CCL9 Induced by Tgfb Signaling in Myeloid Cells Enhances Tumor Cell Survival in the Premetastatic Organ Hangyi H

Published OnlineFirst October 19, 2015; DOI: 10.1158/0008-5472.CAN-15-2282-T

Cancer Microenvironment and Immunology Research

CCL9 Induced by TGFb Signaling in Myeloid Cells Enhances Tumor Cell Survival in the Premetastatic Organ Hangyi H. Yan1, Jian Jiang1,2, Yanli Pang3, B.R. Achyut1, Michael Lizardo4, Xinhua Liang2, Kent Hunter1, Chand Khanna4, Christine Hollander1, and Li Yang1

Abstract

Tumor cell survival in the hostile distant organ is a rate- cells lacking TGFb signaling rescued the tumor metastasis limiting step in cancer metastasis. Bone marrow–derived mye- defect observed in mice with myeloid-speciﬁc Tgfbr2 deletion. loid cells can form a premetastatic niche and provide a tumor- The expression level of CCL23, the human orthologue for promoting microenvironment. However, it is unclear whether CCL9, in peripheral blood mononuclear cells correlated with these myeloid cells in the premetastatic site have any direct progression and survival of cancer patients. Our study demon- effect on tumor cell survival. Here, we report that chemokine strates that CCL9 could serve as a good candidate for anti- þ þ CCL9 was highly induced in Gr-1 CD11b immature myeloid metastasis treatment by targeting the rate-limiting step of cells and in premetastatic lung in tumor-bearing mice. Knock- cancer cell survival. In addition, targeting CCL9 may avoid down of CCL9 in myeloid cells decreased tumor cell survival the adverse effects of TGFb-targeted therapy. Cancer Res; 75(24); and metastasis. Importantly, CCL9 overexpression in myeloid 5283–98. 2015 AACR.

þ þ þ cells that consist of Ly6G CD11b granulocytes, Ly6C Introduction þ þ þ CD11b monocytes and F4/80 CD11b macrophages (9). Tumor cell survival is a rate-limiting step in cancer metastasis þ þ Gr-1 CD11b cells are overproduced in cancer patients, neg- (1). The majority of the cancer cells die in the peripheral blood atively regulate host antitumor immunity (10–12), and pro- and distant hostile organs during the multiple-step processes, mote tumor angiogenesis (13). These immature myeloid cells including invasion, intravasation, extravasation, and coloniza- are also found in premetastatic organ of tumor-bearing mice to tion (1). Recent evidence strongly suggests a critical role of host modulate host inflammatory/immune microenvironment cells and tumor microenvironment in supporting tumor cell (7, 14), including NK (natural killer) cell activities (15, 16) survival and metastasis. One mechanism is through formation and promoting mesenchymal-to-epithelial transition of tumor of premetastatic niche (2, 3). Myeloid cells play a critical role in cells (17). However, it is not known whether these myeloid this process (2, 4). These include VEGFR1 myeloid progenitor þ þ þ cells can directly support tumor cell survival in the premeta- cells (5), Mac-1 myeloid cells (6), and Gr-1 CD11b mye- þ static organs. loid–derived suppressor cells (MDSC; ref. 7) as well as Ly6G þ þ þ One important molecular mechanism underlying metastasis- Ly6C granulocytes (8). Gr-1 CD11b immature myeloid cells promoting function of myeloid cells is myeloid-specific TGFb constitute the majority of the immature myeloid cells under signaling (18). TGFb is a pleiotropic molecule and it possesses tumor conditions. They are heterogeneous immature myeloid both tumor-suppressor and tumor-promoter functions (19, 20). The mechanisms underlying the dual role of TGFb are very intricate and are poorly understood. Recent work reveals that 1Laboratory of Cancer Biology and Genetics, National Cancer Institute, NIH, Bethesda, Maryland. 2State Key Laboratory of Oral Diseases,West TGFb regulates production of chemokine/chemokine receptors in China College of Stomatology, Sichuan University, Chengdu, Sichuan, tumor cells that are important for inflammatory cell recruitment 3 P.R. China. Department of Physiology & Pathophysiology, Peking in the tumor microenvironment (21–23). This includes stromal- University Health Science Center, Beijing, P.R. China. 4Pediatric Oncol- ogy Branch, National Cancer Institute, NIH, Bethesda, Maryland. derived factor 1 (SDF-1 or CXCL12; ref. 24) and CCL9 (25). CXCL12 mediates its effects through CXCR4, a receptor that is Note: Supplementary data for this article are available at Cancer Research highly expressed on putative stem and progenitor cells (26, 27). Online (http://cancerres.aacrjournals.org/). þ CCL9 signals through CCR1 and recruits myeloid progenitor Current address for Y. Pang: Center for Reproductive Medicine, Department of cells for tumor cell invasion (25). In addition, TGFb suppresses Obstetrics and Gynecology, Peking University Third Hospital, Beijing 100191, P.R. China. CXCL1 and CXCL5, and deletion of TGFb signaling in cancer cells significantly increases the expression of both chemokines J. Jiang and Y. Pang share co-second authorship for this article. (21). These chemokines are responsible for the recruitment of þ þ Corresponding Author: Li Yang, National Cancer institute, 37 Convent Drive, Gr-1 CD11b myeloid cells to the tumor microenvironment Bethesda, MD 20892. Phone: 301-496-5260; Fax: 301-402-1031; E-mail: (21), where they produce large quantities of matrix metallopro- [email protected] teases (21). A chemokine signature generated due to a loss of doi: 10.1158/0008-5472.CAN-15-2282-T TGFb signaling correlates with poor prognosis of human breast 2015 American Association for Cancer Research. cancer (22).

www.aacrjournals.org 5283

Yan et al.

CCL9, a chemokine also known as macrophage inflammatory Single-cell videomicroscopy for evaluating tumor cell survival protein-1 gamma (MIP-1g; refs. 25, 28–30), is often produced in Mice were euthanized and lungs were removed 6 hours after tail macrophages, osteoclasts, and functions as a cell survival factor vein injection of GFP-labeled tumor cells (5 105) together with þ þ (31, 32). CCL9/CCR1 signaling has been shown to be important Gr-1 CD11b (1.5 106) or RAW264.7 cells (2 105). Images for the recruitment of myeloid progenitors to intestinal tumors, were normalized to the basal signal obtained from lungs 1 hour leading to enhanced invasion (25, 30). However, it remains to be after tail vein injection. Lungs were observed under the fluorescent determined whether CCL9 promotes cancer cell survival, and microscope, 10 random pictures under 10 magnification were whether TGFb regulates CCL9 production. Here, we report that taken and further analyzed as fluorescence signal per field by CCL9 is highly induced in immature myeloid cells in the pre- OpenLab software (Improvision) or ImageJ. For extravasation metastatic lung of tumor-bearing mice or in coculture with tumor experiment, mice were injected with 100 mL of 12.5 mg/mL 70,000 cells, and it plays a critical role in tumor cell survival at the MW tetramethylrhodamine (Invitrogen). Lungs were imaged metastatic site. We further identify CCL9 as a critical mediator under Zeiss 510 NLO confocal microscope. Images were analyzed of the metastasis-promoting effects of myeloid-specific TGFb with Zeiss ZEN software. signaling. Our study provides insight for understanding TGFb cancer biology and suggests a new target for cancer treatment. Ex vivo pulmonary metastasis assay GFP-labeled tumor cells (5 105) were coinjected with sorted þ þ Materials and Methods Gr-1 CD11b cells (1.5 106) or RAW264.7 cells (2 105) Cells and mice through the tail vein. Mice were euthanized 5 minutes after Murine mammary tumor cell lines 67NR, 168FARN, 4T07, 4T1, injection, and the lungs were infused with an agarose medium 67NR-GFP, 4T1-GFP, 4T1-luciferase and melanoma B16F1, mixture as described previously (35). Lung sections (1–2-mm- B16BL6, B16F10, murine macrophage cell line RAW264.7 and thick) were placed on Gelfoam (Pfizer-Pharmacia & Upjohn Co.) neutrophil cell line 32DCl3, as well as human breast tumor cell for culture for 1 to 2 weeks. LEICA-DM IRB fluorescent inverted line MDA-MB-231 and human melanoma cell lines A375S2, SK- microscope (Leica) and Retiga-EXi Fast 1394 Mono Cooled CCD MEL-28 were maintained per standard cell culture techniques. camera (QImaging) were used to capture GFP-positive cells at Cells labeled with GFP were obtained through pSico-GFP virus 10 or 2.5 magnification. The GFP fluorescence pixels were þ infection as published (33) and followed by GFP cell sorting. obtained and analyzed using OpenLab software (Improvision) or B16F1 and B16F10 were provided by Drs. Glenn Merlino and ImageJ (35). The fluorescence intensity per field was quantified þ þ Shioko Kimura, NCI. All Gr-1 CD11b cells were sorted through and normalized to day 0 signal and presented as metastasis FACS or MACS (magnetic-activated cell sorting) from spleens of survival index. Three to six lung sections for each mouse, and a tumor-bearing wild-type, Tgfbr2MyeKO and Tgfbr2Flox mice unless total of 3 to 4 mice were evaluated for each experimental group. otherwise specified. Tgfbr2MyeKO and Tgfbr2Flox control mice were produced as previously described (18). p38 dominant–negative Flow cytometry and cell sorting mice are precious gifts from Dr. Albert J. Fornace, Jr. (Georgetown Single cell suspensions were made from spleens or peripheral University). All animal studies are approved by the National blood of normal and 4T1 tumor-bearing mice (13), as well as lung Cancer Institute Animal Care and Use Committee. tissues (36). Cells were labeled with fluorescence-conjugated antibodies: Gr-1, CD11b, Ly6G, Ly6C, F4/80, Annexin V, 7AAD Spontaneous and experimental metastasis (BD Pharmingen), and CCR1 (R&D Systems). For flow-cytometry For orthotopic metastasis, mammary tumor 4T1 cells (5 105) analysis, cells were run on a FACS Calibur or Fortessa flow were injected into the #2 mammary fat pad (MFP); B16F10 cytometer (BD Biosciences) and analyzed on FlowJo. For sorting, þ þ þ þ þ þ melanoma cells (1 106) were injected s.c. For experimental Gr-1 CD11b cells, CD11b Ly6G cells, CD11b Ly6C cells, þ þ metastasis, 67NR-control/67NR-CCR1 cells (5 or 10 105), 4T1 and CD11b F4/80 cells were sorted from spleens of 4T1 tumor- cells (5 105), B16F1-vec control/B16F1-CCR1 cells (10 105) bearing mice by FACSAria flow cytometer (BD Biosciences) or were injected into the tail vein (TVI) of the recipient mice. For co- MACS according to the manufacturer's protocol (Miltenyi Biotec). þ injection experiment, the tumor cells were injected with Gr- For sorting human CD33 myeloid cells, normal human whole þ þ 1 CD11b (1.5 106) or RAW264.7 cells (2 105). Tumor blood was obtained from NIH blood bank in clinical center. size was measured twice a week using calipers and the tumor Myeloid cells were enriched by Ficoll-Paque (GE Healthcare), volume was calculated as Volume ¼ Length (Width)2. The then labeled with CD33 antibody and sorted with MACS (Milte- number of lung metastasis was evaluated using whole lung nyi Biotec). mounting procedure as described (34) or by hemtoxylin and fl fl eosin (H&E) staining of butter y sections of lungs. One butter y Immunofluorescence staining and TUNEL assay section for each mouse was obtained, and a total of at least 5 mice Paraffin-embedded lung sections or chamber slides with tumor were evaluated for each experimental group. cell culture were incubated with primary antibodies for GFP (Santa Cruz Biotechnology) or PAR (BD Pharmingen). Alexa flour In vivo bioluminascence imaging 488 or 594 secondary antibodies were used for detection (Invi- Mice were received an i.p. injection of D-luciferin (Caliper Life trogen). For TUNEL (Roche Applied Science) assay, lungs were Sciences, 100 mL of 10 mg/mL) 15 minutes before image. Lumi- taken out 6 hours after tail vein coinjection of GFP-labeled tumor þ þ nescent signals were detected using an IVIS-SPECTRUM in vivo cells (5 105) with Gr-1 CD11b (1.5 106) or RAW264.7 cells photon-counting device (Caliper Life Sciences). Images were (2 105). The lungs were fixed and paraffin-embedded sections quantified as photon counts/second using the Living Image were obtained. TUNEL was performed according to manufactory software (Caliper Life Sciences). protocol. The slides were then mounted with Prolong Gold

5284 Cancer Res; 75(24) December 15, 2015 Cancer Research

Myeloid CCL9 and Tumor Cell Survival in Premetastatic Organ

antifade reagent with DAPI (Invitrogen) and examined using Western blotting þ þ fluorescence microscopy. Protein extractions from tumor cells or Gr-1 CD11b cells Coculture of immature myeloid cells with tumor cells or in were analyzed. For the TGFb signaling pathway in regulating tumor-conditioned media, and collection of conditioned media CCL9 production, the sorted myeloid cells were directly subjected for mice injection, for myeloid tumor coculture, 5 105 tumor to protein extraction (basal state) or starved under 1% FBS for 5 cells were cocultured with 1 106 RAW264.7 or 32DCl3 cell lines, hours and treated with TGFb1 (5 ng/mL, for 1 hour). Primary þ þ þ þ Gr-1 CD11b myeloid cells, Ly6G CD11b neutrophiles, antibodies include TbRII, P-p38, p38, P-smad2, smad2, PARP, þ þ þ þ Ly6C CD11b monocytes, and F4/80 CD11b macrophages caspase-3, P-AKT, AKT (Cell Signaling Technology; 1:1,000 dilu- in 2 mL 5% FBS RPMI media in 6-well plate in 37C incubator for tion), BCL-2 (Santa Cruz Biotechnology; 1:500 dilution), and 24 hours. For myeloid cell culture in tumor-conditioned media, b-actin (Sigma). Anti-mouse/rabbit secondary antibodies were myeloid cells in 6-well plate were added 2 mL of tumor culture purchased from Bio-Rad (1:3,000 dilution). supernatant and cultured in 37C incubator for 24 hours. For p38 þ þ inhibition experiments, sorted Gr-1 CD11b cells from spleen of Transfection and electroporation tumor-bearing mice were treated with p38 inhibitor SB203580 FUGW plasmid (gift from Dr. Zheng-Gen Jin, University of (Cell Signaling Technology; 0, 5, 10, 15 nmol/L) in 10% FBS RPMI Rochester, Rochester, NY) was used for generating CCL9/CCR1 for 40 minutes. Tumor-conditioned media were then added to the overexpression vectors; PLKO.1 plasmid (gift from Dr. Jing culture for 6 hours to induce CCL9 expression. The cells were then Huang, NCI, Bethesda, MD) was used for CCL9 and CCR1 collected and tested for CCL9 expression. For the effect of CCL9 knockdown vectors. Tumor cells (67NR, B16F1) and RAW264.7 neutralization on tumor cell or myeloid cell apoptosis, 10 mg/mL cells were transfected with Lipofectamin 2000 per the manufac- þ þ CCL9-neutralizing antibody (R&D Systems) was added to turer's protocol (Invitrogen). Gr-1 CD11b cells sorted from myeloid tumor coculture supernatant and incubated in room spleens of tumor-bearing wild-type, Tgfbr2MyeKO, and Tgfbr2Flox temperature for 1 hour. Tumor cells were starved under 1% FBS for mice, were transfected using an Amaxa Mouse Macrophage 24 hours or myeloid cells that sorted from spleen were then NuclefectorKitperthemanufacturer's instructions (Lonza). cultured overnight in coculture supernatant with or without CCL9 neutralization before apoptotic analysis. To collect 4T1 condi- Statistical analysis tioned media for mice injection, the cells were cultured 24 hours GraphPad Prism v5.04 was used for graphs and for statistics. in 0.1% oxygen, 5% CO , and 94.9% nitrogen conditions; the 2 Unless otherwise indicated, data were expressed as mean SE. All media were then i.p. injected in mice. data were analyzed using the Student t test for comparison of two groups or one-way ANOVA for three groups or more. Differences Cytokine antibody array, ELISA of CCL9, CCL23, or TGFb1 were considered statistically significant when the P value was For cytokine antibody array, culture supernatant was collected <0.05. and processed per the manufacturer's protocol (Raybiotech; AAM- CYT-1000). The expression levels of cytokines/chemokines were Results measured by dot density using the ImageJ software, which were þ þ then normalized to control dot density, and presented as relative CCL9 was induced in Gr-1 CD11b immature myeloid cells expression levels. For CCL9, CCL23, or TGF-b1 ELISA, cell culture and the premetastatic lung supernatants, or protein extractions from cells or mouse organs Host derived myeloid cells form a premetastatic niche and – were collected and processed per the manufacturer's protocol support metastatic colony formation (5 7, 37). We suspected that (R&D Systems). tumor-educated myeloid cells might secrete factors that could directly promote metastasis of the tumor cells at the metastatic site. To address this question, we used the 4T1 mammary tumor RT-qPCR model that shares many characteristics with human breast cancer, Total RNA was extracted using an RNeasy Mini Kit (Qiagen) particularly its ability to spontaneously metastasize to the lungs. and cDNA was synthesized using High-Capacity cDNA Reverse In addition, the 4T1 cell line has related cell lines derived from the Transcription Kits (Applied Biosystem). Relative gene expression same spontaneous tumor that represent different degree of metas- was determined using SYBR Green PCR Master Mix (Applied tasis capability, from localized tumor (67NR) to fully metastatic þ þ Biosystem). The comparative threshold cycle method was used tumors (4T1). We sorted Gr-1 CD11b cells from spleens of 4T1 to calculate gene expression and normalized to GAPDH as a gene tumor-bearing mice as they showed very close cytokine profiling þ þ reference. RT-qPCR primers were as follow: CCR1 forward: from that of Gr-1 CD11b cells derived from the lungs (Supple- þ þ GTGTTCATCATTGGAGTGGTGG, and reverse: GGTTGAACAGG- mentary Fig. S1A). We then cocultured sorted Gr-1 CD11b TAGATGCTGGTC; GAPDH forward: AATGTGTCCGTCGTG- cells with 4T1 mammary tumor cells, and performed a cytokine GATCTGA, and reverse: GATGCCTGCTTCACCACCTTCT. protein array analysis on culture supernatants. Interestingly, CCL9 was highly induced in the myeloid tumor coculture supernatant MTT assay but not in the supernatant of tumor cell or myeloid cells cultured 4T1 cells (3 103) starved under 1% FBS for 24 hours were alone (Fig. 1A, red box, and red bar on the right). In contrast, other plated in each well of 96-well plate for overnight. The cells were CC family members were poorly expressed or not changed. CCL2, then cultured in mrCCL9 containing media for 2 hours followed another CCL9 family member was mostly produced in tumor cells by treatment of low serum (1%) or glucose-free conditions, or (Fig. 1A, yellow rectangle), in agreement with a previous finding doxorubicin (LC Laboratories, 1, 2, 10, 100, 250 nmol/L). MTT (38). Pro-MMP9, a key regulator for tumor vascular remodeling assays were performed 24 hours later following the manufac- (39), was also expressed in these myeloid cells (Fig. 1A, blue turer's recommendations (Sigma). rectangle), consistent with our earlier studies (13).

www.aacrjournals.org Cancer Res; 75(24) December 15, 2015 5285

Yan et al.

A 4T1 tumor cells Gr-1+CD11b+ Coculture 4T1 Gr-1+CD11b+ Coculture

8,000

6,000

4,000 Dot density

2,000

0 CCL2 CCL12 CCL3 CCL9 CCL19 CCL20 CXCL1 Pro-MMP9

CCL3 CCL9 CXCL1 CCL2 CCL19 Pro-MMP9 CCL12 CCL20

B C

80 20 100 10

80 60 15 60 40 10 5 40

CCL9 (pg/mL) 20 5 CCL9 (pg/mL) 20 CCL9 (pg/ m g protein) CCL9 (pg/ m g protein) 0 0 0 0 + + + + 4T1 4T1 + CD11b + CD11b B16BL6+ CD11b B16BL6 + CD11b Coculture Coculture Gr-1 Gr-1 Gr-1 Gr-1 Culture supernatant Cell pellet from coculture Culture supernatant Cell pellet from coculture

D E F 4T1 lungs B16F10 lungs 800

25 15 600 20 10 400 15

CCL9 (pg/mL) 200 10 5 5 0 CCL9 (pg/ m g protein) CCL9 (pg/ m g protein)

0 0 0 11 14 0 10 18 Media alone Days after tumor injection Days after injection

Tumor conditionedMyeloid tumor media coculture

Figure 1. CCL9 is upregulated in the myeloid tumor coculture supernatant and premetastatic lung. A, cytokine protein array, CCL9, and family members are highlighted with colored boxes. One of two experiments performed is shown here. Right top, semiquantitative data from dot density. B and C, CCL9 ELISA of culture supernatant from myeloid tumor coculture, myeloid or tumor cell single culture, as well as protein extraction from pellet of 4T1 (B) or B16BL6 (C) tumor þ þ cells. For both B and C, Gr-1 CD11b cells were pooled from three mice, with technical triplicates per treatment group. D and E, CCL9 ELISA of premetastatic lung protein extraction from 4T1 tumor-bearing mice (D) and B16F10 tumor-bearing mice (E). n ¼ 3 mice for each group. Equal amount of proteins extracted from lungs were loaded to the plate and the results were presented as pg CCL9/mg protein. F, CCL9 expression in myeloid cells cultured in 4T1 tumor-conditioned media or in coculture with 4T1 tumor cells, ELISA assay with triplicates of samples. The experiment was repeated two times with different biologic samples. G, CCL9 ELISA of sorted Gr-1þCD11bþ cells and lungs from mice received i.p. injection of hypoxic 4T1 conditioned medium for 14 days (n ¼ 5 mice); , P < 0.05; , P < 0.01; , P < 0.001.

5286 Cancer Res; 75(24) December 15, 2015 Cancer Research

Myeloid CCL9 and Tumor Cell Survival in Premetastatic Organ

We therefore focused our effort on CCL9. Using ELISA, we neutrophil cell line (Fig. 2C). In addition, RAW264.7 cells showed þ þ found that CCL9 was only present in myeloid tumor coculture a metastasis-promoting effect similar to Gr-1 CD11b cells when supernatants but not in supernatants from tumor cells or myeloid coinjected with tumor cells through tail vein (Supplementary Fig. cells cultured alone, in both systems of 4T1 mammary tumor cells S1C). Importantly, 67NR tumor cells coinjected with CCL9-defi- and B16BL6 melanoma cells (Fig. 1B and C, left). Adherent tumor cient RAW264.7 cells showed a decrease in lung metastasis cells were separated from nonadherent myeloid cells before compared with those coinjected with the control RAW264.7 cells protein extraction and CCL9 ELISA. Only myeloid cells but not (Fig. 2D and E, Supplementary Fig. S1D). This result was further þ þ tumor cells showed detectable CCL9 expression (Fig. 1B and C, validated with CCL9 knockdown in primary Gr-1 CD11b cells right), confirming that tumor cells did not produce CCL9 in our (Fig. 2F and G). CCL9 knockdown did not show any effect on the system. The basal level of CCL9 in B16BL6 model is likely due to primary tumor growth (Supplementary Fig. S1E). Together, our different subset composition of myeloid cells, which will be data suggest a unique function of CCL9 in myeloid cells to þ þ addressed later. As Gr-1 CD11b cells or other immature mye- promote cancer metastasis. loid cells are present in the lung before tumor cell arrival (5–7), we further tested whether CCL9 was upregulated in premetastatic CCR1 mediates CCL9 signaling and promotes tumor metastasis lungs. As expected, we found that CCL9 expression was signifi- CCR1 is the sole receptor mediating CCL9 signaling (25, 28– cantly higher in premetastatic lungs compared with normal lungs 30). We next examined the correlation between CCR1 expres- in both 4T1 and B16F10 models (Fig. 1D and E). The 4T1 and sion in tumor cells with cancer metastasis. We used the 4T1 B16F10 models have been reported for the existence of a pre- mammary tumor and B16 melanoma models comprised of cell metastatic niche establishment before tumor cell arrival, day 14 lines with different degree of metastatic capability. Flow-cyto- for the 4T1 model and day 18 for the B16 model after tumor cell metry analysis revealed approximately 8% of highly metastatic injection (5, 7, 8). This elevated CCL9 production seen in the 4T1 cells express CCR1 protein, which was higher than that of premetastatic lungs was not observed in other organs at the 67NR, 168FARN, and 4T07 cells (Fig. 3A). Similarly, less premetastatic phase of mice bearing 4T1 (Supplementary Fig. metastatic B16F1 cells had lower level of CCR1 mRNA expres- S1B) and B16F10 tumors (data not shown), suggesting an organ sion compared with more metastatic B16F10 cells (Supplemen- specificity for premetastatic niche formation. tary Fig. S2A). Interestingly, tumor cells from metastatic lung To ask whether direct contact between tumor cells and Gr- nodules showed higher CCR1 expression than those from the þ þ 1 CD11b cells was necessary for CCL9 expression, we cultured primary tumor tissues and cells in culture (Fig. 3B). To examine þ þ Gr-1 CD11b cells in tumor cell-conditioned media, or in direct whether CCR1 is important for lung metastasis, we overex- contact with tumor cells, and measured CCL9 concentrations in pressed CCR1 in low metastatic 67NR and B16F1 cells (Sup- þ þ the supernatant. Interestingly, Gr-1 CD11b cell cultured in plementary Fig. S2B and S2C). Mice bearing 67NR-CCR1 or tumor-conditioned media also produced high levels of CCL9 B16F1-CCR1 tumor cells showed significantly increased lung expression (Fig. 1F). However, CCL9 was produced at a higher metastasis (Fig. 3C and D). To further investigate whether CCL9 þ þ level in Gr-1 CD11b cells cocultured with tumor cells (Fig. 1F), signals through CCR1 to promote cancer metastasis, we co- suggesting that, although cell–cell contact was not necessary, injected CCL9-deficient RAW264.7 cells with 67NR-CCR1 cells. proximity enhanced CCL9 expression. Finally, to investigate Consistent with our earlier observations, CCL9 knockdown in þ þ CCL9 production in Gr-1 CD11b cells and lungs under pre- RAW264.7 cells decreased tumor metastasis in 67NR cells, as metastatic conditions, we performed i.p. injection of hypoxic well as 67NR-CCR1 cells (Fig. 3E). Interestingly, CCR1 over- tumor culture supernatant. An induction of CCL9 in Gr- expression in 67NR cells did not rescue the metastasis defi- þ þ 1 CD11b cells and premetastatic lungs was observed by CCL9 ciency in the context of myeloid-specific CCL9 knockdown (Fig. ELISA (Fig. 1G). Together, our data suggest that CCL9 is produced 3E), suggesting that CCL9, but not the other family members, is þ þ by Gr-1 CD11b cells and in the premetastatic lung. We therefore the major cytokine signaling through the CCR1 receptor to hypothesized that CCL9 might play a critical role in metastatic promote metastasis. This finding is consistent with our earlier colony formation. observation that CCL9 is the most upregulated cytokine in the CCL9 family members (Fig. 1A).

Knockdown of CCL9 in RAW264.7 macrophages or primary CCL9/CCR1 correlates with metastasis and decreased survival þ þ Gr-1 CD11b cells decreased cancer cell metastasis in cancer patients Tumor-associated myeloid cells have been shown to promote To establish the clinical significance of our findings, we next cancer metastasis (5–7, 37, 38). Consistent with this, 4T1 mam- looked into the correlation between CCL9 expression levels and þ þ mary tumor cells when coinjected with Gr-1 CD11b cells metastasis using publicly available patient databases. CCL23 has showed an increased metastasis (Fig. 2A). Moreover, 67NR, a been identified as the human orthologue for mouse CCL9 relatively non-metastatic cell line derived from the same mam- (25, 30). They shared 92% to 99% sequence identity (Supple- mary tumor as 4T1, showed a 3-fold increase in metastasis when mentary Fig. S3 and Supplementary Table S1) and cluster together þ þ coinjected with Gr-1 CD11b cells by tail vein (Fig. 2B). To by Treefam analysis (Supplementary Fig. S3A). They are predicted determine whether CCL9 is a critical mediator in the myeloid- orthologs by MetaPhOrs online tool (Supplementary Fig. S3B) mediated promotion of cancer metastasis, we first explored and show similar chemoattractant functionality (25, 29, 40). In whether RAW264.7, a widely used macrophage cell line, could addition, human CCL23 and mouse CCL9 are two of the four NC6 be used for CCL9 knockdown. When cultured in tumor-condi- subfamily members in b chemokines (41). Analysis of publically tioned media, RAW264.7 macrophages showed a similar cytokine available database (Oncomine, GSE20685) showed a negative þ þ profile with primary Gr-1 CD11b cells especially in their high- correlation between CCL23 or CCR1 expression levels and level expression of CCL9, which was not seen in the 32Dcl3 metastatic status 3 years after diagnosis in breast cancer patients

www.aacrjournals.org Cancer Res; 75(24) December 15, 2015 5287

Yan et al.

Figure 2. þ þ Knockdown of CCL9 in myeloid cells decreased cancer metastasis. A, luciferase Imaging of lung metastasis with tumor cells coinjected with Gr-1 CD11b cells. þ þ IVIS live image 7 days after tail vein coinjection of 5 105 4T1 tumor cells expressing luciferase (4T1-luc) with 1 106 Gr-1 CD11b cells. Mice n ¼ 5 for each group. Quantitative data are on the right. B, number of lung metastasis of 67NR tumor cells coinjected with Gr-1þCD11bþ cells. (Continued on the following page.)

5288 Cancer Res; 75(24) December 15, 2015 Cancer Research

Myeloid CCL9 and Tumor Cell Survival in Premetastatic Organ

(Fig. 4A, heat map), or with a decreased metastasis-free survival and B16F1 tumor cells (Fig. 5A, right). CCL9 knockdown in (Fig. 4A). Interestingly, meta-analysis of 1,577 breast cancer RAW264.7 cells also decreased metastasis colony formation of patients in GOBO breast cancer database (42) revealed that 67NR-CCR1 (Fig. 5B, left and middle) or B16F1 cells (Fig. 5B, patients with low expression of CCL23/CCR1 have a better right) as demonstrated by PUMA. These results were further þ þ þ survival among 166 PAM50 HER2 patients (Fig. 4B), which validated through CCL9 knockdown in primary Gr-1 CD11b was not observed in the HER2 patients (data not shown). myeloid cells that increased tumor cell apoptosis (Supple- PAM50 (prediction analysis of microarray using 50-gene clas- mentary Fig. S4B, top) and decreased metastatic colony for- sifier) is a 50-gene signature that adds further prognostic and mation (Supplementary Fig. S4B, bottom). Knockdown of CCL9 þ þ predictive information to standard parameters for breast cancer in Gr-1 CD11b cells did not affect tumor cell extravasation patients (43). These data suggest a negative correlation of (Supplementary Fig. S4C). This was evaluated through counting CCL23/CCR1 with metastasis-free survival of cancer patients. green colored 67NR-GFP tumor cells against a red vascular map To examine CCL23 induction in human myeloid cells under (Dextran labeled) under confocal microscope. The B16F1 cells þ cancer conditions, we sorted human CD33 myeloid cells from seemed to be more sensitive to changes in CCL9 concentration peripheral blood mononuclear cells (PBMC) of healthy blood than 67NR (Supplementary Fig. S4D), likely due to higher donors and cocultured them with human breast cancer cell CCR1 expression in B16F1 cells (Supplementary Fig. S4E). To line MDA-MB-231 or human melanoma cell lines A375S2 and determine the effect of CCL9/CCR1 on tumor cell survival in vitro, þ SK-MEL-28. Culture supernatant from CD33 myeloid cells we continued to use the above low metastatic 67NR mammary alone, tumor cells alone, or coculture was examined by CCL23 tumor cells and B16F1 melanoma cells that were more sensitive ELISA. Consistent with our mouse findings, CCL23 was highly for apoptosis induction upon serum starvation and glucose- induced in myeloid tumor coculture supernatants but not in free culture condition. Recombinant mouse CCL9 (rmCCL9) supernatants from tumor cells or myeloid cells cultured alone decreased and neutralization of CCL9 increased the number of þ þ (Fig. 4C). In addition, CCL23 was mostly produced by myeloid 7AAD /Annexin V cells (Supplementary Fig. S4D). rmCCL9 cells but not tumor cells, consistent with our mouse data. This also increased the survival of 67NR cells cultured in glucose-free observation was made with separation of adherent tumor conditions (Fig. 5C, left). Furthermore, 4T1 cells treated with cells from nonadherent myeloid cells for protein extraction doxorubicin (67NR were not used as they were mostly killed and CCL23 ELISA (Fig. 4D). Finally, MDA-MB-231 tumor- under the same conditions) showed an increased survival upon conditioned media induced CCL23 production; however in rmCCL9 treatment (Fig. 5C, right; Supplementary Fig. S4F). þ coculture, CCL23 was produced at a higher level in CD33 We next addressed the molecular mechanisms underlying CCL9 myeloid cells (Fig. 4E), suggesting that cell–cell proximity promotion of tumor cell survival. We found that rmCCL9 increased enhanced CCL9 expression, similar to our findings in mouse. phospho-AKT (P-AKT) and BLC-2, two well-described cell survival Together, our data support that CCL23 was induced in myeloid pathways and markers, whereas CCL9-neutralizing antibody cells and correlates with human cancer metastasis. decreased P-AKT and BLC-2 expression (Fig. 5D, left). There was no change in cleaved caspase-3 in cells treated with rmCCL9- or CCL9/CCR1 promotes tumor cell survival CCL9-neutralizing antibody. Rather, there was a change in the Tumor cell survival in the hostile distant organ is a rate-limiting expression of PARP, an important noncanonical apoptosis medi- step in the metastatic process (1). Indeed, when 4T1 cells were ator (44). rmCCL9 decreased PARP expression in starved 67NR introduced into the venous circulation of mice, the majority of cells whereas CCL9-neutralizing antibody elevated its expression in 4T1 tumor cells die within 24 hours after arrest at the secondary 67NR cells cultured in myeloid tumor coculture supernatant (Fig. site (Supplementary Fig. S4A). To investigate the effect of mye- 5D, left). Immunofluorescence staining of PAR, the substrate of loid-derived CCL9 on tumor cell survival in the premetastatic PARP, showed rmCCL9 decreased PAR in starved B16F1 tumor lung, we used fluorescence imaging of single-cell video micros- cells, whereas CCL9-neutralizing antibody elevated PAR in B16F1 copy (SCVM) and a pulmonary metastasis assay (PUMA; ref. 35). cells cultured in myeloid tumor coculture supernatant, supporting SCVM detects single live tumor cells hours after tail vein injection, a role of PARP in CCL9 promotion of tumor cells survival (Fig. 5D, which allows us to examine the effect of myeloid CCL9 on tumor middle). Together, these data provide evidence for a role of CCL9/ cell survival in vivo. PUMA evaluates tumor cell colonization ex CCR1 signaling in tumor cell survival and metastasis as a result of vivo in cultured lung slice 7 to 14 days after tail vein coinjection of interaction between myeloid cells and tumor cells. the tumor cells and myeloid cells. We used 67NR-GFP or B16F1- GFP cells in these assays, as they are more vulnerable to CCL9 CCL9 is critical in myeloid-specific TGFb regulation of tumor knockdown in myeloid cells. Using SCVM and TUNEL assays, metastasis we found that CCL9 knockdown in RAW264.7 cells decreased We recently reported that deletion of Tgfbr2 in myeloid cells the survival of 67NR-CCR1 and increased apoptosis (Fig. 5A, left) (Tgfbr2MyeKO) decreased tumor metastasis through modulation

(Continued.) A total of 5 105 67NR cells were coinjected with 1 106 Gr-1þCD11bþ cells through tail vein; lungs were harvested after 21 days; n ¼ 8for þ þ each group. C, cytokine protein array of primary Gr-1 CD11b cells (sorted from spleens of tumor-bearing mice), RAW264.7 macrophage cell line, and 32Dcl3 neutrophil cell line, cultured in tumor-conditioned media for 24 hours. The culture supernatant was used for array. Red boxes on blots, CCL9 expression. Heat map was generated on the basis of semiquantitative data from dot density, then normalized to control dots. Blue rectangle, CCL9 expression. D, CCL9 knockdown in RAW264.7 cells, by ELISA. E, lung metastasis of 67NR tumor cells coinjected with RAW264.7 cells deficient in CCL9 expression. F, CCL9 knockdown in primary Gr-1þCD11bþ cells. G, lung metastasis of 67NR tumor cells coinjected with Gr-1þCD11bþ cells deficient in CCL9 expression. For both D and F, CCL9 expression was detected by ELISA. One experiment from two with triplicates was shown. For E and G, mice received tail vein coinjection of 5 105 67NR and 2 105 RAW264.7 cells or 1.5 106 Gr-1þCD11bþ cells, and were sacrificed 4 weeks after cell injection. Mice n ¼ 8–9 for each group; , P < 0.05; , P < 0.01; , P < 0.001.

www.aacrjournals.org Cancer Res; 75(24) December 15, 2015 5289

Yan et al.

Figure 3. CCL9/CCR1 signaling promotes tumor metastasis. A, ﬂow cytometry showing CCR1þ cells in cell line derivatives of 4T1 tumor. One experiment is shown from two performed. Quantitative data are on the left. B, RT-qPCR of CCR1 expression in cultured 4T1 cells, primary tumors, and metastatic lung tumor nodules. Three biologic samples were pooled, with triplicates for each group used in experiments. C, number of lung metastatic nodules upon CCR1 overexpression in 67NR cells (67NR-CCR1). Mice received tail vein injection of 106 67NR-CCR1, 67NR-control, and 4T1 cells; the lungs were harvested 21 days later. Left, representative H&E sections of mouse lungs; right, number of lung metastatic nodules, n ¼ 7 to 8 mice for each group. D, number of lung metastasis in mice that received tail vein injection of B16F1-CCR1, B16F1-vec, and B16F10 cells. Lungs were collected 21 days after tail vein injection and subjected to whole lung mounting procedure; n ¼ 8–9 mice for each group. E, number of lung metastatic nodules of tumor-bearing mice that received coinjection of 67NR-CCR1 and its control with CCL9 knockdown RAW264.7 cells. Mice were euthanized 4 weeks after injection; n ¼ 9 mice for each group. Representative pictures on the right; , P < 0.05; , P < 0.01; , P < 0.001.

5290 Cancer Res; 75(24) December 15, 2015 Cancer Research

Myeloid CCL9 and Tumor Cell Survival in Premetastatic Organ

A No metastasis With metastasis

CCL23 2.18E-4 CCR1 8.02E-4

–3.11 0 3.11

12 12 P < 0.005

P < 0.05 8 8

44 Metastasis-free survival (year) Metastasis-free survival (year) Metastasis-free survival 0 0 –2 024 –10123 CCL23 (Log2 media-centered intensity) CCR1 (Log2 media-centered intensity)

B All tumors: Subset=PAM50_HER2 enriched: C Cancer cells Myeloid cells Coculture merged genes: CCL23 and CCR1

600 100 500

400

300 50 P = 0.00853 200 10 CCL23 (pg/mL) 5 CCL23/CCR1 low n = 58

Metastasis-free survival (%) Metastasis-free survival CCL23/CCR1 medium n = 53 0 MDA-MB-231 A375S2 SK-MEL-28 0 CCL23/CCR1 high n = 55 Breast Melanoma 0246810 Culture supernatant Time (years)

DE60 4 Cancer cells Myeloid cells 40 3

2 20 CCL23 (pg/mL) 1

CCL23 (pg/ m g protein) 0 0 MDA-MB-231 A375S2 SK-MEL-28 Media alone Breast Melanoma Cell pellet from coculture Tumor conditionedMyeloid tumor media coculture

Figure 4. CCL23/CCR1 correlates with metastatic status or survival of cancer patients. A, correlation of CCL23 or CCR1 expression levels with breast cancer metastatic status 3 years after diagnosis (heat map), or with a decreased overall metastasis-free survival. Oncomine database (GSE20685) was used for the analysis. B, Kaplan–Meier survival curve of CCL23/CCR1 expression in 166 PAM50 HER2þ breast cancer patients in GOBO database (42). C, CCL23 ELISA in sorted human CD33þ PBMC cocultured with human cancer cell lines of breast and melanoma. CD33þ myeloid cells were sorted from normal donors and were pooled, þ with triplicates per treatment group. Culture supernatant from CD33 PBMC cells alone, tumor cells alone, or in coculture was tested. D, CCL23 ELISA þ þ of protein extraction from adherent tumor cells or nonadherent CD33 PBMC cells after separation from coculture. Tumor cells or CD33 PBMC were pooled, þ with triplicates per treatment group. E, CCL23 ELISA of sorted CD33 PBMC cultured in MDA-MB-231 tumor-conditioned media or in coculture with MDA-MB-231 cells, ELISA assay with triplicates of samples; , P < 0.05; , P < 0.01; , P < 0.001.

www.aacrjournals.org Cancer Res; 75(24) December 15, 2015 5291

Yan et al.

A 6 h after injection (%)

120 6 h after injection (%) SCVM TUNEL 80 40 SCVM TUNEL ## 80 TUNEL + cells ### TUNEL + cells 60 # 30 60 80 # 40 20 ** 40 40 * * 20 10 20 % of Cells 6 h/1h % of Cells 6 h/1h

0 0 0 0 67NR + + + B16F1 +++ RAW Control sh4 sh1 RAW Control sh4 sh1 CCL9 KD RAW-tumor coinjection CCL9 KD RAW-tumor coinjection B

67NR * ** 60 ** 80

–100 mm 60 40 67NR+ CCL9 sh4 40

20 survival index survival

survival index survival 20 Pulmonary metastasis Pulmonary metastasis 67NR+ 0 0 CCL9 sh1 67NR + + + B16F1 + + + RAW Control sh4 sh1 RAW Control sh4 sh1 CCL9 KD RAW-tumor coinjection CCL9 KD RAW-tumor coinjection

C +rmCCL9 0 0.4 2 ng/mL 0.3 5 ng/mL ** 0.3 ** +rmCCL9 * 0.2 * 0 0.2 10 ng/mL 20 ng/mL 0.1 0.1 Absorbance at 570 nm Absorbance at 570 nm 0.0 0.0 Full media Low serum Glucose free 250 nmol/L doxorubicin Treatments + D rmCCL9 B16F1 CoSN ++ B16F1 +rmCCL9 CCL9 CCL9 NeuAB +

pAKT CCR1

AKT –10 mm BCL-2 Caspases PARP PARP Cleaved caspases caspase3 PAR p-AKT Cleaved BCL-2 caspase3 B16F1 B16F1 b-Actin +CoSN +CoSN+CCL9 NeuAB Tumor cell apoptosis PAR nucleus

5292 Cancer Res; 75(24) December 15, 2015 Cancer Research

Myeloid CCL9 and Tumor Cell Survival in Premetastatic Organ

þ þ þ þ of cytokine production (18). TbRII-deficient Gr-1 CD11b cells Gr-1 CD11b cells consist of heterogeneous immature mye- displayed significantly decreased CCL9 expression in a cytokine loid cells. To determine the cell subset(s) responsible for CCL9 protein array (Fig. 6A). This result was further confirmed with production, FACS-sorted myeloid subsets (Fig. 7C) were cocul- ELISA using multiple TbRII-deficient or control tumor-bearing tured with tumor cells, and CCL9 production was measured by þ þ þ þ mice (Fig. 6B). Unlike wild-type Gr-1 CD11b cells, TbRII-defi- ELISA. Although sorted Ly6G CD11b cells produced lower þ þ þ þ þ þ cient Gr-1 CD11b cells failed to support tumor cell survival in levels of CCL9 than either Ly6C CD11b or F4/80 CD11b vivo by SCVM (Fig. 6C). Instead, these cells induced tumor cell subsets, upon coculture with tumor cells, CCL9 production was þ þ apoptosis to a level similar to the tumor cell alone group (Fig. 6D). elevated 20-fold in Ly6G CD11b cells while remaining mostly þ þ þ þ To investigate the importance of CCL9 in TGFb regulation of unchanged in the Ly6C CD11b and F4/80 CD11b subsets þ þ myeloid cell function, we overexpressed CCL9 in TbRII-deficient (Fig. 7D). In addition, only Ly6G CD11b cells were significantly þ þ Gr-1 CD11b cells (Supplementary Fig. S5A). Tumor cells coin- increased in the premetastatic lung (day 14 after 4T1 tumor jected with CCL9-expressing TbRII-deficient myeloid cells showed injection), whereas the number of the other cell types was an increased survival and metastasis when compared with the unchanged (Supplementary Fig. S6). Taking this into consider- þ þ controls by PUMA (Fig. 6E). We next determined the downstream ation, the increase in CCL9 was far greater in the Ly6G CD11b mediators of the TGFb pathway that might regulate CCL9 expres- cells (Fig. 7E). Our studies suggest that CCL9 was produced in þ þ sion. TGFb signals through SMAD-dependent canonical pathways Ly6G CD11b cells, and had an autocrine effect on myeloid cell and SMAD-independent noncanonical pathways (20). Upon survival and CCL9 production. TGFb treatment, a decreased level of P-p38 or P-smad2 (less pronounced) was observed in TbRII-deficient myeloid cells com- Discussion pared with that of wild-type. This difference between TbRII- We report here for the first time that CCL9 is a critical down- deficient and wild-type myeloid cells was not observed in untreat- stream mediator of myeloid TGFb signaling, and that the myeloid ed conditions (Fig. 6F). To investigate the role of p-38 in TGFb CCL9/tumor CCR1 axis plays an important role in tumor cell regulation of CCL9 production, we cultured control and TbRII- þ þ survival and metastatic colony formation (Fig. 7F). CCL9 is highly deficient Gr-1 CD11b cells in tumor-conditioned media that induced in immature myeloid cells and in the premetastatic lung contained high level of TGFb. These cells were treated with the p38 of tumor-bearing mice. It functions as a survival factor for tumor inhibitor SB203580 that inhibits p38 kinase activities, shown by cells in the distant premetastatic site. Mechanistically, CCL9 is a inhibited phosphorylation of ATF2 (Supplementary Fig. S5B). critical downstream mediator of the metastasis-promoting effects SB203580 reduced CCL9 production specifically in the control þ þ of myeloid-specific TGFb signaling. Our study suggests a novel but not in TbRII-deficient Gr-1 CD11b cells (Fig. 6G). Impor- þ þ cellular and molecular mechanism underlying the "seed and soil" tantly, p38 dominant–negative Gr-1 CD11b cells showed a hypothesis for cancer metastasis. Importantly, CCL23, the human decreased CCL9 production (Fig. 6H). Finally, TGFb was pro- orthologue for CCL9, and its receptor CCR1, correlate with duced in tumor-conditioned medium and the premetastatic lungs progression and metastasis of breast cancers, indicating human in mice received injection of conditioned medium (Supplemen- relevance. Our work identifies a unique target that contributes to tary Fig. S5B). Together, our data suggest that CCL9 is regulated by cancer cell survival and is situated downstream of the metastasis- p38 and is critical in TGFb signaling in myeloid cells that pro- promoting effects of TGFb signaling in myeloid cells. motes tumor cell survival in metastatic lungs. Tumor cell survival in the hostile distant organ is a critical rate- limiting step in cancer metastasis. Highly metastatic tumor cells Autocrine effect of CCL9/CCR1 and myeloid subsets expressing have a significantly higher survival in the distant organ (33). CCL9 Blocking tumor cell apoptosis increases metastasis (45, 46). In CCL9 was reported to decrease apoptosis in osteoclasts, one of addition to the molecular mediators within tumor cells, factors the myeloid cell types (32). We therefore asked whether CCL9 has produced by host cells, including chemokines and cytokines, also þ þ an effect on Gr-1 CD11b cell survival. CCL9 neutralization modulate tumor cell survival (2, 47–50). For example, the inflam- þ þ increased apoptosis of Gr-1 CD11b cells cultured in tumor- matory chemoattractants S100A8 and S100A9 are produced in the conditioned media (Fig. 7A). Knockdown of CCR1 in RAW264.7 premetastatic lung or brain and contribute to metastasis colony cells decreased their CCL9 production (Fig. 7B), suggesting the formation (6, 51, 52). CCL9 was clearly produced in the pre- þ þ existence of a CCL9-CCR1 autocrine effect. metastatic lung and by the CD11b LyG myeloid cells promoting

Figure 5. CCL9 promotes cancer cell survival and colony formation. A, tumor cell survival and apoptosis after coinjection with CCL9-deficient RAW264.7 cells. Fluorescence signal from SCVM indicating tumor cell survival was plotted on the left y-axis; and the percentage of TUNEL-positive cells indicating apoptosis is on the right y-axis. Left, 67NR-CCR1 mammary tumor model; right, the B16F1 melanoma model; n ¼ 3–4 mice per group; or #, P < 0.05, or ##, P < 0.01; ###, P < 0.001 compared with the controls. B, PUMA for tumor cell survival and metastasis. GFP-labeled 67NR-CCR1 or B16F1 cells (5 105) were coinjected with RAW264.7 cells with or without CCL9 knockdown. Fluorescence imaging was obtained 7 days after lung section culture. The GFP florescence pixels were obtained on day 7 and were normalized with those from day 0 (baseline), and presented as pulmonary metastasis index. Representative images are on the left; quantitative data for 67NR are in the middle and B16F1 on the right. Three mice each group, 3 to 4 lung pieces each mouse. C, MTT assay for tumor cell survival, with addition of rmCCL9. The cells were cultured under glucose free or low serum conditions (left) and with treatment of anticancer drug doxorubicin (right). D, left, Western blot analysis of P-AKT, AKT, BCL2, PARP, caspase-3, and cleaved caspase-3, as well as b-actin; middle, fluorescence staining of PAR (green, with nuclei in blue) in starved B16F1 cells treated with rmCCL9 or in B16F1 cells cultured in myeloid tumor coculture supernatant and treated with CCL9 neutralizing antibody. Right, schematic pathways for tumor cell survival and apoptosis regulated by CCL9; , P < 0.05; , P < 0.01. mrCCL9, mouse recombinant CCL9; CoSN, myeloid tumor coculture supernatant; CCL9 NeuAB, CCL9-neutralizing antibody.

www.aacrjournals.org Cancer Res; 75(24) December 15, 2015 5293

Yan et al.

A 0.3 B 15

0.2 10 Flox KO ** CCL9 0.1 5 MIP-2 *** CCL9 (pg/ m g protein) 0.0 0 Relative expression of CCL9 Relative expression Flox-Tgfbr2 KO-Tgfbr2

Flox-Tgfbr2 KO-Tgfbr2

CD EN.S. 100 60 50 * * ** *** * ** 80 40 40 60 cells

+ 30 40 20 20

20 TUNEL % of Cells 6 h/1 h 10 0 6 h after injection (%) 0

Metastasis/survival index Metastasis/survival 0 Alone Alone KO-Tgfbr2 Flox Control CCL9 Flox-Tgfbr2 Flox-Tgfbr2 KO-Tgfbr2 + Gr-1+CD11b+ + Gr-1+CD11b+ KO-Tgfbr2 FG H +TGF-b1 4 * DMSO 300 * Flox ko Flox ko 5 nmol/L 3 10 nmol/L TbRII 15 nmol/L 200 P-p38 2 *** p38 100

1 CCL9 (pg/mL)

P-smad2 CCL9 (pg/ m g protein)

0 0 smad2 Flox-Tgfbr2 KO-Tgfbr2 WT p38 DN

b-Actin

Sorted Sorted, starved, and treated

Figure 6. þ þ CCL9 is critical in myeloid-specific TGFb regulation of tumor metastasis. A, cytokine protein array indicating CCL9 expression in floxed or TbRII-deficient Gr-1 CD11b fl cells sorted from peripheral blood of 4T1 tumor-bearing Tgfbr2 ox or Tgfbr2MyeKO mice. The samples were combined from three mice, with duplicates for each sample. Semiquantitative data of dot density are on the right. B, CCL9 ELISA in myeloid cells sorted from peripheral blood of TbRII-deficient or control þ þ tumor-bearing mice (n ¼ 3). C, SCVM for tumor cell survival. GFP-labeled 67NR cells (5 105) were coinjected with floxed or TbRII-deficient Gr-1 CD11b cells (1 106). The lungs were taken out for images 1 and 6 hours after injection. Ten fields for each mouse lung were examined. Fluorescent signals at 6 hours were normalized with 1 hour signal; n ¼ 3 mice per group. D, TUNEL assay for tumor cell apoptosis from lung sections from C. TUNEL-positive cells were counted and þ calculated and presented as percentage of GFP cells, as shown at y-axis. E, PUMA for tumor cell survival and metastasis. 67NR-GFP cells were coinjected þ þ with TbRII-deficient Gr-1 CD11b cells with or without CCL9 overexpression. Fluorescence imaging was obtained 14 days after lung section culture. Fluorescence signal per field was quantified, then normalized to day 0 signal and presented as metastasis survival index. Three mice each group, 3 to 4 lung pieces each þ þ mouse. F, Western blot analysis for P-p38 level in TbRII-deficient Gr-1 CD11b cells, compared with control cells, with or without TGFb1 treatment. One representative þ þ experiment is shown here from two performed. G, CCL9 ELISA of floxed or TbRII-deficient Gr-1 CD11b cells treated with p38 inhibitor for 6 hours. H, CCL9 ELISA of Gr-1þCD11bþ cells sorted from spleen of p38 dominant–negative or wild-type mice. The cells were cultured in 4T1 tumor-conditioned media for 24 hours. Spleens from three mice were pooled for sorting. Validation of P-p38 by Western is at the bottom; , P < 0.05; , P < 0.01; , P < 0.001.

tumor cell survival and metastasis. We showed that CCL9 was sion levels were examined in myeloid cells and tumor cells at the produced in myeloid cells and little CCL9 was found in tumor same time so we could make a direct comparison (Figs. 1 and 4). cells in both mouse models and human setting. As CCL9 expres- Our data are in agreement with reports that CCL9 is secreted in

5294 Cancer Res; 75(24) December 15, 2015 Cancer Research

Myeloid CCL9 and Tumor Cell Survival in Premetastatic Organ

A B Relative expression of CCR1 60 250 -4 (%) CCL9 level 2.0x10 + CCR1 relative expression 200 * 1.5x10-4 40 150 1.0x10-4

and/or 7AAD 100 + 20 -5 CCL9 (pg/mL) 5.0x10 50

AnnexinV 0 0 0.0 Control sh5 sh3 sh1

Control Myeloid cell CCR1 KD + Anti-CCL9

CD5 5 105 10 F4/80hiCD11b+ 10 Ly6C-Ly6G- 4 4 104 18.4 10 28.7 10 58.3 *** 26.6 350 *** 3 3 103 10 10 300 Ly6G+CD11b+ 2 2 102 10 10 F4/80-Ly6C- Ly6C+CD11b+ 250 0 0 F4/80lowLy6G- 0 89.2 F4/80 F4/80 CD11b 0 102 103 104 105 0 102 103 104 105 0 102 103 104 105 200 Ly6G Ly6C Ly6C 150 Post sorting 100 CCL9 (pg/mL)

5 5 5 50 10 F4/80hiCD11b+ 10 Ly6C+CD11b+ 10 Ly6G+CD11b+ Ly6C-Ly6G- F4/80lowLy6G- F4/80-Ly6C- 0 104 104 104 96.3 Single Coculture 96.4 F480+ Ly6C+ Ly6G+ 103 103 103

102 102 102 0 0 0 99.9 F4/80 F4/80 F4/80 0 102 103 104 105 01102 103 04 105 01102 103 04 105 Ly6C Ly6C Ly6C

E F 35 *** b 28 TGF 1 F4/80+ TbRII Ly6C+ Premetastatic lung 21 Ly6G+ Survival of tumor cells Myeloid in the distant organ

14 CCL9 *** 7 Autocrine Fold change of CCL9 expression

0 CCR1 Tumor Pellet Supernatant

Figure 7. Autocrine effect of CCL9/CCR1 on myeloid cells and Ly6GþCD11bþ subset. A, ﬂow-cytometry analysis of Annexin V and 7AAD of Gr-1þCD11bþ cells cultured in myeloid tumor coculture supernatant and treated with CCL9-neutralizing antibody. Three representative mice were used for each group. B, relative þ þ expression of CCL9 (ELISA, left y-axis) and CCR1 (qPCR, right y-axis) upon CCR1 knockdown in RAW264.7 cells. C, sorting strategy of Ly6G , Ly6C ,and F4/80þ myeloid cell subsets. Bottom, post-sorting ﬂow-cytometry analysis. D, CCL9 ELISA of sorted F4/80þCD11bþ, Ly6CþCD11bþ, and Ly6GþCD11bþ cells upon coculture with tumor cells. Three spleens from tumor-bearing mice were used for sorting. E, fold change of CCL9 production by myeloid cells with consideration of the fold increase in numbers of myeloid cell subsets in the premetastatic lung (Supplementary Fig. S6). F, schematic hypothesis: TGFb signals through TbRII on myeloid cells and stimulates CCL9 production; CCL9 then signals through CCR1 on tumor cells, resulting in an increased tumor cell survival and metastatic colony formation. CCL9 also signals through CCR1 on myeloid cells and mediates an autocrine effect that increases CCL9 production and myeloid cell survival; , P < 0.05; , P < 0.001.

www.aacrjournals.org Cancer Res; 75(24) December 15, 2015 5295

Yan et al.

macrophages and myeloid cell lines (31, 32). These data with previous reports that TGFb signaling through BMPRII in are different from previous reports in which the CCL9–CCR1 mammary epithelial cells (54) and TGFb-SMAD4 in colon epi- þ axis was implicated in the recruitment of CCR1 Gr-1 myeloid thelial cells regulate CCL9 expression (25). However, myeloid cells in response to CCL9 production by tumor cells TGFb promotes (Fig. 6), whereas epithelial TGFb inhibits CCL9 (30, 53, 54). In contrast, our study reveals a new function of expression (25, 54). The molecular mechanisms underlying this the CCL9–CCR1 axis in supporting tumor cell survival in the opposite mode of regulation might be due to the difference in distant premetastatic organ. The observed CCL9 induction in downstream TGFb signaling network between myeloid cells and intestinal tumor cells is likely due to the blockade of TGFb tumor epithelial cells. signaling that has been shown to elevate the expression of a Chemokines have been implicated in TGFb regulation of number of chemokines (21, 22). tumor microenvironment and tumor progression. Loss of TGFb Tumor–stroma interactions are indispensable participants in signaling in carcinoma cells enhances chemokine production the metastatic process (55–59). Of interest, cancer cells often do and correlates with poor prognosis of human breast cancer not need additional genomic alterations to establish metastatic patients (22). In mouse models, deletion of TGFb signaling in colonies when compared to the cancer cells at the primary tumor cancer epithelial cells increases metastasis due to chemokine site (60). In fact, gene expression orchestrated by the stromal expression, which promotes the interaction of carcinoma microenvironment cues could play a fundamental role in met- cells and bone marrow–derived cells, tumor cell migration, and astatic processes (59). Myeloid cells have been implicated in survival, and decreases tumor cell apoptosis (6, 21, 25, 51, 74). supporting cancer metastasis (5, 7, 38, 53, 61). The functionality Our data demonstrate that CCL9 is the key regulator of the of these cells involve suppression of host antitumor immunity metastasis-promoting effects of myeloid TGFb signaling and (12, 18), promotion of tumor angiogenesis (13) or tumor cell provide a new understanding of tumor–host interactions in extravasation (38), enhancement of tumor cell migration and TGFb regulation of metastasis. Targeting CCL9 derived from invasion (53) as well as formation of the premetastatic niche myeloid cells through bone marrow manipulation (e.g., CCL9 þ (5, 7, 62, 63). We found that in the premetastatic lung, Ly6G shRNA driven by CD11b promoter) or CCL9-neutralizing anti- þ CD11b cells produce CCL9, which supports incoming meta- body could be used for reprogramming premetastatic organ static tumor cell survival. CCL9 also has an autocrine effect on microenvironment, thus inhibiting metastasis. In addition, tar- myeloid cells, which further amplifies CCL9 signaling and geting CCL9 as a downstream effector of the prometastatic effect expression, likely enhancing myeloid cell survival in the pre- of TGFb might bypass some of the negative consequences of metastatic lung. These findings provide new molecular insights TGFb neutralization. for the tumor–host interaction in the premetastatic organ site. Our results are consistent with the metastasis-promoting effect Disclosure of Potential Conflicts of Interest of Gr-1–positive inflammatory monocytes (38) as well as imma- No potential conflicts of interest were disclosed. ture myeloid cells (6) or VEGFR1 myeloid progenitor cells (5), but different from a recent publication, which showed that þ þ þ Authors' Contributions Ly6G CD11b or Gr-1 cells have an antitumor function Conception and design: H.H. Yan, C. Khanna, L. Yang (64, 65). These differences may reflect the context-dependent Development of methodology: H.H. Yan, J. Jiang, C. Khanna functionality of myeloid cells such as time and spatial factors in Acquisition of data (provided animals, acquired and managed patients, mouse models. provided facilities, etc.): H.H. Yan, B.R. Achyut, M. Lizardo Our data also provide molecular insight for CCL9 as a down- Analysis and interpretation of data (e.g., statistical analysis, biostatistics, computational analysis): H.H. Yan, J. Jiang, B.R. Achyut, M. Lizardo, K. Hunter, stream mediator of the metastasis-promoting function of TGFb. C. Khanna, C. Hollander, L. Yang TGFb is produced in high level by cancer cells and myeloid cells Writing, review, and/or revision of the manuscript: H.H. Yan, Y. Pang, (18). It promotes cancer metastasis, including breast cancer M. Lizardo, C. Khanna, L. Yang (20, 66, 67). One underlying mechanism is its role in premeta- Administrative, technical, or material support (i.e., reporting or organizing static niche formation (6, 63, 68). However, TGFb possesses both data, constructing databases): H.H. Yan, J. Jiang, Y. Pang, X. Liang, C. Hollander, tumor-suppressor and tumor-promoter functions and has been L. Yang Study supervision: L. Yang rather puzzling. Multiple lines of evidence suggest that TGFb signaling in epithelial cells, fibroblasts and T cells are tumor Acknowledgments suppressing, as its deletion in these cell types promotes tumor The authors thank Drs. Howard Young, Lalage Wakefield, Glenn Merlino, development and progression (69, 70). Very interestingly, distinct Michael Lichton, and Zhenggang Liu for critical reading of the article and from all cell types discussed above, myeloid-specific TGFb has Barbara Taylor, Karen Wolcott, and Subhadra Banerjee for technical assistance been shown to be metastasis promoting, in that deletion of TbRII on FACS. They also thank Dr. Arnulfo Mendoza for the technique support in in these cells significantly decrease metastasis (18). Here, we PUMA, Drs. Anand Merchant, Aleksandra Michalowski, and Binwu Tang in provide a mechanistic explanation for this observation, as we bioinformatics, and appreciate the assistance of technicians from animal detected significantly lower CCL9 expression in TbRII-deficient facility. þ þ Gr-1 CD11b cells. Overexpression of CCL9 in TbRII-deficient myeloid cells promoted tumor cell survival and metastasis capa- Grant Support bility (Fig. 6). Our data suggest that the chemokine CCL9 is a This work was supported by NCI intramural funding to L. Yang. The costs of publication of this article were defrayed in part by the payment of critical downstream mediator of the metastasis-promoting effects fi page charges. This article must therefore be hereby marked advertisement in of myeloid-speci c TGFb signaling. This effect was regulated accordance with 18 U.S.C. Section 1734 solely to indicate this fact. through P-p38 in the noncanonical TGFb pathway (Fig. 6) in agreement with previous publications showing a role for p38 in Received August 20, 2015; accepted September 7, 2015; published CCL9 induction by other factors (71–73). Our study is consistent OnlineFirst October 19, 2015.

5296 Cancer Res; 75(24) December 15, 2015 Cancer Research

Myeloid CCL9 and Tumor Cell Survival in Premetastatic Organ

References 1. Mehlen P, Puisieux A. Metastasis: a question of life or death. Nat Rev Cancer 25. Kitamura T, Kometani K, Hashida H, Matsunaga A, Miyoshi H, Hosogi H, 2006;6:449–58. et al. SMAD4-deficient intestinal tumors recruit CCR1(þ) myeloid cells 2. Kang Y, Pantel K. Tumor cell dissemination: emerging biological insights that promote invasion. Nat Genet 2007;39:467–75. from animal models and cancer patients. Cancer Cell 2013;23:573–81. 26. Balkwill F, Coussens LM. Cancer: an inflammatory link. Nature 3. Sceneay J, Smyth MJ, Moller A. The pre-metastatic niche: finding common 2004;431:405–6. ground. Cancer Metastasis Rev 2013;32:449–64. 27. Du R, Lu KV, Petritsch C, Liu P, Ganss R, PassegueE,etal.HIF1alpha 4. Keskinov AA, Shurin MR. Myeloid regulatory cells in tumor spreading and induces the recruitment of bone marrow-derived vascular modulatory metastasis. Immunobiology 2015;220:236–42. cells to regulate tumor angiogenesis and invasion. Cancer Cell 2008;13: 5. Kaplan RN, Riba RD, Zacharoulis S, Bramley AH, Vincent L, Costa C, et al. 206–20. VEGFR1-positive haematopoietic bone marrow progenitors initiate the 28. Lean JM, Murphy C, Fuller K, Chambers TJ. CCL9/MIP-1gamma and its pre-metastatic niche. Nature 2005;438:820–7. receptor CCR1 are the major chemokine ligand/receptor species expressed 6. Hiratsuka S, Watanabe A, Aburatani H, Maru Y. Tumour-mediated upre- by osteoclasts. J Cell Biochem 2002;87:386–93. gulation of chemoattractants and recruitment of myeloid cells predeter- 29. Zhao X, Sato A, Dela Cruz CS, Linehan M, Luegering A, Kucharzik T, et al. mines lung metastasis. Nat Cell Biol 2006;8:1369–75. CCL9 is secreted by the follicle-associated epithelium and recruits dome þ þ þ 7. Yan HH, Pickup M, Pang Y, Gorska AE, Li Z, Chytil A, et al. Gr-1 CD11b region Peyer's patch CD11b dendritic cells. J Immunol 2003;171: myeloid cells tip the balance of immune protection to tumor promotion in 2797–803. the premetastatic lung. Cancer Res 2010;70:6139–49. 30. Kitamura T, Fujishita T, Loetscher P, Revesz L, Hashida H, Kizaka-Kondoh 8. Kowanetz M, Wu X, Lee J, Tan M, Hagenbeek T, Qu X, et al. Granulocyte- S, et al. Inactivation of chemokine (C-C motif) receptor 1 (CCR1) sup- colony stimulating factor promotes lung metastasis through mobilization presses colon cancer liver metastasis by blocking accumulation of imma- of Ly6GþLy6C þgranulocytes. Proc Natl Acad Sci U S A 2010;107: ture myeloid cells in a mouse model. Proc Natl Acad Sci U S A 21248–55. 2010;107:13063–8. 9. Gabrilovich DI, Nagaraj S. Myeloid-derived suppressor cells as regulators of 31. Hara T, Bacon KB, Cho LC, Yoshimura A, Morikawa Y, Copeland NG, et al. the immune system. Nat Rev Immunol 2009;9:162–74. Molecular cloning and functional characterization of a novel member of 10. Almand B, Clark JI, Nikitina E, van Beynen J, English NR, Knight SC, et al. the C-C chemokine family. J Immunol 1995;155:5352–8. Increased production of immature myeloid cells in cancer patients: a 32. Okamatsu Y, Kim D, Battaglino R, Sasaki H, Sp€ate U, Stashenko P. MIP-1 mechanism of immunosuppression in cancer. J Immunol 2001;166: gamma promotes receptor-activator-of-NF-kappa-B-ligand-induced oste- 678–89. oclast formation and survival. J Immunol 2004;173:2084–90. 11. Youn JI, Nagaraj S, Collazo M, Gabrilovich DI. Subsets of myeloid-derived 33. Hong SH, Ren L, Mendoza A, Eleswarapu A, Khanna C. Apoptosis resis- suppressor cells in tumor-bearing mice. J Immunol 2008;181:5791–802. tance and PKC signaling: distinguishing features of high and low metastatic 12. Gabrilovich DI, Ostrand-Rosenberg S, Bronte V. Coordinated regulation of cells. Neoplasia 2012;14:249–58. myeloid cells by tumours. Nat Rev Immunol 2012;12:253–68. 34. Jessen KA, Liu SY, Tepper CG, Karrim J, McGoldrick ET, Rosner A, et al. 13. Yang L, DeBusk LM, Fukuda K, Fingleton B, Green-Jarvis B, Shyr Y, et al. Molecular analysis of metastasis in a polyomavirus middle T mouse model: þ þ Expansion of myeloid immune suppressor Gr CD11b cells in tumor- the role of osteopontin. Breast Cancer Res 2004;6:R157–69. bearing host directly promotes tumor angiogenesis. Cancer Cell 2004;6: 35. Mendoza A, Hong SH, Osborne T, Khan MA, Campbell K, Briggs J, et al. 409–21. Modeling metastasis biology and therapy in real time in the mouse lung. J 14. Kim S, Takahashi H, Lin WW, Descargues P, Grivennikov S, Kim Y, et al. Clin Invest 2010;120:2979–88. Carcinoma-produced factors activate myeloid cells through TLR2 to stim- 36. Ljung BM, Mayall B, Lottich C, Boyer C, Sylvester SS, Leight GS, et al. Cell ulate metastasis. Nature 2009;457:102–6. dissociation techniques in human breast cancer—variations in tumor cell 15. Mauti LA, Le Bitoux MA, Baumer K, Stehle JC, Golshayan D, Provero P, et al. viability and DNA ploidy. Breast Cancer Res Treat 1989;13:153–9. Myeloid-derived suppressor cells are implicated in regulating permissive- 37. Psaila B, Lyden D. The metastatic niche: adapting the foreign soil. Nat Rev ness for tumor metastasis during mouse gestation. J Clin Invest 2011;121: Cancer 2009;9:285–93. 2794–807. 38. Qian BZ, Li J, Zhang H, Kitamura T, Zhang J, Campion LR, et al. CCL2 16. Sceneay J, Chow MT, Chen A, Halse HM, Wong CS, Andrews DM, et al. recruits inflammatory monocytes to facilitate breast-tumour metastasis. þ þ Primary tumor hypoxia recruits CD11b /Ly6Cmed/Ly6G immune sup- Nature 2011;475:222–5. pressor cells and compromises NK cell cytotoxicity in the premetastatic 39. Bergers G, Brekken R, McMahon G, Vu TH, Itoh T, Tamaki K, et al. Matrix niche. Cancer Res 2012;72:3906–11. metalloproteinase-9 triggers the angiogenic switch during carcinogenesis. 17. Gao D, Joshi N, Choi H, Ryu S, Hahn M, Catena R, et al. Myeloid progenitor Nat Cell Biol 2000;2:737–44. cells in the premetastatic lung promote metastases by inducing mesen- 40. Patel VP, Kreider BL, Li Y, Li H, Leung K, Salcedo T, et al. Molecular and chymal to epithelial transition. Cancer Res 2012;72:1384–94. functional characterization of two novel human C-C chemokines as 18. Pang Y, Gara SK, Achyut BR, Li Z, Yan HH, Day C-P, et al. Transforming inhibitors of two distinct classes of myeloid progenitors. J Exp Med growth factor beta signaling in myeloid cells is required for tumor metas- 1997;185:1163–72. tasis. Cancer Discov 2013;3:936–51. 41. Berahovich RD, Miao Z, Wang Y, Premack B, Howard MC, Schall TJ. 19. Bierie B, Moses HL. Tumour microenvironment: TGFbeta: the molecular Proteolytic activation of alternative CCR1 ligands in inflammation. J Jekyll and Hyde of cancer. Nat Rev Cancer 2006;6:506–20. Immunol 2005;174:7341–51. 20. Massague J. TGFbeta signalling in context. Nat Rev Mol Cell Biol 2012;13: 42. Ringner M, Fredlund E, Hakkinen J, Borg A, Staaf J. (GOBO: gene expres- 616–30. sion-based outcome for breast cancer online. PLoS ONE 2011;6:e17911. 21. Yang L, Huang J, Ren X, Gorska AE, Chytil A, Aakre M, et al. Abrogation of 43. Parker JS, Mullins M, Cheang MC, Leung S, Voduc D, Vickery T, et al. þ þ TGFbeta signaling in mammary carcinomas recruits Gr-1 CD11b mye- Supervised risk predictor of breast cancer based on intrinsic subtypes. J Clin loid cells that promote metastasis. Cancer Cell 2008;13:23–35. Oncol 2009;27:1160–7. 22. BierieB,Chung CH,Parker JS, Stover DG, Cheng N,ChytilA,etal. Abrogation 44. Schreiber V, Dantzer F, Ame JC, de Murcia G. Poly(ADP-ribose): novel of TGF-beta signaling enhances chemokine production and correlates with functions for an old molecule. Nat Rev Mol Cell Biol 2006;7:517–28. prognosis in human breast cancer. J Clin Invest 2009;119:1571–82. 45. Owen-Schaub LB, van Golen KL, Hill LL, Price JE. Fas and Fas ligand 23. Ijichi H, Chytil A, Gorska AE, Aakre ME, Bierie B, Tada M, et al. Inhibiting interactions suppress melanoma lung metastasis. J Exp Med 1998;188: Cxcr2 disrupts tumor-stromal interactions and improves survival in a 1717–23. mouse model of pancreatic ductal adenocarcinoma. J Clin Invest 46. Medina-Ramirez CM, Goswami S, Smirnova T, Bamira D, Benson B, Ferrick 2011;121:4106–17. N, et al. Apoptosis inhibitor ARC promotes breast tumorigenesis, metas- 24. Kojima Y, Acar A, Eaton EN, Mellody KT, Scheel C, Ben-Porath I, et al. tasis, and chemoresistance. Cancer Res 2011;71:7705–15. Autocrine TGF-beta and stromal cell-derived factor-1 (SDF-1) signaling 47. Coussens LM, Werb Z. Inflammation and cancer. Nature 2002;420:860–7. drives the evolution of tumor-promoting mammary stromal myofibro- 48. Steeg PS. Tumor metastasis: mechanistic insights and clinical challenges. blasts. Proc Natl Acad Sci U S A 2010;107:20009–14. Nat Med 2006;12:895–904.

www.aacrjournals.org Cancer Res; 75(24) December 15, 2015 5297

Yan et al.

49. Lazennec G, Richmond A. Chemokines and chemokine receptors: new 64. Granot Z, Henke E, Comen EA, King TA, Norton L, Benezra R. Tumor insights into cancer-related inflammation. Trends Mol Med 2010;16: entrained neutrophils inhibit seeding in the premetastatic lung. Cancer 133–44. Cell 2011;20:300–14. 50. Viola A, Sarukhan A, Bronte V, Molon B. The pros and cons of chemokines 65. Catena R, Bhattacharya N, El Rayes T, Wang S, Choi H, Gao D, et al. Bone þ in tumor immunology. Trends Immunol 2012;33:496–504. marrow-derived Gr1 cells can generate a metastasis-resistant microenvi- 51. Acharyya S, Oskarsson T, Vanharanta S, Malladi S, Kim J, Morris PG, et al. A ronment via induced secretion of thrombospondin-1. Cancer Discov CXCL1 paracrine network links cancer chemoresistance and metastasis. 2013;3:578–89. Cell 2012;150:165–78. 66. Figueroa JD, Flanders KC, Garcia-Closas M, Anderson WF, Yang XR, 52. Liu Y, Kosaka A, Ikeura M, Kohanbash G, Fellows-Mayle W, Snyder LA, et al. Matsuno RK, et al. Expression of TGF-beta signaling factors in invasive Premetastatic soil and prevention of breast cancer brain metastasis. Neuro breast cancers: relationships with age at diagnosis and tumor character- Oncol 2013;15:891–903. istics. Breast Cancer Res Treat 2009;121:727–35. 53. Kitamura T, Taketo MM. Keeping out the bad guys: gateway to cellular 67. Kang Y, Siegel PM, Shu W, Drobnjak M, Kakonen SM, Cordon-Cardo C, target therapy. Cancer Res 2007;67:10099–102. et al. A multigenic program mediating breast cancer metastasis to bone. 54. Owens P, Pickup MW, Novitskiy SV, Chytil A, Gorska AE, Aakre ME, et al. Cancer Cell 2003;3:537–49. Disruption of bone morphogenetic protein receptor 2 (BMPR2) in mam- 68. Wilson C, Holen I, Coleman RE. Seed, soil and secreted hormones: mary tumors promotes metastases through cell autonomous and paracrine potential interactions of breast cancer cells with their endocrine/paracrine mediators. Proc Natl Acad Sci U S A 2012;109:2814–9. microenvironment and implications for treatment with bisphosphonates. 55. McAllister SS, Weinberg RA. Tumor-host interactions: a far-reaching rela- Cancer Treat Rev 2012;38:877–89. tionship. J Clin Oncol 2010;28:4022–8. 69. Achyut BR, Yang L. Transforming growth factor-beta in the gastrointestinal 56. Grivennikov SI, Greten FR, Karin M. Immunity, inflammation, and cancer. and hepatic tumor microenvironment. Gastroenterology 2011;141: Cell 2010;140:883–99. 1167–78. 57. Cook LM, Hurst DR, Welch DR. Metastasis suppressors and the tumor 70. Pickup M, Novitskiy S, Moses HL. The roles of TGFbeta in the tumour microenvironment. Semin Cancer Biol 2011;21:113–22. microenvironment. Nat Rev Cancer 2013;13:788–99. 58. Sethi N, Kang Y. Unravelling the complexity of metastasis—molecular 71. Ravindran C, Cheng YC, Liang SM. (CpG-ODNs induces up-regulated understanding and targeted therapies. Nat Rev Cancer 2011;11:735–48. expression of chemokine CCL9 in mouse macrophages and microglia. Cell 59. Sleeman JP. The metastatic niche and stromal progression. Cancer Metas- Immunol 260:113–8. tasis Rev 2012;31:429–40. 72. Iotti G, Ferrari-Amorotti G, Rosafio C, Corradini F, Lidonnici MR, Ronchetti 60. Vanharanta S, Massague J. Origins of metastatic traits. Cancer Cell M, et al. Expression of CCL9/MIP-1gamma is repressed by BCR/ABL and its 2013;24:410–21. restoration suppresses in vivo leukemogenesis of 32D-BCR/ABL cells. 61. Condeelis J, Pollard JW. Macrophages: obligate partners for tumor cell Oncogene 2007;26:3482–91. migration, invasion, and metastasis. Cell 2006;124:263–6. 73.YangYJ,ChenW,CarriganSO,ChenWM,RothK,AkiyamaT,etal. 62. Gil-Bernabe AM, Ferjancic S, Tlalka M, Zhao L, Allen PD, Im JH, et al. TRAF6 specifically contributes to FcepsilonRI-mediated cytokine Recruitment of monocytes/macrophages by tissue factor-mediated coag- production but not mast cell degranulation. J Biol Chem 2008;283: ulation is essential for metastatic cell survival and premetastatic niche 32110–8. establishment in mice. Blood 2012;119:3164–75. 74. Hembruff SL, Jokar I, Yang L, Cheng N. Loss of transforming growth factor- 63. Peinado H, Lavotshkin S, Lyden D. The secreted factors responsible for pre- beta signaling in mammary fibroblasts enhances CCL2 secretion to prometastatic niche formation: old sayings and new thoughts. Semin Cancer mote mammary tumor progression through macrophage-dependent and Biol 2011;21:139–46. -independent mechanisms. Neoplasia 2010;12:425–33.

5298 Cancer Res; 75(24) December 15, 2015 Cancer Research

CCL9 Induced by TGFβ Signaling in Myeloid Cells Enhances Tumor Cell Survival in the Premetastatic Organ

Hangyi H. Yan, Jian Jiang, Yanli Pang, et al.

Cancer Res 2015;75:5283-5298. Published OnlineFirst October 19, 2015.

Updated version Access the most recent version of this article at: doi:10.1158/0008-5472.CAN-15-2282-T

Supplementary Access the most recent supplemental material at: Material http://cancerres.aacrjournals.org/content/suppl/2015/10/17/0008-5472.CAN-15-2282-T.DC1

Cited articles This article cites 73 articles, 23 of which you can access for free at: http://cancerres.aacrjournals.org/content/75/24/5283.full#ref-list-1

Citing articles This article has been cited by 4 HighWire-hosted articles. Access the articles at: http://cancerres.aacrjournals.org/content/75/24/5283.full#related-urls

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Department at Subscriptions [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://cancerres.aacrjournals.org/content/75/24/5283. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.