DOCSLIB.ORG

Role of the Vasopressin 1B Receptor in Rodent Aggressive Behavior and Synaptic Plasticity in Hippocampal Area CA2

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Role of the Vasopressin 1B Receptor in Rodent Aggressive Behavior and Synaptic Plasticity in Hippocampal Area CA2 Molecular Psychiatry (2015) 20, 490–499 © 2015 Macmillan Publishers Limited All rights reserved 1359-4184/15 www.nature.com/mp ORIGINAL ARTICLE Role of the vasopressin 1b receptor in rodent aggressive behavior and synaptic plasticity in hippocampal area CA2 JH Pagani1,3, M Zhao2,3, Z Cui1,3, SK Williams Avram1, DA Caruana2,4, SM Dudek2 and WS Young1 The vasopressin 1b receptor (Avpr1b) is critical for social memory and social aggression in rodents, yet little is known about its specific roles in these behaviors. Some clues to Avpr1b function can be gained from its profile of expression in the brain, which is largely limited to the pyramidal neurons of the CA2 region of the hippocampus, and from experiments showing that inactivation of the gene or antagonism of the receptor leads to a reduction in social aggression. Here we show that partial replacement of the Avpr1b through lentiviral delivery into the dorsal CA2 region restored the probability of socially motivated attack behavior in total Avpr1b knockout mice, without altering anxiety-like behaviors. To further explore the role of the Avpr1b in this hippocampal region, we examined the effects of Avpr1b agonists on pyramidal neurons in mouse and rat hippocampal slices. We found that selective Avpr1b agonists induced significant potentiation of excitatory synaptic responses in CA2, but not in CA1 or in slices from Avpr1b knockout mice. In a way that is mechanistically very similar to synaptic potentiation induced by oxytocin, Avpr1b agonist-induced potentiation of CA2 synapses relies on NMDA (N-methyl-D-aspartic acid) receptor activation, calcium and calcium/calmodulin- dependent protein kinase II activity, but not on cAMP-dependent protein kinase activity or presynaptic mechanisms. Our data indicate that the hippocampal CA2 is important for attacking in response to a male intruder and that the Avpr1b, likely through its role in regulating CA2 synaptic plasticity, is a necessary mediator. Molecular Psychiatry (2015) 20, 490–499; doi:10.1038/mp.2014.47; published online 27 May 2014 INTRODUCTION relatively resistant to damage arising during the course of various 13–18 Aggressive behavior, found across the animal kingdom, is usually illnesses, including epilepsy. Conversely, CA2 non-pyramidal highly adaptive for survival. Examples include maternal protection neurons in schizophrenic and bipolar patients seem to be 19 of the young, defense of territory and capture of prey.1,2 Human preferentially lost and pyramidal neurons in CA2 of schizo- 20 aggressive behavior, on the other hand, particularly that involving phrenics are smaller. Gene expression studies show that the CA2 physical violence, is typically viewed as pathological and can region is molecularly distinct from the rest of the hippo- 21,22 accompany several forms of psychiatric illness such as schizo- campus. In addition, its pyramidal neurons have distinct phrenia. An understanding of these complex behaviors at the physiological characteristics that include an apparent lack of cellular level, however, is still lacking. With the goal of ameliorat- capacity for typical long-term synaptic potentiation (LTP) when 23 ing some symptoms of mental illness, including aggressive using conventional methods of Schaffer collateral stimulation. behavior, many recent human studies have explored the effects This property of LTP resistance seems to be due to higher calcium of the two neuropeptides vasopressin (Avp) and oxytocin (Oxt).3 buffering and extrusion and the expression of RGS14 in CA2 24,25 Many of the effects of these neuropeptides are likely mediated by pyramidal neurons. the oxytocin (Oxtr) and vasopressin 1a (Avpr1a) receptors4–6 To gain an understanding of its role in the brain, we inactivated which are widely distributed within the central nervous system. the Avpr1b gene in the mouse and found that social recognition is Vasopressin 1b receptor (Avpr1b) expression, in contrast, is highly reduced in both male and female mice in these knockouts 9,26 restricted to the pyramidal cells in the CA2 region of the (KOs). Specific inactivation of CA2 pyramidal cell activity also 27 hippocampus.7 Like the Oxtr and Avpr1a, this receptor is likely reduces social recognition. In addition, male territorial aggres- to have an important role in human behavior, as it is required for sion and maternal aggression are disrupted in this knockout 9,28 proper regulation of social aggression and social recognition in line. Spatial memory, as tested in the Morris water maze, is several mammalian species.8,9 normal.9 Predatory aggression and defensive behaviors are The CA2 region was described in 1934,10 yet little is known of its unaffected, indicating that the pattern of motor skills important function as it had, until recently, been overlooked as a part of the for aggressive behaviors remains intact.28 Interestingly, although hippocampal circuit (reviews, Jones et al.11 and Piskorowski and phenotypic changes in aggression often co-occur with changes in Chevaleyre12). Pathological studies show that compared with anxiety-like behavior,29 reduced aggression in the Avpr1b KOs is neurons in the flanking CA1 and CA3 fields, neurons in CA2 are observed without any detectible changes in anxiety-like behavior.7 1Section on Neural Gene Expression, National Institute of Mental Health, National Institutes of Health, Bethesda, MD, USA and 2Laboratory of Neurobiology, National Institute of Environmental Health Sciences, National Institutes of Health, Research Triangle Park, NC, USA. Correspondence: Dr WS Young, Section on Neural Gene Expression, National Institute of Mental Health, National Institutes of Health, 9000 Rockville Pike, Building 49, Room 5A56, Bethesda, 20892-4484, MD, USA or Dr SM Dudek, Laboratory of Neurobiology, National Institute of Environmental Health Sciences, National Institutes of Health, Building 101, Room F279A, 111T W. Alexander Drive, Research Triangle Park, NC 27709, USA. E-mail: [email protected] or [email protected] 3These authors contributed equally to this work. 4Current address: Institute for Science and Technology in Medicine, Keele University, Keele, Staffordshire ST5 5BG, UK. Received 20 November 2012; revised 7 March 2014; accepted 16 April 2014; published online 27 May 2014 Vasopressin 1b receptor function in the hippocampal CA2 JH Pagani et al 491 Support for the role of Avpr1b in aggression comes from the Surgical procedures administration of an Avpr1b antagonist to mice and hamsters that Mice were anesthetized with 250–500 mg kg − 1 intraperitoneal injections reduces aggressive behavior in these species.30,31 of 2,2,2-tribromoethanol (Avertin; Sigma-Aldrich, St. Louis, MO, USA) and To test our hypothesis that Avp acts through the Avpr1b were kept warm with a heating pad during anesthesia and recovery. Each specifically expressed in dorsal CA2 to permit normal social mouse was placed in a small animal stereotaxic instrument (Benchmark aggression, we used lentiviral injections to partially restore Avpr1b Angle Two, Leica Microsystems, Richmond, VA, USA), and an ophthalmic expression there. This resulted in significant aggressive behavior ointment was applied to prevent drying of the eyes. The skull hair was in Avpr1b KO mice, without altering anxiety-like behavior. We then plucked, the surgical area was disinfected, and a small incision was made sought to determine the functional effects of Avp on CA2 to expose the skull. The skull was then opened over the appropriate stereotaxic coordinates using a small-burr (0.45 mm) drill and a 30-gauge synapses in vitro by testing our hypothesis that Avpr1b agonists blunt-end needle was inserted for injection. Following needle removal, the modulate synaptic strength or plasticity in mice and rats. We skin was closed with wound clips. The mouse received 0.35 ml of warm fi found that application of the Avpr1b agonists induced signi cant saline intraperitoneally and was observed until waking. Then he was potentiation of synaptic responses, an effect mimicked by Oxt and returned to the home cage and monitored carefully for the next 48 h. not found in Avpr1b knockout mice. Surgery was conducted in accordance with NIH Guidelines for rodent survival following surgery. MATERIALS AND METHODS Virus injections Animals Each mouse received pressure injections targeting six sites (three on each The development and genotyping of the Avpr1b and Oxtr KO lines were side) of the dorsal hippocampus of either lenti-Avpr1b or lenti-GFP (KO 9,32 fl described in detail previously. Brie y, Avpr1b mice were genotyped +Replace or KO+GFP, respectively) using a Hamilton syringe with a 30G using these primers: 5, ACCTGTAGATATTTGACAGCCCGG; 9, GAAACGGCTA blunt-ended needle mounted on a stereotaxic device. The viral solutions CTCTCTCCGATTCCAAAAGAAAG; and neo1, ACCCCTTCCCAGCCTCTGAG were stored at − 80 °C before being thawed on ice and backfilled into the ′ ′ ′ CCCAGAAAGCGAAGG. PCR (95 °C × 4 ; (95 °C × 1 ,60°C×1,72°C syringes. The six sites of injection (per mouse) were: injection sites 1 and 2 ′ ′ ×1) × 40; 72 °C × 5 ; 10 °C) yields 762 and 461 bp bands for wild-types medial–lateral relative to the midline: ± 1.25 mm, anterior–posterior (WTs) and Avpr1b KOs, respectively (see Supplementary Figure 1 for relative to the bregma: − 1.22 and dorsal–ventral relative to the surface schematic of the Avpr1b KO). Oxtr mice were genotyped using these of the brain: − 1.73 mm; sites 3 and 4 medial–lateral: ± 2.00, anterior– primers: Seq. 1, ACCCCAGGAAGATGTACCCGTAGTAAAGC; Seq4, TTAGGT posterior: − 1.70 and dorsal–ventral: − 1.83 mm; and sites 5 and 6 CCCAGGAAAGAGTCAGCCGCTCTGCCTGCAGAGAGG; and DTAo10.3, TGGGA medial–lateral: ± 2.60, anterior–posterior: − 2.18 and dorsal–ventral: GTCCAGAGATAGTGGAA. PCR (95 °C × 4′, (95 °C × 45′′,60°C×45′′,72° − 2.15 mm. The injection volume for each site was 400 nl delivered at C×45′′) × 40, 72 °C × 5′, 10 °C) yields bands at 221 and 150 bp for WTs − 50 nl min 1. and Oxtr KOs, respectively. The mice have been backcrossed into C57Bl/6J mice (Jackson Laboratories, Bar Harbor, ME, USA) for more than 10 generations and used here for in vivo behavior and in vitro electrophysiol- In situ hybridization histochemistry ogy experiments.
Load more

Recommended publications
  • Strategies to Increase ß-Cell Mass Expansion
    This electronic thesis or dissertation has been downloaded from the King’s Research Portal at https://kclpure.kcl.ac.uk/portal/ Strategies to increase -cell mass expansion Drynda, Robert Lech Awarding institution: King's College London The copyright of this thesis rests with the author and no quotation from it or information derived from it may be published without proper acknowledgement. END USER LICENCE AGREEMENT Unless another licence is stated on the immediately following page this work is licensed under a Creative Commons Attribution-NonCommercial-NoDerivatives 4.0 International licence. https://creativecommons.org/licenses/by-nc-nd/4.0/ You are free to copy, distribute and transmit the work Under the following conditions: Attribution: You must attribute the work in the manner specified by the author (but not in any way that suggests that they endorse you or your use of the work). Non Commercial: You may not use this work for commercial purposes. No Derivative Works - You may not alter, transform, or build upon this work. Any of these conditions can be waived if you receive permission from the author. Your fair dealings and other rights are in no way affected by the above. Take down policy If you believe that this document breaches copyright please contact [email protected] providing details, and we will remove access to the work immediately and investigate your claim. Download date: 02. Oct. 2021 Strategies to increase β-cell mass expansion A thesis submitted by Robert Drynda For the degree of Doctor of Philosophy from King’s College London Diabetes Research Group Division of Diabetes & Nutritional Sciences Faculty of Life Sciences & Medicine King’s College London 2017 Table of contents Table of contents .................................................................................................
    [Show full text]
  • Design and Synthesis of Cyclic Analogs of the Kappa Opioid Receptor Antagonist Arodyn
    Design and synthesis of cyclic analogs of the kappa opioid receptor antagonist arodyn By © 2018 Solomon Aguta Gisemba Submitted to the graduate degree program in Medicinal Chemistry and the Graduate Faculty of the University of Kansas in partial fulfillment of the requirements for the degree of Doctor of Philosophy. Chair: Dr. Blake Peterson Co-Chair: Dr. Jane Aldrich Dr. Michael Rafferty Dr. Teruna Siahaan Dr. Thomas Tolbert Date Defended: 18 April 2018 The dissertation committee for Solomon Aguta Gisemba certifies that this is the approved version of the following dissertation: Design and synthesis of cyclic analogs of the kappa opioid receptor antagonist arodyn Chair: Dr. Blake Peterson Co-Chair: Dr. Jane Aldrich Date Approved: 10 June 2018 ii Abstract Opioid receptors are important therapeutic targets for mood disorders and pain. Kappa opioid receptor (KOR) antagonists have recently shown potential for treating drug addiction and 1,2,3 4 8 depression. Arodyn (Ac[Phe ,Arg ,D-Ala ]Dyn A(1-11)-NH2), an acetylated dynorphin A (Dyn A) analog, has demonstrated potent and selective KOR antagonism, but can be rapidly metabolized by proteases. Cyclization of arodyn could enhance metabolic stability and potentially stabilize the bioactive conformation to give potent and selective analogs. Accordingly, novel cyclization strategies utilizing ring closing metathesis (RCM) were pursued. However, side reactions involving olefin isomerization of O-allyl groups limited the scope of the RCM reactions, and their use to explore structure-activity relationships of aromatic residues. Here we developed synthetic methodology in a model dipeptide study to facilitate RCM involving Tyr(All) residues. Optimized conditions that included microwave heating and the use of isomerization suppressants were applied to the synthesis of cyclic arodyn analogs.
    [Show full text]
  • Radial Glia Reveal Complex Regulation by the Neuropeptide Secretoneurin
    Transcriptomic and proteomic characterizations of goldfish (Carassius auratus) radial glia reveal complex regulation by the neuropeptide secretoneurin Dillon Da Fonte Thesis submitted to the Faculty of Graduate and Postdoctoral Studies University of Ottawa in partial fulfillment of the requirements for the Master of Science degree in biology Department of Biology Faculty of Science University of Ottawa © Dillon Da Fonte, Ottawa, Canada, 2016 Acknowledgements Finishing this thesis has been both a challenging and rewarding experience. This accomplishment would not have been possible without the never-ending support of colleagues, friends, family. First, I would like to express my most sincere gratitude to my supervisor and mentor, Dr. Vance Trudeau. Thank you for the opportunities you have given me, this experience has truly solidified my passion for research. I appreciate our many conversations that were enjoyed over a beer – it was truly a memorable experience. I would also like to thank my M.Sc. advisory committee, Dr. Michael Jonz and Dr. Marc Ekker for your time and insightful comments. A special thank you to Dr. Chris Martynuik who taught me the bioinformatics needed to analyze both transcriptomic and proteomic data and for all your help during my time at the University of Florida. I would like to also acknowledge my funding support from University of Ottawa, NSERC, and the Michael Smith Foreign Study Award for supporting my research stay at the University of Florida. To all current and past members of TeamENDO, thank you for the sense of community you all instilled in the lab. Both inside and outside the lab, I have made memories with all of you that I will cherish forever.
    [Show full text]
  • Design and Synthesis of Functionally Selective Kappa Opioid Receptor Ligands
    Design and Synthesis of Functionally Selective Kappa Opioid Receptor Ligands By Stephanie Nicole Johnson Submitted to the graduate degree program in Medicinal Chemistry and the Graduate Faculty of the University of Kansas in partial fulfillment of the requirements for the degree of Masters in Science. Chairperson: Dr. Thomas E. Prisinzano Dr. Apurba Dutta Dr. Jeffrey P. Krise Date Defended: May 2, 2017 The Thesis Committee for Stephanie Nicole Johnson certifies that this is the approved version of the following thesis: Design and Synthesis of Functionally Selective Kappa Opioid Receptor Ligands Chairperson: Dr. Thomas E. Prisinzano Date approved: May 4, 2017 ii Abstract The ability of ligands to differentially regulate the activity of signaling pathways coupled to a receptor potentially enables researchers to optimize therapeutically relevant efficacies, while minimizing activity at pathways that lead to adverse effects. Recent studies have demonstrated the functional selectivity of kappa opioid receptor (KOR) ligands acting at KOR expressed by rat peripheral pain sensing neurons. In addition, KOR signaling leading to antinociception and dysphoria occur via different pathways. Based on this information, it can be hypothesized that a functionally selective KOR agonist would allow researchers to optimize signaling pathways leading to antinociception while simultaneously minimizing activity towards pathways that result in dysphoria. In this study, our goal was to alter the structure of U50,488 such that efficacy was maintained for signaling pathways important for antinociception (inhibition of cAMP accumulation) and minimized for signaling pathways that reduce antinociception. Thus, several compounds based on the U50,488 scaffold were designed, synthesized, and evaluated at KORs. Selected analogues were further evaluated for inhibition of cAMP accumulation, activation of extracellular signal-regulated kinase (ERK), and inhibition of calcitonin gene- related peptide release (CGRP).
    [Show full text]
  • Estrogen Receptor (ER) Expression and Function in the Pregnant Human Myometrium: Estradiol Via Era Activates ERK1/2 Signaling in Term Myometrium
    227 Estrogen receptor (ER) expression and function in the pregnant human myometrium: estradiol via ERa activates ERK1/2 signaling in term myometrium Toni Welsh1,2, Matrika Johnson1, Lijuan Yi1, Huiqing Tan1, Roksana Rahman1, Amy Merlino1, Tamas Zakar2,3 and Sam Mesiano1 1Department of Reproductive Biology, Case Western Reserve University, 11100 Euclid Avenue, Cleveland, Ohio 44106, USA 2Mothers and Babies Research Centre, University of Newcastle, Newcastle, New South Wales 2308, Australia 3Department of Obstetrics and Gynaecology, John Hunter Hospital, Newcastle, New South Wales 2305, Australia (Correspondence should be addressed to S Mesiano; Email: [email protected]) Abstract Estrogens are thought to promote labor by increasing inhibition of 26S proteasome activity increased ERa protein the expression of pro-contraction genes in myometrial cells. abundance to detectable levels in term myometrial explants, The specific estrogen receptors ((ERs: ERa and ERb (also however, indicating rapid turnover of ERa protein by known as ESR1 and ESR2)) and G protein-coupled receptor proteasomal processing in the pregnant myometrium. E2 30 (GPR30; also known as G protein-coupled estrogen stimulated rapid extranuclear signaling in myometrial explants, receptor 1)) and signaling pathways that mediate these actions as evidenced by increased extracellularly regulated kinase are not clearly understood. In this study, we identified the ERs (ERK1/2) phosphorylation within 10 min. This effect was expressed in the pregnant human myometrium and determined inhibited by pre-treatment with an ER antagonist, ICI a key extranuclear signaling pathway through which estradiol 182 780, indicating the involvement of ERa. Inhibition of (E2) modulates expression of the gene encoding the oxytocin ERK signaling abrogated the ability of E2 to stimulate OXTR receptor (OXTR), a major pro-contraction protein.
    [Show full text]
  • The Oxytocin/Vasopressin Receptor Family Has at Least Five Members in the Gnathostome Lineage, Including Two Distinct V2 Subtypes
    The oxytocin/vasopressin receptor family has at least five members in the gnathostome lineage, including two distinct V2 subtypes General and Comparative Endocrinology 175(1): 135-143 doi:10.1016/j.ygcen.2011.10.011 Accepted October 20, 2011 E-pub October 28, 2012 Published January 1, 2012 Figshare doi:10.6084/m9.figshare.811860. Shared October 1, 2013 Daniel Ocampo Daza*, Michalina Lewicka¹, Dan Larhammar Department of Neuroscience, Science for Life Laboratory, Uppsala Universitet, Box 593, SE-751 24 Uppsala, Sweden * Corresponding author. E-mail address: [email protected] ¹ Current address: Department of Neuroscience, Karolinska Institutet, SE-171 77 Stockholm, Sweden Cite as D. Ocampo Daza, M. Lewicka and D. Larhammar. The oxytocin/vasopressin family has at least five members in the gnathostome lineage, including two distinct V2 subtypes. General and Comparative Endocrinology, 175 (1) (2012) 135-143. This document corresponds to the article as it appeared upon acceptance. You are free to download, print and distribute it for any purposes under a Creative Commons Attribution 3.0 Unported License (http://creativecommons.org/licenses/by/3.0/), provided the original work is cited as specified. Errata: The introduction incorrectly states that “the V2 receptor inhibits adenylyl cyclase, thereby reducing the production of cAMP” on page 3. In fact the V2-type vasopressin receptors stimulate adenylyl cyclase and increase the cytosolic cyclic AMP release, see for instance Schöneberg et al., Molecular aspects of vasopressin receptor function, Advances in experimental medicine and biology 449 (1998) 347–58. This mistake was reported in the proofreading phase of pre-publication, but the correction was not carried to the final version of the article.
    [Show full text]
  • G Protein-Coupled Receptors: What a Difference a ‘Partner’ Makes
    Int. J. Mol. Sci. 2014, 15, 1112-1142; doi:10.3390/ijms15011112 OPEN ACCESS International Journal of Molecular Sciences ISSN 1422-0067 www.mdpi.com/journal/ijms Review G Protein-Coupled Receptors: What a Difference a ‘Partner’ Makes Benoît T. Roux 1 and Graeme S. Cottrell 2,* 1 Department of Pharmacy and Pharmacology, University of Bath, Bath BA2 7AY, UK; E-Mail: [email protected] 2 Reading School of Pharmacy, University of Reading, Reading RG6 6UB, UK * Author to whom correspondence should be addressed; E-Mail: [email protected]; Tel.: +44-118-378-7027; Fax: +44-118-378-4703. Received: 4 December 2013; in revised form: 20 December 2013 / Accepted: 8 January 2014 / Published: 16 January 2014 Abstract: G protein-coupled receptors (GPCRs) are important cell signaling mediators, involved in essential physiological processes. GPCRs respond to a wide variety of ligands from light to large macromolecules, including hormones and small peptides. Unfortunately, mutations and dysregulation of GPCRs that induce a loss of function or alter expression can lead to disorders that are sometimes lethal. Therefore, the expression, trafficking, signaling and desensitization of GPCRs must be tightly regulated by different cellular systems to prevent disease. Although there is substantial knowledge regarding the mechanisms that regulate the desensitization and down-regulation of GPCRs, less is known about the mechanisms that regulate the trafficking and cell-surface expression of newly synthesized GPCRs. More recently, there is accumulating evidence that suggests certain GPCRs are able to interact with specific proteins that can completely change their fate and function. These interactions add on another level of regulation and flexibility between different tissue/cell-types.
    [Show full text]
  • Analysis of the Indacaterol-Regulated Transcriptome in Human Airway
    Supplemental material to this article can be found at: http://jpet.aspetjournals.org/content/suppl/2018/04/13/jpet.118.249292.DC1 1521-0103/366/1/220–236$35.00 https://doi.org/10.1124/jpet.118.249292 THE JOURNAL OF PHARMACOLOGY AND EXPERIMENTAL THERAPEUTICS J Pharmacol Exp Ther 366:220–236, July 2018 Copyright ª 2018 by The American Society for Pharmacology and Experimental Therapeutics Analysis of the Indacaterol-Regulated Transcriptome in Human Airway Epithelial Cells Implicates Gene Expression Changes in the s Adverse and Therapeutic Effects of b2-Adrenoceptor Agonists Dong Yan, Omar Hamed, Taruna Joshi,1 Mahmoud M. Mostafa, Kyla C. Jamieson, Radhika Joshi, Robert Newton, and Mark A. Giembycz Departments of Physiology and Pharmacology (D.Y., O.H., T.J., K.C.J., R.J., M.A.G.) and Cell Biology and Anatomy (M.M.M., R.N.), Snyder Institute for Chronic Diseases, Cumming School of Medicine, University of Calgary, Calgary, Alberta, Canada Received March 22, 2018; accepted April 11, 2018 Downloaded from ABSTRACT The contribution of gene expression changes to the adverse and activity, and positive regulation of neutrophil chemotaxis. The therapeutic effects of b2-adrenoceptor agonists in asthma was general enriched GO term extracellular space was also associ- investigated using human airway epithelial cells as a therapeu- ated with indacaterol-induced genes, and many of those, in- tically relevant target. Operational model-fitting established that cluding CRISPLD2, DMBT1, GAS1, and SOCS3, have putative jpet.aspetjournals.org the long-acting b2-adrenoceptor agonists (LABA) indacaterol, anti-inflammatory, antibacterial, and/or antiviral activity. Numer- salmeterol, formoterol, and picumeterol were full agonists on ous indacaterol-regulated genes were also induced or repressed BEAS-2B cells transfected with a cAMP-response element in BEAS-2B cells and human primary bronchial epithelial cells by reporter but differed in efficacy (indacaterol $ formoterol .
    [Show full text]
  • The Oxytocin Receptor Gene (OXTR) Is Associated with Autism Spectrum Disorder: a Meta-Analysis
    Molecular Psychiatry (2015) 20, 640–646 © 2015 Macmillan Publishers Limited All rights reserved 1359-4184/15 www.nature.com/mp ORIGINAL ARTICLE The oxytocin receptor gene (OXTR) is associated with autism spectrum disorder: a meta-analysis D LoParo and ID Waldman The oxytocin receptor gene (OXTR) has been studied as a risk factor for autism spectrum disorder (ASD) owing to converging evidence from multiple levels of analysis that oxytocin (OXT) has an important role in the regulation of affiliative behavior and social bonding in both nonhuman mammals and humans. Inconsistency in the effect sizes of the OXTR variants included in association studies render it unclear whether OXTR is truly associated with ASD, and, if so, which OXTR single-nucleotide polymorphisms (SNPs) are associated. Thus, a meta-analytic review of extant studies is needed to determine whether OXTR shows association with ASD, and to elucidate which specific SNPs have a significant effect on ASD. The current meta-analysis of 16 OXTR SNPs included 3941 individuals with ASD from 11 independent samples, although analyses of each individual SNP included a subset of this total. We found significant associations between ASD and the SNPs rs7632287, rs237887, rs2268491 and rs2254298. OXTR was also significantly associated with ASD in a gene-based test. The current meta-analysis is the largest and most comprehensive investigation of the association of OXTR with ASD and the findings suggest directions for future studies of the etiology of ASD. Molecular Psychiatry (2015) 20, 640–646; doi:10.1038/mp.2014.77; published online 5 August 2014 INTRODUCTION sizes.8 Nevertheless, several genes and genomic regions have Autism spectrum disorder (ASD) refers to a group of neuro- shown relatively consistent association with ASD.
    [Show full text]
  • Effects of Chronic Psychosocial Stress on HPA Axis Functionality in Male C57BL/6 Mice and the Impact of Trait Anxiety on the Individual Stress Vulnerability
    Effects of chronic psychosocial stress on HPA axis functionality in male C57BL/6 mice and the impact of trait anxiety on the individual stress vulnerability DISSERTATION ZUR ERLANGUNG DES DOKTORGRADES DER NATURWISSENSCHAFTEN (DR. RER. NAT.) DER FAKULTÄT FÜR BIOLOGIE UND VORKLINISCHE MEDIZIN DER UNIVERSITÄT REGENSBURG vorgelegt von Andrea Monika Füchsl aus Straubing im Jahr 2013 Das Promotionsgesuch wurde eingereicht am: 04.10.2013 Die Arbeit wurde angeleitet von: Prof. Dr. rer. nat. Inga D. Neumann Unterschrift: DISSERTATION Durchgeführt am Institut für Zoologie der Universität Regensburg TABLE OF CONTENTS I Table of Contents Chapter 1 – Introduction 1 Stress ...................................................................................................... 1 1.1 The Stress System ..................................................................................... 1 1.1.2 Sympathetic nervous system (SNS) ..................................................... 2 1.2.2 Hypothalamic-Pituitary-Adrenal (HPA) axis .......................................... 4 1.2 Acute vs. chronic/repeated stress ............................................................. 13 1.3 Psychosocial stress .................................................................................. 18 2 GC Signalling ....................................................................................... 20 2.1 Corticosteroid availability .......................................................................... 20 2.2 Corticosteroid receptor types in the brain .................................................
    [Show full text]
  • Evolution of Neuropeptide Signalling Systems (Doi:10.1242/Jeb.151092) Maurice R
    © 2018. Published by The Company of Biologists Ltd | Journal of Experimental Biology (2018) 221, jeb193342. doi:10.1242/jeb.193342 CORRECTION Correction: Evolution of neuropeptide signalling systems (doi:10.1242/jeb.151092) Maurice R. Elphick, Olivier Mirabeau and Dan Larhammar There was an error published in J. Exp. Biol. (2018) 221, jeb151092 (doi:10.1242/jeb.151092). In Fig. 2, panels B and C are identical. The correct figure is below. The authors apologise for any inconvenience this may have caused. Journal of Experimental Biology 1 © 2018. Published by The Company of Biologists Ltd | Journal of Experimental Biology (2018) 221, jeb151092. doi:10.1242/jeb.151092 REVIEW Evolution of neuropeptide signalling systems Maurice R. Elphick1,*,‡, Olivier Mirabeau2,* and Dan Larhammar3,* ABSTRACT molecular to the behavioural level (Burbach, 2011; Schoofs et al., Neuropeptides are a diverse class of neuronal signalling molecules 2017; Taghert and Nitabach, 2012; van den Pol, 2012). that regulate physiological processes and behaviour in animals. Among the first neuropeptides to be chemically identified in However, determining the relationships and evolutionary origins of mammals were the hypothalamic neuropeptides vasopressin and the heterogeneous assemblage of neuropeptides identified in a range oxytocin, which act systemically as hormones (e.g. regulating of phyla has presented a huge challenge for comparative physiologists. diuresis and lactation) and act within the brain to influence social Here, we review revolutionary insights into the evolution of behaviour (Donaldson and Young, 2008; Young et al., 2011). neuropeptide signalling that have been obtained recently through Evidence of the evolutionary antiquity of neuropeptide signalling comparative analysis of genome/transcriptome sequence data and by emerged with the molecular identification of neuropeptides in – ‘deorphanisation’ of neuropeptide receptors.
    [Show full text]
  • Osteoblast Regulation Via Ligand-Activated Nuclear Trafficking of the Oxytocin Receptor
    Osteoblast regulation via ligand-activated nuclear trafficking of the oxytocin receptor Adriana Di Benedettoa,b, Li Sunc,d, Carlo G. Zambonine, Roberto Tammaa, Beatrice Nicoa, Cosima D. Calvanoe, Graziana Colaiannia, Yaoting Jic,d, Giorgio Morib, Maria Granoa, Ping Luc,d, Silvia Coluccia, Tony Yuenc,d, Maria I. Newf,1, Alberta Zallonea,2, and Mone Zaidic,d,g,1,2 aDepartment of Basic Medical Science, Neurosciences and Sensory Organs, University of Bari Aldo Moro Medical School, Bari 70126, Italy; bDepartment of Clinical and Experimental Medicine, University of Foggia, Foggia 71122, Italy; cMount Sinai Bone Program and dDepartment of Medicine, Mount Sinai School of Medicine, New York, NY 10029; eDepartment of Chemistry, University of Bari Aldo Moro, Bari 70126, Italy; and Departments of fPediatrics and gStructural and Chemical Biology, Mount Sinai School of Medicine, New York, NY 10029 Contributed by Maria I. New, October 8, 2014 (sent for review August 27, 2014); reviewed by Xu Cao, Christopher Huang, and Carlos Isales We report that oxytocin (Oxt) receptors (Oxtrs), on stimulation by bisphosphate 3-kinase (Akt/PI3K) (9, 10). Such mechanisms can the ligand Oxt, translocate into the nucleus of osteoblasts, impli- elicit delayed genomic responses. cating this process in the action of Oxt on osteoblast maturation. After being internalized, GPCRs are either recycled back to Sequential immunocytochemistry of intact cells or isolated nucleo- the plasma membrane to resensitize the cell to ligand action or plasts stripped of the outer nuclear membrane showed progressive transported to lysosomes for degradation. Although G proteins nuclear localization of the Oxtr; this nuclear translocation was con- have been found in the Golgi body, endoplasmic reticulum, and firmed by monitoring the movement of Oxtr–EGFP as well as by cytoskeleton (11–13), GPCRs can localize to the nucleus or nuclear immunogold labeling.
    [Show full text]