sign in sign up
<<
Home , Gastrin

Proc. Natl. Acad. Sci. USA Vol. 90, pp. 9085-9089, October 1993 Biochemistry The human gastrin/ type B receptor gene: Alternative splice donor site in exon 4 generates two variant mRNAs (gastrointestinal /G -coupled receptor/gastric function/alternative splice junction/ 11) IL SONG*, DAVID R. BROWN*t, RODNEY N. WILTSHIRE0§, IRA GANTZ¶, JEFFREY M. TRENTO§, AND TADATAKA YAMADA*II Departments of *Internal Medicine, tRadiation Oncology, §Human Genetics, and $Surgery, The University of Michigan Medical Center, Ann Arbor, MI 48109 Communicated by Horace W. Davenport, July 12, 1993

ABSTRACT Gastrin and its carboxyl-terminal homolog homologous CCKB receptor cDNA has been cloned from cholecystokinin (CCK) exert a variety of biological actions in human cerebral cortex (10, 11). the brain and that are mediated in part Receptors for gastrin that have been characterized on through one or more G protein-coupled receptors which exhibit parietal cells and gastric myocytes have a pharmacological similar affinity for both . Genomic clones encoding a profile which is similar to that of the CCKB receptor. Indeed human gastrin/CCKB receptor were isolated by screening a competitive CCKB antagonists such as L-365,260 and PD human EMBL phage library with a partial-length DNA frag- 134308, which readily discriminate between CCK receptor ment which was based on the nucleotide sequence of the canine types, are incapable of selectively differentiating CCKB and gastrin receptor. The gene contained a 1356-bp open reading gastrin receptors (8). Recently, gastrin receptor cDNAs have frame consisting offive exons interrupted by 4 introns and was been isolated from cDNA libraries derived from canine assigned to human chromosome llpl5.4. A region of exon 4, parietal cells and rodent (Mastomys) enterochromaffin-like which encodes a portion ofthe putative third intracellular loop, tumor cells (12, 13). They encode homologous of appears to be alternatively spliced to yield two different similar length (453 and 450 aa, respectively) with seven mRNAs, one containing (452 amino ; long isoform) and deduced transmembrane regions, comparable to other G the other lacking (447 amino acids; short isoform) the penta- protein-coupled receptors. The recombinant receptors, when sequence Gly-Gly-Ala-Gly-Pro. The two receptor iso- transfected into COS-7 cells, manifest high (nanomolar) forms may contribute to functional differences in gastrin- and affinities for both gastrin and CCK and are coupled to an CCK-mediated signal transduction. increase in intracellular calcium (12, 13). Structurally, the canine gastrin receptor displays nearly 90% amino The gastrin is synthesized and identity with the putative CCKB receptors from human and released from G cells in the gastric antrum. Its putative rat (9-11). physiological actions include stimulation of pro- The sequence and organization of the full-length genes duction (1), induction of gastric smooth muscle contraction encoding members of the gastrin/CCK receptor family have (2), and promotion of growth and differentiation of the not been identified. Such information is essential for analysis mucosa (3). Cholecystokinin (CCK), a peptide pos- oftheir transcriptional regulation and structural relationships sessing an identical C-terminal pentapeptide sequence to to other receptor genes. We have cloned and sequenced a gastrin, mimics the actions of gastrin in the stomach. On the gastrin/CCKB receptor gene from a human genomic li- basis ofpharmacological and radioligand binding studies, the brary**. The gene appears to be alternatively spliced to yield diverse effects of CCK in peripheral organs and the central two different receptor isoforms which differ by 5 aa in the nervous system are thought to be mediated by two receptor putative third intracellular loop. The gastrin/CCKB receptor types (4, 5). The CCKA receptor has been localized to the gene was assigned to human chromosome 11p15.4 by fluo- , , vagal afferent neurons, spinal cord, rescence in situ hybridization. and certain mesencephalic nuclei. It is selectively blocked by the analog and exhibits a relative affinity for sulfated CCK that is 3 orders of magnitude higher METHODS than for gastrin. The cDNAs encoding this receptor have Genomic Library Screening and DNA Sequencing. A human been cloned from rat pancreas (6) and human gallbladder (7). genomic library in the bacteriophage AEMBL-3 (Clontech) The CCKB receptor is more ubiquitously distributed in the was screened with a 32P-labeled cDNA fragment generated by brain than the CCKA receptor, being chiefly found in hypo- the polymerase chain reaction (PCR) with primers based on thalamic nuclei, the limbic system, and the frontal cortex. the cDNA sequence of the canine gastrin receptor (see Unlike the CCKA receptor, the CCKB receptor exhibits below). Two positive clones were digested with Sst I and the nearly equal affinity for gastrin and both sulfated and non- resulting restriction fragments of length 0.7-3.2 kb (Fig. 1) sulfated forms of CCK. Moreover, CCKB antagonists which were subcloned into phage M13mpl8 or -mpl9 and se- are currently available can discriminate between CCKA and quenced in both directions by the dideoxy method (14). In CCKB receptors with up to 1000-fold selectivity (8). A cDNA encoding the putative CCKB receptor has been cloned from Abbreviation: CCK, cholecystokinin. AR42-J cells (a rat pancreatic acinar cell line) and rat cerebral tPresent address: Department of Veterinary PathoBiology (Pharma- cortex. It encodes a 452-aa protein manifesting 48% amino cology Section), University of Minnesota, 1988 Fitch Avenue, St. acid identity with the CCKA receptor (9). Recently, an Paul, MN 55108. "To whom reprint requests should be addressed at: Department of Internal Medicine, 3101 Taubman Center, University of Michigan The publication costs of this article were defrayed in part by page charge Medical Center, Ann Arbor, MI 48109-0368. payment. This article must therefore be hereby marked "advertisement" **The sequence reported in this paper has been deposited in the in accordance with 18 U.S.C. §1734 solely to indicate this fact. GenBank data base (accession no. L10822). 9085 Downloaded by guest on September 23, 2021 9086 Biochemistry: Song et al. Proc. Natl. Acad. Sci. USA 90 (1993)

A El (Promega) through 30 cycles of denaturation (1 min at 94°C), 5 1 E2 E3 E4 E5 I ..1 I I 3' annealing (2 min at 50°C), and extension (3 min at 72°C), with A A 3.2 2.1 A 07 2.4 A a final extension period of 10 min at 72°C. PCR products were S SS S S S 0.08 purified by phenol/chloroform extraction and digested with BamHI for ligation into M13mpl8 and sequence confirma- B ATG TGA EXON 1 EXON 2 EXON 3 EXON 4 EXON 5i tion. The 390-bp cDNA fragment derived from canine fundic Short l 151 252 _-250 158 = 533 RNA was labeled with 32P by random priming and used as a ATG TGA screening probe. To analyze human stomach gastrin/CCKB EXON 1 EXON 2 EXON 3 EXON 4 EXON 5 lAllig lForml 151 L 252 250 | 163 _ 533 receptor cDNAs, either oligonucleotide Y2 or a random hexamer was used as a primer for reverse transcription of

C D7 D2 human fundic total RNA to cDNA. Oligonucleotides Y1 and

EXON 5 Y3 were used to amplify the exon/intron splicing junction Y1 S8 Y4 Y3 Y2 TGA occurring between exons 4 and 5. Primer Y1 contained internal Sst I restriction sites, and primer Y3 possessed an Sst FIG. 1. Structure ofthe human gastrin/CCKB receptor gene. (A) I site at its 5' end. The resulting PCR product (646 bp) was Restriction map and exon location. Sst I restriction sites (under- sequenced as described above. Primer Y4 was constructed as scored by S with arrowhead) within the gene were located in intron a 20-mer based on a sequence in intron 4. Primer S8 was used 1 and exons 4 and 5. The Sst I restriction fragments were subcloned into the M13 vector and sequenced. (B) Two variant RNAs encode in combination with primer Y3 to verify the long receptor the gastrin/CCKB receptor. The sizes of exons (bp) appear within RNA isoform (see Fig. 1 for primer locations and Table 1 for rectangles. The RNA variants differ only in the size of exon 4, in sequence positions). which a sequence of 15 nt (black bar in long form) is either absent Chromosomal Mapping. To identify its chromosomal loca- (short form) or present (long form). The ATG in exon 1 and TGA in tion, 1 ,ug of DNA from a clone of the human gastrin/CCKB exon 5 indicate sites oftranslation initiation and termination, respec- receptor gene (-10 kb in length) was labeled with biotin and tively. (C) Oligonucleotide primers used to amplify DNA fragments hybridized to human metaphase (18). The by PCR (see also Table 1). Primers D7 and D2 were used to generate the 390-bp DNA fragment used as a probe to screen canine and chromosomes identified by fluorescence in situ hybridization human genomic libraries. Y2 was used as a primer for reverse were previously G-banded (using trypsin/Giemsa stain) and transcription ofhuman fundic RNA to cDNA, and primers Y1 and Y3 photographed with a Zeiss Axiophot microscope equipped were employed in PCR amplification of the exon/intron boundary with a dual-bandpass fluorescein/rhodamine filter to allow between exons 4 and 5. Primers Y1 and Y4 were used to amplify the direct comparisons of the results. sequence between exon 4 and intron 4 in human genomic DNA to confirm the existence of a single gene. Primer S8 was used together with primer Y3 to amplify the long isoform from human stomach RESULTS AND DISCUSSION RNA. Organization of the Gastrin/CCKB Receptor Gene. A ran- addition, an 81-bp DNA fragment was determined to span dom-primed 32P-labeled canine gastrin receptor cDNA probe two Sst I sites in the first intron as determined by sequencing gave positive hybridization signals with 2 clones of 5 x 105 an Sph I restriction fragment (restriction site in exon 2) in the plaques from a human genomic library. One of the human 3'-to-5' direction. A canine genomic library (Clontech) was genomic clones was incomplete (exon 1 absent) and the other also screened for this gene. Oligonucleotide primers for clone, H50-1, contained the full-length gene encoding the sequencing or PCR were synthesized on a DNA synthesizer gastrin/CCKB receptor. An incomplete gastrin/CCKB recep- (model 380B; Applied Biosystems). Computer analyses of tor gene lacking exon 1 was also isolated from a canine nucleotide sequences were performed with the Genetics genomic library. The human receptor gene exceeded 8 kb in Computer Group (GCG) program (University of Wisconsin length and contained a 1356-bp open reading frame which was Biotechnology Center, Madison, WI). Nucleotide sequences interrupted by four introns of 164-1177 bp (Figs. 1 and 2). Its were translated to sequences by using the IUB deduced amino acid sequence delineates it as a member ofthe code in the GCG program (15). G protein-coupled, heptahelical receptor superfamily. Exon PCR Cloning. RNA was extracted (16) from canine and 1 encodes the putative extracellular amino terminus of the human gastric fundic mucosa. Total RNA (10-20 ,ug) was receptor. Exons 2 and 3 encode transmembrane regions I-IV, reverse-transcribed to cDNA (17), and this cDNA served as and exon 4 encodes the fifth transmembrane region and an the template for subsequent PCRs. PCR primers D2 and D7, initial portion of the third intracellular loop. Exon 5 encodes which contained BamHI restriction sites at their 5' ends (Fig. the remainder of this intracellular loop, the remaining trans- 1 and Table 1) were used to generate a 390-bp probe for membrane regions VI and VII, the intracellular carboxyl screening human and canine genomic libraries. These se- terminus, and the 3' untranslated region (Fig. 3). The 5' quences were based on the canine gastrin receptor cDNA region immediately upstream from the ATG initiation codon sequence (12) and correspond to nt 2810-2839 (primer D7) to nucleotide -293 manifests a high G+C content (76%). A and 3167-3199 (primer D2) of the human receptor gene (Fig. polyadenylylation site (AATAAA) occurs 558 bp down- 2). PCR was performed with Taq DNA polymerase stream from the stop (TGA) codon (Fig. 2). Table 1. Sequence of oligonucleotide primers used for PCR Primer Sequence (5' -* 3') Orientation Location/exon* D2t TCAGCCAGGCCCTAGCGTGCTGATGGTGGTGTA Antisense 3199-3167/5 D7t CGGCCCTACCAGGCCAAGCTGTTGGCCAAG Sense 2810-2839/5 Y1 GTGGCCTACGGGCTTATCTCTCGCGAGCTCTACTTA Sense 2354-2389/4 Y2 CATCGGGAAGAGCCCTGGGGCGAGCTCGTGGAGGCC Antisense 3122-3087/5 Y3 GAGGCGTAGCTCAGCAAGTGAATGAAGGAGAT Antisense 3000-2969/5 Y4 tcccagctcaactccatttc Antisense 2589-2570/intron 4 S8 CAGGTGGGGCTGGAC Sense 2457-2471/4 *Based on the human gastrin/CCKB receptor gene sequence shown in Fig. 2. tThe sequence of primers D2 and D7 is from the canine gastrin receptor cDNA. Downloaded by guest on September 23, 2021 Biochemistry: Song et al. Proc. Nati. Acad. Sci. USA 90 (1993) 9087

-333 GAGGGATTTAAGGCGAAACA -293 -193 ACGGGAACCCAGG4CGGGGcCAGCCCGAATAOGACGCGCGGGGGCAGCGGAGGAGAA0AGCC -93 GGGAGCCTuAGC4CGGAATCGCAGCGTGAOGCAGGTGGOAGCCOOTOAGCCOGTGGTAGAOCGCOCCGCOGC M E 2 6 G CTG CTA AAG CTG AAC CGG AGC GTO CAG CACCGACC Cc 00 CC O OCT TCC! CTG TOIC CCCCCG CC L L K L N R S V Q G T G P G P G A S L C R P G A P 27 81 T CTC CTC AAC AGC AGC AGT GTGOC, AAC CT AGC TOC GAG CCC CCT CGC ATT CCOA C GOO ACA C GTOGG L L N S S S V G N L S C E P P R I R G A G T R 50 156G 256 AGCCTCACTCCTCATCACATCMTTTATGATCTG-AGTrACCCCATTACCCAAGCGGTTGCT? VCI'rTcCA 356 TGCTCACMGATTCTATTATAGAGTAAGIGAAATM ACAGAATAAAGTTA 456 TAG? GTIGTAAGAAACAGGCATGGGTCAGAGAAAGAGGAGAGTAGAAGGGCCCAAAATCATA'¶GTTGAACAGATA 556 TGA?CCAAAAAATGTTAGGGTGATGGGAGTGTAAATTCGCGGACACTAC 656GGAAATAATCATAGAAGATATCTAGVCTCAATCTCT 756 TCTTGAGAC'GTAA 'CAAG AGAGA 1 LTTTAAATAA 856 956 1056 TAGATrTCOAGAGAGTGAOACGGAAAAGTTTAGAGGAATGGCA'TACA 1156 CCTCrAAGGGGTTAGAAGGCTAAAGGATT'rCA?CCAIATAcGTCTGTGGAOAGAcTGTGTGGGGrGG 1256 TAGCGAGGOG?TATATAOCGCCCTACTGCCACcCCII'CrCC AA 'TTO GAG CTO CCC ATT' AGA E L E L A I R 57 1349 ATC ACT rTTr TAC CA TO ATC T~TC CTO ATO. ACC- O¶TT GA GGA AAT ATO CTC ATC ATC OTO GTt CTO MCACT ACCr I T L Y A V I F L M S V G G NM L I I V V L G L S 82 1424 =C CC CTG AGG ACT OT ACC AAT GCC TITC CT CTC TtA CT QCA OGM ACC MCAC OTt CTO CTO CCrT amO OT OC R R L R T V T N A F L L S L A V S D L L L A V A C 107 1499 ATO CCC 'IT ACC CTC CTM CCC AAT CTC ATOG GGC ACA TITt ATC TT'T GGC ACC OT TC TO AAG CMC Cmm TCC TAC! M P F T L LP N L MG T F I F G T V I C K A V S Y 132 1574 CT T TGGOWTGAGACAACCACCCACCCCCA'TGkCCACTCTCCCGCCCAAT'ITGTTAGT'ICCGIGAGAGO L M 134 1671 TGTGAGGAAGTCCCACTGA7TGCGTGTAGTGCAA-GTTTCCTAGGTGACTCCTC'TTCICC CTII IT GGC GTOG TO GTO ACT =T TC G V S V S V S 141 1764 CGC T C TC T GCC A'TC GCA CT GAG CGG TAC AGC GCC ATC TOC CGA CCA CTCGGOC CGATOG TOO CA T L S L V A I A L E R Y S A I C R P L Q A R V W Q 166 1839 0ACO CGC 'rCC CAC CCC OCT CCC OTC ATT QTA CCC ACO TMO CTO CT TCC OCA CTA CT A MrOT CrCC TAC MCCC=C T R S H A A R V I VT N L L S G L L V P Y P V191 1914 0 TAC_ ACT OTC OTO. CAA CCA O;Tc COO CC CO TOCO TOC OTOG CAT CCCTOCCACTMr CCC CC TC CCZC CA Y T V V Q P V C P R V L Q C V H R W P S A R V R Q 216 1989 r.ArT G-TtAGCTGC.rCCATAAACTATCCTAGG~AATTCCTTTCTCACCCCTATTAGATOC'IACGACCATTGCCCAGAATCTTCCTCCAGCTTCCCG T W 218 2086 GAGAATTACCACGCCAACTCCTATITCTOCATCCACCACCCTGGAGTITCCAGTTTGGOOCCCTCCCCAO'TCTCTCTCCCT1'CCCAGCGGCACCCCCAAA 2186TCTCC-ATCGTCTCCACCAAAATGCTGCT TCTTTATCGTACGACCATAC 2286 TCTGTOTTGCCTTCAG r0 TCC GTA CTO CTO CIT CT CTC 'TOG TTC TTC ATIC CCG COT OMTOCIr ATM CCC OTO. CC TAC S V L L L LL L F F I P 0 V V M A V A Y 238 2364 CC CIT ATC =~C CC-C GACO CTC "AC TTA COO CTT CGC 'TTT GAC CCC GAC ACT GAC ACC GAC ACC AA ACC AC- CTC C G L I S R E L Y L 0 L R F D 0 D 5 D S D S Q S R V 263 2439 G A AC CA CCC_ GGG CTO CC"CGT 000 OCT OGA CGA C TAGCAATTOCAOOAGIIGA0CAOOCTC R N Q G L P __270 G G A G P (275) 2525 GGAGTrGOGTCOGACTCwAAATO%AAGGTAGGOOGAAGACGATOGIOOTGACOOTAGOOATOCOAATG 2625 GGGACTCGCC-L 'iT'-iTCTCTCCGCCCACCCTTTi,GTGCTC'AG CC OICT CITT GAC CAG AAC GGG COT TOC COO CCT GAG ACT GCC CC 285 R A V H Q N OGR C R P ET 0 A(290) 2710 C CGTTC A GAC AGCC GAT GGC TGC TAC GTM CAA CTT CGA COT TCC! CGG CCT GCCC T GAO CT ACC QCC CTO AC 310 V 0 E D S DOG C Y V Q L P R S R P AL E L TA L T (315) 2785 r0 OCT CCT COO, CMC OG TCC CC-C TCC CMC CCC ACC rAO. CCC AAG TCTC OCT AAG AAG CMC OTOm MT A ATO TT 335 A P G P 0 S 0 5 R P T Q A KL L A KK R V V R M L (340) 2860 r0 CTO'rTO.IT.CTr GT CTT TTIT TTT CTO TOT TOO 'TTO CCA CIT TAT ACT GCCC AAC ACTOO CCIC _CC_C 'TAT CO. 360 L V I V V L F F L C W L P V Y S A N T W R A F D 0 (365) 2935 C CCCQ COT OCA QCA CGA GCA CTCr TCO COT OCT CCT ATC TCC TTC ATT CAC ITO =T ACC TAC CCCr TCrO rer 'TOT CT 385 P 0 A H R A L S G A P I S F I H L L S Y A S A C V (390) 3010 C AAC CCC CTO O"IC TAC TOC q-C' ATO CAC COT CGC =T CrC CAGACCC TOGC CTO. rAA ACT TOC OC-T CC O C O 410 N P L V Y C F M H R R F R Q A C L E T C A R C C P (415) 3085 C_ COO CCT CrA CGA OCT CCC CCC AGG OCT CTT CCC GAT GAO GAC CCT CCC ACT CCC TCC ATT GCT TOO CTO TCCr AC, 435 R P P R A R P R A L P 0 E D P P T P 5 I A S L S R (440) 3160 G CTTr ACC TAC ACC ACC ATC ACC ACA CTO CCC CCT GGC TOA OATAOOCOOGGIAOAOCAAAAGAC447 L S Y T T I S T L 0 P0G * (452) 3246 TGACCCTTCGAGACATAGAAAACACAAACCACAACTOGACACAGGAAACCAACACCCACAOCTCCACOAAGAOTA'ICT 3346 OCCAAGAACAGACOAAOGAGAOAOCCOTTGATACTGCAAAAAOCCOClGA 3446AAAACTCCACTAAT'CTCATGAATTAAGCTACCCC'AAATAArAGACGT'IT 3546 TGGCAGACTGAAGCGCCGGTCCTG'TACCC0GCCICCACGATAATCACCCT 3646 ATCTC_ATACCTvTGACCAACAGGCT0I"tCTOC-ACTC0AAAGG'i c'rrCATCCCT'II CA0?1AAGGAcC= GCIcccC'TcrCcA 3746 TG'ITCAAGAAATA&T'IATT'TGGC'TCCTTCCTOACICITTG'TTT00A0TA AGATGTPIOGAT'TT'' 3846 CAGGTCTCTCCCACTG'ITGCACACTICTOTCACAACCCC'TTGCCAGAAAGCCCAGCCTCTGA0G'ITCAGCGTGGCTTGCATATITC?TTCTCOAGTTTTC 3946 ATCCTCTACCTACA'ITCCAAMTT?OCAATAACTTATOGTAAAGATTGTATAAOAICOTAA'ATCAOO 4046 OGCCOTAGATT'TAOAGTAIAAIIIOTA FIG. 2. Nucleotide and deduced amino acid sequence of the human gastrin/CCKB receptor gene. The five exons are underlined. The nucleotide sequence is numbered on the left relative to the first nucleotide of the translation initiation codon; amino acids are numbered on the right and are depicted in the single-letter symbols below each triplet codon. The putative stop codon (TGA) at nt 3197-3199 is underscored by asterisks, and a polyadenylylation consensus motif (AATAAA) is underlined at nt 3758-3763. In exon 4, altemnative splicing results in the expression of the pentapeptide cassette Gly-Gly-Ala-Gly-Pro (GGAGP) at nt 2460-2474 (overUined amino acids). The interrupted open reading frame of the gene exhibited receptor genes display a relatively high homology to that of 88% and 100% nucleotide identity with canine gastrin recep- the gastrin/CCKB receptor and also contain four introns (19). tor and human CCKB receptor cDNA sequences, respec- Alternative Splicing of Exon 4. The human gastrin/CCKB tively (10-12). In contrast, the protein-coding region of the receptor gene contained exon/intron boundaries at aa 51, gene manifests :w50% amino acid identity with rat and human 135, 218, and 271 (or 276) that conformed to known splice CCKA receptor cDNAs (6, 7). Many genes encoding G junction consensus sequences (20). In a region of exon 4, protein-coupled receptors, such as those encoding most however, two of these consensus sequences were found in types of and muscarinic receptors, close proximity (Fig. 3). This region of exon 4 encodes a possess an intronless open reading frame. Nevertheless, portion of the third intracellular loop, an important site for several exceptions are known to exist. Genes encoding three effector coupling and regulatory phosphorylation in most G receptor subtypes mediating the actions of another class of protein-coupled receptors. Using PCR with strategically de- gut peptides, the tachykinins, are among these intron- signed primers (Fig. 1 and Table 1), we determined that the containing genes. The nucleotide sequences ofthe tachykinin human gastrin/CCKB receptor gene was alternatively spliced Downloaded by guest on September 23, 2021 9088 Biochemistry: Song et al. Proc. Natl. Acad. Sci. USA 90 (1993)

A EXON 2 EXON 3 VEXON 5

11 III IV V VI Ill FIG. 3. Alternative splicing of the gastrin/CCKB receptor gene. (A) Relationship of exons to putative B membrane-spanning regions I-VII. Circled area high- I 1 2 I lights region of alternative splicing. (B) Alternative Human cDNA RNA splicing in exon 4. The pentapeptide cassette Short lorm G L P 271© A V GGAGP encoded by 15 nt (underlined in the human Long Form G L P G G A G P 276 @ A V gene) is located at aa 271-275 in the third intracellular

Human Gene GGG CTG CCA GGT G0G GCT GG0 CCA C gtgagcao (192/207). gtgct cog GG GCT OTT loop of the long receptor isoform. Asterisks indicate Canine Gene 0GG CTG CGG GGT GGG GCG GG0 CCR G gtgggtga ....(128).... gtgctcag GT CCT GCC splice sites. RNA splicing at arrow 1 (G/gt) yields a Canine cDNA G L R G G A G P 275 G P glycine (G) residue at position 271 ofthe short isoform, Rat cDNA G L P G G AA P 276 G P and at arrow 2 (C/gt) an arginine (R) residue at position Mastornys cDNA G L P G G T A P 276 G P 276 is translated in the long isoform.

in exon 4. Two mRNA variants were found to exist in human CCKB receptor cDNA from human brain (10, 11). These stomach: one, termed the long isoform, contained a block of species differences may arise from an important difference in 15 nt in exon 4 that encoded the pentapeptide cassette genomic sequence at the splice junction in the fourth exon. GGAGP. A second, short isoform lacked this sequence. Both G/gt is the most common motiffor RNA splicing at the 3' end isoforms were identified to coexist in each of three separate of an exon (20). In the canine gene, the splice junction in human gastric specimens; thus, the variant mRNAs do not question is G/gt (Fig. 3). In the human gene, however, the appear to arise from differences between individuals. When comparable site is C/gt; thus a G/gt site 15 bp upstream may the Y1 and Y3 primers were utilized for PCR, only the short become the preferred splice junction, giving rise to the short isoform was identified at first; the long isoform was identified isoform of the receptor. with the S8 and Y3 primers. However, the long isoform ofthe We hypothesize that these two mRNA isoforms arise from gastrin/CCKB receptor was also identified when the PCR a single gene. A report by Lee et al. (11) indicates that a single fragments obtained using the Y1 and Y3 primers were used gene encodes the human gastrin/CCKB receptor as deter- as templates for a second PCR reaction with the S8 and Y3 mined by Southern blotting of human genomic DNA. Fur- primers. ther, when we amplified DNA from (i) two different samples The short isoform of the human gastrin/CCKB receptor is of human genomic DNA by PCR using primers Y1 and Y3 or spliced at a G/gt consensus site (Fig. 4, arrow 1); the 15 nt (ii) genomic DNA obtained as a contaminant during RNA after the splice junction are not included in the mRNA extraction from the human stomach specimens using the encoding this isoform. In contrast, the long isoform, spliced primers Y1 and Y4, only a single gene sequence correspond- at C/gt (Fig. 4, arrow 2) encodes the pentapeptide sequence ing to that shown in Fig. 2 was obtained. in its mRNA. The pentapeptide cassette (with slight modifi- Alternative splicing occurs in the third intracellular loop of cations) is also encoded in the gastrin receptor cDNAs from certain other G protein-coupled receptors, such as the human canine parietal cells (12) and Mastomys enterochromaffin- D2 and D3 receptors (21-23). In the case of the D2 like tumors (13) and in the CCKB receptor cDNA from rat dopamine receptor, alternative splicing may affect the cou- brain (9). However, it is apparently absent in the gastrin/ pling of the receptor to second-messenger pathways (24, 25).

5 3' -w FAON' 1-1--'-t - FIAOtNI 5 am GGGCTGTTCACCAGAACGGGCGTT...... GGGCTGCCAG ...... - ~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~~Ir (A) CDNA ARI: Short Fornm

2 .GGGCTGCCAGtgtggggctggaccac glgagcaaaat INTRON 4 gtgctcag GGGCTG

Gene

(C) cDNA l

Long Form 1 { 14

.G...... CAG gtggggctggaccac GGGCTGTTCACCAGAACGGGCGTTG

I-.X(-)N 4 I .]t I.x(F( N o

FIG. 4. Sequence analysis of gastrin/CCKB receptor isoforms observed by PCR amplification of RNA from the fundic mucosa of a single human stomach. In A, a cDNA (short form) which lacks a tract of 15 nt appears to arise from a splice junction at G/gt (arrow 1) in the gene (B). In C, a longer cDNA isoform contains the 15-nt sequence encoding the pentapeptide GGAGP and is spliced at C/gt (arrow 2) in the gene. Asterisks indicate splice sites. Downloaded by guest on September 23, 2021 Biochemistry: Song et al. Proc. Natl. Acad. Sci. USA 90 (1993) 9089 A the role, if any, of altered gastrin/CCKB receptor gene _mo 4)- ., expression in these disorders may be worthy of further exploration. We thank Dr. M. K. Abbas for technical assistance. This work was 44 supported in part by National Institutes of Health Grants RO1- DK34306 and P30-CA46592 and funds from the University of Mich- f .' 's~i l." igan Gastrointestinal Peptide Research Center (National Institutes of Health Grant P30-DK34933). D.R.B. was a Visiting Research Inves- tigator supported in part by National Research Service Award F33-DK08686. qwakop **4-V A 1. Dockray, G. J. & Gregory, R. A. (1990) in Handbook of Physiology, eds. Schultz, S. G., Makhlouf, G. M. & Rauner, B. B. (Am. Physiol. Soc., Baltimore, MD), Vol. 2, Sect. 6, pp. Va_ 311-336. 2. Grider, J. R. & Makhlouf, G. M. (1990) Am. J. Physiol. 259, G184-G190. 3. Zachary, I. & Rozengurt, E. (1993) Handb. Exp. Pharmacol. ** t 106, 343-362. 4. Innis, R. B. & Snyder, S. H. (1980) Proc. Natl. Acad. Sci. USA 77, 6917-6921. 5. Moran, T. H., Robinson, P. H., Goldrich, M. S. & McHugh, P. R. (1986) Brain Res. 362, 175-179. 6. Wank, S. A., Harkins, R., Jensen, R. T., Shapira, H., de Weerth, A. & Slattery, T. (1992) Proc. Natl. Acad. Sci. USA 89, 3125-3129. 7. Ulrich, C. D., Ferber, I., Holicky, E., Hadac, E., Buell, G. & Miller, L. J. (1993) Biochem. Biophys. Res. Commun. 193, 204-211. 8. Presti, M. E. & Gardner, J. D. (1993) Am. J. Physiol. 264, G399-G406. 9. Wank, S. A., Pisegna, J. R. & de Weerth, A. (1992) Proc. Natl. Acad. Sci. USA 89, 8691-8695. 10. Pisegna, J. R., de Weerth, A., Huppi, K. & Wank, S. A. (1992) Biochem. Biophys. Res. Commun. 189, 296-303. 11. Lee, Y. M., Beinborn, M., McBride, E. W., Lu, M., Kola- kowski, L. F., Jr., & Kopin, A. S. (1993) J. Biol. Chem. 268, 8164-8169. 12. Kopin, A. S., Lee, Y.-M., McBride, E. W., Miller, L. J., Lu, M., Lin, H. Y., Kolakowski, L. F., Jr., & Beinborn, M. (1992) Proc. Natl. Acad. Sci. USA 89, 3605-3609. 13. Nakata, H., Matsui, T., Ito, M., Taniguchi, T., Naribayashi, FIG. 5. Localization of the gene encoding a gastrin/CCKB re- Y., Arima, N., Nakamura, A., Kinoshita, Y., Chihara, K., ceptor to human chromosome 11. (A) G-banded metaphase chromo- Hosoda, S. & Chiba, T. (1992) Biochem. Biophys. Res. Com- some spread. (B) Identical metaphase chromosome spread after mun. 187, 1151-1157. fluorescence in situ hybridization with a biotin-labeled probe of the 14. Sanger, F., Nicklen, S. & Coulson, A. R. (1977) Proc. Natl. gastrin/CCKB receptor gene. Arrows indicate chromosome 11. Acad. Sci. USA 74, 5463-5467. (Inset) Localization of the fluorescent signal to 11p15.4 under a 15. Nomenclature Committee (1985) Eur. J. Biochem. 150, 1-5. higher resolution of chromosome banding. 16. Chomczynski, P. & Sacchi, N. (1987) Anal. Biochem. 162, 156-159. Thus, the pentapeptide cassette in the gastrin/CCKB recep- 17. Gubler, U. & Hoffman, B. (1983) Gene 25, 263-269. tor may be of potential functional importance. If so, aberra- 18. Meltzer, P. S., Guan, X.-Y., Burgess, A. & Trent, J. M. (1992) tions in alternative RNA splicing within the internal exon Nat. Genet. 1, 24-28. may contribute to disease states involving the gastrointestinal 19. Gerard, N. P., Bao, L., Xiao-Ping, H. & Gerard, C. (1993) Regul. Pept. 43, 21-35. tract and possibly the central nervous system. 20. Mount, S. M. (1982) Nucleic Acids Res. 10, 459-472. Chromosomal Mapping. Twenty-seven metaphase cells 21. Giros, B., Sokoloff, P., Martres, M.-P., Riou, J.-F., Emorine, were examined and 24 cells exhibited positive fluorescent L. J. & Schwartz, J.-C. (1989) Nature (London) 342, 923-926. signals on the terminal short arm of chromosome 11. Fifty- 22. Monsma, F. J., Jr., McVittie, L. D., Gerfen, C. R., Mahan, nine percent (16/27) ofthe cells manifested specific signals on L. C. & Sibley, D. R. (1989) Nature (London) 342, 926-929. both homologs, whereas 30% (8/27) displayed a specific 23. Fishburn, C. S., Belleli, D., David, C., Carmon, S. & Fuchs, S. (1993) J. Biol. Chem. 268, 5872-5878. signal on one homolog. The results demonstrated the local- 24. Montmayeur, J.-P. & Borrelli, E. (1991) Proc. Natl. Acad. Sci. ization of the gastrin/CCKB receptor gene to chromosome USA 88, 3135-3139. 11p15.4 (Fig. 5). Genes encoding other members of the G 25. Liu, Y. F., Civelli, 0., Grandy, D. K. & Albert, P. R. (1992) J. protein-coupled receptor superfamily on this chromosome Neurochem. 59, 2311-2317. include the D4 dopamine receptor gene, which maps near the 26. Gelernter, J., Kennedy, J. L., van Tol, H. H. M., Civelli, 0. & telomere at 11p15.S (26), and the m4 muscarinic cholinergic Kidd, K. K. (1992) Genomics 13, 208-210. 27. Grewal, R. P., Martinez, M., Hoehe, M., Bonner, T. I., Ger- receptor gene, which is localized near the centromere at shon, E. S. & Detera-Wadleigh, S. (1992) Genomics 13, 239- llpll-p12 (27). Deletions in the short arm ofchromosome 11 240. have been linked to astrocytic tumors in adults and primitive 28. Fults, D., Petronio, J., Noblett, B. D. & Pedone, C. A. (1992) neuroectodermal tumors of children (28). Determination of Genomics 14, 799-801. Downloaded by guest on September 23, 2021