DOCSLIB.ORG

Chemokine Ligand (CXCL)12 and CXCL13 Lymphocytes Responsiveness to CXC RGS13 Regulates Germinal Center B

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Chemokine Ligand (CXCL)12 and CXCL13 Lymphocytes Responsiveness to CXC RGS13 Regulates Germinal Center B RGS13 Regulates Germinal Center B Lymphocytes Responsiveness to CXC Chemokine Ligand (CXCL)12 and CXCL13 This information is current as Geng-Xian Shi, Kathleen Harrison, Gaye Lynn Wilson, of September 28, 2021. Chantal Moratz and John H. Kehrl J Immunol 2002; 169:2507-2515; ; doi: 10.4049/jimmunol.169.5.2507 http://www.jimmunol.org/content/169/5/2507 Downloaded from References This article cites 39 articles, 17 of which you can access for free at: http://www.jimmunol.org/content/169/5/2507.full#ref-list-1 http://www.jimmunol.org/ Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication by guest on September 28, 2021 *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2002 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology RGS13 Regulates Germinal Center B Lymphocytes Responsiveness to CXC Chemokine Ligand (CXCL)12 and CXCL13 Geng-Xian Shi, Kathleen Harrison, Gaye Lynn Wilson, Chantal Moratz, and John H. Kehrl1 Normal lymphoid tissue development and function depend upon directed cell migration. Providing guideposts for cell movement and positioning within lymphoid tissues, chemokines signal through cell surface receptors that couple to heterotrimeric G proteins, which are in turn subject to regulation by regulator of G protein signaling (RGS) proteins. In this study, we report that germinal center B lymphocytes and thymic epithelial cells strongly express one of the RGS family members, RGS13. Located between Rgs1 and Rgs2, Rgs13 spans 42 kb on mouse chromosome 1. Rgs13 encodes a 157-aa protein that shares 82% amino acid identity with its 159-aa human counterpart. In situ hybridization with sense and antisense probes localized Rgs13 expression to the germinal Downloaded from center regions of mouse spleens and Peyer’s patches and to the thymus medulla. Affinity-purified RGS13 Abs detected RGS13- expressing cells in the light zone of the germinal center. RGS13 interacted with both Gi␣ and Gq␣ and strongly impaired signaling through Gi-linked signaling pathways, including signaling through the chemokine receptors CXCR4 and CXCR5. Prolonged CD40 signaling up-regulated RGS13 expression in human tonsil B lymphocytes. These results plus previous studies of RGS1 indicate the germinal center B cells use two RGS proteins, RGS1 and RGS13, to regulate their responsiveness to chemokines. The Journal of Immunology, 2002, 169: 2507–2515. http://www.jimmunol.org/ any cellular stimuli elicit physiological responses in RGS proteins possessed GAP activity for Gi and Gq subfamily target cells by activating receptors that couple to het- members (8–10). Coding regions for ϳ25 human RGS proteins M erotrimeric G proteins. Activated receptors trigger G␣ have now been identified. Two Rho guanine nucleotide exchange subunits to exchange GTP for GDP, which leads to the dissociation factors, which have a divergent RGS domain, selectively act as ␤␥ of G␣ subunits from heterodimers. Both GTP-bound G␣ and GAPs for G12␣ and G13␣ and recently another subfamily of RGS ␤␥ free subunits activate downstream effectors. However, G␣ sub- proteins have been identified that act as GAPs for Gs␣ (11, 12). units possess an intrinsic GTPase activity that limits the duration Renowned for their roles in the positioning and migration of that they remain GTP bound and able to trigger signaling (re- lymphocytes within lymphoid tissues, chemokines signal thorough by guest on September 28, 2021 viewed in Refs. 1 and 2). Also limiting the duration of GTP-G␣, G protein-coupled receptors (GPCRs) that use Gi and Gq, thereby members of the regulator of G protein signaling (RGS)2 protein suggesting that chemokine responses depend in part upon the num- family dramatically increase the intrinsic GTPase activity of G␣ ber and levels of RGS proteins that lymphocytes express (reviewed subunits, a property that defines them as GTPase-activating pro- in Refs. 13 and 14). RGS proteins may establish thresholds for teins (GAPs). Genetic studies in yeast, Caenorhabditis elegans, responsiveness, provide a stop signal for migration, and/or con- and Aspergillus nidulans first identified such proteins (3–5). Sug- tribute to receptor desensitization. Experimentally, the introduc- gesting that they function by binding of G␣ subunits, a yeast two- tion of expression vectors for RGS1, RGS3, and RGS4 into B hybrid screen with a G␣ subunit identified a mammalian RGS pro- lymphocyte cell lines dramatically impaired chemokine-induced tein termed G␣-interacting protein (6). Cementing the functional cell migration (15–17). Among the known chemokines and their relationship between the yeast and mammalian proteins, human receptors, CXC chemokine ligand (CXCL)12 via CXCR4, RGS1, RGS2, RGS3, and RGS4 substituted to varying degrees for CXCL13 via CXCR4, and CXCL19 and CXCL21 via CCR7 pro- Sst2p, a yeast protein involved in the desensitization of pheromone vide critical positioning cues for B lymphocytes during B cell de- signaling (7). Rapidly thereafter several studies demonstrated that velopment and/or B cell immune responses (18–24). Located within lymphoid tissues, germinal centers are sites crit- ical for the generation of B cells with high-affinity Ag receptors B Cell Molecular Immunology Section, Laboratory of Immunoregulation, National (reviewed in Ref. 25). During the establishment of germinal cen- Institute of Allergy and Infectious Diseases, National Institutes of Health, Bethesda, MD 20892 ters, activated B cells and select T cells must migrate into the Received for publication May 3, 2002. Accepted for publication June 26, 2002. germinal center region from the B cell follicle. The acquisition of The costs of publication of this article were defrayed in part by the payment of page high-affinity Ag receptors, i.e., the affinity maturation of the B cell charges. This article must therefore be hereby marked advertisement in accordance Ab response, likely depends upon the recirculation of B lympho- with 18 U.S.C. Section 1734 solely to indicate this fact. cytes between the dark and light zones of the germinal center (26). 1 Address correspondence and reprint requests to Dr. John H. Kehrl, Building 10, Finally, select B cells leave the germinal center region destined to Room 11B10, Laboratory of Immunoregulation, National Institute of Allergy and Infectious Diseases, National Institutes of Health, 9000 Rockville Pike, Bethesda, MD become plasma or memory B cells. The retention and migratory 20892-1876. E-mail address: [email protected] signals that orchestrate the movements of germinal center B cells 2 Abbreviations used in this paper: RGS, regulator of G protein signaling; GAP, remain only partially understood, although CXCL12/CXCR4 may GTPase-activating protein; GPCR, G protein-coupled receptor; GFP, green fluores- direct plasma cell precursors from the germinal center region (27). cent protein; HS, human serum; MAPK, mitogen-activated protein kinase; CHO, Among the RGS proteins expressed in B lymphocytes, RGS1 Chinese hamster ovary; EST, expressed sequence tag; PNA, peanut agglutinin; ϩ CXCL, CXC chemokine ligand. shows a prominent expression in germinal center B cells, CD38 / Copyright © 2002 by The American Association of Immunologists, Inc. 0022-1767/02/$02.00 2508 RSG13 REGULATES GERMINAL CENTER B LYMPHOCYTE RESPONSIVENESS Ϫ IgD , sorted from human tonsil, while similarly sorted mantle strate kit for peroxidase (Vector Laboratories). The slides were counter- zone B cells, CD38Ϫ/IgDϩ, lacked detectable RGS1 by immuno- stained with hematoxylin, dehydrated, cleared in ethanol and xylene, and blotting (16). Surprisingly, we find that germinal center B cells permanently mounted using Permount (Fisher Scientific, Pittsburgh, PA). prominently express another RGS protein, RGS13. Although Isolation of cells and their analysis by RT-PCR and Western RGS1 can be found in many other tissues beside B cells, RGS13 blotting possesses a very restricted range of tissue expression. Beside char- The tonsil B and T cells were isolated from tonsil mononuclear cells by two acterizing RGS13 in B cells and B cell lines, we have also exam- rounds of SRBC rosetting as previously described (16). The purity of tonsil ined what signals modulate its expression, determined its intracel- B cells was routinely Ͼ95%. A total of 1 ϫ 107 of the purified B cells were lular localization, and examined its ability to modulate signaling stimulated with various reagents for 4, 24, 48 h in RPMI 1640 supple- through a variety of GPCRs including CXCR4 and CXCR5. mented with 10% FCS, respectively, at final concentration of 100 ng/ml CXCL12 (R&D Systems, Minneapolis, MN), 1 ␮g/ml CXCL13 (R&D Systems), 1 ␮g/ml anti-CD40 or anti-CD95 mAb, 20 ␮mol/L 1-palmitoyl- Materials and Methods 2-hydroxy-sn-glycero-3-phosphocholine (16/0; Avanti, Alabaster, AL), 4 Plasmids and reagents ␮l/ml anti-human IgM (␮-chain-specific) antiserum, 100 ng/ml PMA, or 30 ␮mol/L L-␣-lysophosphatidic acid (Sigma-Aldrich). The stimulated ton- The coding region of mouse RGS13 was isolated by PCR from a cDNA sil B cells were harvested and the total RNA was isolated with TRIzol clone with GenBank number AW495950 and then subcloned into EcoRI/ reagents (Life Technologies) and then 2 ␮g total RNA was subsequently BamHI of p3XFLAG-CMV-14 (Sigma-Aldrich, St. Louis, MO) or used for reverse transcription (Omniscript; Qiagen, Cologne, Germany). pEGFP-N1 (Clontech Laboratories, Palo Alto, CA). The coding region of ThefollowingPCRprimerswereusedforthePCR:RGS13,ATGAGCAGGCG human RGS13 was inserted into EcoRI/BamHI sites of p3XFLAG-CMV- GAATTGTTGGA and GAAACTGTTGTTGGACTGCATA; RGS1, CCAG 14.
Load more

Recommended publications
  • CXCL13/CXCR5 Interaction Facilitates VCAM-1-Dependent Migration in Human Osteosarcoma
    International Journal of Molecular Sciences Article CXCL13/CXCR5 Interaction Facilitates VCAM-1-Dependent Migration in Human Osteosarcoma 1, 2,3,4, 5 6 7 Ju-Fang Liu y, Chiang-Wen Lee y, Chih-Yang Lin , Chia-Chia Chao , Tsung-Ming Chang , Chien-Kuo Han 8, Yuan-Li Huang 8, Yi-Chin Fong 9,10,* and Chih-Hsin Tang 8,11,12,* 1 School of Oral Hygiene, College of Oral Medicine, Taipei Medical University, Taipei City 11031, Taiwan; [email protected] 2 Department of Orthopaedic Surgery, Chang Gung Memorial Hospital, Puzi City, Chiayi County 61363, Taiwan; [email protected] 3 Department of Nursing, Division of Basic Medical Sciences, and Chronic Diseases and Health Promotion Research Center, Chang Gung University of Science and Technology, Puzi City, Chiayi County 61363, Taiwan 4 Research Center for Industry of Human Ecology and Research Center for Chinese Herbal Medicine, Chang Gung University of Science and Technology, Guishan Dist., Taoyuan City 33303, Taiwan 5 School of Medicine, China Medical University, Taichung 40402, Taiwan; [email protected] 6 Department of Respiratory Therapy, Fu Jen Catholic University, New Taipei City 24205, Taiwan; [email protected] 7 School of Medicine, Institute of Physiology, National Yang-Ming University, Taipei City 11221, Taiwan; [email protected] 8 Department of Biotechnology, College of Health Science, Asia University, Taichung 40402, Taiwan; [email protected] (C.-K.H.); [email protected] (Y.-L.H.) 9 Department of Sports Medicine, College of Health Care, China Medical University, Taichung 40402, Taiwan 10 Department of Orthopedic Surgery, China Medical University Beigang Hospital, Yunlin 65152, Taiwan 11 Department of Pharmacology, School of Medicine, China Medical University, Taichung 40402, Taiwan 12 Chinese Medicine Research Center, China Medical University, Taichung 40402, Taiwan * Correspondence: [email protected] (Y.-C.F.); [email protected] (C.-H.T.); Tel.: +886-4-2205-2121-7726 (C.-H.T.); Fax: +886-4-2233-3641 (C.-H.T.) These authors contributed equally to this work.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • The Unexpected Role of Lymphotoxin Β Receptor Signaling
    Oncogene (2010) 29, 5006–5018 & 2010 Macmillan Publishers Limited All rights reserved 0950-9232/10 www.nature.com/onc REVIEW The unexpected role of lymphotoxin b receptor signaling in carcinogenesis: from lymphoid tissue formation to liver and prostate cancer development MJ Wolf1, GM Seleznik1, N Zeller1,3 and M Heikenwalder1,2 1Department of Pathology, Institute of Neuropathology, University Hospital Zurich, Zurich, Switzerland and 2Institute of Virology, Technische Universita¨tMu¨nchen/Helmholtz Zentrum Mu¨nchen, Munich, Germany The cytokines lymphotoxin (LT) a, b and their receptor genesis. Consequently, the inflammatory microenviron- (LTbR) belong to the tumor necrosis factor (TNF) super- ment was added as the seventh hallmark of cancer family, whose founder—TNFa—was initially discovered (Hanahan and Weinberg, 2000; Colotta et al., 2009). due to its tumor necrotizing activity. LTbR signaling This was ultimately the result of more than 100 years of serves pleiotropic functions including the control of research—indeed—the first observation that tumors lymphoid organ development, support of efficient immune often arise at sites of inflammation was initially reported responses against pathogens due to maintenance of intact in the nineteenth century by Virchow (Balkwill and lymphoid structures, induction of tertiary lymphoid organs, Mantovani, 2001). Today, understanding the underlying liver regeneration or control of lipid homeostasis. Signal- mechanisms of why immune cells can be pro- or anti- ing through LTbR comprises the noncanonical/canonical carcinogenic in different types of tumors and which nuclear factor-jB (NF-jB) pathways thus inducing cellular and molecular inflammatory mediators (for chemokine, cytokine or adhesion molecule expression, cell example, macrophages, lymphocytes, chemokines or proliferation and cell survival.
    [Show full text]
  • Defining Natural Antibodies
    PERSPECTIVE published: 26 July 2017 doi: 10.3389/fimmu.2017.00872 Defining Natural Antibodies Nichol E. Holodick1*, Nely Rodríguez-Zhurbenko2 and Ana María Hernández2* 1 Department of Biomedical Sciences, Center for Immunobiology, Western Michigan University Homer Stryker M.D. School of Medicine, Kalamazoo, MI, United States, 2 Natural Antibodies Group, Tumor Immunology Division, Center of Molecular Immunology, Havana, Cuba The traditional definition of natural antibodies (NAbs) states that these antibodies are present prior to the body encountering cognate antigen, providing a first line of defense against infection thereby, allowing time for a specific antibody response to be mounted. The literature has a seemingly common definition of NAbs; however, as our knowledge of antibodies and B cells is refined, re-evaluation of the common definition of NAbs may be required. Defining NAbs becomes important as the function of NAb production is used to define B cell subsets (1) and as these important molecules are shown to play numerous roles in the immune system (Figure 1). Herein, we aim to briefly summarize our current knowledge of NAbs in the context of initiating a discussion within the field of how such an important and multifaceted group of molecules should be defined. Edited by: Keywords: natural antibody, antibodies, natural antibody repertoire, B-1 cells, B cell subsets, B cells Harry W. Schroeder, University of Alabama at Birmingham, United States NATURAL ANTIBODY (NAb) PRODUCING CELLS Reviewed by: Andre M. Vale, Both murine and human NAbs have been discussed in detail since the late 1960s (2, 3); however, Federal University of Rio cells producing NAbs were not identified until 1983 in the murine system (4, 5).
    [Show full text]
  • The Role of CXCR5 and Its Ligand CXCL13 in The
    European Journal of Endocrinology (2004) 150 225–234 ISSN 0804-4643 EXPERIMENTAL STUDY The role of CXCR5 and its ligand CXCL13 in the compartmentalization of lymphocytes in thyroids affected by autoimmune thyroid diseases G Aust, D Sittig, L Becherer1, U Anderegg2, A Schu¨tz3, P Lamesch1 and E Schmu¨cking Institute of Anatomy, 1Department of Surgery, 2Department of Dermatology and 3 Institute of Pathology, University of Leipzig, Leipzig, Germany (Correspondence should be addressed to G Aust, University of Leipzig, Institute of Anatomy, Ph-Rosenthal-Strasse 55, Leipzig, 04103, Germany; Email: [email protected]) Abstract Objective: Graves’ disease (GD) and Hashimoto’s thyroiditis (HT) are characterized by lymphocytic infiltrates partly resembling secondary lymphoid follicles in the thyroid. CXCR5 and its ligand CXCL13 regulate compartmentalization of B- and T-cells in secondary lymphoid organs. The aim of the study was to elucidate the role of this chemokine receptor–ligand pair in thyroid autoimmunity. Methods: Peripheral blood and thyroid-derived lymphocyte subpopulations were examined by flow cyto- metry for CXCR5. CXCR5 and CXCL13 cDNA were quantified in thyroid tissues by real-time RT-PCR. Results: We found no differences between the percentages of peripheral blood CXCR5þ T- and B-cells in GD patients (n ¼ 10) and healthy controls (n ¼ 10). In GD patients, the number of memory CD4þ cells expressing CXCR5 which are functionally characterized as follicular B helper T-cells is higher in thyroid- derived (18^3%) compared with peripheral blood T-lymphocytes (8^2%). The highest CXCL13 mRNA levels were found in HT (n ¼ 2, 86.1^1.2 zmol (10221 mol) cDNA/PCR) followed by GD tissues (n ¼ 16, 9.6^3.5).
    [Show full text]
  • Etters to the Ditor
    LETTERS TO THE EDITOR even in patients with modest or no changes in BM tumor CXCL13 levels are elevated in patients with infiltration, suggesting a contributing mechanism in addi- Waldenström macroglobulinemia, and are tion to tumor debulking.6 Anemia in some WM patients predictive of major response to ibrutinib may be related to elevated hepcidin levels produced by LPL cells.7 However, the effect of ibrutinib on hepcidin Waldenström macroglobulinemia (WM) is character- remains unknown. Serum cytokines are important in ized by bone marrow (BM) infiltration of monoclonal WM biology and can be produced either by the malig- Immunoglobulin M (IgM) secreting lymphoplasmacytic nant cells, the surrounding microenvironmental cells, as lymphoma (LPL), and typically presents with anemia. well as by cells of the immune system.8 The anti-tumor MYD88 and CXCR4 activating somatic mutations effect of ibrutinib may impact all of these compartments, (CXCR4MUT) are common in WM, and found in 90-95% 1–3 including cytokines that may support growth and sur- and 35-40% of WM patients, respectively. Activating vival of tumor cells, and contribute to morbidity in WM, mutations in MYD88 support tumor growth via nuclear 9,10 factor kappa-light-chain enhancer-of-activated B-cells including anemia. As such, we aimed to characterize the serum cytokine profile in WM patients based on (NF-κB), which is triggered by Interleukin (IL)-1 receptor- associated kinases (IRAK4/IRAK1) and Bruton’s tyrosine MYD88 and CXCR4 mutation status, and to characterize kinase (BTK).4 A distinct transcriptome signature based serum cytokine and hepcidin changes in response to ibru- on both MYD88 and CXCR4 mutation status has been tinib therapy.
    [Show full text]
  • And B Cell-Associated Cytokine And
    Gyllemark et al. Journal of Neuroinflammation (2017) 14:27 DOI 10.1186/s12974-017-0789-6 RESEARCH Open Access Intrathecal Th17- and B cell-associated cytokine and chemokine responses in relation to clinical outcome in Lyme neuroborreliosis: a large retrospective study Paula Gyllemark1* , Pia Forsberg2, Jan Ernerudh3 and Anna J. Henningsson4 Abstract Background: B cell immunity, including the chemokine CXCL13, has an established role in Lyme neuroborreliosis, and also, T helper (Th) 17 immunity, including IL-17A, has recently been implicated. Methods: We analysed a set of cytokines and chemokines associated with B cell and Th17 immunity in cerebrospinal fluid and serum from clinically well-characterized patients with definite Lyme neuroborreliosis (group 1, n = 49), defined by both cerebrospinal fluid pleocytosis and Borrelia-specific antibodies in cerebrospinal fluid and from two groups with possible Lyme neuroborreliosis, showing either pleocytosis (group 2, n = 14) or Borrelia-specific antibodies in cerebrospinal fluid (group 3, n = 14). A non-Lyme neuroborreliosis reference group consisted of 88 patients lacking pleocytosis and Borrelia-specific antibodies in serum and cerebrospinal fluid. Results: Cerebrospinal fluid levels of B cell-associated markers (CXCL13, APRIL and BAFF) were significantly elevated in groups 1, 2 and 3 compared with the reference group, except for BAFF, which was not elevated in group 3. Regarding Th17-associated markers (IL-17A, CXCL1 and CCL20), CCL20 in cerebrospinal fluid was significantly elevated in groups 1, 2 and 3 compared with the reference group, while IL-17A and CXCL1 were elevated in group 1. Patients with time of recovery <3 months had lower cerebrospinal fluid levels of IL-17A, APRIL and BAFF compared to patients with recovery >3 months.
    [Show full text]
  • Supplementary Table 1
    Supplementary Table 1. 492 genes are unique to 0 h post-heat timepoint. The name, p-value, fold change, location and family of each gene are indicated. Genes were filtered for an absolute value log2 ration 1.5 and a significance value of p ≤ 0.05. Symbol p-value Log Gene Name Location Family Ratio ABCA13 1.87E-02 3.292 ATP-binding cassette, sub-family unknown transporter A (ABC1), member 13 ABCB1 1.93E-02 −1.819 ATP-binding cassette, sub-family Plasma transporter B (MDR/TAP), member 1 Membrane ABCC3 2.83E-02 2.016 ATP-binding cassette, sub-family Plasma transporter C (CFTR/MRP), member 3 Membrane ABHD6 7.79E-03 −2.717 abhydrolase domain containing 6 Cytoplasm enzyme ACAT1 4.10E-02 3.009 acetyl-CoA acetyltransferase 1 Cytoplasm enzyme ACBD4 2.66E-03 1.722 acyl-CoA binding domain unknown other containing 4 ACSL5 1.86E-02 −2.876 acyl-CoA synthetase long-chain Cytoplasm enzyme family member 5 ADAM23 3.33E-02 −3.008 ADAM metallopeptidase domain Plasma peptidase 23 Membrane ADAM29 5.58E-03 3.463 ADAM metallopeptidase domain Plasma peptidase 29 Membrane ADAMTS17 2.67E-04 3.051 ADAM metallopeptidase with Extracellular other thrombospondin type 1 motif, 17 Space ADCYAP1R1 1.20E-02 1.848 adenylate cyclase activating Plasma G-protein polypeptide 1 (pituitary) receptor Membrane coupled type I receptor ADH6 (includes 4.02E-02 −1.845 alcohol dehydrogenase 6 (class Cytoplasm enzyme EG:130) V) AHSA2 1.54E-04 −1.6 AHA1, activator of heat shock unknown other 90kDa protein ATPase homolog 2 (yeast) AK5 3.32E-02 1.658 adenylate kinase 5 Cytoplasm kinase AK7
    [Show full text]
  • Cell TLR7 Activation and Plasmacytoid Dendritic CXCL13 Secretion in Human Monocytes Via HIV-1 Single-Stra
    HIV-1 Single-Stranded RNA Induces CXCL13 Secretion in Human Monocytes via TLR7 Activation and Plasmacytoid Dendritic Cell −Derived Type I IFN This information is current as of October 2, 2021. Kristen W. Cohen, Anne-Sophie Dugast, Galit Alter, M. Juliana McElrath and Leonidas Stamatatos J Immunol 2015; 194:2769-2775; Prepublished online 9 February 2015; doi: 10.4049/jimmunol.1400952 Downloaded from http://www.jimmunol.org/content/194/6/2769 References This article cites 49 articles, 23 of which you can access for free at: http://www.jimmunol.org/content/194/6/2769.full#ref-list-1 http://www.jimmunol.org/ Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists by guest on October 2, 2021 • Fast Publication! 4 weeks from acceptance to publication *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2015 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology HIV-1 Single-Stranded RNA Induces CXCL13 Secretion in Human Monocytes via TLR7 Activation and Plasmacytoid Dendritic Cell–Derived Type I IFN Kristen W.
    [Show full text]
  • Cells Receptor-Evoked Responses of Human Mast RGS13 Controls G
    RGS13 Controls G Protein-Coupled Receptor-Evoked Responses of Human Mast Cells This information is current as Geetanjali Bansal, Jeffrey A. DiVietro, Hye Sun Kuehn, of September 25, 2021. Sudhir Rao, Karl H. Nocka, Alasdair M. Gilfillan and Kirk M. Druey J Immunol 2008; 181:7882-7890; ; doi: 10.4049/jimmunol.181.11.7882 http://www.jimmunol.org/content/181/11/7882 Downloaded from References This article cites 65 articles, 27 of which you can access for free at: http://www.jimmunol.org/content/181/11/7882.full#ref-list-1 http://www.jimmunol.org/ Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication by guest on September 25, 2021 *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2008 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology RGS13 Controls G Protein-Coupled Receptor-Evoked Responses of Human Mast Cells1 Geetanjali Bansal,2* Jeffrey A. DiVietro,* Hye Sun Kuehn,† Sudhir Rao,3‡ Karl H. Nocka,4‡ Alasdair M. Gilfillan,4† and Kirk M.
    [Show full text]
  • Chemokine CXCL13 Acts Via CXCR5-ERK Signaling In
    Shen et al. Journal of Neuroinflammation (2020) 17:335 https://doi.org/10.1186/s12974-020-02013-x RESEARCH Open Access Chemokine CXCL13 acts via CXCR5-ERK signaling in hippocampus to induce perioperative neurocognitive disorders in surgically treated mice Yanan Shen1, Yuan Zhang1, Lihai Chen1, Jiayue Du1, Hongguang Bao1, Yan Xing2, Mengmeng Cai1 and Yanna Si1* Abstract Background: Perioperative neurocognitive disorders (PNDs) occur frequently after surgery and worsen patient outcome. How C-X-C motif chemokine (CXCL) 13 and its sole receptor CXCR5 contribute to PNDs remains poorly understood. Methods: A PND model was created in adult male C57BL/6J and CXCR5−/− mice by exploratory laparotomy. Mice were pretreated via intracerebroventricular injection with recombinant CXCL13, short hairpin RNA against CXCL13 or a scrambled control RNA, or ERK inhibitor PD98059. Then surgery was performed to induce PNDs, and animals were assessed in the Barnes maze trial followed by a fear-conditioning test. Expression of CXCL13, CXCR5, and ERK in hippocampus was examined using Western blot, quantitative PCR, and immunohistochemistry. Levels of interleukin-1 beta (IL-1β) and tumor necrosis factor alpha (TNF-α) in hippocampus were assessed by Western blot. Results: Surgery impaired learning and memory, and it increased expression of CXCL13 and CXCR5 in the hippocampus. CXCL13 knockdown partially reversed the effects of surgery on CXCR5 and cognitive dysfunction. CXCR5 knockout led to similar cognitive outcomes as CXCL13 knockdown, and it repressed surgery-induced activation of ERK and production of IL-1β and TNF-α in hippocampus. Recombinant CXCL13 induced cognitive deficits and increased the expression of phospho-ERK as well as IL-1β and TNF-α in hippocampus of wild-type mice, but not CXCR5−/− mice.
    [Show full text]
  • Manuscrit De Thèse
    MANUSCRIT DE THÈSE En vue de l’obtention du titre de Docteur en Sciences du vivant de l’université Paris Descartes Julien Fregeac Rôle du microARN 146a dans le développement cérébral et pertinence pour les maladies du neurodéveloppement Défense de thèse devant le jury composé de Docteur Alessandra Pierani Présidente Docteur Marion Coolen Rapporteure Docteur Frédéric Laumonnier Rapporteur Professeur Pierre Gressens Examinateur Professeur Christophe Lefebvre Examinateur Docteur Laurence Colleaux Directrice de thèse 1 2 Do not take life too seriously. You will never get out of it alive. Elbert Hubbard 3 4 REMERCIEMENTS À mon jury Mes premiers remerciements vont au Dr Marion Coolen et au Dr Frédéric Laumonnier pour le temps qu’ils ont pris afin d'évaluer mon manuscrit, au Pr Pierre Gressens et au Pr Christophe Lefebvre pour avoir accepté d’être mes examinateurs et au Dr Alessandra Pierani pour me faire l’honneur de présider mon jury. Enfin, je remercie l’ensemble de mon jury de m'offrir l'opportunité de discuter de mon projet de thèse avec des experts. Au Dr Laurence Colleaux J'aimerais adresser mes plus grands remerciements à ma directrice de thèse. J'aimerais te remercier Laurence pour m'avoir recruté et cru en moi alors même qu'on n'avait pas encore de financement de thèse, pour m'avoir encadré tout au long de ces quatre années de la meilleure des manières et encore plus pour ton soutien dans les moments difficiles de ces deux dernières années. Tu es une grande scientifique et une chef avec qui c'est un plaisir de travailler mais tu es avant tout une personne formidable.
    [Show full text]