounts of the coding sequence downstream of the nonsense mu- (1)~ 30 48 tation are depicted, and their mRNA decay rates in UPF1 + and upfl - strains are sum- (2) '~[~ 30 57 marized. The PGKl-coding sequence is represented by the solid bar and the se- (3) --E3 5 50 quence that was deleted is represented by the absence of the solid bar. mRNA decay (4) '~[~ 5 63 rates of these PGK1 alleles were determined in either RY262 [UPF(+)] or (5) 5 60 SWP154 [UPF(-)] strains as described in Materials and methods. The deletions B comprise the sequences between {construct 1} 5.6% and 92%, (construct 2) 5.6% and 76.2%, (construct 3) 5.6% and 67.7%, (6) 5 63 (construct 4) 5.6% and 55%, and (construct 5) 5.6% and 39% of the PGK1 protein-coding region. (B) (Construct 6) PGK1 60 ND allele containing a nonsense mutation inserted at 55% of the protein coding sequence [the H2{2) site]; {construct 7) The same PGK1 allele as in construct 6 in which sequences between 55% and 76.2% of the coding sequence downstream of the nonsense mutation were deleted, mRNA half-lives were determined as described in Materials and methods.

GENES & DEVELOPMENT 1741 Downloaded from genesdev.cshlp.org on October 2, 2021 - Published by Cold Spring Harbor Laboratory Press

Peltz et al. that deleted between 5% and 67% of the PGK1 protein- construct 1 with construct 31. Degradation of this coding region was degraded sixfold more rapidly than a mRNA was a result of the nonsense-mediated mRNA transcript from the PGK1 nonsense allele containing a decay pathway, as this transcript was stabilized in a slightly larger deletion {106 nucleotidesl, in which be- upfl- strain (Fig. 4A). Decay of the mRNA encoded by tween 5% and 76% of the PGK1 protein-coding region the PGK1 nonsense allele with the 106-nucleotide frag- was removed (Fig. 3A; cf. construct 2 with 3). To test ment inserted in the opposite orientation was only min- whether this 106-nucleotide region contains a specific imally affected (Fig. 4A; construct 21. These results dem- sequence that can induce the nonsense-mediated mRNA onstrate that there are specific sequences downstream of decay pathway, this DNA fragment was inserted down- an amber mutation that are required to promote non- stream of a 5'-proximal nonsense mutation in a PGK1 sense-mediated mRNA decay. gene with a deletion spanning 5-92% of the PGK1 pro- To determine whether this was a unique sequence in tein-coding region. Inserting the 106-nucleotide frag- the PGK1 gene or whether there were redundant element downstream of a nonsense mutation in a PGK1 ments, small deletions were made downstream of a non- allele lacking most of its coding sequence changed the sense codon located in the H2(31 site of the PGK1 gene. half-life of this transcript from 30 to 3-5 min (Fig. 4A; cf. These deletions removed the regions spanning either be-

Figure 4. Specific sequences are required downstream of the amber codon. (A) The 106-nucleotide downstream element was inserted in both orientations downstream of a 5' proximal nonsense mutation in a PGK1 allele with a large deletion of its coding region (PGK1 allele shown in construct 1 ). mRNA decay rates of these PGK1 alleles were determined in either RY262 {UPF1 +l or SWP154 lupfl-) strains as described in Ma- terials and methods. The RNA blots for these experiments are shown above the schematic representations of the PGK1 alleles. The numbers next to each blot correspond to the PGK1 alleles shown schematically below. In PGK1 allele 2 the downstream element is in the opposite orientation as found in the PGK1 gene, whereas PGK1 allele 3 has the element in the correct orientation. (B) Small deletions in the PGK1 allele harboring a nonsense mutation at 5.6% of the protein-coding region were prepared and are represented schematically in this panel. The segments of PGK1 that were deleted comprised (2) between 55% and 76.6% of the protein-coding region and 13) between 55% and 67.7% of the protein-coding region, mRNA decay rates were determined in UPF1 + strains, and the RNA blots and a summary of the data are shown.

1742 GENES & DEVELOPMENT Downloaded from genesdev.cshlp.org on October 2, 2021 - Published by Cold Spring Harbor Laboratory Press

Nonsense-mediated decay of the yeast PGK1 mRNA tween 55% and 67% or 55% and 76% of the PGK1 pro- dent on the 106-nucleotide element. The 5' and 3' tein-coding region (Fig. 4B). The decay rates of tran- boundaries of the functional element within the 106- scripts from these PGK1 nonsense alleles were deter- nucleotide sequence were identified by the experiments mined as before, and the results are summarized in shown in Figure 5. The 5' proximal deletions that re- Figure 4B. The decay rates of the mRNAs from the PGK1 move between 19 and 79 bp and the 3' deletions that nonsense alleles with the small internal deletions were remove between 25 and 90 bp were prepared and inserted equivalent to the decay rate of the PGK1 nonsense allele downstream of the nonsense codon in the mini-PGK1 lacking the deletions (tl/2 = 3-5 min; Fig. 4B). We con- allele, and the decay rates of the mRNAs synthesized clude from these experiments that there are other down- from these genes were determined as before. Deleting stream sequence elements in the PGK1 gene that can i>34 bp from the 5' end of the downstream element sta- function in an manner analogous to that of the down- bilized the transcript, from a half-life of ~<5 min to -30 stream element located between 55% and 67% of the min (Fig. 5). A 19-bp deletion from the 5' end of the PGK1 protein-coding region. downstream element resulted in an intermediate mRNA decay rate (tl/2 = 15 min; Fig. 5). These results indicated that the 5'-proximal 34 nucleotides of this downstream Characterization of a downstream element required element were necessary to promote nonsense-mediated for nonsense-mediated mRNA decay decay of the mRNA from the mini-PGK1 allele. Remov- The mini-PGK1 gene that contained the 106-nucleotide ing 25 bp from the 3' end of the downstream element had element downstream of a 5'-proximal nonsense muta- no effect on the decay rate of the mini-PGK1 transcript, tion (Fig. 4A; construct 31 is an ideal substrate to analyze whereas deleting either 50 or 75 bp resulted in interme- further the role of the downstream element in the non- diate decay rates (t,/2 = 15 min; Fig. 5); larger 3' dele- sense-mediated mRNA decay pathway. It has a small tions stabilized the transcripts such that they had the coding region, lacks the redundant downstream ele- same decay rates as the PGK1 mRNA lacking the down- ments, and the rapid tumover of its transcript is depen- stream element {Fig. 5). Rapid decay of the transcripts

H2 Asp H2 H2 X Bglll (3) (2) (1)

t~2(min) UPFI (+) (-)

(I) GACTTCATCATTGCTG ATG CTTTCTCTGCTG ATG CCAACACCAAGACTGTCACTGACAAGGAAGGTATTCCAGCTGGCTGGCAAGGGTTGGACAATG GTCCAGAAT 3 60

(2) CTTTCTCTGCTG ATG CCAACACCAAGACTGTCACTGACAAGGAAGGTAI"rCCAGCTGGCTGGCAAGGGTTGGACAATG GTCCAGAAT 15 60

(3) CCAACACCAAGACTGTCACTG ACAAGGAAGGTATTCCAGCTGGCTGGCAAGGGTTGGACA ATG GTCCAGAAT 24 80

(4) GTCACTG ACAAGG AAGGTATTCCAGCTGGCTGGCAAGGGTrGGACA ATG GTCCAGAAT 27 60

(5) TCCAGCTGGCTGGCAAGGGTTGGACA ATG GTCCAGAAT 25 60

(6) TGGACA ATG GTCCAGAAT 27 60

GACTTCATCATTGCTG ATG CTTTCTCTGCTG ATG CCAACACCAAGACTGTCACTGACAAGGAAGGTATTCCAGCTGGCTGGCAAGGGTTGGACAATQ GTCCAGAAT

(7) GACTTCATCATTGCTG ATG CTTTCTCTGCTG ATG CCAACACCAAGACTGTCACTGACAAGGAAGGTA'FTCCAGCTGGCTGG 3 60

(8) GACTTCATCATTGCTG ATG CTTTCTCTGCTG ATG CCAACACCAAGACTGTCACTGA 15 60

(9) GACTTCATCATTGCTG ATG CTTTCTCTGCTG 15 60

(10) GACTTCATCATTGCTG ATG C 26 60

(11) GACTTCATCATTGCTG A 27 60

(12) GACTTCATCATTGCTG CTTTCTCTGCTG CCAACACCAAGACTGTCACTGACAAGGAAGGTATTCCAGCTGGCTGGCAAGGGTTGGACAATG GTCCAGAAT 60 - Figure 5. Deletion analysis of the downstream element. The sequences of the downstream element and of 11 deletion mutants are shown. Downstream elements containing the various deletions were inserted into the mini-PGK1 allele containing a nonsense codon at the H2[3) site Idepicted schematically at the top). Half-lives for the respective PGK1 mRNAs were determined in UPF1 + and upfl- strains as described.

GENES & DEVELOPMENT 1743 Downloaded from genesdev.cshlp.org on October 2, 2021 - Published by Cold Spring Harbor Laboratory Press

Peltz et al. from both deletion series was a result of the nonsense- cay pathway (see Fig. 1). Because specific sequences are mediated mRNA decay pathway, as these mRNAs were required downstream of a nonsense mutation to promote stabilized in a upfl - strain (Fig. 5). Collectively, the de- turnover, a likely explanation for the observation that 3' letion analysis of the 106-nucleotide downstream ele- proximal amber mutations do not promote nonsense- ment in the mini-PGK1 gene revealed that the minimum mediated mRNA decay is that they lack the necessary sequence that is both necessary and sufficient to pro- downstream element. This hypothesis predicts that the mote nonsense-mediated mRNA decay consists of the 5' insertion of a functional downstream sequence element 80 nucleotides. Because two ATG codons lie within this distal to a 3' proximal nonsense mutation should pro- sequence (Fig. 5) we considered the possibility that the mote rapid decay of its transcript. To test this hypothe- role of the downstream element in the nonsense-medi- sis, sequences 3' of the nonsense mutation inserted at ated mRNA decay pathway may be to promote transla- 92% of the PGK1 protein-coding region were replaced tional reinitiation. To assess this possibility, these two with protein-coding regions and a 3'UTR sequence from ATG codons were deleted from the same mini-PGK1 a PGK1 gene harboring downstream elements capable of gene used for the 5' and 3' deletion studies. The half-life promoting nonsense-mediated mRNA decay (see Fig. 6B of the transcript from this PGK1 allele was determined for a schematic of the constructions). The two segments as before, and the results indicate that deleting the two from the PGK1 gene inserted downstream of the non- 5' proximal ATG triplets in the downstream element sense mutation included sequences (1) from 5.6% of the stabilizes the nonsense-containing PGK1 allele - 12-fold protein-coding region to the end of the PGK1 gene (Fig. (Fig. 5; construct 12). Taken together with the larger de- 6B; construct 2) and (2) from 39% of the PGK1 protein- letions analyzed in Figure 5, these results indicate that coding region to the end of the PGK1 gene (construct 3). the first two ATGs (ATG-1 and ATG-2) are important The mRNA decay rates of these PGK1 alleles were un- components of the downstream element. affected by these insertions (Fig. 6A, B, cf. construct 1 with constructs 2 and 3; tl/2 = 60-62 min). These results indicate that 3' proximal nonsense mutations are resis- The position-dependent effects of nonsense tant to the nonsense-mediated mRNA decay pathway for mutations on mRNA turnover are a consequence reasons other than a lack of a specific downstream ele- of modulations in the activity of the nonsense- ment. Consistent with this notion, inserting the same mediated mRNA decay pathway sequences downstream of a nonsense mutation located When between 67% and 76.6% of the PGK1 protein- at 67% of the PGK1 protein-coding region, which par- coding sequence has been translated, the PGK1 tran- tially accelerates PGK1 mRNA turnover (see Fig. 1), script becomes insensitive to the nonsense-mediated de- failed to enhance the mRNA decay of these PGK1 alleles

Figure 6. Downstream elements inserted distal to 3' proximal nonsense mutations in the PGK1 gene do not accelerate mRNA decay. Sequences downstream of 3' proximal nonsense mutations in the PGK1 gene were replaced with PGK1 protein-coding sequences harboring downstream elements. Schematic representations of the PGK1 alleles and a summary of the data are shown in B. The decay rates of these transcripts were determined in a UPF1 + strain, and the RNA blots are shown in A. The numbers next to the RNA blots shown in A correspond to the PGK1 alleles shown in B. The solid bar represents the PGK1 gene, the hatched box represents the nonsense mutation, and the open rectangle represents the sequences that were inserted downstream of the nonsense mutation. The PGK1 alleles represented in 2 and 3 replaced sequences downstream of the nonsense mutation inserted at 92.6% of the coding region, whereas 4 and 5 replaced sequences downstream of a nonsense mutation inserted at 55% of the coding region. The sequences added were as follows: (Construct 1) None, control PGK1 allele with a nonsense mutation inserted at the BglII site (92% of the PGK1 protein-coding region); (construct 2) from 5.6% of the PGK1 protein-coding region to the end of the gene; (construct 3) from 39% of the PGK1 protein-coding region to the end of the gene; (construct 4) from 5.6% of the PGK1 protein-coding region to the end of the gene; (construct 5) from 39% of the PGK1 protein-coding region to the end of the gene.

1744 GENES & DEVELOPMENT Downloaded from genesdev.cshlp.org on October 2, 2021 - Published by Cold Spring Harbor Laboratory Press

Nonsense-mediated decay of the yeast PGK1 mRNA

(Fig. 6A, B, constructs 4 and 5; t,/2 = 15-17 min). This would stabilize a given mRNA, whereas the specific el- result indicates that a nonsense codon at 67% of the ement hypothesis predicts that only specific sequences PGK1 protein-coding region is partially resistant to the would stabilize this transcript. To differentiate between nonsense-mediated mRNA decay pathway. these alternatives, the PGK1 alleles shown in Figure 6 On the basis of these results we considered two hy- were constructed. Sequences from the PGK1 protein- potheses to explain the observation that 3' proximal coding region were inserted in-frame and upstream of the nonsense mutations are resistant to nonsense-mediated nonsense mutation located at 55% of the PGK1 protein- mRNA decay: (1) Translation of a specific region in the coding region [i.e., at the H2(2) site]. As a control, these PGK1 transcript inactivates the nonsense-mediated sequences were inserted in-frame into the wild-type mRNA decay pathway (specific element hypothesis), or PGK1 gene (Fig. 7). The sequences inserted into the (2) factors involved in the nonsense-mediated mRNA de- PGK1 alleles comprised either (1) the amino-terminal cay pathway become inactivated stochastically after ri- 21% of the PGK1 protein-coding region or (2) sequences bosomes translocate a certain distance of the PGK1 tran- between 55-76% of the PGK1 protein-coding region. We script (stochastic inactivation hypothesis). We reasoned reasoned that the PGK1 amino-terminal region would be that we could differentiate between the two hypotheses a nonspecific sequence, as nonsense mutations inserted by comparing the stabilities of PGK1 transcripts in within and near this region promote nonsense-mediated which additional protein-coding sequences were inserted mRNA decay. The PGK1 protein-coding region between upstream of a nonsense mutation that promoted non- 55% and 76% was inserted upstream of a nonsense mu- sense-mediated mRNA decay. The stochastic inactiva- tation because this is the region in the PGK1 gene in tion model predicts that increasing the distance a ribo- which transcripts harboring nonsense mutations change some translocates before reading a nonsense codon from being sensitive to resistant to the nonsense-medi-

Figure 7. Sequences in the PGK1 gene inactivate the nonsense-mediated mRNA decay pathway. The outline of the experimental approach is shown in the top panel and the decay rates of the various PGK1 alleles are shown at the bottom panel. PGK1 protein-coding sequences were inserted in-frame into either the wild-type PGK1 gene or upstream of a nonsense mutation located at the 55% site of the PGK1 protein-coding region. The two segments of the PGK1 coding-region that were inserted into the Asp718 (or KpnI; see Fig. 1) site of the PGK1 alleles (as shown in the top panel) were the following: (1) the amino-terminal 21% of the PGK1 protein-coding sequence, and (21 the segment between 55% and 76.2% of the PGK1 protein-coding region. PGK1 alleles containing these insertions were transformed into the UPF1 + strain, and the decay rates of the respective transcripts were determined. The RNA blots from these decay measurements are shown. The numbers to the left of each blot correspond to the schematic representations of the various PGK1 alleles.

GENES & DEVELOPMENT 1745 Downloaded from genesdev.cshlp.org on October 2, 2021 - Published by Cold Spring Harbor Laboratory Press

Peltz et al. ated mRNA decay pathway (see Fig. 1). We anticipated The position of a nonsense codon governs its effect that if there were a specific stabilizer element in the on mRNA decay PGK1 gene, then this 55-76% region would contain ei- Early work on the effects of nonsense mutations on the ther the complete element or a portion of that element. transcripts of the yeast URA3 and URA1 genes (Losson These experiments showed that inserting the amino- and Lacroute 1979; Pelsy and Lacroute 1984) showed terminal 21% of the PGK1 protein-coding region up- that mRNA destabilization was promoted by amber and stream of a nonsense mutation did not affect mRNA ochre mutations that mapped near mRNA 5' termini but decay rates. The mRNA containing the inserted se- not by similar mutations mapping near mRNA 3' ter- quence had a 4-min half-life (Fig. 7; construct 2), that is, mini. For the PGK1 gene, we, too, find that 5' proximal the same decay rate as the mRNA encoded by the PGK1 nonsense mutations accelerate mRNA decay rates more nonsense allele lacking the inserted sequence (see Fig. 1). than 3' proximal mutations, but the relationship is non- Insertion of the same sequence into the wild-type PGK1 linear (Fig. 1). Nonsense mutations that terminate trans- gene did not affect the decay of its transcript (tl/2 = 60 lation of the PGK1 transcript after ~<55% of the PGK1- rain), demonstrating that this sequence alone cannot coding sequence accelerate the PGK1 mRNA decay rate promote rapid mRNA turnover (Fig. 7; construct 1). -12-fold. A nonsense mutation that allows translation However, inserting the region comprising 55-76% of the of 67% of the protein-coding region decreases the PGK1 PGK1 protein-coding region upstream and in-frame of mRNA half-life fourfold, and nonsense mutations in- the same nonsense codon led to partial stabilization of serted in the last quarter of the PGK1 protein-coding the encoded mRNA from a half-life of 3-5 min to a half- region have no effect on mRNA decay (Fig. 1). life of 15 min (Fig. 6; construct 4). The partial activity of this sequence suggests that the element has not been isolated in its entirety. Inserting the 55-76% region into mRNA destabilization triggered by premature the wild-type PGK1 gene did not affect mRNA decay, translational termination requires sequences demonstrating that this sequence by itself is not an in- downstream of the termination codon stability element (Fig. 7, construct 3). These results rule out the stochastic inactivation model and indicate that The discontinuous relationship between the position of there is a specific sequence in the PGK1 transcript that, a nonsense codon and its effect on mRNA tumover (Fig. when translated, inactivates the nonsense-mediated 1) suggested that sequences downstream of the nonsense mRNA decay pathway. codon may play a role in nonsense-mediated decay, either because they act as sites accessible to nuclease at- Discussion tack or because sequences in addition to a nonsense codon are required to trigger mRNA decay (Fig. 2). A Nonsense mutations accelerate cytoplasmic mRNA series of deletions that remove different amounts of the decay in yeast PGK1 protein-coding region downstream of an early non- In both prokaryotes and eukaryotes nonsense mutations sense mutation demonstrated that sequences 3' of the in a gene can reduce the abundance of the mRNA tran- nonsense codon are necessary to promote nonsense-me- scribed from that gene (Morse and Yanofsky 1969; Los- diated mRNA decay (Fig. 3). Experiments that inserted son and Lacroute 1979; Maquat et al. 1981; Pelsy and small regions of the deleted DNA back into a PGK1 non- Lacroute 1984; Baumann et al. 1985; Nilsson et al. 1987; sense allele, in which most of the protein-coding region Daar and Maquat 1988; Urlaub et al. 1989; Cheng et al. was deleted, demonstrated that a 106-nucleotide se- 1990; Gozalbo and Hohmann 1990; Barker and Beamon quence element, when positioned downstream of the 1991; Gaspar et al. 1991; Leeds et al. 1991; Baserga and nonsense codon, can promote rapid decay of its mRNA Benz 1992; Lim et al. 1992; Cheng and Maquat 1993). (Fig. 4). Although the 106-nucleotide element is specific, Results of this study and others indicate that in S. cere- it is not unique. Deletion of the 106-nucleotide fragment visiae this nonsense-mediated effect can be attributed to from an otherwise intact PGK1 gene containing an early cytoplasmic events that are concurrent with mRNA nonsense mutation did not stabilize the resultant tran- translation. Evidence for the latter comes from experi- script (Fig. 4), indicating that there are redundant 3' cis- ments demonstrating that (1) nonsense mutations en- acting elements in the PGK1 gene that can promote non- hance cytoplasmic mRNA decay rates (Losson and Lac- sense-mediated mRNA decay. route 1979; Pelsey and Lacroute 1984; Leeds et al. 1991; Nucleotides essential to the destabilizing function of Fig. 1), (2) nonsense-containing mRNAs are polysome the 106-nucleotide element were defined by deletion associated (Leeds et al. 1991; He et al. 1993), (3) non- analysis. The 5'-proximal 34 nucleotides of this element sense-suppressing tRNAs and inhibitors of translational were shown to be necessary for nonsense-mediated elongation stabilize nonsense-containing mRNAs (Los- mRNA decay and -80 nucleotides of 5'-proximal se- son and Lacroute 1979; Gozalbo and Hohmann 1990; quence were necessary for function as an independent S.W. Peltz, A.H. Brown, and A. Jacobson, unpubl.), and element. Of three ATGs present in the 106-nucleotide (4) a significant fraction of the protein encoded by the segment, two that are bracketed by identical nucleotides UPF1 gene is cytoplasmic (Peltz et al. 1993; C. Trotta, are located within the sequences essential for destabiliz- A.H. Brown, C. Powers, R. Singer, S.W. Peltz, and A. ing function (Fig. 5). Deleting these ATG codons from Jacobson, unpubl.). the downstream element in the mini-PGK1 nonsense al-

1746 GENES & DEVELOPMENT Downloaded from genesdev.cshlp.org on October 2, 2021 - Published by Cold Spring Harbor Laboratory Press

Nonsense-mediated decay of the yeast PGK1 mRNA lele stabilizes its transcript (Fig. 5). These results suggest containing mRNAs. Preliminary results from experi- that the downstream element may be a site of transla- ments using either a genetic screen for interacting pro- tional reinitiation and that the contexts of ATG-1 and teins, or cell fractionation and microscopy of cells car- ATG-2 within this element may be more suitable for rying an epitope-tagged UPF1 gene, indicate that Upflp translational reinitiation than the context of ATG-3. may associate with several other proteins as well as with Two additional observations support the possibility that polysomes (Peltz et al. 1993; F. He, C. Trotta, S.W. Peltz, the downstream element is a site of translational initia- A.H. Brown, C. Powers, R. Singer, and A. Jacobson, un- tion: (1) Insertion of a stem-loop structure, which inhib- publ.). its both translation initiation and reinitiation, immedi- It is unlikely that the normal function of the UPF1 ately downstream of a nonsense codon stabilizes an gene is anticipatory, that is, that Upflp is solely involved otherwise unstable PGK1 transcript; and (2) 3-aminotri- in the degradation of mRNAs with premature nonsense azole, an inhibitor of amino acid biosynthesis that has r The normal role of the UPF1 gene may be to been shown to reduce the capacity of cells to reinitiate regulate the decay rates of transcripts with upstream translation at downstream start codons (as in the case of open reading frames (for review, see Peltz and Jacobson the GCN4 transcript; Hinnebusch and Liebman 1991) 1993) and control the abundance of unspliced pre- stabilizes mRNAs with nonsense mutations without af- mRNAs that appear in the cytoplasm. Support for the fecting the decay of wild-type transcripts (S.W. Peltz, latter conclusion comes from experiments showing that A.H. Brown, and A.Jacobson, unpubl.). in a upfl - strain, a fraction of the intron-containing pre- mRNAs encoded by the CYH2, RP51 b, and MER2 genes are stabilized up to fivefold and are associated with poly- Nonsense-mediated mRNA decay requires the activity somes (He et al. 1993). of the UPF1 gene product Nonsense suppressors in yeast are either tRNA mutants, Cis-acting stabilizer sequences regulate nonsense- capable of decoding a translational termination codon, or mediated mRNA decay mutants in non-tRNA genes, which enhance the expression of nonsense-containing alleles by other mecha- The 5' cap notwithstanding (Piper et al. 1987), there is nisms. The latter mutants include the allosuppressors, only limited evidence for the existence of cis-acting sta- frameshift suppressors, and omnipotent suppressors bilizer sequences in yeast mRNAs. The experiments de- (Surguchov 1988; Hinnebusch and Liebman 1991). At scribed in this paper indicate that there are sequences least one of these suppressors, upfl, acts by suppressing within the coding region of the PGK1 mRNA that can be nonsense-mediated mRNA decay. Loss of function of the considered formally to be stabilizer sequences as they trans-acting factor, Upflp, leads to the selective stabili- inactivate the nonsense-mediated mRNA decay path- zation of mRNAs containing early nonsense mutations way. Including the nonsense codon, this pathway there- without affecting the decay rates of most other mRNAs fore requires at least three cis-acting elements in mRNA. (Leeds et al. 1991; Peltz and Jacobson 1993; Fig. 1). We observed that nonsense mutations in the PGK1 The effect of the upflA mutation on the turnover of mRNA were only destabilizing if they occurred within the various PGK1 nonsense alleles was position indepen- the first two-thirds of the transcript. The resistance of dent; all of the PGK1 nonsense alleles have mRNA half- 3'-proximal nonsense mutations to nonsense-mediated lives on the order of i hr in a upflA strain (Fig. 1), a result mRNA decay cannot be explained by the lack of an ac- that indicates that loss of UPF1 function restores wild- tive downstream element or the need for a ribosome-free type decay rates to mRNAs that would otherwise have zone within the coding region of the PGK1 mRNA. been susceptible to the enhancement of decay rates pro- Rather, our experiments indicate that there must be se- moted by nonsense codons. These results also demon- quences in the PGK1 mRNA that, when translated, neu- strate that neither the linker used to insert nonsense tralize the destabilizing effects of any downstream non- mutations into the PGK1 gene, nor the PGK1 sequence sense mutations. At least part of these stabilizer se- itself, contained instability elements capable of acceler- quences must be localized to the 55-76% segment of the ating PGK1 mRNA decay rates independent of the non- PGK1 protein-coding region as premature translation sense-mediated mRNA decay pathway. through this segment led to partial stabilization of a non- The UPF1 gene has been cloned and sequenced and sense-containing PGK1 mRNA (Fig. 7). Such a stabiliz- shown to be (1) nonessential for viability, (2) capable of ing element may promote resistance to the nonsense- encoding a 109-kD protein with both zinc finger, nucle- mediated decay pathway by promoting the loss of a otide (GTP)-binding site and RNA helicase motifs, (3) ribosome-associated factor required for nonsense-medi- identical to NAM7, a nuclear gene that was isolated as a ated mRNA decay (Fig. 2; models 3 and 4). high-copy suppressor of mitochondrial RNA splicing A similar, or possibly identical, stabilizing sequence mutations, and (4) partially homologous to the yeast appears to regulate the destabilizing effects of the STE3 SEN1 gene (Leeds et al. 1991,1992; Altamura et al. 1992; 3' UTR. Heaton et al. (1992)have found that the 3' UTR Koonin 1992). The latter encodes a noncatalytic subunit of the STE3 mRNA could not destabilize an intact PGK 1 of the tRNA splicing endonuclease complex (Winey and reporter mRNA but could destabilize a PGK1 mRNA Culbertson 1988), suggesting that Upflp may also be part with a large deletion of its coding region. Because the of a nuclease complex targeted specifically to nonsense- large PGK1 deletion used by Heaton et al. (1992) covers

GENES & DEVELOPMENT 1747 Downloaded from genesdev.cshlp.org on October 2, 2021 - Published by Cold Spring Harbor Laboratory Press

Peltz et al. the 55-76% region characterized in this study, we con- paused at a specific site may expose a downstream nu- sider it possible that the stabilizer element that regulates clease recognition site that could then be cleaved by ei- nonsense-mediated mRNA decay may be the same ele- ther a soluble or a ribosome-bound or ribosome-activated ment that prevents the 3' UTR of the STE3 transcript nuclease. A two-site model, in which the first site po- from promoting rapid mRNA turnover. This hypothesis tentiates the cleavage mechanism and the second site is remains to be tested. the actual position of the nucleolytic attack, is consistent with the deletion data of Figure 5. Moreover, the dependence on a ribosome-bound or ribosome-activated mRNA translation and mRNA turnover are intimately nuclease is consistent with the available data for both linked: possible functions of the necessary the coding region stabilizer element and the UPF1 gene sequences and factors product. We interpret the stabilizer experiments to indi- Experiments reported previously have demonstrated that cate that a translation or destabilization factor falls off ongoing translation is important for promoting or regu- the ribosome as a consequence of traversing the se- lating rapid mRNA turnover (Graves et al. 1987; Gay et quence element and propose that such a factor may be al. 1989; Parker and Jacobson 1990; Wisdom and Lee the protein encoded by either the UPF1 gene or one of 1991; Bemstein et al. 1992; Peltz et al. 1992; for review, the factors with which it interacts. As such, this protein see Peltz et al. 1991; Peltz and Jacobson 1993). Consis- could be (1) a translational initiation factor that is also tent with this linkage of translation and turnover, we required for a reinitiation event that may trigger mRNA find that (1) premature translational termination desta- degradation, (2) a nuclease, activated by a downstream bilizes mRNAs, (2) the extent of such destabilization is reinitiation event, or (3) a factor that promotes an inter- dependent on the relative position of a nonsense muta- action with a specific nuclease or nuclease complex. tion within the coding region, (3)nonsense-containing mRNAs are associated with polysomes (Leeds et al. 1991; He et al. 1993), (4) cycloheximide treatment stabi- Materials and methods lizes PGK1 mRNAs containing nonsense mutations Yeast strains, growth conditions, and (S.W. Peltz, A.H. Brown, and A. Jacobson, unpubl.), and transformation procedures (5) sequences downstream of a nonsense codon are es- The yeast strains used for these studies were RY262 (MATa, sential for mRNA destabilization. his4-519, ura3-52, rpbl-1; Nonet et al. 1987) and SWP154; the As noted above, the downstream sequences may serve latter was prepared by plating PLY154 (MATa upfl-AI::URA3 as a site of translational reinitiation. Although reinitia- ura3-52 rpbl-I his4-38 leu2-1; Leeds et al. 1991) on media con- tion may be the event that triggers decay, alternative taining 5-fluoro-orotic acid (Bach et al. 1979; Guthrie and Fink models can be inferred from the available data. For ex- 1991) and selecting for strains able to grow because of a muta- ample, an essential event in the destabilization process tion in the URA3 gene. PLY154 was generously supplied by P. may be a mRNA-rRNA interaction analogous to that Leeds and M. Culbertson (University of Wisconsin, Madison). Yeast media were prepared as described previously (Sherman et occurring in prokaryotic initiation (Noller 1991) and pro- al. 1986). Synthetic media lacking uracil (for the RY262 strain I posed for mammalian internal initiation (Sonnenberg or lacking uracil and tryptophan (for the SWP154 strain) were 1991). An analysis of possible complementary sequences used to select for and maintain plasmids containing the mutant showed that a 9-nucleotide sequence surrounding the PGK1 genes (Table 1). Yeast transformations were performed by ATG-1 and ATG-2 codons is complementary to se- the lithium acetate procedure (Ito et al. 1983) as modified by quences in yeast 18S rRNA (for review, see Peltz and Schiestl and Gietz (1989). Jacobson 1993). The nucleotides bracketing the third ATG in the 106-nucleotide downstream element will Materials not accommodate this base-pairing scheme and do not show significant complementarity with any region in Restriction enzymes were obtained from Boehringer Mannheim and New England Biolabs. Radioactive nucleotides were ob- the 18S rRNA. Interestingly, a 14-nucleotide sequence tained from either ICN ([~/-32P]ATP) or Amersham ([a- from the instability element of the inherently unstable 32P]dCTP). Oligonucleotides used in these studies (Table 2) MAT~I mRNA (Parker and Jacobson 1990) is also com- were purchased from Operon, Inc., with the exception of the plementary to the same region of 18S rRNA (for review, SMURFT linker (harboring amber codons in all three reading see Peltz and Jacobson 1993). Clearly, these interactions frames), which was purchased from Pharmacia. are only hypothetical and must be weighed in light of models suggesting that this region of rRNA may be in- mRNA decay measurements, RNA preparation, and RNA volved in intramolecular base-pairing (Dams et al. 1988). analysis However, this premise merits attention because substan- tive evidence has emerged in recent years that rRNA has mRNA decay rates were determined in either strains RY262 (UPF1 +) or SWP154 (upfl-). Strain RY262 was transformed a functional role in translation (Dahlberg 1989; Noller with centromere plasmids harboring the URA3 gene and the 1991) and the processes of translation and turnover are PGK1 alleles of interest. Strain SWP154 was transformed with intimately linked (see above). either either YCpPL53 (Leeds et al. 1991), a yeast centromere A likely consequence of either event (i.e., translational plasmid containing both the UPF1 and TRP1 genes [SWP154( + )] reinitiation or mRNA-rRNA base-pairing) may be ribo- or plasmid YCpMS38 (Leeds et al. 1991), a yeast centromere some pausing. We consider it possible that a ribosome plasmid harboring only the TRP1 gene [SWP154(- )] (both plas-

1748 GENES & DEVELOPMENT Downloaded from genesdev.cshlp.org on October 2, 2021 - Published by Cold Spring Harbor Laboratory Press

Nonsense-mediated decay of the yeast PGK1 mRNA

Table 1. PGK1 alleles prepared for this study Plasmid name Description pRIP 1PGK( + Aid) PGK1 gene with a DNA tag inserted into the 3'UT region in the designated (+) orientation. pRIP 1PGK[- AU} Same as pRIP1PGK[ +AU} except the DNA tag was in the opposite orientation. pRIPPGKBglUAG Linker containing amber codons inserted at 92.6% of the PGK1 protein-coding region (BglII site, 1449 bp). pRIPPGKXbaUAG Linker containing amber codons inserted at 76.2% of the PGK1 protein-coding region (XbaI site, 1244 bp). pRIPPGKH2( 1 )UAG Linker containing amber codons inserted at 67.7% of the PGK1 protein-coding region [HincII(1) site, 1138 bp]. pRIPPGKH2(2)UAG Linker containing amber codons inserted at 55% of the PGK1 protein-coding region [HincII(2) site, 979 bp]. pRIPPGKAspUAG Linker containing amber codons inserted at 39% of the PGK1 protein-coding region (Asp718 site, 789 bp). pRIPPGKH2{3)AUG Linker containing amber codons inserted at 5.6% of the PGK1 protein-coding region [HincII(3) site, 361 bp]. pRIPPGKH2(3)A1 PGK1 nonsense allele [linker containing amber codons inserted into the H2(3) site] that deleted between 5.6% and 92.6% of the coding region. pRIPPGKH2(3)a2 PGK1 nonsense allele [linker containing amber codons inserted into the H2(3} site] that deleted between 5.6% and 76.2% of the coding region. pRIPPGKH2(3)A3 PGK1 nonsense allele [linker contalmng amber codons inserted into the H2(3) site] that deleted between 5.6% and 67.7% of the coding region. pRIPPGKH2(3)A4 PGKI nonsense allele [linker containing amber codons inserted into the H2(3) siteI that deleted between 5.6% and 55% of the coding region. pRIPPGKH2(3)A5 PGK1 nonsense allele [linker containing amber codons inserted into the H2(3) site] that deleted between 5.6% and 39% of the coding region. pRIPPGKH2(2)A1 PGK1 nonsense allele [linker containing amber codons inserted into the H2(2) site] that deleted between 55% and 76.2% of the coding region. pRIPPGKH2(2)A2 PGK1 nonsense allele [linker containing amber codons inserted into the H2(2) site] that deleted between 55% and 67.7% of the coding region. pRIPPGKH2{3)AIINI(+) PGK1 nonsense allele described in pRIPPGKH2(3)A1 that contains nucleotides 1139-1244 of PGK1 protein-coding sequence 3' of the nonsense codon. pRIPPGKH2(3)a 1IN 1( - ) PGK1 nonsense allele described in pRIPPGKH2(3)A1 that contains nucleotides 1139-1244 of PGK1 protein-coding sequence in the inverted orientation 3' of the nonsense codon. pRIPPGKH2(3)A6 PGK1 nonsense allele [linker containing amber codons inserted into the H2(3) site] that deleted between 55% and 76.2% of the coding region. pRIPPGKH2(3)A7 PGKI nonsense allele [linker containing amber codons inserted into the H2(3) site] that deleted between 55% and 67.2% of the coding region. pRIPPGKH2(3)A IIN2 PGK1 nonsense allele described in pRIPPGKH2(3)dil that contains the complete downstream element inserted 3' of the nonsense codon. pRIPPGKH2(3)A 1IN3 PGK1 nonsense allele described in pRIPPGKH2(3)A1 that harbors the downstream element with the 5' 19 bp deleted inserted 3' of the nonsense codon. pRIPPGKH2(3)A 1IN4 PGK1 nonsense allele described in pRIPPGKH2(3)al that harbors the downstream element with the 5' 34 bp deleted inserted 3' of the nonsense codon. pRIPPGKH2(3)A 1IN5 PGK1 nonsense allele described in pRIPPGKH2(3)A1 that harbors the downstream element with the 5' 49 bp deleted inserted 3' of the nonsense codon. pRIPPGKH2(3)A 1IN6 PGKI nonsense allele described in pRIPPGKH2(3)A1 that harbors the downstream element with the 5' 79 bp deleted inserted 3' of the nonsense codon. pRIPPGKH2{3)A IIN7 PGK1 nonsense allele described in pRIPPGKH2(3)A1 that harbors the downsteam element with the 5' bp deleted inserted 3' of the nonsense codon. pRIPPGKH2(3)A 1IN8 PGK1 nonsense allele described in pRIPPGKH2(3)A1 that harbors the downstream element with the 3' 25 bp deleted inserted 3' of the nonsense codon. pRIPPGKH2(3)A 1IN9 PGKI nonsense allele described in pRIPPGKH2(3)A1 that harbors the downstream element with the 3' 50 bp deleted inserted 3' of the nonsense codon. pRIPPGKH2(3)AIIN10 PGK1 nonsense allele described in pRIPPGKH2(3)A1 that harbors the downstream element with the 3' 75 bp deleted inserted 3' of the nonsense codon. pRIPPGKH2(3}AIIN11 PGK1 nonsense allele described in pRIPPGKH2(3)dil that harbors the downstream element with the 3' 86 bp deleted inserted 3' of the nonsense codon. pRIPPGKH2(3)IN 12 PGK1 nonsense allele described in pRIPPGKH2(3)A1 that harbors the downstream element with the 3' 90 bp deleted inserted 3' of the nonsense codon. pRIPPGKH2(3)A 11N2AATG PGK1 nonsense allele described in pRIPPGKH2[3)A1 that contains the downstream element with the two 5'-proximal ATG codons deleted inserted 3' of the nonsense codon.

(Table 1 continued on following page)

GENES & DEVELOPMENT 1749 Downloaded from genesdev.cshlp.org on October 2, 2021 - Published by Cold Spring Harbor Laboratory Press

Peltz et al.

Table 1. (Continued)

Plasmid name Description pRIPPGKBglIN 1 PGK1 nonsense allele (linker containing amber codons inserted into the BglII site) in which the PGK1 sequence between the H2(3) and the end of the gene was inserted 3' of the nonsense mutation. pRIPPGKBglUAGIN2 PGK1 nonsense allele (linker containing amber codons inserted into the BglII site) in which the PGK1 sequence between the Asp718 and the end of the gene was inserted 3' of the nonsense mutation. pRIPPGKH2( 1 )UAGIN3 PGK1 nonsense allele [linker containing amber codons inserted into the H2(1) site] in which the PGK1 sequence between the H2(3) and the end of the gene was inserted 3' of the nonsense mutation. pRIPPGKH2( 1 )UAGIN4 PGKI nonsense allele [linker containing amber codons inserted into the HincII(1) site] in which the PGK1 sequence between the Asp718 and the end of the gene was inserted 3' of the nonsense mutation. pRIPPGKAspIN2 Wild-type PGK1 allele containing the amino-proximal 21% of the PGKl-coding region inserted in-frame into Asp718 site of the PGK1 gene. pRIPPGKAspIH2(2)UAGIN2 PGK1 nonsense allele [linker containing amber codons inserted into the HincII(2) of the PGK1 gene] containing the amino-proximal 21% of the PGKl-coding region inserted in-frame into the Asp718 site of the PGK1 gene. pRIPPGKKpnlN1 Wild-type PGK1 allele containing between 55% and 76.2% of the PGKl-coding region inserted in-frame into KpnI site of the PGKI gene. pRIPPGKKpnH2{2)IN1 PGK1 nonsense allele [linker containing amber codons inserted into the HincII(2) of the PGK1 gene] containing between 55% and 76.2% of the PGKl-coding region inserted in-frame into the KpnI site of the PGK1 gene.

mids were generously provided by P. Leeds and M. Culbertson). grown to mid-log phase {OD6o o = 0.5-0.7) at 24~ centrifuged, Centromere plasmids containing the URA3 gene and one of the resuspended in 18 ml of the same medium, and incubated at various PGK1 alleles {see Table 1) were then transformed into 24~ for 10 min. Transcription was inhibited by thermal inac- SWP154( + ) and SWP154( - ). mRNA decay rates were measured tivation of RNA polymerase II by shifting the concentrated cul- as described previously (Herrick et al. 1990), with the following ture to 36~ by the addition of 18 ml of medium preheated to modifications. In brief, cultures (100 ml) of yeast cells were 50~ After the temperature shift, the culture was maintained at

Table 2. List of oligonucleotides

I. 5'-CGATAGTAATATTTATATATTTATATTTTTAAAATATTTATTTATTTATTTATTTATTTAAGAT-3' 2. 5'-CGATCTTAAATAAATAAATAAATAAATATTTTAAAAATATAAATATATAAATATTACTAT-3' 8. 5'-AATAGATCTATTCTGGACCATTGTCCAA-3' 4. 5'-AGTCCTAGCTAGCTAGGACTTC-3' 5. 5'-AGTCGCTAGCTAGCTAGCTTTCTCTGCTGATG-3' 6. 5'-GGTCGCTAGCTAGCCAACACCAAGACTGTCACT-3' 7. 5'-GGTCGCTAGCTAGGTCACTGACAAGGAAGGTA-3' 8. 5'-GGTCGCTAGCTAGTCCAGCTGGCTGGCAAGGGT-3' 9. 5'-GGTCGCTAGCTAGTGGCAAGGGTTGGACAATGGT-3' 10. 5'-AATAGATCTCCAGCCAGCTGCAATACC-3' 11. 5'-AATAGATCTTCAGTGACAGTCTTGGTG-3' 12. 5'-AATAGATCTCAGCAGAGAAAGCATCAG-3' 13. 5'-CTAGCTAGGACTTCATCATTGCTGATGCA-3' 14. 5'-GATCTGCATCAGCAATGATGAAGTCCTAG-3' 15. 5'-CTAGCTAGGACTTCATCATTGCTGAS-3' 16. 5'-GATCTCAGCAATGATGAAGTCCTAG-3' 17. 5'-CTAGCTAGGACTTCATCATTGCTGAT(A-T-C)CTTTCTCTGCTGAT(A-T-C)CCAACACCAAGAC TGTCACTGACAAGGAAGGTATTCCAGCTGGCTGGCAAGGGTTGGACAAT(A-T-C)GTCCAGAATCTA G-3' 18. 5'-CTAGCTAGATTCTGGAC(A-T-G)ATTGTCCAACCCTTGCCAGCCAGCTGGAATACCTTCCTTTGTCA GTGACAGTCTTGGTGTTGG(A-T-G)CAGCAGAGAAAG(A-T-G)ATCAGCAATGATGAAGTCCTAG-3' 19. 5'-AGTCCTAGCTAGCTAGGACTTCATCATTGCTGCTTTCTCTGCTGCCAACAAGACTGTCACTGACAA-3' 20. 5'-GGAAGGGTACCATGTCTTTATCTTCAAAG-3' 21. 5'-GGAAGGGTACCCAACAATGATTGCAATTC-3' 22. 5'-GGAAGGTACCGACTCTATCATCATTGGGT-3' 23. 5'-TTTCGGTACCTGGACCATTGTCCAACC-3'

1750 GENES & DEVELOPMENT Downloaded from genesdev.cshlp.org on October 2, 2021 - Published by Cold Spring Harbor Laboratory Press

Nonsense-mediated decay of the yeast PGK1 mRNA

36~ with shaking and aliquots (4 ml) were removed at various pared from the PGK1 allele containing the AU-rich sequence in times. Upon removal of an aliquot, cells were collected by rapid the - AU orientation. centrifugation, the supernatants were removed by aspiration, Preparation of PGK1 alleles with coding region nonsense mu- and the cell pellets were frozen quickly in dry ice. Routinely, tations The BarnHI-HindIII DNA fragment from pRIPPGK 9cells were frozen within 15 sec of removal of the culture aliquot. (-AU) was subcloned into the BamHI-HindIII sites of plasmid Total yeast RNA was isolated as described previously (Herrick pUC9 (Yanisch-Perron et al. 1985), yielding the plasmid et al. 1990; Parker et al. 1991). Equal amounts (usually 10-20 pucgPGK{- AU). Plasmid pucgPGK(- AU) was cleaved sub- ~g) of total RNA from each time point of an experiment were sequently either completely or partially (see below) with restric- analyzed by Northern blotting (Thomas 1980). Gels were tion enzymes HincII, Asp718, XbaI, and BglII. The Asp718, stained with ethidium bromide before and after blotting to as- XbaI, and BglII sites were filled in using DNA polymerase Kle- sess the efficiency of RNA transfer and to confirm the equal now fragment, and an oligonucleotide linker containing an am- loading of RNA. When oligonucleotide probes were used blots ber mutation in all three reading frames was inserted into these were prehybridized in 6x SSC, 1% SDS, and 10x Denhardt's sites by standard procedures (Sambrook et al. 1989). The se- solution for 1-2 hr and hybridized in the same buffer with 10s quence of the linker harboring the amber codons is 5'- cpm of the radiolabeled oligonucleotide overnight. Blots were CTAGCTAGCTAG-3' (the NheI restriction site is underlined). washed twice in 6 x SSC, 0.1% SDS, at room temperature for 15 Because there are three HincII sites in the PGKI gene and an min and washed once in the same solution at 55~ for 30 min. additional XbaI site in the pUC9 plasmid, pUC9PGK(-AU) Hybridizations using probes prepared by random priming (see was cleaved partially with XbaI and HincII; 8 ~g of below) were performed as described previously (Herrick et al. pUC9PGK( - AU) was mixed with 20 units of HincII or XbaI in 1990). Northern blots were quantitated by using a Betagen Blot an 80-~1 reaction mixture and, at different times (i.e., 0--120 Analyzer (Betagen, Waltham, MA.; Herrick et al. 1990). Data are min), 10 ~1 aliquots were removed and digestion quenched by expressed as the loglo of the percentage of each RNA remaining adding 2 ~1 of 0.5 M EDTA and heating to 65~ for 15 min. The versus time at 36~ Reproducibility of mRNA decay rate mea- DNA fragments that were cleaved only once by these enzymes surements was ---15%. mRNA turnover rates for the PGK1 al- were isolated by gel electrophoresis. Linker insertion was con- leles shown in Figure 1 were the same in RY262 and SWP1541 + 1 firmed by DNA restriction analysis and DNA sequencing. The cells. following plasmids resulted from these constructions and are schematically represented in Figure 1B (the numbers next to the Preparation of radioactive probes plasmid names correspond to the PGK1 alleles cartooned in Fig. 1B; site numbers refer to specific PGK1 nucleotides): (2) DNA probes were labeled to high specific activity with pUC9PGKBglUAG, nonsense mutation inserted at 92.6% of the [ot-32PO4] dCTP (Feinberg and Vogelstein 1983) or by 5' end la- PGK1 protein-coding region (site 1449); (3) pUC9PGKXbaUAG, beling of single-stranded oligodeoxynucleotides with [~/-32PO4] nonsense mutation inserted at 76.2% of the PGK1 protein-cod- ATP (Sambrook et al. 1989). Oligonucleotide 1 (Table 2) was ing region (site 1244); (4) pUC9PGKH2(1)UAG, nonsense mu- used to monitor mRNA decay of the PGK1 alleles listed in tation inserted at 67.7% of the PGK1 protein-coding region (site Table 1. The 506-bp AccI-EcoRI fragment in M13mp9 was used 1138); (5) pUC9PGKH2(2)UAG, nonsense mutation inserted at to prepare a radioactive probe to monitor the decay of the CYH2 55% of the PGK1 protein-coding region (site 979); (6) pUC9PG- mRNA (Kaufer et al. 1983). KAspUAG, nonsense mutation inserted at 39% of the PGK1 protein-coding region (site 789); (7) pUC9PGKH213)UAG, non- Plasmid constructions sense mutation inserted at 5.6% of the PGK1 protein-coding region (site 361). The BamHI-HindIII DNA fragments contain- Preparation of the wild-type PGK1 gene with a DNA "'tag" ing the PGK1 alleles from these plasmids were subcloned into inserted into its 3' UTR The 2.1-kb BamHI-HindIII fragment the yeast centromere plasmid pRIP1, yielding the following encompassing the wild-type PGK1 gene was cloned into the plasmids: pRIPPGKH2(3)UAG, pRIPPGKAspUAG, pRIPPGKH- BamHI and HindIII sites of the yeast centromere plasmid pRIP1 2(2)UAG, pRIPPGKH2(1)UAG, pRIPPGKXbaUAG, and pRIPP- yielding plasmid pRIP1PGK. Plasmid pRIPl harbors the URA3 GKBglUAG. gene, which is used as a selectable marker (Parker and Jacobson 1990). The nucleotide positions cited for the PGK1 gene are Preparation of PGK1 alleles with deletions of the protein-cod- derived from the EMBL Database (accession number M17195). ing region downstream of a 5'-proximal nonsense mutation To distinguish the transcripts of the PGK1 alleles of interest The PGK1 alleles cartooned in Figure 3, A and B, were prepared from the endogenous PGK1 mRNA, a DNA tag (encoding the using the PGK1 nonsense alleles described above. The PGK1 AU-rich element in the 3' UTR of the GM-CSF gene (Shaw and deletion alleles in Figure 3A were prepared as follows (the num- Kamen 1986) was inserted into the ClaI site (basepair 1561) bers next to the plasmid names correspond to the PGK1 alleles located in the 3' UTR of the PGK1 gene. The double-stranded cartooned in Fig. 3A): (1) plasmid pucgPGKH2{3)A1 (deletion DNA fragment encoding the DNA tag was prepared by anneal- between 5.6% and 92.6% of the PGK1 protein-coding region) ing oligodeoxynucleotides 1 and 2 (Table 2). Each oligonucle- was prepared by cleaving plasmids pUC9PGKH2(3)UAG and otide (7.5 ~g) was added to a 10-~1 reaction containing 10 mM pucgPGKBglUAG with BamHI and NheI, isolating the 0.6-kb Tris (pH 7.5), 1.0 mM EDTA, and 100 mM NaC1 and the mixture fragment of the former and the 2.45-kb fragment of the latter, was incubated at 65~ for 15 min, 57~ for 1 hr, 37~ for 1 hr, and ligating these DNA fragments together; (2) plasmid pucg- and at room temperature for 1 hr. Using standard procedures PGKH2(3)a2 (deletion between 5.6% and 76.2% of the PGK1 (Sambrook et al. 1989), the duplex DNA was inserted into plas- protein-coding region) was prepared by cleaving plasmids mid pRIP1PGK that was cleaved with ClaI. The plasmids con- pucgPGKH2(3)UAG and pucgPGKXbaUAG with BarnHI and taining DNA insertions were sequenced, and the PGK1 gene NheI, isolating the 0.6-kb fragment of the former and the 2.65- with the DNA tag inserted in the same orientation as in the kb fragment of the latter, and ligating them together; (3) plasmid GM-CSF gene were called pRIPPGK( + AU), whereas insertions pucgPGKH2(3)A3 (deletion between 5.6% and 67.7% of the in the reverse orientation were called pRIPPGK(-AU). The PGK1 protein-coding region) was prepared by cleaving plasmids PGK1 alleles constructed in this study were subsequently pre- pucgPGKH2(3)UAG and pucgPGKH2(IlUAG with BamHI

GENES & DEVELOPMENT 1751 Downloaded from genesdev.cshlp.org on October 2, 2021 - Published by Cold Spring Harbor Laboratory Press

Peltz et al. and NheI, isolating the 0.6-kb fragment of the former and the tions of these genes are shown in Figure 6B (the numbers next to 2.76-kb fragment of the latter, and ligating them together; (4) the plasmid names correspond to the PGK1 alleles cartooned in plasmid pUC9PGKH2(3)A4 (deletion between 5.6% and 55% of Fig. 6). Plasmids pUC9PGKBglUAG, pUC9PGKH2(1)UAG, the PGK1 protein-coding region) was prepared by cleaving plas- pUC9PGKH2(3)UAG, and pUC9PGKAspUAG, were cut with raids pucgPGKH2(3)UAG and pUC9PGKH2(2)UAG with NheI and HindIII, and the respective 4.0-kb, 3.69-kb, 1.35-kb, BamHI and NheI, isolating the 0.6-kb fragment of the former and 0.86-kb DNA fragments were isolated. The 4.0-kb DNA and the 2.92-kb fragment of the latter and ligating them to- fragment from plasmid pUC9PGKBglUAG was ligated to either gether; (5) plasmid pUC9PGKH2(3)A5 (deletion between 5.6% the 1.35- or the 0.86- kb DNA fragments isolated from plasmids and 39% of the PGK1 protein-coding region) was prepared by pucgPGKH2(3)UAG and pucgPGKAspUAG and resulted in cleaving plasmids pUC9PGKH2(3)UAG and pucgPGKBglUAG the following plasmids, respectively: (2) pUC9PGKBglIN1 and with BamHI and NheI, isolating the 0.6-kb fragment of the (3) pucgPGKBglIN2. The 3.69-kb DNA fragment isolated from former and the 3.11-kb fragment of the latter, and ligating them plasmid pUCPGKH2(1)UAG was ligated to either the 1.35- or together. The PGK1 allele represented in Figure 3B [plasmid the 0.86-kb DNA fragments isolated from plasmids pucgPGK- pUC9PGKH2(2)A1], which is a deletion between 55% and H2{3)UAG and pUC9PGKAspUAG, yielding plasmids [3) pUC- 76.2% of the PGK1 protein-coding region (see Fig. 2B; construct 9PGKH2( 1)IIN3 and (4) pUC9PGKH2( 1)IN4. 7), was prepared by cleaving plasmids pUC9PGKH2(2)UAG and The BamHI-HindIII DNA fragments containing the PGK1 pUC9PGKXbaUAG with BamHI and NheI, isolating the 1.29- alleles from these plasmids were subcloned into the yeast cen- kb fragment of the former and the 2.65-kb of the latter, and tromere plasmid pRIP1, yielding plasmids pRIPPGKH2(3)AIIN- ligating them together. 1(+) and pRIPPGKH2(3)AIINI(- ), pRIPPGKBglIN1, pRIPPGK- PGK1 alleles represented in Figure 4B were constructed as BglIN2, pRIPPGKH2( 1)IN3, and pRIPPGKH2( 1 )lIN4. follows: Plasmid pUC9PGKH2(2)A2 (deletion between 55% and 67.7% of the PGK1 protein-coding region) was prepared by Preparation of PGK1A alleles containing portions of the down- cleaving plasmids pUC9PGKH2(2)UAG and pUC9PGKH2(1)- stream element For those constructions in which specific UAG with BamHI and NheI, isolating the 1.29-kb fragment of fragments were generated by PCR, reaction mixtures (50 ~1) the former and the 2.76-kb of the latter, and ligating them to- contained 200 ng of primers, 50 ng of template, and 2.5 units of gether. Plasmid pucgPGKH2(3)A6 (deletion between 55% and Taq polymerase. Reactions were cycled 25 times, extracted 76.2% of the PGK1 protein-coding region; Fig. 4B, construct 2) twice with phenol-chloroform and ethanol precipitated, and was prepared by cleaving plasmids pUC9PGKH2(3)UAG and the DNA fragments were then cleaved with restriction enzymes pUC9PGKH2(2)A1 with BamHI and Asp718, isolating the 1.03- of interest. After digestion, DNA samples were phenol ex- kb fragment of the former and the 2.84-kb of the latter, and tracted and ethanol precipitated and then ligated directly to the ligating them together; pUC9PGKH2(3)A7 (deletion between vector of choice. 55% and 67.7% of the PGK1 protein-coding region; Fig. 4B, The 5' and 3' deletions of the DNA fragment located between construct 3) was prepared by cleaving plasmids pUC9PGKH2- 67.7% and 76.2% of the PGK1 protein-coding region, which (3)UAG and pUC9PGKH2(2)A2 with BamHI and Asp718, iso- harbors the downstream element, were synthesized by PCR, lating the 1.03-kb fragment of the former and the 2.95-kb frag- cleaved with NheI and BglII, and ligated to the 2.45-kb NheI- ment of the latter, and ligating them together. The BamHI- BglII fragment from pUC9PGKH2(3)UAG. The sequence of the HindIII DNA fragments containing the PGK1 alleles from the DNA fragments synthesized by PCR were confirmed by DNA plasmids described above were subcloned into the yeast cen- sequencing. The names of the plasmids and primers used in the tromere plasmid pRIP1, yielding the following plasmids: PCR reactions are described below (the PCR primers are num- pRIPPGKH2(3)A1, pRIPPGKH2{3)A2, pRIPPGKH2(3)A3, pRIPP- bered and described in Table 2; the numbers in brackets next to GKH2(3)A4, pRIPPGKH2(3)A5, pRIPPGKH2(3)A6, pRIPPGKH2- the plasmid names refer to the PGK1 alleles represented sche- (3)a7, pRIPPGKH2{2)A1, and pRIPPGKH2(2)A2. matically in Fig. 5; the deletions endpoints of the downstream element are shown in Fig. 5). 5'-Deletion series--(1) [pUC9PG- Preparation of PGK1A alleles with a downstream element in- KH2(3)AIIN2 (complete downstream element], PCR primers (3) serted 3' of the nonsense mutation Schematic representations and (4); (2) [plasmid pUC9PGKH2(3)AIIN3 (5'A19], PCR prim- of these genes are shown in Figure 3A. The DNA fragment ers (3) and (5};(3)[pUC9PGKH2(3)AIIN4 (5'A34)], PCR primers encompassing the downstream element between 67.6% and (3) and (6);(4)[pUC9PGKH2{3)AIIN5 (5'A49)1, PCR primers (3) 76.2% (nucleotides 1139-1244) of the PGK1 protein-coding re- and (7); (5)[pUC9PGKH2(3)AIIN6 (5'A64)], PCR primers (3)and gion was isolated from plasmid pucgPGKH2(1)UAG by first (8); (6) [pUC9PGKH2(3)AIIN7 (5'a79)], PCR primers (3) and (8). cleaving this plasmid with XbaI and filling in the 5' overhang 3' Deletion series--(7)[pUCgPGKH2(3)AIIN8 {3'a25)], PCR with DNA polymerase Klenow fragment. The DNA linker en- primers (4) and (10); (8) [pUCgPGKH2(3)AIIN9 (3'A501], PCR coding these amber codons (see above) was blunt-end ligated to primers (4) and (11); (9)[pUC9PGKH2(3)AIIN10 (3'a75)], PER this DNA, which was subsequently cut with the restriction primers (4) and (12). The two additional 3' deletions of the enzyme NheI. This DNA fragment was isolated and subcloned downstream element were prepared by hybridizing two oligo- into the NheI site of vector pUC9PGKH2(3)A1. The orientation nucleotides and ligating the double-stranded DNA to the 2.45- of the insert in this plasmid was determined by DNA sequenc- kb fragment from pucgPGKH2(3)UAG that was cut with NheI ing. pUC9PGKH2(3)AIN 1(+) contains the DNA fragment in the and BglII. These include (10) pUC9PGKH2(3)AIINll (3'A86), same orientation as that found in the PGK1 gene, whereas oligonucleotides (13)and (14); (11)pUC9PGKH2(3)AIIN12 pUC9PGKH2(3)A 1IN 1( - ) contains the downstream element in (3'A90), oligonucleotides (15) and (16). The BamHI-HindIII the reverse orientation. The BamHI-HindIII DNA fragment DNA fragments containing the PGK1 alleles from these plas- containing the PGKI alleles from the plasmids described above raids were subcloned into the yeast centromere plasmid pRIP1, were subcloned into the yeast centromere plasmid pRIP1, yield- yielding the following plasmids: pRIPPGKH2(3)AIIN2, pRIPP- ing plasmids pRIPPGKH2(3)AIINI(+) and pRIPPGKH2(3)A1- GKH2(3)AIIN3, pRIPPGKH2(3)AIIN4, pRIPPGKH2(3)AIIN5, INli-}. pRIPPGKH2(3)AIIN6, pRIPPGKH2(3)AIIN7, pRIPPGKH2(3)A1- Preparation of PGK1 alleles with downstream elements in- IN8, pRIPPGKH2(3)AIIN9, pRIPPGKH2(3)AIIN10, pRIPPGKH- serted distal to 3' nonsense mutations Schematic representa- 2(3)AIIN11, and pRIPPGKH2{3)AIIN12.

1752 GENES & DEVELOPMENT Downloaded from genesdev.cshlp.org on October 2, 2021 - Published by Cold Spring Harbor Laboratory Press

Nonsense-mediated decay of the yeast PGK1 mRNA

Preparation of a PGK1 allele lacking ATG-1 and ATG-2 in the Baserga, S.J. and E. J. Benz, Jr. 1992. f~-globin nonsense muta- downstream element A DNA fragment containing a deletion tion: Deficient accumulation of mRNA occurs despite nor- of the two 5' proximal ATG codons in the downstream element mal cytoplasmic stability. Proc. Natl. Acad. Sci. 89: 2935- was synthesized by using oligonucleotide primers 4 and 19 de- 2939. scribed in Table 2. The DNA fragment was subsequently Baumann, B., M.J. Potash, and G. Kohler. 1985. Consequences of cleaved with NheI and BglII and ligated to the 2.45-kb fragment frameshift mutations at the immunoglobulin heavy chain from pucgPGKH2(3)UAG. DNA sequence analysis was used to locus of the mouse. EMBO J. 4: 351-359. confirm the authenticity of the DNA fragment synthesized by Bernstein, P., D. Herrick, R.D. Prokipcak, and J. Ross. 1992. PCR. This PGK1 allele is schematically represented in Figure 5, Control of c-myc mRNA half-life in v/tro by a protein capa- construct 12. ble of binding to a coding region stability determinant. Genes & Dev. 6: 642-654. Preparation of PGK1 alleles containing coding region Cheng, J. and L.E. Maquat. 1993. Nonsense codons can reduce insertions These PGK1 alleles are schematically represented the abundance of nuclear mRNA without affecting the abun- in Figure 7. Two DNA fragments synthesized by PCR encoded dance of pre-mRNA or the half-life of cytoplasmic mRNA. the following portions of the PGK1 protein-coding region: {1) Mol. Cell. Biol. 13: 1892-1902. the first 21% of the amino-terminal region of the PGK1 protein- Cheng, J., M. Fogel-Petrovic, and L.E. Maquat. 1990. Transla- coding region [PCR primers (20) and (21)]; and (2) between 55% tion to near the distal end of the penultimate exon is re- and 76.2% of the PGK1 protein-coding region [PCR primers (22) quired for normal levels of spliced triosephosphate isomer- and (23)]. The DNA fragments synthesized in the PCR reaction ase mRNA. Mol. Cell. Biol. 10: 5215-5225. (2) were cleaved by KpnI and inserted in-frame into either Cleveland, D.W and T.W. Yen. 1989. Multiple determinants of pucgPGK(-AU) or pUCPGKH2(3)UAG, which were also eucaryotic mRNA stability. New Biol. 1: 121-126. cleaved with KpnI. The DNA synthesized in PCR reaction 1 was Daar, I.O. and L.E. Maquat. 1988. Premature translation termi- cleaved by Asp718 and inserted in-frame into either nation mediates triosephosphate isomerase mRNA degrada- pUC9PGK(-AU) or pUCPGKH2(2)UAG, which were also tion. Mol. Cell. Biol. 8: 802-813. cleaved with Asp718. The orientation of the DNA insertions Dahlberg, A. 1989. The functional role of ribosomal RNA in was determined by DNA restriction analysis, subsequently con- protein synthesis. Cell 57: 525-529. firmed by sequence analysis, and resulted in the following plas- Dams, E., L. Hendriks, Y. Van de Peer, J.-M. Neefs, G. Smits, I. raids [the numbers correspond to the schematic representation Vandenbempt, and R. De Wachter. 1988. Compilation of of the PGK1 alleles shown in Fig. 6: (1) pUC9PGKAspIN2; small ribosomal subunit RNA sequences. Nucleic Acids {2) pUC9PGKAspH2(2)IN2; (3)pUC9PGKKpnIIN1; and (4) Res. suppl. 16: r87-r173. pUC9PGKKpnIH2(2}UAGIN1 ]. The BamHI-HindIII DNA frag- Feinberg, A.P. and B. Vogelstein. 1983. A technique for radiola- ments containing the PGK1 alleles from these plasmids were beling DNA restriction endonuclease fragments to high spe- subcloned into the yeast centromere plasmid pRIPl, yielding cific activity. Anal. Biochem. 132: 6-13. {addendum 1984) the following plasmids: pRIPPGKAspIN2, pRIPPGKAspH2(2)- Anal. Biochem. 137: 266-267. UAGIN2, pRIPPGKKpnIIN1, and pRIPPGKKpnIH2(2)UAGIN1. Gaspar, M.-L., T. Meo, P. Bourgarel, J.-L. Guenet, and M. Tosi. 1991. A single base deletion in the Tfm androgen receptor Acknowledgments gene creates a short-lived messenger RNA that directs internal translation initiation. Proc. Natl. Acad. Sci. 88: 8606- This work was supported by a grant (GM27757) to A.J. from the 8610. National Institutes of Health and by a postdoctoral fellowship Gay, D.A, T.J. Yen, J.T.Y. Lau, and D.W. Cleveland. 1989. Se- to S.W.P. from the American Cancer Society. We thank Chris- quences that confer ~-tubulin autoregulation through mod- tine Bonczek and Janet Donahue for technical help and He Feng, ulated mRNA stability reside within exon 1 of a ~-tubulin Chris Trotta, and Ellen Welch for their enthusiasm, advice, and mRNA. Cell 50: 671-679. critical reading of the manuscript. Gozalbo, D. and S. Hohmann. 1990. Nonsense suppressors par- The publication costs of this article were defrayed in part by tially revert the decrease of the mRNA level of a nonsense payment of page charges. This article must therefore be hereby mutant allele in yeast. Curr. Genet. 17: 77-79. marked "advertisement" in accordance with 18 USC section Graves, R.A., N.B. Pandey, N. Chodchoy, and W.F. Marzluff. 1734 solely to indicate this fact. 1987. Translation is required for regulation of histone mRNA degradation. Cell 48: 615-626. References Guthrie, C. and G.R. Fink, (eds.). 1991. Methods in enzymology: Molecular biology of Saccharomyces cerevisiae. Academic Altamura, N., O. Groudinsky, G. Dujardin, and P.P. Slonimski. Press, New York. 1992. NAM7 nuclear gene encodes a novel member of a fam- He, F., S.W. Peltz, J.L. Donahue, M. Rosbash, and A. Jacobson. ily of helicases with a Zn-ligand motif and is involved in 1993. Stabilization and ribosome association of unspliced mitochondrial functions in Saccharomyces cerevisiae. J. pre-mRNAs in a yeast upfl - mutant. Proc. Natl. Acad. Sci. Mol. Biol. 224: 575-587. (in press). Atwater, J.A., R. Wisdom, and I.M. Verma. 1990. Regulated Heaton, B., C. Decker, D. Muhlrad, J. Donahue, A. Jacobson, and mRNA stability. Annu. Rev. Genet. 24: 519-541. R. Parker. 1992. Analysis of chimeric mRNAs identifies two Bach, M.-L., F. Lacroute, and D. Botstein. 1979. Evidence for regions within the STE3 mRNA which promote rapid transcriptional regulation of orotidine-5'-phosphate decar- mRNA decay. Nucleic Acids Res. 20: 5365-5373. boxylase in yeast by hybridization of mRNA to the yeast Hentze, M.W. 1991. Determinants and regulation of cytoplas- structural gene cloned in Escherichia coll. Proc. Natl. Acad. mic mRNA stability in eukaryotic cells. Biochim. Biophys. Sci. 76: 386-390. Acta. 1090: 281-292. Barker, G.F. and K. Beemon. 1991. Nonsense codons within the Herrick, D. and A. Jacobson. 1992. A segment of the coding Rous sarcoma virus gag gene decrease the stability of un- region is necessary but not sufficient for rapid decay of the spliced viral RNA. Mol. Cell. Biol. 11: 2760-2768. HIS3 mRNA in yeast. Gene 114: 35--41.

GENES & DEVELOPMENT 1753 Downloaded from genesdev.cshlp.org on October 2, 2021 - Published by Cold Spring Harbor Laboratory Press

Peltz et al.

Herrick, D., R. Parker, and A. Jacobson. 1990. Identification and Peltz, S.W., G. Brewer, P. Bernstein, and J. Ross. 1991. Regula- comparison of stable and unstable mRNAs in the yeast Sac- tion of mRNA tumover in eukaryotic cells. Crit. Rev. Eu- charomyces cerevisiae. Mol. Cell. Biol. 10: 2269-2284. karyotic Gene Expression 1: 99-126. Hinnebusch, A.G. and S.W. Liebman. 1991. Protein synthesis Peltz S.W. and A. Jacobson. 1993. mRNA Turnover in Saccha- and translational control in Saccharomyces cerevisiae. In romyces cerevisiae. In Control of mRNA stability {ed. G. The molecular and cellular biology of the yeast Saccharo- Brawerman and J. Belasco), pp. 291-328. Academic Press, myces: Volume I. Genome dynamics, protein synthesis, and San Diego, CA. energetics (ed. J.R. Broach, J.R. Pringle, and E.W. Jones), pp. Peltz, S.W., J.L. Donahue, and A. Jacobson. 1992. A mutation in 627-735. Cold Spring Harbor Laboratory Press, Cold Spring tRNA nucleotidyltransferase stabilizes mRNAs in Saccha- Harbor, New York. romyces cerevisiae. Mol. Cell. Biol. 12: 5778-5784. Hitzeman, R.A., F.E. Hagie, J.S. Hayflick, C.Y. Chen, P.H. See- Peltz, S.W., C. Trotta, H. Feng, A. Brown, J. Donahue, E. Welch, burg, and R. Derynck. 1982. The primary structure of the and A. Jacobson. 1993. Identification of the cis-acting se- yeast Saccharomyces cerevisiae gene for 3-phosphoglycerate quences and trans-acting factors involved in nonsense-me- kinase. Nucleic Acids Res. 10: 7791-9808. diated mRNA decay. In Protein synthesis and targetting in Ito, H., Y. Fukuda, K. Murata, and A. Kimura. 1983. Transfor- yeast (ed. M. Tuite, J. McCarthy, A. Brown, and F. Sherman), mation of intact yeast cells treated with alkali cations. J. pp. 1-10. Springer-Verlag, Berlin, Germany. Bacteriol. 153: 163-168. Piper, P.W., B. Curran, W. Davies, K. Hirst, and K. Seward. 1987. Jacobson, A., A.H. Brown, J.L. Donahue, D. Herrick, R. Parker, S. cerevisiae mRNA populations of different intrinsic and S.W. Peltz. 1990. Regulation of mRNA stability in yeast. mRNA stability in unstressed and heat-shocked cells display In Post-transcriptional regulation of gene expression (ed. almost constant mTGpppA:mTGpppG 5'-cap ratios. FEBS J.E.G. McCarthy and M.F. Tuite), pp. 45-54. Springer-Verlag, Lett. 220: 177-180. Berlin, Germany. Ross, J. 1988. RNA turnover in eukaryotic cells. Mol. Biol. Med. Kaufer, N.F., H.M. Fried, W.F. Schwindinger, M. Jasin, and J.R. 5: 1-14. Warner. 1983. Cycloheximide resistance in yeast: The gene Sambrook, J., E.F. Fritsch, and T. Maniatis. 1989. Molecular and its protein. Nucleic Acids Res. 11: 3123--3135. cloning: A laboratory manual. Cold Spring Harbor Labora~ Koonin, E.V. 1992. A new group of putative RNA helicases. tory Press, Cold Spring Harbor, New York. Trends Biochem. Sci. 17: 495--497. Schiestl, R.H. and R.D. Gietz 1989. High efficiency transforma- Leeds, P., S.W. Peltz, A. Jacobson, and M.R. Culbertson. 1991. tion of intact yeast cells using single stranded nucleic acids The product of the yeast UPF1 gene is required for rapid as a carrier. Curr. Genet. 16: 339-346. turnover of mRNAs containing a premature translational Shaw, G. and R. Kamen. 1986. A conserved AU sequence from termination codon. Genes & Dev. 5: 2303-2314. the 3' untranslated region of GM-CSF mRNA mediates se- Leeds, P., J.M. Wood, B.-S. Lee, and M.R. Culbertson. 1992. lective mRNA degradation. Cell 46: 659-667. Gene products that promote mRNA turnover in Saccharo- Sherman, F., G.R. Fink, and J.B. Hicks. 1986. Laboratory course myces cerevisiae. Mol. Cell. Biol. 12: 2165-2177. manual for methods in yeast genetics. Cold Spring Harbor Lim, S.-K., C.D. Sigmund, K.W. Gross, and L.E. Maquat. 1992. Laboratory Press, Cold Spring Harbor, New York. Nonsense codons in human ~3-globin mRNA result in the Sonnenberg, N. 1991. Picornavirus RNA translation continues production of mRNA degradation products. Mol. Cell. Biol. to surprise. Trends Genet. 7: 105-106. 12: 1149-1161. Surguchov, A.P. 1988. Omnipotent nonsense suppressors: New Losson, R. and F. Lacroute. 1979. Interference of nonsense mu- clues to an old puzzle. Trends Biochem. Sci. 13: 120--123. tations with eukaryotic messenger RNA stability. Pro& Thomas, P.F. 1980. Hybridization of denatured RNA and small Natl. Acad. Sci. 76: 5134--5137. DNA fragments transferred to nitrocellulose. Proc. Natl. Maquat, L.E., A.J. Kinniburgh, E.A. Rachmilewitz, and J. Ross. Acad. Sci. 77: 5201-5205. 1981. Unstable J3-globin mRNA in mRNA-deficient B-thal- Urlaub, G., P.J. Mitchell, C.J. Ciudad, and L.A. Chasin. 1989. assemia. Cell 27: 543-553. Nonsense mutations in the dihydrofolate reductase gene af- Morse, D.E. and C. Yanofsky. 1969. Polarity and the degradation fect RNA processing. Mol. Cell. Biol. 9: 2868-2880. of mRNA. Nature 224:329-331. Winey, M. and M.R. Culbertson. 1988. Mutations affecting the Nilsson, G., J.G. Belasco, S.N. Cohen, and A. yon Gabain. 1987. tRNA-splicing endonuclease activity of Saccharomyces cer- Effect of premature termination of translation on mRNA evisiae. Genetics 118:607-617. stability depends on the site of ribosome release. Proc. Natl. Wisdom, R. and W. Lee. 1991. The protein-coding region of Acad. Sci. 84: 4890--4894. c-myc mRNA contains a sequence that specifies rapid Noller, H.F. 1991. Ribosomal RNA and translation. Annu. Rev. mRNA turnover and induction by protein synthesis inhibi- Biochem. 60: 191-227. tors. Genes & Dev. 5: 232-243. Nonet, M., C. Scafe, J. Sexton, and R. Young. 1987. Eucaryotic Yanisch-Perron, C., J. Vieira, and J. Messing. 1985. Improved RNA polymerase conditional mutant that rapidly ceases cloning vectors and host strains: Nucleotide sequences of mRNA synthesis. Mol. Cell. Biol. 7: 1602-1611. the M13mpl8 and pUC19 vectors. Gene 33: 103-119. Parker, R., D. Herrick, S.W. Peltz, and A. Jacobson. 1991. Mea- surement of mRNA decay rates in Saccharomyces cerevisiae. In Methods in enzymology: Molecular biology of Sac- charomyces cerevisiae. (ed. C. Guthrie and G. Fink), pp. 415-423. Academic Press, San Diego, CA. Parker, R. and A. Jacobson. 1990. Translation and a forty-two nucleotide segment within the coding region of the mRNA encoded by the MATaI gene are involved in promoting rapid mRNA decay in yeast. Proc. Natl. Acad. Sci. 87: 2780-2784. Pelsy, F. and F. Lacroute. 1984. Effect of ochre nonsense mutations on yeast URA1 stability. Curr. Genet. 8: 277-282.

1754 GENES & DEVELOPMENT Downloaded from genesdev.cshlp.org on October 2, 2021 - Published by Cold Spring Harbor Laboratory Press

mRNA destabilization triggered by premature translational termination depends on at least three cis-acting sequence elements and one trans-acting factor.

S W Peltz, A H Brown and A Jacobson

Genes Dev. 1993, 7: Access the most recent version at doi:10.1101/gad.7.9.1737

References This article cites 50 articles, 21 of which can be accessed free at: http://genesdev.cshlp.org/content/7/9/1737.full.html#ref-list-1

License

Email Alerting Receive free email alerts when new articles cite this article - sign up in the box at the top Service right corner of the article or click here.