DOCSLIB.ORG

Inhibition of 17Β-HSD1: SAR of Bicyclic Substituted Hydroxyphenylmethanones and Discovery of Highly Potent Inhibitors Enabling a Proof of Principle Study in Rodents

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Inhibition of 17Β-HSD1: SAR of Bicyclic Substituted Hydroxyphenylmethanones and Discovery of Highly Potent Inhibitors Enabling a Proof of Principle Study in Rodents Inhibition of 17β-HSD1: SAR of Bicyclic Substituted Hydroxyphenylmethanones and Discovery of Highly Potent Inhibitors Enabling a Proof of Principle Study in Rodents Dissertation zur Erlangung des Grades des Doktors der Naturwissenschaften der Naturwissenschaftlich-Technischen Fakultät III Chemie, Pharmazie, Bio- und Werkstoffwissenschaften der Universität des Saarlandes von M.Sc. Ahmed Saad Abdelsamie Ahmed Saarbrücken 2013 Tag des Kolloquiums : 22.11.2013 Vorsitzende/r: Prof. Dr. Dr. h.c. Hans H. Maurer Berichterstatter/in: Prof. Dr. Rolf W. Hartmann Prof. Dr. Uli Kazmaier Akad. Mitarbeiter/in: Dr. Sonja Keßler I Diese Arbeit entstand unter der Anleitung von Prof. Dr. R.W. Hartmann in der Fachrichtung 8.2 Pharmazeutische und Medizinische Chemie der Naturwissenschaftlich- Technischen Fakultät III der Universität des Saarlandes von April 2010 bis October 2013. II Acknowledgment I would like to express my sincere gratitude to my supervisor Prof. Dr. Rolf W. Hartmann, for fruitful discussion and for giving me the opportunity to prepare my thesis as a member of his research group. His endless support and advice have been a great help during these years. I would like to thank my official referee Prof. Dr. Uli Kazmaier for the reviewing of this dissertation. I am deeply grateful to Dr. Martin Frotscher, my second supervisor, for fruitful discussions, writing of scientific papers and for his significant support during these years. I would like to thank all the ElexoPharm GmbH colleagues, especially Dr. Chris van Koppen, Dr. Emmanuel Bey, and Dr. Nina Hanke for their help and contribution in the development of the project. I am grateful to all my HSD co-workers, especially Dr. Enrico Perspicace and Marco Gargano, for fruitful collaboration. I also wish warmly thank to Martina Jankowski and Isabella Reichert for performing the in vitro tests, Dr. Stefan Boettcher for running the mass experiments, Dr. Joseph Zapp for the NMR measurements, Lothar Jager for his sympathy and his pleasant service. I wish to express my sincere thanks to all my colleagues in the Chemistry of Natural & Microbial Products Department, Pharmaceutical Industrial Division, the National Research Center (NRC) in Cairo, especially Prof. Dr. Hoda I. El Diwani and assistant prof. Dr. Shadia A. Galal for their support and advice. I will always be grateful for that. I also wish to thank my collegues Dr. Mohammad Abdel-Halim and Dr. Mostafa Hamed, and all the members of Prof. Dr. Hartmann for their help and support. Finally, I would like to thank my family, especially my parents. To them I dedicate this thesis. Ahmed Saad Abdelsamie Ahmed Saarbrücken, 08.10.2013 III Abbreviations 17β-HSD1 17β-hydroxysteroid dehydrogenase type 1 17β-HSD2 17β-hydroxysteroid dehydrogenase type 2 A androstenedione Å Ångström ACD advanced chemistry development ACTH adrenocorticotropic hormone ADD androgen-dependent diseases ADME absorption, distribution, metabolism, and excretion AI aromatase inhibitor AKR aldo-keto reductase Arg (A) arginine Asn (N) asparagine Asp (D) aspartic acid BSHs bicyclic substitutedbhydroxyphenylmethanones CC column chromatography CDCl3 deuterated chloroform CD3COCD3 deuterated aceton CD3OD deuterated methanol CD3SOCD3 deuterated dimethylsulfoxyde COX cyclooxygenase CYP cytochrome P450 superfamily DAST diethylaminosulfur trifluoride DBPO dibenzoyl peroxide DHEA dehydroepiandrosterone DHEA-S dehydroepiandrosterone-sulfate DHT 5α-dihydrotestosterone DME di-methoxyethane DMEM Dulbecco's modified eagle medium DMF dimethylformamide DMSO dimethyl sulphoxide DTT (2S,3S)-1,4-bis(sulfanyl)butane-2,3-diol E1 estrone E1-S estrone sulfate E2 17β-estradiol E3 estriol EDD estrogen-dependent disease EDSP endocrine disruptor screening program EDTA ethylene diaminetetraacetate IV EPA environmental protection agency ER estrogen receptor equiv equivalent Et3N triethylamine EWG electron withdrawing group GALAS global adjusted locally according to similarity Glu (E) glutamic acid Gly (G) glycine GnRH gonatropin releasing hormone H human HEK293 human embryonic kidney-293 His (H) histidine HPLC high-performance liquid chromatography HSD hydroxysteroid dehydrogenase Hz hertz IC50 half maximal inhibitory concentration IUPAC international union of pure and applied chemistry Leu (L) leucine LH luteinizing hormone LHRH luteinizing hormone releasing hormone Lys (K) lysine m mouse M molar µM micromolar Me methyl MHz megahertz MOE molecular operating environment mM millimolar mp melting point mRNA messenger ribonucleic acid MTT 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide MW molecular weight NADP(H) nicotinamide adenine dinucleotide phosphate NAD(H) nicotinamide adenine dinucleotide nBuLi n-butyllithium NBS N-bromosuccinimide nM nanomolar NMR nuclear magnetic resonance PAPS 3`-phosphoadenosine-5`-phosphosulfate PDB protein data bank Pd(dppf)Cl2 (1,1`-bis(diphenylphosphino)ferrocene)palladium(II) dichloride PDB protein data bank Pd(PPh3)4 tetrakis(triphenylphosphine)palladium (0) PG prostaglandine V PMSF phenylmethansulfonylflouride PoP proof of principle ppm parts per million r rat RBA relative binding affinity rt room temperature SAR structure activity relationship SDR short dehydrogenase reductase SDS sodium dodecyl sulphate Ser (S) serine SERM selective estrogen receptor modulator SF selectivity factor SUB substrate binding site T testosterone THF tetrahydrofurane TMSiCl trimethylsilyl chloride TSQ triple stage quadrupole Tris tris(hydroxymethyl)aminomethane Tyr (Y) tyrosine UDPGA uridine diphosphoglucuronic acid VI Abstract Estradiol is the most potent estrogen in humans. It is known to be involved in development and proliferation of estrogen dependent diseases such as breast cancer and endometriosis. The last step of its biosynthesis is catalyzed by 17β-hydroxysteroid dehydrogenase type 1 (17β- HSD1) which consequently is a promising target for the treatment of these diseases. Recently, we reported on bicyclic substituted hydroxyphenylmethanones (BSHs) as potent inhibitors of 17β- HSD1. Our goal in this study was to obtain a suitable candidate for proof of principle (PoP) study in an animal disease model for endometriosis. At a first stage, we focused on rational structural modifications in this compound class with the aim of gaining more insight into its structure-activity relationship (SAR). At a second stage, supplementary substituents were added to the most active core to enhance activity towards both human and rodent 17β-HSD1 enzymes. Thus, the most potent nonsteroidal inhibitors of h17β-HSD1 described so far have been discovered. Furthermore, a successful strategy was applied to improve the metabolic stability in human liver microsomes (S9 fraction). Compound II.43, one of the most interesting h17β-HSD1 inhibitors in this study, showed a very good metabolic stability towards both phase I and II in human liver microsomes (S9 fraction), with 72 % remaining after 60 min. In addition, inhibition of rodent 17β-HSD1 was significantly improved. Compound II.47 could be considered a possible candidate for a PoP study (63 % inhibition of rat 17β-HSD1 @ 250 nM). VII Zusammenfassung Estradiol ist das potenteste Estrogen beim Menschen. Es ist bekanntermaßen an Entstehung und Fortschreiten Estrogen-abhängiger Erkrankungen wie Brustkrebs und Endometriose beteiligt. Der letzte Schritt seiner Biosynthese wird durch 17β-Hydroxysteroid Dehydrogenase Typ 1 (17β-HSD1) katalysiert. Daher ist dieses Enzym ein vielversprechendes Target für die Behandlung dieser Erkrankungen. Kürzlich berichteten wir über bicyclisch substituierte Hydroxyphenylmethanone (BSHs), die potente Inhibitoren der 17β-HSD1 darstellen. Das Ziel der vorliegenden Studie bestand darin, einen Wirkstoff-Kandidaten zu erhalten, der für die Indikation Endometriose eine proof of principle- (PoP-)Studie in einem Krankheitsmodell am Tier (Nager) ermöglicht. Dazu wurden zunächst rationale Strukturmodifikationen durchgeführt, die das Ziel hatten, die Struktur-Wirkbeziehungen (SAR) dieser Wirkstoffklasse zu beleuchten. Aus den resultierenden Verbindungen wurde anschließend diejenige mit den interessantesten biologischen Eigenschaften ausgewählt, um durch Einfügen weiterer Substituenten die Hemmaktivität sowohl gegenüber der humanen als auch gegenüber Nager-17β-HSD1 weiter zu steigern. Aus diesen Arbeiten gingen die potentesten nichtsteroidalen Inhibitoren der humanen 17β-HSD1 hervor, die bisher beschrieben wurden. Darüber hinaus wurde erfolgreich eine Strategie zur Verbesserung der metabolischen Stabilität in humanen Lebermikrosomen (S9- Fraktion) angewandt. Verbindung II.43, eine der interessantesten Verbindungen der Studie, zeigt eine sehr hohe metabolische Stabilität: Nach 60 minütiger Inkubation liegen 72 % der Verbindung unverändert vor. Auch die Hemmung des Nager-Enzyms konnte signifikant verbessert werden. Verbindung II.47 kann als möglicher Kandidat für eine PoP-Studie an der Ratte angesehen werden (63 % Hemmung der Ratten-17β-HSD1 bei 250 nM). VIII Table of Content 1. Introduction 1 1.1 Sex steroid hormones 1 1.1.1 General 1 1.1.2 Estrogens 3 1.2 Estrogen-dependent diseases 4 1.2.1 Breast cancer 4 1.2.1.1 General 4 1.2.1.2 Treatment options 5 1.2.2 Endometriosis 6 1.2.2.1 General 6 1.2.2.2 Treatment options 8 1.2.3 Disadvantages of existing therapies 9 1.3 Hydroxysteroid dehydrogenases (HSDs) 9 1.3.1 General 9 1.3.2 17β-HSDs 10 1.3.2.1 General 10 1.3.2.2 Cell metabolism and unidirectional steroid flux in living cells 13 1.3.3 17β-HSD1 15 1.3.3.1 17β-HSD1 as a promising drug target 15 1.3.3.2 Structural design 16 IX 1.3.3.3
Load more

Recommended publications
  • PARSANA-DISSERTATION-2020.Pdf
    DECIPHERING TRANSCRIPTIONAL PATTERNS OF GENE REGULATION: A COMPUTATIONAL APPROACH by Princy Parsana A dissertation submitted to The Johns Hopkins University in conformity with the requirements for the degree of Doctor of Philosophy Baltimore, Maryland July, 2020 © 2020 Princy Parsana All rights reserved Abstract With rapid advancements in sequencing technology, we now have the ability to sequence the entire human genome, and to quantify expression of tens of thousands of genes from hundreds of individuals. This provides an extraordinary opportunity to learn phenotype relevant genomic patterns that can improve our understanding of molecular and cellular processes underlying a trait. The high dimensional nature of genomic data presents a range of computational and statistical challenges. This dissertation presents a compilation of projects that were driven by the motivation to efficiently capture gene regulatory patterns in the human transcriptome, while addressing statistical and computational challenges that accompany this data. We attempt to address two major difficulties in this domain: a) artifacts and noise in transcriptomic data, andb) limited statistical power. First, we present our work on investigating the effect of artifactual variation in gene expression data and its impact on trans-eQTL discovery. Here we performed an in-depth analysis of diverse pre-recorded covariates and latent confounders to understand their contribution to heterogeneity in gene expression measurements. Next, we discovered 673 trans-eQTLs across 16 human tissues using v6 data from the Genotype Tissue Expression (GTEx) project. Finally, we characterized two trait-associated trans-eQTLs; one in Skeletal Muscle and another in Thyroid. Second, we present a principal component based residualization method to correct gene expression measurements prior to reconstruction of co-expression networks.
    [Show full text]
  • Association Between CYP17A1, CYP19A1, and HSD17B1 Gene Polymorphisms in Hormone Synthesis Pathway with Ovarian Cancer Risk
    Association between CYP17A1, CYP19A1, and HSD17B1 Gene Polymorphisms in Hormone Synthesis pathway with Ovarian Cancer Risk Gowtham Kumar G1, Andrea Francis1, Solomon Paul1, Chirag Molia1, Manickavasagam M1, Usha Rani1, Ramya R1, and Nalini Ganesan1 1Sri Ramachandra Institute of Higher Education and Research August 27, 2020 Abstract Objective: To investigate the polymorphisms of genes in the steroidogenesis pathway to understand the etiological mechanisms to OC risk in the South Indian population Design: Case-Control Study Setting and Sample: Ovarian cancer cases (200) and healthy individuals (200) from the South Indian population. Methods: All the cases and controls were genotyped for SNPs by using allelic discrimination assay. Main outcome measures: Genetic distribution of SNPs of Steroidogenesis pathway genes in the South Indian population. Results: The observed results for rs743752, the homozygous CC genotype revealed significant association (OR; 1.68; 95%CI, 1.25-2.26; p =<0.05) and the dominant model, recessive model and additive model showed a significant association with an OR of 1.62; 95%CI, 1.09 { 2.42; p = 0.015, OR of 0.29, 95%CI, 0.14 { 0.60; p = <0.001 and OR of 1.68, 95%CI, 1.25 { 2.26); p = <0.001 respectively in cases and controls for OC risk. In rs10046, the heterozygous CT genotype (OR; 1.61; 95%CI 1.06 { 2.43; p = 0.023), the dominant (OR; 1.65; 95%CI, 1.11 { 2.45; p = 0.012) and the additive (OR; 1.46; 95%CI, 1.07 - 1.98; p = 0.015) models were found to be statistically significant.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Hsd17b1) Inhibitor for Endometriosis
    DEVELOPMENT OF HYDROXYSTEROID (17-BETA) DEHYDROGENASE TYPE 1 (HSD17B1) INHIBITOR FOR ENDOMETRIOSIS Niina Saarinen1,2, Tero Linnanen1, Jasmin Tiala1, Camilla Stjernschantz1, Leena Hirvelä1, Taija Heinosalo2, Bert Delvoux3, Andrea Romano3, Gabriele Möller4, Jerzy Adamski4, Matti Poutanen2, Pasi Koskimies1 1Forendo Pharma Ltd, Finland; 2Institute of Biomedicine, Research Centre for Integrative Physiology and Pharmacology, University of Turku, Finland; 3Department of Obstetrics and Gynaecology; GROW, School for Oncology and Developmental Biology; Maastricht University Medical Centre, The Netherlands; 4Institute of Experimental Genetics, Genome Analysis Center, Helmholtz Zentrum München, Germany BACKGROUND OBJECTIVE Local activation of estrogens in endometriosis tissue The main objective of the present work was to assess is considered important for growth of the lesions. the preclinical efficacy of the novel HSD17B1 inhibitor, Hydroxysteroid (17-beta) dehydrogenase type 1 FOR-6219 (HSD17B1) is expressed in endometriosis tissue and converts the biologically low-active estrogen, estrone (E1), to the highly active estradiol (E2), while hydroxysteroid (17-beta) dehydrogenase type 2 (HSD17B2), catalyzes the opposite reaction. In contrast to eutopic endometrium, in endometriotic lesions the HSD17B1/HSD17B2 expression ratio is increased and E2 levels are higher than those of E1 throughout the menstrual cycle. Thus, inhibition of HSD17B1 is considered as a feasible strategy for lowering local E2 production in endometriosis. MAIN RESULTS FOR-6219 inhibits human HSD17B1 Ø FOR-6219 is a potent and FOR-6219 does not trigger estrogenic fully selective inhibitor of response in immature rat uterine human HSD17B1 over growth assay HSD17B2 Ø FOR-6219 does not bind to estrogen receptor α or β, and exhibits no estrogen-like response in immature rat uterotrophic assay Ø FOR-6219 inhibits HSD17B1 in cynomolgus monkey, dog and rabbit i.e.
    [Show full text]
  • Alternative Haplotypes of Antigen Processing Genes in Zebrafish Diverged Early in Vertebrate Evolution
    Alternative haplotypes of antigen processing genes in PNAS PLUS zebrafish diverged early in vertebrate evolution Sean C. McConnella,1, Kyle M. Hernandezb, Dustin J. Wciselc,d, Ross N. Kettleboroughe, Derek L. Stemplee, Jeffrey A. Yoderc,d,f, Jorge Andradeb, and Jill L. O. de Jonga,1 aSection of Hematology-Oncology and Stem Cell Transplant, Department of Pediatrics, The University of Chicago, Chicago, IL 60637; bCenter for Research Informatics, The University of Chicago, Chicago, IL 60637; cDepartment of Molecular Biomedical Sciences, College of Veterinary Medicine, North Carolina State University, Raleigh, NC 27607; dGenomic Sciences Graduate Program, North Carolina State University, Raleigh, NC 27607; eVertebrate Development and Genetics, Wellcome Trust Sanger Institute, Cambridge CB10 1SA, United Kingdom; and fComparative Medicine Institute, North Carolina State University, Raleigh, NC 27607 Edited by Peter Parham, Stanford University School of Medicine, Stanford, CA, and accepted by Editorial Board Member Peter Cresswell June 23, 2016 (received for review May 16, 2016) Antigen processing and presentation genes found within the Recent genomic studies have offered considerable insights into MHC are among the most highly polymorphic genes of vertebrate the evolution of the vertebrate adaptive immune system by com- genomes, providing populations with diverse immune responses to a paring phylogenetically divergent species (11–14). Throughout wide array of pathogens. Here, we describe transcriptome, exome, vertebrates, gene linkage within the MHC region is highly con- and whole-genome sequencing of clonal zebrafish, uncovering the served. For example, MHCI and antigen processing genes remain most extensive diversity within the antigen processing and presen- tightly linked in sharks, members of the oldest vertebrate lineage tation genes of any species yet examined.
    [Show full text]
  • Chuanxiong Rhizoma Compound on HIF-VEGF Pathway and Cerebral Ischemia-Reperfusion Injury’S Biological Network Based on Systematic Pharmacology
    ORIGINAL RESEARCH published: 25 June 2021 doi: 10.3389/fphar.2021.601846 Exploring the Regulatory Mechanism of Hedysarum Multijugum Maxim.-Chuanxiong Rhizoma Compound on HIF-VEGF Pathway and Cerebral Ischemia-Reperfusion Injury’s Biological Network Based on Systematic Pharmacology Kailin Yang 1†, Liuting Zeng 1†, Anqi Ge 2†, Yi Chen 1†, Shanshan Wang 1†, Xiaofei Zhu 1,3† and Jinwen Ge 1,4* Edited by: 1 Takashi Sato, Key Laboratory of Hunan Province for Integrated Traditional Chinese and Western Medicine on Prevention and Treatment of 2 Tokyo University of Pharmacy and Life Cardio-Cerebral Diseases, Hunan University of Chinese Medicine, Changsha, China, Galactophore Department, The First 3 Sciences, Japan Hospital of Hunan University of Chinese Medicine, Changsha, China, School of Graduate, Central South University, Changsha, China, 4Shaoyang University, Shaoyang, China Reviewed by: Hui Zhao, Capital Medical University, China Background: Clinical research found that Hedysarum Multijugum Maxim.-Chuanxiong Maria Luisa Del Moral, fi University of Jaén, Spain Rhizoma Compound (HCC) has de nite curative effect on cerebral ischemic diseases, *Correspondence: such as ischemic stroke and cerebral ischemia-reperfusion injury (CIR). However, its Jinwen Ge mechanism for treating cerebral ischemia is still not fully explained. [email protected] †These authors share first authorship Methods: The traditional Chinese medicine related database were utilized to obtain the components of HCC. The Pharmmapper were used to predict HCC’s potential targets. Specialty section: The CIR genes were obtained from Genecards and OMIM and the protein-protein This article was submitted to interaction (PPI) data of HCC’s targets and IS genes were obtained from String Ethnopharmacology, a section of the journal database.
    [Show full text]
  • HSD17B8 (NM 014234) Human Tagged ORF Clone – RG203806
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RG203806 HSD17B8 (NM_014234) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: HSD17B8 (NM_014234) Human Tagged ORF Clone Tag: TurboGFP Symbol: HSD17B8 Synonyms: D6S2245E; dJ1033B10.9; FABG; FABGL; H2-KE6; HKE6; KE6; RING2; SDR30C1 Vector: pCMV6-AC-GFP (PS100010) E. coli Selection: Ampicillin (100 ug/mL) Cell Selection: Neomycin ORF Nucleotide >RG203806 representing NM_014234 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCGTCTCAGCTCCAGAACCGACTCCGCTCCGCACTGGCCTTGGTCACAGGTGCGGGGAGCGGCATCG GCCGAGCGGTCAGTGTACGCCTGGCCGGAGAGGGGGCCACCGTAGCTGCCTGCGACCTGGACCGGGCAGC GGCACAGGAGACGGTGCGGCTGCTGGGCGGGCCAGGGAGCAAGGAGGGGCCGCCCCGAGGGAACCATGCT GCCTTCCAGGCTGACGTGTCTGAGGCCAGGGCCGCCAGGTGCCTGCTGGAACAAGTGCAGGCCTGCTTTT CTCGCCCACCATCTGTCGTTGTGTCCTGTGCGGGCATCACCCAGGATGAGTTTCTGCTGCACATGTCTGA GGATGACTGGGACAAAGTCATAGCTGTCAACCTCAAGGGCACCTTCCTAGTCACTCAGGCTGCAGCACAA GCCCTGGTGTCCAATGGTTGTCGTGGTTCCATCATCAACATCAGTAGCATCGTAGGAAAGGTGGGGAACG TGGGGCAGACAAACTATGCAGCATCCAAGGCTGGAGTGATTGGGCTGACCCAGACCGCAGCCCGGGAGCT TGGACGACATGGGATCCGCTGTAACTCTGTCCTCCCAGGGTTCATTGCAACACCCATGACACAGAAAGTG CCACAGAAAGTGGTGGACAAGATTACTGAAATGATCCCGATGGGACACTTGGGGGACCCTGAGGATGTGG CAGATGTGGTCGCATTCTTGGCATCTGAAGATAGTGGATACATCACAGGGACCTCAGTGGAAGTCACTGG AGGTCTTTTCATG ACGCGTACGCGGCCGCTCGAG
    [Show full text]
  • Epigenetic Reprogramming Underlies Efficacy of DNA Demethylation
    www.nature.com/scientificreports OPEN Epigenetic reprogramming underlies efcacy of DNA demethylation therapy in osteosarcomas Naofumi Asano 1,2, Hideyuki Takeshima3, Satoshi Yamashita3, Hironori Takamatsu2,3, Naoko Hattori3, Takashi Kubo4, Akihiko Yoshida5, Eisuke Kobayashi6, Robert Nakayama2, Morio Matsumoto2, Masaya Nakamura2, Hitoshi Ichikawa 4, Akira Kawai6, Tadashi Kondo1 & Toshikazu Ushijima 3* Osteosarcoma (OS) patients with metastasis or recurrent tumors still sufer from poor prognosis. Studies have indicated the efcacy of DNA demethylation therapy for OS, but the underlying mechanism is still unclear. Here, we aimed to clarify the mechanism of how epigenetic therapy has therapeutic efcacy in OS. Treatment of four OS cell lines with a DNA demethylating agent, 5-aza-2′- deoxycytidine (5-aza-dC) treatment, markedly suppressed their growth, and in vivo efcacy was further confrmed using two OS xenografts. Genome-wide DNA methylation analysis showed that 10 of 28 primary OS had large numbers of methylated CpG islands while the remaining 18 OS did not, clustering together with normal tissue samples and Ewing sarcoma samples. Among the genes aberrantly methylated in primary OS, genes involved in skeletal system morphogenesis were present. Searching for methylation-silenced genes by expression microarray screening of two OS cell lines after 5-aza-dC treatment revealed that multiple tumor-suppressor and osteo/chondrogenesis-related genes were re-activated by 5-aza-dC treatment of OS cells. Simultaneous activation of multiple genes related to osteogenesis and cell proliferation, namely epigenetic reprogramming, was considered to underlie the efcacy of DNA demethylation therapy in OS. Osteosarcoma (OS) is the most common malignant tumor of the bone in children and adolescents1.
    [Show full text]
  • Dottorato Di Ricerca the Effect of Finasteride
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by UniCA Eprints Università degli Studi di Cagliari DOTTORATO DI RICERCA Scuola di Dottorato in Neuroscienze e Scienze Morfologiche Corso di Dottorato in Neuroscienze Ciclo XXIII THE EFFECT OF FINASTERIDE IN TOURETTE SYNDROME: RESULTS OF A CLINICAL TRIAL Settore scientifico disciplinari di afferenza BIO/14 Presentata da: Silvia Paba Coordinatore Dottorato Prof.ssa Alessandra Concas Tutor Dott.ssa Paola Devoto Esame finale anno accademico 2009 - 2010 1. INTRODUCTION 1 1.1 General characteristics of steroid 5α-reductase 2 1.2 S5αR inhibitors 15 1.3 S5αR inhibitors as putative therapeutic agents for some neuropsychiatric disorders. 23 2. AIMS OF THE STUDY 37 3. METHODS 38 3.1 Subjects 38 3.2 Procedures 39 3.3 Data analysis 40 4. RESULTS 41 4.1 Description of sample 41 4.2 Dosing, range and compliance 41 4.3 Effects of finasteride on TS and tic severity 44 4.4 Effects of finasteride on obsessive compulsive symptoms 46 4.5 Adverse effects 47 5. DISCUSSION 48 6. CONCLUSION 52 REFERENCES 54 1. INTRODUCTION The enzyme steroid 5α reductase (S5αR) catalyzes the conversion of Δ4-3-ketosteroid precursors - such as testosterone, progesterone and androstenedione - into their 5α- reduced metabolites. Although the current nomenclature assigns five enzymes to the S5αR family, only the types 1 and 2 appear to play an important role in steroidogenesis, mediating an overlapping set of reactions, albeit with distinct chemical characteristics and anatomical distribution. The discovery that the 5α-reduced metabolite of testosterone, 5α-dihydrotestosterone (DHT), is the most potent androgen and stimulates prostatic growth led to the development of S5αR inhibitors with high efficacy and tolerability.
    [Show full text]
  • In This Table Protein Name, Uniprot Code, Gene Name P-Value
    Supplementary Table S1: In this table protein name, uniprot code, gene name p-value and Fold change (FC) for each comparison are shown, for 299 of the 301 significantly regulated proteins found in both comparisons (p-value<0.01, fold change (FC) >+/-0.37) ALS versus control and FTLD-U versus control. Two uncharacterized proteins have been excluded from this list Protein name Uniprot Gene name p value FC FTLD-U p value FC ALS FTLD-U ALS Cytochrome b-c1 complex P14927 UQCRB 1.534E-03 -1.591E+00 6.005E-04 -1.639E+00 subunit 7 NADH dehydrogenase O95182 NDUFA7 4.127E-04 -9.471E-01 3.467E-05 -1.643E+00 [ubiquinone] 1 alpha subcomplex subunit 7 NADH dehydrogenase O43678 NDUFA2 3.230E-04 -9.145E-01 2.113E-04 -1.450E+00 [ubiquinone] 1 alpha subcomplex subunit 2 NADH dehydrogenase O43920 NDUFS5 1.769E-04 -8.829E-01 3.235E-05 -1.007E+00 [ubiquinone] iron-sulfur protein 5 ARF GTPase-activating A0A0C4DGN6 GIT1 1.306E-03 -8.810E-01 1.115E-03 -7.228E-01 protein GIT1 Methylglutaconyl-CoA Q13825 AUH 6.097E-04 -7.666E-01 5.619E-06 -1.178E+00 hydratase, mitochondrial ADP/ATP translocase 1 P12235 SLC25A4 6.068E-03 -6.095E-01 3.595E-04 -1.011E+00 MIC J3QTA6 CHCHD6 1.090E-04 -5.913E-01 2.124E-03 -5.948E-01 MIC J3QTA6 CHCHD6 1.090E-04 -5.913E-01 2.124E-03 -5.948E-01 Protein kinase C and casein Q9BY11 PACSIN1 3.837E-03 -5.863E-01 3.680E-06 -1.824E+00 kinase substrate in neurons protein 1 Tubulin polymerization- O94811 TPPP 6.466E-03 -5.755E-01 6.943E-06 -1.169E+00 promoting protein MIC C9JRZ6 CHCHD3 2.912E-02 -6.187E-01 2.195E-03 -9.781E-01 Mitochondrial 2-
    [Show full text]
  • Differential Expression and Co-Expression Gene Networks Reveal Candidate Biomarkers of Boar Taint in Non-Castrated Pigs
    Downloaded from orbit.dtu.dk on: Oct 06, 2021 Differential expression and co-expression gene networks reveal candidate biomarkers of boar taint in non-castrated pigs Drag, Markus; Skinkyté-Juskiené, Ruta; Do, Duy N.; Kogelman, Lisette J. A.; Kadarmideen, Haja N. Published in: Scientific Reports Link to article, DOI: 10.1038/s41598-017-11928-0 Publication date: 2017 Document Version Publisher's PDF, also known as Version of record Link back to DTU Orbit Citation (APA): Drag, M., Skinkyté-Juskiené, R., Do, D. N., Kogelman, L. J. A., & Kadarmideen, H. N. (2017). Differential expression and co-expression gene networks reveal candidate biomarkers of boar taint in non-castrated pigs. Scientific Reports, 7(1), [12205]. https://doi.org/10.1038/s41598-017-11928-0 General rights Copyright and moral rights for the publications made accessible in the public portal are retained by the authors and/or other copyright owners and it is a condition of accessing publications that users recognise and abide by the legal requirements associated with these rights. Users may download and print one copy of any publication from the public portal for the purpose of private study or research. You may not further distribute the material or use it for any profit-making activity or commercial gain You may freely distribute the URL identifying the publication in the public portal If you believe that this document breaches copyright please contact us providing details, and we will remove access to the work immediately and investigate your claim. www.nature.com/scientificreports OPEN Differential expression and co- expression gene networks reveal candidate biomarkers of boar taint Received: 8 November 2016 Accepted: 1 September 2017 in non-castrated pigs Published: xx xx xxxx Markus Drag 1,4, Ruta Skinkyté-Juskiené 1, Duy N.
    [Show full text]
  • A Challenge for Medicinal Chemistry by the 17Β-Hydroxysteroid Dehydro
    Send Orders of Reprints at [email protected] 1164 Current Topics in Medicinal Chemistry, 2013, 13, 1164-1171 A Challenge for Medicinal Chemistry by the 17-hydroxysteroid Dehydro- genase Superfamily: An Integrated Biological Function and Inhibition Study S.-X. Lina,b, D. Poiriera and J. Adamskic,d.e aLaboratory of Molecular Endocrinology and Oncology, Centre Hospitalier Universitaire (CHU) de Quebec Research Center (CHUL) and Laval University, Québec City, Québec, G1V4G2, Canada; bWHO Collaborating Center for Re- search in Human Reproductive Health, Shanghai, 200031, China; cHelmholtz Zentrum München, Institute of Experi- mental Genetics, Genome Analysis Center, 85764 Neuherberg, Germany; dLehrstuhl für Experimentelle Genetik, Tech- nische Universität München, 85350 Freising-Weihenstephan, Germany; eGerman Center for Diabetes Research (DZD), 85764 Neuherberg, Germany Abstract: Members of the 17-hydroxysteroid dehydrogenase (17-HSD) superfamily perform distinct multiple catalyses by the same enzyme, apparently contradictory to the long-held beliefs regarding the high specificity of enzymes. Surpris- ingly, these multi-catalyses can combine synergistically in vitro and in vivo and their dysfunction may result in the stimu- lation of breast or prostate cancer. 17-HSD1 possesses high estrogen activation activity, while its androgen inactivation is significant for decreasing the week concentration of dihydrotestosterone (DHT) in breast cancer cells, an important fac- tor for cell proliferation. 17-HSD5 can also carry out multiple catalyses in hormone-dependent cancer cells. In addition to 17-HSDs 1 and 5 some other family members possess such dual-activity as well, and their inhibition decreases hor- mone-dependent cancer proliferation. The multi-specificity of 17-HSD1 is structurally based on the pseudo-symmetric androgens that can accommodate the narrow enzyme substrate tunnel by both normal and alternative binding.
    [Show full text]