Regulation of the Gastrin Promoter by Epidermal Growth Factor and Neuropeptides JUANITA M

Home , Gastrin

Proc. Nati. Acad. Sci. USA Vol. 86, pp. 3036-3040, May 1989 Biochemistry Regulation of the gastrin promoter by epidermal growth factor and neuropeptides JUANITA M. GODLEY AND STEPHEN J. BRAND Gastrointestinal Unit, Department of Medicine, Harvard Medical School, Massachusetts General Hospital, Boston, MA 02114 Communicated by Kurt J. Isselbacher, December 30, 1988

ABSTRACT The regulation of gastrin gene transcription gastrin secretion (12, 13), the effect of GRP on gastrin gene was studied in GH4 pituitary cells transfected with constructs expression has not been reported. Antral G cells are also comprised of the first exon of the human gastrin gene and inhibited by the paracrine release of somatostatin from various lengths of 5' regulatory sequences ligated upstream of adjacent antral D cells (14), and local release of somatostatin the reporter gene chloramphenicol acetyltransferase. Gastrin inhibits gastrin gene expression as well as gastrin secretion reporter gene activity in GH4 cells was equal to the activity of (15). a reporter gene transcribed from the endogenously expressed In contrast to the detailed studies on gastrin secretion, the growth hormone promoter. The effect of a variety of peptides regulation of gastrin gene expression has not been well on gastrin gene transcription including epidermal growth investigated. The cellular mechanisms controlling gastrin factor (normally present in the gastric lumen), gastrin- secretion have been analyzed using isolated primary G cells releasing peptide, vasoactive intestinal peptide, and somato- (12, 13); however, the limited viability of these cells has statin (present in gastric nerves) was assessed. Epidermal precluded their use in studying the regulation of gastrin gene growth factor increased the rate ofgastrin transcription almost transcription using DNA transfection techniques. Although 3-fold, whereas thyrotropin-releasing hormone and vasoactive there are no permanent cell lines derived from antral G cells, intestinal peptide increased gastrin transcription 2- and 1.5- permanent cell lines have been derived from other gastrin- fold, respectively. Gastrin-releasing peptide, a peptide that expressing neuroendocrine tissues, such as the anterior strongly stimulates gastrin release, weakly increased gastrin pituitary (16, 17) and pancreatic islets (18). The GH4 pituitary transcription (1.3-fold). Somatostatin inhibited the increase in cell line is a particularly attractive cell line for analyzing gastrin transcription induced by epidermal growth factor, regulation of the gastrin gene because these cells possess thyrotropin-releasing hormone, and vasoactive intestinal pep- functional receptors for EGF (19), GRP (20), thyrotropin- tide. Constructs containing various lengths of 5' regulatory releasing hormone (TRH) (21), VIP (22), and somatostatin sequences defmed a response element -40 to -82 base pairs (23), all putative regulators of gastrin secretion from antral G (bp) 5' to the transcription initiation site. This 40-bp sequence cells. Furthermore, studies on the stimulation of prolactin contains Spl and AP2 binding sites, which suggests that gene expression by EGF in GH4 cells have identified an EGF epidermal growth factor and thyrotropin-releasing hormone response element within the prolactin gene (24). stimulate gastrin gene transcription through transcription The present study shows that the promoter of the gastrin factors that bind to Spl and/or AP2 motifs. gene was highly active when transfected into GH4 cells, comparable to the activity of the rat growth hormone pro- Gastrin has a dual action in the gastrointestinal tract, one as moter, which like Rous sarcoma virus promoter-chloram- the major hormone controlling gastric acid secretion and the phenicol acetyltransferase (RSVCAT) is not regulated by other as a growth factor controlling mucosal proliferation (1- EGF (24). Gastrin promoter activity was stimulated almost 3). Secretion of gastrin from antral G cells is determined by 3-fold by EGF and to a lesser degree by TRH and VIP. a complex interplay of stimuli in the gastric lumen and in Somatostatin inhibited the increase in gastrin promoter mucosal nerves (4). A distinguishing feature of endocrine activity induced by EGF, TRH, and VIP. Deletional mapping cells in the gastrointestinal tract is that they are regulated by identified a 40-base pair (bp) sequence immediately upstream stimuli in the gastrointestinal lumen via receptors on their of the TATA box that was required for EGF and TRH apical surface. Although the components of gastric contents stimulation. This sequence contains putative binding motifs that regulate antral G cells are poorly characterized, gastric for Spl (25) and AP2 (26) transcription factors, suggesting secretions contain one of the highest concentrations of that transcription factors binding to these motifs are activated biologically active epidermal growth factor (EGF) in tissue by EGF. fluids (5, 6). Therefore, in addition to its role as a mucosal growth factor, EGF may also regulate antral G cells via MATERIALS AND METHODS luminal receptors on the apical surface of the G cell. Specific receptors for EGF have been characterized on the rat Gastrin-Chloramphenicol Acetyltransferase (CAT) Con- enterocyte (7), and EGF has been shown to stimulate growth structs. A phage containing about 1300 bp of 5'-flanking of the gastric mucosa (8). EGF also stimulates hormone gene genomic DNA of the human gastrin gene was isolated from expression, the best studied example being the pituitary a Charon 4A human genomic library that was identical to the hormone prolactin (9). Therefore, EGF may stimulate gastrin one described by Ito et al. (27). An EcoRI-Pst I fragment of gene expression in addition to its role as a luminal growth this genomic insert, which included 1300 bp of 5'-flanking factor. Antral G cells are also stimulated by neuropeptides sequence and the entire first exon (noncoding) was ligated released from antral nerves, such as gastrin-releasing peptide upstream of a promoterless CAT gene in the expression (GRP) (10, 11) and vasoactive intestinal peptide (VIP) (4). Although studies ofisolated G cells show that GRP stimulates Abbreviations: EGF, epidermal growth factor; GRP, gastrin- releasing peptide; TRH, thyrotropin-releasing hormone; VIP, vasoactive intestinal peptide; CAT, chloramphenicol acetyltransferase; The publication costs of this article were defrayed in part by page charge LTR, long terminal repeat; GASCAT, gastrin promoter-CAT; RS- payment. This article must therefore be hereby marked "advertisement" VCAT, Rous sarcoma virus promoter-CAT; GHCAT, growth hor- in accordance with 18 U.S.C. §1734 solely to indicate this fact. mone promoter-CAT. 3036 Downloaded by guest on October 1, 2021 Biochemistry: Godley and Brand Proc. NatL. Acad. Sci. USA 86 (1989) 3037 vector pOCAT (1300 GASCAT) (28). The growth hormone Primer-Extension Analysis. Primer-extension analysis was promoter-CAT plasmid (GHCAT) was a gift from David carried out after the method of Wu et al. (35). Thirty Moore (Harvard Medical School, Massachusetts General micrograms of total RNA extracted from GH4 cells tran- Hospital) (29). siently transfected with the 1300 GASCAT construct was Cell Culture and Transfections. GH4 cells were cultured in hybridized to a 32P-labeled oligonucleotide primer (10 ng; 108 Ham's F-10 medium with 12.5% horse serum, 2.5% fetal calf cpm/10 ng) complementary to the coding sequence +85 to serum, penicillin at 100 jig/ml and streptomycin (medium) at + 103 of the CAT gene. 100 pug/ml in a humidified atmosphere of 5% C02/95% air. Stable transformants: The 1300 GASCAT plasmid was trans- RESULTS fected with the RSVneo plasmid, which expresses the neomycin resistance gene from the Rous sarcoma virus promoter GH4 Cells Express the Gastrin Promoter. GH4 cells were (GASCAT:RSVCAT, 30:1 ratio) as a calcium phosphate transfected with a GASCAT plasmid containing 1.3 kilobases were selected by resis- (kb) of 5'-flanking DNA and the first exon of the human coprecipitate (30). Transfected cells gastrin gene ligated upstream of the reporter gene CAT. tance to the neomycin analogue G418 at 400 gg/ml. Pooled Gastrin promoter activity was measured by assaying CAT stable transformants were then used in EGF regulation enzyme activity in extracts of transfected GH4 cells and was studies. Transient expression assays: Subconfluent GH4 cells compared with the activity of RSVCAT and GHCAT plas- were transfected with a mixture containing DEAE-dextran at mids (Fig. 1A). In RSVCAT, the CAT gene is transcribed 400 ,ug/ml, DNA at 5 gg/ml, and 50 mM Tris HCI in F-10 from the Rous sarcoma virus long terminal repeat (LTR) medium without serum for 15 min at 370C followed by promoter that is highly expressed in many cell types. In glycerol shock for 2 min (31, 32). EGF and neuropeptides GHCAT, the CAT gene is transcribed from the rat growth were added the day after transfection and 24 hr before hormone promoter, which regulates a gene specifically ex- preparing cell extracts. pressed in GH4 cells (29). In transient expression assays, CAT Assays. Cell extracts were assayed for CAT by the GASCAT activity was nearly 50% of RSVCAT activity and method of Gorman et al. (33); protein was determined by the similar to that of GHCAT activity (Fig. LA). In contrast, method of Bradford (34). GASCAT activity in fibroblast (3T3) cells was <5% of RSVCAT (Fig. 1A). Although the endogenous gastrin gene is -- I ~~GH4I 3T3 not expressed in GH4 cells, the gastrin promoter is as active GASCAT GHCAT RSVCAT GASCAT RSVCAT as the growth hormone promoter, indicating that GH4 cells A) possess specific transcription factors-not present in fibro- S.,... blasts-that are necessary to activate the gastrin promoter. Primer-extension analysis demonstrated that CAT activity *0 resulted from mRNA that initiates from the authentic gastrin * S.' promoter (Fig. 1B). The expected 215-bp primer-extension product was seen in GH4 cells transfected with a GASCAT plasmid, but not in mock-transfected GH4 cells. The cis regulatory DNA sequences controlling gastrin promoter activity were identified by measuring the activity of 999999 GASCAT plasmids containing sequential deletions of 5'- flanking DNA. GASCAT reporter genes having 600, 194, or 82 bp of 5'-flanking DNA had similar activity to that of the 1300 GASCAT plasmid (Fig. 2). The 40 GASCAT construct containing only 15 bp of DNA upstream of the TATA box

Start 5 flanking DNA Site IExon I CAT 85 101 bp- -1300 -600 -194 -82-40 TATA Exon I CAT rK 180- EcoRI NcoI HincdI NdeI Avaff < <~,__ mR/VA GosCAT 1300 600 194 82 40 - 3OpPramer 1- 215--bp .I PrImer 23.- Exten~sion Product

FIG. 1. (A) Gastrin promoter activity in GH4 pituitary cells and z 20 NIH 3T3 fibroblasts. The 1300 GASCAT plasmid is a chimeric gene containing 1.3 kb of5'-flanking DNA and exon I ofthe human gastrin ; gene ligated upstream of the CAT gene. DNA was transfected into 1 GH4 cells using DEAE-dextran, and CAT activity in cell extracts was Z' 10 i~ measured 48 hr later. Gastrin promoter activity (GASCAT) was compared with the activities of the Rous sarcoma virus LTR promoter (RSVCAT) and the rat growth hormone promoter (GH- CAT) in GH4 cells and 3T3 fibroblasts. Shown are autoradiograms of 6asCA.T acetylated derivatives of 14C-labeled chloramphenicol resolved by TRANSFECTED DNA thin-layer chromatography. (B) Primer-extension analysis of mRNA isolated from GH4 cells transiently transfected with the 1300 GAS- FIG. 2. Deletional analysis of cis-acting DNA elements regulat- CAT plasmid resolved on an 8% polyacrylamide-urea denaturing gel. ing gastrin promoter activity in GH4 pituitary cells. Deletions of the Lanes: 1, mock-transfected GH4 cells; 2, GH4 cells transfected with 5'-flanking DNA ofthe gastrin gene were created using the Nco 1 (600 the 1300 GASCAT plasmid. Markers are Klenow end-labeled frag- GASCAT), HinclI (194 GASCAT), Nde 1 (82 GASCAT), and Ava II ments from a Hpa II digest of pBR322 (bp). The arrow indicates the (40 GASCAT) restriction sites. Resultant plasmids were transiently position ofa 215-bp primer-extension product after hybridizing RNA transfected into GH4 cells. Cell extracts were assayed for CAT with 1 pmol of 32P-end-labeled oligonucleotide primer complemen- activity and expressed as percent 14C-labeled chloramphenicol con- tary to nucleotides +85 to +103 of the CAT coding sequence. verted per hr per 20 ,ug of protein. Downloaded by guest on October 1, 2021 3038 Biochemistry: Godley and Brand Proc. NatL Acad Sci. USA 86 (1989) retained half of the promoter activity found in the 1300 construct (Fig. 2). Therefore, the cis regulatory elements *** p<0.00 necessary for basal gastrin promoter activity in GH4 cells are 200- ** pC0.015 found close to the TATA box or within the first exon of the * p<0-05 gastrin gene. EGF Stimulates Gastrin Promoter Activity. Gastrin promoter activity increased 3-fold after incubating GH4 cells for 24 hr with 1-100 nM EGF (Fig. 3A). Although the response 150 - ofthe promoter to EGF was modest, it was comparable to the K- response observed for the rat prolactin promoter (3-fold) (24) T and the tyrosine hydroxylase promoter (3-fold) (36). The gastrin promoter response to EGF stimulation was equal in magnitude to the increase in endogenous prolactin mRNA seen in these GH4 cells with EGF (data not shown). How- N. S ever, growth hormone mRNA levels in these GH4 cells stably transformed with the GASCAT plasmid were not stimulated by EGF (data not shown), confirming prior observations (19). EGF increased gastrin promoter activity within 4 hr (Fig. 3B). 501 l The stimulation of gastrin promoter activity by EGF did not plateau even after 72 hr ofincubation, which is similar to EGF stimulation of tyrosine hydroxylase promoter activity (36). EGF stimulated gastrin promoter activity in GH4 cells with GASCAT stably integrated into chromosomal DNA (Fig. 3) and in GH4 cells transiently transfected with the GASCAT plasmid (see Fig. 5). Maximal stimulation of the gastrin promoter was seen with 1 nM EGF, which is comparable to FIG. 4. The effect of neuropeptides (TRH, VIP, and GRP), the concentration that maximally stimulates the activity of isoproterenol, and membrane depolarization with 50 mM KCI on the tyrosine hydroxylase and prolactin promoters (36, 37). gastrin promoter activity in GH4 cells. Stable transformants were Neuropeptides Regulate Gastrin Promoter Activity. TRH incubated with 10-7 M TRH, 10-7 M VIP, 10-7 M GRP, 10-7 M and VIP modestly increased gastrin promoter activity in GH4 isoproterenol, and 50 mM KCl for 24 hr before assaying cell extracts for CAT activity. Results are the means of the percent induction cells by 2-fold and 1.5-fold, respectively (Fig. 4). However, SEM for three independent determinations. GRP, the most potent stimulus ofgastrin secretion in G cells, stimulated gastrin promoter activity only 1.3-fold. Although activity in stable GASCAT GH4 transformants (data not the peak effects of GRP and VIP on hormone release occur shown). at <24 hr (12, 22), the fold change in gastrin promoter activity Identification of an EGF and TRH Response Element in the in response to either peptide was maximal at 24 hr. Isopro- Gastrin Promoter. The stimulation of gastrin promoter activ- terenol (a B-adrenergic agonist) had no effect on gastrin ity by EGF and TRH was determined after transfecting GH4 promoter activity and membrane depolarization, whereas 50 cells with gastrin reporter genes containing various deletions mM K+ inhibited promoter activity by almost 50%. The of5'-flanking DNA (Fig. 6A). Gastrin promoter activity ofthe somatostatin analogue, SMS 201-995, effectively antago- 600, 194, and 82 GASCAT plasmids was stimulated 2- to nized EGF stimulation of gastrin promoter activity without 3-fold by EGF. The gastrin promoter, however, lost its ability affecting basal gastrin promoter activity (Fig. 5). Somato- to respond to EGF when only 40 bp of 5'-flanking sequence statin inhibited TRH and VIP stimulation ofgastrin promoter remained. This was not a result of an inactive promoter activity and gave identical inhibition of gastrin promoter because the basal activity of this 40 GASCAT plasmid was

A B EI3 Without Somrototttin T SEM 60 T With Somotostotin 300k T SEM

;~bz 0

40- 200[

K20H

U U.I 1.U 10 100 [EGF], 10-9 M TIME (hours) FIG. 3. Stimulation of gastrin promoter activity by EGF in GH4 cells stably transfected with the 1300 GASCAT plasmid. (A) EGF Control EGF TRH VIP concentration and gastrin promoter activity relationship. Cells were treated with 0.1, 1, 10, 50, and 100 nM EGF for 24 hr. CAT activity FIG. 5. Somatostatin inhibits EGF, TRH, and VIP stimulation of was expressed as the mean of the percent induction compared to gastrin promoter activity. GH4 cells transiently transfected with the control activity ± SEM. (B) Time course of EGF stimulation of 1300 GASCAT plasmid were incubated with 50 nM EGF, 10-7 M gastrin promoter activity. Stably transfected GH4 cells were incu- TRH, or 10-7 M VIP alone or with the somatostatin analogue SMS bated with 50 nM EGF, and CAT activity was assayed after 4, 8, 16, 201-995 (Sandoz Pharmaceutical) (4 x 1O-7 M). Cell extracts were 24, and 72 hr of incubation and then expressed as percent induction. assayed for CAT activity and expressed as cpm per hr per Ag of Control activity represented GH4 cells incubated in parallel with F-10 protein. Results are mean specific activities ± SEM for four media alone. independent determinations. Downloaded by guest on October 1, 2021 Biochemistry: Godley and Brand Proc. NatL. Acad. Sci. USA 86 (1989) 3039 The stimulation of gastrin promoter activity by both EGF B TPH and TRH depended on a 40-bp cis-acting DNA fragment lying 777 between -40 and -82 bp upstream of the gastrin promoter. This segment contains DNA sequence motifs shown to bind 200- two known transcription factors, Spl and AP2 (25, 26). Transcriptional activation by Spl is not known to be induc- ible, and Spl sites are commonly found in the proximal promoter region ofconstitutive housekeeping genes (41). The GasCAT 1300 600 194 82 40 1300 600 194 82 40 activity of the AP2 factor, however, is stimulated by cAMP TRANSFECTED DNVA and phorbol esters through the activation of protein kinase A or protein kinase C, respectively (26). Therefore, TRH could C Hrnc 1 Nde I Ava I TATA Exon I CAT stimulate gastrin promoter activity by increasing AP2 activ- -194 82 -40=> ity, because TRH increases both cAMP-dependent kinase and protein kinase C activities (42, 43). S - SpIs The -40- to -82-bp DNA fragment also confers EGF TATGGCAGGGTAGGGGCGGGTGFGGGGGACAGTTGGGAG&G ATACCGTCCCATCCCC GCCCCACCCCCCTG TCAACCC rCCC responsiveness to the gastrin promoter and, thus, is the third DNA sequence identified that confers EGF AP-2 responsiveness _ _. .1 _ to a promoter active in GH4 cells. Previous studies in GH4 -80 -70 -60 -50 -40 cells have defined DNA fragments of 43 and 53 bp, which confer EGF responsiveness to the prolactin and Moloney FIG. 6. Identification ofthe EGF/TRH response element for the gastrin promoter. Plasmids containing deletions of the 5'-flanking LTR promoters, respectively (24). These DNA fragments do region of the gastrin gene-600 GASCAT, 194 GASCAT, 82 GAS- not share common sequence motifs, suggesting that EGF CAT, 40 GASCAT, and the original 1300 GASCAT plasmid-were stimulation does not activate a common transcription factor transiently transfected into GH4 cells, and 24 hr later 50 nM EGF (A) as has been shown for many promoters that are stimulated by or 10-7 M TRH (B) was added. After 24 hr cell extracts were assayed cAMP (44). There is no cross competition between the for CAT activity and expressed as percent induction. (C) The DNA prolactin and Moloney LTR EGF response elements and the sequence from -40 to -80 of the 5'-flanking DNA of the gastrin nuclear proteins that specifically bind to these sequences promoter containing the EGF response element. Putative DNA (24). binding motif for SpI and AP2 transcription factors are indicated. The different EGF response elements identified in the prolactin, Moloney LTR, and gastrin promoters also all still 50% of the basal activity of the 1300 GASCAT plasmid confer responsiveness to phorbol esters (24). This suggests (Fig. 2). Therefore, these results defined a 40-bp sequence that EGF responsiveness is linked to the activation of the between -40 and -82 bp upstream of the gastrin promoter protein kinase C pathway. However, evidence that EGF that was required for EGF stimulation of the gastrin pro- increases protein kinase C activity is incomplete. Cells moter. Similarly, TRH responsiveness was also abolished respond to EGF stimulation with a modest and brief increase when this 40-bp sequence was removed (Fig. 6B). in diacylglycerol, but activation of protein kinase C has not been documented (45). Furthermore, EGF stimulation of the gastrin promoter is significantly greater than the response to DISCUSSION maximal stimulation with phorbol 12-myristate 13-acetate (3- Because GH4 cells have receptors for peptide regulators that vs. 2-fold), implying that the EGF response is not simply due control G cell secretion, these cells are an attractive model to to activation of protein kinase C by diacylglycerol (unpub- study the regulation of gastrin gene transcription. Further- lished observations). EGF also increases intracellular cal- more, the gastrin promoter is as active in GH4 cells as the cium (46, 47), and the stimulation of prolactin gene expres- promoter of specifically expressed genes, such as growth sion by EGF is markedly reduced when intracellular calcium hormone. An explanation for the high GASCAT expression is depleted (37, 47). Studies with a mutant EGF receptor also without endogenous gastrin gene expression is the possibility indicate that the transcriptional stimulation and the increase that there are repressor elements further upstream not in intracellular calcium are linked (48). The increase in in the GASCAT constructs. en- intracellular calcium induced by EGF may potentiate the present Alternatively, the activation of protein kinase C, because the activity of this dogenous gene may be inactivated by methylation, whereas enzyme is stimulated by calcium (49). Although AP2 activity the transfected GASCAT plasmid may not be methylated is stimulated by cAMP and gastrin promoter activity in- when cotransfected with the neomycin resistance gene. The creases 3-fold with cAMP (unpublished results), it is unlikely strongest stimulation ofgastrin promoter activity was elicited that EGF-mediated effects on the gastrin promoter occur via by EGF. Stimulation ofCAT activity by EGF was not a result cAMP-dependent pathways because EGF does not increase ofnonspecific activation oftranslation because the activity of intracellular cAMP (50, 51). Furthermore, EGF antagonizes the 40 GASCAT construct was not stimulated by EGF (Fig. the cAMP-dependent effects of thyroid-stimulating hormone 6A). If changes in CAT activity were due to effects on of thyroid cells (52) and glucagon on kidney cells (51). translation, then the CAT activity of the 40 GASCAT The present study also shows that the inhibitory peptide construct would also be increased, since all GASCAT con- somatostatin antagonizes EGF and TRH stimulation of structs express the same mRNA. Gastrin promoter activity gastrin promoter activity in GH4 cells. This result is inter- was also stimulated by TRH, and this promoter stimulation esting because reported effects of somatostatin on gene was similarly abolished in the 40 GASCAT. However, the expression have given conflicting interpretations. Although most potent peptide stimulant ofantral G cells, GRP, elicited somatostatin was shown to inhibit growth hormone secre- only weak stimulation of gastrin promoter activity. Yet TRH tion, no effect on growth hormone gene transcription was and GRP elicit similar intracellular responses via increased seen (53). This suggests a dissociation between the inhibitory inositol phospholipid turnover and increased intracellular effects of somatostatin on secretion from effects on gene Ca2+ (38-40). GH4 cells have fewer GRP (3000) receptors transcription. However, there are differences between these than TRH (130,000) and somatostatin (13,000) receptors (21, two studies, which make these divergent observations not 22, 24), which may explain the difference between TRH and directly comparable. For example, Barinaga et al. (53) only GRP effects on the gastrin promoter in GH cells. incubated pituitary cells briefly with somatostatin, whereas Downloaded by guest on October 1, 2021 3040 Biochemistry: Godley and Brand Proc. Natl. Acad Sci. USA 86 (1989) in the present study GH4 cells were incubated with somato- 22. Dorflinger, L. J. & Schonbrunn, A. (1983) Endocrinology 113, statin for 24 hr. Prolonged action by somatostatin may have 1541-1550. 23. Schonbrunn, A. & Tashjian, A. H., Jr. (1978) J. Biol. Chem. effects on gene transcription not seen after brief exposure. 253, 6473-6483. Somatostatin inhibited gastrin promoter activity stimu- 24. Elsholtz, H. P., Mangalam, H. J., Potter, E., Albert, V. R., lated by TRH and EGF but had little effect on basal gastrin Supowit, S., Evans, R. M. & Rosenfeld, M. G. (1986) Science promoter activity. This result implies that somatostatin 234, 1552-1557. inhibits one or more events in the intracellular signaling 25. Kadonaga, J. T., Jones, K. A. & Tjian, R. (1986) Trends pathways activated by TRH and EGF. Somatostatin has Biochem. Sci. 11, 20-23. 26. Imagawa, M., Chiu, R. & Karin, M. (1987) Cell 51, 251-260. well-described inhibitory effects on the activation of adenyl- 27. Ito, R., Sato, K., Helmer, T., Jay, G. & Agarwal, K. (1984) ate cyclase and on the increase in intracellular calcium Proc. Natl. Acad. Sci. USA 81, 4662-4666. elicited by TRH. These are mediated by the inhibitory 28. Prost, E. & Moore, D. D. (1986) Gene 45, 107-111. guanine nucleotide-binding protein (G1) because these two 29. Larsen, P. R., Harvey, J. W. & Moore, D. D. (1986) Proc. effects are sensitive to pertussis toxin inhibition (54, 55). Natl. Acad. Sci. USA 83, 8283-8287. Preliminary studies with pertussis toxin-pretreated cells 30. Jameson, J. L., Deutsch, P. J., Gallagher, G. D., Joffe, R. C. showed a reversal of somatostatin inhibition of EGF- & Habener, J. (1987) Mol. Cell. Biol. 7, 3032-3040. stimulated cells, implicating a role for G proteins in modu- 31. Sompayrac, L. M. & Danna, K. J. (1981) Proc. Natl. Acad. Sci. USA 78, 7575-7578. lating gene transcription. Further studies will confirm 32. Lopata, M., Cleveland, D. & Sollner-Webb, B. (1984) Nucleic whether the effects of somatostatin on gene transcription are Acids Res. 12, 5707-5717. mediated by the same intracellular mechanisms that inhibit 33. Gorman, C. M., Moffat, L. F. & Howard, B. H. (1982) Mol. secretion. Cell. Biol. 2, 1044-1051. 34. Bradford, M. M. (1976) Anal. Biochem. 72, 248-254. This research was supported by National Institutes of Health 35. Wu, L., Morley, B. J. & Campbell, R. D. (1987) Cell 48, 331- Grant 1 R29 DK40543 01 to S.J.B. and the Robert Wood Johnson 342. Minority Faculty Development Award to J.M.G. 36. Lewis, E. J. & Chikaraishi, D. M. (1987) Mol. Cell. Biol. 7, 3332-3336. 1. Walsh, J. H. & Grossman, M. I. (1975) N. Engl. J. Med. 292, 37. White, B. A. & Bancroft, F. C. (1983) J. Biol. Chem. 258, 1324-1334. 4618-4622. 2. Miller, L. R., Jacobson, E. D. & Johnson, L. R. (1973) Gas- 38. Martin, T. F. J., Lucas, D. O., Bajjalieh, S. M. & Kowalchyk, 64, 254-267. J. A. (1986) J. Biol. Chem. 261, 2918-2927. troenterology 39. Tan, K. N. & Tashjian, A. H., Jr. (1984) J. Biol. Chem. 259, 3. Johnson, L. R. (1977) Gastroenterology 72, 788-792. 427-434. 4. Larsson, L. I. (1980) Am. J. Physiol. 239, G237-G246. 40. Takuwa, N., Takuwa, Y., Bollag, W. E. & Rasmussen, H. 5. St. Hilaire, R. J. & Jones, A. L. (1982) Hepatology 2, 601-613. (1987) J. Biol. Chem. 262, 182-188. 6. Gregory, H., Walsh, S. & Hopkins, C. R. (1979) Gastroenter- 41. Holler, M., Westin, G., Jiricny, J. & Schaffner, W. (1988) ology 77, 313-318. Genes Dev. 2, 1127-1135. 7. Thompson, J. F. (1988) Am. J. Physiol. 254, G429-G435. 42. Dannies, P. S., Gautvik, K. M. & Tashjian, A. H., Jr. (1976) 8. Ulshen, M. H., Lyn-Cook, L. E. & Raasch, R. H. (1986) Endocrinology 98, 1147-1159. Gastroenterology 91, 1134-1140. 43. Fearon, C. W. & Tashjian, A. H., Jr. (1985) J. Biol. Chem. 260, 9. Supowit, S., Potter, E., Evans, R. M. & Rosenfeld, M. G. 8366-8371. (1984) Proc. NatI. Acad. Sci. USA 81, 2975-2979. 44. Roesler, W. J., Vandenbark, G. R. & Hanson, R. W. (1988) J. 10. Dockray, G. J., Vaillant, C. & Walsh, J. H. (1979) Neuro- Biol. Chem. 263, 9063-9066. science 4, 1561-1568. 45. Whiteley, B. & Glaser, L. (1986) J. Cell Biol. 103, 1355-1362. 11. Bunnett, N. W., Clark, B., Debas, H. T., del Milton, R. C., 46. Hepler, J. R., Nahahata, N., Lovenberg, T. W., DiGuiseppi, Kovacs, T. 0. G., Orloff, M. S., Pappas, T. N., Reeve, J. R., J., Herman, B., Earp, H. S. & Harden, T. K. (1987) J. Biol. Jr., Rivier, T. & Walsh, J. H. (1985) J. Physiol. (London) 365, Chem. 262, 2951-2956. 121-130. 47. Ramsdell, J. S. & Tashjian, A. H., Jr. (1985) Endocrinology 12. Giraud, A. S., Soll, A. H., Cuttitta, F. & Walsh, J. H. (1987) 117, 2050-2060. Am. J. Physiol. 252, G413-G420. 48. Chen, W. S., Lazar, C. S., Poenie, M., Tsien, R. Y., Gill, 13. Sugano, K., Park, J., Soll, A. H. & Yamada, T. (1987) J. Clin. G. N. & Rosenfeld, M. G. (1987) Nature (London) 328, 820- Invest. 79, 935-942. 823. 14. Yamada, T. (1987) in Physiology ofthe Gastrointestinal Tract, 49. Nishizuka, Y. (1988) Nature (London) 334, 661-665. ed. Johnson, L. R. (Raven, New York), pp. 131-142. 50. Bachrach, L. K., Eggo, M. C., Mak, W. W. & Burrow, G. N. 15. Brand, S. J. & Stone, D. (1988) J. Clin. Invest. 82, 1059-1066. (1985) Endocrinology 116, 1603-1609. 16. Powell, C. T., Ney, C., Aran, P. & Agarwal, K. (1985) Nucleic 51. Lin, M. C., Darfler, F. J. & Beckner, S. K. (1987) Mol. Cell. Acids Res. 13, 7299-7305. Biol. 7, 4324-4328. 17. Rehfeld, J. F. (1986) J. Biol. Chem. 261, 5841-5847. 52. Roger, P. P., Van Hewyerswyn, B., Lambert, C., Reuse, S., 18. Brand, S. J. & Fuller, P. J. (1988) J. Biol. Chem. 263, 5341- Vassart, G. & Dumont, J. E. (1985) Eur. J. Biochem. 152, 239- 5347. 245. 19. Schonbrunn, A., Krasnoff, M., Westendorf, J. M. & Tashjian, 53. Barinaga, M., Bilezikjian, L. M., Vale, W. W., Rosenfeld, A. H., Jr. (1980) J. Cell Biol. 85, 786-797. M. G. & Evans, R. M. (1985) Nature (London) 314, 279-281. 20. Westendorf, J. M. & Schonbrunn, A. (1982) Endocrinology 54. Yajima, Y., Akita, Y. & Saito, T. (1986) J. Biol. Chem. 261, 110, 352-358. 2684-2689. 21. Hinkle, P. M. & Tashjian, A. H., Jr. (1973) J. Biol. Chem. 248, 55. Koch, B. D., Dorflinger, L. J. & Schonbrunn, A. (1985) J. Biol. 6180-6186. Chem. 260, 13138-13145. Downloaded by guest on October 1, 2021