DOCSLIB.ORG

Genomic Architecture and Transcriptional Activation Of

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Genomic Architecture and Transcriptional Activation Of Oncogene (1998) 17, 2761 ± 2770 ã 1998 Stockton Press All rights reserved 0950 ± 9232/98 $12.00 http://www.stockton-press.co.uk/onc Genomic architecture and transcriptional activation of the mouse and human tumor susceptibility gene TSG101: Common types of shorter transcripts are true alternative splice variants Kay-Uwe Wagner1, Patricia Dierisseau1, Edmund B Rucker III1, Gertraud W Robinson1 and Lothar Hennighausen*,1 1Laboratory of Genetics and Physiology, National Institute of Diabetes, Digestive, and Kidney Diseases, National Institutes of Health, Building 8, Room 101, Bethesda, Maryland 20892-0822, USA The functional inactivation of the tumor susceptibility both encode predicted proteins of about 43 kDa in size gene tsg101 in mouse NIH3T3 cells leads to cell that show 94% similarity. On the subcellular level, the transformation and the formation of metastatic tumors TSG101 protein is localized mainly in the cytoplasm in nude mice. We cloned, mapped and sequenced the (Zhong et al., 1997) but depending on the stage of the mouse tsg101 gene and further identi®ed a processed cell cycle it can be detected in the nucleus and it can pseudogene that is 98% identical to the tsg101 cDNA. co-localize with the mitotic spindle apparatus during Based on Northern blot analysis, tsg101 is expressed cell division (Xie et al., 1998). Another indication that ubiquitously in mouse tissues. A comparison of the TSG101 may have dierent functions at speci®c stages coding region of the mouse tsg101 gene with the human of the cell cycle is the presence of highly conserved TSG101 cDNA revealed that both the mouse and human motifs, such as a coiled-coil domain that is proposed to gene encode ten additional highly conserved amino acids interact with stathmin (Maucuer et al., 1995) and a at the N-terminus. Based on the mouse tsg101 genomic proline-rich region known to exist in activation structure, we predicted four additional introns within the domains of transcription factors (Li et al., 1997). human TSG101 gene. Their location was con®rmed using Furthermore, an N-terminal region is similar to the PCR and sequencing analysis. The presence of these so catalytic domain of ubiquitin-conjugating enzymes far unidenti®ed introns now explains published data on suggesting a potential role of TSG101 as a regulator aberrantly spliced mRNA products that were frequently in ubiquitin-mediated protein degradation (Koonin and observed in primary breast tumors. We show that a Abagyan, 1997; Ponting et al., 1997). The mechanism majority of shorter TSG101 transcripts are not the result underlying cell transformation after inactivation of of aberrant splicing events, but represent a fraction of both tsg101 alleles is not known. Potentially as a true alternative splice variants. Finally, we examined regulator of protein degradation, TSG101 could tsg101 expression patterns during dierent stages of in¯uence the half-life of other important tumor mammary gland development and in dierent transgenic suppressors and regulatory factors of the cell cycle. mouse models for breast tumorigenesis. Since inactivation of TSG101 was observed to be associated with abnormal microtubule organizing Keywords: TSG101 protein; mice; human; genomic centers and nuclear anomalies, it is suggested that the DNA; pseudogene; mammary gland absence of the TSG101 protein or the lack of individual TSG101 domains may lead to chromosomal instability and, thereby to a progression of tumorigen- esis (Xie et al., 1998). Introduction The human TSG101 gene has been mapped to a speci®c chromosomal region on chromosome 11, The tumor susceptibility gene 101 (tsg101) was discov- p15.1-p15.2 (Li et al., 1997), that is associated with a ered in mouse NIH3T3 ®broblasts using a random loss of heterozygosity in dierent types of tumors such homozygous knockout approach (Li and Cohen, 1996). as breast cancer (Ali et al., 1987) and Wilms' tumor The functional inactivation of this gene leads to cell (Reeve et al., 1989). However, rearrangements and transformation in vitro and to metastasizing tumors in somatic mutations within the TSG101 gene are rare vivo when transformed mouse ®broblasts were trans- events in human breast cancers (Steiner et al., 1997; planted into nude mice. Reversal of the neoplastic Gayther et al., 1997; Lee and Feinberg, 1997; Wang et properties was obtained in vitro after deleting the gene al., 1998). Instead of gene alterations, aberrant TSG101 that transactivated the antisense promoter using Cre-lox splice forms have been correlated to cell transformation recombination. These results suggested that transforma- (Gayther et al., 1997; Sun et al., 1997; Lee and tion and tumorigenesis were a direct consequence of Feinberg, 1997). In order to identify the structural TSG101 de®ciency (Li and Cohen, 1996). basis of the aberrant transcripts, the intron-exon The tsg101 cDNAs in mouse and human are 86% architecture of the TSG101 gene needs to be identical on the nucleotide level (Li et al., 1997). They determined. This information and the identi®cation of regulatory elements within the promoter will provide new insights into TSG101 transcriptional regulation, alternative and aberrant mRNA splicing events, *Correspondence: L Hennighausen Received 19 August 1998; revised 15 October 1998; accepted 26 resulting protein variants, and gene function in normal October 1998 and transformed tissue. Mouse and human TSG101 K-U Wagner et al 2762 Table 1. Evidently, the larger number of exons and Results introns of the murine tsg101 gene compared to the human homologue is the result of four additional introns Genomic organization of the mouse tsg101 gene within a region considered to be the ®rst exon of the The mouse tsg101 gene was cloned as multiple human gene (Li et al., 1997). The ®rst exon includes the 5' overlapping restriction fragments from two individual untranslated sequence and the translation initiation BAC genomic clones. Brie¯y, a cDNA that was codon. With 329 bp, exon 10 is the largest exon, but it generated by RT ± PCR from mammary tissue of a contains almost 75% of its nucleotides (240 bp) as 3' lactating dam was used to probe a 129/SvJ genomic untranslated sequence. A comparison of the coding BAC library (see Material and methods). Six positive region to the previously published mouse cDNA BAC clones were analysed and ®ve contained a novel sequence (Li and Cohen, 1996) revealed several processed tsg101 pseudogene but not the actual tsg101 dierences. An insertion of two G residues between gene. In order to distinguish the true gene from the position 37 and 38 of the published mouse cDNA shifts pseudogene, we designed a PCR assay that ampli®ed the ®rst ATG codon in position 33 in frame with the intron sequences (see Materials and methods). The tsg101 coding region. This results in the expansion of the sixth BAC clone contained the genuine tsg101 gene. tsg101 open reading frame of exactly 30 nucleotides Since this BAC clone lacked the 5' part of the tsg101 encoding ten additional amino acids at the N-terminus gene a second overlapping BAC clone was isolated. (Met-Ala-Val-Ser-Glu-Ser-Gln-Leu-Lys-Lys). The hy- Overlapping subclones were sequenced and the size of pothesis that the ATG at position 33 is the preferred the mouse tsg101 gene was determined to be 33.6 kb translational start site is supported by the fact that this (GenBank AF060868). Furthermore, we identi®ed ATG codon is ¯anked by a C-rich sequence motif in additional introns, which had not been predicted from position 76to71 and a highly conserved G in positon mapping studies (Li et al., 1997). In addition, we +4 (Kozak, 1997). A mismatch at position 81 (T to C) is determined dierences in the coding region of the similar to the human sequence and did not result in any mouse tsg101 gene to the previously published mouse amino acid substitution. Some additional changes of cDNA sequence (Li and Cohen, 1996). These single nucleotides were observed in the 3' untranslated dierences lead to an expansion of the tsg101 reading region immediately following the translational stop frame that encodes ten additional amino acids at the codon. N-terminus, which are highly similar to the predicted A prominent part of the TSG101 protein, an a-helix human TSG101 protein. domain that forms a coiled-coil structure, was The murine tsg101 gene contains ten exons (Figure 1). reported to be identical to CC2 and has been Sequences of intron-exon junctions are summarized in proposed to interact with stathmin (Maucuer et al., Figure 1 Genomic structure of the mouse tsg101 gene. The numbered boxes illustrating exons 1 ± 10 are not in scale. Solid bars represent known encoded protein domains Table 1 Nucleotide sequence of intron-exon boundaries of the mouse tsg101 gene 3' Acceptor Sequence 5' Donor Sequence Intron Exon Size Intron Size Intron Exon No. (bp) Exon Intron No. (kb) CCCTCTGCCT 1 72 GATGTCCAAG gtgagcccgc 1 6.3 tgcttttcag TACAAATACA 2 84 GATTCATATG gtaagtttat 2 2.6 tcccttttag TTTTTAATGA 3 65 CGTTATCCGAG gtaaataata 3 1.7 tctctcttag GTAATATATA 4 163 CTGGAAACAT gtaagtatta 4 1.8 tcctttttag CCACGGTCAG 5 126 CCACCAAATA gtaagtacac 5 3.5 ttatttttag CCTCCTACAT 6 66 CCAACCCCAG gtaatgaaaa 6 2.4 ttttctatag TGGTTATCCT 7 91 ACCACTGTTG gtaagtataa 7 8.6 tctcctgcag GTCCAGCAG 8 202 TCAAGAAGTA gtaagtaagc 8 1.2 ctgttttcag GCTGAAGTTG 9 239 GTTCCTGAAA gtaagtaccc 9 1.2 tccttcctag CACGTCCGCT 10 329 TGTTGCATAA Mouse and human TSG101 K-U Wagner et al 2763 1995). This particular domain is encoded by two of GAPBF2 known to exist in promoters of other the largest coding exons of tsg101, exon 8 and 9 ubiquitously expressed genes (Aki et al., 1997). (Figure 1). The proline rich region, which is known to be characteristic for transcription factors, is entirely The mouse genome carries a tsg101 pseudogene encoded by exons 5 ± 7.
Load more

Recommended publications
  • Insights Into Comparative Genomics, Codon Usage Bias, And
    plants Article Insights into Comparative Genomics, Codon Usage Bias, and Phylogenetic Relationship of Species from Biebersteiniaceae and Nitrariaceae Based on Complete Chloroplast Genomes Xiaofeng Chi 1,2 , Faqi Zhang 1,2 , Qi Dong 1,* and Shilong Chen 1,2,* 1 Key Laboratory of Adaptation and Evolution of Plateau Biota, Northwest Institute of Plateau Biology, Chinese Academy of Sciences, Xining 810008, China; [email protected] (X.C.); [email protected] (F.Z.) 2 Qinghai Provincial Key Laboratory of Crop Molecular Breeding, Northwest Institute of Plateau Biology, Chinese Academy of Sciences, Xining 810008, China * Correspondence: [email protected] (Q.D.); [email protected] (S.C.) Received: 29 October 2020; Accepted: 17 November 2020; Published: 18 November 2020 Abstract: Biebersteiniaceae and Nitrariaceae, two small families, were classified in Sapindales recently. Taxonomic and phylogenetic relationships within Sapindales are still poorly resolved and controversial. In current study, we compared the chloroplast genomes of five species (Biebersteinia heterostemon, Peganum harmala, Nitraria roborowskii, Nitraria sibirica, and Nitraria tangutorum) from Biebersteiniaceae and Nitrariaceae. High similarity was detected in the gene order, content and orientation of the five chloroplast genomes; 13 highly variable regions were identified among the five species. An accelerated substitution rate was found in the protein-coding genes, especially clpP. The effective number of codons (ENC), parity rule 2 (PR2), and neutrality plots together revealed that the codon usage bias is affected by mutation and selection. The phylogenetic analysis strongly supported (Nitrariaceae (Biebersteiniaceae + The Rest)) relationships in Sapindales. Our findings can provide useful information for analyzing phylogeny and molecular evolution within Biebersteiniaceae and Nitrariaceae.
    [Show full text]
  • Mutation Bias Shapes Gene Evolution in Arabidopsis Thaliana ​
    bioRxiv preprint doi: https://doi.org/10.1101/2020.06.17.156752; this version posted June 18, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. Mutation bias shapes gene evolution in Arabidopsis thaliana ​ 1,2† 1 1 3,4 Monroe, J. Grey ,​ Srikant, Thanvi ,​ Carbonell-Bejerano, Pablo ,​ Exposito-Alonso, Moises ,​ 5​ ​ 6 7 ​ 1† ​ Weng, Mao-Lun ,​ Rutter, Matthew T. ,​ Fenster, Charles B. ,​ Weigel, Detlef ​ ​ ​ ​ 1 Department​ of Molecular Biology, Max Planck Institute for Developmental Biology, 72076 Tübingen, Germany 2 Department​ of Plant Sciences, University of California Davis, Davis, CA 95616, USA 3 Department​ of Plant Biology, Carnegie Institution for Science, Stanford, CA 94305, USA 4 Department​ of Biology, Stanford University, Stanford, CA 94305, USA 5 Department​ of Biology, Westfield State University, Westfield, MA 01086, USA 6 Department​ of Biology, College of Charleston, SC 29401, USA 7 Department​ of Biology and Microbiology, South Dakota State University, Brookings, SD 57007, USA † corresponding​ authors: [email protected], [email protected] ​ ​ ​ Classical evolutionary theory maintains that mutation rate variation between genes should be random with respect to fitness 1–4 and evolutionary optimization of genic 3,5 ​ mutation rates remains controversial .​ However, it has now become known that ​ cytogenetic (DNA sequence + epigenomic) features influence local mutation probabilities 6 ,​ which is predicted by more recent theory to be a prerequisite for beneficial mutation 7 rates between different classes of genes to readily evolve .​ To test this possibility, we ​ used de novo mutations in Arabidopsis thaliana to create a high resolution predictive ​ ​ ​ model of mutation rates as a function of cytogenetic features across the genome.
    [Show full text]
  • Chapter 3. the Beginnings of Genomic Biology – Molecular
    Chapter 3. The Beginnings of Genomic Biology – Molecular Genetics Contents 3. The beginnings of Genomic Biology – molecular genetics 3.1. DNA is the Genetic Material 3.6.5. Translation initiation, elongation, and termnation 3.2. Watson & Crick – The structure of DNA 3.6.6. Protein Sorting in Eukaryotes 3.3. Chromosome structure 3.7. Regulation of Eukaryotic Gene Expression 3.3.1. Prokaryotic chromosome structure 3.7.1. Transcriptional Control 3.3.2. Eukaryotic chromosome structure 3.7.2. Pre-mRNA Processing Control 3.3.3. Heterochromatin & Euchromatin 3.4. DNA Replication 3.7.3. mRNA Transport from the Nucleus 3.4.1. DNA replication is semiconservative 3.7.4. Translational Control 3.4.2. DNA polymerases 3.7.5. Protein Processing Control 3.4.3. Initiation of replication 3.7.6. Degradation of mRNA Control 3.4.4. DNA replication is semidiscontinuous 3.7.7. Protein Degradation Control 3.4.5. DNA replication in Eukaryotes. 3.8. Signaling and Signal Transduction 3.4.6. Replicating ends of chromosomes 3.8.1. Types of Cellular Signals 3.5. Transcription 3.8.2. Signal Recognition – Sensing the Environment 3.5.1. Cellular RNAs are transcribed from DNA 3.8.3. Signal transduction – Responding to the Environment 3.5.2. RNA polymerases catalyze transcription 3.5.3. Transcription in Prokaryotes 3.5.4. Transcription in Prokaryotes - Polycistronic mRNAs are produced from operons 3.5.5. Beyond Operons – Modification of expression in Prokaryotes 3.5.6. Transcriptions in Eukaryotes 3.5.7. Processing primary transcripts into mature mRNA 3.6. Translation 3.6.1.
    [Show full text]
  • "The" Genetic Code?
    Evolutionary Anthropology 14:6–11 (2005) CROTCHETS & QUIDDITIES “The” Genetic Code? KENNETH M. WEISS AND ANNE V. BUCHANAN The DNA-based code for protein through messenger and transfer RNA is widely themselves, that carry the informa- regarded as the code of life. But genomes are littered with other kinds of coding tion. elements as well, and all of them probably came after a supercode for the tRNA Your life depends on the fidelity of system itself. these many codes. Aberrant codes re- lated to cell behavior can lead to dys- genesis or various metabolic diseases. Evolution and the diversification of Everyone knows of “the” genetic Anomalous cell-surface proteins can organisms are made possible by code, by which nucleotide triplets in cause autoimmune destruction, and vi- codes, or arbitrary assignments of DNA in the nucleus of cells specify the ruses are the Alan Turings of life that “meaning,” in multiple ways. Many amino acid (aa) sequence of proteins. evolve ways to break their receptor are not widely appreciated. Codes al- This is the code described in text- codes to gain illicit entry into cells (Fig. low the same system of components books as the heart of the genetic the- 1). to be used for multiple purposes. ory of life and its evolution. Discover- But there is an additional code, a These can be open-ended, the way the ies in recent years have made things code of codes, that makes all of this alphabet and vocabulary make this more complicated by showing that ge- possible, including “the” genetic code column possible, but the flexibility of nomes are littered with all sorts of itself, and may be the oldest and most a code can become constrained once a other kinds of coding elements.
    [Show full text]
  • Designing Lentiviral Vectors for Gene Therapy of Genetic Diseases
    viruses Review Designing Lentiviral Vectors for Gene Therapy of Genetic Diseases Valentina Poletti 1,2,3,* and Fulvio Mavilio 4 1 Department of Woman and Child Health, University of Padua, 35128 Padua, Italy 2 Harvard Medical School, Harvard University, Boston, MA 02115, USA 3 Pediatric Research Institute City of Hope, 35128 Padua, Italy 4 Department of Life Sciences, University of Modena and Reggio Emilia, 41125 Modena, Italy; [email protected] * Correspondence: [email protected] Abstract: Lentiviral vectors are the most frequently used tool to stably transfer and express genes in the context of gene therapy for monogenic diseases. The vast majority of clinical applications involves an ex vivo modality whereby lentiviral vectors are used to transduce autologous somatic cells, ob- tained from patients and re-delivered to patients after transduction. Examples are hematopoietic stem cells used in gene therapy for hematological or neurometabolic diseases or T cells for immunotherapy of cancer. We review the design and use of lentiviral vectors in gene therapy of monogenic diseases, with a focus on controlling gene expression by transcriptional or post-transcriptional mechanisms in the context of vectors that have already entered a clinical development phase. Keywords: lentiviral vectors; transcriptional regulation; post-transcriptional regulation; miRNA; promoters; retroviral integration; ex vivo gene therapy Citation: Poletti, V.; Mavilio, F. 1. Introduction Designing Lentiviral Vectors for Gene Therapy of Genetic Diseases.
    [Show full text]
  • Analysis of Codon Usage Patterns in Giardia Duodenalis Based on Transcriptome Data from Giardiadb
    G C A T T A C G G C A T genes Article Analysis of Codon Usage Patterns in Giardia duodenalis Based on Transcriptome Data from GiardiaDB Xin Li, Xiaocen Wang, Pengtao Gong, Nan Zhang, Xichen Zhang and Jianhua Li * Key Laboratory of Zoonosis Research, Ministry of Education, College of Veterinary Medicine, Jilin University, Changchun 130062, China; [email protected] (X.L.); [email protected] (X.W.); [email protected] (P.G.); [email protected] (N.Z.); [email protected] (X.Z.) * Correspondence: [email protected]; Tel.: +86-431-8783-6172; Fax: +86-431-8798-1351 Abstract: Giardia duodenalis, a flagellated parasitic protozoan, the most common cause of parasite- induced diarrheal diseases worldwide. Codon usage bias (CUB) is an important evolutionary character in most species. However, G. duodenalis CUB remains unclear. Thus, this study analyzes codon usage patterns to assess the restriction factors and obtain useful information in shaping G. duo- denalis CUB. The neutrality analysis result indicates that G. duodenalis has a wide GC3 distribution, which significantly correlates with GC12. ENC-plot result—suggesting that most genes were close to the expected curve with only a few strayed away points. This indicates that mutational pressure and natural selection played an important role in the development of CUB. The Parity Rule 2 plot (PR2) result demonstrates that the usage of GC and AT was out of proportion. Interestingly, we identified 26 optimal codons in the G. duodenalis genome, ending with G or C. In addition, GC content, gene expression, and protein size also influence G.
    [Show full text]
  • Transcription and Open Reading Frame
    Transcription The expression of genetic information stored in the DNA sequence starts with synthesis of the RNA copy of the gene in a process called transcription. The RNA copy of the gene is called messenger RNA (mRNA). A special enzyme, RNA polymerase, recognizes a sequence, called promoter, on the DNA double helix upstream from the protein coding sequence. RNA polymerase binds to the promoter and opens it up: separates the complementary strands at about 12-nt-long region of the promoter. Then the enzyme starts the mRNA synthesis using all 4 NTPs. The DNA strand, which is used as a template by RNA polymerase, is called the template or antisense strand. The opposite strand of the gene, which sequence is identical to the sequence of mRNA (except the substitution T U, of course), is called the coding or sense strand. There is also a special sequence after the end of the gene, which signals to RNA polymerase to terminate the mRNA synthesis. Thus synthesized mRNA molecule, which includes the protein coding region flanked by short unrelated sequences from both sides, is either translated by the ribosome into the protein molecule at the spot (in case of prokaryotes) or is transported from the nucleus to the cytoplasm (in case of eukaryotes) and there it is translated by the ribosome. Open Reading Frame (ORF) Since the genetic code is triplet, three reading frames are possible for the same mRNA molecule. For instance, the sequence: …..AUUGCCUAACCCUUAGGG…. can be separated into triplets by three possible ways: ….AUUGCCUAACCCUUAGGG…. ….AUUGCCUAACCCUUAGGG…. ….AUUGCCUAACCCUUAGGG…. The frame, in which no stop codons are encountered, is called the Open Reading Frame (ORF).
    [Show full text]
  • Codon Usage Biases Co-Evolve with Transcription Termination Machinery
    RESEARCH ARTICLE Codon usage biases co-evolve with transcription termination machinery to suppress premature cleavage and polyadenylation Zhipeng Zhou1†, Yunkun Dang2,3†*, Mian Zhou4, Haiyan Yuan1, Yi Liu1* 1Department of Physiology, The University of Texas Southwestern Medical Center, Dallas, United States; 2State Key Laboratory for Conservation and Utilization of Bio- Resources in Yunnan, Yunnan University, Kunming, China; 3Center for Life Science, School of Life Sciences, Yunnan University, Kunming, China; 4State Key Laboratory of Bioreactor Engineering, East China University of Science and Technology, Shanghai, China Abstract Codon usage biases are found in all genomes and influence protein expression levels. The codon usage effect on protein expression was thought to be mainly due to its impact on translation. Here, we show that transcription termination is an important driving force for codon usage bias in eukaryotes. Using Neurospora crassa as a model organism, we demonstrated that introduction of rare codons results in premature transcription termination (PTT) within open reading frames and abolishment of full-length mRNA. PTT is a wide-spread phenomenon in Neurospora, and there is a strong negative correlation between codon usage bias and PTT events. Rare codons lead to the formation of putative poly(A) signals and PTT. A similar role for codon *For correspondence: usage bias was also observed in mouse cells. Together, these results suggest that codon usage [email protected] (YD); biases co-evolve with the transcription termination machinery to suppress premature termination of [email protected] (YL) transcription and thus allow for optimal gene expression. †These authors contributed DOI: https://doi.org/10.7554/eLife.33569.001 equally to this work Competing interests: The authors declare that no Introduction competing interests exist.
    [Show full text]
  • Small Open Reading Frames Tiny Treasures of the Non-Coding Genomic Regions
    GENERAL ARTICLE Small Open Reading Frames Tiny Treasures of the Non-coding Genomic Regions A Yazhini Open Reading Frames (ORFs) are the DNA sequences in the genome that has the potential to be translated. Generally, only long ORFs (≥ 300 nucleotides or nt) are thought to be protein coding regions and are considered as genes in the genome annotation pipeline. Until recent years, small ORFs (smORFs) of less than 100 codons (< 300 nt) were regarded as non-functional on the basis of empirical observations. How- A Yazhini is a research ever, recent work on ribosome profiling and mass spectrom- student at Molecular etry have led to the discovery of many translating functional Biophysics Unit, Indian Institute of Science. She small ORFs and presence of their stable peptide products. works mainly on protein Further, examples of biologically active peptides with vital evolution, protein structure regulatory functions underline the importance of smORFs prediction and structure of in cell functions. Genome-wide analysis shows that smORFs macromolecule assemblies under the guidance of Prof. N are conserved across diverse species, and the functional char- Srinivasan. Overall, her acterization of their peptides reveals their critical role in a research revolves around broad spectrum of regulatory mechanisms. Further analy- structural and mechanistic sis of small ORFs is likely throw light on many exciting, un- understanding of proteins. explored regulatory mechanisms in different developmental stages and tissue types. 1. Introduction Gene is the protein encoding functional unit in the genome. It consists of promoter, protein coding (exon) and terminal regions. The protein coding regions of the gene are called the ‘open read- ing frames’ (ORFs).
    [Show full text]
  • Unconventional Viral Gene Expression Mechanisms As Therapeutic Targets
    Review Unconventional viral gene expression mechanisms as therapeutic targets https://doi.org/10.1038/s41586-021-03511-5 Jessica Sook Yuin Ho1,3, Zeyu Zhu1,3 & Ivan Marazzi1,2 ✉ Received: 8 June 2020 Accepted: 22 March 2021 Unlike the human genome that comprises mostly noncoding and regulatory sequences, Published online: 19 May 2021 viruses have evolved under the constraints of maintaining a small genome size while expanding the efciency of their coding and regulatory sequences. As a result, viruses Check for updates use strategies of transcription and translation in which one or more of the steps in the conventional gene–protein production line are altered. These alternative strategies of viral gene expression (also known as gene recoding) can be uniquely brought about by dedicated viral enzymes or by co-opting host factors (known as host dependencies). Targeting these unique enzymatic activities and host factors exposes vulnerabilities of a virus and provides a paradigm for the design of novel antiviral therapies. In this Review, we describe the types and mechanisms of unconventional gene and protein expression in viruses, and provide a perspective on how future basic mechanistic work could inform translational eforts that are aimed at viral eradication. Expression of a gene in the human genome is a multistep and heavily (for example, alternative splicing) or use unique strategies. Here we regulated process that resembles a production line. Protein-coding describe the diverse ways by which viral genomes give rise to genes and genes are transcribed almost exclusively by RNA polymerase II (RNAPII). proteins that deviate from the canonical framework of human genes, During transcription, quality-control checkpoints are implemented to restricting our analyses to eukaryotes and their viruses.
    [Show full text]
  • Recitation 8 Solutions (PDF)
    SOLUTION KEY- SECTION 8 Questions: 1. Assume that the sequence of DNA below is a short protein-encoding gene; the sequences in between the transcription start and stop sites are shown. The entire DNA sequence of the very short gene is: 5' CGCTTATAGAACCCAATCTCTCATAGGC 3' 3' GCGAATATCTTGGGTTAGAGAGTATCCG 5' iv. What would the resulting mRNA be if the top strand of this DNA molecule were used as a template in transcription? Label the 5’ and 3’ ends of your molecule. 5’GCCUAUGAGAGAUUGGGUUCUAUAAGCG3’ v. What is the full sequence of the protein that would be translated from this RNA? Label the N and C termini of your molecule. N-met-arg-asp-trp-val-leu-C vi. What would happen to the encoded protein if the underlined nucleotide C were mutated to a T? N-met-arg-asp-C (This creates a premature stop codon resulting in a truncated protein). 2. Drawn below is part of a wild-type gene. The DNA sequence shown encodes the last amino acids of a protein that is normally 380 amino acids long. The bold & underlined codon indicates the correct reading frame of this gene. The lower strand of the gene is used as the template during the transcription of mRNA from this gene. …GCTAAGTATTGCTCAAGATTAGGATGATAAATAACTGG–3’ …CGATTCATAACGAGTTCTAATCCTACTATTTATTGACC–5’ iii. In the copy of the sequence drawn below, circle one base pair that you could change to make a mutant form of the gene that produces a protein that is now 381 amino acids long. Indicate the identity of one new base pair that could take its place.
    [Show full text]
  • Mutations in Noncoding Regions of GJB1 Are a Major Cause of X-Linked CMT
    Mutations in noncoding regions of GJB1 are a major cause of X-linked CMT Pedro J. Tomaselli, MD, ABSTRACT * MSc Objective: To determine the prevalence and clinical and genetic characteristics of patients with X- Alexander M. Rossor, linked Charcot-Marie-Tooth disease (CMT) due to mutations in noncoding regions of the gap junc- * MRCP, PhD tion b-1 gene (GJB1). Alejandro Horga, MD, Methods: Mutations were identified by bidirectional Sanger sequence analysis of the 595 bases PhD of the upstream promoter region, and 25 bases of the 39 untranslated region (UTR) sequence in Zane Jaunmuktane, patients in whom mutations in the coding region had been excluded. Clinical and neurophysiologic FRCPath data were retrospectively collected. Aisling Carr, MRCP, PhD Results: Five mutations were detected in 25 individuals from 10 kindreds representing 11.4% of Paola Saveri, BSc all cases of CMTX1 diagnosed in our neurogenetics laboratory between 1996 and 2016. Four . 1 . Giuseppe Piscosquito, pathogenic mutations, c.-17G A, c.-17 1G T, c.-103C T, and c.-146-90_146-89insT were 9 * . 9 GJB1 MD detected in the 5 UTR. A novel mutation, c. 15C T, was detected in the 3 UTR of in 2 9 Davide Pareyson, MD unrelated families with CMTX1 and is the first pathogenic mutation in the 3 UTR of any myelin- Matilde Laura, MD, PhD associated CMT gene. Mutations segregated with the phenotype, were at sites predicted to be Julian C. Blake, FRCP pathogenic, and were not present in the normal population. Roy Poh, PhD Conclusions: Mutations in noncoding DNA are a major cause of CMTX1 and highlight the impor- James Polke, PhD tance of mutations in noncoding DNA in human disease.
    [Show full text]