Slide 1 / 143 Slide 2 / 143
Eukaryotes
January 2014
www.njctl.org
Slide 3 / 143 Slide 4 / 143 Vocabulary Vocabulary Click on each word below to go to the definition. Click on each word below to go to the definition. 5' cap exocytosis matrix poly-A tail adhering junction exon microfilament pre-mRNA alternative splicing extracellular matrix microtubule protist cell junction food vacuole mitochondrion receptor-mediated endocytosis central vacuole fungi mRNA processing RNA splicing chitin gap junction nuclear envelope rough endoplasmic reticulum chloroplast glycoprotein nuclear pore smooth endoplasmic reticulum chromatin golgi appartus nucleolus stroma chromatin modifying enzyme histone nucleosome tight junction contractile vacuole hydrolytic enzyme nucleus transcription factor cytoskeleton intermediate filament organelle transport vesicle endocytosis intermembrane space peroxisome turgor pressure endomembrane system intron phagocytosis endosymbiosis lumen pinocytosis eukaryote lysosome plasmodesmata
Slide 5 / 143 Slide 6 / 143
Eukaryotes Unit Topics
Click on the topic to go to that section
· The Eukaryotic Cell · The Nucleus & Gene Expression · The Endomembrane System The · Energy-Converting Organelles Eukaryotic · Other Organelles & Cell Structures Cell
Return to Table of Contents Slide 7 / 143 Slide 8 / 143
All Cells Eukaryotes vs. Prokaryotes
All cells have 4 things in common. There are 3 key differences between prokaryotic and eukaryotic cells. · They are surrounded by a plasma membrane (or cell · membrane). Eukaryotic cells are usually larger than prokaryotic cells. · They contain a semifluid substance called the cytosol/cytoplasm. · Eukaryotic cells have small compartments inside them call organelles. · They contain structures called chromosomes, which carry the cell's genes. · Most eukaryotes (but not all) are multi-cellular organisms. · They have ribosomes, which assemble amino acids into proteins.
Slide 9 / 143 Slide 9 (Answer) / 143
1Which is NOT a basic feature of all cells? 1Which is NOT a basic feature of all cells?
A All cells are surrounded by a plasma membrane. A All cells are surrounded by a plasma membrane. B Al cells contain a semifluid substance called the cytoplasm. B Al cells contain a semifluid substance called the cytoplasm. All cells contain structures called chromosomes, which are contained in All cells contain structures called chromosomes, which are contained in C C the nucleus. the nucleus. D All cells have ribosomes. D All cells have ribosomes. C Answer
[This object is a pull tab]
Slide 10 / 143 Slide 11 / 143
Cell Size Surface Area to Volume Ratio Eukaryotic cells are, on average, much larger than prokaryotic cells. The average diameter of most prokaryotic cells is between At the time when prokaryotic cells were evolving, there were most likely 1 and 10µm. By contrast, most eukaryotic cells are between 5 to different sizes of cells. A cell's efficiency and ability to survive depended 100µm in diameter. on its surface area to volume ratio.
Animal Cell (Eukaryote) The volume of the cell determines the amount of chemical activity it can carry out per unit time. The surface area of the cell determines the amount of substances the cell can take in from the environment and the amount of waste it can release.
Bacterium (Prokaryote) As a cell grows in size, it's surface area to volume ratio decreases. It performs chemical reactions faster, but it has a harder time getting nutrients in and waste out. Slide 12 / 143 Slide 13 / 143
Limits of Cell Size Organelles We know that cells need to be small enough so that they have To increase efficiency in the an increased surface area to volume ratio, but be large enough to larger cell, eukaryotes perform the chemical reactions of metabolism. evolved many bacterium-sized parts
Least Efficient known as organelles. Most Efficient Organelles subdivide the cell into specialized compartments.
They play many important roles in the cell. Some transport waste to The smaller the cell, the larger The bigger the cell, the smaller the cell membrane. Others keep the molecules required for specific its surface area and the smaller the surface area is compared chemical reactions located within a certain compartment so theydo not its volume. to its large volume inside. need to diffuse long distances to be useful.
Slide 14 / 143 Slide 15 / 143
Organelles Multicellular Organisms
Organelles making up Eukaryotic cells include: Even with organelles, the size of the cell is limited to about 1000µm3. · Nucleus · Vacuoles This is why large organisms must · Lysosomes · Smooth Endoplasmic Reticulum consist of many smaller cells. · Ribosomes · Rough Endoplasmic Reticulum · Peroxisomes · Chloroplasts · Mitochondria · Golgi Apparatus
Slide 16 / 143 Slide 17 / 143
2Which of the following are prokaryotic cells? Diversity of Eukaryotes A Plants Protists: The first eukaryotic cells. Protists are B Fungi single-celled eukaryotes. They range from protozoans to algae. C Bacteria D Animals Fungi: These organisms evolved second in time along with plants. Examples include mushrooms, molds, and mildews.
Plants: Plants vary in type from the first plants called mosses to the modern flowering plants.
Animals : Animals were the last eukaryotes to evolve. Animals range from ancient sponges and hydra to primates. Slide 17 (Answer) / 143 Slide 18 / 143
2Which of the following are prokaryotic cells? 3 How did eukaryotes solve the problem of small surface area to volume ratio? A Plants A by remaining the same size as prokaryotes B Fungi B by becoming multicellular organisms C Bacteria C C by compartmentalizing functions into organelles D Animals D they haven't solved the problem Answer
[This object is a pull tab]
Slide 18 (Answer) / 143 Slide 19 / 143
3 How did eukaryotes solve the problem of small surface area to 4 All eukaryotes are multi-cellular. volume ratio? True A by remaining the same size as prokaryotes False B by becoming multicellular organisms C by compartmentalizing functions into organelles C D they haven't solved the problem Answer
[This object is a pull tab]
Slide 19 (Answer) / 143 Slide 20 / 143
4 All eukaryotes are multi-cellular.
True False
False The Nucleus & Answer Gene Expression
[This object is a pull tab]
Return to Table of Contents Slide 21 / 143 Slide 22 / 143
The Nucleus The Biological Nucleus
The nucleus from chemistry with protons and neutrons is not the The defining organelle in eukaryotic cell is the nucleus. The same nucleus involved with cells. nucleus of the cell contains the DNA and controls the cell's activities by directing protein synthesis from DNA.
Biological Nucleus prokaryotes: pro: before karyon: kernel/seed (nucleus)
eukaryote: eu: true The biological nucleus is usually, but not always, in the center of a karyon: kernel/seed (nucleus) cell and it is sometimes referred to as the "control center" of the cell.
So prokaryote = "before a nucleus" And eukaryote = "true nucleus"
Slide 23 / 143 Slide 24 / 143
Inside the Nucleus 3 Main Functions of the Nucleus
The nucleus is enclosed by a double cell membrane structure called the 1. To keep and contain a safe copy of all chromosomes (DNA) nuclear envelope. and pass them on to daughter cells in cell division.
The nuclear envelope has many 2. To assemble ribosomes (specifically in the nucleolus). openings called nuclear pores. Nuclear pores help the nucleus 3. To copy DNA instructions into RNA (via transcription). "communicate" with other parts of the cell.
Inside the nucleus is a dense region known as the nucleolus. The nucleolus is where rRNA is made and ribosomes are assembled. They then exit through the nuclear pores.
Slide 25 / 143 Slide 25 (Answer) / 143
5Cells that contain a "true nucleus" and other membrane bound 5Cells that contain a "true nucleus" and other membrane bound organelles are ______. organelles are ______.
A archaea. A archaea.
B bacteria. B bacteria. C C eukaryotes. C eukaryotes. Answer D prokaryotes. D prokaryotes.
[This object is a pull tab] Slide 26 / 143 Slide 26 (Answer) / 143
6 Where is the DNA of a eukaryote found? 6 Where is the DNA of a eukaryote found?
A Nucleus A Nucleus B Nucleolus B Nucleolus C Nucleoid C Nucleoid A D Mitochondria D Mitochondria Answer
[This object is a pull tab]
Slide 27 / 143 Slide 27 (Answer) / 143
7 How does the nucleus control the activities of the cell? 7 How does the nucleus control the activities of the cell?
A By making DNA. A By making DNA.
B By directing protein synthesis. B By directing protein synthesis. B By allowing DNA to leave the nucleus to make proteins. By allowing DNA to leave the nucleus to make proteins. C C Answer
D By sending instructions to the mitochondria. D By sending instructions to the mitochondria.
[This object is a pull tab]
Slide 28 / 143 Slide 29 / 143
Many Cells = Same DNA Transcription and Translation All cells in a multicellular eukaryote contain the same genome. Every cell has all the genes necessary to make all parts of the organism.
Cells become specialized by only expressing (turning on) certain genes, a small fraction of all the genes in the genome. Transcription and translation occur in Eukaryotes the same as in Prokaryotes, Transcription but there are extra steps that help regulate expression.
These muscle cells and brain cells (neurons) have the sameDNA but they are expressing different genes, that is why theirstructure and function are so different. Slide 30 / 143 Slide 31 / 143
Gene Expression in Prokaryotes Gene Expression in Eukaryotes Overview
Gene expression is regulated using operons that turn Eukaryotes have much genes on and off more complex depending on the chromosomes that require chemical environment multiple levels of of the cell. regulation including: · "unpacking" of genes · transcription factors · RNA processing
Slide 32 / 143 Slide 32 (Answer) / 143
8A particular triplet of bases in the template strand of DNA is 8A particular triplet of bases in the template strand of DNA is AGT. The corresponding codon for the mRNA transcribed is AGT. The corresponding codon for the mRNA transcribed is
A AGT. A AGT.
B UGA. B UGA.
C TCA. C TCA. E
D ACU. D ACU. Answer
E UCA E UCA
[This object is a pull tab]
Slide 33 / 143 Slide 33 (Answer) / 143
9 A codon 9 A codon
A consists of two nucleotides. A consists of two nucleotides.
B may code for the same amino acid as another codon. B may code for the same amino acid as another codon. C consists of discrete amino acid regions. C consists of discrete amino acid regions.B
D catalyzes RNA synthesis. D catalyzes RNA synthesis.Answer
E is found in all eukaryotes, but not in prokaryotes. E is found in all eukaryotes, but not in prokaryotes.
[This object is a pull tab] Slide 34 / 143 Slide 34 (Answer) / 143
10If the triplet CCC codes for the amino acid proline in bacteria, 10If the triplet CCC codes for the amino acid proline in bacteria, then in plants CCC should code for then in plants CCC should code for
A leucine. A leucine.
B valine. B valine. E
C cystine. C cystine. Answer
D phenylalanine. D phenylalanine.
E proline. E proline. [This object is a pull tab]
Slide 35 / 143 Slide 36 / 143
Chromosomes Chromatin
DNA is configured into Chromosome Species The DNA is tightly wound structures called # around proteins called chromosomes. Adders-tongue (a fern) 1440 histones, like thread Recall that prokaryotes have Dog 78 wrapped on a spool. The one chromosome that is combination of eight Human 46 histones and DNA is double-stranded and circular. Rat 42 called a nucleosome.
The number of chromosomes Pig 38 a eukaryote has depends on the species. These Cat 38 chromosomes are made up of Rice 24 Video on how DNA is packaged a complex of tightly coiled Slime Mold 12 DNA and associated proteins Jack Jumper Ant 2* called chromatin. *2 for females, 1 for males Source: Wikipedia.com
Slide 37 / 143 Slide 38 / 143
Chromatin's Role in Gene Expression Chromatin Modifying Enzymes
When DNA is packed in chromatin it is not accessible to RNA polymerase so transcription can not happen. The genes that need to be expressed are unwound from histones by The main factor in the specialization of cells in multi-cellular chromatin modifying enzymes in order to expose their nucleotide organisms is what genes are "unpacked" from the chromatin to be sequences. exposed to RNA polymerase. Genes that are unnecessary to a particular cell will remain packed while All gene sequences are the neccessary ones are unpacked. exposed to RNA polymerase
Some genes exposed
No genes exposed Slide 39 / 143 Slide 39 (Answer) / 143
11 No two cells in the human body have exactly the same DNA. 11 No two cells in the human body have exactly the same DNA.
True True False False
False Answer
[This object is a pull tab]
Slide 40 / 143 Slide 40 (Answer) / 143
12 How many spools of DNA and proteins make a nucleosome? 12 How many spools of DNA and proteins make a nucleosome?
8 Answer
[This object is a pull tab]
Slide 41 / 143 Slide 42 / 143
Transcription Transcription Factors
Transcription of DNA into RNA occurs in the nucleus of the eukaryotic cell. Eukaryotic RNA polymerase needs the assistance of proteins called Transcription factors are proteins that are capable of binding with DNA. transcription factors to help regulate when a gene is expressed. When they bind to areas near the promoter region of the gene they work with RNA polymerase to begin the transcription of that gene. If all the necessary transcription factors are present for a specific gene, then the gene can be expressed. If any are missing, transcription will not They are produced in response to cues from the external environment of start. the cell.
There can be thousands of transcription factors in an organism's cells These proteins make the cell capable of turning on genes in response to (3,000 in humans). The kind and number of them present in the nucleus external stimulus. This is essential to multicellular eukaryotes because it at any given time dictate what genes are expressed. allows the different cells of the organism to communicate and respond to situations in unison.
Video on regulated transcription Slide 43 / 143 Slide 44 / 143
External Signals 13 The first step in eukaryotic gene expression is... A transcription B translation C RNA processing External signal activates membrane bound D unraveling the gene protein (receptor) Nucleus Signal Transcription Factor Receptor Metabolic pathway that produces a specific transcription factor in response to signal. The product enters the nucleus.
Cell Slide 44 (Answer) / 143 Slide 45 / 143
13 The first step in eukaryotic gene expression is... 14 Where does transcription occur in eukaryotic cells?
A transcription A nucleus B translation B nucleiod C RNA processing C cytoplasm D unraveling the gene D cell membrane D Answer
[This object is a pull tab]
Slide 45 (Answer) / 143 Slide 46 / 143
14 Where does transcription occur in eukaryotic cells? 15 Once the DNA is unwound from the chromatin, which of the following is necessary to begin transcription? A nucleus B nucleiod A RNA polymerase C cytoplasm B ribosome D cell membrane C transcription factors A D both A & C Answer
[This object is a pull tab] Slide 46 (Answer) / 143 Slide 47 / 143
15 Once the DNA is unwound from the chromatin, which of the 16 Transcribe the following eukaryotic gene sequence: following is necessary to begin transcription? AACTGATTATGGGCT
A RNA polymerase A AACTGATTATGGGCT B ribosome B TTCACTAATACCCGA C transcription factors D C UUGACUAAUACCCGA D both A & C D UUCUGAUUAUGGGCU Answer
[This object is a pull tab]
Slide 47 (Answer) / 143 Slide 48 / 143
16 Transcribe the following eukaryotic gene sequence: AACTGATTATGGGCT mRNA Processing
A AACTGATTATGGGCT After Transcription, the transcript is known aspre-mRNA . Enzymes in the nucleus modify pre-mRNA before the geneticmessages are B TTCACTAATACCCGA sent to the cytoplasm. This is knowmRNA processing. C UUGACUAAUACCCGA C UUCUGAUUAUGGGCU During mRNA processing, both ends of the pre-mRNA are D Answer altered.
Some interior sequences of pre-mRNA may be cut out, and other parts spliced together. [This object is a pull tab]
Slide 49 / 143 Slide 50 / 143
Alteration of mRNA Ends Alteration of mRNA Ends
The 3` end of the pre-mRNAgets a poly-A tail. This tail is series The 5`end of the pre-mRNA receives a molecule known as a of adenosine (A) nucleotides. nucleotide (or 5') cap.
This cap is a modified guanine molecule (the G in A, T, C, G)
pre-mRNA AUGCCCUUAGCC A A A A A A A A A A A A
5' cap added GAUGCCCUUAGCC original pre-mRNA AUGCCCUUAGCC
3' tail added GAUGCCCUUAGCCAAAAAAAA Slide 51 / 143 Slide 52 / 143
Alteration of mRNA Ends RNA Splicing Most eukaryotic genes and their RNA transcripts have long The modifications to the ends of the pre-mRNA have several noncoding stretches of nucleotides that lie between coding regions. functions: These noncoding regions are called intervening sequences, or introns. · They facilitate the export of mRNA from the nucleus to the cytoplasm. The other regions calledex ons (because they are eventually · They protect mRNA from hydrolytic enzymes once it is in the expressed), are usually translated into amino acid sequences. cytoplasm. · They help ribosomes attach to the mRNA so they can be RNA splicing removes introns and joins exons, creating an mRNA translated into a protein. molecule with a continuous coding sequence.
Slide 53 / 143 Slide 53 (Answer) / 143
17What are the coding segments of a stretch of eukaryotic DNA 17What are the coding segments of a stretch of eukaryotic DNA called? called?
A introns A introns B B exons B exons Answer C codons C codons
D replicons D replicons
[This object is a pull tab]
Slide 54 / 143 Slide 55 / 143
mRNA Processing Alternative RNA Splicing This is an example of a pre-mRNA becoming a final transcript.
Some genes can code more than one kind of polypeptide, depending on which segments are treated as exons during RNA splicing.
Alternative splicing allows the number of different proteins an organism can produce to be much greater than its number of genes. Slide 56 / 143 Slide 57 / 143
18Which of the following helps to stabilize mRNA by inhibiting its Alternative RNA Splicing degradation?
DNA sequence AAATTTCCCGGGAAATTTCCCGGG A RNA polymerase Pre-mRNA B ribosomes (Cap)-UUUAAAGGGCCCUUUAAAGGGCCC-(Tail) C 5' cap Alternate splices (Cap)-UUU AAA UUU AAA-(Tail) OR (Cap)-GGC CCG GGC-(Tail) D poly-A tail
Resulting polypeptide (protein) E both C and D Phe - Lys - Phe - Lys OR Gly - Pro - Gly
Alternate splicing can dramatically change the length and/or the sequence of the polypeptide chain that will be made
Slide 57 (Answer) / 143 Slide 58 / 143
18Which of the following helps to stabilize mRNA by inhibiting its 19A transcription unit that is 8,000 nucleotides long may use degradation? 1,200 nucleotides to make a protein consisting of 400 amino acids. This is best explained by the fact that
A many noncoding nucleotides are present in mRNA. A RNA polymerase
B ribosomes B there is redundancy and ambiguity in the genetic code. E C 5' cap Answer D poly-A tail C many nucleotides are needed to code for each amino acid.
E both C and D nucleotides break off and are lost during the transcription [This object is a pull tab] D process.
Slide 58 (Answer) / 143 Slide 59 / 143
19A transcription unit that is 8,000 nucleotides long may use 20Once transcribed, eukaryotic pre-mRNA typically undergoes 1,200 nucleotides to make a protein consisting of 400 amino substantial alteration that includes acids. This is best explained by the fact that
A many noncoding nucleotides are present in mRNA. A removal of introns.
B fusion into circular forms known as plasmids. B there is redundancy and ambiguity in the geneticA code.
Answer C linkage to histone molecules.
C many nucleotides are needed to code for each amino acid. D union with ribosomes.
E fusion with other newly transcribed mRNA. nucleotides break off and are lost during[This object the is a pulltranscription tab] D process. Slide 59 (Answer) / 143 Slide 60 / 143
20Once transcribed, eukaryotic pre-mRNA typically undergoes 21A mutation in which of the following parts of a gene is likely to substantial alteration that includes be most damaging to a cell?
A removal of introns. A intron
B fusion into circular forms known as plasmids. B exon A
C linkage to histone molecules.Answer C would be equally damaging.
D union with ribosomes.
E fusion with other newly transcribed mRNA. [This object is a pull tab]
Slide 60 (Answer) / 143 Slide 61 / 143
21A mutation in which of the following parts of a gene is likely to 22Alternative RNA splicing be most damaging to a cell?
can allow the production of proteins of dramatically different A sizes from a single mRNA. A intron can allow the production of proteins of dramatically different B B B exon amino acid sequences from a single mRNA. Answer C would be equally damaging. C Both can happen
[This object is a pull tab]
Slide 61 (Answer) / 143 Slide 62 / 143
22Alternative RNA splicing Entrance into the Cytoplasm
can allow the production of proteins of dramatically different After the finalized mRNA transcript is complete and correct, the A sizes from a single mRNA. pores in the nuclear envelope allow it to pass to the cytoplasm where it can be translated into proteins by ribosomes. can allow the production of proteins of dramatically different B C amino acid sequences from a single mRNA.
Answer The nuclear pore is a C Both can happen protein structure that controls the traffic flow of the nucleus. Each
[This object is a pull tab] nuclear pore is made up of hundreds of individual proteins that insure only mRNAs with proper caps and tails can make it to the cytoplasm. Slide 63 / 143 Slide 64 / 143
What is the importance of nuclear pores? Degradation of mRNA 23 They allow the nucleus to communicate with other parts of A the cell. Hydrolytic enzymes in the cytoplasm breakdown mRNA molecules. The length of time an mRNA suvives in the cytoplasm relates to how They allow DNA to leave the nucleus in order to direct B much protein is made from it. Longer time in the cytoplasm means protein synthesis. more translation by ribosomes. They allow RNA to leave the nucleus in order to be translated C The length of the poly-A tail is one of many factors that determines in the cytoplasm. the time of survival in the cytoplasm. The longer the tail, the longer it's survival. They allow single stranded DNA molecules to enter the D nucleus and assemble into the double helix.
Slide 64 (Answer) / 143 Slide 65 / 143
23 What is the importance of nuclear pores? Summary of Gene Expression Regulation in Eukaryotes They allow the nucleus to communicate with other parts of A the cell. · The gene must be unpacked from chromatin · The right transcription factors must be present They allow DNA to leave the nucleus in order to direct B protein synthesis. C Transcription occurs Answer They allow RNA to leave the nucleus in order to be translated C in the cytoplasm. · Cap and tail must be added to the mRNA · Pre-mRNA must be edited (spliced) They allow single stranded DNA molecules to enter the D [This object is a pull tab] · Nuclear pores allow passage to the cytoplasm nucleus and assemble into the double helix. · mRNA comes intocontact with a ribosome
Translation occurs
· Protein is used within the cell or exported to the environment
Slide 66 / 143 Slide 67 / 143
The Endomembrane System
Several organelles, some made up mainly of membranes, form a type of assembly line in the cell. They make a protein, then process and ship it to its final destination whether that be inside or outside the cell. Organelles included in this system include the Endomembrane nucleus, rough and smooth endoplasmic reticulum, golgi System appartus, and lysosomes. Collectively, we refer to them as the endomembrane system.
Note: The plasma membrane is also considered part of this system
Return to Table of Contents Slide 68 / 143 Slide 69 / 143
The Endomembrane System Endoplasmic Reticulum
When RNA leaves the nucleus, it enters the endoplasmic reticulum (ER). This organelle is a series of membrane-bound sacs and tubules. It is continuous with the outer membrane of the nuclear envelope (reticulum comes from the latin word for little net).
There are two types of endoplasmic reticulum: rough and smooth.
Slide 70 / 143 Slide 71 / 143
Rough Endoplasmic Reticulum Ribosomes
Recall that the ribosome is Large made of rRNA and proteins. subunit Rough ER has ribosomes attached to its membrane (thus a This is where translation rough appearance). occurs.
These ribosomes synthesize proteins that will be used in the Ribosomes consist of two plasma membrane, secreted outside the cell or shipped to subunits, a small and a another organelle called a lysosome. large. Each subunit consists Small of proteins and rRNA. The subunit As proteins are made by the ribosomes, they enter the lumen two subunits come together (opening) of the ER where they are folded and processed. when proteins need to be made.
Slide 72 / 143 Slide 73 / 143
Ribosomes 24 Where are ribosomal subunits made in the cell?
Recall ribosomes make peptide bonds between amino acids in A Cytoplasm translation. B Nucleus
The instructions for making ribosomes are in the DNA. From C Nucleolus DNA, rRNA is made. Some of the rRNA is structural and other rRNA holds the code from the DNA to make the ribosomal D On the Plasma membrane proteins from mRNA.
transcription translation DNA mRNA Protein Slide 73 (Answer) / 143 Slide 74 / 143
24 Where are ribosomal subunits made in the cell? 25 What do ribosomes consist of?
A Cytoplasm A proteins and DNA
B Nucleus B proteins and rRNA
C Nucleolus C proteins only
D On the Plasma membrane C D DNA only Answer
[This object is a pull tab]
Slide 74 (Answer) / 143 Slide 75 / 143
25 What do ribosomes consist of? 26 List all the parts of the endomembrane system.
rough and smooth endoplasmic reticulum, golgi appartus, A proteins and DNA A lysosomes B proteins and rRNA B nucleus, rough and smooth endoplasmic reticulum, golgi B appartus, lysosomes
C proteins only Answer nucleus, rough and smooth endoplasmic reticulum, golgi D DNA only C appartus nucleus, rough and smooth endoplasmic reticulum, golgi D [This object is a pull tab] appartus, lysosomes, plasma membrane
Slide 75 (Answer) / 143 Slide 76 / 143
26 List all the parts of the endomembrane system. 27 Which of the following is involved in making proteins? rough and smooth endoplasmic reticulum, golgi appartus, A Smooth E.R. A lysosomes nucleus, rough and smooth endoplasmic reticulum, golgi B Ribosomes B appartus, lysosomes D C DNA
nucleus, rough and smoothAnswer endoplasmic reticulum, golgi C appartus D Nuclear membrane nucleus, rough and smooth endoplasmic reticulum, golgi D appartus, lysosomes, plasma membrane [This object is a pull tab] Slide 76 (Answer) / 143 Slide 77 / 143
27 Which of the following is involved in making proteins? Smooth Endoplasmic Reticulum A Smooth E.R. This type of ER is called Smooth because it lacks ribosomes on B Ribosomes its surface. (it looks smooth compared to rough ER)
C DNA B There are a variety of functions of this organelle, which include:
Answer · making lipids. D Nuclear membrane · processing certain drugs and poisons absorbed by the cell. · storing calcium ions (for example, in muscle cells).
[This object is a pull tab] Note: The liver is an organ that detoxifies substances that are brought into the body. Therefore, liver cells have huge amounts of Smooth ER.
Slide 78 / 143 Slide 79 / 143
28 The endomembrane system serves to Protein Transport A ship cell products to places in and out of the cell Once the proteins are processed, short chains of sugars are sometimes linked to these proteins, which are then known as B assemble DNA glycoproteins. These glycoproteins serve as "zip codes" that will tell the protein where it will go. C give directions to other organelles D create pathways for organelles to travel When the molecule is ready to be exported out of the ER, it gets packaged into a transport vesicle. This vesicle is made of membranes from the ER itself. The transport vesicle travels to another organelle known as the Golgi apparatus.
Slide 79 (Answer) / 143 Slide 80 / 143
28 The endomembrane system serves to 29 What determines if we classify endoplasmic reticulum as smooth or rough? A ship cell products to places in and out of the cell A presence or absence of nuclear pores B assemble DNA B presence or absence of genetic material C give directions to other organelles A C presence or absence of ribosomes D create pathways forAnswer organelles to travel D presence of absence of DNA
[This object is a pull tab] Slide 80 (Answer) / 143 Slide 81 / 143
29 What determines if we classify endoplasmic reticulum as 30 Where in the cell are lipids made? smooth or rough? A Nucleus A presence or absence of nuclear pores B Ribosomes B presence or absence of genetic material C Rough endoplasmic reticulum C presence or absence of ribosomes C D Smooth endoplasmic reticulum Answer D presence of absence of DNA
[This object is a pull tab]
Slide 81 (Answer) / 143 Slide 82 / 143
30 Where in the cell are lipids made? Golgi Apparatus A Nucleus
B Ribosomes The main function of this D organelle is to finish, sort, and C Rough endoplasmic reticulum ship cell products. It works like Answer the postal department of the D Smooth endoplasmic reticulum cell.
Structurally, the golgi consists [This object is a pull tab] of stacked flattened sacs (sort of looks like a stack of pita bread).
Slide 83 / 143 Slide 84 / 143
Golgi Apparatus The Golgi Apparatus & the ER The Golgi receives transport vesicles that bud off from the ER and The Golgi is located near the cell membrane. The Golgi works contain proteins. It takes the substances contained in these closely with the ER of a cell. vesicles and modifies them chemically in order to mark them and sort them into different batches depending on their destination. It receives and modifies substances manufactured by the ER. Once the substances are modified, they are shipped out to other The finished products are then packaged into new transport areas of the cell. vesicles which will then move to lysosomes, or will be inserted into the plasma membrane or dumped out of the cell if the protein is a One key difference between the Golgi apparatus and endoplasmic secretory protein. reticulum is that the sacs comprising the Golgi are not interconnected. Video on Protein Trafficking through the Golgi Slide 85 / 143 Slide 85 (Answer) / 143
31 A difference between the Golgi Apparatus and the ER is that 31 A difference between the Golgi Apparatus and the ER is that
A The ER takes the vesicles from the Golgi to transport A The ER takes the vesicles from the Golgi to transport
B The sacs making the Golgi are not interconnected B The sacs making the Golgi are not interconnected B C The Golgi has ribosomes, the ER does not C The Golgi has ribosomes, the ER does not Answer D There is no difference, they are part of the same organelle D There is no difference, they are part of the same organelle
[This object is a pull tab]
Slide 86 / 143 Slide 86 (Answer) / 143
32 Which organelle receives and modifies substances from the 32 Which organelle receives and modifies substances from the endoplasmic reticulum? endoplasmic reticulum?
A Nucleus A Nucleus
B Ribosomes B Ribosomes D
C Lysosomes C Lysosomes Answer
D Golgi Bodies D Golgi Bodies
[This object is a pull tab]
Slide 87 / 143 Slide 88 / 143
Lysosomes Lysosomes
Some proteins from the Golgi Apparatus Lysosomes may fuse with food-containing organelles are transported to the called vacuoles and then the enzymes digest the food, lysosomes. As the releasing nutrients into the cell. Protists do this. name suggests, a lysosome is an Damaged or unneeded proteins may become enclosed organelle that within a membranous vesicle which then fuses with a breaks down other lysosome. substances. (lyse: to cause destruction) The organic molecules from the breakdown process are recycled and reused by the cell. They consist of hydrolytic enzymes enclosed within a membrane. Hydrolytic enzymes break polymers into monomers through hydrolysis. Slide 89 / 143 Slide 90 / 143
33 Which organelle contains hydrolytic enzymes that break down Peroxisomes other substances? A peroxisome is a specific type of lysosome that forms and
breaks down hydrogen peroxide (H2 O2 ) which is toxic to cells. A Endoplasmic Reticulum
In all cells, hydrogen peroxide forms constantly (from the B Golgi Bodies combining of hydrogen and oxygen as bi-products of metabolism) C Lysosomes and needs to be broken down quickly. D Vacuoles
Important note: Peroxisomes are not part of the endomembrane system.
Slide 90 (Answer) / 143 Slide 91 / 143
33 Which organelle contains hydrolytic enzymes that break down 34 Which is not a function of lysosomes? other substances? A aiding the cell in creating ribosomes A Endoplasmic Reticulum B fusing with vacuoles to digest food B Golgi Bodies C C breaking polymers into monomers
C Lysosomes Answer D recycling worn out cell parts D Vacuoles
[This object is a pull tab]
Slide 91 (Answer) / 143 Slide 92 / 143
34 Which is not a function of lysosomes? Plasma Membrane Remember the plasma membrane is a phospholipid bilayer with A aiding the cell in creating ribosomes proteins and other molecules interspersed throughout.
B fusing with vacuoles to digest food
C breaking polymers into monomers A Answer D recycling worn out cell parts
[This object is a pull tab]
Some proteins from the Golgi Apparatus become embedded in the membrane. Others are transported through the membrane to the external environment. Slide 93 / 143 Slide 94 / 143
Plasma Membrane Membrane Transport - Review Passive transport is the The 3 main functions of the plasma membrane: movement of substances Passive Active Transport Transport from an area of high concentration to an area · Selective Permeability of low concentration · Protection without the requirement · Structural support an energy input. Types (REQUIRES include diffusion, osmosis, ENERGY) and facilitated diffusion.
Active transport is the movement of substances from an area of low concentration to an area of high concentration and requires an input of energy.
Slide 95 / 143 Slide 95 (Answer) / 143
35 Which of the following statements about the role of 35 Which of the following statements about the role of phospholipids in forming membranes is correct? phospholipids in forming membranes is correct?
A they are completely insoluble in water A they are completely insoluble in water
B they form a single sheet in water B they form a single sheet in water
C they form a structure in which the hydrophobic portion C they form a structure in which the hydrophobicD portion faces outward faces outward Answer
D they form a selectively permeable structure D they form a selectively permeable structure
[This object is a pull tab]
Slide 96 / 143 Slide 96 (Answer) / 143
36 Active transport moves molecules 36 Active transport moves molecules
A with their concentration gradients without the use of energy A with their concentration gradients without the use of energy
B with their concentration gradients using energy B with their concentration gradients using energy
C against their concentration gradients without the use of energy C against their concentration gradients without the use of energy D against their concentration gradients using energy D against their concentration gradients using energy D Answer
[This object is a pull tab] Slide 97 / 143 Slide 97 (Answer) / 143
37 Which of the following processes includes all others? 37 Which of the following processes includes all others?
A passive transport A passive transport
B facilitated diffusion B facilitated diffusion
C diffusion of a solute across a membrane C diffusion of a solute across a membrane A
D osmosis D osmosis Answer
[This object is a pull tab]
Slide 98 / 143 Slide 99 / 143
Large Molecules and Exocytosis the Plasma Membrane To excrete a macromolecule from Exocytosis Many proteins created by the cell are the cell, the vesicles too large to pass through the that enclose the membrane, even using protein carrier proteins fuse with the or integral proteins. How do these plasma membrane macromolecules exit the cell? and the vesicles then When the substance needs other open up and spill their ways of getting into or out of a cell, contents outside of the they will enter and exit by fusing cell. with the cell membrane. This process is known as . The There are several special functions of the membrane as larger exocytosis This is how secretory proteins from the Golgi exit the cell. substances enter and exit the cell. vesicle will become This is true for insulin in the pancreas. part of the cell membrane.
Slide 100 / 143 Slide 101 / 143
Insulin - A Secretory Protein Endocytosis
Insulin is a protein hormone made by certain cells of the pancreas The opposite of exocytosis is that enable cells to take glucose (sugar) in from the blood. endocytosis.
Insulin is a secretory protein made in the rough ER. Specifically, it is In this process, the cell takes in secreted out of the pancreas cells into the blood stream. macromolecules or other particles by forming vesicles or vacuoles from its plasma membrane.
This is how many protists ingest food particles Slide 102 / 143 Slide 103 / 143
3 Types of Endocytosis 3 Types of Endocytosis
Phagocytosis Is for taking in solid particles. ("phago" mean to eat)
Pinocytosis Is for taking in liquids. However what the cell wants is not the liquid itself, but the substances that are dissolved in the liquid. ("pino" means to drink)
Receptor-mediated endocytosis requires the help of a protein coat and receptor on the membrane to get through.
Slide 104 / 143 Slide 104 (Answer) / 143
38 The process by which a cell ingests large solid particles, 38 The process by which a cell ingests large solid particles, therefore it is known as "cell eating". therefore it is known as "cell eating".
A Pinocytosis A Pinocytosis
B Phagocytosis B Phagocytosis B
C Exocytosis C Exocytosis Answer
D Osmoregulation D Osmoregulation
[This object is a pull tab]
Slide 105 / 143 Slide 105 (Answer) / 143
39 Protein coated vesicles move through the plasma membrane via 39 Protein coated vesicles move through the plasma membrane via this process: this process:
A Phagocytosis A Phagocytosis
B Active Transport B Active Transport C
C Receptor-Mediated Endocytosis C Receptor-MediatedAnswer Endocytosis D Pinocytosis D Pinocytosis
[This object is a pull tab] Slide 106 / 143 Slide 106 (Answer) / 143
40 After a vesicle empties its contents outside a cell, the vesicle 40 After a vesicle empties its contents outside a cell, the vesicle becomes part of: becomes part of:
A the Golgi A the Golgi
B the plasma membrane B the plasma membrane B
C another vesicle C another vesicle Answer D the extracellular fluid D the extracellular fluid
[This object is a pull tab]
Slide 107 / 143 Slide 108 / 143
Energy-Converting Organelles
Chloroplasts reside in plant cells and some protists and convert solar radiation into energy stored in the cell for later use.
Energy-Converting Mitochondria reside in all eukaryotic cells and convert Organelles chemical energy from glucose into ATP. Interestingly, both chloroplasts and mitochondria have their own DNA, separate from that found in the nucleus of the cell. They also have a double cell membrane.
Return to Table of Contents
Slide 109 / 143 Slide 110 / 143
Chloroplasts Thylakoids
These organelles convert solar energy to chemical energy through Remember that during photosynthesis. Chloroplasts are photosynthesis it is on the partitioned into three major thylakoid that the Light Dependent Reactions take place. compartments by internal eukaryotic chloroplast membranes:
· Thylakoids In prokaryotes, thylakoids are areas of highly folded membranes. · Stroma In eukaryotes, they are stacked in the chloroplasts. The fluid · Intermembrane space eukaryotic chloroplast outside these stacks of thylakoids is called the stroma; this is where the Calvin cycle takes place. Slide 111 / 143 Slide 112 / 143
Mitochondria Mitochondria and Respiration
Mitochondria are sometimes Remember cell respiration must take place near a membrane so referred to as the "powerhouses" that a proton gradient can be built in a "membrane space" that is of the cell. They convert chemical separate from the rest of the cell. Thus, the membrane would energy (glucose) into a more separate the inner volume, with a deficit of protons, from the usable and regenerative form of outside, with an excess. chemical energy (ATP). In prokaryotes, the "inter-membrane space" is between the cell membrane and the cell wall. The mitochondria is also partitioned like the chloroplast. They only have two compartments as opposed to threein the chloroplast. In eukaryotes, that membrane is the inter-membrane space of the mitochondria in between the inner membrane and outer · Matrix membrane.
· Intermembrane space
Slide 113 / 143 Slide 114 / 143
The Evolution of Eukaryotes Endosymbiotic Theory
The mitochondria and chloroplast are different from other eukaryotic organelles because they have their own DNA, their own ribosomes, and have a double cell membrane.
In 1970, Lynn Margulis published the "Theory of Endosymbiosis" to explain these facts. The theory states that the mitochondria and chloroplast were once free-living prokaryotes that got taken up (or "eaten") by another prokaryote. When they got taken up by another prokaryote, they dragged the one prokaryote's cell membrane around theirs, thus the double cell The mitochondria was a bacteria that could make its own ATP. The membrane. This now allowed the "new" eukaryote to make its own chloroplast was a bacteria that could perform photosynthesis. ATP or be able to do photosynthesis and make its own food. Thus the evolution of eukaryotes. endo: within sym: together Note: The nucleus and flagella could also have the same possible roots bio: life sis: condition although they are not as heavily supported with evidence as the endosymbiosis = living together, within mitochondria and chloroplast.
Slide 115 / 143 Slide 116 / 143
Evidence for Symbiosis The Mitochondrial Eve
Both mitochondria and chloroplasts can arise only from preexisting Since mitochondrial DNA is not in the cell nucleus, it is only mitochondria and chloroplasts. They cannot be form in a cell that passed along from mother to child; animals, including you, inherit lacks them. your mitochondria from your mother only.
Both mitochondria and chloroplasts have their own DNA and it This is because the egg from our mothers contained her resembles the DNA of bacteria not the DNA found in the nucleus organelles. (Dad's sperm only contains the chromosomes, none of his organelles usually). Both mitochondrial and chloroplast genomes consist of a single circular molecule of DNA, just like in prokaryotes. All of our organelles we inherited from our mothers. Mitochondrial DNA is a way to trace maternal heritage through a family or Both mitochondria and chloroplasts have their own protein- through a species. The "Mitochondrial Eve" is the first human synthesizing machinery, and it more closely resembles that of female that gave rise to all humans. In theory, we can trace all bacteria than that found in the cytoplasm of eukaryotes. humans back to her through our mitochondrial DNA. Slide 117 / 143 Slide 117 (Answer) / 143
41 Which organelle converts food energy into chemical energy 41 Which organelle converts food energy into chemical energy that the cell can use? that the cell can use?
A Nucleus A Nucleus
B Chloroplast B Chloroplast
C Mitochondrion C Mitochondrion C Answer D Golgi D Golgi
[This object is a pull tab]
Slide 118 / 143 Slide 118 (Answer) / 143
42 Which organelle converts solar energy into chemical energy in 42 Which organelle converts solar energy into chemical energy in plants and other photosynthetic organisms? plants and other photosynthetic organisms?
A Nucleus A Nucleus
B Chloroplast B Chloroplast B
C Mitochondrion C Mitochondrion Answer
D Golgi D Golgi
[This object is a pull tab]
Slide 119 / 143 Slide 119 (Answer) / 143
43 Which of the following is not true of mitochondria and chloroplasts? 43 Which of the following is not true of mitochondria and chloroplasts?
A They are present in all eukaryotic cells A They are present in all eukaryotic cells B They have their own DNA B They have their own DNA C They have their own ribosomes C They have their own ribosomes A D They are surrounded by a double membrane D They are surrounded by a double membrane Answer
[This object is a pull tab] Slide 120 / 143 Slide 120 (Answer) / 143
44 Which of the following does NOT provide evidence for the 44 Which of the following does NOT provide evidence for the endosymbiotic theory? endosymbiotic theory?
A Mitochondria and chloroplasts both have their own DNA. A Mitochondria and chloroplasts both have their own DNA. Mitochondria and chloroplasts both come from pre-existing Mitochondria and chloroplasts both come from pre-existing B B mitochondria and chloroplasts. mitochondria and chloroplasts. C
The DNA of mitochondria and chloroplasts resembles the The DNA of mitochondriaAnswer and chloroplasts resembles the C C DNA found in nuclei. DNA found in nuclei.
The DNA of mitochondria and chloroplasts resembles that of The DNA of mitochondria and chloroplasts resembles that of D D bacteria. bacteria. [This object is a pull tab]
Slide 121 / 143 Slide 122 / 143
Vacuoles Vacuoles are membranous sacs and they come in different shapes and sizes and have a variety of functions.
Central Other Organelles and Vacuole Cellular Structures
Return to PROTIST PLANT Table of CELL Contents
Slide 123 / 143 Slide 124 / 143
Central Vacuoles Turgor Pressure
Central Vacuoles in plants store water. Absorbing water makes Increased turgor pressure results from the a plant cell more turgid, or having more pressure inside - leading central vacuole being full with water. It to strength and rigidity. presses out on the cell membrane which then presses out on the cell wall. Central vacuoles that are full will take over most of the cytoplasm and literally push The plant cell will not explode or lose its shape the organelles to the sides like an animal cell would in a hypotonic of the cell. It can also store environment. vital chemicals, pigments and waste products.
When the turgor pressure decreases the cell is limp and droopy. This is associated with wilted, limp lettuce, as well as droopy flowers. Slide 125 / 143 Slide 126 / 143
Contractile Vacuoles Food Vacuoles
Food Vacuoles are Contractile vacuoles mainly found in can be found in certain protists. single-celled protists. These act as a pump to The protist ingests expel excess water food particles. The from the cell. This is particles then fuse especially helpful to with a lysosome. those organisms living The lysosome in a freshwater contains hydrolytic environment to keep the enzymes that break cell from exploding. the food down. Paramecium fed dyed food showing vacuoles.
Slide 127 / 143 Slide 127 (Answer) / 143
45 An organelle found in plant cells that stores water as well as 45 An organelle found in plant cells that stores water as well as other important substances is called the ______. other important substances is called the ______.
A Lysosome A Lysosome
B Contractile Vacuole B Contractile Vacuole C
C Central Vacuole C Central Vacuole Answer
D Golgi bodies D Golgi bodies
[This object is a pull tab]
Slide 128 / 143 Slide 128 (Answer) / 143
46 Food vacuoles are primarily found in which organisms? 46 Food vacuoles are primarily found in which organisms?
A Plants A Plants
B Animals B Animals
C Protists C Protists C D Bacteria D Bacteria Answer
[This object is a pull tab] Slide 129 / 143 Slide 130 / 143
Cytoskeleton 47 Cells can be described as having a cytoskeleton of internal structures that contribute to the shape, organization, and Cytoskeleton is a network of movement of the cell. All of the following are part of the fibers within the cytoplasm. cytoskeleton except
Three types of fibers A the nuclear envelope. collectively make up the cytoskeleton: B microtubules. · Microfilaments · Intermediate filaments C microfilaments. · Microtubules D intermediate filaments. These fibers provide structural support and are also involved in various types of cell movement and motility.
Slide 130 (Answer) / 143 Slide 131 / 143
47 Cells can be described as having a cytoskeleton of internal 48 Which of the following is not a known function of the structures that contribute to the shape, organization, and cytoskeleton? movement of the cell. All of the following are part of the cytoskeleton except A to maintain a critical limit on cell size
B to provide mechanical support to the cell A the nuclear envelope. A
Answer C to maintain the characteristic shape of the cell B microtubules. to hold mitochondria and other organelles in place within the D C microfilaments. cytosol
D intermediate filaments. [This object is a pull tab]
Slide 131 (Answer) / 143 Slide 132 / 143
48 Which of the following is not a known function of the Cell wall cytoskeleton? The cell wall is an outer layer in A to maintain a critical limit on cell size addition to the plasma membrane, found in fungi, algae, and plant cells. B to provide mechanical support to the cell A The composition of the cell wall varies
C to maintain the characteristicAnswer shape of the cell among species and even between cells in the same individual. All cell walls have to hold mitochondria and other organelles in place within the D carbohydrate fibers embedded in a stiff cytosol matrix of proteins and other carbohydrates.
[This object is a pull tab] Plant cell walls are made of the polysaccharide cellulose. Fungal cell walls are made of the polysaccharide chitin. Slide 133 / 143 Slide 134 / 143 Extracellular Matrix Cell Surfaces and Junctions
Cell surfaces protect, support, and join cells. The cells of many multi-cellular animals are surround by a extracellular matrix (ECM). The Cells interact with their environments and each other via their surfaces. ECM provides structural support to Cells need to pass water, nutrients, hormones, and many, many more the cells in addition to providing substances to one another. Adjacent cells communicate and pass various other functions such as substances to one another through cell junctions. anchorage, cellular healing, separating tissues from one another Animal and plant cells have different types of cell junctions. This and regulating cellular is mainly because plants have cell walls and animal cells do not. communication.
The ECM is primarily composed of an interlocking mesh of proteins and carbohydrates.
Slide 135 / 143 Slide 136 / 143
Plant Cell Junctions Animal Cell Junctions Plant cells are supported by rigid cell walls made largely of cellulose.
They connect by Tight junctions plasmodesmata which are channels that allow Adhering junctions them to share water, food, and chemical messages. Communicating (Gap) junctions
Slide 137 / 143 Slide 138 / 143
Tight Junctions Adhering Junctions
Tight junctions can bind Adhering junctions fasten cells together into cells together into leakproof sheets strong sheets. They are somewhat leakproof. tight junction Example: the cells of the lining of the stomach or any epithelial Example: actin is held lining where leaking together in muscle. of substances is not good. Slide 139 / 143 Slide 140 / 143
Communicating (Gap) Junctions 49 Which type of junction is found in plant cells?
A Gap junction Gap junctions B Plasmodesmata allow substances to flow from cell to C Tight junction cell. They are totally D Adhering junction leaky. They are the equivalent of plasmadesmata in plants.
Example: important in embryonic development. Nutrients like sugars, amino acids, ions, and other molecules pass through.
Slide 140 (Answer) / 143 Slide 141 / 143
49 Which type of junction is found in plant cells? 50 Which type of junction allows for the exchange of materials between animal cells? A Gap junction B Plasmodesmata A Gap junction C Tight junction B B Plasmodesmata
D Adhering junction Answer C Tight junction D Adhering junction
[This object is a pull tab]
Slide 141 (Answer) / 143 Slide 142 / 143
50 Which type of junction allows for the exchange of materials Plant vs. Animal Cell Organelles between animal cells?
A Gap junction B Plasmodesmata A
C Tight junction Answer Click here to review the similarities and difference D Adhering junction between plant and animal cells
[This object is a pull tab] Slide 143 / 143
Organelles in Animal and Plant Cells Only Only Both Plant Animal
mitochondria smooth cell wall plasma nucleus ribosomes membrane golgi ER apparatus central vacuole rough ER lysosomes chloroplasts